Sample records for acc oxidase transcripts

  1. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  2. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  3. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling


    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  4. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.


    Sell, Simone; Hehl, Reinhard


    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  5. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].


    Yu, Yi-Xun; Bao, Man-Zhu


    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  6. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.


    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia


    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  7. Effects of inefficient transcription termination of rbcL on the expression of accD in plastids of Arabidopsis thaliana.


    He, Baoye; Mu, Ying; Chi, Wei


    The plastid accD gene encodes one subunit of a multimeric acetyl-CoA carboxylase that is required for fatty acid biosynthesis. In Arabidopsis thaliana, the accD gene is transcribed by the nuclear-encoded phage-type RNA polymerase, and the accumulation of accD transcripts is subjected to a dynamic pattern during chloroplast development. However, the mechanisms underlying the regulation of accD expression remain unknown. Here, we showed that the inefficient transcription termination of rbcL due to the absence of RHON1 impaired the developmental profile of accD, resulting in the constitutive expression of accD during chloroplast development. Moreover, the accumulation of accD transcripts accordingly resulted in an increase in accD protein levels, suggesting that transcript abundance is critical for accD gene production. Our study demonstrates that the interplay between accD and upstream rbcL regulates the expression of accD and highlights the significance of transcriptional regulation in plastid gene expression in higher plants.

  8. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M


    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  9. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).


    Clouse, Ronald M; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  10. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  11. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).


    Clouse, Ronald M; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  12. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].


    Yu, Yi-Xun; Bao, Man-Zhu


    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  13. ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.


    Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong


    Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

  14. ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.


    Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong


    Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

  15. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.


    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae


    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  16. A comparative genomics approach identifies a PPR-DYW protein that is essential for C-to-U editing of the Arabidopsis chloroplast accD transcript.


    Robbins, John C; Heller, Wade P; Hanson, Maureen R


    Several nuclear-encoded proteins containing pentatricopeptide repeat (PPR) motifs have previously been identified to be trans-factors essential for particular chloroplast RNA editing events through analysis of mutants affected in chloroplast biogenesis or function. Other PPR genes are known to encode proteins involved in other aspects of organelle RNA metabolism. A function has not been assigned to most members of the large plant PPR gene family. Arabidopsis and rice each contain over 400 PPR genes, of which about a fifth exhibit a C-terminal DYW domain. We describe here a comparative genomics approach that will facilitate identification of the role of RNA-binding proteins in organelle RNA metabolism. We have implemented this strategy to identify an Arabidopsis nuclear-encoded gene RARE1 that is required for editing of the chloroplast accD transcript. RARE1 carries 15 PPR motifs, an E/E+ and a DYW domain, whereas previously reported editing factors CRR4, CRR21, and CLB19 lack a DYW domain. The accD gene encodes the beta carboxyltransferase subunit of acetyl coA carboxylase, which catalyzes the first step in fatty acid biosynthesis in chloroplasts. Despite a lack of accD C794 editing and lack of restoration of an evolutionarily conserved leucine residue in the beta carboxyltransferase protein, rare1 mutants are unexpectedly robust and reproduce under growth room conditions. Previously the serine-to-leucine alteration caused by editing was deemed essential in the light of the finding that a recombinantly expressed "unedited" form of the pea acetyl coA carboxylase was catalytically inactive.

  17. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )


    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  18. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.


    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P


    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis

  19. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana.


    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi; Shirasu, Ken; Yoshioka, Hirofumi


    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  20. Adaptive Cruise Control (ACC)

    NASA Astrophysics Data System (ADS)

    Reif, Konrad

    Die adaptive Fahrgeschwindigkeitsregelung (ACC, Adaptive Cruise Control) ist eine Weiterentwicklung der konventionellen Fahrgeschwindigkeitsregelung, die eine konstante Fahrgeschwindigkeit einstellt. ACC überwacht mittels eines Radarsensors den Bereich vor dem Fahrzeug und passt die Geschwindigkeit den Gegebenheiten an. ACC reagiert auf langsamer vorausfahrende oder einscherende Fahrzeuge mit einer Reduzierung der Geschwindigkeit, sodass der vorgeschriebene Mindestabstand zum vorausfahrenden Fahrzeug nicht unterschritten wird. Hierzu greift ACC in Antrieb und Bremse ein. Sobald das vorausfahrende Fahrzeug beschleunigt oder die Spur verlässt, regelt ACC die Geschwindigkeit wieder auf die vorgegebene Sollgeschwindigkeit ein (Bild 1). ACC steht somit für eine Geschwindigkeitsregelung, die sich dem vorausfahrenden Verkehr anpasst.

  1. C/EBP transcription factors regulate NADPH oxidase in human aortic smooth muscle cells.


    Manea, Simona-Adriana; Todirita, Andra; Raicu, Monica; Manea, Adrian


    In atherosclerosis, oxidative stress-induced vascular smooth muscle cells (SMCs) dysfunction is partially mediated by up-regulated NADPH oxidase (Nox); the mechanisms of enzyme regulation are not entirely defined. CCAAT/enhancer-binding proteins (C/EBP) regulate cellular proliferation and differentiation, and the expression of many inflammatory and immune genes. We aimed at elucidating the role of C/EBP in the regulation of Nox in SMCs exposed to pro-inflammatory conditions. Human aortic SMCs were treated with interferon-γ (IFN-γ) for up to 24 hrs. Lucigenin-enhanced chemiluminescence, real-time PCR, Western blot, promoter-luciferase reporter analysis and chromatin immunoprecipitation assays were employed to investigate Nox regulation. IFN-γ dose-dependently induced Nox activity and expression, nuclear translocation and up-regulation of C/EBPα, C/EBPβ and C/EBPδ protein expression levels. Silencing of C/EBPα, C/EBPβ or C/EBPδ reduced significantly but differentially the IFN-γ-induced up-regulation of Nox activity, gene and protein expression. In silico analysis indicated the existence of typical C/EBP sites within Nox1, Nox4 and Nox5 promoters. Transient overexpression of C/EBPα, C/EBPβ or C/EBPδ enhanced the luciferase level directed by the promoters of the Nox subtypes. Chromatin immunoprecipitation demonstrated the physical interaction of C/EBPα, C/EBPβ and C/EBPδ proteins with the Nox1/4/5 promoters. C/EBP transcription factors are important regulators of Nox enzymes in IFN-γ-exposed SMCs. Activation of C/EBP may induce excessive Nox-derived reactive oxygen species formation, further contributing to SMCs dysfunction and atherosclerotic plaque development. Pharmacological targeting of C/EBP-related signalling pathways may be used to counteract the adverse effects of oxidative stress. PMID:24797079

  2. A negative regulating element controlling transcription of the gene encoding acyl-CoA oxidase in Saccharomyces cerevisiae.

    PubMed Central

    Wang, T W; Lewin, A S; Small, G M


    Peroxisomes are induced in Saccharomyces cerevisiae when this yeast is grown in the presence of oleate, and are repressed when glucose is supplied as the carbon source. Concomitant with this is an induction/repression of peroxisomal beta-oxidation enzymes. We are investigating the transcriptional control of acyl-CoA oxidase, the first and rate-limiting enzyme in the peroxisomal beta-oxidation cycle. The promoter region of POX1 from S. cerevisiae has been analyzed in POX1/lacZ fusions. Expression of the POX1/lacZ fusion protein underwent glucose repression and oleate induction. By deletion, DNA band shift and DNase I footprinting analyses we have identified a region that is involved in transcriptional repression of POX1. Elimination of this DNA sequence results in constitutive expression of POX1 when S. cerevisiae is grown on a fermentable carbon source or glycerol. Images PMID:1630920

  3. Yap7 is a transcriptional repressor of nitric oxide oxidase in yeasts, which arose from neofunctionalization after whole genome duplication.


    Merhej, Jawad; Delaveau, Thierry; Guitard, Juliette; Palancade, Benoit; Hennequin, Christophe; Garcia, Mathilde; Lelandais, Gaëlle; Devaux, Frédéric


    Flavohemoglobins are the main detoxifiers of nitric oxide (NO) in bacteria and fungi and are induced in response to nitrosative stress. In fungi, the flavohemoglobin encoding gene YHB1 is positively regulated by transcription factors which are activated upon NO exposure. In this study, we show that in the model yeast Saccharomyces cerevisiae and in the human pathogen Candida glabrata, the transcription factor Yap7 constitutively represses YHB1 by binding its promoter. Consequently, YAP7 deletion conferred high NO resistance to the cells. Co-immunoprecipitation experiments and mutant analyses indicated that Yap7 represses YHB1 by recruiting the transcriptional repressor Tup1. In S. cerevisiae, YHB1 repression also involves interaction of Yap7 with the Hap2/3/5 complex through a conserved Hap4-like-bZIP domain, but this interaction has been lost in C. glabrata. The evolutionary origin of this regulation was investigated by functional analyses of Yap7 and of its paralogue Yap5 in different yeast species. These analyses indicated that the negative regulation of YHB1 by Yap7 arose by neofunctionalization after the whole genome duplication which led to the C. glabrata and S. cerevisiae extant species. This work describes a new aspect of the regulation of fungal nitric oxidase and provides detailed insights into its functioning and evolution.

  4. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.


    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao


    The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1.

  5. Elevated level of renal xanthine oxidase mRNA transcription after nephropathogenic infectious bronchitis virus infection in growing layers

    PubMed Central

    Lin, Huayuan; Huang, Qiqi; Liu, Weilian; Zou, Yuelong; Zhu, Shuliang; Deng, Guangfu; Kuang, Jun; Zhang, Caiying; Cao, Huabin; Hu, Guoliang


    To assess relationships between xanthine oxidase (XOD) and nephropathogenic infectious bronchitis virus (NIBV) infection, 240 growing layers (35 days old) were randomly divided into two groups (infected and control) of 120 chickens each. Each chicken in the control and infected group was intranasally inoculated with 0.2 mL sterile physiological saline and virus, respectively, after which serum antioxidant parameters and renal XOD mRNA expression in growing layers were evaluated at 8, 15 and 22 days post-inoculation (dpi). The results showed that serum glutathione peroxidase and superoxide dismutase activities in the infected group were significantly lower than in the control group at 8 and 15 dpi (p < 0.01), while serum malondialdehyde concentrations were significantly higher (p < 0.01). The serum uric acid was significantly higher than that of the control group at 15 dpi (p < 0.01). In addition, the kidney mRNA transcript level and serum activity of XOD in the infected group was significantly higher than that of the control group at 8, 15 and 22 dpi (p < 0.05). The results indicated that NIBV infection could cause the increases of renal XOD gene transcription and serum XOD activity, leading to hyperuricemia and reduction of antioxidants in the body. PMID:26119168

  6. Transcriptional Regulation of Cystathionine-γ-Lyase in Endothelial Cells by NADPH Oxidase 4-Dependent Signaling*

    PubMed Central

    Mistry, Rajesh K.; Murray, Thomas V. A.; Prysyazhna, Oleksandra; Martin, Daniel; Burgoyne, Joseph R.; Santos, Celio; Eaton, Philip; Shah, Ajay M.; Brewer, Alison C.


    The gasotransmitter, hydrogen sulfide (H2S) is recognized as an important mediator of endothelial cell homeostasis and function that impacts upon vascular tone and blood pressure. Cystathionine-γ-lyase (CSE) is the predominant endothelial generator of H2S, and recent evidence suggests that its transcriptional expression is regulated by the reactive oxygen species, H2O2. However, the cellular source of H2O2 and the redox-dependent molecular signaling pathway that modulates this is not known. We aimed to investigate the role of Nox4, an endothelial generator of H2O2, in the regulation of CSE in endothelial cells. Both gain- and loss-of-function experiments in human endothelial cells in vitro demonstrated Nox4 to be a positive regulator of CSE transcription and protein expression. We demonstrate that this is dependent upon a heme-regulated inhibitor kinase/eIF2α/activating transcription factor 4 (ATF4) signaling module. ATF4 was further demonstrated to bind directly to cis-regulatory sequences within the first intron of CSE to activate transcription. Furthermore, CSE expression was also increased in cardiac microvascular endothelial cells, isolated from endothelial-specific Nox4 transgenic mice, compared with wild-type littermate controls. Using wire myography we demonstrate that endothelial-specific Nox4 transgenic mice exhibit a hypo-contractile phenotype in response to phenylephrine that was abolished when vessels were incubated with a CSE inhibitor, propargylglycine. We, therefore, conclude that Nox4 is a positive transcriptional regulator of CSE in endothelial cells and propose that it may in turn contribute to the regulation of vascular tone via the modulation of H2S production. PMID:26620565

  7. Transcriptional Regulation of Cystathionine-γ-Lyase in Endothelial Cells by NADPH Oxidase 4-Dependent Signaling.


    Mistry, Rajesh K; Murray, Thomas V A; Prysyazhna, Oleksandra; Martin, Daniel; Burgoyne, Joseph R; Santos, Celio; Eaton, Philip; Shah, Ajay M; Brewer, Alison C


    The gasotransmitter, hydrogen sulfide (H2S) is recognized as an important mediator of endothelial cell homeostasis and function that impacts upon vascular tone and blood pressure. Cystathionine-γ-lyase (CSE) is the predominant endothelial generator of H2S, and recent evidence suggests that its transcriptional expression is regulated by the reactive oxygen species, H2O2. However, the cellular source of H2O2 and the redox-dependent molecular signaling pathway that modulates this is not known. We aimed to investigate the role of Nox4, an endothelial generator of H2O2, in the regulation of CSE in endothelial cells. Both gain- and loss-of-function experiments in human endothelial cells in vitro demonstrated Nox4 to be a positive regulator of CSE transcription and protein expression. We demonstrate that this is dependent upon a heme-regulated inhibitor kinase/eIF2α/activating transcription factor 4 (ATF4) signaling module. ATF4 was further demonstrated to bind directly to cis-regulatory sequences within the first intron of CSE to activate transcription. Furthermore, CSE expression was also increased in cardiac microvascular endothelial cells, isolated from endothelial-specific Nox4 transgenic mice, compared with wild-type littermate controls. Using wire myography we demonstrate that endothelial-specific Nox4 transgenic mice exhibit a hypo-contractile phenotype in response to phenylephrine that was abolished when vessels were incubated with a CSE inhibitor, propargylglycine. We, therefore, conclude that Nox4 is a positive transcriptional regulator of CSE in endothelial cells and propose that it may in turn contribute to the regulation of vascular tone via the modulation of H2S production.

  8. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  9. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana[OPEN

    PubMed Central

    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi


    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  10. Dual-level regulation of ACC synthase activity by MPK3/MPK6 cascade and its downstream WRKY transcription factor during ethylene induction in Arabidopsis.


    Li, Guojing; Meng, Xiangzong; Wang, Ruigang; Mao, Guohong; Han, Ling; Liu, Yidong; Zhang, Shuqun


    Plants under pathogen attack produce high levels of ethylene, which plays important roles in plant immunity. Previously, we reported the involvement of ACS2 and ACS6, two Type I ACS isoforms, in Botrytis cinerea-induced ethylene biosynthesis and their regulation at the protein stability level by MPK3 and MPK6, two Arabidopsis pathogen-responsive mitogen-activated protein kinases (MAPKs). The residual ethylene induction in the acs2/acs6 double mutant suggests the involvement of additional ACS isoforms. It is also known that a subset of ACS genes, including ACS6, is transcriptionally induced in plants under stress or pathogen attack. However, the importance of ACS gene activation and the regulatory mechanism(s) are not clear. In this report, we demonstrate using genetic analysis that ACS7 and ACS11, two Type III ACS isoforms, and ACS8, a Type II ACS isoform, also contribute to the B. cinerea-induced ethylene production. In addition to post-translational regulation, transcriptional activation of the ACS genes also plays a critical role in sustaining high levels of ethylene induction. Interestingly, MPK3 and MPK6 not only control the stability of ACS2 and ACS6 proteins via direct protein phosphorylation but also regulate the expression of ACS2 and ACS6 genes. WRKY33, another MPK3/MPK6 substrate, is involved in the MPK3/MPK6-induced ACS2/ACS6 gene expression based on genetic analyses. Furthermore, chromatin-immunoprecipitation assay reveals the direct binding of WRKY33 to the W-boxes in the promoters of ACS2 and ACS6 genes in vivo, suggesting that WRKY33 is directly involved in the activation of ACS2 and ACS6 expression downstream of MPK3/MPK6 cascade in response to pathogen invasion. Regulation of ACS activity by MPK3/MPK6 at both transcriptional and protein stability levels plays a key role in determining the kinetics and magnitude of ethylene induction.

  11. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.


    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R


    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

  12. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.


    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T


    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  13. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.


    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A


    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  14. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation.


    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette


    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80kb (cgAUS1) and 1.85kb (cgAUS2a, 2b), encoding for proteins of 68-69kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS-PAGE and shot-gun type nanoUHPLC-ESI-MS/MS.

  15. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation☆

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette


    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  16. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress.


    Datta, Riddhi; Kumar, Deepak; Sultana, Asma; Hazra, Saptarshi; Bhattacharyya, Dipto; Chattopadhyay, Sharmila


    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress.

  17. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-{kappa}B in human aortic smooth muscle cells

    SciTech Connect

    Manea, Adrian; Tanase, Laurentia I.; Raicu, Monica; Simionescu, Maya


    Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysis showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.

  18. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-kappaB in human aortic smooth muscle cells.


    Manea, Adrian; Tanase, Laurentia I; Raicu, Monica; Simionescu, Maya


    Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-kappaB (NF-kappaB) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-kappaB signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-alpha (TNFalpha), a potent inducer of both Nox and NF-kappaB, up to 24h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysis showed that inhibition of NF-kappaB pathway reduced significantly the TNFalpha-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-kappaB elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-kappaB significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-kappaB proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-kappaB is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-kappaB and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications. PMID:20457132

  19. Regulation of Gibberellin 20-Oxidase and Gibberellin 3β-Hydroxylase Transcript Accumulation during De-Etiolation of Pea Seedlings1

    PubMed Central

    Ait-Ali, Tahar; Frances, Shannon; Weller, James L.; Reid, James B.; Kendrick, Richard E.; Kamiya, Yuji


    Gibberellin (GA) 20-oxidase (GA 20-ox) and GA 3β-hydroxylase (GA 3β-hy) are enzymes that catalyze the late steps in the formation of active GAs, and are potential control points in the regulation of GA biosynthesis by light. We have investigated the photoregulation of the GA 20-ox and GA 3β-hy transcript levels in pea (Pisum sativum L.). The GA 20-ox transcript level was higher in light-grown seedlings than in etiolated seedlings, whereas GA 3β-hy mRNA accumulation was higher in etiolated seedlings. However, transfer of etiolated seedlings to light led to a 5-fold increase in the expression of both transcripts 4 h after transfer. GA 20-ox mRNA accumulation is regulated by both phytochromes A and B. Transfer to light also resulted in a 6-fold decrease in GA1 levels within 2 h. These results suggest that the light-induced drop in GA1 level is not achieved through regulation of GA 20-ox and GA 3β-hy mRNA accumulation. The application of exogenous GA1 to apical buds of etiolated seedlings prior to light treatments inhibited the light-induced accumulation of both GA 20-ox and GA 3β-hy mRNA, suggesting that negative feedback regulation is an important mechanism in the regulation of GA 20-ox and GA 3β-hy mRNA accumulation during de-etiolation of pea seedlings. PMID:10557226

  20. Evaluating Performance Portability of OpenACC

    SciTech Connect

    Sabne, Amit J; Sakdhnagool, Putt; Lee, Seyong; Vetter, Jeffrey S


    Accelerator-based heterogeneous computing is gaining momentum in High Performance Computing arena. However, the increased complexity of the accelerator architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle the problem. While the abstraction endowed by OpenACC offers productivity, it raises questions on its portability. This paper evaluates the performance portability obtained by OpenACC on twelve OpenACC programs on NVIDIA CUDA, AMD GCN, and Intel MIC architectures. We study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.

  1. NOX3 NADPH oxidase couples transient receptor potential vanilloid 1 to signal transducer and activator of transcription 1-mediated inflammation and hearing loss.


    Mukherjea, Debashree; Jajoo, Sarvesh; Sheehan, Kelly; Kaur, Tejbeer; Sheth, Sandeep; Bunch, Jennifer; Perro, Christopher; Rybak, Leonard P; Ramkumar, Vickram


    Transient receptor potential vanilloid 1 (TRPV1) is implicated in cisplatin ototoxicity. Activation of this channel by cisplatin increases reactive oxygen species generation, which contribute to loss of outer hair cells in the cochlea. Knockdown of TRPV1 by short interfering RNA protected against cisplatin ototoxicity. In this study, we examined the mechanism underlying TRPV1-mediated ototoxicity using cultured organ of Corti transformed cells (UB/OC-1) and rats. Trans-tympanic injections of capsaicin produced transient hearing loss within 24 h, which recovered by 72 h. In UB/OC-1 cells, capsaicin increased NOX3 NADPH oxidase activity and activation of signal transducer and activator of transcription 1 (STAT1). Intratympanic administration of capsaicin transiently increased STAT1 activity and expression of downstream proinflammatory molecules. Capsaicin produced a transient increase in CD14-positive inflammatory cells into the cochlea, which mimicked the temporal course of STAT1 activation but did not alter the expression of apoptotic genes or damage to outer hair cells. In addition, trans-tympanic administration of STAT1 short interfering RNA protected against capsaicin-induced hearing loss. These data suggest that activation of TRPV1 mediates temporary hearing loss by initiating an inflammatory process in the cochlea via activation of NOX3 and STAT1. Thus, these proteins represent reasonable targets for ameliorating hearing loss.

  2. NOX3 NADPH Oxidase Couples Transient Receptor Potential Vanilloid 1 to Signal Transducer and Activator of Transcription 1-Mediated Inflammation and Hearing Loss

    PubMed Central

    Mukherjea, Debashree; Jajoo, Sarvesh; Sheehan, Kelly; Kaur, Tejbeer; Sheth, Sandeep; Bunch, Jennifer; Perro, Christopher; Rybak, Leonard P.


    Abstract Transient receptor potential vanilloid 1 (TRPV1) is implicated in cisplatin ototoxicity. Activation of this channel by cisplatin increases reactive oxygen species generation, which contribute to loss of outer hair cells in the cochlea. Knockdown of TRPV1 by short interfering RNA protected against cisplatin ototoxicity. In this study, we examined the mechanism underlying TRPV1-mediated ototoxicity using cultured organ of Corti transformed cells (UB/OC-1) and rats. Trans-tympanic injections of capsaicin produced transient hearing loss within 24 h, which recovered by 72 h. In UB/OC-1 cells, capsaicin increased NOX3 NADPH oxidase activity and activation of signal transducer and activator of transcription 1 (STAT1). Intratympanic administration of capsaicin transiently increased STAT1 activity and expression of downstream proinflammatory molecules. Capsaicin produced a transient increase in CD14-positive inflammatory cells into the cochlea, which mimicked the temporal course of STAT1 activation but did not alter the expression of apoptotic genes or damage to outer hair cells. In addition, trans-tympanic administration of STAT1 short interfering RNA protected against capsaicin-induced hearing loss. These data suggest that activation of TRPV1 mediates temporary hearing loss by initiating an inflammatory process in the cochlea via activation of NOX3 and STAT1. Thus, these proteins represent reasonable targets for ameliorating hearing loss. Antioxid. Redox Signal. 14, 999–1010. PMID:20712533

  3. Islet-specific monoamine oxidase A and B expression depends on MafA transcriptional activity and is compromised in type 2 diabetes.


    Ganic, Elvira; Johansson, Jenny K; Bennet, Hedvig; Fex, Malin; Artner, Isabella


    Lack or dysfunction of insulin producing β cells results in the development of type 1 and type 2 diabetes mellitus, respectively. Insulin secretion is controlled by metabolic stimuli (glucose, fatty acids), but also by monoamine neurotransmitters, like dopamine, serotonin, and norepinephrine. Intracellular monoamine levels are controlled by monoamine oxidases (Mao) A and B. Here we show that MaoA and MaoB are expressed in mouse islet β cells and that inhibition of Mao activity reduces insulin secretion in response to metabolic stimuli. Moreover, analysis of MaoA and MaoB protein expression in mouse and human type 2 diabetic islets shows a significant reduction of MaoB in type 2 diabetic β cells suggesting that loss of Mao contributes to β cell dysfunction. MaoB expression was also reduced in β cells of MafA-deficient mice, a mouse model for β cell dysfunction, and biochemical studies showed that MafA directly binds to and activates MaoA and MaoB transcriptional control sequences. Taken together, our results show that MaoA and MaoB expression in pancreatic islets is required for physiological insulin secretion and lost in type 2 diabetic mouse and human β cells. These findings demonstrate that regulation of monoamine levels by Mao activity in β cells is pivotal for physiological insulin secretion and that loss of MaoB expression may contribute to the β cell dysfunction in type 2 diabetes.

  4. NOX3 NADPH oxidase couples transient receptor potential vanilloid 1 to signal transducer and activator of transcription 1-mediated inflammation and hearing loss.


    Mukherjea, Debashree; Jajoo, Sarvesh; Sheehan, Kelly; Kaur, Tejbeer; Sheth, Sandeep; Bunch, Jennifer; Perro, Christopher; Rybak, Leonard P; Ramkumar, Vickram


    Transient receptor potential vanilloid 1 (TRPV1) is implicated in cisplatin ototoxicity. Activation of this channel by cisplatin increases reactive oxygen species generation, which contribute to loss of outer hair cells in the cochlea. Knockdown of TRPV1 by short interfering RNA protected against cisplatin ototoxicity. In this study, we examined the mechanism underlying TRPV1-mediated ototoxicity using cultured organ of Corti transformed cells (UB/OC-1) and rats. Trans-tympanic injections of capsaicin produced transient hearing loss within 24 h, which recovered by 72 h. In UB/OC-1 cells, capsaicin increased NOX3 NADPH oxidase activity and activation of signal transducer and activator of transcription 1 (STAT1). Intratympanic administration of capsaicin transiently increased STAT1 activity and expression of downstream proinflammatory molecules. Capsaicin produced a transient increase in CD14-positive inflammatory cells into the cochlea, which mimicked the temporal course of STAT1 activation but did not alter the expression of apoptotic genes or damage to outer hair cells. In addition, trans-tympanic administration of STAT1 short interfering RNA protected against capsaicin-induced hearing loss. These data suggest that activation of TRPV1 mediates temporary hearing loss by initiating an inflammatory process in the cochlea via activation of NOX3 and STAT1. Thus, these proteins represent reasonable targets for ameliorating hearing loss. PMID:20712533

  5. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz


    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  6. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  7. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )


    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  8. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.


    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills Attached Labs"; (5)…

  9. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.


    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  10. Inhibition by 1-aminocyclobutane-1-carboxylate of the activity of 1-aminocyclopropane-1-carboxylate oxidase obtained from senescing petals of carnation (Dianthus caryophyllus L.) flowers.


    Kosugi, Y; Oyamada, N; Satoh, S; Yoshioka, T; Onodera, E; Yamada, Y


    We partially purified 1-aminocyclopropane-1-carboxylate (ACC) oxidase from senescing petals of carnation (Dianthus caryophyllus L. cv. Nora) flowers and investigated its general characteristics, and, in particular, the inhibition of its activity by ACC analogs. The enzyme had an optimum pH at 7-7.5 and required Fe2+, ascorbate and NaHCO3 for its maximal activity. The Km for ACC was calculated as 111-125 microM in the presence of NaHCO3. Its M(r) was estimated to be 35 and 36 kDa by gel-filtration chromatography on HPLC and SDS-PAGE, respectively, indicating that the enzyme exists in a monomeric form. These properties were in agreement with those reported previously with ACC oxidases from different plant tissues including senescing carnation petals. Among six ACC analogs tested, 1-aminocyclobutane-1-carboxylate (ACBC) inhibited most severely the activity of ACC oxidase from carnation petals. ACBC acted as a competitive inhibitor with the Ki of 20-30 microM. The comparison between the Km for ACC and the Ki for ACBC indicated that ACBC had an affinity which was ca. 5-fold higher than that of ACC. Whereas ACC inactivated carnation ACC oxidase in a time-dependent manner during incubation, ACBC did not cause the inactivation of the enzyme. Preliminary experiments showed that ACBC and its N-substituted derivatives delayed the onset of senescence in cut carnation flowers.

  11. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.


    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T


    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  12. The final step of the ethylene biosynthesis pathway in turnip tops (Brassica rapa): molecular characterization of the 1-aminocyclopropane-1-carboxylate oxidase BrACO1 throughout zygotic embryogenesis and germination of heterogeneous seeds.


    Del Carmen Rodríguez-Gacio, María; Nicolás, Carlos; Matilla, Angel Jesús


    In a previous report from the present authors, it was shown that the 1-aminocyclopropane-1-carboxylate (ACC) oxidation may play a crucial role during zygotic embryogenesis of turnip tops seeds. The present study was performed to elucidate the contribution of the silique-wall and seeds in ethylene production during this developmental process. ACC content in the silique wall is only higher than in seeds during the middle phases of zygotic embryogenesis. The ACC-oxidase (ACO) activity peaks in the silique-wall and seeds during the onset of embryogenesis, declining gradually afterwards, being undetectable during desiccation period. Using reverse transcriptase-polymerase chain reaction, one cDNA clone coding for an ACO and called BrACO1, was isolated. The deduced protein for BrACO1 has a molecular weight of 36.8 kDa and a high homology with other crucifer ACOs. The heterologous expression of this cDNA confirmed that BrACO1 is an ACO. The expression of this gene was high during the first phases of silique-wall development, low during the middle phases and undetectable during desiccation. By contrast, BrACO1 transcript was accumulated only in the earliest phases of seed embryogenesis and may participate in the highest ACO activity and ethylene production by seeds at the beginning of embryogenesis. Finally, in this work a correlation between the heterogeneity of Brassica rapa L. cv. Rapa seeds and the ability to oxidize the ACC to ethylene has been demonstrated.

  13. Incorporation of copper into lysyl oxidase.


    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B


    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  14. ACC forum looks at 'burning' questions

    SciTech Connect

    Carter, R.


    The American Coal Council's (ACC) Spring Coal Forum had as its theme: Coal's renaissance: prospects for regenerating coal generation'. It explored US coal demand, supply, end-user technology and market trends. The article gives an overview of the conference, highlighting several presentations. 2 figs., 1 tab.

  15. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress1[OPEN

    PubMed Central

    Kumar, Deepak; Hazra, Saptarshi; Chattopadhyay, Sharmila


    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  16. Identification, genomic organization, and oxidative stress response of a sigma class glutathione S-transferase gene (AccGSTS1) in the honey bee, Apis cerana cerana.


    Yan, Huiru; Jia, Haihong; Gao, Hongru; Guo, Xingqi; Xu, Baohua


    Glutathione S-transferases (GSTs) are members of a multifunctional antioxidant enzyme superfamily that play pivotal roles in both detoxification and protection against oxidative damage caused by reactive oxygen species. In this study, a complementary DNA (cDNA) encoding a sigma class GST was identified in the Chinese honey bee, Apis cerana cerana (AccGSTS1). AccGSTS1 was constitutively expressed in all tissues of adult worker bees, including the brain, fat body, epidermis, muscle, and midgut, with particularly robust transcription in the fat body. Relative messenger RNA expression levels of AccGSTS1 at different developmental stages varied, with the highest levels of expression observed in adults. The potential function of AccGSTS1 in cellular defenses against abiotic stresses (cold, heat, UV, H2O2, HgCl2, and insecticides) was investigated. AccGSTS1 was significantly upregulated in response to all of the treatment conditions examined, although the induction levels were varied. Recombinant AccGSTS1 protein showed characteristic glutathione-conjugating catalytic activity toward 1-chloro-2,4-dinitrobenzene. Functional assays revealed that AccGSTS1 could remove H2O2, thereby protecting DNA from oxidative damage. Escherichia coli overexpressing AccGSTS1 showed long-term resistance under conditions of oxidative stress. Together, these results suggest that AccGSTS1 is a crucial antioxidant enzyme involved in cellular antioxidant defenses and honey bee survival.

  17. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua


    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  18. AccR Is a Master Regulator Involved in Carbon Catabolite Repression of the Anaerobic Catabolism of Aromatic Compounds in Azoarcus sp. CIB*

    PubMed Central

    Valderrama, J. Andrés; Shingler, Victoria; Carmona, Manuel; Díaz, Eduardo


    Here we characterized the first known transcriptional regulator that accounts for carbon catabolite repression (CCR) control of the anaerobic catabolism of aromatic compounds in bacteria. The AccR response regulator of Azoarcus sp. CIB controls succinate-responsive CCR of the central pathways for the anaerobic catabolism of aromatics by this strain. Phosphorylation of AccR to AccR-P triggers a monomer-to-dimer transition as well as the ability to bind to the target promoter and causes repression both in vivo and in vitro. Substitution of the Asp60 phosphorylation target residue of the N-terminal receiver motif of AccR to a phosphomimic Glu residue generates a constitutively active derivative that behaves as a superrepressor of the target genes. AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two different locations within the PN promoter of the bzd genes for anaerobic benzoate degradation. Because the DNA binding-proficient C-terminal domain of AccR is monomeric, we propose an activation mechanism in which phosphorylation of Asp60 of AccR alleviates interdomain repression mediated by the N-terminal domain. The presence of AccR-like proteins encoded in the genomes of other β-proteobacteria of the Azoarcus/Thauera group further suggests that AccR constitutes a master regulator that controls anaerobic CCR in these bacteria. PMID:24302740

  19. AccR is a master regulator involved in carbon catabolite repression of the anaerobic catabolism of aromatic compounds in Azoarcus sp. CIB.


    Valderrama, J Andrés; Shingler, Victoria; Carmona, Manuel; Díaz, Eduardo


    Here we characterized the first known transcriptional regulator that accounts for carbon catabolite repression (CCR) control of the anaerobic catabolism of aromatic compounds in bacteria. The AccR response regulator of Azoarcus sp. CIB controls succinate-responsive CCR of the central pathways for the anaerobic catabolism of aromatics by this strain. Phosphorylation of AccR to AccR-P triggers a monomer-to-dimer transition as well as the ability to bind to the target promoter and causes repression both in vivo and in vitro. Substitution of the Asp(60) phosphorylation target residue of the N-terminal receiver motif of AccR to a phosphomimic Glu residue generates a constitutively active derivative that behaves as a superrepressor of the target genes. AccR-P binds in vitro to a conserved inverted repeat (ATGCA-N6-TGCAT) present at two different locations within the PN promoter of the bzd genes for anaerobic benzoate degradation. Because the DNA binding-proficient C-terminal domain of AccR is monomeric, we propose an activation mechanism in which phosphorylation of Asp(60) of AccR alleviates interdomain repression mediated by the N-terminal domain. The presence of AccR-like proteins encoded in the genomes of other β-proteobacteria of the Azoarcus/Thauera group further suggests that AccR constitutes a master regulator that controls anaerobic CCR in these bacteria. PMID:24302740

  20. Pleiotropic Effect of AccD5 and AccE5 Depletion in Acyl-Coenzyme A Carboxylase Activity and in Lipid Biosynthesis in Mycobacteria

    PubMed Central

    Bazet Lyonnet, Bernardo; Diacovich, Lautaro; Cabruja, Matías; Bardou, Fabienne; Quémard, Annaïk; Gago, Gabriela; Gramajo, Hugo


    Mycobacteria contain a large variety of fatty acids which are used for the biosynthesis of several complex cell wall lipids that have been implicated in the ability of the organism to resist host defenses. The building blocks for the biosynthesis of all these lipids are provided by a fairly complex set of acyl-CoA carboxylases (ACCases) whose subunit composition and roles within these organisms have not yet been clearly established. Previous biochemical and structural studies provided strong evidences that ACCase 5 from Mycobacterium tuberculosis is formed by the AccA3, AccD5 and AccE5 subunits and that this enzyme complex carboxylates acetyl-CoA and propionyl-CoA with a clear substrate preference for the latest. In this work we used a genetic approach to unambiguously demonstrate that the products of both accD5 and accE5 genes are essential for the viability of Mycobacterium smegmatis. By obtaining a conditional mutant on the accD5-accE5 operon, we also demonstrated that the main physiological role of this enzyme complex was to provide the substrates for fatty acid and mycolic acid biosynthesis. Furthermore, enzymatic and biochemical analysis of the conditional mutant provided strong evidences supporting the notion that AccD5 and/or AccE5 have an additional role in the carboxylation of long chain acyl-CoA prior to mycolic acid condensation. These studies represent a significant step towards a better understanding of the roles of ACCases in mycobacteria and confirm ACCase 5 as an interesting target for the development of new antimycobacterial drugs. PMID:24950047

  1. Mechanism of enhanced responses after combination photodynamic therapy (cPDT) in carcinoma cells involves C/EBP-mediated transcriptional upregulation of the coproporphyrinogen oxidase (CPO) gene

    NASA Astrophysics Data System (ADS)

    Anand, Sanjay; Hasan, Tayyaba; Maytin, Edward V.


    Photodynamic therapy (PDT) with aminolevulinate (ALA) is widely accepted as an effective treatment for superficial carcinomas and pre-cancers. However, PDT is still suboptimal for deeper tumors, mainly due to inadequate ALA penetration and subsequent conversion to PpIX. We are interested in improving the effectiveness of photodynamic therapy (PDT) for deep tumors, using a combination approach (cPDT) in which target protoporphyrin (PpIX) levels are significantly enhanced by differentiation caused by giving Vitamin D or methotrexate (MTX) for 3 days prior to ALAPDT. In LNCaP and MEL cells, a strong correlation between inducible differentiation and expression of C/EBP transcription factors, as well as between differentiation and mRNA levels of CPO (a key heme-synthetic enzyme), indicates the possibility of CPO transcriptional regulation by the C/EBPs. Sequence analysis of the first 1300 base pairs of the murine CPO upstream region revealed 15 consensus C/EBP binding sites. Electrophoretic Mobility Shift Assays (EMSA) proved that these sites form specific complexes that have strong, moderate or weak affinities for C/EBPs. However, in the context of the full-length CPO promoter, inactivation of any type of site (strong or weak) reduced CPO promoter activity (luciferase assay) to nearly the same extent, suggesting cooperative interactions. A comparative analysis of murine and human CPO promoters revealed possible protein-protein interactions between C/EBPs and several neighboring transcription factors such as NFkB, Sp1, AP-1, CBP/p300 and CREB (an enhanceosome complex). Overall, these results confirm that C/EBP's are important for CPO expression via complex mechanisms which upregulate PpIX and enhance the outcome of cPDT.

  2. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.


    Tucker, Mark L; Xue, Ping; Yang, Ronghui


    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  3. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua


    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  4. 1-Aminocyclopropane-1-carboxylic acid oxidase: insight into cofactor binding from experimental and theoretical studies.


    Brisson, Lydie; El Bakkali-Taheri, Nadia; Giorgi, Michel; Fadel, Antoine; Kaizer, József; Réglier, Marius; Tron, Thierry; Ajandouz, El Hassan; Simaan, A Jalila


    1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a nonheme Fe(II)-containing enzyme that is related to the 2-oxoglutarate-dependent dioxygenase family. The binding of substrates/cofactors to tomato ACCO was investigated through kinetics, tryptophan fluorescence quenching, and modeling studies. α-Aminophosphonate analogs of the substrate (1-aminocyclopropane-1-carboxylic acid, ACC), 1-aminocyclopropane-1-phosphonic acid (ACP) and (1-amino-1-methyl)ethylphosphonic acid (AMEP), were found to be competitive inhibitors versus both ACC and bicarbonate (HCO(3)(-)) ions. The measured dissociation constants for Fe(II) and ACC clearly indicate that bicarbonate ions improve both Fe(II) and ACC binding, strongly suggesting a stabilization role for this cofactor. A structural model of tomato ACCO was constructed and used for docking experiments, providing a model of possible interactions of ACC, HCO(3)(-), and ascorbate at the active site. In this model, the ACC and bicarbonate binding sites are located close together in the active pocket. HCO(3)(-) is found at hydrogen-bond distance from ACC and interacts (hydrogen bonds or electrostatic interactions) with residues K158, R244, Y162, S246, and R300 of the enzyme. The position of ascorbate is also predicted away from ACC. Individually docked at the active site, the inhibitors ACP and AMEP were found coordinating the metal ion in place of ACC with the phosphonate groups interacting with K158 and R300, thus interlocking with both ACC and bicarbonate binding sites. In conclusion, HCO(3)(-) and ACC together occupy positions similar to the position of 2-oxoglutarate in related enzymes, and through a hydrogen bond HCO(3)(-) likely plays a major role in the stabilization of the substrate in the active pocket. PMID:22711330

  5. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.


    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica


    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  6. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.


    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  7. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng


    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  8. Characterization of a Decapentapletic Gene (AccDpp) from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress

    PubMed Central

    Wang, Hongfang; Guo, Xulei; Guo, Xingqi; Sun, Qinghua; Xu, Baohua


    To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ) signal pathway. Decapentapletic gene (Dpp) belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana). In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp. PMID:26881804

  9. C-terminal phosphorylation is essential for regulation of ethylene synthesizing ACC synthase enzyme.


    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    The genetic and molecular biological studies mainly in Arabidopsis and in some other plants have begun to uncover the various components of ripening signaling pathway in plants. Although transcriptional regulation of major ripening genes have been studied in detail, information on role of phosphorylation in regulating the activity and stability of core ripening pathway associated proteins in relation to ethylene biosynthesis during fruit ripening is still limited. Recently we have demonstrated the evidence for post-translational regulation of MA-ACS1 (Musa acuminata ACC synthase 1), the rate limiting step enzyme regulating ripening ethylene production in banana, through phosphorylation at the C-terminal Ser 476 and 479 residues by a 41-kDa Ser/Thr protein kinase. (1) Here we have further discussed role of protein phosphorylation in regulation of stability and activity of ACS enzymes and the mechanistic and evolutionary perspective of phosphorylation pattern of Type I ACC synthase enzymes. PMID:23221778

  10. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated...

  11. Opine-based Agrobacterium competitiveness: dual expression control of the agrocinopine catabolism (acc) operon by agrocinopines and phosphate levels.


    Kim, H Stanley; Yi, Hyojeong; Myung, Jaehee; Piper, Kevin R; Farrand, Stephen K


    Agrobacterium tumefaciens strain C58 can transform plant cells to produce and secrete the sugar-phosphate conjugate opines agrocinopines A and B. The bacterium then moves in response to the opines and utilizes them as exclusive sources of carbon, energy, and phosphate via the functions encoded by the acc operon. These privileged opine-involved activities contribute to the formation of agrobacterial niches in the environment. We found that the expression of the acc operon is induced by agrocinopines and also by limitation of phosphate. The main promoter is present in front of the first gene, accR, which codes for a repressor. This operon structure enables efficient repression when opine levels are low. The promoter contains two putative operators, one overlapping the -10 sequence and the other in the further upstream from it; two partly overlapped putative pho boxes between the two operators; and two consecutive transcription start sites. DNA fragments containing either of the operators bound purified repressor AccR in the absence of agrocinopines but not in the presence of the opines, demonstrating the on-off switch of the promoter. Induction of the acc operon can occur under low-phosphate conditions in the absence of agrocinopines and further increases when the opines also are present. Such opine-phosphate dual regulatory system of the operon may ensure maximum utilization of agrocinopines when available and thereby increase the chances of agrobacterial survival in the highly competitive environment with limited general food sources. PMID:18344359

  12. Obesity Drives Th17 Cell Differentiation by Inducing the Lipid Metabolic Kinase, ACC1.


    Endo, Yusuke; Asou, Hikari K; Matsugae, Nao; Hirahara, Kiyoshi; Shinoda, Kenta; Tumes, Damon J; Tokuyama, Hirotake; Yokote, Koutaro; Nakayama, Toshinori


    Chronic inflammation due to obesity contributes to the development of metabolic diseases, autoimmune diseases, and cancer. Reciprocal interactions between metabolic systems and immune cells have pivotal roles in the pathogenesis of obesity-associated diseases, although the mechanisms regulating obesity-associated inflammatory diseases are still unclear. In the present study, we performed transcriptional profiling of memory phenotype CD4 T cells in high-fat-fed mice and identified acetyl-CoA carboxylase 1 (ACC1, the gene product of Acaca) as an essential regulator of Th17 cell differentiation in vitro and of the pathogenicity of Th17 cells in vivo. ACC1 modulates the DNA binding of RORγt to target genes in differentiating Th17 cells. In addition, we found a strong correlation between IL-17A-producing CD45RO(+)CD4 T cells and the expression of ACACA in obese subjects. Thus, ACC1 confers the appropriate function of RORγt through fatty acid synthesis and regulates the obesity-related pathology of Th17 cells.

  13. Estrogen related receptor α (ERRα) a promising target for the therapy of adrenocortical carcinoma (ACC).


    Casaburi, Ivan; Avena, Paola; De Luca, Arianna; Chimento, Adele; Sirianni, Rosa; Malivindi, Rocco; Rago, Vittoria; Fiorillo, Marco; Domanico, Francesco; Campana, Carmela; Cappello, Anna Rita; Sotgia, Federica; Lisanti, Michael P; Pezzi, Vincenzo


    The pathogenesis of the adrenocortical cancer (ACC) involves integration of molecular signals and the interplay of different downstream pathways (i.e. IGFII/IGF1R, β-catenin, Wnt, ESR1). This tumor is characterized by limited therapeutic options and unsuccessful treatments. A useful strategy to develop an effective therapy for ACC is to identify a common downstream target of these multiple pathways. A good candidate could be the transcription factor estrogen-related receptor alpha (ERRα) because of its ability to regulate energy metabolism, mitochondrial biogenesis and signalings related to cancer progression. In this study we tested the effect of ERRα inverse agonist, XCT790, on the proliferation of H295R adrenocortical cancer cell line. Results from in vitro and in vivo experiments showed that XCT790 reduced H295R cell growth. The inhibitory effect was associated with impaired cell cycle progression which was not followed by any apoptotic event. Instead, incomplete autophagy and cell death by a necrotic processes, as a consequence of the cell energy failure, induced by pharmacological reduction of ERRα was evidenced. Our results indicate that therapeutic strategies targeting key factors such as ERRα that control the activity and signaling of bioenergetics processes in high-energy demanding tumors could represent an innovative/alternative therapy for the treatment of ACC. PMID:26312764

  14. Estrogen related receptor α (ERRα) a promising target for the therapy of adrenocortical carcinoma (ACC)

    PubMed Central

    Chimento, Adele; Sirianni, Rosa; Malivindi, Rocco; Rago, Vittoria; Fiorillo, Marco; Domanico, Francesco; Campana, Carmela; Cappello, Anna Rita; Sotgia, Federica; Lisanti, Michael P.; Pezzi, Vincenzo


    The pathogenesis of the adrenocortical cancer (ACC) involves integration of molecular signals and the interplay of different downstream pathways (i.e. IGFII/IGF1R, β-catenin, Wnt, ESR1). This tumor is characterized by limited therapeutic options and unsuccessful treatments. A useful strategy to develop an effective therapy for ACC is to identify a common downstream target of these multiple pathways. A good candidate could be the transcription factor estrogen-related receptor alpha (ERRα) because of its ability to regulate energy metabolism, mitochondrial biogenesis and signalings related to cancer progression. In this study we tested the effect of ERRα inverse agonist, XCT790, on the proliferation of H295R adrenocortical cancer cell line. Results from in vitro and in vivo experiments showed that XCT790 reduced H295R cell growth. The inhibitory effect was associated with impaired cell cycle progression which was not followed by any apoptotic event. Instead, incomplete autophagy and cell death by a necrotic processes, as a consequence of the cell energy failure, induced by pharmacological reduction of ERRα was evidenced. Our results indicate that therapeutic strategies targeting key factors such as ERRα that control the activity and signaling of bioenergetics processes in high-energy demanding tumors could represent an innovative/alternative therapy for the treatment of ACC. PMID:26312764

  15. Plasmid-Encoded ACC-4, an Extended-Spectrum Cephalosporinase Variant from Escherichia coli▿

    PubMed Central

    Papagiannitsis, Costas C.; Tzouvelekis, Leonidas S.; Tzelepi, Eva; Miriagou, Vivi


    ACC-4, an omega loop mutant (Val211→Gly) of the Hafnia alvei-derived cephalosporinase ACC-1, was encoded by an Escherichia coli plasmid. The genetic environment of blaACC-4 shared similarities with plasmidic regions carrying blaACC-1. Kinetics of β-lactam hydrolysis and levels of resistance to β-lactams showed that ACC-4 was more effective than ACC-1 against expanded-spectrum cephalosporins. PMID:17664321

  16. Adrenocortical cancer (ACC) - literature overview and own experience.


    Dworakowska, Dorota; Drabarek, Agata; Wenzel, Ingrid; Babińska, Anna; Świątkowska-Stodulska, Renata; Sworczak, Krzysztof


    Adrenocortical carcinoma (ACC) is a malignant endocrine tumour. The rarity of the disease has stymied therapeutic development. Age distribution shows two peaks: the first and fifth decades of life, with children and women more frequently affected. Although 60-70% of ACCs are biochemically found to overproduce hormones, it is not clinically apparent in many cases. If present, endocrine symptoms include signs of hypercortisolaemia, virilisation or gynaecomastia. ACC carries a poor prognosis, and a cure can be achieved only by complete surgical resection. Mitotane is used both as an adjuvant treatment and also in non-operative patients. The role of radio- and chemotherapy is still controversial. The post-operative disease free survival is low and oscillates around 30% due to high tumour recurrence rate. The diagnosis is based on tumour histological assessment with the use of the Weiss score, however urinary steroid profiling (if available) can serve to differentiate between ACC and other adrenal tumours. Conventional prognostic markers in ACC include stage and grade of disease, and, as currently reported, the presence of hypercortisolaemia. Molecular analysis has had a significant impact on the understanding of the pathogenetic mechanism of ACC development and the evaluation of prognostic and predictive markers, among which alterations of the IGF system, the Wnt pathway, p53 and molecules involved in cancer cell invasion properties and angiogenesis seem to be very promising. We here summarise our own experience related to the management of ACC and present a literature overview. We have not aimed to include a detailed summary of the molecular alterations biology described in ACC, as this has already been addressed in other papers. PMID:25554619

  17. Molecular characterization and expression analysis of 1-aminocyclopropane-1-carboxylate oxidase homologs from potato under abiotic and biotic stresses.


    Nie, Xianzhou; Singh, Rudra P; Tai, George C C


    In this work, we report cloning of two full-length 1-aminocyclopropane-1-carboxylate oxidase (ACO) cDNAs (ACO1 and ACO2) from potato (Solanum tuberosum) and their expression in potato tissues. The sequence data indicate that the two cDNAs share a high degree of homology with each other, and with known ACO genes from other plant species, including monocots and dicots. However, these potato genes lack homology at the 5' and 3' ends, despite similarities in their open reading frames and encoded amino acids. Phylogenetic analysis places them in two subfamilies of ACOs. The genes are tissue specific: expression is high in leaves and low in roots and tubers. In sprouts and tubers, ACO1 is induced by heat (40 degrees C) and cold (0 degrees C) stresses, whereas ACO2 is induced only by cold (0 degrees C). ACO1 is markedly induced in leaves by wounding, soil-flooding, and exogenous application of 1-aminocyclopropane-1-carboxylic acid (ACC). In contrast, ACO2 induction is lower under these treatments. ACO1 and ACO2 are regulated very differently in potato leaves with respect to senescence. ACO2 expression is unaffected by senescence, whereas that of ACO1 is closely related to the age and senescence in both attached and detached leaves. Exogenous ACC not only induces ACO1, but also accelerates leaf senescence. ACO1 transcripts are induced significantly in leaves, stems, and tubers in the Potato virus A (PVA)-resistant potato cultivar Shepody when graft inoculated with PVA. PMID:12416623

  18. ACC deaminase activity in avirulent Agrobacterium tumefaciens D3.


    Hao, Youai; Charles, Trevor C; Glick, Bernard R


    Some plant-growth-promoting bacteria encode the enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, which breaks down ACC, the direct precursor of ethylene biosynthesis in all higher plants, into ammonia and α-ketobutyrate and, as a result, reduces stress ethylene levels in plants caused by a wide range of biotic and abiotic stresses. It was previously shown that ACC deaminase can inhibit crown gall development induced by Agrobacterium tumefaciens and can partially protect plants from this disease. Agrobacterium tumefaciens D3 has been previously reported to contain a putative ACC deaminase structural gene (acdS) and a regulatory gene (acdR = lrpL). In the present study, it was found that A. tumefaciens D3 is an avirulent strain. ACC deaminase activity and its regulation were also characterized. Under gnotobiotic conditions, wild-type A. tumefaciens D3 was shown to be able to promote plant root elongation, while the acdS and lrpL double mutant strain A. tumefaciens D3-1 lost that ability. When co-inoculated with the virulent strain, A. tumefaciens C58, in wounded castor bean plants, both the wild-type A. tumefaciens D3 and the mutant A. tumefaciens D3-1 were found to be able to significantly inhibit crown gall development induced by A. tumefaciens C58. PMID:21491979

  19. Recent developments in use of 1-aminocyclopropane-1-carboxylate (ACC) deaminase for conferring tolerance to biotic and abiotic stress.


    Gontia-Mishra, Iti; Sasidharan, Shaly; Tiwari, Sharad


    Ethylene is an essential plant hormone also known as a stress hormone because its synthesis is accelerated by induction of a variety of biotic and abiotic stress. The plant growth promoting bacteria containing the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase enhances plant growth by decreasing plant ethylene levels under stress conditions. The expression of ACC deaminase (acdS) gene in transgenic plants is an alternative approach to overcome the ethylene-induced stress. Several transgenic plants have been engineered to express both bacterial/plant acdS genes which then lowers the stress-induced ethylene levels, thus efficiently combating the deleterious effects of environmental stresses. This review summarizes the current knowledge of various transgenic plants overexpressing microbial and plant acdS genes and their potential under diverse biotic and abiotic stresses. Transcription regulation mechanism of acdS gene from different bacteria, with special emphasis to nitrogen fixing bacteria is also discussed in this review.

  20. Determination of 1-aminocycopropane-1-carboxylic acid (ACC) to assess the effects of ACC deaminase-containing bacteria on roots of canola seedlings.


    Penrose, D M; Moffatt, B A; Glick, B R


    Previously, it was proposed that plant growth-promoting bacteria that possess the enzyme, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, can reduce the amount of ethylene produced by a plant and thereby promote root elongation. To test this model, canola seeds were imbibed in the presence of the chemical ethylene inhibitor, 2-aminoethoxyvinyl glycine (AVG), various strains of plant growth-promoting bacteria, and a psychrophilic bacterium containing an ACC deaminase gene on a broad host range plasmid. The extent of root elongation and levels of ACC, the immediate precursor of ethylene, were measured in the canola seedling roots. A modification of the Waters AccQ.Tag Amino Acid Analysis Method was used to quantify ACC in the root extracts. It was found that, in the presence of the ethylene inhibitor, AVG, or any one of several ACC deaminase-containing strains of bacteria, the growth of canola seedling roots was enhanced and the ACC levels in these roots were lowered.

  1. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.


    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  2. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  3. Discovery and optimization of antibacterial AccC inhibitors

    SciTech Connect

    Cheng, Cliff C.; Shipps, Jr., Gerald W.; Yang, Zhiwei; Sun, Binyuan; Kawahata, Noriyuki; Soucy, Kyle A.; Soriano, Aileen; Orth, Peter; Xiao, Li; Mann, Paul; Black, Todd


    The biotin carboxylase (AccC) is part of the multi-component bacterial acetyl coenzyme-A carboxylase (ACCase) and is essential for pathogen survival. We describe herein the affinity optimization of an initial hit to give 2-(2-chlorobenzylamino)-1-(cyclohexylmethyl)-1H-benzo[d]imidazole-5-carboxamide (1), which was identified using our proprietary Automated Ligand Identification System (ALIS). The X-ray co-crystal structure of 1 was solved and revealed several key interactions and opportunities for further optimization in the ATP site of AccC. Structure Based Drug Design (SBDD) and parallel synthetic approaches resulted in a novel series of AccC inhibitors, exemplified by (R)-2-(2-chlorobenzylamino)-1-(2,3-dihydro-1H-inden-1-yl)-1H-imidazo[4,5-b]pyridine-5-carboxamide (40). This compound is a potent and selective inhibitor of bacterial AccC with an IC{sub 50} of 20 nM and a MIC of 0.8 {micro}g/mL against a sensitized strain of Escherichia coli (HS294 E. coli).

  4. The ACCE 2012 Study Tour: Reflections on Reoccurring Themes

    ERIC Educational Resources Information Center

    Clements, Di; Grover, David; Grover, Pam; Hearne, Dominic; Knipe, Steven; Martin, Kim; Pazzi, Georgina; Pollard, Edward; Prestridge, Sarah


    Transformational leadership is essential in education as it empowers educators to make positive changes to the way they think, feel and act in improving learning for all. Reflection is a vital element of leading the change process. In relation to participating in the ACCE study tour experience, reflection allows one to sit and think about the…

  5. Isoelectric focusing of wound-induced tomato ACC synthase

    SciTech Connect

    White, J.A.; Kende, H. )


    Several techniques of electrofocusing have been used to determine whether 1-aminocyclopropane-1-carboxylate (ACC) synthase isolated from wounded tomato pericarp tissue exists in different isoforms, each with its characteristic isoelectric point (pI). The pI of the native enzyme was found to be 6.0 {plus minus} 0.2. When radiolabeled, denatured ACC synthase was electrofocused by non-equilibrium pH gradient electrophoresis (NEpHGE), the enzyme separated into four discernible spots which, upon reaching equilibrium, ranged in pI from 6.6 to 6.9. Immunopurified ACC synthase from four tomato cultivars (Duke, Cornell, Mountain Pride and Pik Red) migrated in each case as a 50-kDa protein on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE). We propose that native ACC synthase in extracts of tomato pericarp tissue exists in one single form and that the charge heterogeneities observed upon electrofocusing of denatured enzyme result from modifications of preexisting protein.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  7. Opine-Based Agrobacterium Competitiveness: Dual Expression Control of the Agrocinopine Catabolism (acc) Operon by Agrocinopines and Phosphate Levels ▿ †

    PubMed Central

    Kim, H. Stanley; Yi, Hyojeong; Myung, Jaehee; Piper, Kevin R.; Farrand, Stephen K.


    Agrobacterium tumefaciens strain C58 can transform plant cells to produce and secrete the sugar-phosphate conjugate opines agrocinopines A and B. The bacterium then moves in response to the opines and utilizes them as exclusive sources of carbon, energy, and phosphate via the functions encoded by the acc operon. These privileged opine-involved activities contribute to the formation of agrobacterial niches in the environment. We found that the expression of the acc operon is induced by agrocinopines and also by limitation of phosphate. The main promoter is present in front of the first gene, accR, which codes for a repressor. This operon structure enables efficient repression when opine levels are low. The promoter contains two putative operators, one overlapping the −10 sequence and the other in the further upstream from it; two partly overlapped putative pho boxes between the two operators; and two consecutive transcription start sites. DNA fragments containing either of the operators bound purified repressor AccR in the absence of agrocinopines but not in the presence of the opines, demonstrating the on-off switch of the promoter. Induction of the acc operon can occur under low-phosphate conditions in the absence of agrocinopines and further increases when the opines also are present. Such opine-phosphate dual regulatory system of the operon may ensure maximum utilization of agrocinopines when available and thereby increase the chances of agrobacterial survival in the highly competitive environment with limited general food sources. PMID:18344359

  8. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.


    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria


    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC and EC was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine.

  9. Dissecting the role of climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using a 1-aminocyclopropane-1-carboxylic acid oxidase knockdown line.


    Atkinson, Ross G; Gunaseelan, Kularajathevan; Wang, Mindy Y; Luo, Luke; Wang, Tianchi; Norling, Cara L; Johnston, Sarah L; Maddumage, Ratnasiri; Schröder, Roswitha; Schaffer, Robert J


    During climacteric fruit ripening, autocatalytic (Type II) ethylene production initiates a transcriptional cascade that controls the production of many important fruit quality traits including flavour production and softening. The last step in ethylene biosynthesis is the conversion of 1-aminocyclopropane-1-carboxylic acid (ACC) to ethylene by the enzyme ACC oxidase (ACO). Ten independent kiwifruit (Actinidia chinensis) lines were generated targeting suppression of fruit ripening-related ACO genes and the fruit from one of these lines (TK2) did not produce detectable levels of climacteric ethylene. Ripening behaviour in a population of kiwifruit at harvest is asynchronous, so a short burst of exogenous ethylene was used to synchronize ripening in TK2 and control fruit. Following such a treatment, TK2 and control fruit softened to an 'eating-ripe' firmness. Control fruit produced climacteric ethylene and softened beyond eating-ripe by 5 d. In contrast, TK2 fruit maintained an eating-ripe firmness for >25 d and total volatile production was dramatically reduced. Application of continuous exogenous ethylene to the ripening-arrested TK2 fruit re-initiated fruit softening and typical ripe fruit volatiles were detected. A 17 500 gene microarray identified 401 genes that changed after ethylene treatment, including a polygalacturonase and a pectate lyase involved in cell wall breakdown, and a quinone oxidoreductase potentially involved in volatile production. Many of the gene changes were consistent with the softening and flavour changes observed after ethylene treatment. However, a surprisingly large number of genes of unknown function were also observed, which could account for the unique flavour and textural properties of ripe kiwifruit.

  10. ACC (1-aminocyclopropane-1-carboxylate) deaminase activity, a widespread trait in Burkholderia species, and its growth-promoting effect on tomato plants.


    Onofre-Lemus, Janette; Hernández-Lucas, Ismael; Girard, Lourdes; Caballero-Mellado, Jesús


    The genus Burkholderia includes pathogens of plants and animals and some human opportunistic pathogens, such as the Burkholderia cepacia complex (Bcc), but most species are nonpathogenic, plant associated, and rhizospheric or endophytic. Since rhizobacteria expressing ACC (1-aminocyclopropane-1-carboxylate) deaminase may enhance plant growth by lowering plant ethylene levels, in this work we investigated the presence of ACC deaminase activity and the acdS gene in 45 strains, most of which are plant associated, representing 20 well-known Burkholderia species. The results demonstrated that ACC deaminase activity is a widespread feature in the genus Burkholderia, since 18 species exhibited ACC deaminase activities in the range from 2 to 15 mumol of alpha-ketobutyrate/h/mg protein, which suggests that these species may be able to modulate ethylene levels and enhance plant growth. In these 18 Burkholderia species the acdS gene sequences were highly conserved (76 to 99% identity). Phylogenetic analysis of acdS gene sequences in Burkholderia showed tight clustering of the Bcc species, which were clearly distinct from diazotrophic plant-associated Burkholderia species. In addition, an acdS knockout mutant of the N(2)-fixing bacterium Burkholderia unamae MTl-641(T) and a transcriptional acdSp-gusA fusion constructed in this strain showed that ACC deaminase could play an important role in promotion of the growth of tomato plants. The widespread ACC deaminase activity in Burkholderia species and the common association of these species with plants suggest that this genus could be a major contributor to plant growth under natural conditions.

  11. Reward salience and risk aversion underlie differential ACC activity in substance dependence

    PubMed Central

    Alexander, William H.; Fukunaga, Rena; Finn, Peter; Brown, Joshua W.


    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed. PMID:26106528

  12. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi


    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  13. Monoamine oxidases in major depressive disorder and alcoholism.


    Duncan, Jeremy; Johnson, Shakevia; Ou, Xiao-Ming


    Monoamine oxidases play an integral role in brain function. Both monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B) regulate neurochemistry by degrading monoamine neurotransmitters (serotonin, dopamine, and norepinephrine). Any alteration in MAO levels can have devastating effects on the brain and behavior by lowering or raising neurotransmitter levels and producing toxic reactive oxygen species. In this review article, MAO is examined in terms of function and genetic organization, with special focus on recent discoveries related to the transcriptional regulation of MAO. In recent studies, transcriptional regulation involves a repressor protein, R1, for MAO-A and an activator protein, KLF11 (a Krüppel-like factor; also referred to as transforming growth factor-beta early inducible gene 2, TIEG2), for both MAO-A and MAO-B, by binding to Sp/KLF sites in the core promoters of MAO and regulating MAO gene expression. Furthermore, KLF11 may influence MAO-B expression and augment glyceraldehyde-3 phosphate dehydrogenase (GAPDH) to upregulate MAO-B transcription upon exposure to ethanol. Finally, we review recent progress in MAO research and highlight the roles that MAOs play in several psychiatric conditions, including chronic stress, major depressive disorder and alcohol dependence. Further research in this area is needed to better understand MAOs, their transcription factors and signaling pathways in psychiatric illnesses in order to develop new strategies for pharmacological advancement.

  14. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  15. Further studies of auxin and ACC induced feminization in the cucumber plant using ethylene inhibitors

    NASA Technical Reports Server (NTRS)

    Takahashi, H.; Jaffe, M. J.


    The present study was designed to establish the role of an essential hormone controlling sex expression in cucumber. A potent anti-ethylene agent, AgNO3, completely inhibited pistillate flower formation caused by IAA, ACC or ethephon. Inhibitors of ethylene biosynthesis, AVG and CoCl2 also suppressed feminization due to exogenous IAA or ACC. Though AVG also suppressed ethephon-induced feminization, this may be due to the second effect of AVG rather than the effect on ACC biosynthesis. These results confirm that ethylene is a major factor regulating feminization and that exogenous auxin induces pistillate flower formation through its stimulation of ethylene production, rather than ACC production.

  16. Indole-3-ethanol Oxidase

    PubMed Central

    Percival, Frank W.; Purves, William K.; Vickery, Larry E.


    We report the further characterization of indole-3-ethanol oxidase from cucumber seedlings. The effects of various inhibitors suggest that the enzyme may be a flavoprotein with a metal ion and sulfhydryl groups required for full activity. Indole-3-acetaldehyde, a product of the reaction, inhibits the enzyme. This inhibition is overcome by O2 but not by indole-3-ethanol, indicating that the kinetic mechanism of the enzyme is a ping-pong Bi-Bi. The enzyme undergoes cooperative interactions with indoleethanol, yielding Hill coefficients as high as 2.96. Gibberellins are without effect on the enzyme, but it is inhibited by several acidic indoles possessing growth-promoting activity and by two synthetic auxins, 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid. Increasing concentrations of indoleacetic acid (IAA) brought about a slight reduction in the indoleethanol concentration producing halfmaximal velocity. Increasing levels of indoleethanol decreased the concentration of IAA required for half-maximal inhibition. At low concentrations of indoleethanol, low levels of IAA activated rather than inhibited. The effect of IAA was not overcome at higher levels of indoleethanol. These results may be interpreted as showing that IAA is a noncompetitive inhibitor which binds to that conformation of the enzyme which also binds indoleethanol. The significance of these interactions for the regulation of IAA biosynthesis is discussed. PMID:16658401

  17. 24 CFR 882.805 - HA application process, ACC execution, and pre-rehabilitation activities.

    Code of Federal Regulations, 2013 CFR


    ... Register notice, plus the cost of the fire and safety improvements required by 24 CFR 982.605(b)(4). HUD... 24 Housing and Urban Development 4 2013-04-01 2013-04-01 false HA application process, ACC... § 882.805 HA application process, ACC execution, and pre-rehabilitation activities. (a) Review....

  18. ACCE/ACS National Educator and Leader of the Year Winners: AEC Congratulates These Outstanding Educators

    ERIC Educational Resources Information Center

    Australian Educational Computing, 2012


    This article presents the ACCE/ACS National Educator and Leader of the Year winners. Anne Mirtschin is the recipient of the ACCE/ACS 2012 Educator of the Year Award. Mirtschin is an innovative teacher at Hawkesdale P-12 College a small rural school that is isolated culturally and geographically. She uses online tools and technology to create…

  19. Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.


    Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J


    An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action. PMID:26668208

  20. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.


    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  1. Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.


    Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J


    An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action.

  2. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.


    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C


    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  3. [Alternative oxidase in industrial fungi].


    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang


    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi.

  4. The CEOS Atmospheric Composition Constellation (ACC), an Integrated Observing System

    NASA Astrophysics Data System (ADS)

    Hilsenrath, E.; Langen, J.; Zehner, C.


    The Atmospheric Composition (AC) Constellation is one of four pilot projects initiated by the Committee for Earth Observations Systems (CEOS) to bring about technical/scientific cooperation among space agencies that meet the goals of GEO and comply with the CEOS member agencies national programs. The Constellation concept has been endorsed in the GEO Work Plan, 2007-2009. The AC Constellation goal is to collect and deliver data to develop and improve monitoring, assessment and predictive capabilities for changes in the ozone layer, air quality and climate forcing associated with changes in the environment. These data will support five of the nine GEO SBAs: Health, Energy, Climate, Hazards, and Ecosystems. At the present time ESA, EC, CSA, CNES, JAXA, DLR, NIVR, NASA, NOAA and Eumetsat are participating in the Constellation study, and have major assets in orbit including 17 instruments on seven platforms. One goal of the Constellation study is to identify missing capabilities that will result when the present orbiting research satellites missions end and those not included in the next generation operational missions. Missing observations include very accurate and high spatial resolution measurements needed to be to track trends in atmospheric composition and understand their relationship to climate change. The following are the top level objectives for the AC Constellation Concept Study: • Develop a virtual constellation of existing and upcoming missions using synergies among the instruments and identify missing capabilities. • Study advanced architecture with new space assets and varying orbits with expectations that new technology could also be brought forward to best meet user requirements • Data system interoperability to insure that data are useful, properly targeted, and easily accessible. To demonstrate that the Constellation concept can provide value added data products, the ACC has initiated the three projects that are being supported by the

  5. NADPH oxidases in Eukaryotes: red algae provide new hints!


    Hervé, Cécile; Tonon, Thierry; Collén, Jonas; Corre, Erwan; Boyen, Catherine


    The red macro-alga Chondrus crispus is known to produce superoxide radicals in response to cell-free extracts of its green algal pathogenic endophyte Acrochaete operculata. So far, no enzymes involved in this metabolism have been isolated from red algae. We report here the isolation of a gene encoding a homologue of the respiratory burst oxidase gp91(phox) in C. crispus, named Ccrboh. This single copy gene encodes a polypeptide of 825 amino acids. Search performed in available genome and EST algal databases identified sequences showing common features of NADPH oxidases in other algae such as the red unicellular Cyanidioschyzon merolae, the economically valuable red macro-alga Porphyra yezoensis and the two diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. Domain organization and phylogenetic relationships with plant, animal, fungal and algal NADPH oxidase homologues were analyzed. Transcription analysis of the C. crispus gene revealed that it was over-transcribed during infection of C. crispus gametophyte by the endophyte A. operculata, and after incubation in presence of atrazine, methyl jasmonate and hydroxyperoxides derived from C20 polyunsaturated fatty acids (PUFAs). These results also illustrate the interest of exploring the red algal lineage for gaining insight into the deep evolution of NADPH oxidases in Eukaryotes.

  6. 1-aminocyclopropane-1-carboxylic acid (ACC) in plants: more than just the precursor of ethylene!

    PubMed Central

    Van de Poel, Bram; Van Der Straeten, Dominique


    Ethylene is a simple two carbon atom molecule with profound effects on plants. There are quite a few review papers covering all aspects of ethylene biology in plants, including its biosynthesis, signaling and physiology. This is merely a logical consequence of the fascinating and pleiotropic nature of this gaseous plant hormone. Its biochemical precursor, 1-aminocyclopropane-1-carboxylic acid (ACC) is also a fairly simple molecule, but perhaps its role in plant biology is seriously underestimated. This triangularly shaped amino acid has many more features than just being the precursor of the lead-role player ethylene. For example, ACC can be conjugated to three different derivatives, but their biological role remains vague. ACC can also be metabolized by bacteria using ACC-deaminase, favoring plant growth and lowering stress susceptibility. ACC is also subjected to a sophisticated transport mechanism to ensure local and long-distance ethylene responses. Last but not least, there are now a few exciting studies where ACC has been reported to function as a signal itself, independently from ethylene. This review puts ACC in the spotlight, not to give it the lead-role, but to create a picture of the stunning co-production of the hormone and its precursor. PMID:25426135

  7. OpenARC: Extensible OpenACC Compiler Framework for Directive-Based Accelerator Programming Study

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    Directive-based, accelerator programming models such as OpenACC have arisen as an alternative solution to program emerging Scalable Heterogeneous Computing (SHC) platforms. However, the increased complexity in the SHC systems incurs several challenges in terms of portability and productivity. This paper presents an open-sourced OpenACC compiler, called OpenARC, which serves as an extensible research framework to address those issues in the directive-based accelerator programming. This paper explains important design strategies and key compiler transformation techniques needed to implement the reference OpenACC compiler. Moreover, this paper demonstrates the efficacy of OpenARC as a research framework for directive-based programming study, by proposing and implementing OpenACC extensions in the OpenARC framework to 1) support hybrid programming of the unified memory and separate memory and 2) exploit architecture-specific features in an abstract manner. Porting thirteen standard OpenACC programs and three extended OpenACC programs to CUDA GPUs shows that OpenARC performs similarly to a commercial OpenACC compiler, while it serves as a high-level research framework.

  8. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni


    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  9. Recalibration of the ACC/AHA Risk Score in Two Population-Based German Cohorts

    PubMed Central

    de las Heras Gala, Tonia; Geisel, Marie Henrike; Peters, Annette; Thorand, Barbara; Baumert, Jens; Lehmann, Nils; Jöckel, Karl-Heinz; Moebus, Susanne; Erbel, Raimund; Meisinger, Christine


    Background The 2013 ACC/AHA guidelines introduced an algorithm for risk assessment of atherosclerotic cardiovascular disease (ASCVD) within 10 years. In Germany, risk assessment with the ESC SCORE is limited to cardiovascular mortality. Applicability of the novel ACC/AHA risk score to the German population has not yet been assessed. We therefore sought to recalibrate and evaluate the ACC/AHA risk score in two German cohorts and to compare it to the ESC SCORE. Methods We studied 5,238 participants from the KORA surveys S3 (1994–1995) and S4 (1999–2001) and 4,208 subjects from the Heinz Nixdorf Recall (HNR) Study (2000–2003). There were 383 (7.3%) and 271 (6.4%) first non-fatal or fatal ASCVD events within 10 years in KORA and in HNR, respectively. Risk scores were evaluated in terms of calibration and discrimination performance. Results The original ACC/AHA risk score overestimated 10-year ASCVD rates by 37% in KORA and 66% in HNR. After recalibration, miscalibration diminished to 8% underestimation in KORA and 12% overestimation in HNR. Discrimination performance of the ACC/AHA risk score was not affected by the recalibration (KORA: C = 0.78, HNR: C = 0.74). The ESC SCORE overestimated by 5% in KORA and by 85% in HNR. The corresponding C-statistic was 0.82 in KORA and 0.76 in HNR. Conclusions The recalibrated ACC/AHA risk score showed strongly improved calibration compared to the original ACC/AHA risk score. Predicting only cardiovascular mortality, discrimination performance of the commonly used ESC SCORE remained somewhat superior to the ACC/AHA risk score. Nevertheless, the recalibrated ACC/AHA risk score may provide a meaningful tool for estimating 10-year risk of fatal and non-fatal cardiovascular disease in Germany. PMID:27732641

  10. Report of the American College of Cardiology (ACC) Scientific Sessions 2015, San Diego.


    Murohara, Toyoaki


    The 64th Annual Scientific Sessions and Exposition of the American College of Cardiology (ACC) were held at the San Diego Convention Center from March 14-16, 2015. The ACC Scientific Sessions are 1 of 2 major scientific cardiology meetings in the United States, with nearly 20,000 attendees, including 15,000 cardiovascular professionals. There were over 2,100 oral and poster abstracts, and more than 15 late-breaking clinical trials (LBCTs) abstructs. This report presents the highlights and several key presentations, especially the LBCTs, from the ACC Scientific Sessions 2015. I hope this review will help cardiologists update to the latest information.

  11. Report of the American College of Cardiology (ACC) Scientific Sessions 2015, San Diego.


    Murohara, Toyoaki


    The 64th Annual Scientific Sessions and Exposition of the American College of Cardiology (ACC) were held at the San Diego Convention Center from March 14-16, 2015. The ACC Scientific Sessions are 1 of 2 major scientific cardiology meetings in the United States, with nearly 20,000 attendees, including 15,000 cardiovascular professionals. There were over 2,100 oral and poster abstracts, and more than 15 late-breaking clinical trials (LBCTs) abstructs. This report presents the highlights and several key presentations, especially the LBCTs, from the ACC Scientific Sessions 2015. I hope this review will help cardiologists update to the latest information. PMID:25959559

  12. Report of the American College of Cardiology (ACC) Scientific Sessions 2016, Chicago.


    Mano, Toshiaki; Yamamoto, Kazuhiro


    The 65(th)Annual Scientific Sessions of the American College of Cardiology (ACC) were held at McCormick Place, Chicago, from April 2-4, 2016. The ACC Scientific Sessions are one of the 2 major scientific cardiology meetings in the USA and one of the major scientific meetings of cardiology in the world. It had an attendance of 18,769 and over 2,000 oral and poster abstracts, including 8 late-breaking clinical trials. This report presents the key presentations and the highlights from the ACC Scientific Sessions 2016 in Chicago. (Circ J 2016; 80: 1308-1313).

  13. NADPH oxidase-dependent acid production in airway epithelial cells.


    Schwarzer, Christian; Machen, Terry E; Illek, Beate; Fischer, Horst


    The purpose of this study was to determine the role of NADPH oxidase in H(+) secretion by airway epithelia. In whole cell patch clamp recordings primary human tracheal epithelial cells (hTE) and the human serous gland cell line Calu-3 expressed a functionally similar zinc-blockable plasma membrane H(+) conductance. However, the rate of H(+) secretion of confluent epithelial monolayers measured in Ussing chambers was 9-fold larger in hTE compared with Calu-3. In hTE H(+) secretion was blocked by mucosal ZnCl(2) and the NADPH oxidase blockers acetovanillone and 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), whereas these same blockers had no effect in Calu-3. We determined levels of transcripts for the NADPH oxidase transmembrane isoforms (Nox1 through -5, Duox1 and -2, and p22(phox)) and found Duox1, -2, and p22(phox) to be highly expressed in hTE, as well as the intracellular subunits p40(phox), p47(phox), and p67(phox). In contrast, Calu-3 lacked transcripts for Duox1, p40(phox), and p47(phox). Anti-Duox antibody staining resulted in prominent apical staining in hTE but no significant staining in Calu-3. When treated with amiloride to block the Na(+)/H(+) exchanger, intracellular pH in hTE acidified at significantly higher rates than in Calu-3, and treatment with AEBSF blocked acidification. These data suggest a role for an apically located Duox-based NADPH oxidase during intracellular H(+) production and H(+) secretion, but not in H(+) conduction.

  14. Technology Awareness Workshop on Active Combustion Control (ACC) in Propulsion Systems: JANNAF Combustion Subcommittee Workshop

    NASA Technical Reports Server (NTRS)

    Fry, Ronald S. (Editor); Gannaway, Mary T. (Editor)


    A JANNAF Combustion Subcommittee Technology Awareness Seminar on Active Combustion Control (ACC) in Propulsion Systems' was held 12 November 1997 at the NASA Lewis Research Center (LeRC), Cleveland, Ohio. The objectives of the seminar were: 1) Define the need and potential of ACC to meet future requirements for gas turbines and ramjets; 2) Explain general principles of ACC and discuss recent successes to suppress combustion instabilities, increase combustion efficiency, reduce emission, and extend flammability limits; 3) Identify R&D barriers/needs for practical implementation of ACC; 4) Explore potential for improving coordination of future R&D activities funded by various government agencies. Over 40 individuals representing senior management from over 20 industry and government organizations participated. This document summarizes the presentations and findings of this seminar.

  15. IMPACC: A Tightly Integrated MPI+OpenACC Framework Exploiting Shared Memory Parallelism

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    We propose IMPACC, an MPI+OpenACC framework for heterogeneous accelerator clusters. IMPACC tightly integrates MPI and OpenACC, while exploiting the shared memory parallelism in the target system. IMPACC dynamically adapts the input MPI+OpenACC applications on the target heterogeneous accelerator clusters to fully exploit target system-specific features. IMPACC provides the programmers with the unified virtual address space, automatic NUMA-friendly task-device mapping, efficient integrated communication routines, seamless streamlining of asynchronous executions, and transparent memory sharing. We have implemented IMPACC and evaluated its performance using three heterogeneous accelerator systems, including Titan supercomputer. Results show that IMPACC can achieve easier programming, higher performance, and better scalability than the current MPI+OpenACC model.

  16. Effect of dexamethasone and ACC on bacteria-induced mucin expression in human airway mucosa.


    Hauber, Hans-Peter; Goldmann, Torsten; Vollmer, Ekkehard; Wollenberg, Barbara; Zabel, Peter


    Gram-negative bacteria can stimulate mucin production, but excessive mucus supports bacterial infection and consequently leads to airway obstruction. Therefore, the effect of dexamethasone (DEX) and the antioxidant acetyl-cysteine (ACC) on bacteria-induced mucus expression was investigated. Explanted human airway mucosa and mucoepidermoid cells (Calu-3) were stimulated with lipopolysaccharide (LPS) or PAM3 (a synthetic lipoprotein). DEX or ACC were added to either LPS- or PAM3-stimulated airway mucosa or Calu-3 cells. Mucin mRNA expression (MUC5AC) and total mucus glycoconjugates (mucin protein) were quantified using real-time PCR and periodic acid Schiff staining. LPS and PAM3 significantly increased mucin expression in airway mucosa and Calu-3 cells (P < 0.05). DEX alone had no significant effect on mucin expression in airway mucosa or Calu-3 cells (P > 0.05). In contrast, DEX significantly reduced LPS- and PAM3-induced mucin expression in explanted mucosal tissue and mucin expression in Calu-3 cells (P < 0.05). In explanted human airway mucosa ACC alone significantly increased mucin expression (P < 0.05). In contrast, ACC significantly decreased LPS- and PAM3-induced mucin expression (P < 0.05). In Calu-3 cells ACC alone had no significant effect on mucin expression (P > 0.05). ACC decreased LPS- and PAM3-induced mucin expression, but this effect was not significant (P > 0.05). These data suggest that DEX can effectively reduce bacteria-induced mucin expression in the airways. ACC alone may increase mucin expression in noninfected mucosa, but it decreased bacteria-induced mucin expression. Further studies are warranted to evaluate whether the effect of DEX or ACC is clinically relevant. PMID:17600317

  17. Effect of dexamethasone and ACC on bacteria-induced mucin expression in human airway mucosa.


    Hauber, Hans-Peter; Goldmann, Torsten; Vollmer, Ekkehard; Wollenberg, Barbara; Zabel, Peter


    Gram-negative bacteria can stimulate mucin production, but excessive mucus supports bacterial infection and consequently leads to airway obstruction. Therefore, the effect of dexamethasone (DEX) and the antioxidant acetyl-cysteine (ACC) on bacteria-induced mucus expression was investigated. Explanted human airway mucosa and mucoepidermoid cells (Calu-3) were stimulated with lipopolysaccharide (LPS) or PAM3 (a synthetic lipoprotein). DEX or ACC were added to either LPS- or PAM3-stimulated airway mucosa or Calu-3 cells. Mucin mRNA expression (MUC5AC) and total mucus glycoconjugates (mucin protein) were quantified using real-time PCR and periodic acid Schiff staining. LPS and PAM3 significantly increased mucin expression in airway mucosa and Calu-3 cells (P < 0.05). DEX alone had no significant effect on mucin expression in airway mucosa or Calu-3 cells (P > 0.05). In contrast, DEX significantly reduced LPS- and PAM3-induced mucin expression in explanted mucosal tissue and mucin expression in Calu-3 cells (P < 0.05). In explanted human airway mucosa ACC alone significantly increased mucin expression (P < 0.05). In contrast, ACC significantly decreased LPS- and PAM3-induced mucin expression (P < 0.05). In Calu-3 cells ACC alone had no significant effect on mucin expression (P > 0.05). ACC decreased LPS- and PAM3-induced mucin expression, but this effect was not significant (P > 0.05). These data suggest that DEX can effectively reduce bacteria-induced mucin expression in the airways. ACC alone may increase mucin expression in noninfected mucosa, but it decreased bacteria-induced mucin expression. Further studies are warranted to evaluate whether the effect of DEX or ACC is clinically relevant.

  18. Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture.


    Saleem, Muhammad; Arshad, Muhammad; Hussain, Sarfraz; Bhatti, Ahmad Saeed


    Ethylene is a gaseous plant growth hormone produced endogenously by almost all plants. It is also produced in soil through a variety of biotic and abiotic mechanisms, and plays a key role in inducing multifarious physiological changes in plants at molecular level. Apart from being a plant growth regulator, ethylene has also been established as a stress hormone. Under stress conditions like those generated by salinity, drought, waterlogging, heavy metals and pathogenicity, the endogenous production of ethylene is accelerated substantially which adversely affects the root growth and consequently the growth of the plant as a whole. Certain plant growth promoting rhizobacteria (PGPR) contain a vital enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, which regulates ethylene production by metabolizing ACC (an immediate precursor of ethylene biosynthesis in higher plants) into alpha-ketobutyrate and ammonia. Inoculation with PGPR containing ACC deaminase activity could be helpful in sustaining plant growth and development under stress conditions by reducing stress-induced ethylene production. Lately, efforts have been made to introduce ACC deaminase genes into plants to regulate ethylene level in the plants for optimum growth, particularly under stressed conditions. In this review, the primary focus is on giving account of all aspects of PGPR containing ACC deaminase regarding alleviation of impact of both biotic and abiotic stresses onto plants and of recent trends in terms of introduction of ACC deaminase genes into plant and microbial species.

  19. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.


    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun


    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  20. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )


    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  1. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.


    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria


    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC and EC was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine. PMID:15587701

  2. Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition

    PubMed Central

    Kolla, Nathan J.; Chiuccariello, Lina; Wilson, Alan A.; Houle, Sylvain; Links, Paul; Bagby, R. Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V.; Pasricha, Suvercha; Meyer, Jeffrey H.


    BACKGROUND Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. METHODS [11C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. RESULTS Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p < .001). In BPD, PFC and ACC MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = −.44, p = .023). CONCLUSIONS These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. PMID:25698585

  3. Positive coping styles and perigenual ACC volume: two related mechanisms for conferring resilience?


    Holz, Nathalie E; Boecker, Regina; Jennen-Steinmetz, Christine; Buchmann, Arlette F; Blomeyer, Dorothea; Baumeister, Sarah; Plichta, Michael M; Esser, Günter; Schmidt, Martin; Meyer-Lindenberg, Andreas; Banaschewski, Tobias; Brandeis, Daniel; Laucht, Manfred


    Stress exposure has been linked to increased rates of depression and anxiety in adults, particularly in females, and has been associated with maladaptive changes in the anterior cingulate cortex (ACC), which is an important brain structure involved in internalizing disorders. Coping styles are important mediators of the stress reaction by establishing homeostasis, and may thus confer resilience to stress-related psychopathology. Anatomical scans were acquired in 181 healthy participants at age 25 years. Positive coping styles were determined using a self-report questionnaire (German Stress Coping Questionnaire, SVF78) at age 22 years. Adult anxiety and depression symptoms were assessed at ages 22, 23 and 25 years with the Young Adult Self-Report. Information on previous internalizing diagnoses was obtained by diagnostic interview (2-19 years). Positive coping styles were associated with increased ACC volume. ACC volume and positive coping styles predicted anxiety and depression in a sex-dependent manner with increased positive coping and ACC volume being related to lower levels of psychopathology in females, but not in males. These results remained significant when controlled for previous internalizing diagnoses. These findings indicate that positive coping styles and ACC volume are two linked mechanisms, which may serve as protective factors against internalizing disorders. PMID:26743466

  4. ACC deaminase genes are conserved among Mesorhizobium species able to nodulate the same host plant.


    Nascimento, Francisco X; Brígido, Clarisse; Glick, Bernard R; Oliveira, Solange


    Rhizobia strains expressing the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase have been reported to display an augmented symbiotic performance as a consequence of lowering the plant ethylene levels that inhibit the nodulation process. Genes encoding ACC deaminase (acdS) have been studied in Rhizobium spp.; however, not much is known about the presence of acdS genes in Mesorhizobium spp. The aim of this study was to assess the prevalence and phylogeny of acdS genes in Mesorhizobium strains including a collection of chickpea-nodulating mesorhizobia from Portugal. ACC deaminase genes were detected in 10 of 12 mesorhizobia type strains as well as in 18 of 18 chickpea Mesorhizobium isolates studied in this work. No ACC deaminase activity was detected in any Mesorhizobium strain tested under free-living conditions. Despite the lack of ACC deaminase activity, it was possible to demonstrate that in Mesorhizobium ciceri UPM-Ca7(T) , the acdS gene is transcribed under symbiotic conditions. Phylogenetic analysis indicates that strains belonging to different species of Mesorhizobium, but nodulating the same host plant, have similar acdS genes, suggesting that acdS genes are horizontally acquired by transfer of the symbiosis island. This data, together with analysis of the symbiosis islands from completely sequenced Mesorhizobium genomes, suggest the presence of the acdS gene in a Mesorhizobium common ancestor that possessed this gene in a unique symbiosis island.

  5. Positive coping styles and perigenual ACC volume: two related mechanisms for conferring resilience?


    Holz, Nathalie E; Boecker, Regina; Jennen-Steinmetz, Christine; Buchmann, Arlette F; Blomeyer, Dorothea; Baumeister, Sarah; Plichta, Michael M; Esser, Günter; Schmidt, Martin; Meyer-Lindenberg, Andreas; Banaschewski, Tobias; Brandeis, Daniel; Laucht, Manfred


    Stress exposure has been linked to increased rates of depression and anxiety in adults, particularly in females, and has been associated with maladaptive changes in the anterior cingulate cortex (ACC), which is an important brain structure involved in internalizing disorders. Coping styles are important mediators of the stress reaction by establishing homeostasis, and may thus confer resilience to stress-related psychopathology. Anatomical scans were acquired in 181 healthy participants at age 25 years. Positive coping styles were determined using a self-report questionnaire (German Stress Coping Questionnaire, SVF78) at age 22 years. Adult anxiety and depression symptoms were assessed at ages 22, 23 and 25 years with the Young Adult Self-Report. Information on previous internalizing diagnoses was obtained by diagnostic interview (2-19 years). Positive coping styles were associated with increased ACC volume. ACC volume and positive coping styles predicted anxiety and depression in a sex-dependent manner with increased positive coping and ACC volume being related to lower levels of psychopathology in females, but not in males. These results remained significant when controlled for previous internalizing diagnoses. These findings indicate that positive coping styles and ACC volume are two linked mechanisms, which may serve as protective factors against internalizing disorders.

  6. OpenACC to FPGA: A Framework for Directive-based High-Performance Reconfigurable Computing

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    This paper presents a directive-based, high-level programming framework for high-performance reconfigurable computing. It takes a standard, portable OpenACC C program as input and generates a hardware configuration file for execution on FPGAs. We implemented this prototype system using our open-source OpenARC compiler; it performs source-to-source translation and optimization of the input OpenACC program into an OpenCL code, which is further compiled into a FPGA program by the backend Altera Offline OpenCL compiler. Internally, the design of OpenARC uses a high- level intermediate representation that separates concerns of program representation from underlying architectures, which facilitates portability of OpenARC. In fact, this design allowed us to create the OpenACC-to-FPGA translation framework with minimal extensions to our existing system. In addition, we show that our proposed FPGA-specific compiler optimizations and novel OpenACC pragma extensions assist the compiler in generating more efficient FPGA hardware configuration files. Our empirical evaluation on an Altera Stratix V FPGA with eight OpenACC benchmarks demonstrate the benefits of our strategy. To demonstrate the portability of OpenARC, we show results for the same benchmarks executing on other heterogeneous platforms, including NVIDIA GPUs, AMD GPUs, and Intel Xeon Phis. This initial evidence helps support the goal of using a directive-based, high-level programming strategy for performance portability across heterogeneous HPC architectures.

  7. Radiolabeling of a wound-inducible pyridoxal phosphate utilizing protein from tomato: evidence for its identification as ACC synthase

    SciTech Connect

    Privalle, L.S.; Graham, J.S.; Caughey, P.A.


    Aminocyclopropane 1-carboxylic acid (ACC) synthase, a pyridoxal phosphate utilizing enzyme, catalyzes the conversion of S-adenosylmethionine to ACC, the rate limiting step in the biosynthesis of the plant hormone, ethylene. Ethylene, besides being involved in normal plant growth processes, is also produced in response to stress, e.g. wounding, pathogen infection, etc. The authors report the partial purification (400 fold) of ACC synthase from wounded pink tomato pericarp by classical techniques including ammonium sulfate precipitation, ion exchange and phenyl sepharose chromatography. Further purification results in a decrease in specific activity apparently due to the instability of the enzyme and the low levels present in plant tissue. Radiolabeling of a pyridoxal phosphate-utilizing protein in the ACC synthase enriched fraction was achieved. Evidence that this radiolabeled protein is ACC synthase will be presented. Amino acid sequence determination of putative ACC synthase-derived peptides is underway.

  8. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.


    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  9. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen


    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  10. Glucose oxidase activity of actinomycetes.


    St Vlahov, S


    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  11. Precipitation of ACC in liposomes-a model for biomineralization in confined volumes

    SciTech Connect

    Tester, Chantel C; Wu, Ching-Hsuan; Weigand, Steven; Joester, Derk


    Biomineralizing organisms frequently precipitate minerals in small phospholipid bilayer-delineated compartments. We have established an in vitro model system to investigate the effect of confinement in attoliter to femtoliter volumes on the precipitation of calcium carbonate. In particular, we analyze the growth and stabilization of liposome-encapsulated amorphous calcium carbonate (ACC) nanoparticles using a combination of in situ techniques, cryo-transmission electron microscopy (Cryo-TEM), and small angle X-ray scattering (SAXS). Herein, we discuss ACC nanoparticle growth rate as a function of liposome size, carbon dioxide flux across the liposome membrane, pH, and osmotic pressure. Based on these experiments, we argue that the stabilization of ACC nanoparticles in liposomes is a consequence of a low nucleation rate (high activation barrier) of crystalline polymorphs of calcium carbonate.

  12. Frontal and rostral anterior cingulate (rACC) theta EEG in depression: implications for treatment outcome?


    Arns, Martijn; Etkin, Amit; Hegerl, Ulrich; Williams, Leanne M; DeBattista, Charles; Palmer, Donna M; Fitzgerald, Paul B; Harris, Anthony; deBeuss, Roger; Gordon, Evian


    In major depressive disorder (MDD), elevated theta current density in the rostral anterior cingulate (rACC), as estimated by source localization of scalp-recorded electroencenphalogram (EEG), has been associated with response to antidepressant treatments, whereas elevated frontal theta has been linked to non-response. This study used source localization to attempt to integrate these apparently opposite results and test, whether antidepressant response is associated with elevated rACC theta and non-response with elevated frontal theta and whether theta activity is a differential predictor of response to different types of commonly used antidepressants. In the international Study to Predict Optimized Treatment in Depression (iSPOT-D), a multi-center, international, randomized, prospective practical trial, 1008 MDD participants were randomized to escitalopram, sertraline or venlafaxine-XR. The study also recruited 336 healthy controls. Treatment response and remission were established after eight weeks using the 17-item Hamilton Rating Scale for Depression (HRSD17). The resting-state EEG was assessed at baseline with eyes closed and source localization (eLORETA) was employed to extract theta from the rACC and frontal cortex. Patients with MDD had elevated theta in both frontal cortex and rACC, with small effect sizes. High frontal and rACC theta were associated with treatment non-response, but not with non-remission, and this effect was most pronounced in a subgroup with previous treatment failures. Low theta in frontal cortex and rACC are found in responders to antidepressant treatments with a small effect size. Future studies should investigate in more detail the role of previous treatment (failure) in the association between theta and treatment outcome. PMID:25936227

  13. A feasibility study on porting the community land model onto accelerators using OpenACC


    Wang, Dali; Wu, Wei; Winkler, Frank; Ding, Wei; Hernandez, Oscar R.


    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflowmore » procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.« less

  14. A feasibility study on porting the community land model onto accelerators using OpenACC

    SciTech Connect

    Wang, Dali; Wu, Wei; Winkler, Frank; Ding, Wei; Hernandez, Oscar R.


    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflow procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.

  15. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz


    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  16. An OpenACC-Based Unified Programming Model for Multi-accelerator Systems

    SciTech Connect

    Kim, Jungwon; Lee, Seyong; Vetter, Jeffrey S


    This paper proposes a novel SPMD programming model of OpenACC. Our model integrates the different granularities of parallelism from vector-level parallelism to node-level parallelism into a single, unified model based on OpenACC. It allows programmers to write programs for multiple accelerators using a uniform programming model whether they are in shared or distributed memory systems. We implement a prototype of our model and evaluate its performance with a GPU-based supercomputer using three benchmark applications.

  17. Relationship of monoamine oxidase-A distribution volume to postpartum depression and postpartum crying.


    Sacher, Julia; Rekkas, P Vivien; Wilson, Alan A; Houle, Sylvain; Romano, Leslie; Hamidi, Jinous; Rusjan, Pablo; Fan, Ian; Stewart, Donna E; Meyer, Jeffrey H


    Postpartum depression (PPD) has a prevalence rate of 13% and a similarly high proportion of women report a subclinical state of one or more major depressive episode symptoms. The aim was to investigate whether monoamine oxidase-A (MAO-A) VT, an index of MAO-A density, is increased in the prefrontal and anterior cingulate cortex (PFC and ACC), during PPD or when a PPD spectrum symptom, greater predisposition to crying, is present. MAO-A is an enzyme that increases in density after estrogen decline, and has several functions including creating oxidative stress, influencing apoptosis and monoamine metabolism. Fifty-seven women were recruited including 15 first-onset, antidepressant naive, PPD subjects, 12 postpartum healthy who cry due to sad mood, 15 asymptomatic postpartum healthy women, and 15 healthy women not recently pregnant. Each underwent [(11)C]-harmine positron emission tomography scanning to measure MAO-A VT. Both PPD and greater predisposition to crying were associated with greater MAO-A VT in the PFC and ACC (multivariate analysis of variance (MANOVA), group effect, F21,135=1.856; p=0.019; mean combined region elevation 21% and 14% in PPD and crying groups, respectively, relative to postpartum asymptomatic). Greater MAO-A VT in the PFC and ACC represents a new biomarker in PPD, and the PPD symptom of predisposition to crying. Novel strategies for preventing PPD (and some PPD symptoms) may be possible by avoiding environmental conditions that elevate MAO-A level and enhancing conditions that normalize MAO-A level. These findings also argue for clinical trials in PPD with the newer, well-tolerated MAO-A inhibitor antidepressants.

  18. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )


    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  19. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre


    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  20. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.


    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova


    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  1. Complete plastid genome sequence of Primula sinensis (Primulaceae): structure comparison, sequence variation and evidence for accD transfer to nucleus.


    Liu, Tong-Jian; Zhang, Cai-Yun; Yan, Hai-Fei; Zhang, Lu; Ge, Xue-Jun; Hao, Gang


    Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp) were separated by a large single-copy region (82,064 bp) and a small single-copy region (17,725 bp). The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF) were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36-rps8, rps16-trnQ, trnH-psbA and ndhC-trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.

  2. Complete plastid genome sequence of Primula sinensis (Primulaceae): structure comparison, sequence variation and evidence for accD transfer to nucleus

    PubMed Central

    Liu, Tong-Jian; Zhang, Cai-Yun; Yan, Hai-Fei; Zhang, Lu


    Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp) were separated by a large single-copy region (82,064 bp) and a small single-copy region (17,725 bp). The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF) were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis. PMID:27375965

  3. GPER agonist G-1 decreases adrenocortical carcinoma (ACC) cell growth in vitro and in vivo.


    Chimento, Adele; Sirianni, Rosa; Casaburi, Ivan; Zolea, Fabiana; Rizza, Pietro; Avena, Paola; Malivindi, Rocco; De Luca, Arianna; Campana, Carmela; Martire, Emilia; Domanico, Francesco; Fallo, Francesco; Carpinelli, Giulia; Cerquetti, Lidia; Amendola, Donatella; Stigliano, Antonio; Pezzi, Vincenzo


    We have previously demonstrated that estrogen receptor (ER) alpha (ESR1) increases proliferation of adrenocortical carcinoma (ACC) through both an estrogen-dependent and -independent (induced by IGF-II/IGF1R pathways) manner. Then, the use of tamoxifen, a selective estrogen receptor modulator (SERM), appears effective in reducing ACC growth in vitro and in vivo. However, tamoxifen not only exerts antiestrogenic activity, but also acts as full agonist on the G protein-coupled estrogen receptor (GPER). Aim of this study was to investigate the effect of a non-steroidal GPER agonist G-1 in modulating ACC cell growth. We found that G-1 is able to exert a growth inhibitory effect on H295R cells both in vitro and, as xenograft model, in vivo. Treatment of H295R cells with G-1 induced cell cycle arrest, DNA damage and cell death by the activation of the intrinsic apoptotic mechanism. These events required sustained extracellular regulated kinase (ERK) 1/2 activation. Silencing of GPER by a specific shRNA partially reversed G-1-mediated cell growth inhibition without affecting ERK activation. These data suggest the existence of G-1 activated but GPER-independent effects that remain to be clarified. In conclusion, this study provides a rational to further study G-1 mechanism of action in order to include this drug as a treatment option to the limited therapy of ACC.

  4. GPER agonist G-1 decreases adrenocortical carcinoma (ACC) cell growth in vitro and in vivo

    PubMed Central

    Zolea, Fabiana; Rizza, Pietro; Avena, Paola; Malivindi, Rocco; De Luca, Arianna; Campana, Carmela; Martire, Emilia; Domanico, Francesco; Fallo, Francesco; Carpinelli, Giulia; Cerquetti, Lidia; Amendola, Donatella; Stigliano, Antonio; Pezzi, Vincenzo


    We have previously demonstrated that estrogen receptor (ER) alpha (ESR1) increases proliferation of adrenocortical carcinoma (ACC) through both an estrogen-dependent and -independent (induced by IGF-II/IGF1R pathways) manner. Then, the use of tamoxifen, a selective estrogen receptor modulator (SERM), appears effective in reducing ACC growth in vitro and in vivo. However, tamoxifen not only exerts antiestrogenic activity, but also acts as full agonist on the G protein-coupled estrogen receptor (GPER). Aim of this study was to investigate the effect of a non-steroidal GPER agonist G-1 in modulating ACC cell growth. We found that G-1 is able to exert a growth inhibitory effect on H295R cells both in vitro and, as xenograft model, in vivo. Treatment of H295R cells with G-1 induced cell cycle arrest, DNA damage and cell death by the activation of the intrinsic apoptotic mechanism. These events required sustained extracellular regulated kinase (ERK) 1/2 activation. Silencing of GPER by a specific shRNA partially reversed G-1-mediated cell growth inhibition without affecting ERK activation. These data suggest the existence of G-1 activated but GPER-independent effects that remain to be clarified. In conclusion, this study provides a rational to further study G-1 mechanism of action in order to include this drug as a treatment option to the limited therapy of ACC. PMID:26131713

  5. A Comparative Analysis of the Integration of Faith and Learning between ACSI and ACCS Accredited Schools

    ERIC Educational Resources Information Center

    Peterson, Daniel Carl


    The purpose of this descriptive quantitative study was to analyze and compare the integration of faith and learning occurring in Christian schools accredited by the Association of Christian Schools International (ACSI) and classical Christian schools accredited by the Association of Classical and Christian Schools (ACCS). ACSI represents the…

  6. GPER agonist G-1 decreases adrenocortical carcinoma (ACC) cell growth in vitro and in vivo.


    Chimento, Adele; Sirianni, Rosa; Casaburi, Ivan; Zolea, Fabiana; Rizza, Pietro; Avena, Paola; Malivindi, Rocco; De Luca, Arianna; Campana, Carmela; Martire, Emilia; Domanico, Francesco; Fallo, Francesco; Carpinelli, Giulia; Cerquetti, Lidia; Amendola, Donatella; Stigliano, Antonio; Pezzi, Vincenzo


    We have previously demonstrated that estrogen receptor (ER) alpha (ESR1) increases proliferation of adrenocortical carcinoma (ACC) through both an estrogen-dependent and -independent (induced by IGF-II/IGF1R pathways) manner. Then, the use of tamoxifen, a selective estrogen receptor modulator (SERM), appears effective in reducing ACC growth in vitro and in vivo. However, tamoxifen not only exerts antiestrogenic activity, but also acts as full agonist on the G protein-coupled estrogen receptor (GPER). Aim of this study was to investigate the effect of a non-steroidal GPER agonist G-1 in modulating ACC cell growth. We found that G-1 is able to exert a growth inhibitory effect on H295R cells both in vitro and, as xenograft model, in vivo. Treatment of H295R cells with G-1 induced cell cycle arrest, DNA damage and cell death by the activation of the intrinsic apoptotic mechanism. These events required sustained extracellular regulated kinase (ERK) 1/2 activation. Silencing of GPER by a specific shRNA partially reversed G-1-mediated cell growth inhibition without affecting ERK activation. These data suggest the existence of G-1 activated but GPER-independent effects that remain to be clarified. In conclusion, this study provides a rational to further study G-1 mechanism of action in order to include this drug as a treatment option to the limited therapy of ACC. PMID:26131713

  7. ACCE Study Tour to ISTE2011 (San Francisco, New York, Washington, Philadelphia)

    ERIC Educational Resources Information Center

    Gronn, Donna; Romeo, Geoff


    In June/July this year a group of 28 educators from across Australia travelled to the US on the 2011 ACCE ISTE Study Tour. The group comprised a very broad section of educators--primary, secondary and tertiary classroom teachers, ICT coordinators, managers, private consultants and regional office managers. The government, catholic and independent…

  8. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2010 CFR


    ... are subject to the Consolidated ACC (see 24 CFR part 990). Accordingly, if a PHA, before submitting a..., under 24 CFR part 990, for determination of the total amount of Operating Subsidy payable under the... HOUSING AND URBAN DEVELOPMENT PHA-OWNED PROJ- ECTS-CONTINUED OPERATION AS LOW-INCOME HOUSING...

  9. Waste management facility accident analysis (WASTE ACC) system: software for analysis of waste management alternatives

    SciTech Connect

    Kohout, E.F.; Folga, S.; Mueller, C.; Nabelssi, B.


    This paper describes the Waste Management Facility Accident Analysis (WASTE{underscore}ACC) software, which was developed at Argonne National Laboratory (ANL) to support the US Department of Energy`s (DOE`s) Waste Management (WM) Programmatic Environmental Impact Statement (PEIS). WASTE{underscore}ACC is a decision support and database system that is compatible with Microsoft{reg_sign} Windows{trademark}. It assesses potential atmospheric releases from accidents at waste management facilities. The software provides the user with an easy-to-use tool to determine the risk-dominant accident sequences for the many possible combinations of process technologies, waste and facility types, and alternative cases described in the WM PEIS. In addition, its structure will allow additional alternative cases and assumptions to be tested as part of the future DOE programmatic decision-making process. The WASTE{underscore}ACC system demonstrates one approach to performing a generic, systemwide evaluation of accident risks at waste management facilities. The advantages of WASTE{underscore}ACC are threefold. First, the software gets waste volume and radiological profile data that were used to perform other WM PEIS-related analyses directly from the WASTE{underscore}MGMT system. Second, the system allows for a consistent analysis across all sites and waste streams, which enables decision makers to understand more fully the trade-offs among various policy options and scenarios. Third, the system is easy to operate; even complex scenario runs are completed within minutes.

  10. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false HUD approval of demolition or disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development Regulations Relating to Housing and Urban Development (Continued) OFFICE OF ASSISTANT SECRETARY FOR PUBLIC AND INDIAN HOUSING, DEPARTMENT OF HOUSING AND...

  11. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2011 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  12. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2013 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  13. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2012 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  14. Characterization of a cytochrome a1 that functions as a ubiquinol oxidase in Acetobacter aceti.


    Fukaya, M; Tayama, K; Tamaki, T; Ebisuya, H; Okumura, H; Kawamura, Y; Horinouchi, S; Beppu, T


    The terminal oxidase for ethanol oxidation in Acetobacter aceti was purified as a complex consisting of four subunits (subunits I, II, III, and IV) with molecular masses of 72, 34, 21, and 13 kDa, respectively. Spectrophotometric analysis and catalytic properties determined with the purified enzyme showed that it belonged to a family of cytochrome a1 (ba)-type ubiquinol oxidases. A polymerase chain reaction with two oligonucleotides designed for amino acid sequences that are conserved in subunit I of the aa3-type cytochrome c oxidases from various origins and of an Escherichia coli o (bo)-type ubiquinol oxidase was used for cloning the cytochrome a1 gene. A 0.5-kb fragment thus amplified was used as the probe to clone a 4.5-kb KpnI fragment that contained a putative open reading frame for the whole subunit I gene. The molecular weight and amino acid composition of the product of this open reading frame (cyaA) were the same as those of the purified protein from A. aceti. The amino acid sequence of CyaA was homologous to that of subunit I of the E. coli o-type ubiquinol oxidase. Nucleotide sequence analysis of the region neighboring the cyaA gene revealed that the genes (cyaB, cyaC, and cyaD) encoding the other three subunits (subunits II, III, and IV) were clustered upstream and downstream of the cyaA gene in the order cyaB, cyaA, cyaC, and cyaD and with the same transcription polarity, forming an operon. As expected from the enzymatic properties, CyaB, CyaC, and CyaD showed great similarity in amino acid sequence to the corresponding sununits of the E. coli o-type ubiquinol oxidase and as(3)-type cytochrome c oxidases.

  15. Characterization of transcriptional profiles of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding, cold and different photoperiods during ripening in banana fruit.


    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    The ripening-specific genes MA-ACS1 (Musa acuminata ACC synthase1) and MA-ACO1 (M. acuminata ACC oxidase 1) are regulated in response to a wide variety of factors. Here, we have studied the differential transcript accumulation pattern and protein levels of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding and low temperature in preclimacteric banana fruit. We have shown that exogenous application of ethylene and auxin induced the expression of MA-ACS1, while MA-ACO1 showed marginal expression following ethylene treatment in preclimacteric stage. Auxin did not induce MA-ACO1 expression. Thus, auxin-treated banana fruits showed lower ethylene production rate as compared to ethylene-treated fruits. Conversely, wounding and cold treatment down-regulated the expression of both the genes and thus inhibited ethylene production. Furthermore, we have detected a GCC-box putative ethylene-responsive element (ERE)- and an auxin-responsive element (ARE)-specific DNA-binding activity in the banana pulp and studied the ethylene and auxin responsive characteristics of the GCC-box and ARE (TGTCTC) containing synthetic promoter fragments. In addition, we have detected an enhanced ethylene production rate and expression level of MA-ACS1 and MA-ACO1 genes along with a strong GCC-box-specific DNA-binding activity following exposure to constant dark period for 8d at the preclimacteric stage. Together, our study provides interesting information about the regulation of expression of MA-ACS1 and MA-ACO1 genes in response to various factors during ripening in banana fruit, which may have physiological relevance concerning ethylene biosynthesis during post-harvest conditions. PMID:18554749

  16. Characterization of transcriptional profiles of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding, cold and different photoperiods during ripening in banana fruit.


    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    The ripening-specific genes MA-ACS1 (Musa acuminata ACC synthase1) and MA-ACO1 (M. acuminata ACC oxidase 1) are regulated in response to a wide variety of factors. Here, we have studied the differential transcript accumulation pattern and protein levels of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding and low temperature in preclimacteric banana fruit. We have shown that exogenous application of ethylene and auxin induced the expression of MA-ACS1, while MA-ACO1 showed marginal expression following ethylene treatment in preclimacteric stage. Auxin did not induce MA-ACO1 expression. Thus, auxin-treated banana fruits showed lower ethylene production rate as compared to ethylene-treated fruits. Conversely, wounding and cold treatment down-regulated the expression of both the genes and thus inhibited ethylene production. Furthermore, we have detected a GCC-box putative ethylene-responsive element (ERE)- and an auxin-responsive element (ARE)-specific DNA-binding activity in the banana pulp and studied the ethylene and auxin responsive characteristics of the GCC-box and ARE (TGTCTC) containing synthetic promoter fragments. In addition, we have detected an enhanced ethylene production rate and expression level of MA-ACS1 and MA-ACO1 genes along with a strong GCC-box-specific DNA-binding activity following exposure to constant dark period for 8d at the preclimacteric stage. Together, our study provides interesting information about the regulation of expression of MA-ACS1 and MA-ACO1 genes in response to various factors during ripening in banana fruit, which may have physiological relevance concerning ethylene biosynthesis during post-harvest conditions.

  17. NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity

    PubMed Central

    Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto


    The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP−) to oxygen to make O2•−. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

  18. Novel deletion in a patient with an isolated peroxisoml acyl-CoA oxidase deficiency

    SciTech Connect

    Poll-The, B.T.; Fournier, B.; Clevers, H.; Wanders, R.J.A.


    Disorders with defective peroxisome assembly are associated with multiple peroxisomal enzymatic abnormalities. Besides these diseases patients have been described suspected of having a single enzyme defect in the peroxisomal {beta}-oxidation pathway. Laboratory findings for these patients include elevated plasma very long chain fatty acids (VLCFA) and impaired VLCFA oxidation in fibroblasts. Complementation analysis between these patients and those with a proven single enzyme deficiency, using peroxisomal {beta}-oxidation of VLCFA as the criterion for complementation, has been used to show whether the patients are deficient in acyl-CoA oxidase, peroxisomal trifunctional protein or thiolase activity. Fibroblasts from a patient showing the clinical and biochemical abnormalities of isolated acyl-CoA oxidase deficiency (using cell complementation) were analyzed at the molecular level. Isolation of RNA from patient`s fibroblasts was followed by random reverse transcription of RNA and PCR amplification. PCR products were blotted and hybridized with the human acyl-CoA oxidase cDNA. A fragment 150 bp shorter than normal was found. Upon sequencing, exon 7 was found to be deleted leading to a frameshift in the acyl-CoA oxidase mRNA. Southern blot analysis of the patient`s DNA did not reveal any deletion in contrast to two siblings previously reported as having a deletion of at least 17 kb in the acyl-CoA oxidase gene.

  19. Real-time dynamic optical imaging of ACC-M tumor cells killed by HSV-tk/ACV system.


    Xiong, Tao; Li, Yongjin; Li, Zhiyang; Xie, Xiangmo; Lu, Lisha


    HSV-tk/ACV induced and killed human adenoid cystic carcinoma cell (ACC-M) in vivo and in vitro, which were observed through optical imaging and green fluorescence protein (GFP) tagging technique. ACC-M was transfected with TK-GFP, and the single clone cell ACC-M-TK-GFP was selected by G418. With fluorescent stereomicroscope, whole-body fluorescent imaging system and fluorescent microscope, we could observe ACV treated ACC-M-TK-GFP cells in cell level and nude mice. The therapies of tumor were visualized clearly with optical imaging. This study proves that optical imaging is a very good approach for studying the effect of HSV-tk/ACV on the ACC-M tumor cells and decreasing the amount of vessel about tumors cell. Optical imaging will become a visual groundwork for monitoring tumor growth and evaluating in vivo curative effect of antitumor drugs.

  20. Role of the Antarctic Circumpolar Current (ACC) on the Antarctica ice-sheet

    NASA Astrophysics Data System (ADS)

    Ladant, Jean-Baptiste; Donnadieu, Yannick; Lefebvre, Vincent; Dumas, Christophe


    Since more than a decade, most publications have put forward the primary role of atmospheric CO2 for explaining the Eocene Oligocene transition while diminishing the potential for the gateways to play a major role. Here we investigate the role of the Drake Passage opening on the Antarctica ice-sheet using a new modelling system including the Fast Ocean Atmosphere Model (FOAM), the high resolution atmospheric model LMDz and the ice-sheet model GRISLI. Using a set of boundary conditions, i.e. atmospheric CO2 level, orbital parameters and continental configuration, FOAM provides SSTs required to run LMDz, which is then used to simulate ice-sheet over Antarctica with GRISLI. As demonstrated by Lefebvre et al. (2012), the opening of southern oceanic gateways does not trigger the onset of the ACC for CO2 typical of the late Eocene (>840 ppm). A cooler background climatic state such as the one prevalent at the end of the Oligocene is required to simulate a well-developed ACC. Here, we show that the formation of the East Antarctica ice-sheet triggers the onset of the ACC in FOAM. Changes in oceanographic conditions have a significative impact on the atmospheric circulation simulated by LMDz, which in turn influence the ice-sheet geometry. In particular, we show that the ACC may have triggered the onset of West Antarctica ice-sheet through a feedback loop including multiple interactions between the atmosphere, the ocean and the Antarctica ice-sheet. The sensitivity of our results to unconstrained parameters such as those fixing the ablation / freezing below the ice-shelves but also to the topography of the Antarctica (Wilson et al., 2012) will be presented. Ref.: Deciphering the role of southern gateways and carbon dioxide on the onset of the ACC, Lefebvre V. et al., vol. 27, Paleoceanography, 2012 Antarctic topography at the Eocene - Oligocene boundary, Wilson D.S. et al., vol. 335, P-cubed, 2012.

  1. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.


    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  2. Human lysyl oxidase-like 2.


    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae


    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2.

  3. An alternative oxidase monoclonal antibody recognises a highly conserved sequence among alternative oxidase subunits.


    Finnegan, P M; Wooding, A R; Day, D A


    The alternative oxidase is found in the inner mitochondrial membranes of plants and some fungi and protists. A monoclonal antibody raised against the alternative oxidase from the aroid lily Sauromatum guttatum has been used extensively to detect the enzyme in these organisms. Using an immunoblotting strategy, the antibody binding site has been localised to the sequence RADEAHHRDVNH within the soybean alternative oxidase 2 protein. Examination of sequence variants showed that A2 and residues C-terminal to H7 are required for recognition by the monoclonal antibody raised against the alternative oxidase. The recognition sequence is highly conserved among all alternative oxidase proteins and is absolutely conserved in 12 of 14 higher plant sequences, suggesting that this antibody will continue to be extremely useful in studying the expression and synthesis of the alternative oxidase.

  4. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.


    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A


    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  5. Towards a multi-node OpenACC Implementation of the ICON Model

    NASA Astrophysics Data System (ADS)

    Sawyer, Will; Zaengl, Guenther; Linardakis, Leonidas


    We have ported the Icosahedral Non-hydrostatic (ICON) model's dynamics solver to Graphical Processing Units (GPUs), which is a task within the Partnership for Advanced Computing in Europe (PRACE) Second Implementation Phase (2IP) Work Package 8 (WP8). Initial single-node OpenCL and CUDA-Fortran implementations of ICON's non-hydrostatic dynamical core (NHDC) resulted in a maximum factor of two speedup over the latest CPU nodes, e.g., a dual-socket Intel Sandybridge. While this performance was promising, ICON developers viewed neither OpenCL nor CUDA-Fortran as viable programming paradigms for the actual production code, and suggested instead the OpenACC standard as the proper paradigm for the multi-node GPU implementation, which was then undertaken in WP8. We will present the results of the multi-node OpenACC implementation of the ICON NHDC for hybrid multicore platforms. The code baseline is the ICON "DSL" (Domain Specific Language) testbed code, which is essentially a stripped-down version of the ICON model for dynamics simulations only. We will discuss on the OpenACC directives used for the port of the computational as well as the communication code to GPUs, and report the resulting GPU performance on NVIDIA K20x as compared to contemporary CPU architectures. In addition, the future roadmap for an accelerated ICON version will be presented. As a first step, we are now incorporating the OpenACC directives into the ICON development trunk, based on the feedback given to us from the ICON developers at the Max Planck Institute for Meteorology (MPI-M) and the German Weather Service (DWD). Moreover, we plan to port the ICON Climate physical parameterizations stemming from the ECHAM model to OpenACC. This step should enable the full ICON on many core platforms which support OpenACC. The resulting model should benefit climate researchers world-wide who plan to transition from ECHAM to ICON in the coming years.

  6. Regulation of NADPH oxidases in skeletal muscle.


    Ferreira, Leonardo F; Laitano, Orlando


    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  7. Activation of polyphenol oxidase of chloroplasts.


    Tolbert, N E


    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or -18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density.Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles x mg(-1) chlorophyll x hr(-1). Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes.Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  8. Isolation and characterization of ACC deaminase-producing fluorescent pseudomonads, to alleviate salinity stress on canola (Brassica napus L.) growth.


    Jalili, Farzad; Khavazi, Kazem; Pazira, Ebrahim; Nejati, Alireza; Rahmani, Hadi Asadi; Sadaghiani, Hasan Rasuli; Miransari, Mohammad


    Salinity stress is of great importance in arid and semi-arid areas of the world due to its impact in reducing crop yield. Under salinity stress, the amount of 1-aminocyclopropane-1-carboxylate (ACC), a precursor for ethylene production in plants, increases. Here, we conducted research under the hypothesis that isolated ACC deaminase-producing Pseudomonas fluorescens and Pseudomonas putida can alleviate the stressful effects of salinity on canola (Brassica napus L.) growth. The experiments were conducted in the Soil and Water Research Institute, Tehran, Iran. Seven experimental stages were conducted to isolate and characterize ACC deaminase-producing Pseudomonas fluorescens strains and to determine factors enhancing their growth and, consequently, their effects on the germination of canola seeds. Under salinity stress, in 14% of the isolates, ACC deaminase activity was observed, indicating that they were able to utilize ACC as the sole N-source. Bacterial strains differed in their ability to synthesize auxin and hydrogen cyanide compounds, as well as in their ACC deaminase activity. Under salinity stress, the rate of germinating seeds inoculated with the strains of ACC deaminase-producing Pseudomonas fluorescens and Pseudomonas putida, and seedling growth was significantly higher. These results indicate the significance of soil biological activities, including the activities of plant growth-promoting bacteria, in the alleviation of soil stresses such as salinity on plant growth.

  9. Azide inhibition of urate oxidase

    PubMed Central

    Gabison, Laure; Colloc’h, Nathalie; Prangé, Thierry


    The inhibition of urate oxidase (UOX) by azide was investigated by X-ray diffraction techniques and compared with cyanide inhibition. Two well characterized sites for reagents are present in the enzyme: the dioxygen site and the substrate-binding site. To examine the selectivity of these sites towards azide inhibition, several crystallization conditions were developed. UOX was co-crystallized with azide (N3) in the presence or absence of either uric acid (UA, the natural substrate) or 8-azaxanthine (8AZA, a competitive inhibitor). In a second set of experiments, previously grown orthorhombic crystals of the UOX–UA or UOX–8AZA complexes were soaked in sodium azide solutions. In a third set of experiments, orthorhombic crystals of UOX with the exchangeable ligand 8-nitroxanthine (8NXN) were soaked in a solution containing uric acid and azide simultaneously (competitive soaking). In all assays, the soaking periods were either short (a few hours) or long (one or two months). These different experimental conditions showed that one or other of the sites, or the two sites together, could be inhibited. This also demonstrated that azide not only competes with dioxygen as cyanide does but also competes with the substrate for its enzymatic site. A model in agreement with experimental data would be an azide in equilibrium between two sites, kinetically in favour of the dioxygen site and thermodynamically in favour of the substrate-binding site. PMID:25005084

  10. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.


    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  11. Molecular cloning and characterisation of banana fruit polyphenol oxidase.


    Gooding, P S; Bird, C; Robinson, S P


    Polyphenol oxidase (PPO; EC is the enzyme thought to be responsible for browning in banana [Musa cavendishii (AAA group, Cavendish subgroup) cv. Williams] fruit. Banana flesh was high in PPO activity throughout growth and ripening. Peel showed high levels of activity early in development but activity declined until ripening started and then remained constant. PPO activity in fruit was not substantially induced after wounding or treatment with 5-methyl jasmonate. Banana flowers and unexpanded leaf roll had high PPO activities with lower activities observed in mature leaves, roots and stem. Four different PPO cDNA clones were amplified from banana fruit (BPO1, BPO11, BPO34 and BPO35). Full-length cDNA and genomic clones were isolated for the most abundant sequence (BPO1) and the genomic clone was found to contain an 85-bp intron. Introns have not been previously found in PPO genes. Northern analysis revealed the presence of BPO1 mRNA in banana flesh early in development but little BPO1 mRNA was detected at the same stage in banana peel. BPO11 transcript was only detected in very young flesh and there was no detectable expression of BPO34 or BPO35 in developing fruit samples. PPO transcripts were also low throughout ripening in both flesh and peel. BPO1 transcripts were readily detected in flowers, stem, roots and leaf roll samples but were not detected in mature leaves. BPO11 showed a similar pattern of expression to BPO1 in these tissues but transcript levels were much lower. BPO34 and BPO35 mRNAs were only detected at a low level in flowers and roots and BPO34 transcript was detected in mature leaves, the only clone to do so. The results suggest that browning of banana fruit during ripening results from release of pre-existing PPO enzyme, which is synthesised very early in fruit development.

  12. Rat pristanoyl-CoA oxidase. cDNA cloning and recognition of its C-terminal (SQL) by the peroxisomal-targeting signal 1 receptor.


    Vanhooren, J C; Fransen, M; de Béthune, B; Baumgart, E; Baes, M; Torrekens, S; Van Leuven, F; Mannaerts, G P; Van Veldhoven, P P


    The composite pristanoyl-CoA oxidase cDNA sequence, derived from two overlapping clones from a rat liver cDNA library and a 5'-RACE (rapid amplification of cDNA ends) PCR fragment, consisted of 2600 bases and contained an open reading frame of 2100 bases, encoding a protein of 700 amino acids with a calculated molecular mass of 78445 Da. This value is somewhat larger than the reported molecular mass of 70 kDa as determined earlier by SDS-gel electrophoresis. The amino acid identity with rat palmitoyl-CoA oxidase was rather low (28%) and barely higher than that with the yeast acyl-CoA oxidases (20%), suggesting that the palmitoyl-CoA oxidase/pristanoyl-CoA oxidase duplication occurred early in evolution. The carboxy-terminal tripeptide of pristanoyl-CoA oxidase was SQL. In vitro studies with the bacterially expressed human peroxisomal-targeting signal-1 import receptor indicated that SQL functions as a peroxisome-targeting signal. Northern analysis of tissues from control and clofibrate treated rats demonstrated that the pristanoyl-CoA oxidase gene is transcribed in liver and extrahepatic tissues and that transcription is not enhanced by treatment of rats with peroxisome proliferators. No mRNA could be detected by northern analysis of human tissues, suggesting that the human pristanoyl-CoA oxidase gene, if present, is only poorly or not transcribed.

  13. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.


    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge


    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  14. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa


    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  15. Biochemistry and genetics of ACC deaminase: a weapon to “stress ethylene” produced in plants

    PubMed Central

    Singh, Rajnish P.; Shelke, Ganesh M.; Kumar, Anil; Jha, Prabhat N.


    1-aminocyclopropane-1-carboxylate deaminase (ACCD), a pyridoxal phosphate-dependent enzyme, is widespread in diverse bacterial and fungal species. Owing to ACCD activity, certain plant associated bacteria help plant to grow under biotic and abiotic stresses by decreasing the level of “stress ethylene” which is inhibitory to plant growth. ACCD breaks down ACC, an immediate precursor of ethylene, to ammonia and α-ketobutyrate, which can be further metabolized by bacteria for their growth. ACC deaminase is an inducible enzyme whose synthesis is induced in the presence of its substrate ACC. This enzyme encoded by gene AcdS is under tight regulation and regulated differentially under different environmental conditions. Regulatory elements of gene AcdS are comprised of the regulatory gene encoding LRP protein and other regulatory elements which are activated differentially under aerobic and anaerobic conditions. The role of some additional regulatory genes such as AcdB or LysR may also be required for expression of AcdS. Phylogenetic analysis of AcdS has revealed that distribution of this gene among different bacteria might have resulted from vertical gene transfer with occasional horizontal gene transfer (HGT). Application of bacterial AcdS gene has been extended by developing transgenic plants with ACCD gene which showed increased tolerance to biotic and abiotic stresses in plants. Moreover, distribution of ACCD gene or its homolog's in a wide range of species belonging to all three domains indicate an alternative role of ACCD in the physiology of an organism. Therefore, this review is an attempt to explore current knowledge of bacterial ACC deaminase mediated physiological effects in plants, mode of enzyme action, genetics, distribution among different species, ecological role of ACCD and, future research avenues to develop transgenic plants expressing foreign AcdS gene to cope with biotic and abiotic stressors. Systemic identification of regulatory circuits

  16. Effects of Nonlinear Frequency Compression on ACC Amplitude and Listener Performance

    PubMed Central

    Kirby, Benjamin J.; Brown, Carolyn J.


    Objectives Nonlinear frequency compression is a signal processing technique used to increase the audibility of high frequency speech sounds for hearing aid users with sloping, high frequency hearing loss. However, excessive compression ratios may reduce spectral contrast between sounds and negatively impact speech perception. This is of particular concern in infants and young children who may not be able to provide feedback about frequency compression settings. This study explores use of an objective cortical auditory evoked potential that is sensitive to changes in spectral contrast, the auditory change complex (ACC), in the verification of frequency compression parameters. Design ACC responses were recorded from adult listeners to a spectral ripple contrast stimulus that was processed using a range of frequency compression ratios (1:1, 1.5:1, 2:1, 3:1, and 4:1). Vowel identification, consonant identification, speech recognition in noise (QuickSIN), and behavioral ripple discrimination thresholds were also measured under identical frequency compression conditions. In Experiment 1, these tasks were completed in 10 adults with normal hearing. In Experiment 2, these same tasks were repeated in 10 adults with sloping, high frequency hearing loss. Results Repeated measures ANOVAs were completed for each task and each group with frequency compression ratio as the within-subjects factor. Increasing the compression ratio did not affect vowel identification for the normal hearing group but did cause a significant decrease in vowel identification for the hearing-impaired listeners. Increases in compression ratio were associated with significant decrements in ACC amplitudes, consonant identification scores, ripple discrimination thresholds, and speech perception in noise scores for both groups of listeners. Conclusions The ACC response, like speech and non-speech perceptual measures, is sensitive to frequency compression ratio. Further work is needed to establish optimal

  17. Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear 'Gold Nijisseiki'.


    Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping


    To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level.

  18. Adolescent neighborhood quality predicts adult dACC response to social exclusion

    PubMed Central

    Beckes, Lane; Chango, Joanna; Allen, Joseph P.; Coan, James A.


    Neuroimaging studies using the social-exclusion paradigm Cyberball indicate increased dorsal anterior cingulate cortex (dACC) and right insula activity as a function of exclusion. However, comparatively less work has been done on how social status factors may moderate this finding. This study used the Cyberball paradigm with 85 (45 females) socio-economically diverse participants from a larger longitudinal sample. We tested whether neighborhood quality during adolescence would predict subsequent neural responding to social exclusion in young adulthood. Given previous behavioral studies indicating greater social vigilance and negative evaluation as a function of lower status, we expected that lower adolescent neighborhood quality would predict greater dACC activity during exclusion at young adulthood. Our findings indicate that young adults who lived in low-quality neighborhoods in adolescence showed greater dACC activity to social exclusion than those who lived in higher quality neighborhoods. Lower neighborhood quality also predicted greater prefrontal activation in the superior frontal gyrus, dorsal medial prefrontal cortex and the middle frontal gyrus, possibly indicating greater regulatory effort. Finally, this effect was not driven by subsequent ratings of distress during exclusion. In sum, adolescent neighborhood quality appears to potentiate neural responses to social exclusion in young adulthood, effects that are independent of felt distress. PMID:25349459

  19. Bacteria with ACC deaminase can promote plant growth and help to feed the world.


    Glick, Bernard R


    To feed all of the world's people, it is necessary to sustainably increase agricultural productivity. One way to do this is through the increased use of plant growth-promoting bacteria; recently, scientists have developed a more profound understanding of the mechanisms employed by these bacteria to facilitate plant growth. Here, it is argued that the ability of plant growth-promoting bacteria that produce 1-aminocyclopropane-1-carboxylate (ACC) deaminase to lower plant ethylene levels, often a result of various stresses, is a key component in the efficacious functioning of these bacteria. The optimal functioning of these bacteria includes the synergistic interaction between ACC deaminase and both plant and bacterial auxin, indole-3-acetic acid (IAA). These bacteria not only directly promote plant growth, they also protect plants against flooding, drought, salt, flower wilting, metals, organic contaminants, and both bacterial and fungal pathogens. While a considerable amount of both basic and applied work remains to be done before ACC deaminase-producing plant growth-promoting bacteria become a mainstay of plant agriculture, the evidence indicates that with the expected shift from chemicals to soil bacteria, the world is on the verge of a major paradigm shift in plant agriculture. PMID:24095256

  20. The ACC strategy in biomineralization: the case of earthworm's amorphous spherulites

    NASA Astrophysics Data System (ADS)

    Briones, Maria J. I.; Alvarez-Otero, Rosa; Méndez, Jesús; Gago Duport, Luis


    The occurrence of amorphous calcium carbonate (ACC), an hydrated and highly soluble form of solid CaCO3, seems to be a common feature in all carbonate forming organisms such as mollusks, corals, echinoderms and crustaceans. The ubiquity of ACC in these Ca-carbonate biomineralizing systems, as a precursor of further crystalline phases, has recently open the interesting question about if the formation of an amorphous phase is a necessary step in the calcification process of all organisms and consequently, whether it would be possible to define the "amorphous precursor estategy" as a general mechanism in biomineralization. Neverthelees, although ACC appears to be widespread in these organisms very little is known about its particular role in the biomineralization scheme of the different phyla. The formation of CaCO3 spherulites in the calciferous glands of earthworms is a particular case of calcareous biomineralization involving the presence of ACC as a transient precursor phase [2]. Interestingly, the formation of crystalline carbonates via ACC in these organisms is not connected with skeleton building so it must play another functional role. In addition, the transient transformation stages can be followed by in situ spectrometric techniques and therefore, earthworms provide and adequate model to analyse the mutual interactions between ACC-solvent-and crystalline phases. In this study, we have analysed the morphological and structural transformations from the initial ACC spherulites until the formation of the crystalline phases: vaterite (and/or aragonite) and finally calcite, is accomplished. The characterization of ACC was done by performing in situ FT-IR, together with and HREM and Debye scherrer -XRD. The structural results were interpreted in the light of the histological study of the gland. The geometry of the secretory epithelium of the calciferous gland, as evidenced by TEM [2], shows the presence of irregulary shaped cells with their apical surface

  1. Trait impulsivity is related to ventral ACC and amygdala activity during primary reward anticipation.


    Kerr, Kara L; Avery, Jason A; Barcalow, Joel C; Moseman, Scott E; Bodurka, Jerzy; Bellgowan, Patrick S F; Simmons, W Kyle


    Trait impulsivity is characterized by behavioral disinhibition and rash decision-making that contribute to many maladaptive behaviors. Previous research demonstrates that trait impulsivity is related to the activity of brain regions underlying reward sensitivity and emotion regulation, but little is known about this relationship in the context of immediately available primary reward. This is unfortunate, as impulsivity in these contexts can lead to unhealthy behaviors, including poor food choices, dangerous drug use and risky sexual practices. In addition, little is known about the relationship between integration of reward and affective neurocircuitry, as measured by resting-state functional connectivity, and trait impulsivity in everyday life, as measured with a commonly used personality inventory. We therefore asked healthy adults to undergo a functional magnetic resonance imaging task in which they saw cues indicating the imminent oral administration of rewarding taste, as well as a resting-state scan. Trait impulsivity was associated with increased activation during anticipation of primary reward in the anterior cingulate cortex (ACC) and amygdala. Additionally, resting-state functional connectivity between the ACC and the right amygdala was negatively correlated with trait impulsivity. These findings demonstrate that trait impulsivity is related not only to ACC-amygdala activation but also to how tightly coupled these regions are to one another. PMID:24526181

  2. Bacteria with ACC deaminase can promote plant growth and help to feed the world.


    Glick, Bernard R


    To feed all of the world's people, it is necessary to sustainably increase agricultural productivity. One way to do this is through the increased use of plant growth-promoting bacteria; recently, scientists have developed a more profound understanding of the mechanisms employed by these bacteria to facilitate plant growth. Here, it is argued that the ability of plant growth-promoting bacteria that produce 1-aminocyclopropane-1-carboxylate (ACC) deaminase to lower plant ethylene levels, often a result of various stresses, is a key component in the efficacious functioning of these bacteria. The optimal functioning of these bacteria includes the synergistic interaction between ACC deaminase and both plant and bacterial auxin, indole-3-acetic acid (IAA). These bacteria not only directly promote plant growth, they also protect plants against flooding, drought, salt, flower wilting, metals, organic contaminants, and both bacterial and fungal pathogens. While a considerable amount of both basic and applied work remains to be done before ACC deaminase-producing plant growth-promoting bacteria become a mainstay of plant agriculture, the evidence indicates that with the expected shift from chemicals to soil bacteria, the world is on the verge of a major paradigm shift in plant agriculture.

  3. Adolescent neighborhood quality predicts adult dACC response to social exclusion.


    Gonzalez, Marlen Z; Beckes, Lane; Chango, Joanna; Allen, Joseph P; Coan, James A


    Neuroimaging studies using the social-exclusion paradigm Cyberball indicate increased dorsal anterior cingulate cortex (dACC) and right insula activity as a function of exclusion. However, comparatively less work has been done on how social status factors may moderate this finding. This study used the Cyberball paradigm with 85 (45 females) socio-economically diverse participants from a larger longitudinal sample. We tested whether neighborhood quality during adolescence would predict subsequent neural responding to social exclusion in young adulthood. Given previous behavioral studies indicating greater social vigilance and negative evaluation as a function of lower status, we expected that lower adolescent neighborhood quality would predict greater dACC activity during exclusion at young adulthood. Our findings indicate that young adults who lived in low-quality neighborhoods in adolescence showed greater dACC activity to social exclusion than those who lived in higher quality neighborhoods. Lower neighborhood quality also predicted greater prefrontal activation in the superior frontal gyrus, dorsal medial prefrontal cortex and the middle frontal gyrus, possibly indicating greater regulatory effort. Finally, this effect was not driven by subsequent ratings of distress during exclusion. In sum, adolescent neighborhood quality appears to potentiate neural responses to social exclusion in young adulthood, effects that are independent of felt distress.

  4. Trait impulsivity is related to ventral ACC and amygdala activity during primary reward anticipation

    PubMed Central

    Kerr, Kara L.; Avery, Jason A.; Barcalow, Joel C.; Moseman, Scott E.; Bodurka, Jerzy; Bellgowan, Patrick S. F.


    Trait impulsivity is characterized by behavioral disinhibition and rash decision-making that contribute to many maladaptive behaviors. Previous research demonstrates that trait impulsivity is related to the activity of brain regions underlying reward sensitivity and emotion regulation, but little is known about this relationship in the context of immediately available primary reward. This is unfortunate, as impulsivity in these contexts can lead to unhealthy behaviors, including poor food choices, dangerous drug use and risky sexual practices. In addition, little is known about the relationship between integration of reward and affective neurocircuitry, as measured by resting-state functional connectivity, and trait impulsivity in everyday life, as measured with a commonly used personality inventory. We therefore asked healthy adults to undergo a functional magnetic resonance imaging task in which they saw cues indicating the imminent oral administration of rewarding taste, as well as a resting-state scan. Trait impulsivity was associated with increased activation during anticipation of primary reward in the anterior cingulate cortex (ACC) and amygdala. Additionally, resting-state functional connectivity between the ACC and the right amygdala was negatively correlated with trait impulsivity. These findings demonstrate that trait impulsivity is related not only to ACC-amygdala activation but also to how tightly coupled these regions are to one another. PMID:24526181

  5. WASTE-ACC: A computer model for analysis of waste management accidents

    SciTech Connect

    Nabelssi, B.K.; Folga, S.; Kohout, E.J.; Mueller, C.J.; Roglans-Ribas, J.


    In support of the U.S. Department of Energy`s (DOE`s) Waste Management Programmatic Environmental Impact Statement, Argonne National Laboratory has developed WASTE-ACC, a computational framework and integrated PC-based database system, to assess atmospheric releases from facility accidents. WASTE-ACC facilitates the many calculations for the accident analyses necessitated by the numerous combinations of waste types, waste management process technologies, facility locations, and site consolidation strategies in the waste management alternatives across the DOE complex. WASTE-ACC is a comprehensive tool that can effectively test future DOE waste management alternatives and assumptions. The computational framework can access several relational databases to calculate atmospheric releases. The databases contain throughput volumes, waste profiles, treatment process parameters, and accident data such as frequencies of initiators, conditional probabilities of subsequent events, and source term release parameters of the various waste forms under accident stresses. This report describes the computational framework and supporting databases used to conduct accident analyses and to develop source terms to assess potential health impacts that may affect on-site workers and off-site members of the public under various DOE waste management alternatives.

  6. Characterization of ACC deaminase from the biocontrol and plant growth-promoting agent Trichoderma asperellum T203.


    Viterbo, Ada; Landau, Udi; Kim, Sofia; Chernin, Leonid; Chet, Ilan


    1-aminocyclopropane-1-carboxylate (ACC) deaminase activity was evaluated in the biocontrol and plant growth-promoting fungus Trichoderma asperellum T203. Fungal cultures grown with ACC as the sole nitrogen source showed high enzymatic activity. The enzyme encoding gene (Tas-acdS) was isolated, and an average 3.5-fold induction of the gene by 3 mM ACC was detected by real-time PCR. Escherichia coli bacteria carrying the intron-free cDNA of Tas-acdS cloned into the vector pAlter-EX1 under the control of the tac promoter revealed specific ACC deaminase (ACCD) activity and the ability to promote canola (Brassica napus) root elongation in pouch assays. RNAi silencing of the ACCD gene in T. asperellum showed decreased ability of the mutants to promote root elongation of canola seedlings. These data suggest a role for ACCD in the plant root growth-promotion effect by T. asperellum.

  7. Observational fear learning involves affective pain system and Cav1.2 Ca2+ channels in ACC

    PubMed Central

    Jeon, Daejong; Kim, Sangwoo; Chetana, Mattu; Jo, Daewoong; Ruley, H Earl; Lin, Shih-Yao; Rabah, Dania; Kinet, Jean-Pierre; Shin, Hee-Sup


    Fear can be acquired vicariously through social observation of others suffering from aversive stimuli. We found that mice (observers) developed freezing behavior by observing other mice (demonstrators) receive repetitive foot shocks. Observers had higher fear responses when demonstrators were socially related to themselves, such as siblings or mating partners. Inactivation of anterior cingulate cortex (ACC) and parafascicular or mediodorsal thalamic nuclei, which comprise the medial pain system representing pain affection, substantially impaired this observational fear learning, whereas inactivation of sensory thalamic nuclei had no effect. The ACC neuronal activities were increased and synchronized with those of the lateral amygdala at theta rhythm frequency during this learning. Furthermore, an ACC-limited deletion of Cav1.2 Ca2+ channels in mice impaired observational fear learning and reduced behavioral pain responses. These results demonstrate the functional involvement of the affective pain system and Cav1.2 channels of the ACC in observational social fear. PMID:20190743

  8. Observational fear learning involves affective pain system and Cav1.2 Ca2+ channels in ACC.


    Jeon, Daejong; Kim, Sangwoo; Chetana, Mattu; Jo, Daewoong; Ruley, H Earl; Lin, Shih-Yao; Rabah, Dania; Kinet, Jean-Pierre; Shin, Hee-Sup


    Fear can be acquired vicariously through social observation of others suffering from aversive stimuli. We found that mice (observers) developed freezing behavior by observing other mice (demonstrators) receive repetitive foot shocks. Observers had higher fear responses when demonstrators were socially related to themselves, such as siblings or mating partners. Inactivation of anterior cingulate cortex (ACC) and parafascicular or mediodorsal thalamic nuclei, which comprise the medial pain system representing pain affection, substantially impaired this observational fear learning, whereas inactivation of sensory thalamic nuclei had no effect. The ACC neuronal activities were increased and synchronized with those of the lateral amygdala at theta rhythm frequency during this learning. Furthermore, an ACC-limited deletion of Ca(v)1.2 Ca(2+) channels in mice impaired observational fear learning and reduced behavioral pain responses. These results demonstrate the functional involvement of the affective pain system and Ca(v)1.2 channels of the ACC in observational social fear.

  9. ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.


    Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver


    Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. PMID:20630728

  10. Expression of genes responsible for ethylene production and wilting are differently regulated in carnation (Dianthus caryophyllus L.) petals.


    Kosugi; Shibuya; Tsuruno; Iwazaki; Mochizuki; Yoshioka; Hashiba; Satoh


    Carnation petals exhibit autocatalytic ethylene production and wilting during senescence. The autocatalytic ethylene production is caused by the expression of 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase genes, whereas the wilting of petals is related to the expression of the cysteine proteinase (CPase) gene. So far, it has been believed that the ethylene production and wilting are regulated in concert in senescing carnation petals, since the two events occurred closely in parallel with time. In the present study, we investigated the expression of these genes in petals of a transgenic carnation harboring a sense ACC oxidase transgene and in petals of carnation flowers treated with 1,1-dimethyl-4-(phenylsulfonyl)semicarbazide (DPSS). In petals of the transgenic carnation flowers, treatment with exogenous ethylene caused accumulation of the transcript for CPase and in-rolling (wilting), whereas it caused no or little accumulation of the transcripts for ACC oxidase and ACC synthase and negligible ethylene production. In petals of the flowers treated with DPSS, the transcripts for ACC synthase and ACC oxidase were accumulated, but no significant change in the level of the transcript for CPase was observed. These results suggest that the expression of ACC synthase and ACC oxidase genes, which leads to ethylene production, is differentially regulated from the expression of CPase, which leads to wilting, in carnation petals.

  11. Amelioration of high salinity stress damage by plant growth-promoting bacterial endophytes that contain ACC deaminase.


    Ali, Shimaila; Charles, Trevor C; Glick, Bernard R


    Plant growth and productivity is negatively affected by soil salinity. However, it is predicted that plant growth-promoting bacterial (PGPB) endophytes that contain 1-aminocyclopropane-1-carboxylate (ACC) deaminase (E.C. can facilitate plant growth and development in the presence of a number of different stresses. In present study, the ability of ACC deaminase containing PGPB endophytes Pseudomonas fluorescens YsS6, Pseudomonas migulae 8R6, and their ACC deaminase deficient mutants to promote tomato plant growth in the absence of salt and under two different levels of salt stress (165 mM and 185 mM) was assessed. It was evidence that wild-type bacterial endophytes (P. fluorescens YsS6 and P. migulae 8R6) promoted tomato plant growth significantly even in the absence of stress (salinity). Plants pretreated with wild-type ACC deaminase containing endophytic strains were healthier and grew to a much larger size under high salinity stress compared to plants pretreated with the ACC deaminase deficient mutants or no bacterial treatment (control). The plants pretreated with ACC deaminase containing bacterial endophytes exhibit higher fresh and dry biomass, higher chlorophyll contents, and a greater number of flowers and buds than the other treatments. Since the only difference between wild-type and mutant bacterial endophytes was ACC deaminase activity, it is concluded that this enzyme is directly responsible for the different behavior of tomato plants in response to salt stress. The use of PGPB endophytes with ACC deaminase activity has the potential to facilitate plant growth on land that is not normally suitable for the majority of crops due to their high salt contents.

  12. NADPH oxidases: new actors in thyroid cancer?


    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne


    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  13. Xanthine oxidase inhibitory activity of alkyl gallates.


    Masuoka, Noriyoshi; Nihei, Ken-ichi; Kubo, Isao


    A series (C1-C12) of alkyl gallates was examined for their effects on the activity of xanthine oxidase. Octyl (C8), decyl (C10), and dodecyl (C12) gallates competitively inhibited uric acid formation generated by xanthine oxidase, and the inhibition increased upon increasing the alkyl chain length. Interestingly, neither menthyl nor bornyl gallates inhibited uric acid formation. These data indicate that the hydrophobic alkyl portion is associated with the xanthine-binding site in the Mo-binding domain. It is likely that the linear alkyl portion interacts with the hydrophobic domain close to the binding site, and the hydrophobic interaction is crucial to inhibit the xanthine oxidase reaction. On the other hand, all of gallic acid and its esters equally suppress superoxide anion generation catalyzed by xanthine oxidase at low concentration. The suppression is not due to scavenging activity of these gallates but due to reduction of xanthine oxidase by these gallates. The reduced enzyme catalyzes the reaction to generate hydrogen peroxide and uric acid.

  14. Mitochondrial targeting of human protoporphyrinogen oxidase.


    Davids, Lester M; Corrigall, Anne V; Meissner, Peter N


    Variegate porphyria is an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. This study examined the effect of three South African VP-causing mutations (H20P, R59W, R168C) on mitochondrial targeting. Only H20P did not target, and of eight protoporphyrinogen oxidase-GFP chimeric fusion proteins created, N-terminal residues 1-17 were found to be the minimal protoporphyrinogen oxidase sequence required for efficient mitochondrial targeting. Removal of this N-terminal sequence displayed mitochondrial localization, suggesting internal mitochondrial targeting signals. In addition, six constructs were engineered to assess the effect of charge and helicity on mitochondrial targeting of the protein. Of those engineered, only the PPOX20/H20P-GFP construct abolished mitochondrial targeting, presumably through disruption of the protoporphyrinogen oxidase alpha-helix. Based on our results we propose a mechanism for protoporphyrinogen oxidase targeting to the mitochondrion.

  15. Immunoblot analyses of the elicited Sanguinaria canadensis enzyme, dihydrobenzophenanthridine oxidase: evidence for resolution from a polyphenol oxidase isozyme.


    Ignatov, A; Neuman, M C; Barg, R; Krueger, R J; Coscia, C J


    In our initial purification of dihydrobenzophenanthridine oxidase from Sanguinaria canadensis plant cell cultures, we reported that our most purified preparations contained a major band at 77 kDa and minor lower Mr bands. Here we present evidence on highly purified dihydrobenzophenanthridine oxidase from elicited S. canadensis cultures to indicate that this enzyme is the 77-kDa protein and that lower Mr bands include an isozyme(s) of the polyphenol oxidase family that copurifies with it. An antibody raised against the 77-kDa protein and an anti-polyphenol oxidase antibody that recognizes a 70-kDa band were used to monitor chromatographic fractions by immunoblot analysis of the oxidases. Oxidase-containing eluates from DEAE-Sephadex, CM, and HiTrap blue were compared to corresponding flow-through fractions. Bands at 77 and 88 kDa were detected with anti-dihydrobenzophenanthridine oxidase antibody in eluates displaying high dihydrobenzophenanthridine oxidase activity. Polyphenol oxidase specific activity and immunoreactivity partitioned both in flow-through and eluate fractions of the CM and HiTrap columns. Estimation of the dihydrobenzophenanthridine oxidase and polyphenol oxidase specific activities for each step showed increasing enrichment of alkaloidal enzyme accompanied by variable dihydrobenzophenanthridine oxidase/polyphenol oxidase activity ratios. Taken together these observations indicate that the dihydrobenzophenanthridine and polyphenol oxidases have Mr values of 77 and 70 kDa, respectively, and the two enzymes are different entities.

  16. Assessing the effects of heavy metals in ACC deaminase and IAA production on plant growth-promoting bacteria.


    Carlos, Mendoza-Hernández José; Stefani, Perea-Vélez Yazmin; Janette, Arriola-Morales; Melani, Martínez-Simón Sara; Gabriela, Pérez-Osorio


    This study poses a methodology in order to simultaneously quantify ACC deaminase and IAA levels in the same culture medium. Ten bacterial strains isolated from plant rhizosphere naturally settled in mining residues were chosen. These bacterial strains were characterized as PGPB, and all of them showed at least three characteristics (indole-3 acetic acid and siderophore production, ACC deaminase enzyme activity, and inorganic phosphate solubilization). Taxonomic identification showed that the strains belong to Enterobacter, Serratia, Klebsiella, and Escherichia genera. Similarly, both the ACC deaminase enzyme activity and the IAA synthesis in the presence of Cu, As, Pb, Ni, Cd, and Mn were measured. The results showed that both the ACC deaminase enzyme activity and the IAA synthesis were higher with the Pb, As, and Cu treatments than with the Escherichia N16, Enterobacter K131, Enterobacter N9, and Serratia K120 control treatments. On the other hand, Ni, Cd, and Mn negatively affected both the ACC deaminase enzyme activity and the IAA production on every bacterium except on the Klebsiella Mc173 strain. Serratia K120 bacterium got a positive correlation between ACC deaminase and IAA in the presence of every heavy metal, and it also promoted Helianthus annuus plant growth, showing a potential use in phytoremediation systems.

  17. Assessing the effects of heavy metals in ACC deaminase and IAA production on plant growth-promoting bacteria.


    Carlos, Mendoza-Hernández José; Stefani, Perea-Vélez Yazmin; Janette, Arriola-Morales; Melani, Martínez-Simón Sara; Gabriela, Pérez-Osorio


    This study poses a methodology in order to simultaneously quantify ACC deaminase and IAA levels in the same culture medium. Ten bacterial strains isolated from plant rhizosphere naturally settled in mining residues were chosen. These bacterial strains were characterized as PGPB, and all of them showed at least three characteristics (indole-3 acetic acid and siderophore production, ACC deaminase enzyme activity, and inorganic phosphate solubilization). Taxonomic identification showed that the strains belong to Enterobacter, Serratia, Klebsiella, and Escherichia genera. Similarly, both the ACC deaminase enzyme activity and the IAA synthesis in the presence of Cu, As, Pb, Ni, Cd, and Mn were measured. The results showed that both the ACC deaminase enzyme activity and the IAA synthesis were higher with the Pb, As, and Cu treatments than with the Escherichia N16, Enterobacter K131, Enterobacter N9, and Serratia K120 control treatments. On the other hand, Ni, Cd, and Mn negatively affected both the ACC deaminase enzyme activity and the IAA production on every bacterium except on the Klebsiella Mc173 strain. Serratia K120 bacterium got a positive correlation between ACC deaminase and IAA in the presence of every heavy metal, and it also promoted Helianthus annuus plant growth, showing a potential use in phytoremediation systems. PMID:27296962

  18. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus).


    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo


    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  19. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    PubMed Central

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo


    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  20. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang


    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  1. Xanthine oxidase inhibitors from Brandisia hancei.


    Kong, L D; Wolfender, J L; Cheng, C H; Hostettmann, K; Tan, R X


    Xanthine oxidase is a key enzyme associated with the incidence of hyperuricemia-related disorders. Repeated chromatography of the enzyme inhibitory part of the water extract of the twigs and leaves of Brandisia hancei (Scrophulariaceae) gave a flavone luteolin, an iridoid glycoside mussaenoside, two beta-sitosterol glycosides daucosterol and beta-sitosterol gentiobioside, and five phenylethanoids arenarioside, brandioside, acteoside, 2'-O-acetylacteoside and isoacteoside. Luteolin and isoacteoside inhibited the xanthine oxidase (XO, EC with the IC50 values at 7.83 and 45.48 microM, respectively. Isoacteoside was found to be the first phenylethanoid that decreased substantially the formation of uric acid by inhibiting competitively xanthine oxidase (Ki value: 10.08 microM). Furthermore, the study suggested that the caffeoylation of the 6'-hydroxyl group of the phenylethanoids was essential for the enzyme inhibitory action.

  2. ALTERNATIVE OXIDASE: From Gene to Function.


    Vanlerberghe, Greg C.; McIntosh, Lee


    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  3. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata


    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  4. Capteurs monopodes pour mesures accélérométriques

    NASA Astrophysics Data System (ADS)

    Delaite, R.; Valentin, J.-P.


    A new design for accelerometric measurements sensors is described. It uses a plate vibrating in thickness shear mode, maintained by the means of a single holder located at the crystal edge. This mounting does cancel the mechanical and thermal stresses which generally modify the sensor output signal. So the ratio signal/noise of a thickness shear accelerometer is improved and the intrinsic sensitivity is multiplied by a factor 40, by comparison with the sensitivity of a thickness shear plate bonded by the means of two opposite holders. Un nouveau dispositif destiné aux mesures d'accélération est présenté. Il met en œuvre une lame vibrant en cisaillement d'épaisseur, fixée à sa structure de maintien par l'intermédiaire d'une unique liaison. Ce montage permet d'éliminer les contraintes mécaniques et thermiques qui perturbent habituellement le signal de mesure, et qui sont liées soit au montage des éléments du capteur, soit aux variations rapides de température qui interviennent lors de la mise en fonctionnement du capteur. Le rapport signal/bruit d'un accéléromètre à lame vibrant en cisaillement d'épaisseur s'en trouve amélioré et la sensibilité à l'accélération est multipliée par un facteur 40, comparée à celle d'un capteur qui serait constitué d'une lame vibrant en cisaillement d'épaisseur, fixée par deux liaisons diamétralement opposées.

  5. BACCHUS: Brussels Automatic Code for Characterizing High accUracy Spectra

    NASA Astrophysics Data System (ADS)

    Masseron, Thomas; Merle, Thibault; Hawkins, Keith


    BACCHUS (Brussels Automatic Code for Characterizing High accUracy Spectra) derives stellar parameters (Teff, log g, metallicity, microturbulence velocity and rotational velocity), equivalent widths, and abundances. The code includes on the fly spectrum synthesis, local continuum normalization, estimation of local S/N, automatic line masking, four methods for abundance determinations, and a flagging system aiding line selection. BACCHUS relies on the grid of MARCS model atmospheres, Masseron's model atmosphere thermodynamic structure interpolator, and the radiative transfer code Turbospectrum (ascl:1205.004).

  6. Higher Order Modes HOM___s in Coupled Cavities of the Flash Module ACC39

    SciTech Connect

    Shinton, I.R.R.; Jones, R.M.; Li, Z.; Zhang, P.; /Manchester U. /Cockcroft Inst. Accel. Sci. Tech. /DESY


    We analyse the higher order modes (HOM's) in the 3.9GHz bunch shaping cavities installed in the FLASH facility at DESY. A suite of finite element computer codes (including HFSS and ACE3P) and globalised scattering matrix calculations (GSM) are used to investigate the modes in these cavities. This study is primarily focused on the dipole component of the multiband expansion of the wakefield, with the emphasis being on the development of a HOM-based BPM system for ACC39. Coupled inter-cavity modes are simulated together with a limited band of trapped modes.

  7. Runaway transcription

    PubMed Central


    A newly demonstrated defect in RNA polymerase II termination caused by 7SK snRNA knockdown may have revealed a novel mechanism uncoupling RNA processing from transcription. Please see related Research article, PMID:24079702

  8. Involvement of Gluconic Acid and Glucose Oxidase in the Pathogenicity of Penicillium expansum in Apples.


    Hadas, Yoav; Goldberg, Israel; Pines, Ophry; Prusky, Dov


    ABSTRACT The contribution of gluconic acid secretion to the colonization of apple tissue by Penicillium expansum was analyzed by modulation (increase or decrease) of gluconic acid accumulation at the infection court. P. expansum isolates that express the most gox2 transcripts and concomitant glucose oxidase (GOX) activity and that secrete the most gluconic acid cause disease of apple at the fastest rate. Cultures grown under reduced oxygen concentration generated fewer gox2 transcripts, produced less gluconic acid, and led to a 15% reduction in disease. Furthermore, the detection of significantly high levels of transcripts of gox2 and GOX activity at the edge of the decaying tissue emphasize the involvement of GOX in tissue acidification of the decaying tissue. Taken together, these results emphasize the importance of GOX in the production of the gluconic acid that leads, in turn, to host tissue acidification. This acidification enhanced the expression of pectolytic enzymes and the establishment of conditions for necrotrophic development of P. expansum.

  9. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  10. How to achieve performance portable code using OpenACC compiler directives?

    NASA Astrophysics Data System (ADS)

    Lapillonne, Xavier; Fuhrer, Oliver


    In view of adapting the weather and climate model COSMO to future architectures a new version of the model capable of running on graphics processing units (GPUs) has been developed. A large part of the code has been ported using compiler directives based on the OpenACC programming model. In order to achieve the best performance on GPUs several optimizations have been introduced for time critical components, mostly in the so-called physical parameterizations. Some of these modifications unfortunately degrade performance on traditional CPUs. Being a large community code, the COSMO model is required to perform well on both hybrid and CPU-only supercomputers. The current practical solution is to have separate source files for GPU and CPU execution, which may in the long-term result in maintenance issues. Considering the physical parameterization responsible for the atmospheric radiative transfer computations, we first present the restructuring techniques necessary to achieve performance on the GPU. We then show that some parts of the code are compute bound on the CPU while memory bound limited on the GPU, leading to different requirements in terms of optimization. We finally discuss various solutions to achieve a portable and maintainable code, both in terms of possible improvement of the OpenACC standard or in terms of programming strategy.

  11. Various effects of fluorescent bacteria of the genus Pseudomonas containing ACC deaminase on wheat seedling growth.


    Magnucka, Elżbieta G; Pietr, Stanisław J


    The study evaluates the effect of rhizobacteria having 1-aminocyclopropane-1-carboxylate deaminase (ACCd) on the development of wheat seedlings. This enzyme has been proposed to play a key role in microbe-plant association. Three fluorescent pseudomonads containing this deaminase were selected from 70 strains of pseudomonads isolated from rhizosphere of wheat (Triticum aestivum L.) and rape (Brassica napus L.). These bacteria, varied significantly in the ability to both biosynthesize auxins and hydrolyze ACC. Among them, Pseudomonas brassicacearum subsp. brassicacearum strain RZ310 presented the highest activities of ACC deaminase during 96h of growth in liquid Dworkin and Foster (DF) salt medium. Additionally, this rape rhizosphere strain did not produce indoles. Two other isolates, Pseudomonas sp. PO283 and Pseudomonas sp. PO366, secreted auxins only in the presence of their precursor. Phylogenetic analysis of the 16S rRNA gene and four other protein-encoding genes indicated that these wheat rhizosphere isolates belonged to the fluorescent Pseudomonas group. Moreover, the effects of these strains on wheat seedling growth under in vitro conditions were markedly dependent on both their cell suspensions used to grain inoculation and nutrient conditions. Strains tested had beneficial influence on wheat seedlings mainly at low cell densities. In addition, access to nutrients markedly changed bacteria action on cereal growth. Their presence generally favored the positive effects of pseudomonads on length and the estimated biomasses of wheat coleoptiles. Despite these general rules, impacts of each isolate on the growth parameters of cereal seedlings were unique. PMID:25983132

  12. Various effects of fluorescent bacteria of the genus Pseudomonas containing ACC deaminase on wheat seedling growth.


    Magnucka, Elżbieta G; Pietr, Stanisław J


    The study evaluates the effect of rhizobacteria having 1-aminocyclopropane-1-carboxylate deaminase (ACCd) on the development of wheat seedlings. This enzyme has been proposed to play a key role in microbe-plant association. Three fluorescent pseudomonads containing this deaminase were selected from 70 strains of pseudomonads isolated from rhizosphere of wheat (Triticum aestivum L.) and rape (Brassica napus L.). These bacteria, varied significantly in the ability to both biosynthesize auxins and hydrolyze ACC. Among them, Pseudomonas brassicacearum subsp. brassicacearum strain RZ310 presented the highest activities of ACC deaminase during 96h of growth in liquid Dworkin and Foster (DF) salt medium. Additionally, this rape rhizosphere strain did not produce indoles. Two other isolates, Pseudomonas sp. PO283 and Pseudomonas sp. PO366, secreted auxins only in the presence of their precursor. Phylogenetic analysis of the 16S rRNA gene and four other protein-encoding genes indicated that these wheat rhizosphere isolates belonged to the fluorescent Pseudomonas group. Moreover, the effects of these strains on wheat seedling growth under in vitro conditions were markedly dependent on both their cell suspensions used to grain inoculation and nutrient conditions. Strains tested had beneficial influence on wheat seedlings mainly at low cell densities. In addition, access to nutrients markedly changed bacteria action on cereal growth. Their presence generally favored the positive effects of pseudomonads on length and the estimated biomasses of wheat coleoptiles. Despite these general rules, impacts of each isolate on the growth parameters of cereal seedlings were unique.

  13. Waste-ACC: A computer model for radiological analysis of waste management

    SciTech Connect

    Nabelssi, B.K.; Folga, S.; Kohout, E.


    WASTE-ACC, a computational framework and integrated PC-based database system, has been developed by Argonne National Laboratory to assess radiological atmospheric releases from facility accidents in support of the U.S. Department of Energy`s (DOE`s) Waste Management (WM) Programmatic Environmental. Impact Statement, (PEIS). WASTE-ACC facilitates the many calculations required in the accident analyses by the numerous combinations of waste types, treatment technologies, facility locations, and site consolidation strategies in the WM PEIS alternatives for each waste type across the DOE complex. This paper focuses on the computational framework used to assess atmospheric releases and health risk impacts from potential waste management accidents that may affect on-site workers and off-site members of the public. The computational framework accesses several relational databases as needed to calculate radiological releases for the risk dominant accidents. The databases contain throughput volumes, treatment process parameters, radionuclide characteristics, radiological profiles of the waste, site-specific dose conversion factors, and accident data such as frequencies of initiators, conditional probabilities of subsequent events, and source term release parameters of the various waste forms under accident stresses.

  14. The 2013 ACC/AHA Cholesterol Treatment Guidelines: Applicability to Patients with Diabetes.


    Ziaeian, Boback; Dinkler, John; Guo, Yuanlin; Watson, Karol


    Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death worldwide and the management of blood cholesterol is a cornerstone of medical therapy for the primary and secondary prevention of cardiovascular disease. Patients with diabetes represent an important high-risk group in whom clinicians should advocate the use of statins and lifestyle modification for the reduction of ASCVD. The recent 2013 ACC/AHA guidelines on managing blood cholesterol provide an important framework for the effective implementation of this important risk reduction strategy. The guidelines identify four groups of individuals who have been shown to benefit from statin therapy and update the dosing and monitoring recommendations based on evidence from published, large-scale randomized controlled trials (RCTs) with clinical hard endpoints. Primary care physicians and specialists play key roles in identifying populations at elevated ASCVD risk and providing effective care for patients, especially those with diabetes. This article will summarize the 2013 ACC/AHA guidelines on managing blood cholesterol and provide a practical management overview in order to facilitate implementation of these guidelines for patients with diabetes.

  15. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.


    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan


    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  16. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming


    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the AVC-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  17. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming


    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the ACV-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  18. 5th International ACC Symposium: Classification of Adrenocortical Cancers from Pathology to Integrated Genomics: Real Advances or Lost in Translation?


    de Krijger, Ronald E; Bertherat, Jérôme


    For the clinician, despite its rarity, adrenocortical cancer is a heterogeneous tumor both in term of steroid excess and tumor evolution. For patient management, it is crucial to have an accurate vision of this heterogeneity, in order to use a correct tumor classification. Pathology is the best way to classify operated adrenocortical tumors: to recognize their adrenocortical nature and to differentiate benign from malignant tumors. Among malignant tumors pathology also aims at prognosis assessment. Although progress has being made for prognosis assessment, there is still a need for improvement. Recent studies have established the value of Ki67 for adrenocortical cancer (ACC) prognostication, aiming also at standardization to reduce variability. The use of genomics to study adrenocortical tumors gives a very new insight in their pathogenesis and molecular classification. Genomics studies of ACC give now a clear description of the mRNA (transcriptome) and miRNA expression profile, as well as chromosomal and methylation alterations. Exome sequencing also established firmly the list of the main ACC driver genes. Interestingly, genomics study of ACC also revealed subtypes of malignant tumors with different pattern of molecular alterations, associated with different outcome. This leads to a new vision of adrenocortical tumors classification based on molecular analysis. Interestingly, these molecular classifications meet also the results of pathological analysis. This opens new perspectives on the development and use of various molecular tools to classify, along with pathological analysis, ACC, and guides patient management at the area of precision medicine. PMID:26676358

  19. Phylogeny and molecular evolution of the Acc1 gene within the StH genome species in Triticeae (Poaceae).


    Fan, Xing; Sha, Li-Na; Wang, Xiao-Li; Zhang, Hai-Qin; Kang, Hou-Yang; Wang, Yi; Zhou, Yong-Hong


    To estimate the phylogeny and molecular evolution of a single-copy gene encoding plastid acetyl-CoA carboxylase (Acc1) within the StH genome species, two Acc1 homoeologous sequences were isolated from nearly all the sampled StH genome species and were analyzed with those from 35 diploid taxa representing 19 basic genomes in Triticeae. Sequence diversity patterns and genealogical analysis suggested that (1) the StH genome species from the same areas or neighboring geographic regions are closely related to each other; (2) the Acc1 gene sequences of the StH genome species from North America and Eurasia are evolutionarily distinct; (3) Dasypyrum has contributed to the nuclear genome of Elymus repens and Elymus mutabilis; (4) the StH genome polyploids have higher levels of sequence diversity in the H genome homoeolog than the St genome homoeolog; and (5) the Acc1 sequence may evolve faster in the polyploid species than in the diploids. Our result provides some insight on evolutionary dynamics of duplicate Acc1 gene, the polyploidy speciation and phylogeny of the StH genome species.

  20. Extracellular oxidases of the lignin-degrading fungus Panus tigrinus.


    Cadimaliev, D A; Revin, V V; Atykyan, N A; Samuilov, V D


    Two extracellular oxidases (laccases) were isolated from the extracellular fluid of the fungus Panus (Lentinus) tigrinus cultivated in low-nitrogen medium supplemented with birch sawdust. The enzymes were purified by successive chromatography on columns with TEAE-cellulose and DEAE-Toyopearl 650M. Both oxidases catalyze oxidation of pyrocatechol and ABTS. Moreover, oxidase 1 also catalyzes oxidation of guaiacol, o-phenylenediamine, and syringaldazine. The enzymes have identical pH (7.0) and temperature (60-65 degrees C) optimums. Absorption spectra of the oxidases differ from the spectra of typical "blue" laccases and are similar to the spectrum of yellow oxidase. PMID:16038613

  1. The effect of native and ACC deaminase-containing Azospirillum brasilense Cd1843 on the rooting of carnation cuttings.


    Li, Qiaosi; Saleh-Lakha, Saleema; Glick, Bernard R


    Carnation cuttings treated with non-transformed and 1-aminocyclopropane (ACC) deaminase-containing Azospirillum brasilense Cd1843 produced significantly more roots than untreated controls and fewer roots than cuttings treated with 0.1% indolebutyric acid (IBA). The roots produced by cuttings treated with ACC deaminase-containing Azospirillum brasilense Cd1843 were the longest roots resulting from any of the treatments, followed by non-transformed Azospirillum brasilense Cd1843, 0.1% IBA, and treatment with water. The results are interpreted in terms of a previously proposed model of bacterial promotion of plant growth by ACC deaminase and indoleacetic acid, and may have implications for the use of plant growth-promoting bacteria in the flower industry. PMID:16121231

  2. Coexistence of two forms of LTP in ACC provides a synaptic mechanism for the interactions between anxiety and chronic pain.


    Koga, Kohei; Descalzi, Giannina; Chen, Tao; Ko, Hyoung-Gon; Lu, Jinshan; Li, Shermaine; Son, Junehee; Kim, TaeHyun; Kwak, Chuljung; Huganir, Richard L; Zhao, Ming-Gao; Kaang, Bong-Kiun; Collingridge, Graham L; Zhuo, Min


    Chronic pain can lead to anxiety and anxiety can enhance the sensation of pain. Unfortunately, little is known about the synaptic mechanisms that mediate these re-enforcing interactions. Here we characterized two forms of long-term potentiation (LTP) in the anterior cingulate cortex (ACC); a presynaptic form (pre-LTP) that requires kainate receptors and a postsynaptic form (post-LTP) that requires N-methyl-D-aspartate receptors. Pre-LTP also involves adenylyl cyclase and protein kinase A and is expressed via a mechanism involving hyperpolarization-activated cyclic nucleotide-gated (HCN) channels. Interestingly, chronic pain and anxiety both result in selective occlusion of pre-LTP. Significantly, microinjection of the HCN blocker ZD7288 into the ACC in vivo produces both anxiolytic and analgesic effects. Our results provide a mechanism by which two forms of LTP in the ACC may converge to mediate the interaction between anxiety and chronic pain. PMID:25556835

  3. Zonal Variations of Eddy Diffusivities in an ACC-like Channel: Discrete Transport Corridors.

    NASA Astrophysics Data System (ADS)

    Lazar, A.; Thompson, A. F.


    The meridional overturning circulation in a wind-driven re-entrant channel arises from a balance between an Eulerian mean overturning and an eddy overturning. These cancel to leading order in the Southern Ocean's Antarctic Circumpolar Current (ACC). An ACC-like flow, with realistic stratification, zonal transport and distributions of eddy kinetic energy, develops even when these two overturning components cancel completely. Many studies have noted that an enhancement of the Eulerian overturning circulation, which tends to steepen isopycnals, is balanced in part by an enhancement of the eddy circulation that relaxes isopycnal tilt. Thus the domain-averaged isopycnal slope and zonal transport are relatively insensitive to changes in wind forcing. However, the response of the system's mesoscale variability and eddy fluxes is not uniform throughout the domain. We present a process study of an idealized eddy-resolving ACC-like channel with negligible residual overturning to explore how the along-stream distribution of eddy characteristics establishes a balance between wind and eddy overturning circulations. For each simulation, we decompose the overturning circulation into mean, standing and transient components. As the surface wind stress increases, the standing component balances a larger portion of the mean overturning. This in turn leads to an increasing departure from zonally-symmetric eddy characteristics. A zonal-mean, or net, eddy diffusivity Κnet is defined as the eddy diffusivity required to exactly balance the mean overturning based on the zonal-mean isopycnal slope, s. This gives Κnet=τ/ρ0fs, where τ is the wind stress, ρ0 is a reference density and f is the Coriolis parameter. Κnet is compared to local eddy diffusivities, Κlocal, diagnosed directly from the divergent component of the eddy buoyancy flux divided by the local isopycnal slope. We find that with a simple topographic ridge and moderate wind forcing, along-stream averages of

  4. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa


    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  5. Lysyl oxidase isoforms in gastric cancer.


    Añazco, Carolina; Delgado-López, Fernando; Araya, Paulina; González, Ileana; Morales, Erik; Pérez-Castro, Ramón; Romero, Jacqueline; Rojas, Armando


    Gastric cancer (GC) is the fifth most frequent cancer in the world and shows the highest incidence in Latin America and Asia. An increasing amount of evidence demonstrates that lysyl oxidase isoforms, a group of extracellular matrix crosslinking enzymes, should be considered as potential biomarkers and therapeutic targets in GC. In this review, we focus on the expression levels of lysyl oxidase isoforms, its functions and the clinical implications in GC. Finding novel proteins related to the processing of these extracellular matrix enzymes might be helpful in the design of new therapies, which, in combination with classic pharmacology, could be used to delay the progress of this aggressive cancer and offer a wider temporal window for clinical intervention. PMID:27564724

  6. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  7. Monoamine oxidase inhibitors from Gentiana lutea.


    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira


    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  8. [2013 Guidelines ACC/AHA cardiovascular risk. Incomplete evidence and failed attempt at simplification].


    Corral, Pablo


    After almost a decade, finally Guidelines for the management of hypercholesterolemia in adults by the AHA/ACC were published. The substantial change in the paradigm of this new recommendation is the treatment decision basically statin, based on a recalculation of cardiovascular risk. Four groups were identified and based on them different statins indication, according to the power applied. As is apparent, have been used only randomized clinical trials (RCT) as the sole basis for the drafting of these new guidelines. Two basic issues are reviewed and revised in the following article: leaving aside other types of evidence to generate the recommendation and on the other hand the attempt to simplify the interpretation and management of this condition. We stress the need for any recommendation to clinical reasoning to interpret different scenarios involved in each patient. PMID:25496959

  9. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.


    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey


    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  10. [2013 Guidelines ACC/AHA cardiovascular risk. Incomplete evidence and failed attempt at simplification].


    Corral, Pablo


    After almost a decade, finally Guidelines for the management of hypercholesterolemia in adults by the AHA/ACC were published. The substantial change in the paradigm of this new recommendation is the treatment decision basically statin, based on a recalculation of cardiovascular risk. Four groups were identified and based on them different statins indication, according to the power applied. As is apparent, have been used only randomized clinical trials (RCT) as the sole basis for the drafting of these new guidelines. Two basic issues are reviewed and revised in the following article: leaving aside other types of evidence to generate the recommendation and on the other hand the attempt to simplify the interpretation and management of this condition. We stress the need for any recommendation to clinical reasoning to interpret different scenarios involved in each patient.

  11. Reward sensitivity modulates brain activity in the prefrontal cortex, ACC and striatum during task switching.


    Fuentes-Claramonte, Paola; Ávila, César; Rodríguez-Pujadas, Aina; Ventura-Campos, Noelia; Bustamante, Juan C; Costumero, Víctor; Rosell-Negre, Patricia; Barrós-Loscertales, Alfonso


    Current perspectives on cognitive control acknowledge that individual differences in motivational dispositions may modulate cognitive processes in the absence of reward contingencies. This work aimed to study the relationship between individual differences in Behavioral Activation System (BAS) sensitivity and the neural underpinnings involved in processing a switching cue in a task-switching paradigm. BAS sensitivity was hypothesized to modulate brain activity in frontal regions, ACC and the striatum. Twenty-eight healthy participants underwent fMRI while performing a switching task, which elicited activity in fronto-striatal regions during the processing of the switch cue. BAS sensitivity was negatively associated with activity in the lateral prefrontal cortex, anterior cingulate cortex and the ventral striatum. Combined with previous results, our data indicate that BAS sensitivity modulates the neurocognitive processes involved in task switching in a complex manner depending on task demands. Therefore, individual differences in motivational dispositions may influence cognitive processing in the absence of reward contingencies.

  12. Reward Sensitivity Modulates Brain Activity in the Prefrontal Cortex, ACC and Striatum during Task Switching

    PubMed Central

    Fuentes-Claramonte, Paola; Ávila, César; Rodríguez-Pujadas, Aina; Ventura-Campos, Noelia; Bustamante, Juan C.; Costumero, Víctor; Rosell-Negre, Patricia; Barrós-Loscertales, Alfonso


    Current perspectives on cognitive control acknowledge that individual differences in motivational dispositions may modulate cognitive processes in the absence of reward contingencies. This work aimed to study the relationship between individual differences in Behavioral Activation System (BAS) sensitivity and the neural underpinnings involved in processing a switching cue in a task-switching paradigm. BAS sensitivity was hypothesized to modulate brain activity in frontal regions, ACC and the striatum. Twenty-eight healthy participants underwent fMRI while performing a switching task, which elicited activity in fronto-striatal regions during the processing of the switch cue. BAS sensitivity was negatively associated with activity in the lateral prefrontal cortex, anterior cingulate cortex and the ventral striatum. Combined with previous results, our data indicate that BAS sensitivity modulates the neurocognitive processes involved in task switching in a complex manner depending on task demands. Therefore, individual differences in motivational dispositions may influence cognitive processing in the absence of reward contingencies. PMID:25875640

  13. Reward sensitivity modulates brain activity in the prefrontal cortex, ACC and striatum during task switching.


    Fuentes-Claramonte, Paola; Ávila, César; Rodríguez-Pujadas, Aina; Ventura-Campos, Noelia; Bustamante, Juan C; Costumero, Víctor; Rosell-Negre, Patricia; Barrós-Loscertales, Alfonso


    Current perspectives on cognitive control acknowledge that individual differences in motivational dispositions may modulate cognitive processes in the absence of reward contingencies. This work aimed to study the relationship between individual differences in Behavioral Activation System (BAS) sensitivity and the neural underpinnings involved in processing a switching cue in a task-switching paradigm. BAS sensitivity was hypothesized to modulate brain activity in frontal regions, ACC and the striatum. Twenty-eight healthy participants underwent fMRI while performing a switching task, which elicited activity in fronto-striatal regions during the processing of the switch cue. BAS sensitivity was negatively associated with activity in the lateral prefrontal cortex, anterior cingulate cortex and the ventral striatum. Combined with previous results, our data indicate that BAS sensitivity modulates the neurocognitive processes involved in task switching in a complex manner depending on task demands. Therefore, individual differences in motivational dispositions may influence cognitive processing in the absence of reward contingencies. PMID:25875640

  14. Increased xanthine oxidase in the skin of preeclamptic women.


    Bainbridge, Shannon A; Deng, Jau-Shyong; Roberts, James M


    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened proinflammatory cytokine production, this enzyme is preferentially in its oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress, and hyperuricemia, it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from nonpregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggests maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia.

  15. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)


    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  16. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  17. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  18. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.


    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen


    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  19. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.


    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P


    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  20. Characterization of the acc operon from the nopaline-type Ti plasmid pTiC58, which encodes utilization of agrocinopines A and B and susceptibility to agrocin 84.


    Kim, H; Farrand, S K


    The acc locus from the Ti plasmid pTiC58 confers utilization of and chemotaxis toward agrocinopines A and B (A+B), as well as susceptibility to a highly specific antiagrobacterial antibiotic, agrocin 84. DNA sequence analyses revealed that acc is composed of eight open reading frames, accR and accA through accG. Previous work showed that accR encodes the repressor which regulates this locus, and accA codes for the periplasmic binding protein of the agrocinopine transport system (S. Beck Von Bodman, G. T. Hayman, and S. K. Farrand, Proc. Natl. Acad. Sci. USA 89:643-647, 1992; G. T. Hayman, S. Beck Von Bodman, H. Kim, P. Jiang, and S. K. Farrand, J. Bacteriol. 175:5575-5584, 1993). The predicted proteins from accA through accE, as a group, have homology to proteins that belong to the ABC-type transport system superfamily. The predicted product of accF is related to UgpQ of Escherichia coli, which is a glycerophosphoryl diester phosphodiesterase, and also to agrocinopine synthase coded for by acs located on the T-DNA. The translated product of accG is related to myoinositol 1 (or 4) monophosphatases from various eucaryotes. Analyses of insertion mutations showed that accA through accE are required for transport of both agrocin 84 and agrocinopines A+B, while accF and accG are required for utilization of the opines as the sole source of carbon. Mutations in accF or accG did not abolish transport of agrocin 84, although we observed slower removal of the antibiotic from the medium by the accF mutant compared to the wild type. However, the insertion mutation in accF abolished detectable uptake of agrocinopines A+B. A mutation in accG had no effect on transport of the opines. The accF mutant was not susceptible to agrocin 84 although it took up the antibiotic. This finding suggests that agrocin 84 is activated by AccF after being transported into the bacterial cell. PMID:9393724

  1. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

    PubMed Central

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.


    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426

  2. cDNA cloning and expression of potato polyphenol oxidase.


    Hunt, M D; Eannetta, N T; Yu, H; Newman, S M; Steffens, J C


    Polyphenol oxidases (PPOs) of plants are copper metalloproteins which catalyze the oxidation of mono- and o-diphenols to o-diquinones. Although PPOs are believed to be primarily responsible for the deleterious browning of many fruit and vegetable crops and are thought to be involved in plant-pest interactions, direct evidence for these roles is lacking. We report the cloning of two PPO cDNAs from Solanum tuberosum leaves. These cDNAs exhibit 97% and 98% sequence similarity at the DNA and deduced amino acid levels, respectively. Putative copper-binding regions of both cDNAs are very similar to those of mammalian, bacterial and Neurospora tyrosinases. Both leaf PPO cDNAs appear to encode polypeptides which are processed to a mature molecular weight of 57,000. In potato leaves, petioles, roots, and flowers, PPO is encoded by ca. 2 kb transcripts. Leaf PPO mRNA is developmentally regulated and only detectable in young foliage. In contrast, the protein profile of immunologically detectable PPO remains constant from the apical node through the eleventh leaf node. PMID:7678763

  3. Brain monoamine oxidase A activity predicts trait aggression.


    Alia-Klein, Nelly; Goldstein, Rita Z; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D; Fowler, Joanna S


    The genetic deletion of monoamine oxidase A (MAO A), an enzyme that breaks down the monoamine neurotransmitters norepinephrine, serotonin, and dopamine, produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, Mendelian Inheritance in Men database number 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in vivo in healthy nonsmoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the multidimensional personality questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions, the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than one-third of the variability. Because trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  4. Lysyl oxidase-like-2 (LOXL2) is a major isoform in chondrocytes and is critically required for differentiation.


    Iftikhar, Mussadiq; Hurtado, Paola; Bais, Manish V; Wigner, Nate; Stephens, Danielle N; Gerstenfeld, Louis C; Trackman, Philip C


    The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation.

  5. Improved Performance of an Air Cooled Condenser (ACC) Using SPX Wind Guide Technology at Coal-Based Thermoelectric Power Plants

    SciTech Connect

    Ken Mortensen


    This project added a new airflow enhancement technology to an existing ACC cooling process at a selected coal power plant. Airflow parameters and efficiency improvement for the main plant cooling process using the applied technology were determined and compared with the capabilities of existing systems. The project required significant planning and pre-test execution in order to reach the required Air Cooled Condenser system configuration for evaluation. A host Power Plant ACC system had to be identified, agreement finalized, and addition of the SPX ACC Wind Guide Technology completed on that site. Design of the modification, along with procurement, fabrication, instrumentation, and installation of the new airflow enhancement technology were executed. Baseline and post-modification cooling system data was collected and evaluated. The improvement of ACC thermal performance after SPX wind guide installation was clear. Testing of the improvement indicates there is a 5% improvement in heat transfer coefficient in high wind conditions and 1% improvement at low wind speed. The benefit increased with increasing wind speed. This project was completed on schedule and within budget.

  6. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression Is Moderated by dACC Reactivity to Rejection.


    Chester, David S; DeWall, C Nathan


    Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissists' motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Thirty participants (15 females; Mage  = 18.86, SD = 1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively toward one of the rejecters by blasting him or her with unpleasant noise. When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Narcissism's role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain's discrepancy detector registers the newly created gap between the grandiose and threatened selves.

  7. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2013 CFR


    ... 24 Housing and Urban Development 4 2013-04-01 2013-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  8. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2014 CFR


    ... 24 Housing and Urban Development 4 2014-04-01 2014-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  9. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2012 CFR


    ... 24 Housing and Urban Development 4 2012-04-01 2012-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  10. The human ACC2 CT-domain C-terminus is required for full functionality and has a novel twist

    SciTech Connect

    Madauss, Kevin P.; Burkhart, William A.; Consler, Thomas G.; Cowan, David J.; Gottschalk, William K.; Miller, Aaron B; Short, Steven A.; Tran, Thuy B.; Williams, Shawn P.


    Inhibition of acetyl-CoA carboxylase (ACC) may prevent lipid-induced insulin resistance and type 2 diabetes, making the enzyme an attractive pharmaceutical target. Although the enzyme is highly conserved amongst animals, only the yeast enzyme structure is available for rational drug design. The use of biophysical assays has permitted the identification of a specific C-terminal truncation of the 826-residue human ACC2 carboxyl transferase (CT) domain that is both functionally competent to bind inhibitors and crystallizes in their presence. This C-terminal truncation led to the determination of the human ACC2 CT domain-CP-640186 complex crystal structure, which revealed distinctions from the yeast-enzyme complex. The human ACC2 CT-domain C-terminus is comprised of three intertwined -helices that extend outwards from the enzyme on the opposite side to the ligand-binding site. Differences in the observed inhibitor conformation between the yeast and human structures are caused by differing residues in the binding pocket.

  11. Basement membrane heparan sulfate proteoglycan (perlecan) synthesized by ACC3, adenoid cystic carcinoma cells of human salivary gland origin.


    Kimura, S; Cheng, J; Toyoshima, K; Oda, K; Saku, T


    The biosynthesis of basement membrane heparan sulfate proteoglycan (HSPG), known as perlecan, in ACC3 cells established from a adenoid cystic carcinoma of the human salivary gland was studied using metabolic labeling and immunoprecipitation with discriminative antibodies specific for HSPG core protein. Treatment of immunoprecipitated HSPG with HNO2, heparitinase, and chondroitinase ABC revealed that ACC3 cells synthesized HSPG molecules composed of 470-kDa core protein and heparan sulfate but not of chondroitin sulfate. The core protein was shown to contain complex type N-linked oligosaccharides by digestion with N-glycanase and endoglycosidase H. Pulse-chase experiments showed that the mature form of HSPG was formed in the cells in 30 min and released into the medium thereafter. Degradation of HSPG was also found in the chase period of 3 h. In time course experiments, HSPG was found to be synthesized maximally at day 4 after plating, deposited in the cell layer maximally at day 6, and secreted maximally at day 8. This was also confirmed by immunofluorescence, Northern blotting, and in-situ hybridization. The results indicate that ACC3 cells synthesize, secrete and degrade basement membrane type HSPG, which is analogous to those produced by other cell types, and that the biosynthesis and secretion of HSPG in ACC3 cells are strictly regulated by the cell growth, that may be reflected in the characteristic histology of adenoid cystic carcinomas. PMID:9990141

  12. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia


    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  13. Expression of recombinant AccMRJP1 protein from royal jelly of Chinese honeybee in Pichia pastoris and its proliferation activity in an insect cell line

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Main royal jelly protein 1 (MRJP1) is the most abundant member of the main royal jelly protein (MRJP) family among honeybees. Mature MRJP1 cDNA of the Chinese honeybee (Apis cerana cerana MRJP1, or AccMRJP1) was expressed in Pichia pastoris. SDS-PAGE showed that recombinant AccMRJP1 was identical in...

  14. In vitro antimalarial and xanthine oxidase inhibition of 2-Aminoanthraquinone.


    Rauf, Abdur; Khan, Rehan; Khan, Haroon; Jehan, Noor; Akram, Mohammad; Ahmad, Zarka; Muhammad, Naveed; Farooq, Umar; Khan, Ajmal


    In the present research study 2-Aminoanthraquinone were scrutinized for their antimalarial and Xanthine oxidase inhibitor potential. It demonstrated marked concentration dependent antimalarial activity with maximum effect of 89.06% and with IC50 of 34.17 µM. Regarding Xanthine oxidase inhibitor activity, it evoked significant effect with 57.45% activity with IC50 value of 81.57.19 μM. In conclusion, 2-Aminoanthraquinone showed potent antimalarial and xanthine oxidase inhibitory activity. PMID:27087090

  15. Gram-scale, low-cost, rapid synthesis of highly stable Mg-ACC nanoparticles and their long-term preservation

    NASA Astrophysics Data System (ADS)

    Jiang, Jun; Gao, Min-Rui; Qiu, Yun-Hao; Yu, Shu-Hong


    A simple chemistry route is reported for the gram-scale, low-cost, rapid synthesis of highly stable Mg-ACC nanoparticles. The possible structure of Mg-ACC can be defined as Mg0.15Ca0.85CO3.H2O0.85. The molar ratio of Mg2+:Ca2+:CO32- and the concentrations of the reactants (CaCl2, Na2CO3, and MgCl2) play important roles in the Mg:Ca molar ratio of the obtained Mg-ACC nanoparticles. In particular, Mg-ACC can be preserved for over one year without crystallization by either storing its dry powder at -5 °C or storing it in ethanol at 5 °C. The ability to synthesize Mg-ACC nanoparticles on a large scale is useful for biomineralization studies and industrial applications.

  16. Gram-scale, low-cost, rapid synthesis of highly stable Mg-ACC nanoparticles and their long-term preservation.


    Jiang, Jun; Gao, Min-Rui; Qiu, Yun-Hao; Yu, Shu-Hong


    A simple chemistry route is reported for the gram-scale, low-cost, rapid synthesis of highly stable Mg-ACC nanoparticles. The possible structure of Mg-ACC can be defined as Mg₀.₁₅Ca₀.₈₅CO₃·H₂O₀.₈₅. The molar ratio of Mg²(+):Ca²(+):CO₃²⁻and the concentrations of the reactants (CaCl₂, Na₂CO₃, and MgCl₂) play important roles in the Mg:Ca molar ratio of the obtained Mg-ACC nanoparticles. In particular, Mg-ACC can be preserved for over one year without crystallization by either storing its dry powder at -5°C or storing it in ethanol at 5°C. The ability to synthesize Mg-ACC nanoparticles on a large scale is useful for biomineralization studies and industrial applications.

  17. Crystal Structure of a Two-domain Multicopper Oxidase

    PubMed Central

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.


    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 Å resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases. PMID:19224923

  18. Effects of wintertime fasting and seasonal adaptation on AMPK and ACC in hypothalamus, adipose tissue and liver of the raccoon dog (Nyctereutes procyonoides).


    Kinnunen, Sanni; Mänttäri, Satu; Herzig, Karl-Heinz; Nieminen, Petteri; Mustonen, Anne-Mari; Saarela, Seppo


    The raccoon dog (Nyctereutes procyonoides) is a canid with autumnal fattening and passive wintering strategy. We examined the effects of wintertime fasting and seasonality on AMP-activated protein kinase (AMPK), a regulator of metabolism, and its target, acetyl-CoA carboxylase (ACC) on the species. Twelve farmed raccoon dogs (eleven females/one male) were divided into two groups: half were fasted for ten weeks in December-March (winter fasted) and the others were fed ad libitum (winter fed). A third group (autumn fed, eight females) was fed ad libitum and sampled in December. Total AMPK, ACC and their phosphorylated forms (pAMPK, pACC) were measured from hypothalamus, liver, intra-abdominal (iWAT) and subcutaneous white adipose tissues (sWAT). The fasted animals lost 32% and the fed 20% of their body mass. Hypothalamic AMPK expression was lower and pACC levels higher in the winter groups compared to the autumn fed group. Liver pAMPK was lower in the winter fasted group, with consistently decreased ACC and pACC. AMPK and pAMPK were down-regulated in sWAT and iWAT of both winter groups, with a parallel decline in pACC in sWAT. The responses of AMPK and ACC to fasting were dissimilar to the effects observed previously in non-seasonal mammals and hibernators. Differences between the winter fed and autumn fed groups indicate that the functions of AMPK and ACC could be regulated in a season-dependent manner. Furthermore, the distinctive effects of prolonged fasting and seasonal adaptation on AMPK-ACC pathway could contribute to the wintering strategy of the raccoon dog. PMID:26603554

  19. Effects of wintertime fasting and seasonal adaptation on AMPK and ACC in hypothalamus, adipose tissue and liver of the raccoon dog (Nyctereutes procyonoides).


    Kinnunen, Sanni; Mänttäri, Satu; Herzig, Karl-Heinz; Nieminen, Petteri; Mustonen, Anne-Mari; Saarela, Seppo


    The raccoon dog (Nyctereutes procyonoides) is a canid with autumnal fattening and passive wintering strategy. We examined the effects of wintertime fasting and seasonality on AMP-activated protein kinase (AMPK), a regulator of metabolism, and its target, acetyl-CoA carboxylase (ACC) on the species. Twelve farmed raccoon dogs (eleven females/one male) were divided into two groups: half were fasted for ten weeks in December-March (winter fasted) and the others were fed ad libitum (winter fed). A third group (autumn fed, eight females) was fed ad libitum and sampled in December. Total AMPK, ACC and their phosphorylated forms (pAMPK, pACC) were measured from hypothalamus, liver, intra-abdominal (iWAT) and subcutaneous white adipose tissues (sWAT). The fasted animals lost 32% and the fed 20% of their body mass. Hypothalamic AMPK expression was lower and pACC levels higher in the winter groups compared to the autumn fed group. Liver pAMPK was lower in the winter fasted group, with consistently decreased ACC and pACC. AMPK and pAMPK were down-regulated in sWAT and iWAT of both winter groups, with a parallel decline in pACC in sWAT. The responses of AMPK and ACC to fasting were dissimilar to the effects observed previously in non-seasonal mammals and hibernators. Differences between the winter fed and autumn fed groups indicate that the functions of AMPK and ACC could be regulated in a season-dependent manner. Furthermore, the distinctive effects of prolonged fasting and seasonal adaptation on AMPK-ACC pathway could contribute to the wintering strategy of the raccoon dog.

  20. Successful treatment of c-kit-positive metastatic Adenoid Cystic Carcinoma (ACC) with a combination of curcumin plus imatinib: A case report.


    Demiray, M; Sahinbas, H; Atahan, S; Demiray, H; Selcuk, D; Yildirim, I; Atayoglu, A T


    Adenoid cystic carcinoma (ACC) is an aggressive malignant neoplasm of the secretory glands. Conventional chemotherapy has poor effectiveness against metastatic ACC. Thus, a novel effective therapy is needed against metastatic ACC. A majority of ACCs (up to 94%) express c-kit. Imatinib is monoclonal antibody with specific activity against c-kit but has not been found to be effective in treating patients with ACC in which c-kit is overexpressed and activated. The NF-κB and mTOR pathways have been shown that ubiquitously and concurrently activated, indicating that the inhibition of these pathways may represent a novel treatment approach for patients with ACC. Curcumin has been shown to inhibit NF-κB and NF-κB-related pathways. 43-year-old patient was diagnosed ACC from submandibular salivary gland. After complete resection of tumor adjuvant radiotherapy was initiated. Seven years later multiple lung metastases were detected and ACC was confirmed by re-biopsy. First-line chemotherapy failed. NF-κB and c-kit were overexpressed in the metastatic specimens. Therefore, we treated the patient with metastatic chemoresistant ACC with imatinib 400mg/day and intravenous curcumin 225mg/m(2) twice a week plus oral bioavailable curcumin Arantal(®) 2×84mg/day. At 24 months, we observed near complete anatomic and complete metabolic response. To our knowledge, this is the first report of a patient with a c-kit-positive ACC that is successfully treated with the combination of imatinib and curcumin in an integrative approach. PMID:27515884

  1. Lysyl oxidase-like 2 deaminates lysine 4 in histone H3.


    Herranz, Nicolás; Dave, Natàlia; Millanes-Romero, Alba; Morey, Lluis; Díaz, Víctor M; Lórenz-Fonfría, Víctor; Gutierrez-Gallego, Ricardo; Jerónimo, Celia; Di Croce, Luciano; García de Herreros, Antonio; Peiró, Sandra


    Methylation of lysine 4 (K4) within histone H3 has been linked to active transcription and is removed by LSD1 and the JmjC domain-containing proteins by amino-oxidation or hydroxylation, respectively. Here, we describe the deamination catalyzed by Lysyl oxidase-like 2 protein (LOXL2) as an unconventional chemical mechanism for H3K4 modification. Infrared spectroscopy and mass spectrometry analyses demonstrated that recombinant LOXL2 specifically deaminates trimethylated H3K4. Moreover, LOXL2 activity is linked with the transcriptional control of CDH1 gene by regulating H3K4me3 deamination. These results reveal another H3 modification and provide a different mechanism for H3K4 modification.

  2. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.


    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  3. Auxin and Ethylene Induce Flavonol Accumulation through Distinct Transcriptional Networks1[C][W][OA

    PubMed Central

    Lewis, Daniel R.; Ramirez, Melissa V.; Miller, Nathan D.; Vallabhaneni, Prashanthi; Ray, W. Keith; Helm, Richard F.; Winkel, Brenda S.J.; Muday, Gloria K.


    Auxin and ethylene are key regulators of plant growth and development, and thus the transcriptional networks that mediate responses to these hormones have been the subject of intense research. This study dissected the hormonal cross talk regulating the synthesis of flavonols and examined their impact on root growth and development. We analyzed the effects of auxin and an ethylene precursor on roots of wild-type and hormone-insensitive Arabidopsis (Arabidopsis thaliana) mutants at the transcript, protein, and metabolite levels at high spatial and temporal resolution. Indole-3-acetic acid (IAA) and 1-aminocyclopropane-1-carboxylic acid (ACC) differentially increased flavonol pathway transcripts and flavonol accumulation, altering the relative abundance of quercetin and kaempferol. The IAA, but not ACC, response is lost in the transport inhibitor response1 (tir1) auxin receptor mutant, while ACC responses, but not IAA responses, are lost in ethylene insensitive2 (ein2) and ethylene resistant1 (etr1) ethylene signaling mutants. A kinetic analysis identified increases in transcripts encoding the transcriptional regulators MYB12, Transparent Testa Glabra1, and Production of Anthocyanin Pigment after hormone treatments, which preceded increases in transcripts encoding flavonoid biosynthetic enzymes. In addition, myb12 mutants were insensitive to the effects of auxin and ethylene on flavonol metabolism. The equivalent phenotypes for transparent testa4 (tt4), which makes no flavonols, and tt7, which makes kaempferol but not quercetin, showed that quercetin derivatives are the inhibitors of basipetal root auxin transport, gravitropism, and elongation growth. Collectively, these experiments demonstrate that auxin and ethylene regulate flavonol biosynthesis through distinct signaling networks involving TIR1 and EIN2/ETR1, respectively, both of which converge on MYB12. This study also provides new evidence that quercetin is the flavonol that modulates basipetal auxin transport

  4. Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.


    Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

  5. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  6. The Chlamydomonas reinhardtii alternative oxidase 1 is regulated by heat stress.


    Zalutskaya, Zhanneta; Lapina, Tatiana; Ermilova, Elena


    The alternative oxidase (AOX) is a non-energy conserving terminal oxidase that has emerged as an important mitochondrial component of the cell stress responses. Although the most studied abiotic condition in relation to Chlamydomonas reinhardtii is high temperature, changes in AOX capacity of the alga were studied only under oxidative stress and cold. To examine whether elevated temperatures affected AOX1 expression, we applied quantitative real-time PCR and pharmaceutical approaches. In this work, we demonstrated a sharp increase in AOX1 transcript and protein abundance under heat stress. Furthermore, C. reinhardtii cells displayed a large increase in alternative respiration in response to high temperature. Feeding with the protein kinase inhibitor staurosporine strongly retarded the AOX1 transcription. Finally, the addition of the calcium chelator EGTA prevented heat-induced AOX1 expression. Together, our results imply that heat-inducible Ca(2+) influx and protein kinase(s) may mediate AOX1 expression at elevated temperatures. Characterization of heat-induced AOX1 regulation in the green alga C. reinhardtii provides a framework for a more complete understanding of the function of this conserved protein.

  7. NADPH Oxidase Promotes Neutrophil Extracellular Trap Formation in Pulmonary Aspergillosis

    PubMed Central

    Röhm, Marc; Grimm, Melissa J.; D'Auria, Anthony C.; Almyroudis, Nikolaos G.


    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47phox−/−) mice which had resolved in wild-type mice by day 5 but progressed in p47phox−/− mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47phox−/− mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  8. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.


    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  9. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  10. A portable platform for accelerated PIC codes and its application to GPUs using OpenACC

    NASA Astrophysics Data System (ADS)

    Hariri, F.; Tran, T. M.; Jocksch, A.; Lanti, E.; Progsch, J.; Messmer, P.; Brunner, S.; Gheller, C.; Villard, L.


    We present a portable platform, called PIC_ENGINE, for accelerating Particle-In-Cell (PIC) codes on heterogeneous many-core architectures such as Graphic Processing Units (GPUs). The aim of this development is efficient simulations on future exascale systems by allowing different parallelization strategies depending on the application problem and the specific architecture. To this end, this platform contains the basic steps of the PIC algorithm and has been designed as a test bed for different algorithmic options and data structures. Among the architectures that this engine can explore, particular attention is given here to systems equipped with GPUs. The study demonstrates that our portable PIC implementation based on the OpenACC programming model can achieve performance closely matching theoretical predictions. Using the Cray XC30 system, Piz Daint, at the Swiss National Supercomputing Centre (CSCS), we show that PIC_ENGINE running on an NVIDIA Kepler K20X GPU can outperform the one on an Intel Sandy bridge 8-core CPU by a factor of 3.4.

  11. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks.

  12. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  13. Endothelins and NADPH oxidases in the cardiovascular system.


    Dammanahalli, Karigowda J; Sun, Zhongjie


    1. The endothelin (ET) system and NADPH oxidase play important roles in the regulation of cardiovascular function, as well as in the pathogenesis of hypertension and other cardiovascular diseases. 2. Endothelins activate NADPH oxidases and thereby increase superoxide production, resulting in oxidative stress and cardiovascular dysfunction. Thus, NADPH oxidases may mediate the role of endothelins in some cardiovascular diseases. However, the role of reactive oxygen species (ROS) in mediating ET-induced vasoconstriction and cardiovascular disease remains under debate, as evidenced by conflicting reports from different research teams. Conversely, activation of NADPH oxidase can stimulate ET secretion via ROS generation, which further enhances the cardiovascular effects of NADPH oxidase. However, little is known about how ROS activate the endothelin system. It seems that the relationship between ET-1 and ROS may vary with cardiovascular disorders. 3. Endothelins activate NADPH oxidase via the ET receptor-proline-rich tyrosine kinase-2 (Pyk2)-Rac1 pathway. Rac1 is an important regulator of NADPH oxidase. There is ample evidence supporting direct stimulation by Rac1 of NADPH oxidase activity. In addition, Rac1-induced cardiomyocyte hypertrophy is mediated by the generation of ROS.

  14. Influence of gossypol acetic acid on the growth of human adenoid cystic carcinoma ACC-M cells and the expression of DNA methyltransferase 1.


    Wu, Y; Wei, Y-N; Yue, W-Y; Chen, W-F; Fu, S


    We investigated the effects of gossypol acetic acid (GAA) on the proliferation, apoptosis, and expression of DNA methyltransferase 1 (DNMT1) mRNA in human adenoid cystic carcinoma (ACC-M) cells in vitro. The proliferation and apoptosis of ACC-M cells after treatment with different concentrations of GAA were detected using Cell Counting Kit-8 and flow cytometry, respectively. DNMT1 mRNA expression was measured by real-time fluorescence quantitative polymerase chain reaction. The growth of ACC-M cells was inhibited after treatment with GAA for 24, 48, and 72 h. The apoptotic rates of ACC-M cells after treatment with GAA for 72 h were higher than those of control cells (without treatment) (P < 0.05). DNMT1 mRNA expression in ACC-M after treatment with GAA for 72 h was lower than that in control cells (P < 0.05). GAA had inhibitory effects on the proliferation and induced apoptosis of human ACC-M cells, while GAA also reduced the expression level of DNMT1 mRNA in ACC-M cells.

  15. Expression of recombinant AccMRJP1 protein from royal jelly of Chinese honeybee in Pichia pastoris and its proliferation activity in an insect cell line.


    Shen, Lirong; Zhang, Weiguang; Jin, Feng; Zhang, Liwen; Chen, Zhengxian; Liu, Liang; Parnell, Laurence D; Lai, Chao-Qiang; Li, Duo


    Major royal jelly protein 1 (MRJP1) is the most abundant member of the major royal jelly protein (MRJP) family of honeybee. Mature MRJP1 cDNA of the Chinese honeybee (Apis cerana cerana MRJP1, or AccMRJP1) was expressed in Pichia pastoris. SDS-PAGE showed that recombinant AccMRJP1 was identical in molecular weight to the glycosylated AmMRJP1 from the Western honeybee (Apis mellifera). Western blots probed with anti-AccMRJP1 antibody demonstrated that recombinant AccMRJP1 and soluble protein of the Western honeybee RJ (AmSPRJ) contained immunoreactive MRJP1. The 57 kDa protein in AmSPRJ contained an N-terminal amino sequence of N-I-L-R-G-E, which is identical to that previously characterized in AmMRJP1. The molecular weight of recombinant AccMRJP1 was decreased from 57 to 48 kDa after deglycosylation, indicating that AccMRJP1 was glycosylated. The recombinant AccMRJP1 significantly stimulated Tn-5B-4 cell growth, similar to AmSPRJ and fetal bovine serum, and affected cell shape and adhesion to the substrate.

  16. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.


    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong


    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

  17. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )


    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  18. Characterization of ascorbate oxidase from Acremonium sp. HI-25.


    Hirose, J; Sakurai, T; Imamura, K; Watanabe, H; Iwamoto, H; Hiromi, K; Itoh, H; Shin, T; Murao, S


    The ascorbate oxidase obtained from a microorganism, Acremonium sp. HI-25 (molecular weight, 80 kDa; monomeric protein), was studied with respect to atomic absorption, EPR, absorption spectra, circular dichroism (CD) spectra, and steady-state kinetics. The enzyme was found to be a multicopper protein, containing four copper atoms of three kinds, types 1, 2, and 3 copper, in the ratio of 1:1:2. The EPR parameters of the type 1 and 2 copper atoms in the ascorbate oxidase are very similar to those in the case of the ascorbate oxidase obtained from cucumber, which is a dimeric protein. The apparent Km and kcat values for ascorbic acid of the ascorbate oxidase from Acremonium sp. HI-25 are almost the same as those of the monomeric unit of the ascorbate oxidase from cucumber. PMID:7961590

  19. Genetic identification of ACC-RESISTANT2 reveals involvement of LYSINE HISTIDINE TRANSPORTER1 in the uptake of 1-aminocyclopropane-1-carboxylic acid in Arabidopsis thaliana.


    Shin, Kihye; Lee, Sumin; Song, Won-Yong; Lee, Rin-A; Lee, Inhye; Ha, Kyungsun; Koo, Ja-Choon; Park, Soon-Ki; Nam, Hong-Gil; Lee, Youngsook; Soh, Moon-Soo


    1-Aminocyclopropane-1-carboxylic acid (ACC) is a biosynthetic precursor of ethylene, a gaseous plant hormone which controls a myriad of aspects of development and stress adaptation in higher plants. Here, we identified a mutant in Arabidopsis thaliana, designated as ACC-resistant2 (are2), displaying a dose-dependent resistance to exogenously applied ACC. Physiological analyses revealed that mutation of are2 impaired various aspects of exogenous ACC-induced ethylene responses, while not affecting sensitivity to other plant hormones during seedling development. Interestingly, the are2 mutant was normally sensitive to gaseous ethylene, compared with the wild type. Double mutant analysis showed that the ethylene-overproducing mutations, eto1 or eto3, and the constitutive ethylene signaling mutation, ctr1 were epistatic to the are2 mutation. These results suggest that the are2 mutant is not defective in ethylene biosynthesis or ethylene signaling per se. Map-based cloning of ARE2 demonstrated that LYSINE HISTIDINE TRANSPORTER1 (LHT1), encoding an amino acid transporter, is the gene responsible. An uptake experiment with radiolabeled ACC indicated that mutations of LHT1 reduced, albeit not completely, uptake of ACC. Further, we performed an amino acid competition assay and found that two amino acids, alanine and glycine, known as substrates of LHT1, could suppress the ACC-induced triple response in a LHT1-dependent way. Taken together, these results provide the first molecular genetic evidence supporting that a class of amino acid transporters including LHT1 takes part in transport of ACC, thereby influencing exogenous ACC-induced ethylene responses in A. thaliana. PMID:25520403

  20. PHD3 Loss in Cancer Enables Metabolic Reliance on Fatty Acid Oxidation via Deactivation of ACC2.


    German, Natalie J; Yoon, Haejin; Yusuf, Rushdia Z; Murphy, J Patrick; Finley, Lydia W S; Laurent, Gaëlle; Haas, Wilhelm; Satterstrom, F Kyle; Guarnerio, Jlenia; Zaganjor, Elma; Santos, Daniel; Pandolfi, Pier Paolo; Beck, Andrew H; Gygi, Steven P; Scadden, David T; Kaelin, William G; Haigis, Marcia C


    While much research has examined the use of glucose and glutamine by tumor cells, many cancers instead prefer to metabolize fats. Despite the pervasiveness of this phenotype, knowledge of pathways that drive fatty acid oxidation (FAO) in cancer is limited. Prolyl hydroxylase domain proteins hydroxylate substrate proline residues and have been linked to fuel switching. Here, we reveal that PHD3 rapidly triggers repression of FAO in response to nutrient abundance via hydroxylation of acetyl-coA carboxylase 2 (ACC2). We find that PHD3 expression is strongly decreased in subsets of cancer including acute myeloid leukemia (AML) and is linked to a reliance on fat catabolism regardless of external nutrient cues. Overexpressing PHD3 limits FAO via regulation of ACC2 and consequently impedes leukemia cell proliferation. Thus, loss of PHD3 enables greater utilization of fatty acids but may also serve as a metabolic and therapeutic liability by indicating cancer cell susceptibility to FAO inhibition. PMID:27635760

  1. 2016 ESC and ACC/AHA/HFSA heart failure guideline update - what is new and why is it important?


    Jessup, Mariell; Marwick, Thomas H; Ponikowski, Piotr; Voors, Adriaan A; Yancy, Clyde W


    Heart failure (HF) is a global epidemic affecting millions of individuals worldwide. Although important progress has been made in the management of HF, this condition remains a common cause of morbidity and death. Since the publication of the previous sets of guidelines for the management of HF, new diagnostic and therapeutic options for HF have emerged. Now, both the ESC and the ACC/AHA/HFSA have simultaneously published an update of their guidelines incorporating, among others, recommendations for the use of new pharmacological therapies for the treatment of HF. For this Viewpoint article, we have asked the chairs of the ESC Task Force, the chairs of the ACC/AHA/HFSA Writing Committee, and an independent opinion leader in the field to offer their expert insight into the new guidelines, highlighting what is new, what the main differences are between the two sets of guidelines, and what steps should be taken to improve the guidelines in future updates.

  2. Report of the American College of Cardiology (ACC) Scientific Sessions 2013, San Francisco--highlighting late-breaking trials.


    Yamada, Hirotsugu


    The American College of Cardiology's (ACC) 62nd Annual Scientific Session was held at the Moscone Center, San Francisco, from March 9-11, 2013. The meeting focused on the "transformation of cardiovascular care, from discovery to delivery", featured over 20 late-breaking clinical trials and 2,000 abstracts. These sessions gave notable exposure and recognition of studies likely to significantly affect clinical practice. There were 21 trials scheduled for presentation in 5 featured Late-Breaking Clinical Trial sessions, but one, the PREVAIL trial, was not presented because of a failure to observe an embargo. I summarize and overview both the late-breaking trials presented at ACC 2013 and the PREVAIL trial.  

  3. PHD3 Loss in Cancer Enables Metabolic Reliance on Fatty Acid Oxidation via Deactivation of ACC2.


    German, Natalie J; Yoon, Haejin; Yusuf, Rushdia Z; Murphy, J Patrick; Finley, Lydia W S; Laurent, Gaëlle; Haas, Wilhelm; Satterstrom, F Kyle; Guarnerio, Jlenia; Zaganjor, Elma; Santos, Daniel; Pandolfi, Pier Paolo; Beck, Andrew H; Gygi, Steven P; Scadden, David T; Kaelin, William G; Haigis, Marcia C


    While much research has examined the use of glucose and glutamine by tumor cells, many cancers instead prefer to metabolize fats. Despite the pervasiveness of this phenotype, knowledge of pathways that drive fatty acid oxidation (FAO) in cancer is limited. Prolyl hydroxylase domain proteins hydroxylate substrate proline residues and have been linked to fuel switching. Here, we reveal that PHD3 rapidly triggers repression of FAO in response to nutrient abundance via hydroxylation of acetyl-coA carboxylase 2 (ACC2). We find that PHD3 expression is strongly decreased in subsets of cancer including acute myeloid leukemia (AML) and is linked to a reliance on fat catabolism regardless of external nutrient cues. Overexpressing PHD3 limits FAO via regulation of ACC2 and consequently impedes leukemia cell proliferation. Thus, loss of PHD3 enables greater utilization of fatty acids but may also serve as a metabolic and therapeutic liability by indicating cancer cell susceptibility to FAO inhibition.

  4. 2016 ESC and ACC/AHA/HFSA heart failure guideline update - what is new and why is it important?


    Jessup, Mariell; Marwick, Thomas H; Ponikowski, Piotr; Voors, Adriaan A; Yancy, Clyde W


    Heart failure (HF) is a global epidemic affecting millions of individuals worldwide. Although important progress has been made in the management of HF, this condition remains a common cause of morbidity and death. Since the publication of the previous sets of guidelines for the management of HF, new diagnostic and therapeutic options for HF have emerged. Now, both the ESC and the ACC/AHA/HFSA have simultaneously published an update of their guidelines incorporating, among others, recommendations for the use of new pharmacological therapies for the treatment of HF. For this Viewpoint article, we have asked the chairs of the ESC Task Force, the chairs of the ACC/AHA/HFSA Writing Committee, and an independent opinion leader in the field to offer their expert insight into the new guidelines, highlighting what is new, what the main differences are between the two sets of guidelines, and what steps should be taken to improve the guidelines in future updates. PMID:27625120

  5. The human lysyl oxidase-like 2 protein functions as an amine oxidase toward collagen and elastin.


    Kim, Young-Mi; Kim, Eun-Cheol; Kim, Youngho


    The lysyl oxidase-like 2 (LOXL2) protein is a human paralogue of lysyl oxidase (LOX) that functions as an amine oxidase for formation of lysine-derived cross-links found in collagen and elastin. In addition to the C-terminal domains characteristic to the LOX family members, LOXL2 contains four scavenger receptor cysteine-rich (SRCR) domains in the N-terminus. In order to assess the amine oxidase activity of LOXL2, we expressed a series of recombinant LOXL2 proteins with deletions in the SRCR domains, using an Escherichia coli expression system. All of the purified recombinant LOXL2 proteins, with or without the SRCR domains in the N-terminus, showed significant amine oxidase activity toward several different types of collagen and elastin in in vitro amine oxidase assays, indicating deletion of the SRCR domains does not interfere with amine oxidase activity of LOXL2. Further, amine oxidase activity of LOXL2 was not susceptible to inhibition by β-aminopropionitrile, an irreversible inhibitor of LOX, suggesting a different enzymatic mechanism between these two paralogues.

  6. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488

    PubMed Central

    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar


    abstract Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  7. A comparison of native GPU computing versus OpenACC for implementing flow-routing algorithms in hydrological applications

    NASA Astrophysics Data System (ADS)

    Rueda, Antonio J.; Noguera, José M.; Luque, Adrián


    In recent years GPU computing has gained wide acceptance as a simple low-cost solution for speeding up computationally expensive processing in many scientific and engineering applications. However, in most cases accelerating a traditional CPU implementation for a GPU is a non-trivial task that requires a thorough refactorization of the code and specific optimizations that depend on the architecture of the device. OpenACC is a promising technology that aims at reducing the effort required to accelerate C/C++/Fortran code on an attached multicore device. Virtually with this technology the CPU code only has to be augmented with a few compiler directives to identify the areas to be accelerated and the way in which data has to be moved between the CPU and GPU. Its potential benefits are multiple: better code readability, less development time, lower risk of errors and less dependency on the underlying architecture and future evolution of the GPU technology. Our aim with this work is to evaluate the pros and cons of using OpenACC against native GPU implementations in computationally expensive hydrological applications, using the classic D8 algorithm of O'Callaghan and Mark for river network extraction as case-study. We implemented the flow accumulation step of this algorithm in CPU, using OpenACC and two different CUDA versions, comparing the length and complexity of the code and its performance with different datasets. We advance that although OpenACC can not match the performance of a CUDA optimized implementation (×3.5 slower in average), it provides a significant performance improvement against a CPU implementation (×2-6) with by far a simpler code and less implementation effort.

  8. Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.


    McDonald, Allison E; Vanlerberghe, Greg C


    Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans.

  9. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.


    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  10. Alternative oxidase involvement in Daucus carota somatic embryogenesis.


    Frederico, António Miguel; Campos, Maria Doroteia; Cardoso, Hélia Guerra; Imani, Jafargholi; Arnholdt-Schmitt, Birgit


    Plant alternative oxidase (AOX) is a mitochondrial inner membrane enzyme involved in alternative respiration. The critical importance of the enzyme during acclimation upon stress of plant cells is not fully understood and is still an issue of intensive research and discussion. Recently, a role of AOX was suggested for the ability of plant cells to change easily its fate upon stress. In order to get new insights about AOX involvement in cell reprogramming, quantitative real-time polymerase chain reaction (PCR) and inhibitor studies were performed during cell redifferentiation and developmental stages of Daucus carota L. somatic embryogenesis. Transcript level analysis shows that D. carota AOX genes (DcAOX1a and DcAOX2a) are differentially expressed during somatic embryogenesis. DcAOX1a shows lower expression levels, being mainly down-regulated, whereas DcAOX2a presented a large up-regulation during initiation of the realization phase of somatic embryogenesis. However, when globular embryos start to develop, both genes are down-regulated, being this state transient for DcAOX2a. In addition, parallel studies were performed using salicylhydroxamic acid (SHAM) in order to inhibit AOX activity during the realization phase of somatic embryogenesis. Embryogenic cells growing in the presence of the inhibitor were unable to develop embryogenic structures and its growth rate was diminished. This effect was reversible and concentration dependent. The results obtained contribute to the hypothesis that AOX activity supports metabolic reorganization as an essential part of cell reprogramming and, thus, enables restructuring and de novo cell differentiation.

  11. Enzymatic polymerization of dihydroquercetin using bilirubin oxidase.


    Khlupova, M E; Vasil'eva, I S; Shumakovich, G P; Morozova, O V; Chertkov, V A; Shestakova, A K; Kisin, A V; Yaropolov, A I


    Dihydroquercetin (or taxifolin) is one of the most famous flavonoids and is abundant in Siberian larch (Larix sibirica). The oxidative polymerization of dihydroquercetin (DHQ) using bilirubin oxidase as a biocatalyst was investigated and some physicochemical properties of the products were studied. DHQ oligomers (oligoDHQ) with molecular mass of 2800 and polydispersity of 8.6 were obtained by enzymatic reaction under optimal conditions. The oligomers appeared to be soluble in dimethylsulfoxide, dimethylformamide, and methanol. UV-visible spectra of oligoDHQ in dimethylsulfoxide indicated the presence of highly conjugated bonds. The synthesized oligoDHQ was also characterized by FTIR and (1)H and (13)C NMR spectroscopy. Comparison of NMR spectra of oligoDHQ with DHQ monomer and the parent flavonoids revealed irregular structure of a polymer formed via the enzymatic oxidation of DHQ followed by nonselective radical polymerization. As compared with the monomer, oligoDHQ demonstrated higher thermal stability and high antioxidant activity.

  12. [NADPH oxidases, Nox: new isoenzymes family].


    Chuong Nguyen, Minh Vu; Lardy, Bernard; Paclet, Marie-Hélène; Rousset, Francis; Berthier, Sylvie; Baillet, Athan; Grange, Laurent; Gaudin, Philippe; Morel, Françoise


    NADPH oxidases, Nox, are a family of isoenzymes, composed of seven members, whose sole function is to produce reactive oxygen species (ROS). Although Nox catalyze the same enzymatic reaction, they acquired from a common ancestor during evolution, specificities related to their tissue expression, subcellular localization, activation mechanisms and regulation. Their functions could vary depending on the pathophysiological state of the tissues. Indeed, ROS are not only bactericidal weapons in phagocytes but also essential cellular signaling molecules and their overproduction is involved in chronic diseases and diseases of aging. The understanding of the mechanisms involved in the function of Nox and the emergence of Nox inhibitors, require a thorough knowledge of their nature and structure. The objectives of this review are to highlight, in a structure/function approach, the main similar and differentiated properties shared by the human Nox isoenzymes.

  13. Degradation of pentachlorophenol by potato polyphenol oxidase.


    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu


    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  14. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.


    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  15. Drugs related to monoamine oxidase activity.


    Fišar, Zdeněk


    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions.

  16. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie


    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  17. ROS signalling, NADPH oxidases and cancer.


    Landry, William D; Cotter, Thomas G


    ROS (reactive oxygen species) have long been regarded as a series of destructive molecules that have a detrimental effect on cell homoeostasis. In support of this are the myriad antioxidant defence systems nearly all eukaryotic cells have that are designed to keep the levels of ROS in check. However, research data emerging over the last decade have demonstrated that ROS can influence a range of cellular events in a manner similar to that seen for traditional second messenger molecules such as cAMP. Hydrogen peroxide (H2O2) appears to be the main ROS with such signalling properties, and this molecule has been shown to affect a wide range of cellular functions. Its localized synthesis by the Nox (NADPH oxidase) family of enzymes and how these enzymes are regulated is of particular interest to those who work in the field of tumour biology.

  18. Circumpolar Estimates of Isopycnal Mixing in the ACC from Argo Floats

    NASA Astrophysics Data System (ADS)

    Roach, C. J.; Balwada, D.; Speer, K. G.


    There are few direct observations of cross-stream isopycnal mixing in the interior of the Southern Ocean, yet such measurements are needed to determine the role of eddies transporting properties across the ACC, and key to progress toward testing theories of meridional overturning. In light of this we examine if it is possible to obtain estimates of mixing from Argo float trajectories. We divided the Southern Ocean into overlapping 15ο longitude bins before estimating mixing. Resulting diffusivities ranged from 300 to 3000 m2s-1, with peaks corresponding to the Scotia Sea; Kerguelen and Campbell Plateaus. Comparison of our diffusivities with previous regional studies demonstrated good agreement. Tests of the methodology in the DIMES region found that mixing from Argo floats agreed closely with mixing from RAFOS floats. To further test the method we used the Southern Ocean State Estimate velocity fields to advect particles with Argo and RAFOS float like behaviours. Stirring estimates from the particles agreed well with each other in the Kerguelen Island region, South Pacific and Scotia Sea, despite the differences in the imposed behaviour. Finally, these estimates were compared to mixing length suppression theory presented in Ferrari and Nikurashin 2010. This mixing length suppression theory quantifies horizontal diffusivity similar to Prandtl (1925), but the mixing length is suppressed in the presence of mean flows and eddy phase speeds. Our results suggest that the theory can explain both the structure and magnitude of mixing using mean flow data. An exception is near the Kerguelen and Campbell Plateaus where theory under-estimates mixing relative to our results.

  19. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  20. Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.


    Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo


    Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process. PMID:27295021

  1. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie


    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  2. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio


    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  3. The lysyl oxidases LOX and LOXL2 are necessary and sufficient to repress E-cadherin in hypoxia: insights into cellular transformation processes mediated by HIF-1.


    Schietke, Ruth; Warnecke, Christina; Wacker, Ingrid; Schödel, Johannes; Mole, David R; Campean, Valentina; Amann, Kerstin; Goppelt-Struebe, Margarete; Behrens, Jürgen; Eckardt, Kai-Uwe; Wiesener, Michael S


    Hypoxia has been shown to promote tumor metastasis and lead to therapy resistance. Recent work has demonstrated that hypoxia represses E-cadherin expression, a hallmark of epithelial to mesenchymal transition, which is believed to amplify tumor aggressiveness. The molecular mechanism of E-cadherin repression is unknown, yet lysyl oxidases have been implicated to be involved. Gene expression of lysyl oxidase (LOX) and the related LOX-like 2 (LOXL2) is strongly induced by hypoxia. In addition to the previously demonstrated LOX, we characterize LOXL2 as a direct transcriptional target of HIF-1. We demonstrate that activation of lysyl oxidases is required and sufficient for hypoxic repression of E-cadherin, which mediates cellular transformation and takes effect in cellular invasion assays. Our data support a molecular pathway from hypoxia to cellular transformation. It includes up-regulation of HIF and subsequent transcriptional induction of LOX and LOXL2, which repress E-cadherin and induce epithelial to mesenchymal transition. Lysyl oxidases could be an attractive molecular target for cancers of epithelial origin, in particular because they are partly extracellular.

  4. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.


    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  5. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel


    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  6. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D


    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  7. CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.


    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  8. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  9. Overexpression of a Water-Forming NADH Oxidase Improves the Metabolism and Stress Tolerance of Saccharomyces cerevisiae in Aerobic Fermentation.


    Shi, Xinchi; Zou, Yanan; Chen, Yong; Zheng, Cheng; Ying, Hanjie


    Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD(+), which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the by product glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX) showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON) at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37% higher than that for CON (30.82 ± 1.54 g/L). Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved osmotolerance. Thus

  10. Overexpression of a Water-Forming NADH Oxidase Improves the Metabolism and Stress Tolerance of Saccharomyces cerevisiae in Aerobic Fermentation

    PubMed Central

    Shi, Xinchi; Zou, Yanan; Chen, Yong; Zheng, Cheng; Ying, Hanjie


    Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the by product glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX) showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON) at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37% higher than that for CON (30.82 ± 1.54 g/L). Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved osmotolerance. Thus

  11. Overexpression of a Water-Forming NADH Oxidase Improves the Metabolism and Stress Tolerance of Saccharomyces cerevisiae in Aerobic Fermentation

    PubMed Central

    Shi, Xinchi; Zou, Yanan; Chen, Yong; Zheng, Cheng; Ying, Hanjie


    Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the by product glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX) showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON) at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37% higher than that for CON (30.82 ± 1.54 g/L). Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved osmotolerance. Thus

  12. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina


    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  13. NADPH oxidase deficiency in X-linked chronic granulomatous disease.

    PubMed Central

    Hohn, D C; Lehrer, R I


    We measured the cyanide-insensitive pyridine nucleotide oxidase activity of fractionated resting and phagocytic neutrophils from 11 normal donors, 1 patient with hereditary deficiency of myeloperoxidase, and 7 patients with X-linked chronic granulomatous disease (CGD). When measured under optimal conditions (at pH 5.5 and in the presence of 0.5 mM Mn++), NADPH oxidase activity increased fourfold with phagocytosis and was six-fold higher than with NADH. Phagocytic neutrophils from patients with CGD were markedly deficient in NADPH oxidase activity. Images PMID:235560

  14. Identification of yeasts from clinical specimens by oxidase test.


    Kumar, S; Arora, B S; Mathur, M D


    A total of 100 yeasts and yeast like fungi isolates from clinical specimens were negative for oxidase production on Sabouraud dextrose agar. When grown on Columbia agar, chocolate agar, tryptose agar, Mueller-Hinton agar, brain heart infusion and a medium resembling Sabouraud's dextrose agar but with starch instead of dextrose, all the isolate of Candida albicans (55), C. guilliermondii (6), C. parapsilosis (14), C. tropicalis (6), C. pseudotropicalis (6) and Crytococcus neoformans (2) were positive for oxidase producation. Torulopsis glabrata (2), Saccharomyces cervisiae (2) and two out of seven isolates of C. krusei were negative for oxidase test. PMID:11344606

  15. Cardiac-specific deletion of acetyl CoA carboxylase 2 (ACC2) prevents metabolic remodeling during pressure-overload hypertrophy

    PubMed Central

    Kolwicz, Stephen C.; Olson, David P.; Marney, Luke C.; Garcia-Menendez, Lorena; Synovec, Robert E.; Tian, Rong


    Rationale Decreased fatty acid oxidation (FAO) with increased reliance on glucose are hallmarks of metabolic remodeling that occurs in pathological cardiac hypertrophy and is associated with decreased myocardial energetics and impaired cardiac function. To date, it has not been tested whether prevention of the metabolic switch that occurs during the development of cardiac hypertrophy has unequivocal benefits on cardiac function and energetics. Objectives Since malonyl CoA production via acetyl CoA carboxylase 2 (ACC2) inhibits mitochondrial fatty acid transport, we hypothesized that mice with a cardiac-specific deletion of ACC2 (ACC2H−/−) would maintain cardiac fatty acid oxidation (FAO) and improve function and energetics during the development of pressure-overload hypertrophy. Methods and Results ACC2 deletion led to a significant reduction in cardiac malonyl CoA levels. In isolated perfused heart experiments, left ventricular (LV) function and oxygen consumption were similiar in ACC2H−/− mice despite an ~60% increase in FAO compared to controls (CON). After 8 weeks of pressure-overload via transverse aortic constriction (TAC), ACC2H−/− mice exhibited a substrate utilization profile similar to sham animals while CON-TAC hearts had decreased FAO with increased glycolysis and anaplerosis. Myocardial energetics, assessed by 31P NMR spectroscopy, and cardiac function were maintained in ACC2H−/− after 8 weeks of TAC. Furthermore, ACC2H−/−-TAC demonstrated an attenuation of cardiac hypertrophy with a significant reduction in fibrosis relative to CON-TAC. Conclusions These data suggest that reversion to the fetal metabolic profile in chronic pathological hypertrophy is associated with impaired myocardial function and energetics and maintenance of the inherent cardiac metabolic profile and mitochondrial oxidative capacity is a viable therapeutic strategy. PMID:22730442

  16. A novel 1-Cys thioredoxin peroxidase gene in Apis cerana cerana: characterization of AccTpx4 and its role in oxidative stresses.


    Huaxia, Yifeng; Wang, Fang; Yan, Yan; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua


    Thioredoxin peroxidase (Tpx), also named peroxiredoxin (Prx), is an important peroxidase that can protect organisms against stressful environments. AccTpx4, a 1-Cys thioredoxin peroxidase gene from the Chinese honey bee Apis cerana cerana, was cloned and characterized. The AccTpx4 gene encodes a protein that is predicted to contain the conserved PVCTTE motif from 1-Cys peroxiredoxin. Quantitative real-time PCR (Q-PCR) and Western blotting revealed that AccTpx4 was induced by various oxidative stresses, such as cold, heat, insecticides, H(2)O(2), and HgCl(2). The in vivo peroxidase activity assay showed that recombinant AccTpx4 protein could efficiently degrade H(2)O(2) in the presence of DL-dithiothreitol (DTT). In addition, disc fusion assays revealed that AccTpx4 could function to protect cells against oxidative stresses. These results indicate that AccTpx4 plays an important role in oxidative stress responses and may contribute to the conservation of honeybees. PMID:25971604

  17. Structural Evidence for Direct Interactions Between the BRCT Domains of Human BRCA1 and a Phospho-Peptide from Human ACC1

    SciTech Connect

    Shen,Y.; Tong, L.


    The tandem BRCA1 C-terminal (BRCT) domains are phospho-serine/threonine recognition modules essential for the function of BRCA1. Recent studies suggest that acetyl-CoA carboxylase 1 (ACC1), an enzyme with crucial roles in de novo fatty acid biosynthesis and lipogenesis and essential for cancer cell survival, may be a novel binding partner for BRCA1, through interactions with its BRCT domains. We report here the crystal structure at 3.2 Angstroms resolution of human BRCA1 BRCT domains in complex with a phospho-peptide from human ACC1 (p-ACC1 peptide, with the sequence 1258-DSPPQ-pS-PTFPEAGH-1271), which provides molecular evidence for direct interactions between BRCA1 and ACC1. The p-ACC1 peptide is bound in an extended conformation, located in a groove between the tandem BRCT domains. There are recognizable and significant structural differences to the binding modes of two other phospho-peptides to these domains, from BACH1 and CtIP, even though they share a conserved pSer-Pro-(Thr/Val)-Phe motif. Our studies establish a framework for understanding the regulation of lipid biosynthesis by BRCA1 through its inhibition of ACC1 activity, which could be a novel tumor suppressor function of BRCA1.

  18. RHON1 mediates a Rho-like activity for transcription termination in plastids of Arabidopsis thaliana.


    Chi, Wei; He, Baoye; Manavski, Nikolay; Mao, Juan; Ji, Daili; Lu, Congming; Rochaix, Jean David; Meurer, Jörg; Zhang, Lixin


    Although transcription termination is essential to generate functional RNAs, its underlying molecular mechanisms are still poorly understood in plastids of vascular plants. Here, we show that the RNA binding protein RHON1 participates in transcriptional termination of rbcL (encoding large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase) in Arabidopsis thaliana. Inactivation of RHON1 leads to enhanced rbcL read-through transcription and to aberrant accD (encoding β-subunit of the acetyl-CoA carboxylase) transcriptional initiation, which may result from inefficient transcription termination of rbcL. RHON1 can bind to the mRNA as well as to single-stranded DNA of rbcL, displays an RNA-dependent ATPase activity, and terminates transcription of rbcL in vitro. These results suggest that RHON1 terminates rbcL transcription using an ATP-driven mechanism similar to that of Rho of Escherichia coli. This RHON1-dependent transcription termination occurs in Arabidopsis but not in rice (Oryza sativa) and appears to reflect a fundamental difference between plastomes of dicotyledonous and monocotyledonous plants. Our results point to the importance and significance of plastid transcription termination and provide insights into its machinery in an evolutionary context.

  19. Austrian Carbon Calculator (ACC) - modelling soil carbon dynamics in Austrian soils

    NASA Astrophysics Data System (ADS)

    Sedy, Katrin; Freudenschuss, Alexandra; Zethner, Gehard; Spiegel, Heide; Franko, Uwe; Gründling, Ralf; Xaver Hölzl, Franz; Preinstorfer, Claudia; Haslmayr, Hans Peter; Formayer, Herbert


    Austrian Carbon Calculator (ACC) - modelling soil carbon dynamics in Austrian soils. The project funded by the Klima- und Energiefonds, Austrian Climate Research Programme, 4th call Authors: Katrin Sedy, Alexandra Freudenschuss, Gerhard Zethner (Environment Agency Austria), Heide Spiegel (Austrian Agency for Health and Food Safety), Uwe Franko, Ralf Gründling (Helmholtz Centre for Environmental Research) Climate change will affect plant productivity due to weather extremes. However, adverse effects could be diminished and satisfying production levels may be maintained with proper soil conditions. To sustain and optimize the potential of agricultural land for plant productivity it will be necessary to focus on preserving and increasing soil organic carbon (SOC). Carbon sequestration in agricultural soils is strongly influenced by management practice. The present management is affected by management practices that tend to speed up carbon loss. Crop rotation, soil cultivation and the management of crop residues are very important measures to influence carbon dynamics and soil fertility. For the future it will be crucial to focus on practical measures to optimize SOC and to improve soil structure. To predict SOC turnover the existing humus balance model the application of the "Carbon Candy Balance" was verified by results from Austrian long term field experiments and field data of selected farms. Thus the main aim of the project is to generate a carbon balancing tool box that can be applied in different agricultural production regions to assess humus dynamics due to agricultural management practices. The toolbox will allow the selection of specific regional input parameters for calculating the C-balance at field level. However farmers or other interested user can also apply their own field data to receive the result of C-dynamics under certain management practises within the next 100 years. At regional level the impact of predefined changes in agricultural management

  20. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu


    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  1. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.


    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  2. Isolation of oxidase-negative Pseudomonas aeruginosa from sputum culture.

    PubMed Central

    Hampton, K D; Wasilauskas, B L


    Two isolates of Pseudomonas aeruginosa lacking characteristic indophenol oxidase were recovered from a sputum specimen. A discussion of the characteristic biochemical tests and antibiograms along with a possible explanation for this phenomenon is presented. PMID:225349

  3. Alternative oxidase (AOX) and phenolic metabolism in methyl jasmonate-treated hairy root cultures of Daucus carota L.


    Sircar, Debabrata; Cardoso, Hélia G; Mukherjee, Chiranjit; Mitra, Adinpunya; Arnholdt-Schmitt, Birgit


    Methyl-jasmonate (MJ)-treated hairy roots of Daucus carota L. were used to study the influence of alternative oxidase (AOX) in phenylpropanoid metabolism. Phenolic acid accumulation, as well as total flavonoids and lignin content of the MJ-treated hairy roots were decreased by treatment with salicylhydroxamic acid (SHAM), a known inhibitor of AOX. The inhibitory effect of SHAM was concentration dependent. Treatment with propyl gallate (PG), another inhibitor of AOX, also had a similar inhibitory effect on accumulation of phenolic acid, total flavonoids and lignin. The transcript levels of two DcAOX genes (DcAOX2a and DcAOX1a) were monitored at selected post-elicitation time points. A notable rise in the transcript levels of both DcAOX genes was observed preceding the MJ-induced enhanced accumulation of phenolics, flavonoids and lignin. An appreciable increase in phenylalanine ammonia-lyase (PAL) transcript level was also observed prior to enhanced phenolics accumulation. Both DcAOX genes showed differential transcript accumulation patterns after the onset of elicitation. The transcript levels of DcAOX1a and DcAOX2a attained peak at 6hours post elicitation (hpe) and 12hpe, respectively. An increase in the transcript levels of both DcAOX genes preceding the accumulation of phenylpropanoid-derivatives and lignin showed a positive correlation between AOX activity and phenylpropanoid biosynthesis. The results provide important new insight about the influence of AOX in phenylpropanoid biosynthesis.

  4. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.


    Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E


    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  5. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    SciTech Connect

    Riganti, Chiara


    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to those observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.

  6. Molecular cloning and functional characterization of a putative sulfite oxidase (SO) ortholog from Nicotiana benthamiana.


    Xia, Zongliang; Su, Xinhong; Wu, Jianyu; Wu, Ke; Zhang, Hua


    Sulfite oxidase (SO) catalyzes the oxidation of sulfite to sulfate and thus has important roles in diverse metabolic processes. However, systematic molecular and functional investigations on the putative SO from tobacco (Nicotiana benthamiana) have hitherto not been reported. In this work, a full-length cDNA encoding putative sulfite oxidase from N. benthamiana (NbSO) was isolated. The deduced NbSO protein shares high homology and typical structural features with other species SOs. Phylogenetic analysis indicates that NbSO cDNA clone encodes a tobacco SO isoform. Southern blot analysis suggests that NbSO is a single-copy gene in the N. benthamiana genome. The NbSO transcript levels were higher in aerial tissues and were up-regulated in N. benthamiana during sulfite stress. Reducing the SO expression levels through virus-induced gene silencing caused a substantial accumulation in sulfite content and less sulfate accumulation in N. benthamiana leaves when exposed to sulfite stress, and thus resulted in decreased tolerance to sulfite stress. Taken together, this study improves our understanding on the molecular and functional properties of plant SO and provides genetic evidence on the involvement of SO in sulfite detoxification in a sulfite-oxidizing manner in N. benthamiana plants. PMID:21667106

  7. Leishmania major possesses a unique HemG-type protoporphyrinogen IX oxidase

    PubMed Central

    Zwerschke, Dagmar; Karrie, Simone; Jahn, Dieter; Jahn, Martina


    Leishmania major was proposed to either utilize haem from its host or partially synthesize the tetrapyrrole from host provided precursors. However, only indirect evidence was available for this partial late haem biosynthetic pathway. Here, we demonstrate that the LMJF_06_1280 gene of L. major encodes a HemG-type PPO (protoporphyrinogen IX oxidase) catalysing the oxidation of protoporphyrinogen IX to protoporphyrin IX. Interestingly, trypanosomatids are currently the only known eukaryotes possessing HemG-type enzymes. The LMJF_06_1280 gene forms a potential transcriptional unit with LMJF_06_1270 encoding CPO (coproporphyrinogen III oxidase) and with LMJF_06_1290 for a cytochrome b5. In vivo function of the L. major hemG gene was shown by the functional complementation of the Escherichia coli ΔhemG strain LG285. Restored haem formation in E. coli was observed using HPLC analyses. Purified recombinant L. major HemG revealed PPO activity in vitro using different ubiquinones and triphenyltetrazolium as electron acceptors. FMN was identified as the L. major HemG cofactor. Active site residues were found to be essential for HemG catalysis. These data in combination with the solved crystal structures of L. major CPO and the physiological proof of a ferrochelatase activity provide clear-cut evidence for a partial haem biosynthetic pathway in L. major. PMID:24962471

  8. Alternative oxidase: a respiratory electron transport chain pathway essential for maintaining photosynthetic performance during drought stress.


    Vanlerberghe, Greg C; Martyn, Greg D; Dahal, Keshav


    Photosynthesis and respiration are the hubs of energy metabolism in plants. Drought strongly perturbs photosynthesis as a result of both diffusive limitations resulting from stomatal closure, and in some cases biochemical limitations that are associated with a reduced abundance of key photosynthetic components. The effects of drought on respiration, particularly respiration in the light (RL ), are less understood. The plant mitochondrial electron transport chain includes a non-energy conserving terminal oxidase called alternative oxidase (AOX). Several studies have shown that drought increases AOX transcript, protein and maximum capacity. Here we review recent studies comparing wild-type (WT) tobacco to transgenic lines with altered AOX protein amount. Specifically during drought, RL was compromised in AOX knockdown plants and enhanced in AOX overexpression plants, compared with WT. Significantly, these differences in RL were accompanied by dramatic differences in photosynthetic performance. Knockdown of AOX increased the susceptibility of photosynthesis to drought-induced biochemical limitations, while overexpression of AOX delayed the development of such biochemical limitations, compared with WT. Overall, the results indicate that AOX is essential to maintaining RL during drought, and that this non-energy conserving respiration maintains photosynthesis during drought by promoting energy balance in the chloroplast. This review also outlines several areas for future research, including the possibility that enhancement of non-energy conserving respiratory electron sinks may be a useful biotechnological approach to increase plant performance during stress.

  9. Quinone compounds regulate the level of ROS production by the NADPH oxidase Nox4.


    Nguyen, Minh Vu Chuong; Lardy, Bernard; Rousset, Francis; Hazane-Puch, Florence; Zhang, Leilei; Trocmé, Candice; Serrander, Lena; Krause, Karl-Heinz; Morel, Françoise


    NADPH oxidase Nox4 is expressed in a wide range of tissues and plays a role in cellular signaling by providing reactive oxygen species (ROS) as intracellular messengers. Nox4 oxidase activity is thought to be constitutive and regulated at the transcriptional level; however, we challenge this point of view and suggest that specific quinone derivatives could modulate this activity. In fact, we demonstrated a significant stimulation of Nox4 activity by 4 quinone derivatives (AA-861, tBuBHQ, tBuBQ, and duroquinone) observed in 3 different cellular models, HEK293E, T-REx™, and chondrocyte cell lines. Our results indicate that the effect is specific toward Nox4 versus Nox2. Furthermore, we showed that NAD(P)H:quinone oxidoreductase (NQO1) may participate in this stimulation. Interestingly, Nox4 activity is also stimulated by reducing agents that possibly act by reducing the disulfide bridge (Cys226, Cys270) located in the extracellular E-loop of Nox4. Such model of Nox4 activity regulation could provide new insight into the understanding of the molecular mechanism of the electron transfer through the enzyme, i.e., its potential redox regulation, and could also define new therapeutic targets in diseases in which quinones and Nox4 are implicated. PMID:23583257

  10. Isolation and analysis of a cDNA clone encoding an S. guttatum alternataive oxidase protein

    SciTech Connect

    Rhoads, D.M.; McIntosh, L. Michigan State Univ., East Lansing )


    Antibodies that recognize the 35, 36, and 37 kilodalton (kDa) alternative oxidase proteins were used to isolate a cDNA proteins were used to isolate a cDNA clone of a nuclearly encoded protein of Sauromatum guttatum. The amino acid sequence deduced from clone pAOSG81 revealed a protein with a predicted molecular mass of 44 kDa, while a 42 kDa protein is immunoprecipitated from in vitro translation products made using S. guttatum poly A+ RNA. The protein contains a 60-65 amino acid transit peptide which is predicted to form amphiphilic helices. We have also identified regions of the mature 42 kDa protein which are likely to be membrane associated. Clone pAOSG81 is being used to screen a genomic library. The genomic clone encoding the 42 kDa protein will be used to investigate the salicylic-acid-controlled transcriptional regulation of the S. guttatum alternative oxidase proteins.

  11. Expression of Wnt and TGF-β pathway components and key adrenal transcription factors in adrenocortical tumors: association to carcinoma aggressiveness.


    Parviainen, Helka; Schrade, Anja; Kiiveri, Sanne; Prunskaite-Hyyryläinen, Renata; Haglund, Caj; Vainio, Seppo; Wilson, David B; Arola, Johanna; Heikinheimo, Markku


    Factors controlling benign and malignant adrenocortical tumorigenesis are largely unknown, but several mouse models suggest an important role for inhibin-alpha (INHA). To show that findings in the mouse are relevant to human tumors and clinical outcome, we investigated the expression of signaling proteins and transcription factors involved in the regulation of INHA in human tumor samples⋅ Thirty-one adrenocortical tumor samples, including 13 adrenocortical carcinomas (ACCs), were categorized according to Weiss score, hormonal profile, and patient survival data and analyzed using immunohistochemistry and RT-PCR. Expression of the TGF-β signaling mediator SMAD3 varied inversely with Weiss score, so that SMAD3 expression was lowest in the most malignant tumors. By contrast, SMAD2 expression was upregulated in most malignant tumors. Wnt pathway co-receptors LRP5 and LRP6 were predominantly expressed in benign adrenocortical tumors. In ACCs, expression of transcription factors GATA-6 and SF-1 correlated with that of their target gene INHA. Moreover, the diminished expression of GATA-6 and SF-1 in ACCs correlated with poor outcome. We conclude that the factors driving INHA expression are reduced in ACCs with poor outcome, implicating a role for INHA as a tumor suppressor in humans.

  12. Expression of Wnt and TGF-β pathway components and key adrenal transcription factors in adrenocortical tumors – association to carcinoma aggressiveness

    PubMed Central

    Parviainen, Helka; Schrade, Anja; Kiiveri, Sanne; Prunskaite-Hyyryläinen, Renata; Haglund, Caj; Vainio, Seppo; Wilson, David B.; Arola, Johanna; Heikinheimo, Markku


    Factors controlling benign and malignant adrenocortical tumorigenesis are largely unknown, but several mouse models suggest an important role for inhibin-alpha (INHA). To show that findings in the mouse are relevant to human tumors and clinical outcome, we investigated the expression of signaling proteins and transcription factors involved in the regulation of INHA in human tumor samples. Thirty-one adrenocortical tumor samples, including 13 adrenocortical carcinomas (ACCs), were categorized according to Weiss score, hormonal profile, and patient survival data and analyzed using immunohistochemistry and RT-PCR. Expression of the TGF-β signaling mediator SMAD3 varied inversely with Weiss score, so that SMAD3 expression was lowest in the most malignant tumors. By contrast, SMAD2 expression was upregulated in most malignant tumors. Wnt pathway co-receptors LRP5 and LRP6 were predominantly expressed in benign adrenocortical tumors. In ACCs, expression of transcription factors GATA-6 and SF-1 correlated with that of their target gene INHA. Moreover, the diminished expression of GATA-6 and SF-1 in ACCs correlated with poor outcome. We conclude that the factors driving INHA expression are reduced in ACCs with poor outcome, implicating a role for INHAas a tumor suppressor in humans. PMID:23866946

  13. Coupling the mitochondrial transcription machinery to human disease.


    Shadel, Gerald S


    Mitochondria are the central processing units for cellular energy metabolism and, in addition to carrying out oxidative phosphorylation, regulate important processes such as apoptosis and calcium homeostasis. Because mitochondria possess a genome that is central to their multiple functions, an understanding of the mechanism of mitochondrial gene expression is required to decipher the many ways mitochondrial dysfunction contributes to human disease. Towards this end, two human transcription factors that are related to rRNA methyltransferases have recently been characterized, providing new insight into the mechanism of mitochondrial transcription and a novel link to maternally inherited deafness. Furthermore, studies in the Saccharomyces cerevisiae model system have revealed a functional coupling of transcription and translation at the inner mitochondrial membrane, where assembly of the oxidative phosphorylation system commences. Defects in an analogous coupling mechanism in humans might underlie the cytochrome oxidase deficiency that causes a form of Leigh Syndrome.

  14. Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.


    Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M


    It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.

  15. Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.


    Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M


    It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity. PMID:8882384

  16. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    SciTech Connect

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. )


    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

  17. Chronic monoamine oxidase-B inhibitor treatment blocks monoamine oxidase-A enzyme activity.


    Bartl, Jasmin; Müller, Thomas; Grünblatt, Edna; Gerlach, Manfred; Riederer, Peter


    Patients with Parkinson's disease receive selective irreversible monoamine oxidase (MAO)-B inhibitors, but their effects on MAO-A activity are not known during long-term application. We determined MAO-A inhibition in plasma samples from patients with MAO-B inhibitor intake or without MAO-B inhibitor treatment and from healthy controls. We detected a 70 % reduction of MAO-A activity in patients with MAO-B inhibitor therapy in comparison to the other groups. Our results suggest that treatment with MAO-B inhibitor may also influence MAO-A activity in vivo, when administered daily.

  18. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  19. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.


    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637


    SciTech Connect



    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  1. Origin and evolution of lysyl oxidases.


    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes.

  2. Monoamine oxidase: radiotracer chemistry and human studies.


    Fowler, Joanna S; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D


    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serotonin, norepinephrine, and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson's disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 years since the first radiotracers were developed and the first positron emission tomography (PET) images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables that have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe the following: (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological, and psychiatric disorders; and (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers that are currently used and possible new applications.

  3. Inhibition of monoamine oxidase by benzoxathiolone analogues.


    Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P


    Inhibitors of the monoamine oxidase (MAO) enzymes are considered useful therapeutic agents, and are used in the clinic for the treatment of depressive illness and Parkinson's disease. In addition, MAO inhibitors are also under investigation for the treatment of certain cardiovascular pathologies and as possible aids to smoking cessation. In an attempt to discover novel classes of compounds that inhibit the MAOs, the current study examines the human MAO inhibitory properties of a small series of 2H-1,3-benzoxathiol-2-one analogues. The results show that the benzoxathiolones are potent MAO-B inhibitors with IC50 values ranging from 0.003 to 0.051 μM. Although the benzoxathiolones are selective for the MAO-B isoform, two compounds display good MAO-A inhibition with IC50 values of 0.189 and 0.424 μM. Dialysis studies show that a selected compound inhibits the MAOs reversibly. It may thus be concluded that the benzoxathiolone class is suitable for the design and development of MAO-B inhibitors, and that in some instances good MAO-A inhibition may also be achieved.

  4. Monoamine oxidase inhibitory activities of heterocyclic chalcones.


    Minders, Corné; Petzer, Jacobus P; Petzer, Anél; Lourens, Anna C U


    Studies have shown that natural and synthetic chalcones (1,3-diphenyl-2-propen-1-ones) possess monoamine oxidase (MAO) inhibition activities. Of particular importance to the present study is a report that a series of furanochalcones acts as MAO-B selective inhibitors. Since the effect of heterocyclic substitution, other than furan (and more recently thiophene, piperidine and quinoline) on the MAO inhibitory properties of the chalcone scaffold remains unexplored, the aim of this study was to synthesise and evaluate further heterocyclic chalcone analogues as inhibitors of the human MAOs. For this purpose, heterocyclic chalcone analogues that incorporate pyrrole, 5-methylthiophene, 5-chlorothiophene and 6-methoxypyridine substitution were examined. Seven of the nine synthesised compounds exhibited IC50 values <1 μM for the inhibition of MAO-B, with all compounds exhibiting higher affinities for MAO-B compared to the MAO-A isoform. The most potent MAO-B inhibitor (4h) displays an IC50 value of 0.067 μM while the most potent MAO-A inhibitor (4e) exhibits an IC50 value of 3.81 μM. It was further established that selected heterocyclic chalcones are reversible and competitive MAO inhibitors. 4h, however, may exhibit tight-binding to MAO-B, a property linked to its thiophene moiety. We conclude that high potency chalcones such as 4h represent suitable leads for the development of MAO-B inhibitors for the treatment of Parkinson's disease and possibly other neurodegenerative disorders.

  5. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  6. Xanthine oxidase inhibitory lanostanoids from Ganoderma tsugae.


    Lin, Kai-Wei; Chen, Yen-Ting; Yang, Shyh-Chyun; Wei, Bai-Luh; Hung, Chi-Feng; Lin, Chun-Nan


    Two new lanostanoids, 3α-acetoxy-22-oxo-5α-lanosta-8,24-dien-21-oic acid, named tsugaric acid D (1) and 16α-hydroxy-3-oxo-5α-lanosta-6,8,24(24(1))-trien-21-oic acid, named tsugaric acid E (2) were isolated from the fruit bodies of Ganoderma tsugae. The structures 1 and 2 were determined by spectroscopic methods. Compound 1 and known compounds 3 and 6 exhibited significant inhibitory effects on xanthine oxidase (XO) activity with an IC50 values of 90.2±24.2, 116.1±3.0, and 181.9±5.8 μM, respectively. Known compound 5 was able to protect human keratinocytes against damage induced by UVB light, which showed 5 could protect keratinocytes from photodamage. The 1 and 5 μM 1 combined with 5 μM cisplatin, respectively, enhanced the cytotoxicity induced by cisplatin. It suggested that 1 and 5 μM 1 combined with low dose of cisplatin may enhance the therapeutic efficacy of cisplatin and reduce side effect and cisplatin resistant.

  7. Leflunomide, a Reversible Monoamine Oxidase Inhibitor.


    Petzer, Jacobus P; Petzer, Anél


    A screening study aimed at identifying inhibitors of the enzyme, monoamine oxidase (MAO), among clinically used drugs have indicated that the antirheumatic drug, leflunomide, is an inhibitor of both MAO isoforms. Leflunomide inhibits human MAO-A and MAO-B and exhibits IC50 values of 19.1 μM and 13.7 μM, respectively. The corresponding Ki values are 17.7 μM (MAO-A) and 10.1 μM (MAO-B). Dialyses of mixtures of the MAO enzymes and leflunomide show that inhibition of the MAOs by leflunomide is reversible. The principal metabolite of leflunomide, teriflunomide (A77 1726), in contrast is not an MAO inhibitor. This study concludes that, although leflunomide is only moderately potent as an MAO inhibitor, isoxazole derivatives may represent a general class of MAO inhibitors and this heterocycle may find application in MAO inhibitor design. In this respect, MAO inhibitors are used in the clinic for the treatment of depressive illness and Parkinson's disease, and are under investigation as therapy for certain types of cancer, Alzheimer's disease and age-related impairment of cardiac function. PMID:26299850

  8. Monoamine oxidase: Radiotracer chemistry and human studies


    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.


    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variablesmore » which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.« less

  9. Monoamine oxidase: Radiotracer chemistry and human studies

    SciTech Connect

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.


    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.

  10. Crystallization of beef heart cytochrome c oxidase

    NASA Astrophysics Data System (ADS)

    Yoshikawa, Shinya; Shinzawa, Kyoko; Tsukihara, Tomitake; Abe, Toshio; Caughey, Winslow S.


    The three-dimensional structure of cytochrome c oxidase, a complex (multimetal, multisubunit) membrane protein is critical to elucidation of the mechanism of the enzymic reactions and their control. Our recent developments in the crystallization of the enzyme isolated from beef hearts are presented. The crystals appeared more readily at higher protein concentration, lower ionic strength, higher detergent concentration (Brij-35) and lower temperature. Large crystals were obtained by changing one of these parameters to the crystallization point as slowly as possible, keeping the other parameters constant. Increasing the detergent concentration was the most successful method, producing green crystals of the resting oxidized form as hexagonal bipyramids with typical dimensions of 0.6 mm. The usual procedures for crystallization of water soluble proteins, such as increasing ionic strength by vapor diffusion, were not applicable for this enzyme. Crystals of the resting oxidized enzyme belong to a space group of P6 2 or P6 4 with cell dimensions, a = b = 208.7 Å and c = 282.3 Å. The Patterson function shows that the crystal exhibited a non-crystallographic two-fold axis parallel to the c-axis in the asymmetric unit.

  11. Polyphenol Oxidase from Hybrid Poplar. Cloning and Expression in Response to Wounding and Herbivory1

    PubMed Central

    Constabel, C. Peter; Yip, Lynn; Patton, Joseph J.; Christopher, Mary E.


    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa × Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests. PMID:10982443

  12. Polyphenol oxidase from hybrid poplar. Cloning and expression in response to wounding and herbivory.


    Constabel, C P; Yip, L; Patton, J J; Christopher, M E


    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa x Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests.

  13. Impact of the New ACC/AHA Guidelines on the Treatment of High Blood Cholesterol in a Managed Care Setting

    PubMed Central

    Tran, Josephine N.; Caglar, Toros; Stockl, Karen M.; Lew, Heidi C.; Solow, Brian K.; Chan, Paul S.


    Background In November 2013, the American College of Cardiology (ACC) and the American Heart Association (AHA) together issued new guidelines for the treatment of patients with high cholesterol, providing a new paradigm for the management of cholesterol in the primary and secondary prevention of coronary artery disease. Objective To examine the impact of the 2013 ACC/AHA cholesterol treatment guidelines on pharmacy utilization of cholesterol-lowering drugs in a real-world managed care setting. Methods Pharmacy claims from OptumRx, a national pharmacy benefit management provider, for the period between January 1, 2013, and December 31, 2013 (baseline period), were used to identify candidates for cholesterol-lowering therapy and to estimate the number of potential patients who will be starting or intensifying statin therapy based on the updated cholesterol treatment guidelines. Potential candidates for cholesterol-lowering treatments included patients with diabetes or hypertension aged 40 to 75 years who were not already receiving a cholesterol-lowering medication, as well as patients receiving cholesterol-lowering therapies during the baseline period. The baseline cholesterol-lowering medication market share was used to project changes in pharmacy utilization over the next 3 years. Results Based on the 2013 ACC/AHA cholesterol treatment guidelines, there will be a 25% increase in the proportion of the overall population that is treated with statins over the next 3 years, increasing from 3,909,407 (27.7%) patients to 4,892,668 (34.7%) patients. The largest proportion of the increase in statin utilization is projected to be for primary prevention in patients aged 40 to 75 years who were not receiving any cholesterol-lowering treatment at baseline. These projected changes will increase the overall number of statin prescriptions by 25% and will decrease the number of nonstatin cholesterol-lowering medication prescriptions by 68% during the next 3 years. Conclusion The

  14. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)


    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  15. Genetic and genomic analysis of Rhizoctonia solani interactions with Arabidopsis; evidence of resistance mediated through NADPH oxidases.


    Foley, Rhonda C; Gleason, Cynthia A; Anderson, Jonathan P; Hamann, Thorsten; Singh, Karam B


    Rhizoctonia solani is an important soil-borne necrotrophic fungal pathogen, with a broad host range and little effective resistance in crop plants. Arabidopsis is resistant to R. solani AG8 but susceptible to R. solani AG2-1. A screen of 36 Arabidopsis ecotypes and mutants affected in the auxin, camalexin, salicylic acid, abscisic acid and ethylene/jasmonic acid pathways did not reveal any variation in response to R. solani and demonstrated that resistance to AG8 was independent of these defense pathways. The Arabidopsis Affymetrix ATH1 Genome array was used to assess global gene expression changes in plants infected with AG8 and AG2-1 at seven days post-infection. While there was considerable overlap in the response, some gene families were differentially affected by AG8 or AG2-1 and included those involved in oxidative stress, cell wall associated proteins, transcription factors and heat shock protein genes. Since a substantial proportion of the gene expression changes were associated with oxidative stress responses, we analysed the role of NADPH oxidases in resistance. While single NADPH oxidase mutants had no effect, a NADPH oxidase double mutant atrbohf atrbohd resulted in an almost complete loss of resistance to AG8, suggesting that reactive oxidative species play an important role in Arabidopsis's resistance to R. solani.

  16. Characterization of an Apis cerana cerana cytochrome P450 gene (AccCYP336A1) and its roles in oxidative stresses responses.


    Zhu, Ming; Zhang, Weixing; Liu, Feng; Chen, Xiaobo; Li, Han; Xu, Baohua


    Cytochrome P450 monooxygenases (P450), widely distributed multifunctional enzymes, that play an important role in the oxidative metabolism of endogenous compounds and xenobiotics. Studies have found that these enzymes show peroxidase-like activity and may thus be involved in protecting organisms against reactive oxygen species (ROS). In this work, Apis cerana cerana was used to investigate the molecular mechanisms of P450 family genes in resisting ROS damage. A cytochrome P450 gene was isolated, AccCYP336A1. The open reading frame (ORF) of AccCYP336A1 is 1491bp in length and encodes a predicted protein of 496 amino acids. The obtained amino acid sequence of AccCYP336A1 shared a high sequence identity with homologous proteins and contained the highly conserved features of this protein family. Quantitative real-time PCR (qRT-PCR) analysis showed that AccCYP336A1 was present in some fast developmental stages and had a higher expression in the epidermis than in other tissues. Additionally, the expression levels of AccCYP336A1 were up-regulated by cold (4 °C), heat (42 °C), ultraviolet (UV) radiation, H2O2 and pesticide (thiamethoxam, deltamethrin, methomyl and phoxim) treatments. These results were confirmed by the western blot assays. Furthermore, the recombinant AccCYP336A1 protein acted as an antioxidant that resisted paraquat-induced oxidative stress. Taken together, these results suggest that AccCYP336A1 may play a very significant role in antioxidant defense against ROS damage. PMID:26877110

  17. Existence of aa3-type ubiquinol oxidase as a terminal oxidase in sulfite oxidation of Acidithiobacillus thiooxidans.


    Sugio, Tsuyoshi; Hisazumi, Tomohiro; Kanao, Tadayoshi; Kamimura, Kazuo; Takeuchi, Fumiaki; Negishi, Atsunori


    It was found that Acidithiobacillus thiooxidans has sulfite:ubiquinone oxidoreductase and ubiquinol oxidase activities in the cells. Ubiquinol oxidase was purified from plasma membranes of strain NB1-3 in a nearly homogeneous state. A purified enzyme showed absorption peaks at 419 and 595 nm in the oxidized form and at 442 and 605 nm in the reduced form. Pyridine ferrohaemochrome prepared from the enzyme showed an alpha-peak characteristic of haem a at 587 nm, indicating that the enzyme contains haem a as a component. The CO difference spectrum of ubiquinol oxidase showed two peaks at 428 nm and 595 nm, and a trough at 446 nm, suggesting the existence of an aa(3)-type cytochrome in the enzyme. Ubiquinol oxidase was composed of three subunits with apparent molecular masses of 57 kDa, 34 kDa, and 23 kDa. The optimum pH and temperature for ubiquinol oxidation were pH 6.0 and 30 degrees C. The activity was completely inhibited by sodium cyanide at 1.0 mM. In contrast, the activity was inhibited weakly by antimycin A(1) and myxothiazol, which are inhibitors of mitochondrial bc(1) complex. Quinone analog 2-heptyl-4-hydoroxyquinoline N-oxide (HOQNO) strongly inhibited ubiquinol oxidase activity. Nickel and tungstate (0.1 mM), which are used as a bacteriostatic agent for A. thiooxidans-dependent concrete corrosion, inhibited ubiquinol oxidase activity 100 and 70% respectively.

  18. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit.

  19. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  20. Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

    SciTech Connect

    Wang, Xianwei Lu, Jingjun; Khaidakov, Magomed; Mitra, Sona; Ding, Zufeng; Raina, Sameer; Goyal, Tanu; Mehta, Jawahar L.


    Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiac fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac fibroblast

  1. Monoamine oxidase and agitation in psychiatric patients.


    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela


    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  2. Specification of Dendritogenesis Site in Drosophila aCC Motoneuron by Membrane Enrichment of Pak1 through Dscam1.


    Kamiyama, Daichi; McGorty, Ryan; Kamiyama, Rie; Kim, Michael D; Chiba, Akira; Huang, Bo


    Precise positioning of dendritic branches is a critical step in the establishment of neuronal circuitry. However, there is limited knowledge on how environmental cues translate into dendrite initiation or branching at a specific position. Here, through a combination of mutation, RNAi, and imaging experiments, we found that a Dscam-Dock-Pak1 hierarchical interaction defines the stereotypical dendrite growth site in the Drosophila aCC motoneuron. This interaction localizes the Cdc42 effector Pak1 to the plasma membrane at the dendrite initiation site before the activation of Cdc42. Ectopic expression of membrane-anchored Pak1 overrides this spatial specification of dendritogenesis, confirming its function in guiding Cdc42 signaling. We further discovered that Dscam1 localization in aCC occurs through an inter-neuronal contact that involves Dscam1 in the partner MP1 neuron. These findings elucidate a mechanism by which Dscam1 controls neuronal morphogenesis through spatial regulation of Cdc42 signaling and, subsequently, cytoskeletal remodeling.

  3. OpenACC acceleration of an unstructured CFD solver based on a reconstructed discontinuous Galerkin method for compressible flows

    SciTech Connect

    Xia, Yidong; Lou, Jialin; Luo, Hong; Edwards, Jack; Mueller, Frank


    Here, an OpenACC directive-based graphics processing unit (GPU) parallel scheme is presented for solving the compressible Navier–Stokes equations on 3D hybrid unstructured grids with a third-order reconstructed discontinuous Galerkin method. The developed scheme requires the minimum code intrusion and algorithm alteration for upgrading a legacy solver with the GPU computing capability at very little extra effort in programming, which leads to a unified and portable code development strategy. A face coloring algorithm is adopted to eliminate the memory contention because of the threading of internal and boundary face integrals. A number of flow problems are presented to verify the implementation of the developed scheme. Timing measurements were obtained by running the resulting GPU code on one Nvidia Tesla K20c GPU card (Nvidia Corporation, Santa Clara, CA, USA) and compared with those obtained by running the equivalent Message Passing Interface (MPI) parallel CPU code on a compute node (consisting of two AMD Opteron 6128 eight-core CPUs (Advanced Micro Devices, Inc., Sunnyvale, CA, USA)). Speedup factors of up to 24× and 1.6× for the GPU code were achieved with respect to one and 16 CPU cores, respectively. The numerical results indicate that this OpenACC-based parallel scheme is an effective and extensible approach to port unstructured high-order CFD solvers to GPU computing.

  4. OpenACC acceleration of an unstructured CFD solver based on a reconstructed discontinuous Galerkin method for compressible flows


    Xia, Yidong; Lou, Jialin; Luo, Hong; Edwards, Jack; Mueller, Frank


    Here, an OpenACC directive-based graphics processing unit (GPU) parallel scheme is presented for solving the compressible Navier–Stokes equations on 3D hybrid unstructured grids with a third-order reconstructed discontinuous Galerkin method. The developed scheme requires the minimum code intrusion and algorithm alteration for upgrading a legacy solver with the GPU computing capability at very little extra effort in programming, which leads to a unified and portable code development strategy. A face coloring algorithm is adopted to eliminate the memory contention because of the threading of internal and boundary face integrals. A number of flow problems are presented to verify the implementationmore » of the developed scheme. Timing measurements were obtained by running the resulting GPU code on one Nvidia Tesla K20c GPU card (Nvidia Corporation, Santa Clara, CA, USA) and compared with those obtained by running the equivalent Message Passing Interface (MPI) parallel CPU code on a compute node (consisting of two AMD Opteron 6128 eight-core CPUs (Advanced Micro Devices, Inc., Sunnyvale, CA, USA)). Speedup factors of up to 24× and 1.6× for the GPU code were achieved with respect to one and 16 CPU cores, respectively. The numerical results indicate that this OpenACC-based parallel scheme is an effective and extensible approach to port unstructured high-order CFD solvers to GPU computing.« less

  5. Expression of Acc-Royalisin gene from royal jelly of Chinese honeybee in Escherichia coli and its antibacterial activity.


    Shen, Lirong; Ding, Meihui; Zhang, Liwen; Jin, Feng; Zhang, Weiguang; Li, Duo


    Royalisin is an antibacterial peptide found in Royal Jelly. Two gene fragments of Chinese honeybee (Apis cerana cerana) head, 280 bp cDNA encoding pre-pro-Acc-royalisin (PPAR) of 95 amino acid residues, and 165 bp cDNA encoding mature Acc-royalisin (MAR) of 51 amino acid residues were cloned into the pGEX-4T-2 vector. They were then transformed individually into Escherichia coli for expression. Two expressed fusion proteins, glutathione S-transferase (GST)-PPAR of 36 kDa and GST-MAR of 32 kDa were obtained, which were cross reacted with GST antibody accounting for up to 16.3% and 15.4% of bacterial protein, respectively. In addition, 41% of GST-PPAR and nearly 100% of GST-MAR were soluble proteins. Both lysates of the two purified fusion proteins displayed antibacterial activities, similar to that of nisin against Gram-positive bacteria strains, Staphylococcus aureus, Bacillus subtilis and Micrococcus luteus. MAR peptide released from the thrombin-cleaved GST-MAR fusion protein has a stronger antibacterial activity than that of GST-MAR fusion protein.

  6. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.


    Sytykiewicz, Hubert


    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. PMID:27178208

  7. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.


    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok


    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion. PMID:22846334

  8. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.


    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok


    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion.

  9. WRKY transcription factors.


    Rushton, Paul J; Somssich, Imre E; Ringler, Patricia; Shen, Qingxi J


    WRKY transcription factors are one of the largest families of transcriptional regulators in plants and form integral parts of signalling webs that modulate many plant processes. Here, we review recent significant progress in WRKY transcription factor research. New findings illustrate that WRKY proteins often act as repressors as well as activators, and that members of the family play roles in both the repression and de-repression of important plant processes. Furthermore, it is becoming clear that a single WRKY transcription factor might be involved in regulating several seemingly disparate processes. Mechanisms of signalling and transcriptional regulation are being dissected, uncovering WRKY protein functions via interactions with a diverse array of protein partners, including MAP kinases, MAP kinase kinases, 14-3-3 proteins, calmodulin, histone deacetylases, resistance proteins and other WRKY transcription factors. WRKY genes exhibit extensive autoregulation and cross-regulation that facilitates transcriptional reprogramming in a dynamic web with built-in redundancy.

  10. Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene.


    Irfan, Mohammad; Ghosh, Sumit; Meli, Vijaykumar S; Kumar, Anil; Kumar, Vinay; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis


    α-Mannosidase (α-Man), a fruit ripening-specific N-glycan processing enzyme, is involved in ripening-associated fruit softening process. However, the regulation of fruit-ripening specific expression of α-Man is not well understood. We have identified and functionally characterized the promoter of tomato (Solanum lycopersicum) α-Man to provide molecular insights into its transcriptional regulation during fruit ripening. Fruit ripening-specific activation of the α-Man promoter was revealed by analysing promoter driven expression of beta-glucuronidase (GUS) reporter in transgenic tomato. We found that RIPENING INHIBITOR (RIN), a MADS box family transcription factor acts as positive transcriptional regulator of α-Man during fruit ripening. RIN directly bound to the α-Man promoter sequence and promoter activation/α-Man expression was compromised in rin mutant fruit. Deletion analysis revealed that a promoter fragment (567 bp upstream of translational start site) that contained three CArG boxes (binding sites for RIN) was sufficient to drive GUS expression in fruits. In addition, α-Man expression was down-regulated in fruits of Nr mutant which is impaired in ethylene perception and promoter activation/α-Man expression was induced in wild type following treatment with a precursor of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC). Although, α-Man expression was induced in rin mutant after ACC treatment, the transcript level was less as compared to ACC-treated wild type. Taken together, these results suggest RIN-mediated direct transcriptional regulation of α-Man during fruit ripening and ethylene may acts in RIN-dependent and -independent ways to regulate α-Man expression. PMID:26834776

  11. Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene

    PubMed Central

    Irfan, Mohammad; Ghosh, Sumit; Meli, Vijaykumar S.; Kumar, Anil; Kumar, Vinay; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis


    α-Mannosidase (α-Man), a fruit ripening-specific N-glycan processing enzyme, is involved in ripening-associated fruit softening process. However, the regulation of fruit-ripening specific expression of α-Man is not well understood. We have identified and functionally characterized the promoter of tomato (Solanum lycopersicum) α-Man to provide molecular insights into its transcriptional regulation during fruit ripening. Fruit ripening-specific activation of the α-Man promoter was revealed by analysing promoter driven expression of beta-glucuronidase (GUS) reporter in transgenic tomato. We found that RIPENING INHIBITOR (RIN), a MADS box family transcription factor acts as positive transcriptional regulator of α-Man during fruit ripening. RIN directly bound to the α-Man promoter sequence and promoter activation/α-Man expression was compromised in rin mutant fruit. Deletion analysis revealed that a promoter fragment (567 bp upstream of translational start site) that contained three CArG boxes (binding sites for RIN) was sufficient to drive GUS expression in fruits. In addition, α-Man expression was down-regulated in fruits of Nr mutant which is impaired in ethylene perception and promoter activation/α-Man expression was induced in wild type following treatment with a precursor of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC). Although, α-Man expression was induced in rin mutant after ACC treatment, the transcript level was less as compared to ACC-treated wild type. Taken together, these results suggest RIN-mediated direct transcriptional regulation of α-Man during fruit ripening and ethylene may acts in RIN-dependent and -independent ways to regulate α-Man expression. PMID:26834776

  12. The ROS Wheel: Refining ROS Transcriptional Footprints1[OPEN

    PubMed Central

    Noctor, Graham


    In the last decade, microarray studies have delivered extensive inventories of transcriptome-wide changes in messenger RNA levels provoked by various types of oxidative stress in Arabidopsis (Arabidopsis thaliana). Previous cross-study comparisons indicated how different types of reactive oxygen species (ROS) and their subcellular accumulation sites are able to reshape the transcriptome in specific manners. However, these analyses often employed simplistic statistical frameworks that are not compatible with large-scale analyses. Here, we reanalyzed a total of 79 Affymetrix ATH1 microarray studies of redox homeostasis perturbation experiments. To create hierarchy in such a high number of transcriptomic data sets, all transcriptional profiles were clustered on the overlap extent of their differentially expressed transcripts. Subsequently, meta-analysis determined a single magnitude of differential expression across studies and identified common transcriptional footprints per cluster. The resulting transcriptional footprints revealed the regulation of various metabolic pathways and gene families. The RESPIRATORY BURST OXIDASE HOMOLOG F-mediated respiratory burst had a major impact and was a converging point among several studies. Conversely, the timing of the oxidative stress response was a determining factor in shaping different transcriptome footprints. Our study emphasizes the need to interpret transcriptomic data sets in a systematic context, where initial, specific stress triggers can converge to common, aspecific transcriptional changes. We believe that these refined transcriptional footprints provide a valuable resource for assessing the involvement of ROS in biological processes in plants. PMID:27246095

  13. Sulfide inhibition of and metabolism by cytochrome c oxidase.


    Nicholls, Peter; Marshall, Doug C; Cooper, Chris E; Wilson, Mike T


    Hydrogen sulfide (H2S), a classic cytochrome c oxidase inhibitor, is also an in vitro oxidase substrate and an in vivo candidate hormonal ('gasotransmitter') species affecting sleep and hibernation. H2S, nitric oxide (NO) and carbon monoxide (CO) share some common features. All are low-molecular-mass physiological effectors and also oxidase inhibitors, capable of binding more than one enzyme site, and each is an oxidizable 'substrate'. The oxidase oxidizes CO to CO2, NO to nitrite and sulfide to probable persulfide species. Mitochondrial cytochrome c oxidase in an aerobic steady state with ascorbate and cytochrome c is rapidly inhibited by sulfide in a biphasic manner. At least two successive inhibited species are involved, probably partially reduced. The oxidized enzyme, in the absence of turnover, occurs in at least two forms: the 'pulsed' and 'resting' states. The pulsed form reacts aerobically with sulfide to form two intermediates, 'P' and 'F', otherwise involved in the reaction of oxygen with reduced enzyme. Sulfide can directly reduce the oxygen-reactive a3CuB binuclear centre in the pulsed state. The resting enzyme does not undergo such a step, but only a very slow one-electron reduction of the electron-transferring haem a. In final reactivation phases, both the steady-state inhibition of catalysis and the accumulation of P and F states are reversed by slow sulfide oxidation. A model for this complex reaction pattern is presented. PMID:24059525

  14. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf


    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  15. New Insights Into the Roles of NADPH Oxidases in Sexual Development and Ascospore Germination in Sordaria macrospora

    PubMed Central

    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich


    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

  16. Salivary glucose oxidase from caterpillars mediates the induction of rapid and delayed-induced defenses in the tomato plant.


    Tian, Donglan; Peiffer, Michelle; Shoemaker, Erica; Tooker, John; Haubruge, Eric; Francis, Frederic; Luthe, Dawn S; Felton, Gary W


    Caterpillars produce oral secretions that may serve as cues to elicit plant defenses, but in other cases these secretions have been shown to suppress plant defenses. Ongoing work in our laboratory has focused on the salivary secretions of the tomato fruitworm, Helicoverpa zea. In previous studies we have shown that saliva and its principal component glucose oxidase acts as an effector by suppressing defenses in tobacco. In this current study, we report that saliva elicits a burst of jasmonic acid (JA) and the induction of late responding defense genes such as proteinase inhibitor 2 (Pin2). Transcripts encoding early response genes associated with the JA pathway were not affected by saliva. We also observed a delayed response to saliva with increased densities of Type VI glandular trichomes in newly emerged leaves. Proteomic analysis of saliva revealed glucose oxidase (GOX) was the most abundant protein identified and we confirmed that it plays a primary role in the induction of defenses in tomato. These results suggest that the recognition of GOX in tomato may represent a case for effector-triggered immunity. Examination of saliva from other caterpillar species indicates that saliva from the noctuids Spodoptera exigua and Heliothis virescens also induced Pin2 transcripts.

  17. Salivary Glucose Oxidase from Caterpillars Mediates the Induction of Rapid and Delayed-Induced Defenses in the Tomato Plant

    PubMed Central

    Tian, Donglan; Peiffer, Michelle; Shoemaker, Erica; Tooker, John; Haubruge, Eric; Francis, Frederic; Luthe, Dawn S.; Felton, Gary W.


    Caterpillars produce oral secretions that may serve as cues to elicit plant defenses, but in other cases these secretions have been shown to suppress plant defenses. Ongoing work in our laboratory has focused on the salivary secretions of the tomato fruitworm, Helicoverpa zea. In previous studies we have shown that saliva and its principal component glucose oxidase acts as an effector by suppressing defenses in tobacco. In this current study, we report that saliva elicits a burst of jasmonic acid (JA) and the induction of late responding defense genes such as proteinase inhibitor 2 (Pin2). Transcripts encoding early response genes associated with the JA pathway were not affected by saliva. We also observed a delayed response to saliva with increased densities of Type VI glandular trichomes in newly emerged leaves. Proteomic analysis of saliva revealed glucose oxidase (GOX) was the most abundant protein identified and we confirmed that it plays a primary role in the induction of defenses in tomato. These results suggest that the recognition of GOX in tomato may represent a case for effector-triggered immunity. Examination of saliva from other caterpillar species indicates that saliva from the noctuids Spodoptera exigua and Heliothis virescens also induced Pin2 transcripts. PMID:22558369

  18. pACC1 peptide loaded chitosan nanoparticles induces apoptosis via reduced fatty acid synthesis in MDA-MB-231 cells

    NASA Astrophysics Data System (ADS)

    Kaliaperumal, Jagatheesh; Hari, Natarajan; Pavankumar, Padarthi; Elangovan, Namasivayam


    The development of formulations with therapeutic peptides has been restricted to poor cell penetration and in this attempt; we developed pACC1 peptide loaded chitosan nanoparticles. The prepared nanoparticles were characterized with FT-IR, XRD, SEM and TEM. In addition, the suitable formulation was evaluated for hemocompatibility, plasma stability and embryo toxicity using Danio rerio embryo model. The results showed that pACC1 peptide loaded chitosan nanoparticles were compatible with plasma. They possess sustained release pattern and also found to be safe up to 300 mg/L in embryo toxicity tests. Cytotoxicity assays with MDA-MB-231 cell lines suggested that, pACC1 peptide loaded chitosan nanoparticles were capable of enhanced cellular penetration and reduced palmitic acid content, which was confirmed by H1 NMR. Hence, these nanoparticles could be employed as excellent adjuvant therapeutics while treating solid tumors with multi-drug resistance.

  19. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.


    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated

  20. Expression of alternative oxidase in Drosophila ameliorates diverse phenotypes due to cytochrome oxidase deficiency

    PubMed Central

    Kemppainen, Kia K.; Rinne, Juho; Sriram, Ashwin; Lakanmaa, Matti; Zeb, Akbar; Tuomela, Tea; Popplestone, Anna; Singh, Satpal; Sanz, Alberto; Rustin, Pierre; Jacobs, Howard T.


    Mitochondrial dysfunction is a significant factor in human disease, ranging from systemic disorders of childhood to cardiomyopathy, ischaemia and neurodegeneration. Cytochrome oxidase, the terminal enzyme of the mitochondrial respiratory chain, is a frequent target. Lower eukaryotes possess alternative respiratory-chain enzymes that provide non-proton-translocating bypasses for respiratory complexes I (single-subunit reduced nicotinamide adenine dinucleotide dehydrogenases, e.g. Ndi1 from yeast) or III + IV [alternative oxidase (AOX)], under conditions of respiratory stress or overload. In previous studies, it was shown that transfer of yeast Ndi1 or Ciona intestinalis AOX to Drosophila was able to overcome the lethality produced by toxins or partial knockdown of complex I or IV. Here, we show that AOX can provide a complete or substantial rescue of a range of phenotypes induced by global or tissue-specific knockdown of different cIV subunits, including integral subunits required for catalysis, as well as peripheral subunits required for multimerization and assembly. AOX was also able to overcome the pupal lethality produced by muscle-specific knockdown of subunit CoVb, although the rescued flies were short lived and had a motility defect. cIV knockdown in neurons was not lethal during development but produced a rapidly progressing locomotor and seizure-sensitivity phenotype, which was substantially alleviated by AOX. Expression of Ndi1 exacerbated the neuronal phenotype produced by cIV knockdown. Ndi1 expressed in place of essential cI subunits produced a distinct residual phenotype of delayed development, bang sensitivity and male sterility. These findings confirm the potential utility of alternative respiratory chain enzymes as tools to combat mitochondrial disease, while indicating important limitations thereof. PMID:24293544

  1. Regulation of Ascorbate Oxidase Expression in Pumpkin by Auxin and Copper 1

    PubMed Central

    Esaka, Muneharu; Fujisawa, Kouichi; Goto, Miwa; Kisu, Yasutomo


    Ascorbate oxidase expression in pumpkin (Cucurbita spp.) tissues was studied. Specific ascorbate oxidase activities in pumpkin leaf and stem tissues were about 2 and 1.5 times that in the fruit tissues, respectively. In seeds, little ascorbate oxidase activity was detected. Northern blot analyses showed an abundant ascorbate oxidase mRNA in leaf and stem tissues. Fruit tissues had lower levels of ascorbate oxidase mRNA than leaf and stem tissues. Ascorbate oxidase mRNA was not detected in seeds. Specific ascorbate oxidase activity gradually increased during early seedling growth of pumpkin seeds. The increase was accompanied by an increase in ascorbate oxidase mRNA. When ascorbate oxidase activity in developing pumpkin fruits was investigated, the activities in immature fruits that are rapidly growing at 0, 2, 4, and 7 d after anthesis were much higher than those in mature fruits at 14 and 30 d after anthesis. The specific activity and mRNA of ascorbate oxidase markedly increased after inoculation of pumpkin fruit tissues into Murashige and Skoog's culture medium in the presence of an auxin such as 2,4-dichlorophenoxyacetic acid (2,4-D) but not in the absence of 2,4-D. In the presence of 10 mg/L of 2,4-D, ascorbate oxidase mRNA was the most abundant. Thus, ascorbate oxidase is induced by 2,4-D. These results indicate that ascorbate oxidase is involved in cell growth. In pumpkin callus, ascorbate oxidase activity could be markedly increased by adding copper. Furthermore, immunological blotting showed that the amount of ascorbate oxidase protein was also increased by adding copper. However, northern blot analyses showed that ascorbate oxidase mRNA was not increased by adding copper. We suggest that copper may control ascorbate oxidase expression at translation or at a site after translation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:16652952

  2. Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

    SciTech Connect

    Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W. . E-mail:


    High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an {alpha}-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10{sup 4} U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions.

  3. Studies on the active site of pig plasma amine oxidase.

    PubMed Central

    Collison, D; Knowles, P F; Mabbs, F E; Rius, F X; Singh, I; Dooley, D M; Cote, C E; McGuirl, M


    Amine oxidase from pig plasma (PPAO) has two bound Cu2+ ions and at least one pyrroloquinoline quinone (PQQ) moiety as cofactors. It is shown that recovery of activity by copper-depleted PPAO is linear with respect to added Cu2+ ions. Recovery of e.s.r. and optical spectral characteristics of active-site copper parallel the recovery of catalytic activity. These results are consistent with both Cu2+ ions contributing to catalysis. Further e.s.r. studies indicate that the two copper sites in PPAO, unlike those in amine oxidases from other sources, are chemically distinct. These comparative studies establish that non-identity of the Cu2+ ions in PPAO is not a requirement for amine oxidase activity. It is shown through the use of a new assay procedure that there are two molecules of PQQ bound per molecule of protein in PPAO; only the more reactive of these PQQ moieties is required for activity. PMID:2559715

  4. X-ray absorption spectroscopy of chicken sulfite oxidase crystals

    SciTech Connect

    George, G.N.; Pickering, I.J.; Kisker, C.


    Sulfite oxidase catalyzes the physiologically vital oxidation of sulfite to sulfate. Recently, the crystal structure of chicken sulfite oxidase has been reported at 1.9 {angstrom} resolution. In contrast to the information available from previous X-ray absorption spectroscopic studies, the active site indicated by crystallography was a mono-oxo species. Because of this the possibility that the crystals did in fact contain a reduced molybdenum species was considered in the crystallographic work. The authors report herein an X-ray absorption spectroscopic study of polycrystalline sulfite oxidase prepared in the same manner as the previous single-crystal samples, and compare this with data for frozen solutions of oxidized and reduced enzyme.

  5. The use of galactose oxidase in lipid labeling

    SciTech Connect

    Radin, N.S.; Evangelatos, G.P.


    Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using (6-/sup 3/H)galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate.

  6. Composition of partially purified NADPH oxidase from pig neutrophils.

    PubMed Central

    Bellavite, P; Jones, O T; Cross, A R; Papini, E; Rossi, F


    The superoxide (O2.-)-forming enzyme NADPH oxidase from pig neutrophils was solubilized and partially purified by gel-filtration chromatography. The purification procedure allowed the separation of NADPH oxidase activity from NADH-dependent cytochrome c reductase and 2,6-dichlorophenol-indophenol reductase activities. O2.-forming activity was co-purified with cytochrome b-245 and was associated with phospholipids. However, active fractions endowed with cytochrome b were devoid of ubiquinone and contained only little FAD. The cytochrome b/FAD ratio was 1.13:1 in the crude solubilized extract and increased to 18.95:1 in the partially purified preparations. Most of FAD was associated with fractions containing NADH-dependent oxidoreductases. These results are consistent with the postulated role of cytochrome b in O2.-formation by neutrophil NADPH oxidase, but raise doubts about the participation of flavoproteins in this enzyme activity. PMID:6439185

  7. Improved operational stability of peroxidases by coimmobilization with glucose oxidase.


    van de Velde, F; Lourenço, N D; Bakker, M; van Rantwijk, F; Sheldon, R A


    The operational stability of peroxidases was considerably enhanced by generating hydrogen peroxide in situ from glucose and oxygen. For example, the total turnover number of microperoxidase-11 in the oxidation of thioanisole was increased sevenfold compared with that obtained with continuous addition of H(2)O(2). Coimmobilization of peroxidases with glucose oxidase into polyurethane foams afforded heterogeneous biocatalysts in which the hydrogen peroxide is formed inside the polymeric matrix from glucose and oxygen. The total turnover number of chloroperoxidase in the oxidation of thioanisole and cis-2-heptene was increased to new maxima of 250. 10(3) and 10. 10(3), respectively, upon coimmobilization with glucose oxidase. Soybean peroxidase, which normally shows only classical peroxidase activity, was transformed into an oxygen-transfer catalyst when coimmobilized with glucose oxidase. The combination catalyst mediated the enantioselective oxidation of thioanisole [50% ee (S)] with 210 catalyst turnovers. PMID:10861408

  8. The mechanism of cytochrome C oxidase inhibition by nitric oxide.


    Antunes, Fernando; Cadenas, Enrique


    The basic biochemistry of the inhibition of cytochrome oxidase by NO is reviewed. Three possible mechanisms that include the binding of NO to the fully reduced Fe(a3)-Cu(B) site, to the semi-reduced Fe(a3)-Cu(B) site, and to the fully oxidized Fe(a3)-Cu(B) site are confronted with the experimental data. Mathematical models are used to facilitate the analysis and to solve puzzling observations concerning the NO inhibition of cytochrome oxidase. It is concluded that the inhibition of cytochrome oxidase by NO is mixed, having both competitive and uncompetitive components, but under physiological electron flows the competitive component is largely predominant. The physiological and pathological relevance of this inhibition is briefly discussed.

  9. Oxidation of polymines by diamine oxidase from human seminal plasma.

    PubMed Central

    Hölttä, E; Pulkkinen, P; Elfving, K; Jänne, J


    1. Diamine oxidase [amine-oxygen oxidoreductase (deaminating)(pyridoxal-containing), EC] was purified from human seminal plasma more than 1,700-fold. The enzyme appeared to be homogeneous on polyacrylamide-gel electrophoresis at two different pH values. 2. The general properties of the enzyme were comparable with those described for other diamine oxidases from different mammalian sources. The molecular weight of the enzyme was calculated to be about 182,000. 3. The enzyme had highest affinity for diamines, but polyamines spermidine and spermine were also degraded at concentrations that can be considered physiological in human semen. 3. The possible degradation of spermine by diamine oxidase in human semen in vivo may give rise to the formation of cytotoxic aldehydes that conceivably can influence the motility and survival of the spermatozoa. PMID:239684

  10. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.


    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K


    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology. PMID:26164855

  11. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.


    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K


    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology.

  12. The STS-ACC transcatheter valve therapy national registry: a new partnership and infrastructure for the introduction and surveillance of medical devices and therapies.


    Carroll, John D; Edwards, Fred H; Marinac-Dabic, Danica; Brindis, Ralph G; Grover, Frederick L; Peterson, Eric D; Tuzcu, E Murat; Shahian, David M; Rumsfeld, John S; Shewan, Cynthia M; Hewitt, Kathleen; Holmes, David R; Mack, Michael J


    The Society of Thoracic Surgeons (STS) and American College of Cardiology (ACC) transcatheter valve therapy (TVT) registry is a novel, national registry for all new TVT devices created through a partnership of the STS and the ACC in close collaboration with the Food and Drug Administration, the Center for Medicare and Medicaid Services, and the Duke Clinical Research Institute. The registry will serve as an objective, comprehensive, and scientifically based resource to improve the quality of patient care, to monitor the safety and effectiveness of TVT devices, to serve as an analytic resource for TVT research, and to enhance communication among key stakeholders. PMID:23644082

  13. The STS-ACC transcatheter valve therapy national registry: a new partnership and infrastructure for the introduction and surveillance of medical devices and therapies.


    Carroll, John D; Edwards, Fred H; Marinac-Dabic, Danica; Brindis, Ralph G; Grover, Frederick L; Peterson, Eric D; Tuzcu, E Murat; Shahian, David M; Rumsfeld, John S; Shewan, Cynthia M; Hewitt, Kathleen; Holmes, David R; Mack, Michael J


    The Society of Thoracic Surgeons (STS) and American College of Cardiology (ACC) transcatheter valve therapy (TVT) registry is a novel, national registry for all new TVT devices created through a partnership of the STS and the ACC in close collaboration with the Food and Drug Administration, the Center for Medicare and Medicaid Services, and the Duke Clinical Research Institute. The registry will serve as an objective, comprehensive, and scientifically based resource to improve the quality of patient care, to monitor the safety and effectiveness of TVT devices, to serve as an analytic resource for TVT research, and to enhance communication among key stakeholders.

  14. Effect of solvents on the fumonisins analysis by high-performance liquid chromatography with AccQ.Fluor as the derivatizing reagent.


    Velázquez, C; Llovera, M; Plana, J; Canela, R


    The effect of several solvent systems on the chromatographic response of fumonisin B1 and B2 derived with 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AccQ.Fluor) is described. Naturally contaminated corn samples were extracted and purified by a standard method. Then, samples were dissolved in different solvents, derived with AccQ.Fluor reagent and analysed using HPLC. Results were solvent dependent, methanol being the best one among all assayed solvents for both fumonisins studied and acetonitrile the poorest. o-Phthaldialdehyde (OPA) reagent was used as a reference method.

  15. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    SciTech Connect

    Qin, Ling; Mills, Denise A.; Buhrow, Leann; Hiser, Carrie; Ferguson-Miller, Shelagh


    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  16. Functional characterization of gibberellin oxidases from cucumber, Cucumis sativus L.


    Pimenta Lange, Maria João; Liebrandt, Anja; Arnold, Linda; Chmielewska, Sara-Miriam; Felsberger, André; Freier, Eduard; Heuer, Monika; Zur, Doreen; Lange, Theo


    Cucurbits have been used widely to elucidate gibberellin (GA) biosynthesis. With the recent availability of the genome sequence for the economically important cucurbit Cucumis sativus, sequence data became available for all genes potentially involved in GA biosynthesis for this species. Sixteen cDNAs were cloned from root and shoot of 3-d to 7-d old seedlings and from mature seeds of C. sativus. Two cDNAs code for GA 7-oxidases (CsGA7ox1, and -2), five for GA 20-oxidases (CsGA20ox1, -2, -3, -4, and -5), four for GA 3-oxidases (CsGA3ox1, -2, -3, and -4), and another five for GA 2-oxidases (CsGA2ox1, -2, -3, -4, and -5). Their enzymatic activities were investigated by heterologous expression of the cDNAs in Escherichia coli and incubation of the cell lysates with (14)C-labelled, D2-labelled, or unlabelled GA-substrates. The two GA 7-oxidases converted GA12-aldehyde to GA12 efficiently. CsGA7ox1 converted GA12 to GA14, to 15α-hydroxyGA12, and further to 15α-hydroxyGA14. CsGA7ox2 converted GA12 to its 12α-hydroxylated analogue GA111. All five GA 20-oxidases converted GA12 to GA9 as a major product, and to GA25 as a minor product. The four GA 3-oxidases oxidized the C19-GA GA9 to GA4 as the only product. In addition, three of them (CsGA3ox2, -3, and -4) converted the C20-GA GA12 to GA14. The GA 2-oxidases CsGA2ox1, -2, -3, and -4 oxidized the C19-GAs GA9 and GA4 to GA34 and GA51, respectively. CsGA2ox2, -3, and -4 converted GA51 and GA34 further to respective GA-catabolites. In addition to C19-GAs, CsGA2ox4 also converted the C20-GA GA12 to GA110. In contrast, CsGA2ox5 oxidized only the C20 GA12 to GA110 as the sole product. As shown for CsGA20ox1 and CsGA3ox1, similar reactions were catalysed with 13-hydroxlyated GAs as substrates. It is likely that these enzymes are also responsible for the biosynthesis of 13-hydroxylated GAs in vivo that occur at low levels in cucumber.

  17. Colloidal properties of biomacromolecular solutions: Towards urate oxidase crystal design

    NASA Astrophysics Data System (ADS)

    Bonneté, Françoise


    Crystallization of biological macromolecules is governed by weak interaction forces, attractive and repulsive. Knowledge of solution properties, via second virial coefficient measurements, makes it possible to select physico-chemical parameters that govern and control phase diagrams and thus to grow crystals for specific applications (bio-crystallography or pharmaceutical processes). We highlight here with urate oxidase a salting-in effect that increases its solubility and the depletion effect of amphiphilic polymer, at a polymer concentration above its cmc, in order to grow diffracting crystals of urate oxidase. These two effects were used to grow crystals for high pressure crystallography and in a purification process.

  18. Spatiotemporal Production of Reactive Oxygen Species by NADPH Oxidase Is Critical for Tapetal Programmed Cell Death and Pollen Development in Arabidopsis.


    Xie, Hong-Tao; Wan, Zhi-Yuan; Li, Sha; Zhang, Yan


    Male sterility in angiosperms has wide applications in agriculture, particularly in hybrid crop breeding and gene flow control. Microspores develop adjacent to the tapetum, a layer of cells that provides nutrients for pollen development and materials for pollen wall formation. Proper pollen development requires programmed cell death (PCD) of the tapetum, which requires transcriptional cascades and proteolytic enzymes. Reactive oxygen species (ROS) also affect tapetal PCD, and failures in ROS scavenging cause male sterility. However, many aspects of tapetal PCD remain unclear, including what sources generate ROS, whether ROS production has a temporal pattern, and how the ROS-producing system interacts with the tapetal transcriptional network. We report here that stage-specific expression of NADPH oxidases in the Arabidopsis thaliana tapetum contributes to a temporal peak of ROS production. Genetic interference with the temporal ROS pattern, by manipulating RESPIRATORY-BURST OXIDASE HOMOLOG (RBOH) genes, affected the timing of tapetal PCD and resulted in aborted male gametophytes. We further show that the tapetal transcriptional network regulates RBOH expression, indicating that the temporal pattern of ROS production intimately connects to other signaling pathways regulated by the tapetal transcriptional network to ensure the proper timing of tapetal PCD.

  19. Spatiotemporal Production of Reactive Oxygen Species by NADPH Oxidase Is Critical for Tapetal Programmed Cell Death and Pollen Development in Arabidopsis[C][W

    PubMed Central

    Xie, Hong-Tao; Wan, Zhi-Yuan; Li, Sha; Zhang, Yan


    Male sterility in angiosperms has wide applications in agriculture, particularly in hybrid crop breeding and gene flow control. Microspores develop adjacent to the tapetum, a layer of cells that provides nutrients for pollen development and materials for pollen wall formation. Proper pollen development requires programmed cell death (PCD) of the tapetum, which requires transcriptional cascades and proteolytic enzymes. Reactive oxygen species (ROS) also affect tapetal PCD, and failures in ROS scavenging cause male sterility. However, many aspects of tapetal PCD remain unclear, including what sources generate ROS, whether ROS production has a temporal pattern, and how the ROS-producing system interacts with the tapetal transcriptional network. We report here that stage-specific expression of NADPH oxidases in the Arabidopsis thaliana tapetum contributes to a temporal peak of ROS production. Genetic interference with the temporal ROS pattern, by manipulating RESPIRATORY-BURST OXIDASE HOMOLOG (RBOH) genes, affected the timing of tapetal PCD and resulted in aborted male gametophytes. We further show that the tapetal transcriptional network regulates RBOH expression, indicating that the temporal pattern of ROS production intimately connects to other signaling pathways regulated by the tapetal transcriptional network to ensure the proper timing of tapetal PCD. PMID:24808050

  20. Morphology of nuclear transcription.


    Weipoltshammer, Klara; Schöfer, Christian


    Gene expression control is a fundamental determinant of cellular life with transcription being the most important step. The spatial nuclear arrangement of the transcription process driven by RNA polymerases II and III is nonrandomly organized in foci, which is believed to add another regulatory layer on gene expression control. RNA polymerase I transcription takes place within a specialized organelle, the nucleolus. Transcription of ribosomal RNA directly responds to metabolic requirements, which in turn is reflected in the architecture of nucleoli. It differs from that of the other polymerases with respect to the gene template organization, transcription rate, and epigenetic expression control, whereas other features are shared like the formation of DNA loops bringing genes and components of the transcription machinery in close proximity. In recent years, significant advances have been made in the understanding of the structural prerequisites of nuclear transcription, of the arrangement in the nuclear volume, and of the dynamics of these entities. Here, we compare ribosomal RNA and mRNA transcription side by side and review the current understanding focusing on structural aspects of transcription foci, of their constituents, and of the dynamical behavior of these components with respect to foci formation, disassembly, and cell cycle. PMID:26847177

  1. A Nonnatural Transcriptional Coactivator

    NASA Astrophysics Data System (ADS)

    Nyanguile, Origene; Uesugi, Motonari; Austin, David J.; Verdine, Gregory L.


    In eukaryotes, sequence-specific DNA-binding proteins activate gene expression by recruiting the transcriptional apparatus and chromatin remodeling proteins to the promoter through protein-protein contacts. In many instances, the connection between DNA-binding proteins and the transcriptional apparatus is established through the intermediacy of adapter proteins known as coactivators. Here we describe synthetic molecules with low molecular weight that act as transcriptional coactivators. We demonstrate that a completely nonnatural activation domain in one such molecule is capable of stimulating transcription in vitro and in vivo. The present strategy provides a means of gaining external control over gene activation through intervention using small molecules.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  3. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.


    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu


    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  4. SCAI/AATS/ACC/STS operator and institutional requirements for transcatheter valve repair and replacement, Part III: Pulmonic valve.


    Hijazi, Ziyad M; Ruiz, Carlos E; Zahn, Evan; Ringel, Richard; Aldea, Gabriel S; Bacha, Emile A; Bavaria, Joseph; Bolman, R Morton; Cameron, Duke E; Dean, Larry S; Feldman, Ted; Fullerton, David; Horlick, Eric; Mack, Michael J; Miller, D Craig; Moon, Marc R; Mukherjee, Debabrata; Trento, Alfredo; Tommaso, Carl L


    With the evolution of transcatheter valve replacement, an important opportunity has arisen for cardiologists and surgeons to collaborate in identifying the criteria for performing these procedures. Therefore, The Society for Cardiovascular Angiography and Interventions (SCAI), American Association for Thoracic Surgery (AATS), American College of Cardiology (ACC), and The Society of Thoracic Surgeons (STS) have partnered to provide recommendations for institutions to assess their potential for instituting and/or maintaining a transcatheter valve program. This article concerns transcatheter pulmonic valve replacement (tPVR). tPVR procedures are in their infancy with few reports available on which to base an expert consensus statement. Therefore, many of these recommendations are based on expert consensus and the few reports available. As the procedures evolve, technology advances, experience grows, and more data accumulate, there will certainly be a need to update this consensus statement. The writing committee and participating societies believe that the recommendations in this report serve as appropriate requisites. In some ways, these recommendations apply to institutions more than to individuals. There is a strong consensus that these new valve therapies are best performed using a Heart Team approach; thus, these credentialing criteria should be applied at the institutional level. Partnering societies used the ACC's policy on relationships with industry (RWI) and other entities to author this document ( To avoid actual, potential, or perceived conflicts of interest due to industry relationships or personal interests, all members of the writing committee, as well as peer reviewers of the document, were asked to disclose all current healthcare-related relationships including those existing 12 months before the initiation of the writing effort. A committee of interventional cardiologists and

  5. Removal of Asbestos-Containing Coatings (ACC) from gas transmission pipelines. Final report, January 1991-October 1993

    SciTech Connect

    Petersen, L.E.; Blackburn, M.L.


    Corrosion control coatings on transmission pipelines may contain asbestos as a secondary component of the coating. Current environmental and health regulations require a wet removal process for asbestos materials that provides close control of airborne emissions and asbestos fibers in effluent water. Modification of current line-traveling, water jet equipment was successfully completed in developing an economic removal process for asbestos-containing coatings (ACC). Materials handling components were added in yard experiments that permitted water jet removal, slurry filtration, and residue containerization meeting emission control levels, while providing pipe cleanliness suitable for recoating. Field evaluations under in-the-ditch and over-the-ditch conditions on 16-, 26- and 30-inch pipelines verified the achievement of design coating removal rates and asbestos emission control that meets current regulations.

  6. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  7. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.


    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  8. Pre-LTP requires extracellular signal-regulated kinase in the ACC

    PubMed Central

    Yamanaka, Manabu; Tian, Zhen; Darvish-Ghane, Soroush


    The extracellular signal-regulated kinase is an important protein kinase for cortical plasticity. Long-term potentiation in the anterior cingulate cortex is believed to play important roles in chronic pain, fear, and anxiety. Previous studies of extracellular signal-regulated kinase are mainly focused on postsynaptic form of long-term potentiation (post-long-term potentiation). Little is known about the relationship between extracellular signal-regulated kinase and presynaptic long-term potentiation (pre-long-term potentiation) in cortical synapses. In this study, we examined whether pre-long-term potentiation in the anterior cingulate cortex requires the activation of presynaptic extracellular signal-regulated kinase. We found that p42/p44 mitogen-activated protein kinase inhibitors, PD98059 and U0126, suppressed the induction of pre-long-term potentiation. By contrast, these inhibitors did not affect the maintenance of pre-long-term potentiation. Using pharmacological inhibitors, we found that pre-long-term potentiation recorded for 1 h did not require transcriptional or translational processes. Our results strongly indicate that the activation of presynaptic extracellular signal-regulated kinase is required for the induction of pre-long-term potentiation, and this involvement may explain the contribution of extracellular signal-regulated kinase to mood disorders. PMID:27178245

  9. 2015 ACC Health Policy Statement on Cardiovascular Team-Based Care and the Role of Advanced Practice Providers.


    Brush, John E; Handberg, Eileen M; Biga, Cathleen; Birtcher, Kim K; Bove, Alfred A; Casale, Paul N; Clark, Michael G; Garson, Arthur; Hines, Jerome L; Linderbaum, Jane A; Rodgers, George P; Shor, Robert A; Thourani, Vinod H; Wyman, Janet F


    The mission of the American College of Cardiology is "to transform cardiovascular care and improve heart health." Cardiovascular team-based care is a paradigm for practice that can transform care, improve heart health, and help meet the demands of the future. One strategic goal of the College is to help members successfully transition their clinical practices to the future, with all its complexity, challenges, and opportunities. The ACC's strategic plan is aligned with the triple aim of improved care, improved population health, and lower costs per capita. The traditional understanding of quality, access, and cost is that you cannot improve one component without diminishing the others. With cardiovascular team-based care, it is possible to achieve the triple aim of improving quality, access, and cost simultaneously to also improve cardiovascular health. Striving to serve the best interests of patients is the true north of our guiding principles. Cardiovascular team-based care is a model that can improve care coordination and communication and allow each team member to focus more on the quality of care. In addition, the cardiovascular team-based care model increases access to cardiovascular care and allows expansion of services to populations and geographic areas that are currently underserved. This document will increase awareness of the important components of cardiovascular team-based care and create an opportunity for more discussion about the most creative and effective means of implementing it. We hope that this document will stimulate further discussions and activities within the ACC and beyond about team-based care. We have identified areas that need improvement, specifically in APP education and state regulation. The document encourages the exploration of collaborative care models that should enable team members to optimize their education, training, experience, and talent. Improved team leadership, coordination, collaboration, engagement, and efficiency

  10. Diiron centre mutations in Ciona intestinalis alternative oxidase abolish enzymatic activity and prevent rescue of cytochrome oxidase deficiency in flies

    PubMed Central

    Andjelković, Ana; Oliveira, Marcos T.; Cannino, Giuseppe; Yalgin, Cagri; Dhandapani, Praveen K.; Dufour, Eric; Rustin, Pierre; Szibor, Marten; Jacobs, Howard T.


    The mitochondrial alternative oxidase, AOX, carries out the non proton-motive re-oxidation of ubiquinol by oxygen in lower eukaryotes, plants and some animals. Here we created a modified version of AOX from Ciona instestinalis, carrying mutations at conserved residues predicted to be required for chelation of the diiron prosthetic group. The modified protein was stably expressed in mammalian cells or flies, but lacked enzymatic activity and was unable to rescue the phenotypes of flies knocked down for a subunit of cytochrome oxidase. The mutated AOX transgene is thus a potentially useful tool in studies of the physiological effects of AOX expression. PMID:26672986

  11. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M


    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  12. Structural Changes and Proton Transfer in Cytochrome c Oxidase.


    Vilhjálmsdóttir, Jóhanna; Johansson, Ann-Louise; Brzezinski, Peter


    In cytochrome c oxidase electron transfer from cytochrome c to O2 is linked to transmembrane proton pumping, which contributes to maintaining a proton electrochemical gradient across the membrane. The mechanism by which cytochrome c oxidase couples the exergonic electron transfer to the endergonic proton translocation is not known, but it presumably involves local structural changes that control the alternating proton access to the two sides of the membrane. Such redox-induced structural changes have been observed in X-ray crystallographic studies at residues 423-425 (in the R. sphaeroides oxidase), located near heme a. The aim of the present study is to investigate the functional effects of these structural changes on reaction steps associated with proton pumping. Residue Ser425 was modified using site-directed mutagenesis and time-resolved spectroscopy was used to investigate coupled electron-proton transfer upon reaction of the oxidase with O2. The data indicate that the structural change at position 425 propagates to the D proton pathway, which suggests a link between redox changes at heme a and modulation of intramolecular proton-transfer rates.

  13. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  14. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...

  15. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.


    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie


    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols.

  16. Energy-Dependent Reversal of the Cytochrome Oxidase Reaction

    NASA Astrophysics Data System (ADS)

    Wikstrom, Marten


    Energization of isolated rat liver mitochondria with ATP under conditions in which cytochrome c is poised in a highly oxidized state shifts the state of cytochrome oxidase (cytochrome c oxidase; ferrocytochrome c:oxygen oxidoreductase, EC from fully oxidized to two new spectroscopically distinguishable states depending on the applied phosphorylation potential and redox potential at cytochrome c. Both new states are spectrally similar or identical to two previously described intermediates in the reaction between reduced enzyme and O2. The data suggest that the energy-dependent transitions are due to reversed electron transfer from water to ferricytochrome c linked to accumulation of intermediates of O2 reduction at the catalytic heme a3/copper center. Titrations with redox potential indicate that each transition is a one-electron step, a finding that would identify the second observed compound as enzyme-bound peroxide or its equivalent. This is consistent with this compound being spectrally identical to ``Compound C,'' previously described as the reaction product between half-reduced oxidase (two electrons) and O2. On the basis of these data a catalytic scheme of O2 reduction is proposed for the heme a3/copper center of cytochrome oxidase.

  17. Molecular dynamics in cytochrome c oxidase Moessbauer spectra deconvolution

    SciTech Connect

    Bossis, Fabrizio; Palese, Luigi L.


    Research highlights: {yields} Cytochrome c oxidase molecular dynamics serve to predict Moessbauer lineshape widths. {yields} Half height widths are used in modeling of Lorentzian doublets. {yields} Such spectral deconvolutions are useful in detecting the enzyme intermediates. -- Abstract: In this work low temperature molecular dynamics simulations of cytochrome c oxidase are used to predict an experimentally observable, namely Moessbauer spectra width. Predicted lineshapes are used to model Lorentzian doublets, with which published cytochrome c oxidase Moessbauer spectra were simulated. Molecular dynamics imposed constraints to spectral lineshapes permit to obtain useful information, like the presence of multiple chemical species in the binuclear center of cytochrome c oxidase. Moreover, a benchmark of quality for molecular dynamic simulations can be obtained. Despite the overwhelming importance of dynamics in electron-proton transfer systems, limited work has been devoted to unravel how much realistic are molecular dynamics simulations results. In this work, molecular dynamics based predictions are found to be in good agreement with published experimental spectra, showing that we can confidently rely on actual simulations. Molecular dynamics based deconvolution of Moessbauer spectra will lead to a renewed interest for application of this approach in bioenergetics.

  18. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.


    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie


    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols. PMID:26305170


    EPA Science Inventory

    The iron chelator deferoxamine has been reported to inhibit both xanthine oxidase (XO) and xanthine dehydrogenase activity, but the relationship of this effect to the availability of iron in the cellular and tissue environment remains unexplored. XO and total xanthine oxidoreduct...

  20. Purification of gibberellin sub 53 -oxidase from spinach

    SciTech Connect

    Wilson, T.M.; Zeevaart, J.A.D. )


    Spinach is a long-day rosette plants, in which stem growth is mediated by gibberellins. It has been shown that two enzymatic steps, GA{sub 53}-oxidase and GA{sub 19}-oxidase, are controlled by light. To develop an understanding into this light regulation, purification of GA{sub 53}-oxidase has been undertaken. The original assay relied on the HPLC separation of the product and substrate, but was considered too slow for the development of a purification scheme. A TLC system was developed which in conjunction with improvements to the assay conditions was sensitive and gave rapid results. The partial purification of the GA{sub 53}-oxidase is achieved by a high speed centrifugation, 40-55% ammonium sulfate precipitation, an hydroxyapatite column, Sephadex G-100 column and an anion exchange FPLC column, Mono Q HR10/10, yielding 1000-fold purification and 15% recovery. Monoclonal antibodies to the protein will be raised and used to further characterize the enzyme.

  1. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  2. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  3. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  4. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  5. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  6. Lead optimization of isocytosine-derived xanthine oxidase inhibitors.


    Bajaj, Komal; Burudkar, Sandeep; Shah, Pranay; Keche, Ashish; Ghosh, Usha; Tannu, Prashant; Khanna, Smriti; Srivastava, Ankita; Deshmukh, Nitin J; Dixit, Amol; Ahire, Yogesh; Damre, Anagha; Nemmani, Kumar V S; Kulkarni-Almeida, Asha; B-Rao, Chandrika; Sharma, Rajiv; Sivaramakrishnan, H


    We report our attempts at improving the oral efficacy of low-nanomolar inhibitors of xanthine oxidase from isocytosine series through chemical modifications. Our lead compound had earlier shown good in vivo efficacy when administered intraperitoneally but not orally. Several modifications are reported here which achieved more than twofold improvement in exposure. A compound with significant improvement in oral efficacy was also obtained.

  7. [Synthesis and localization of L-lactate oxidase in yeasts].


    Arinbasarova, A Iu; Biriukova, E N; Suzina, N E; Medentsev, A G


    Conditions for L-lactate oxidase synthesis by the yeast Yarrowia lpolytica were investigated. The enzyme was found to be synthesized during growth on L-lactate in the exponential growth phase. L-lactate oxidase synthesis was observed, also on glucose after adaptation to stress conditions (oxidative or thermal stress) r during the stationary growth phase after glucose consumption. The cells grown on L-lactate exhibited high levels of antioxidant enzymes (catalase, superoxide dismutase, glucose-6-phosphate dehydrogenase, and glutathione reductase), which exceeded those of glucose-grown cells. The ultrastructure of L-lactate-grown cellsand of those grown on glucose and adapted to various stress.conditions was also found to besimilar, with increased mitochondria, elevated number and size ofperoxisomes, and formation of lipid and polyphosphate inclusions. In order to determine the intracellular localization of L-lactate oxidase, the cells were disintegrated by the lytic enzyme complex from Helix pomatia. Centrifugation of the homogenate in Percoll gradient resulted in the isolation of purified fractions of the native mitochondria and peroxisomes. L-Lactate oxidase was shown to be localized in peroxisomes. PMID:25844463

  8. Alternative oxidase and uncoupling protein: thermogenesis versus cell energy balance.


    Jarmuszkiewicz, W; Sluse-Goffart, C M; Vercesi, A E; Sluse, F E


    The physiological role of an alternative oxidase and an uncoupling protein in plant and protists is discussed in terms of thermogenesis and energy metabolism balance in the cell. It is concluded that thermogenesis is restricted not only by a lower-limit size but also by a kinetically-limited stimulation of the mitochondrial respiratory chain.

  9. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  11. Pig kidney diamine oxidase. A new method of purification.


    Floris, G; Fadda, M B


    Diamine oxidase has been purified from pig kidney by a new method to rapidly obtain larger amounts of pure enzyme with a good yield. The enzyme obtained gives only one band in SDS gel electrophoresis. The specific activity and the absorption spectra were identical to those of already preparations homogeneous reported by different methods of purification. PMID:121960

  12. Enhanced nitrogen fixation in a Rhizobium etli ntrC mutant that overproduces the Bradyrhizobium japonicum symbiotic terminal oxidase cbb{sub 3}

    SciTech Connect

    Soberon, M.; Lopez, O.; Morera, C.; Girard, M.L.; Tabche, M.L.; Miranda, J.


    The ntrC gene codes for a transcriptional activator protein that modulates gene expression in response to nitrogen. The cytochrome production pattern of a Rhizobium etli ntrC mutant (CFN2012) was studied. CO difference spectral analysis of membranes showed that CFN2012 produced a terminal oxidase similar to the symbiotic terminal oxidase of bacteroids in free-living cells under aerobic conditions, with a characteristic trough at 553 nm. CFN2012 produced two c-type cytochromes with molecular masses of 27 and 32 kDa in contrast with the wild-type strain, which produced only a 32-kDa c-tye cytochrome. The expression levels of the R. etli fix/NOQP operon, which codes for terminal oxidase cbb{sub 3}, were not affected by the ntrC mutation. However, the production levels of the two c-type cytochromes (27 and 32 kDa) were enhanced at least eightfold when the Bradyrhizobium japonicum fixNOQP operon was expressed in CFN2012 from the nptII promoter (pMSfix{sup c}), suggesting that these proteins are subunits FixO (27 kDa) and FixP (32 kDa) of cbb{sub 3} and that CFN2012/pMSfix{sup c} overproduced this terminal oxidase. CFN2012/pMSfix{sup c} showed a significant increase in its symbiotic performance as judged by the determination of nitrogenase activities of plants inoculated with this strain, suggesting that the overproduction of cbb{sub 3} terminal oxidase correlates with an enhancement in symbiotic nitrogen fixation.

  13. Suppressive effects of the NADPH oxidase inhibitor apocynin on intestinal tumorigenesis in obese KK-A(y) and Apc mutant Min mice.


    Komiya, Masami; Fujii, Gen; Miyamoto, Shingo; Takahashi, Mami; Ishigamori, Rikako; Onuma, Wakana; Ishino, Kousuke; Totsuka, Yukari; Fujimoto, Kyoko; Mutoh, Michihiro


    Obesity is a risk factor for colorectal cancer. The accumulation of abdominal fat tissue causes abundant reactive oxygen species production through the activation of NADPH oxidase due to excessive insulin stimulation. The enzyme NADPH oxidase catalyzes the production of reactive oxygen species and evokes the initiation and progression of tumorigenesis. Apocynin is an NADPH oxidase inhibitor that blocks the formation of the NADPH oxidase complex (active form). In this study, we investigated the effects of apocynin on the development of azoxymethane-induced colonic aberrant crypt foci in obese KK-A(y) mice and on the development of intestinal polyps in Apc mutant Min mice. Six-week-old KK-A(y) mice were injected with azoxymethane (200 μg/mouse once per week for 3 weeks) and given 250 mg/L apocynin or 500 mg/L apocynin in their drinking water for 7 weeks. Six-week-old Min mice were also treated with 500 mg/L apocynin for 6 weeks. Treatment with apocynin reduced the number of colorectal aberrant crypt foci in KK-A(y) mice by 21% and the number of intestinal polyps in Min mice by 40% compared with untreated mice. Both groups of mice tended to show improved oxidation of serum low-density lipoprotein and 8-oxo-2'-deoxyguanosine adducts in their adipose tissues. In addition, the inducible nitric oxide synthase mRNA levels in polyp tissues decreased. Moreover, apocynin was shown to suppress nuclear factor-κB transcriptional activity in vitro. These results suggest that apocynin and other NADPH oxidase inhibitors may be effective colorectal cancer chemopreventive agents.

  14. NADPH oxidase activity is essential for Keap1/Nrf2-mediated induction of GCLC in response to 2-indol-3-yl-methylenequinuclidin-3-ols.


    Sekhar, Konjeti R; Crooks, Peter A; Sonar, Vijayakumar N; Friedman, David B; Chan, Jeff Y; Meredith, Michael J; Starnes, Joseph H; Kelton, Kathy R; Summar, Samantha R; Sasi, Soumya; Freeman, Michael L


    Glutamate cysteine ligase, the rate-limiting enzyme for the synthesis of glutathione, represents an important component of chemoprevention paradigms. GCLC and GCLM, the genes encoding glutamate cysteine ligase subunits, are induced by indoles, such as indomethacin. Novel functionalized indole analogues and other structurally related compounds were synthesized and used for a comparative structure analysis of GCLC induction. Use of mouse embryo fibroblasts null for Nrf2 (nuclear factor-erythroid 2p45-related transcription factor) and HepG2 cells overexpressing Keap1 demonstrated that indole analogue-mediated GCLC expression was regulated by Nrf2-Keap1 interactions. Indole analogues capable of inducing GCLC were found to increase NADPH oxidase activity. Indole analogues unable to induce GCLC did not increase oxidase activity. HepG2 cells transfected with FLAG/Keap1 were exposed to indomethacin, and the redox state of Keap1 cysteine residues was assessed. The data indicated that Keap1 exhibited several oxidation states that were sensitive to indomethacin treatment. These indomethacin-mediated changes in thiol oxidation states were suppressed by diphenyleneiodonium, a NADPH oxidase inhibitor. Diphenyleneiodonium also suppressed indole analogue-mediated increases in GCLC mRNA. In summary, the use of the indole analogues identified NADPH oxidase activity as a novel upstream activity regulating Nrf2/Keap1 signaling of GCLC, provided data supporting the hypothesis that Keap1 is a downstream effector for oxidase activity, and afforded in vivo data to support the hypothesis that Keap1 thiols can act as molecular sensors of reactive oxygen species. Finally, the comparative structure analysis suggests that 2-indol-3-yl-methylenequinuclidin-3-ols may represent a prototype for the development of novel chemopreventative agents able to activate Keap1/Nrf2 signaling.

  15. The glossyhead1 Allele of ACC1 Reveals a Principal Role for Multidomain Acetyl-Coenzyme A Carboxylase in the Biosynthesis of Cuticular Waxes by Arabidopsis

    SciTech Connect

    Lu, S.; Xu, C.; Zhao, H.; Parsons, E. P.; Kosma, D. K.; Xu, X.; Chao, D.; Lohrey, G.; Bangarusamy, D. K.; Wang, G.; Bressan, R. A.; Jenks, M. A.


    A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C{sub 20:0} or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling.

  16. The glossyhead1 allele of ACC1 reveals a principal role for multidomain acetyl-coenzyme A carboxylase in the biosynthesis of cuticular waxes by Arabidopsis.


    Lü, Shiyou; Zhao, Huayan; Parsons, Eugene P; Xu, Changcheng; Kosma, Dylan K; Xu, Xiaojing; Chao, Daiyin; Lohrey, Gregory; Bangarusamy, Dhinoth K; Wang, Guangchao; Bressan, Ray A; Jenks, Matthew A


    A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C(20:0) or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling.

  17. The TOF-ACC flight electronics for the fast trigger and time of flight of the AMS-02 cosmic ray spectrometer

    NASA Astrophysics Data System (ADS)

    Basili, A.; Bindi, V.; Casadei, D.; Castellini, G.; Contin, A.; Kounine, A.; Lolli, M.; Palmonari, F.; Quadrani, L.


    The AMS-02 experiment has been installed in May 2011 on the international space station (ISS) where it will measure, with an unprecedented accuracy, cosmic rays up to the TeV energy region for several years. The AMS-02 time of flight (TOF) and the anti-coincide counters (ACC) sub-detectors provide respectively the fast trigger and the veto for the data taking to the experiment. The TOF measures the particle crossing time and the absolute charge with very high precision and provides the fast trigger to AMS-02, whereas the ACC detects and vetoes particles which enter the AMS-02 volume from outside of the main detector acceptance. The electronics of the AMS-02 TOF and ACC sub-detectors have been designed to operate in space for a very long time, in extreme conditions and without any human intervention. In this paper the main design concepts of the TOF-ACC electronics, the space qualification tests and the performance are presented.

  18. The rhizobacterium Variovorax paradoxus 5C-2, containing ACC deaminase, promotes growth and development of Arabidopsis thaliana via an ethylene-dependent pathway.


    Chen, Lin; Dodd, Ian C; Theobald, Julian C; Belimov, Andrey A; Davies, William J


    Many plant-growth-promoting rhizobacteria (PGPR) associated with plant roots contain the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase and can metabolize ACC, the immediate precursor of the plant hormone ethylene, thereby decreasing plant ethylene production and increasing plant growth. However, relatively few studies have explicitly linked ethylene emission and/or action to growth promotion in these plant-microbe interactions. This study examined effects of the PGPR Variovorax paradoxus 5C-2 containing ACC deaminase on the growth and development of Arabidopsis thaliana using wild-type (WT) plants and several ethylene-related mutants (etr1-1, ein2-1, and eto1-1). Soil inoculation with V. paradoxus 5C-2 promoted growth (leaf area and shoot biomass) of WT plants and the ethylene-overproducing mutant eto1-1, and also enhanced floral initiation of WT plants by 2.5 days. However, these effects were not seen in ethylene-insensitive mutants (etr1-1 and ein2-1) even though bacterial colonization of the root system was similar. Furthermore, V. paradoxus 5C-2 decreased ACC concentrations of rosette leaves of WT plants by 59% and foliar ethylene emission of both WT plants and eto1-1 mutants by 42 and 37%, respectively. Taken together, these results demonstrate that a fully functional ethylene signal transduction pathway is required for V. paradoxus 5C-2 to stimulate leaf growth and flowering of A. thaliana.

  19. The plasma membrane NADPH oxidase OsRbohA plays a crucial role in developmental regulation and drought-stress response in rice.


    Wang, Xiang; Zhang, Mao-Mao; Wang, Ya-Jing; Gao, Yin-Tao; Li, Ri; Wang, Gang-Feng; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming


    Plasma membrane NADPH oxidases are major producers of reactive oxygen species (ROS) in plant cells under normal growth and stress conditions. In the present study the total activity of rice NADPH oxidases and the transcription of OsRbohA, which encodes an Oryza sativa plasma membrane NADPH oxidase, were stimulated by drought. OsRbohA was expressed in all tissues examined throughout development. Its mRNA was upregulated by a number of factors, including heat, drought, salt, oxidative stress and methyl jasmonate treatment. Compared with wild-type (WT), the OsRbohA-knockout mutant osrbohA exhibited upregulated expression of other respiratory burst oxidase homolog genes and multiple abnormal agronomic traits, including reduced biomass, low germination rate and decreased pollen viability and seed fertility. However, OsRbohA-overexpressing transgenic plants showed no differences in these traits compared with WT. Although osrbohA leaves and roots produced more ROS than WT, the mutant had lesser intracellular ROS. In contrast, OsRbohA-overexpressing transgenic plants exhibited higher ROS production at the intracellular level and in tissues. Ablation of OsRbohA impaired the tolerance of plants to various water stresses, whereas its overexpression enhanced the tolerance. In addition, a number of genes related to energy supply, substrate transport, stress response and transcriptional regulation were differentially expressed in osrbohA plants even under normal growth conditions, suggesting that OsRbohA has fundamental and broad functions in rice. These results indicate that OsRbohA-mediated processes are governed by complex signaling pathways that function during the developmental regulation and drought-stress response in rice. PMID:26400148

  20. Reduced activity of monoamine oxidase in the rat brain following repeated nandrolone decanoate administration.


    Birgner, Carolina; Kindlundh-Högberg, Anna M S; Oreland, Lars; Alsiö, Johan; Lindblom, Jonas; Schiöth, Helgi B; Bergström, Lena


    Anabolic androgenic steroids (AAS) are known as doping agents within sports and body-building, but are currently also abused by other groups in society in order to promote increased courage and aggression. We previously showed that 14 days of daily intramuscular injections of the AAS nandrolone decanoate (15 mg/kg) reduced the extracellular levels of the dopaminergic metabolites 3,4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA) in the nucleus accumbens shell using microdialysis. The aim of the present study was to investigate whether the same dose regimen of nandrolone decanoate may affect the activities of the dopamine-metabolizing enzymes monoamine oxidases A and B (MAO-A and MAO-B). A radiometric assay was used to determine the activities of MAO-A and MAO-B in rat brain tissues after 14 days of daily i.m. nandrolone decanoate injections at the doses 3 and 15 mg/kg. Gene transcript contents of MAO-A, MAO-B and cathecol-O-methyltransferase (COMT) were measured with quantitative real-time reverse transcription PCR. 3 mg/kg of nandrolone decanoate significantly reduced the activity of both MAO-A and -B in the caudate putamen. 15 mg/kg of nandrolone decanoate significantly reduced the activity of MAO-A in the amygdala and increased the gene transcript level of MAO-B in the substantia nigra. In conclusion, imbalanced MAO activities may contribute to explain the impulsive and aggressive behaviour often described in AAS abusers. The reduced MAO activities observed are in line with our previously presented findings of decreased extracellular levels of DOPAC and HVA in the rat brain, indicating decreased monoaminergic activity following repeated AAS administration. PMID:18539264

  1. Involvement of NADPH oxidases in alkali burn-induced corneal injury

    PubMed Central



    Chemical burns are a major cause of corneal injury. Oxidative stress, inflammatory responses and neovascularization after the chemical burn aggravate corneal damage, and lead to loss of vision. Although NADPH oxidases (Noxs) play a crucial role in the production of reactive oxygen species (ROS), the role of Noxs in chemical burn-induced corneal injury remains to be elucidated. In the present study, the transcription and expression of Noxs in corneas were examined by RT-qPCR, western blot analysis and immunofluorescence staining. It was found that alkali burns markedly upregulated the transcription and expression of Nox2 and Nox4 in human or mouse corneas. The inhibition of Noxs by diphenyleneiodonium (DPI) or apocynin (Apo) effectively attenuated alkali burn-induced ROS production and decreased 3-nitrotyrosine (3-NT) protein levels in the corneas. In addition, Noxs/CD11b double-immunofluorescence staining indicated that Nox2 and Nox4 were partially co-localized with CD11b. DPI or Apo prevented the infiltration of CD11b-positive inflammatory cells, and inhibited the transcription of inflammatory cytokines following alkali burn-induced corneal injury. In our mouse model of alkali burn-induced corneal injury, corneal neovascularization (CNV) occurred on day 3, and it affected 50% of the whole area of the cornea on day 7, and on day 14, CNV coverage of the cornea reached maximum levels. DPI or Apo effectively attenuated alkali burn-induced CNV and decreased the mRNA levels of angiogenic factors, including vascular endothelial growth factor (VEGF), VEGF receptors and matrix metalloproteinases (MMPs). Taken together, our data indicate that Noxs play a role in alkali burn-induced corneal injury by regulating oxidative stress, inflammatory responses and CNV, and we thus suggest that Noxs are a potential therapeutic target in the future treatment of chemical-induced corneal injury. PMID:27221536

  2. A new role for LOX and LOXL2 proteins in transcription regulation.


    Iturbide, Ane; García de Herreros, Antonio; Peiró, Sandra


    The lysyl oxidase (LOX) family of proteins (LOX and LOXL1-LOXL4) oxidize amino groups located in the ε-position in lysines to generate an aldehyde group. In general, they are considered as extracellular proteins and have elastin and collagen as their main substrates. However, recent findings suggest a critical intracellular role for LOX and LOXL2 in transcriptional regulation. In this review, we highlight what is known about the transcriptional role of these two members of the family. Intriguingly, both the intracellular localization of these proteins and the fact that histones have been revealed to be their substrates place this family of proteins within the epigenetic field.

  3. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  4. Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.


    Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D


    To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.

  5. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.


    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu


    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  6. Characterization of lead-resistant and ACC deaminase-producing endophytic bacteria and their potential in promoting lead accumulation of rape.


    Zhang, Yan-feng; He, Lin-yan; Chen, Zhao-jin; Zhang, Wen-hui; Wang, Qing-ya; Qian, Meng; Sheng, Xia-fang


    Forty-nine lead (Pb)-resistant endophytic bacteria were isolated from metal-tolerant Commelina communis plants grown on lead and zinc mine tailing, of which, seven 1-aminocyclopropane-1-carboxylate (ACC) deaminase-producing endophytic bacteria were initially obtained and characterized with respect to heavy metal resistance and production of ACC deaminase, indole-3-acetic acid (IAA) as well as siderophores. Two isolates (Q2BJ2 and Q2BG1) showing higher ACC deaminase activity were evaluated for promoting plant growth and Pb uptake of rape grown in quartz sand containing 0 and 100 mg kg(-1) of Pb in pot experiments. The seven Pb-resistant and ACC deaminase-producing endophytic bacterial isolates were found to exhibit different multiple heavy metal resistance characteristics and to show different levels of ACC deaminase activity (ranging from 12.8 μM α-KB mg(-1) h(-1) to 121 μM α-KB mg(-1) h(-1)). Among the seven isolates, six isolates produced indole acetic acid, whilst five isolates produced siderophores. In experiments involving rape plants grown in quartz sand containing 100 mg kg(-1) of Pb, inoculation with the isolates resulted in the increased dry weights of above-ground tissues (ranging from 39% to 71%) and roots (ranging from 35% to 123%) compared to the uninoculated control. Increases in above-ground tissue Pb contents of rape cultivated in 100 mg kg(-1) of Pb-contaminated substrates varied from 58% to 62% in inoculated-rape plants compared to the uninoculated control.

  7. Characterization of ACC deaminase-producing endophytic bacteria isolated from copper-tolerant plants and their potential in promoting the growth and copper accumulation of Brassica napus.


    Zhang, Yan-Feng; He, Lin-Yan; Chen, Zhao-Jin; Wang, Qing-Ya; Qian, Meng; Sheng, Xia-Fang


    One hundred Cu-resistant-endophytic bacteria were isolated from Cu-tolerant plants grown on Cu mine wasteland, of which, eight Cu-resistant and 1-aminocyclopropane-1-carboxylate (ACC) deaminase-producing endophytic bacteria were obtained based on the ACC deaminase activity of the bacteria and characterized with respect to metal resistance, production of ACC deaminase, indole-3-acetic acid (IAA) as well as siderophores and mineral phosphate solubilization. Ralstonia sp. J1-22-2, Pantoea agglomerans Jp3-3, and Pseudomonas thivervalensis Y1-3-9 with higher ACC deaminase activity (ranging from 213 to 370 μM α-ketobutyrate mg(-1)h(-1)) were evaluated for promoting plant growth and Cu uptake of rape grown in quartz sand containing 0, 2.5, and 5 mg kg(-1) of Cu in pot experiments. The eight bacteria were found to exhibit different multiple heavy metal resistance characteristics, to show different levels of ACC deaminase activity and to produce indole acetic acid. Seven bacteria produced siderophores and solubilized inorganic phosphate. Pot experiments showed that inoculation with the strains (J1-22-2, Jp3-3, and Y1-3-9) was found to increase the biomass of rape. Increases in above-ground tissue Cu contents of rape cultivated in 2.5 and 5 mg kg(-1) of Cu-contaminated substrates varied from 9% to 31% and from 3 to 4-fold respectively in inoculated-rape plants compared to the uninoculated control. The maximum Cu uptake of rape was observed after inoculation with P. agglomerans Jp3-3. The results show that metal-resistant and plant growth promoting endophytic bacteria play an important role in plant growth and Cu uptake which may provide a new endophytic bacterial-assisted phytoremediation of Cu-contaminated environment. PMID:21315404

  8. Characterization of lead-resistant and ACC deaminase-producing endophytic bacteria and their potential in promoting lead accumulation of rape.


    Zhang, Yan-feng; He, Lin-yan; Chen, Zhao-jin; Zhang, Wen-hui; Wang, Qing-ya; Qian, Meng; Sheng, Xia-fang


    Forty-nine lead (Pb)-resistant endophytic bacteria were isolated from metal-tolerant Commelina communis plants grown on lead and zinc mine tailing, of which, seven 1-aminocyclopropane-1-carboxylate (ACC) deaminase-producing endophytic bacteria were initially obtained and characterized with respect to heavy metal resistance and production of ACC deaminase, indole-3-acetic acid (IAA) as well as siderophores. Two isolates (Q2BJ2 and Q2BG1) showing higher ACC deaminase activity were evaluated for promoting plant growth and Pb uptake of rape grown in quartz sand containing 0 and 100 mg kg(-1) of Pb in pot experiments. The seven Pb-resistant and ACC deaminase-producing endophytic bacterial isolates were found to exhibit different multiple heavy metal resistance characteristics and to show different levels of ACC deaminase activity (ranging from 12.8 μM α-KB mg(-1) h(-1) to 121 μM α-KB mg(-1) h(-1)). Among the seven isolates, six isolates produced indole acetic acid, whilst five isolates produced siderophores. In experiments involving rape plants grown in quartz sand containing 100 mg kg(-1) of Pb, inoculation with the isolates resulted in the increased dry weights of above-ground tissues (ranging from 39% to 71%) and roots (ranging from 35% to 123%) compared to the uninoculated control. Increases in above-ground tissue Pb contents of rape cultivated in 100 mg kg(-1) of Pb-contaminated substrates varied from 58% to 62% in inoculated-rape plants compared to the uninoculated control. PMID:21227577

  9. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence.


    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung


    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3(+)) and defective mutant (BL3(-)) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3(-) than in the wild-type, but was stronger in BL3(+). The inoculation of BL3(-) into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3(+) had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3(+) increased in a time-dependent manner. Nodules occupied by BL3(-) formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3(-). This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence.

  10. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence

    PubMed Central

    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung


    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3+) and defective mutant (BL3−) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3− than in the wild-type, but was stronger in BL3+. The inoculation of BL3− into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3+ had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3+ increased in a time-dependent manner. Nodules occupied by BL3− formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3−. This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence. PMID:26657304

  11. Evidence for pyrroloquinolinequinone as the carbonyl cofactor in lysyl oxidase by absorption and resonance Raman spectroscopy.


    Williamson, P R; Moog, R S; Dooley, D M; Kagan, H M


    The present study investigated the possibility that pyrroloquinolinequinone (PQQ), an aromatic carbonyl recently indicated to be the carbonyl cofactor in bovine plasma amine oxidase, may also be present at the active site of lysyl oxidase. The absorption and resonance Raman spectra of the phenylhydrazones of bovine plasma amine oxidase, of peptides derived from the active site of bovine aorta lysyl oxidase, and of PQQ were very similar, indicating that the carbonyl cofactor of lysyl oxidase is PQQ or a compound which closely resembles PQQ.

  12. Amino acid oxidase of leukocytes in relation to H2O2-mediated bacterial killing

    PubMed Central

    Eckstein, Marlene R.; Baehner, Robert L.; Nathan, David G.


    D-Amino acid oxidase and L-amino acid oxidase have been measured in sucrose homogenates of polymorphonuclear leukocytes (PMN) obtained from guinea pigs and humans. Subcellular distribution patterns and studies on latency indicate that these oxidases are soluble enzymes. Their hydrogen peroxide-generating capacity was verified. Chronic granulomatous disease PMN, which lack a respiratory burst and fail to generate H2O2 during phagocytosis and do not kill catalase positive bacteria, had peroxide-generating amino acid oxidase activity equal to that found in PMN homogenates from patients with bacterial infections. The precise metabolic and bactericidal role of amino acid oxidases in PMN remains uncertain. PMID:4397948

  13. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)


    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  14. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.


    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo.

  15. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.


    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo. PMID:26976571

  16. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  17. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Styła, K.; Szajdak, L.


    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci

  18. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.


    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes


    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders.

  19. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.


    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi


    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1.

  20. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.


    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi


    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1. PMID:27110861

  1. Spectroscopic and genetic evidence for two heme-Cu-containing oxidases in Rhodobacter sphaeroides.

    PubMed Central

    Shapleigh, J P; Hill, J J; Alben, J O; Gennis, R B


    It has recently become evident that many bacterial respiratory oxidases are members of a superfamily that is related to the eukaryotic cytochrome c oxidase. These oxidases catalyze the reduction of oxygen to water at a heme-copper binuclear center. Fourier transform infrared (FTIR) spectroscopy has been used to examine the heme-copper-containing respiratory oxidases of Rhodobacter sphaeroides Ga. This technique monitors the stretching frequency of CO bound at the oxygen binding site and can be used to characterize the oxidases in situ with membrane preparations. Oxidases that have a heme-copper binuclear center are recognizable by FTIR spectroscopy because the bound CO moves from the heme iron to the nearby copper upon photolysis at low temperature, where it exhibits a diagnostic spectrum. The FTIR spectra indicate that the binuclear center of the R. sphaeroides aa3-type cytochrome c oxidase is remarkably similar to that of the bovine mitochondrial oxidase. Upon deletion of the ctaD gene, encoding subunit I of the aa3-type oxidase, substantial cytochrome c oxidase remains in the membranes of aerobically grown R. sphaeroides. This correlates with a second wild-type R. sphaeroides is grown photosynthetically, the chromatophore membranes lack the aa3-type oxidase but have this second heme-copper oxidase. Subunit I of the heme-copper oxidase superfamily contains the binuclear center. Amino acid sequence alignments show that this subunit is structurally very highly conserved among both eukaryotic and prokaryotic species. The polymerase chain reaction was used to show that the chromosome of R. sphaeroides contains at least one other gene that is a homolog of ctaD, the gene encoding subunit I of the aa3-type cytochrome c oxidase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1313003

  2. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  3. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  4. Lysyl oxidase-like 2 (LOXL2) and E47 EMT factor: novel partners in E-cadherin repression and early metastasis colonization.


    Canesin, G; Cuevas, E P; Santos, V; López-Menéndez, C; Moreno-Bueno, G; Huang, Y; Csiszar, K; Portillo, F; Peinado, H; Lyden, D; Cano, A


    Epithelial-mesenchymal transition (EMT) has been associated with increased aggressiveness and acquisition of migratory properties providing tumor cells with the ability to invade into adjacent tissues. Downregulation of E-cadherin, a hallmark of EMT, is mediated by several transcription factors (EMT-TFs) that act also as EMT inducers, among them, Snail1 and the bHLH transcription factor E47. We previously described lysyl oxidase-like 2 (LOXL2), a member of the lysyl oxidase family, as a Snail1 regulator and EMT inducer. Here we show that LOXL2 is also an E47-interacting partner and functionally collaborates in the repression of E-cadherin promoter. Loss and gain of function analyses combined with in vivo studies in syngeneic breast cancer models demonstrate the participation of LOXL2 and E47 in tumor growth and their requirement for lung metastasis. Furthermore, LOXL2 and E47 contribute to early steps of metastatic colonization by cell and noncell autonomous functions regulating the recruitment of bone marrow progenitor cells to the lungs and by direct transcriptional regulation of fibronectin and cytokines TNFα, ANG-1 and GM-CSF. Moreover, fibronectin and GM-CSF proved to be necessary for LOXL2/E47-mediated modulation of tumor growth and lung metastasis.

  5. Lysyl oxidase-like 2 (LOXL2) and E47 EMT factor: novel partners in E-cadherin repression and early metastasis colonization.


    Canesin, G; Cuevas, E P; Santos, V; López-Menéndez, C; Moreno-Bueno, G; Huang, Y; Csiszar, K; Portillo, F; Peinado, H; Lyden, D; Cano, A


    Epithelial-mesenchymal transition (EMT) has been associated with increased aggressiveness and acquisition of migratory properties providing tumor cells with the ability to invade into adjacent tissues. Downregulation of E-cadherin, a hallmark of EMT, is mediated by several transcription factors (EMT-TFs) that act also as EMT inducers, among them, Snail1 and the bHLH transcription factor E47. We previously described lysyl oxidase-like 2 (LOXL2), a member of the lysyl oxidase family, as a Snail1 regulator and EMT inducer. Here we show that LOXL2 is also an E47-interacting partner and functionally collaborates in the repression of E-cadherin promoter. Loss and gain of function analyses combined with in vivo studies in syngeneic breast cancer models demonstrate the participation of LOXL2 and E47 in tumor growth and their requirement for lung metastasis. Furthermore, LOXL2 and E47 contribute to early steps of metastatic colonization by cell and noncell autonomous functions regulating the recruitment of bone marrow progenitor cells to the lungs and by direct transcriptional regulation of fibronectin and cytokines TNFα, ANG-1 and GM-CSF. Moreover, fibronectin and GM-CSF proved to be necessary for LOXL2/E47-mediated modulation of tumor growth and lung metastasis. PMID:24632622

  6. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    SciTech Connect

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin; Park, Ji-hoon; Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook; Kim, Soon Ha


    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

  7. Oxygen reactivity of mammalian sulfite oxidase provides a concept for the treatment of sulfite oxidase deficiency.


    Belaidi, Abdel A; Röper, Juliane; Arjune, Sita; Krizowski, Sabina; Trifunovic, Aleksandra; Schwarz, Guenter


    Mammalian sulfite oxidase (SO) is a dimeric enzyme consisting of a molybdenum cofactor- (Moco) and haem-containing domain and catalyses the oxidation of toxic sulfite to sulfate. Following sulfite oxidation, electrons are passed from Moco via the haem cofactor to cytochrome c, the terminal electron acceptor. In contrast, plant SO (PSO) lacks the haem domain and electrons shuttle from Moco to molecular oxygen. Given the high similarity between plant and mammalian SO Moco domains, factors that determine the reactivity of PSO towards oxygen, remained unknown. In the present study, we generated mammalian haem-deficient and truncated SO variants and demonstrated their oxygen reactivity by hydrogen peroxide formation and oxygen-consumption studies. We found that intramolecular electron transfer between Moco and haem showed an inverse correlation to SO oxygen reactivity. Haem-deficient SO variants exhibited oxygen-dependent sulfite oxidation similar to PSO, which was confirmed further using haem-deficient human SO in a cell-based assay. This finding suggests the possibility to use oxygen-reactive SO variants in sulfite detoxification, as the loss of SO activity is causing severe neurodegeneration. Therefore we evaluated the potential use of PEG attachment (PEGylation) as a modification method for future enzyme substitution therapies using oxygen-reactive SO variants, which might use blood-dissolved oxygen as the electron acceptor. PEGylation has been shown to increase the half-life of other therapeutic proteins. PEGylation resulted in the modification of up to eight surface-exposed lysine residues of SO, an increased conformational stability and similar kinetic properties compared with wild-type SO. PMID:26171830

  8. Oxygen reactivity of mammalian sulfite oxidase provides a concept for the treatment of sulfite oxidase deficiency.


    Belaidi, Abdel A; Röper, Juliane; Arjune, Sita; Krizowski, Sabina; Trifunovic, Aleksandra; Schwarz, Guenter


    Mammalian sulfite oxidase (SO) is a dimeric enzyme consisting of a molybdenum cofactor- (Moco) and haem-containing domain and catalyses the oxidation of toxic sulfite to sulfate. Following sulfite oxidation, electrons are passed from Moco via the haem cofactor to cytochrome c, the terminal electron acceptor. In contrast, plant SO (PSO) lacks the haem domain and electrons shuttle from Moco to molecular oxygen. Given the high similarity between plant and mammalian SO Moco domains, factors that determine the reactivity of PSO towards oxygen, remained unknown. In the present study, we generated mammalian haem-deficient and truncated SO variants and demonstrated their oxygen reactivity by hydrogen peroxide formation and oxygen-consumption studies. We found that intramolecular electron transfer between Moco and haem showed an inverse correlation to SO oxygen reactivity. Haem-deficient SO variants exhibited oxygen-dependent sulfite oxidation similar to PSO, which was confirmed further using haem-deficient human SO in a cell-based assay. This finding suggests the possibility to use oxygen-reactive SO variants in sulfite detoxification, as the loss of SO activity is causing severe neurodegeneration. Therefore we evaluated the potential use of PEG attachment (PEGylation) as a modification method for future enzyme substitution therapies using oxygen-reactive SO variants, which might use blood-dissolved oxygen as the electron acceptor. PEGylation has been shown to increase the half-life of other therapeutic proteins. PEGylation resulted in the modification of up to eight surface-exposed lysine residues of SO, an increased conformational stability and similar kinetic properties compared with wild-type SO.

  9. LOX-1 transcription.


    Hermonat, Paul L; Zhu, Hongqing; Cao, Maohua; Mehta, Jawahar L


    The importance of the lectin-like oxidized LDL receptor (LOX-1) gene in cardiovascular and other diseases is slowly being revealed. LOX-1 gene expression appears to be a "canary in a coal mine" for atherogenesis, being strongly up-regulated early on in a number of cell types when they are activated, and predicting the sites of future disease. From this early time point the LOX-1 protein often participates in the disease process itself. While gene/protein expression can be regulated on a multiplicity of levels, the most basic and important mode of regulation is usually transcriptional. There are very few studies on the transcriptional regulation of the human LOX-1 promoter; fewer still on definitive mapping of the transcription factors involved. It is known that a wide variety of stimuli up-regulate LOX-1, usually/probably on the transcriptional level. Angiotensin II (Ang II) is one important regulator of renin-angiotensin system and stimulator LOX-1. Ang II is known to up-regulate LOX-1 transcription through an NF-kB motif located at nt -2158. Oxidized low density lipoprotein (ox-LDL) is another important cardiovascular regulator, particularly of atherosclerotic disease, and a strong stimulator of LOX-1. Ox-LDL is known to up-regulate LOX-1 transcription through an Oct-1 motif located at nt -1556. The subsequent enhanced LOX-1 receptor numbers and their binding by ox-LDL ligand triggers a positive feedback loop, increasing further LOX-1 expression, with a presently unknown regulatory governor. The Oct-1 gene also has its own Oct-1-driven positive feedback loop, which likely also contributes to LOX-1 up-regulation. There is also data which suggests the involvement of the transcription factor AP-1 during stimulation with Phorbol 12-myristate acetate. While the importance of NF-κB as a transcriptional regulator of cardiovascular-relevant genes is well known, the importance of Oct-1 is not. Data suggests that Oct-1-mediated up-regulation of transcription is an early

  10. NADPH oxidase-derived reactive oxygen species in cardiac pathophysiology

    PubMed Central

    Cave, Alison; Grieve, David; Johar, Sofian; Zhang, Min; Shah, Ajay M


    Chronic heart failure, secondary to left ventricular hypertrophy or myocardial infarction, is a condition with increasing morbidity and mortality. Although the mechanisms underlying the development and progression of this condition remain a subject of intense interest, there is now growing evidence that redox-sensitive pathways play an important role. This article focuses on the involvement of reactive oxygen species derived from a family of superoxide-generating enzymes, termed NADPH oxidases (NOXs), in the pathophysiology of ventricular hypertrophy, the accompanying interstitial fibrosis and subsequent heart failure. In particular, the apparent ability of the different NADPH oxidase isoforms to define the response of a cell to a range of physiological and pathophysiological stimuli is reviewed. If confirmed, these data would suggest that independently targeting different members of the NOX family may hold the potential for therapeutic intervention in the treatment of cardiac disease. PMID:16321803

  11. Tyrosinase versus Catechol Oxidase: One Asparagine Makes the Difference.


    Solem, Even; Tuczek, Felix; Decker, Heinz


    Tyrosinases mediate the ortho-hydroxylation and two-electron oxidation of monophenols to ortho-quinones. Catechol oxidases only catalyze the oxidation of diphenols. Although it is of significant interest, the origin of the functional discrimination between tyrosinases and catechol oxidases has been unclear. Recently, it has been postulated that a glutamate and an asparagine bind and activate a conserved water molecule towards deprotonation of monophenols. Here we demonstrate for the first time that a polyphenoloxidase, which exhibits only diphenolase activity, can be transformed to a tyrosinase by mutation to introduce an asparagine. The asparagine and a conserved glutamate are necessary to properly orient the conserved water in order to abstract a proton from the monophenol. These results provide direct evidence for the crucial importance of a proton shuttle for tyrosinase activity of type 3 copper proteins, allowing a consistent understanding of their different chemical reactivities. PMID:26773413

  12. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  13. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )


    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  14. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )


    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  15. The 2013 ACC/AHA cardiovascular prevention guidelines improve alignment of statin therapy with coronary atherosclerosis as detected by coronary computed tomography angiography.


    Pursnani, Amit; Mayrhofer, Thomas; Ferencik, Maros; Hoffmann, Udo


    The recently released 2013 ACC/AHA guidelines for management of blood cholesterol have substantially increased the number of adults who are eligible for preventive statin therapy. We sought to determine whether eligibility for statin therapy as determined by the 2013 ACC/AHA guideline recommendation is better aligned with the actual presence of coronary artery disease (CAD) as detected by coronary CT angiography (CCTA) when compared to prior guidelines including the 2004 NCEP ATP III and 2011 ESC/EAS guidelines. In this secondary analysis of the prospective observational ROMICAT I (Rule Out Myocardial Infarction with Computer Assisted Tomography) cohort study, we included all men and women aged 40-79 years presenting with acute chest pain but not diagnosed with acute coronary syndrome nor on admission statin. Based on risk factor assessment and lipid data, we determined guideline-based eligibility for statin therapy by the 2013 ACC/AHA, the 2004 NCEP ATP III, and the 2011 ESC/EAS guidelines. We determined the presence and severity of CAD as detected by CCTA. The 2013 ACC/AHA algorithm identified nearly twice as many individuals as eligible for statins (n = 77/189; 41%) as compared to the 2004 ATP III criteria: (n = 41/189; 22%), (p < .0001) In addition, the 2013 ACC/AHA guidelines were more sensitive for treatment of CCTA-detected CAD than the 2004 ATP III guidelines [53.4% (42.5-64.1) vs 27.3% (18.3-37.8), p < .001] and the 2011 ESC/EAE guidelines [53.4% (42.5-64.1) vs 34.1% (24.3-45.0), p < .001]. However, the specificity of these guidelines was modestly reduced compared to the 2004 ATP III guidelines [70.3 (60.4-79.0) vs 83.2 (74.4-89.9), p < .001] and the 2011 ESC/EAE guidelines [70.3 (60.4-79.0) vs 86.1 (77.8-92.2), p < .001], suggesting increased treatment of subjects without CCTA-detected CAD. Overall, the 2013 ACC/AHA guidelines are more sensitive to identify patients who have CAD detected by CCTA eligible for statin therapy as compared with prior

  16. Impaired Pulmonary NF-κB Activation in Response to Lipopolysaccharide in NADPH Oxidase-Deficient Mice

    PubMed Central

    Koay, M. Audrey; Christman, John W.; Segal, Brahm H.; Venkatakrishnan, Annapurna; Blackwell, Thomas R.; Holland, Steven M.; Blackwell, Timothy S.


    Reactive oxygen species (ROS) are thought to be involved in intracellular signaling, including activation of the transcription factor NF-κB. We investigated the role of NADPH oxidase in the NF-κB activation pathway by utilizing knockout mice (p47phox−/−) lacking the p47phox component of NADPH oxidase. Wild-type (WT) controls and p47phox−/− mice were treated with intraperitoneal (i.p.) Escherichia coli lipopolysaccharide (LPS) (5 or 20 μg/g of body weight). LPS-induced NF-κB binding activity and accumulation of RelA in nuclear protein extracts of lung tissue were markedly increased in WT compared to p47phox−/− mice 90 min after treatment with 20 but not 5 μg of i.p. LPS per g. In another model of lung inflammation, RelA nuclear translocation was reduced in p47phox−/− mice compared to WT mice following treatment with aerosolized LPS. In contrast to NF-κB activation in p47phox−/− mice, LPS-induced production of macrophage inflammatory protein 2 in the lungs and neutrophilic lung inflammation were not diminished in these mice compared to WT mice. We conclude that LPS-induced NF-κB activation is deficient in the lungs of p47phox−/− mice compared to WT mice, but this abnormality does not result in overt alteration in the acute inflammatory response. PMID:11553535

  17. ACC Neuro-over-Connectivity Is Associated with Mathematically Modeled Additional Encoding Operations of Schizophrenia Stroop-Task Performance

    PubMed Central

    Taylor, Reggie; Théberge, Jean; Williamson, Peter C.; Densmore, Maria; Neufeld, Richard W. J.


    Functional magnetic resonance imaging at 7.0 Tesla was undertaken among Schizophrenia participants (Sz), and clinical (major mood disorder; MDD) and healthy controls (HC), during performance of the Stoop task. Stroop conditions included congruent and incongruent word color items, color-only items, and word-only items. Previous modeling results extended to this most widely used selective-attention task. All groups executed item-encoding operations (subprocesses of the item encoding process) at the same rate (performance accuracy being similarly high throughout), thus displaying like processing capacity; Sz participants, however, employed more subprocesses for item completions than did the MDD participants, who in turn used more subprocesses than the HC group. The reduced efficiency in deploying cognitive-workload capacity among the Sz participants was paralleled by more diffuse neuroconnectivity (Blood-Oxygen-Level-Dependent co-activation) with the anterior cingulate cortex (ACC) (Broadman Area 32), spreading away from this encoding-intensive region; and by less evidence of network dissociation across Stroop conditions. Estimates of cognitive work done to accomplish item completion were greater for the Sz participants, as were estimates of entropy in both the modeled trial-latency distribution, and its associated neuro-circuitry. Findings are held to be symptom and assessment significant, and to have potential implications for clinical intervention.

  18. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].


    Trusov, Yuri; Botella, José Ramón


    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  19. ACC Neuro-over-Connectivity Is Associated with Mathematically Modeled Additional Encoding Operations of Schizophrenia Stroop-Task Performance

    PubMed Central

    Taylor, Reggie; Théberge, Jean; Williamson, Peter C.; Densmore, Maria; Neufeld, Richard W. J.


    Functional magnetic resonance imaging at 7.0 Tesla was undertaken among Schizophrenia participants (Sz), and clinical (major mood disorder; MDD) and healthy controls (HC), during performance of the Stoop task. Stroop conditions included congruent and incongruent word color items, color-only items, and word-only items. Previous modeling results extended to this most widely used selective-attention task. All groups executed item-encoding operations (subprocesses of the item encoding process) at the same rate (performance accuracy being similarly high throughout), thus displaying like processing capacity; Sz participants, however, employed more subprocesses for item completions than did the MDD participants, who in turn used more subprocesses than the HC group. The reduced efficiency in deploying cognitive-workload capacity among the Sz participants was paralleled by more diffuse neuroconnectivity (Blood-Oxygen-Level-Dependent co-activation) with the anterior cingulate cortex (ACC) (Broadman Area 32), spreading away from this encoding-intensive region; and by less evidence of network dissociation across Stroop conditions. Estimates of cognitive work done to accomplish item completion were greater for the Sz participants, as were estimates of entropy in both the modeled trial-latency distribution, and its associated neuro-circuitry. Findings are held to be symptom and assessment significant, and to have potential implications for clinical intervention. PMID:27695425

  20. Structures and Mechanism of the Monoamine Oxidase Family

    PubMed Central

    Gaweska, Helena; Fitzpatrick, Paul F.


    Members of the monoamine oxidase family of flavoproteins catalyze the oxidation of primary and secondary amines, polyamines, amino acids, and methylated lysine side chains in proteins. The enzymes have similar overall structures, with conserved FAD-binding domains and varied substrate-binding sites. Multiple mechanisms have been proposed for the catalytic reactions of these enzymes. The present review compares the structures of different members of the family and the various mechanistic proposals. PMID:22022344

  1. Characterization of two brassinosteroid C-6 oxidase genes in pea.


    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B


    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  2. Studies of GA sub 53 oxidase from spinach

    SciTech Connect

    Wilson, T.; Zeevaart, J.A.D. )


    GA{sub 53} oxidase was purified 1,750-fold with 1% recovery of activity from spinach after exposure to 8 long days. This preparation was injected into balb/c mice and hybridomas from spleen cells were produced. Upon preliminary screening by immunoprecipitation of enzyme activity, three positive cell lines were selected. These are being cloned to select a true monoclonal antibody cell line. This antibody will be used to study the light/dark regulation of this enzyme.

  3. Crystal Structures of Intermediates in the Nitroalkane Oxidase Reaction

    SciTech Connect

    Heroux, A.; Bozinovski, D; Valley, M; Fitzpatrick, P; Orville, A


    The flavoenzyme nitroalkane oxidase is a member of the acyl-CoA dehydrogenase superfamily. Nitroalkane oxidase catalyzes the oxidation of neutral nitroalkanes to nitrite and the corresponding aldehydes or ketones. Crystal structures to 2.2 {angstrom} resolution or better of enzyme complexes with bound substrates and of a trapped substrate-flavin adduct are described. The D402N enzyme has no detectable activity with neutral nitroalkanes. The structure of the D402N enzyme crystallized in the presence of 1-nitrohexane or 1-nitrooctane shows the presence of the substrate in the binding site. The aliphatic chain of the substrate extends into a tunnel leading to the enzyme surface. The oxygens of the substrate nitro group interact both with amino acid residues and with the 2'-hydroxyl of the FAD. When nitroalkane oxidase oxidizes nitroalkanes in the presence of cyanide, an electrophilic flavin imine intermediate can be trapped (Valley, M. P., Tichy, S. E., and Fitzpatrick, P. F. (2005) J. Am. Chem. Soc. 127, 2062-2066). The structure of the enzyme trapped with cyanide during oxidation of 1-nitrohexane shows the presence of the modified flavin. A continuous hydrogen bond network connects the nitrogen of the CN-hexyl-FAD through the FAD 2'-hydroxyl to a chain of water molecules extending to the protein surface. Together, our complementary approaches provide strong evidence that the flavin cofactor is in the appropriate oxidation state and correlates well with the putative intermediate state observed within each of the crystal structures. Consequently, these results provide important structural descriptions of several steps along the nitroalkane oxidase reaction cycle.

  4. The Escherichia coli CydX protein is a member of the CydAB cytochrome bd oxidase complex and is required for cytochrome bd oxidase activity.


    VanOrsdel, Caitlin E; Bhatt, Shantanu; Allen, Rondine J; Brenner, Evan P; Hobson, Jessica J; Jamil, Aqsa; Haynes, Brittany M; Genson, Allyson M; Hemm, Matthew R


    Cytochrome bd oxidase operons from more than 50 species of bacteria contain a short gene encoding a small protein that ranges from ∼30 to 50 amino acids and is predicted to localize to the cell membrane. Although cytochrome bd oxidases have been studied for more than 70 years, little is known about the role of this small protein, denoted CydX, in oxidase activity. Here we report that Escherichia coli mutants lacking CydX exhibit phenotypes associated with reduced oxidase activity. In addition, cell membrane extracts from ΔcydX mutant strains have reduced oxidase activity in vitro. Consistent with data showing that CydX is required for cytochrome bd oxidase activity, copurification experiments indicate that CydX interacts with the CydAB cytochrome bd oxidase complex. Together, these data support the hypothesis that CydX is a subunit of the CydAB cytochrome bd oxidase complex that is required for complex activity. The results of mutation analysis of CydX suggest that few individual amino acids in the small protein are essential for function, at least in the context of protein overexpression. In addition, the results of analysis of the paralogous small transmembrane protein AppX show that the two proteins could have some overlapping functionality in the cell and that both have the potential to interact with the CydAB complex.

  5. Polyphenol oxidase and peroxidase in fruits and vegetables.


    Vámos-Vigyázó, L


    Polyphenol oxidases and peroxidases are among the most studied enzymes in fruits and vegetables. Owing to the deleterious effects of discoloration and off-flavor formation induced by their actions, these enzymes have not ceased to be a matter of concern to food technologists, while their versatility as catalyst and their diversity as protein present a challenge to the biochemist. This article gives an account on the present state of knowledge in this field. The occurrence of polyphenol oxidases and peroxidases in food and food raw materials, and their role and importance in food processing are briefly outlined. Results of biochemical research including catalytic properties, substrate specificity, susceptibility towards pH and temperature, action of inhibitors, isolation, purification, and characteristics of the enzymes are given, with special emphasis on recent achievements based on high resolution separation and isoenzyme techniques. Finally, the behavior of polyphenol oxidase and peroxidase in selected major groups of fruits and vegetables is discussed. Some contradictions found in the literature are pointed out and some questions that have not been given the necessary attention by researchers so far are mentioned.

  6. Potential xanthine oxidase inhibitory activity of endophytic Lasiodiplodia pseudotheobromae.


    Kapoor, Neha; Saxena, Sanjai


    Xanthine oxidase is considered as a potential target for treatment of hyperuricemia. Hyperuricemia is predisposing factor for gout, chronic heart failure, atherosclerosis, tissue injury, and ischemia. To date, only two inhibitors of xanthine oxidase viz. allopurinol and febuxostat have been clinically approved for used as drugs. In the process of searching for new xanthine oxidase inhibitors, we screened culture filtrates of 42 endophytic fungi using in vitro qualitative and quantitative XO inhibitory assays. The qualitative assay exhibited potential XO inhibition by culture filtrates of four isolates viz. #1048 AMSTITYEL, #2CCSTITD, #6AMLWLS, and #96 CMSTITNEY. The XO inhibitory activity was present only in the chloroform extract of the culture filtrates. Chloroform extract of culture filtrate #1048 AMSTITYEL exhibited the highest inhibition of XO with an IC50 value of 0.61 μg ml(-1) which was better than allopurinol exhibiting an IC50 of 0.937 μg ml(-1) while febuxostat exhibited a much lower IC50 of 0.076 μg ml(-1). Further, molecular phylogenetic tools and morphological studies were used to identify #1048 AMSTITYEL as Lasiodiplodia pseudotheobromae. This is the first report of an endophytic Lasiodiplodia pseudotheobromae from Aegle marmelos exhibiting potential XO Inhibitory activity.

  7. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.


    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho


    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  8. Quantitative analysis of phenol oxidase activity in insect hemolymph.


    Sorrentino, Richard Paul; Small, Chiyedza N; Govind, Shubha


    We describe a simple, inexpensive, and robust protocol for the quantification of phenol oxidase activity in insect hemolymph. Discrete volumes of hemolymph from Drosophila melanogaster larvae are applied to pieces of filter paper soaked in an L-3, 4-dihydroxyphenylalanine (L-DOPA) solution. Phenol oxidase present in the samples catalyzes melanin synthesis from the L-DOPA precursor, resulting in the appearance of a roughly circular melanized spot on the filter paper. The filter paper is then scanned and analyzed with image-processing software. Each pixel in an image is assigned a grayscale value. The mean of the grayscale values for a circular region of pixels at the center of the image of each spot is used to compute a melanization index (MI) value, the computation is based on a comparison to an external standard (India ink). Numerical MI values for control and experimental larvae can then be pooled and subjected to statistical analysis. This protocol was used to evaluate phenol oxidase activity in larvae of different backgrounds: wild-type, lozenge, hopscotch(Tumorous-lethal) (which induces the formation of large melanotic tumors), and body-color mutations ebony and yellow. Our results demonstrate that this assay is sensitive enough for use in genetic screens with D. melanogaster and could conceivably be used for evaluation of MI from hemolymph of other insects.

  9. Elicitation of dihydrobenzophenanthridine oxidase in Sanguinaria canadensis cell cultures.


    Ignatov, A; Clark, W G; Cline, S D; Psenak, M; Krueger, J; Coscia, C J


    Dihydrobenzophenanthridine (DHBP) oxidase catalyses the last step in the biogenesis of the benzo[c]phenanthridine alkaloid sanguinarine. Addition of autoclaved fungal preparations or putative plant defence signalling intermediates (jasmonic acid (JA), methyl jasmonate (MeJ), acetylsalicylic acid (ASA)) to Sanguinaria canadensis cell suspension cultures elicited an increase in the activity of DHBP oxidase. MeJ and ASA were better inducers of oxidase activity than were the fungal elicitor and JA. Enzyme-specific activity could be induced in a dose- and time-dependent manner up to 4- to 14-fold, respectively, when cells were treated with MeJ or with ASA. A change in total enzyme activity in cultured cells was observed only at the highest concentration of MeJ and not at any level of ASA tested. The results suggest that MeJ and ASA may play a role in the S. canadensis defence against pathogens by eliciting the enzymes involved in the synthesis of the phytoalexin benzophenanthridine alkaloids.

  10. Essential role of lysyl oxidases in notochord development

    PubMed Central

    Gansner, John M.; Mendelsohn, Bryce A.; Hultman, Keith A.; Johnson, Stephen L.; Gitlin, Jonathan D.


    Recent studies reveal a critical role for copper in the development of the zebrafish notochord, suggesting that specific cuproenzymes are required for the structural integrity of the notochord sheath. We now demonstrate that β-aminopropionitrile, a known inhibitor of the copper-dependent lysyl oxidases, causes notochord distortion in the zebrafish embryo identical to that seen in copper deficiency. Characterization of the zebrafish lysyl oxidase genes reveals eight unique sequences, several of which are expressed in the developing notochord. Specific gene knockdown demonstrates that loss of loxl1 results in notochord distortion, and that loxl1 and loxl5b have overlapping roles in notochord formation. Interestingly, while notochord abnormalities are not observed following partial knockdown of loxl1 or loxl5b alone, in each case this markedly sensitizes developing embryos to notochord distortion if copper availability is diminished. Likewise, partial knockdown of the lysyl oxidase substrate col2a1 results in notochord distortion when combined with reduced copper availability or partial knockdown of loxl1 or loxl5b. These data reveal a complex interplay of gene expression and nutrient availability critical to notochord development. They also provide insight into specific genetic and nutritional factors that may play a role in the pathogenesis of structural birth defects of the axial skeleton. PMID:17543297

  11. Towards a structural elucidation of the alternative oxidase in plants.


    Albury, Mary S; Elliott, Catherine; Moore, Anthony L


    In addition to the conventional cytochrome c oxidase, mitochondria of all plants studied to date contain a second cyanide-resistant terminal oxidase or alternative oxidase (AOX). The AOX is located in the inner mitochondrial membrane and branches from the cytochrome pathway at the level of the quinone pool. It is non-protonmotive and couples the oxidation of ubiquinone to the reduction of oxygen to water. For many years, the AOX was considered to be confined to plants, fungi and a small number of protists. Recently, it has become apparent that the AOX occurs in wide range of organisms including prokaryotes and a moderate number of animal species. In this paper, we provide an overview of general features and current knowledge available about the AOX with emphasis on structure, the active site and quinone-binding site. Characterisation of the AOX has advanced considerably over recent years with information emerging about the role of the protein, regulatory regions and functional sites. The large number of sequences available is now enabling us to obtain a clearer picture of evolutionary origins and diversity.

  12. Partial inactivation of cytochrome c oxidase by nonpolar mercurial reagents

    SciTech Connect

    Mann, A.J.; Auer, H.E.


    Purified beef heart cytochrome c oxidase is inactivated to the extent of 35 to 50% by the nonpolar mercurial reagents mercuric chloride and ethylmercuric chloride. The inactivation is complete within 5 min. In titrations of activity, the plateau level of inactivation is attained at added ethylmercuric chloride:heme a ratios of about 1:1. Up to 3 mercury atoms/heme a are bound to the oxidase, although only the first of these affects its enzymatic activity. Incubation of the ethylmercury-modified oxidase with sulfhydryl compounds reverses the inactivation, with 2,3-dimercaptopropanol being most effective of the reagents tested. Spectrophotometric and polarographic assays of enzymatic activity show that K/sub m/ values for the native and the ethylmercury-modified enzymes are practically indistinguishable, and that the partial inactivation observed for the latter is reflected exclusively in a lower value of V/sub max/ compared to that of the native enzyme. Based on these results, we propose that ethylmercuric chloride reacts with a single crucial--SH group per heme a, and that electron transfer processes in the modified product are partially inhibited.

  13. Potential xanthine oxidase inhibitory activity of endophytic Lasiodiplodia pseudotheobromae.


    Kapoor, Neha; Saxena, Sanjai


    Xanthine oxidase is considered as a potential target for treatment of hyperuricemia. Hyperuricemia is predisposing factor for gout, chronic heart failure, atherosclerosis, tissue injury, and ischemia. To date, only two inhibitors of xanthine oxidase viz. allopurinol and febuxostat have been clinically approved for used as drugs. In the process of searching fo