Sample records for acc oxidase transcripts

  1. An ACC Oxidase Gene Essential for Cucumber Carpel Development.


    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen


    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  2. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.


    Sell, Simone; Hehl, Reinhard


    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  3. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M


    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  4. Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol

    PubMed Central

    Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro


    Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

  5. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola


    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several transcription factors are involved in regulating lipid metabolism in various animal tissues. Peroxisome proliferator activated receptor (PPAR) gamma and PPAR alpha regulate both lipogenesis and fatty acid oxidation. Gene fragments for PPAR gamma, PPAR alpha, and acyl CoA oxidase (ACO) have b...

  7. ACC oxidase and miRNA 159a, and their involvement in fresh fruit bunch yield (FFB) via sex ratio determination in oil palm.


    Somyong, Suthasinee; Poopear, Supannee; Sunner, Supreet Kaur; Wanlayaporn, Kitti; Jomchai, Nukoon; Yoocha, Thippawan; Ukoskit, Kittipat; Tangphatsornruang, Sithichoke; Tragoonrung, Somvong


    Oil palm (Elaeis guineesis Jacq.) is the most productive oil-bearing crop, yielding more oil per area than any other oil-bearing crops. However, there are still efforts to improve oil palm yield, in order to serve consumer and manufacturer demand. Oil palm produces female and male inflorescences in an alternating cycle. So, high sex ratio (SR), the ratio of female inflorescences to the total inflorescences, is a favorable trait in term of increasing yields in oil palm. This study aims to understand the genetic control for SR related traits, such as fresh fruit bunch yield (FFB), by characterizing genes at FFB quantitative trait loci (QTLs) on linkage 10 (chromosome 6) and linkage 15 (chromosome 10). Published oil palm sequences at the FFB QTLs were used to develop gene-based and simple sequence repeat (SSR) markers. We used the multiple QTL analysis model (MQM) to characterize the relationship of new markers with the SR traits in the oil palm population. The RNA expression of the most linked QTL genes was also evaluated in various tissues of oil palm. We identified EgACCO1 (encoding aminocyclopropane carboxylate (ACC) oxidase) at chromosome 10 and EgmiR159a (microRNA 159a) at chromosome 6 to be the most linked QTL genes or determinants for FFB yield and/or female inflorescence number with a phenotype variance explained (PVE) from 10.4 to 15 % and suggest that these play the important roles in sex determination and differentiation in oil palm. The strongest expression of EgACCO1 and the predicted precursor of EgmiR159a was found in ovaries and, to a lesser extent, fruit development. In addition, highly normalized expression of EgmiR159a was found in female flowers. In summary, the QTL analysis and the RNA expression reveal that EgACCO1 and EgmiR159a are the potential genetic factors involved in female flower determination and hence would affect yield in oil palm. However, to clarify how these genetic factors regulate female flower determination, more investigation

  8. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.


    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae


    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  9. LRPPRC mutation suppresses cytochrome oxidase activity by altering mitochondrial RNA transcript stability in a mouse model.


    Xu, Fenghao; Addis, Jane B L; Cameron, Jessie M; Robinson, Brian H


    LRPPRC (leucine-rich pentatricopeptide repeat-containing) has been shown to be essential for the maturation of COX (cytochrome c oxidase), possibly by stabilizing RNA transcripts of COXI, COXII and COXIII genes encoded in mtDNA (mitochondrial DNA). We established a mouse 'gene-trap' model using ES cells (embryonic stem cells) in which the C-terminus of LRPPRC has been replaced with a β-geo construct. Mice homozygous for this modification were found to be subject to embryonic lethality, with death before 12.5 dpc (days post-coitum). Biochemical analysis of MEFs (mouse embryonic fibroblasts) isolated from homozygous mutants showed a major decrease in COX activity, with slight reductions in other respiratory chain complexes with mtDNA encoded components. Constructs of LRPPRC containing different numbers of PPRs (pentatricopeptide repeats) were expressed as recombinant proteins and tested for their ability to bind to the COXI mRNA transcript. Full binding required the first 19 PPR motifs. A specific segment of COXI mRNA was identified as the binding target for LRPPRC, encoded by mouse mtDNA nucleotides 5961-6020. These data strongly suggest that LRPPRC is involved in the maturation of COX, and is involved in stabilizing of mitochondrial mRNAs encoding COX transcripts. PMID:21880015

  10. Acetaldehyde-induced cytotoxicity involves induction of spermine oxidase at the transcriptional level.


    Uemura, Takeshi; Tanaka, Yuka; Higashi, Kyohei; Miyamori, Daisuke; Takasaka, Tomokazu; Nagano, Tatsuo; Toida, Toshihiko; Yoshimoto, Kanji; Igarashi, Kazuei; Ikegaya, Hiroshi


    Ethanol consumption causes serious liver injury including cirrhosis and hepatocellular carcinoma. Ethanol is metabolized mainly in the liver to acetic acid through acetaldehyde. We investigated the effect of ethanol and acetaldehyde on polyamine metabolism since polyamines are essential factors for normal cellular functions. We found that acetaldehyde induced spermine oxidase (SMO) at the transcriptional level in HepG2 cells. The levels and activities of ornithine decarboxylase (ODC) and spermidine/spermine acetyltransferase (SSAT) were not affected by acetaldehyde. Spermidine content was increased and spermine content was decreased by acetaldehyde treatment. Knockdown of SMO expression using siRNA reduced acetaldehyde toxicity. Acetaldehyde exposure increased free acrolein levels. An increase of acrolein by acetaldehyde was SMO dependent. Our results indicate that cytotoxicity of acetaldehyde involves, at least in part, oxidation of spermine to spermidine by SMO, which is induced by acetaldehyde. PMID:23707493

  11. Transcriptional and Posttranscriptional Events Control Copper-Responsive Expression of a Rhodobacter capsulatus Multicopper Oxidase

    PubMed Central

    Rademacher, Corinna; Moser, Roman; Lackmann, Jan-Wilm; Klinkert, Birgit; Narberhaus, Franz


    The copper-regulated Rhodobacter capsulatus cutO (multicopper oxidase) gene confers copper tolerance and is carried in the tricistronic orf635-cutO-cutR operon. Transcription of cutO strictly depends on the promoter upstream of orf635, as demonstrated by lacZ reporter fusions to nested promoter fragments. Remarkably, orf635 expression was not affected by copper availability, whereas cutO and cutR were expressed only in the presence of copper. Differential regulation was abolished by site-directed mutations within the orf635-cutO intergenic region, suggesting that this region encodes a copper-responsive mRNA element. Bioinformatic predictions and RNA structure probing experiments revealed an intergenic stem-loop structure as the candidate mRNA element. This is the first posttranscriptional copper response mechanism reported in bacteria. PMID:22287514

  12. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana.


    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi; Shirasu, Ken; Yoshioka, Hirofumi


    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  13. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.


    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  14. Adaptive Cruise Control (ACC)

    NASA Astrophysics Data System (ADS)

    Reif, Konrad

    Die adaptive Fahrgeschwindigkeitsregelung (ACC, Adaptive Cruise Control) ist eine Weiterentwicklung der konventionellen Fahrgeschwindigkeitsregelung, die eine konstante Fahrgeschwindigkeit einstellt. ACC überwacht mittels eines Radarsensors den Bereich vor dem Fahrzeug und passt die Geschwindigkeit den Gegebenheiten an. ACC reagiert auf langsamer vorausfahrende oder einscherende Fahrzeuge mit einer Reduzierung der Geschwindigkeit, sodass der vorgeschriebene Mindestabstand zum vorausfahrenden Fahrzeug nicht unterschritten wird. Hierzu greift ACC in Antrieb und Bremse ein. Sobald das vorausfahrende Fahrzeug beschleunigt oder die Spur verlässt, regelt ACC die Geschwindigkeit wieder auf die vorgegebene Sollgeschwindigkeit ein (Bild 1). ACC steht somit für eine Geschwindigkeitsregelung, die sich dem vorausfahrenden Verkehr anpasst.

  15. mRNA degradation: an underestimated factor in steady-state transcript levels of cytochrome c oxidase subunits?


    Bremer, Katharina; Moyes, Christopher D


    Steady-state mRNA levels are determined by synthesis and degradation; however, changes in mRNA levels are usually attributed to transcription. For cytochrome c oxidase (COX), cold acclimation typically leads to an increase in COX activity while transcript levels for the nuclear-encoded subunits change non-stoichiometrically. Whether those patterns are caused by differences in subunit transcription rates, decay rates or both was not known. We assessed decay rates of transcripts for COX subunits, including representatives that decreased, increased in parallel with COX or increased in excess of COX. Low temperature reduced the decay rate of all transcripts; however, COX subunits displayed higher thermal sensitivity than housekeeping genes. The lower decay rates for COX transcripts might explain some of their increase in response to cold acclimation. The reason for the exaggerated transcript response of two subunits (COX6B-1 and COX7A-2) may be due to decreased decay. However, decay rate differences could not explain the patterns seen with another subunit that did not change in mRNA level with thermal acclimation (COX6A-2). Further, the decay patterns differed between two thermal acclimation experiments, which may explain some of the heterogeneity seen in fish studies. The differences in decay rates suggest that the lack of stoichiometry in mRNA levels is exacerbated by post-transcriptional mechanisms. Collectively, these results suggest that temperature-induced differences in COX subunit mRNA levels and deviations from stoichiometry between them may partially arise from subunit-specific sensitivities to degradation. We suggest that all subunits are controlled by transcription, and that exaggerated responses of some subunits are due to reduced decay rates. PMID:24737751

  16. Tryptamine serves as a proligand of the AhR transcriptional pathway whose activation is dependent of monoamine oxidases.


    Vikström Bergander, Linda; Cai, Wen; Klocke, Bernward; Seifert, Martin; Pongratz, Ingemar


    The function of the aryl hydrocarbon receptor (AhR) in mediating the biological effect to environmental pollutants is well established. However, accumulated evidence indicates a wide range of physiological and pathological functions mediated by the AhR, suggesting the existence of endogenous AhR ligand(s). The nature of an AhR ligand remain elusive; however, it is known that the AhR is activated by several compounds, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin or the tryptophan photoproduct 6-formylindolo[3,2-b]carbazole. In this study, we show that physiological concentrations of tryptamine (TA) lead to induction of cytochrome P4501A1 transcription through an AhR-dependent mechanism. In addition, we show that activation of the AhR by TA requires a functional monoamino oxidase system, suggesting that TA acts as an AhR proligand possibly by converting to a high-affinity AhR ligand. Taken together, we show a possible mechanism, through which AhR signaling is activated by endogenous conversion of TA involving monoamine oxidases. PMID:22865928

  17. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.


    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  18. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

    PubMed Central

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao


    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  19. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.


    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao


    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  20. Elevated level of renal xanthine oxidase mRNA transcription after nephropathogenic infectious bronchitis virus infection in growing layers

    PubMed Central

    Lin, Huayuan; Huang, Qiqi; Liu, Weilian; Zou, Yuelong; Zhu, Shuliang; Deng, Guangfu; Kuang, Jun; Zhang, Caiying; Cao, Huabin; Hu, Guoliang


    To assess relationships between xanthine oxidase (XOD) and nephropathogenic infectious bronchitis virus (NIBV) infection, 240 growing layers (35 days old) were randomly divided into two groups (infected and control) of 120 chickens each. Each chicken in the control and infected group was intranasally inoculated with 0.2 mL sterile physiological saline and virus, respectively, after which serum antioxidant parameters and renal XOD mRNA expression in growing layers were evaluated at 8, 15 and 22 days post-inoculation (dpi). The results showed that serum glutathione peroxidase and superoxide dismutase activities in the infected group were significantly lower than in the control group at 8 and 15 dpi (p < 0.01), while serum malondialdehyde concentrations were significantly higher (p < 0.01). The serum uric acid was significantly higher than that of the control group at 15 dpi (p < 0.01). In addition, the kidney mRNA transcript level and serum activity of XOD in the infected group was significantly higher than that of the control group at 8, 15 and 22 dpi (p < 0.05). The results indicated that NIBV infection could cause the increases of renal XOD gene transcription and serum XOD activity, leading to hyperuricemia and reduction of antioxidants in the body. PMID:26119168

  1. Transcriptional Regulation of Cystathionine-γ-Lyase in Endothelial Cells by NADPH Oxidase 4-Dependent Signaling*

    PubMed Central

    Mistry, Rajesh K.; Murray, Thomas V. A.; Prysyazhna, Oleksandra; Martin, Daniel; Burgoyne, Joseph R.; Santos, Celio; Eaton, Philip; Shah, Ajay M.; Brewer, Alison C.


    The gasotransmitter, hydrogen sulfide (H2S) is recognized as an important mediator of endothelial cell homeostasis and function that impacts upon vascular tone and blood pressure. Cystathionine-γ-lyase (CSE) is the predominant endothelial generator of H2S, and recent evidence suggests that its transcriptional expression is regulated by the reactive oxygen species, H2O2. However, the cellular source of H2O2 and the redox-dependent molecular signaling pathway that modulates this is not known. We aimed to investigate the role of Nox4, an endothelial generator of H2O2, in the regulation of CSE in endothelial cells. Both gain- and loss-of-function experiments in human endothelial cells in vitro demonstrated Nox4 to be a positive regulator of CSE transcription and protein expression. We demonstrate that this is dependent upon a heme-regulated inhibitor kinase/eIF2α/activating transcription factor 4 (ATF4) signaling module. ATF4 was further demonstrated to bind directly to cis-regulatory sequences within the first intron of CSE to activate transcription. Furthermore, CSE expression was also increased in cardiac microvascular endothelial cells, isolated from endothelial-specific Nox4 transgenic mice, compared with wild-type littermate controls. Using wire myography we demonstrate that endothelial-specific Nox4 transgenic mice exhibit a hypo-contractile phenotype in response to phenylephrine that was abolished when vessels were incubated with a CSE inhibitor, propargylglycine. We, therefore, conclude that Nox4 is a positive transcriptional regulator of CSE in endothelial cells and propose that it may in turn contribute to the regulation of vascular tone via the modulation of H2S production. PMID:26620565

  2. Transcriptional Regulation of Cystathionine-γ-Lyase in Endothelial Cells by NADPH Oxidase 4-Dependent Signaling.


    Mistry, Rajesh K; Murray, Thomas V A; Prysyazhna, Oleksandra; Martin, Daniel; Burgoyne, Joseph R; Santos, Celio; Eaton, Philip; Shah, Ajay M; Brewer, Alison C


    The gasotransmitter, hydrogen sulfide (H2S) is recognized as an important mediator of endothelial cell homeostasis and function that impacts upon vascular tone and blood pressure. Cystathionine-γ-lyase (CSE) is the predominant endothelial generator of H2S, and recent evidence suggests that its transcriptional expression is regulated by the reactive oxygen species, H2O2. However, the cellular source of H2O2 and the redox-dependent molecular signaling pathway that modulates this is not known. We aimed to investigate the role of Nox4, an endothelial generator of H2O2, in the regulation of CSE in endothelial cells. Both gain- and loss-of-function experiments in human endothelial cells in vitro demonstrated Nox4 to be a positive regulator of CSE transcription and protein expression. We demonstrate that this is dependent upon a heme-regulated inhibitor kinase/eIF2α/activating transcription factor 4 (ATF4) signaling module. ATF4 was further demonstrated to bind directly to cis-regulatory sequences within the first intron of CSE to activate transcription. Furthermore, CSE expression was also increased in cardiac microvascular endothelial cells, isolated from endothelial-specific Nox4 transgenic mice, compared with wild-type littermate controls. Using wire myography we demonstrate that endothelial-specific Nox4 transgenic mice exhibit a hypo-contractile phenotype in response to phenylephrine that was abolished when vessels were incubated with a CSE inhibitor, propargylglycine. We, therefore, conclude that Nox4 is a positive transcriptional regulator of CSE in endothelial cells and propose that it may in turn contribute to the regulation of vascular tone via the modulation of H2S production. PMID:26620565

  3. ACC Study Guide Series.

    ERIC Educational Resources Information Center

    Austin Community Coll., TX. Rio Grande Campus.

    Ten one-page instructional guides designed to assist Austin Community College (ACC) students in using the library and in writing research papers are presented in this series. The titles of the guides are: (1) "The Media Collection (We have more than books in the LRC)"; (2) "Encyclopedias"; (3) "Finding Books"; (4) "Finding a Dictionary or…

  4. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  5. Elevated Transcription of the Gene QSOX1 Encoding Quiescin Q6 Sulfhydryl Oxidase 1 in Breast Cancer

    PubMed Central

    Soloviev, Mikhail; Esteves, Michelle P.; Amiri, Fakhria; Crompton, Mark R.; Rider, Christopher C.


    The q arm of chromosome 1 is frequently amplified at the gene level in breast cancer. Since the significance of this is unclear we investigated whether 1q genes are overexpressed in this disease. The cDNA levels of 1q-located genes were analysed in a search for overexpressed genes. 26 genes mapping to the 1q arm show highly significant (P≤0.01) overexpression of transcripts in breast cancer compared to normal breast tissue. Amongst those showing the highest levels of overexpression in both expressed sequence tag (EST) and serial analysis of gene expression (SAGE) databases was enzyme quiescin Q6 sulfhydryl oxidase 1 (QSOX1). We investigated QSOX1 cDNA derived from T47D breast carcinoma cells by RT-PCR and 3′-RACE PCR and identified a novel extended form of QSOX1 transcript, containing a long 3′UTR, nearly double the size of the previously reported QSOX1 cDNA, and confirmed its 3′ end nucleotide sequence using RACE-PCR. We also used quantitative real-time PCR to analyse a panel of cDNAs derived from 50 clinically-graded normal and malignant breast tissue samples for the expression of QSOX1 mRNAs. QSOX1 transcription was elevated in an increasing proportion in the grade 2 and grade 3 tumours (graded according to the Nottingham prognostic index), with 10 of the 15 grade 3 tumours (67%) examined exceeding the normal range. There was a significant correlation between relative transcript level and clinical grade (P≤0.01) for all qPCR primer sets tested. QSOX1 mRNA levels, based on SAGE expression data, did not correlate with either Estrogen Receptor (ER) or Epidermal Growth Factor Receptor 2 (ErbB-2 or HER2/neu) expression. Our data indicate that QSOX1 is a potential new prognostic marker which may prove of use in the staging of breast tumours and the stratification of breast cancer patients. PMID:23460839

  6. WRKY Transcription Factors Phosphorylated by MAPK Regulate a Plant Immune NADPH Oxidase in Nicotiana benthamiana[OPEN

    PubMed Central

    Adachi, Hiroaki; Nakano, Takaaki; Miyagawa, Noriko; Ishihama, Nobuaki; Yoshioka, Miki; Katou, Yuri; Yaeno, Takashi


    Pathogen attack sequentially confers pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) after sensing of pathogen patterns and effectors by plant immune receptors, respectively. Reactive oxygen species (ROS) play pivotal roles in PTI and ETI as signaling molecules. Nicotiana benthamiana RBOHB, an NADPH oxidase, is responsible for both the transient PTI ROS burst and the robust ETI ROS burst. Here, we show that RBOHB transactivation mediated by MAPK contributes to R3a/AVR3a-triggered ETI (AVR3a-ETI) ROS burst. RBOHB is markedly induced during the ETI and INF1-triggered PTI (INF1-PTI), but not flg22-tiggered PTI (flg22-PTI). We found that the RBOHB promoter contains a functional W-box in the R3a/AVR3a and INF1 signal-responsive cis-element. Ectopic expression of four phospho-mimicking mutants of WRKY transcription factors, which are MAPK substrates, induced RBOHB, and yeast one-hybrid analysis indicated that these mutants bind to the cis-element. Chromatin immunoprecipitation assays indicated direct binding of the WRKY to the cis-element in plants. Silencing of multiple WRKY genes compromised the upregulation of RBOHB, resulting in impairment of AVR3a-ETI and INF1-PTI ROS bursts, but not the flg22-PTI ROS burst. These results suggest that the MAPK-WRKY pathway is required for AVR3a-ETI and INF1-PTI ROS bursts by activation of RBOHB. PMID:26373453

  7. Fructose containing sugars modulate mRNA of lipogenic genes ACC and FAS and protein levels of transcription factors ChREBP and SREBP1c with no effect on body weight or liver fat.


    Janevski, Mile; Ratnayake, Sunil; Siljanovski, Svetlana; McGlynn, Maree A; Cameron-Smith, David; Lewandowski, Paul


    The aim of this study was to determine the effects of high-glucose, high-fructose and high-sucrose diets on weight gain, liver lipid metabolism and gene expression of proteins involved with hepatic fat metabolism. Rats were fed a diet containing either 60% glucose, 60% fructose, 60% sucrose, or a standard chow for 28 days. Results indicated that high-fructose and high-sucrose diets were associated with higher mRNA levels of gene transcripts involved with fat synthesis; ACC, FAS and ChREBP, with no change in SREBP-1C mRNA. The protein level of ChREBP and SREBP1c was similar in liver homogenates from all groups, but were higher in nuclear fractions from the liver of high-fructose and high-sucrose fed rats. The mRNA level of gene transcripts involved with fat oxidation was the same in all three diets, whilst a high-fructose diet was associated with greater amount of mRNA of the fat transporter CD36. Despite the changes in mRNA of lipogenic proteins, the body weight of animals from each group was the same and the livers from rats fed high-fructose and high-sucrose diets did not contain more fat than control diet livers. In conclusion, changing the composition of the principal monosaccharide in the diet to a fructose containing sugar elicits changes in the level of hepatic mRNA of lipogenic and fat transport proteins and protein levels of their transcriptional regulators; however this is not associated with any changes in body weight or liver fat content. PMID:22159273

  8. Effects of bacterial ACC deaminase on Brassica napus gene expression.


    Stearns, Jennifer C; Woody, Owen Z; McConkey, Brendan J; Glick, Bernard R


    Plants in association with plant growth-promoting rhizobacteria can benefit from lower plant ethylene levels through the action of the bacterial enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase. This enzyme cleaves the immediate biosynthetic precursor of ethylene, ACC. Ethylene is responsible for many aspects of plant growth and development but, under stressful conditions, it exacerbates stress symptoms. The ACC deaminase-containing bacterium Pseudomonas putida UW4 is a potent plant growth-promoting strain and, as such, was used to elaborate the detailed role of bacterial ACC deaminase in Brassica napus (canola) plant growth promotion. Transcriptional changes in bacterially treated canola plants were investigated with the use of an Arabidopsis thaliana oligonucleotide microarray. A heterologous approach was necessary because there are few tools available at present to measure global expression changes in nonmodel organisms, specifically with the sensitivity of microarrays. The results indicate that the transcription of genes involved in plant hormone regulation, secondary metabolism, and stress response was altered in plants by the presence of the bacterium, whereas the upregulation of genes for auxin response factors and the downregulation of stress response genes was observed only in the presence of bacterial ACC deaminase. These results support the suggestion that there is a direct link between ethylene and the auxin response, which has been suggested from physiological studies, and provide more evidence for the stress-reducing benefits of ACC deaminase-expressing plant growth-promoting bacteria. PMID:22352713

  9. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.


    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A


    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  10. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress.


    Datta, Riddhi; Kumar, Deepak; Sultana, Asma; Hazra, Saptarshi; Bhattacharyya, Dipto; Chattopadhyay, Sharmila


    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  11. Cloning and functional expression in E. coli of a polyphenol oxidase transcript from Coreopsis grandiflora involved in aurone formation☆

    PubMed Central

    Kaintz, Cornelia; Molitor, Christian; Thill, Jana; Kampatsikas, Ioannis; Michael, Claudia; Halbwirth, Heidi; Rompel, Annette


    Polyphenol oxidases are involved in aurone biosynthesis but the gene responsible for 4-deoxyaurone formation in Asteraceae was so far unknown. Three novel full-length cDNA sequences were isolated from Coreopsis grandiflora with sizes of 1.80 kb (cgAUS1) and 1.85 kb (cgAUS2a, 2b), encoding for proteins of 68–69 kDa, respectively. cgAUS1 is preferably expressed in young petals indicating a specific role in pigment formation. The 58.9 kDa AUS1 holoproenzyme, was recombinantly expressed in E. coli and purified to homogeneity. The enzyme shows only diphenolase activity, catalyzing the conversion of chalcones to aurones and was characterized by SDS–PAGE and shot-gun type nanoUHPLC–ESI-MS/MS. PMID:25109778

  12. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-{kappa}B in human aortic smooth muscle cells

    SciTech Connect

    Manea, Adrian; Tanase, Laurentia I.; Raicu, Monica; Simionescu, Maya


    Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysis showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.

  13. Regulation of Gibberellin 20-Oxidase and Gibberellin 3β-Hydroxylase Transcript Accumulation during De-Etiolation of Pea Seedlings1

    PubMed Central

    Ait-Ali, Tahar; Frances, Shannon; Weller, James L.; Reid, James B.; Kendrick, Richard E.; Kamiya, Yuji


    Gibberellin (GA) 20-oxidase (GA 20-ox) and GA 3β-hydroxylase (GA 3β-hy) are enzymes that catalyze the late steps in the formation of active GAs, and are potential control points in the regulation of GA biosynthesis by light. We have investigated the photoregulation of the GA 20-ox and GA 3β-hy transcript levels in pea (Pisum sativum L.). The GA 20-ox transcript level was higher in light-grown seedlings than in etiolated seedlings, whereas GA 3β-hy mRNA accumulation was higher in etiolated seedlings. However, transfer of etiolated seedlings to light led to a 5-fold increase in the expression of both transcripts 4 h after transfer. GA 20-ox mRNA accumulation is regulated by both phytochromes A and B. Transfer to light also resulted in a 6-fold decrease in GA1 levels within 2 h. These results suggest that the light-induced drop in GA1 level is not achieved through regulation of GA 20-ox and GA 3β-hy mRNA accumulation. The application of exogenous GA1 to apical buds of etiolated seedlings prior to light treatments inhibited the light-induced accumulation of both GA 20-ox and GA 3β-hy mRNA, suggesting that negative feedback regulation is an important mechanism in the regulation of GA 20-ox and GA 3β-hy mRNA accumulation during de-etiolation of pea seedlings. PMID:10557226

  14. NOX3 NADPH Oxidase Couples Transient Receptor Potential Vanilloid 1 to Signal Transducer and Activator of Transcription 1-Mediated Inflammation and Hearing Loss

    PubMed Central

    Mukherjea, Debashree; Jajoo, Sarvesh; Sheehan, Kelly; Kaur, Tejbeer; Sheth, Sandeep; Bunch, Jennifer; Perro, Christopher; Rybak, Leonard P.


    Abstract Transient receptor potential vanilloid 1 (TRPV1) is implicated in cisplatin ototoxicity. Activation of this channel by cisplatin increases reactive oxygen species generation, which contribute to loss of outer hair cells in the cochlea. Knockdown of TRPV1 by short interfering RNA protected against cisplatin ototoxicity. In this study, we examined the mechanism underlying TRPV1-mediated ototoxicity using cultured organ of Corti transformed cells (UB/OC-1) and rats. Trans-tympanic injections of capsaicin produced transient hearing loss within 24 h, which recovered by 72 h. In UB/OC-1 cells, capsaicin increased NOX3 NADPH oxidase activity and activation of signal transducer and activator of transcription 1 (STAT1). Intratympanic administration of capsaicin transiently increased STAT1 activity and expression of downstream proinflammatory molecules. Capsaicin produced a transient increase in CD14-positive inflammatory cells into the cochlea, which mimicked the temporal course of STAT1 activation but did not alter the expression of apoptotic genes or damage to outer hair cells. In addition, trans-tympanic administration of STAT1 short interfering RNA protected against capsaicin-induced hearing loss. These data suggest that activation of TRPV1 mediates temporary hearing loss by initiating an inflammatory process in the cochlea via activation of NOX3 and STAT1. Thus, these proteins represent reasonable targets for ameliorating hearing loss. Antioxid. Redox Signal. 14, 999–1010. PMID:20712533

  15. NOX3 NADPH oxidase couples transient receptor potential vanilloid 1 to signal transducer and activator of transcription 1-mediated inflammation and hearing loss.


    Mukherjea, Debashree; Jajoo, Sarvesh; Sheehan, Kelly; Kaur, Tejbeer; Sheth, Sandeep; Bunch, Jennifer; Perro, Christopher; Rybak, Leonard P; Ramkumar, Vickram


    Transient receptor potential vanilloid 1 (TRPV1) is implicated in cisplatin ototoxicity. Activation of this channel by cisplatin increases reactive oxygen species generation, which contribute to loss of outer hair cells in the cochlea. Knockdown of TRPV1 by short interfering RNA protected against cisplatin ototoxicity. In this study, we examined the mechanism underlying TRPV1-mediated ototoxicity using cultured organ of Corti transformed cells (UB/OC-1) and rats. Trans-tympanic injections of capsaicin produced transient hearing loss within 24 h, which recovered by 72 h. In UB/OC-1 cells, capsaicin increased NOX3 NADPH oxidase activity and activation of signal transducer and activator of transcription 1 (STAT1). Intratympanic administration of capsaicin transiently increased STAT1 activity and expression of downstream proinflammatory molecules. Capsaicin produced a transient increase in CD14-positive inflammatory cells into the cochlea, which mimicked the temporal course of STAT1 activation but did not alter the expression of apoptotic genes or damage to outer hair cells. In addition, trans-tympanic administration of STAT1 short interfering RNA protected against capsaicin-induced hearing loss. These data suggest that activation of TRPV1 mediates temporary hearing loss by initiating an inflammatory process in the cochlea via activation of NOX3 and STAT1. Thus, these proteins represent reasonable targets for ameliorating hearing loss. PMID:20712533

  16. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.


    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  17. Evaluating Performance Portability of OpenACC

    SciTech Connect

    Sabne, Amit J; Sakdhnagool, Putt; Lee, Seyong; Vetter, Jeffrey S


    Accelerator-based heterogeneous computing is gaining momentum in High Performance Computing arena. However, the increased complexity of the accelerator architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle the problem. While the abstraction endowed by OpenACC offers productivity, it raises questions on its portability. This paper evaluates the performance portability obtained by OpenACC on twelve OpenACC programs on NVIDIA CUDA, AMD GCN, and Intel MIC architectures. We study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.

  18. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz


    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  19. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )


    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  20. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  1. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.


    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills Attached Labs"; (5)…

  2. 1-Aminocyclopropane-1-Carboxylate Oxidase Activity Limits Ethylene Biosynthesis in Rumex palustris during Submergence

    PubMed Central

    Vriezen, Wim H.; Hulzink, Raymond; Mariani, Celestina; Voesenek, Laurentius A.C.J.


    Submergence strongly stimulates petiole elongation in Rumex palustris, and ethylene accumulation initiates and maintains this response in submerged tissues. cDNAs from R. palustris corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene (RP-ACO1) were isolated from elongating petioles and used to study the expression of the corresponding gene. An increase in RP-ACO1 messenger was observed in the petioles and lamina of elongating leaves 2 h after the start of submergence. ACC oxidase enzyme activity was measured in homogenates of R. palustris shoots, and a relevant increase was observed within 12 h under water with a maximum after 24 h. We have shown previously that the ethylene production rate of submerged shoots does not increase significantly during the first 24 h of submergence (L.A.C.J. Voesenek, M. Banga, R.H. Thier, C.M. Mudde, F.M. Harren, G.W.M. Barendse, C.W.P.M. Blom [1993] Plant Physiol 103: 783–791), suggesting that under these conditions ACC oxidase activity is inhibited in vivo. We found evidence that this inhibition is caused by a reduction of oxygen levels. We hypothesize that an increased ACC oxidase enzyme concentration counterbalances the reduced enzyme activity caused by low oxygen concentration during submergence, thus sustaining ethylene production under these conditions. Therefore, ethylene biosynthesis seems to be limited at the level of ACC oxidase activity rather than by ACC synthase in R. palustris during submergence. PMID:10482674

  3. Post-transcriptional control of nuclear-encoded cytochrome oxidase subunits in Trypanosoma brucei: evidence for genome-wide conservation of life-cycle stage-specific regulatory elements

    PubMed Central

    Mayho, Matthew; Fenn, Katelyn; Craddy, Paul; Crosthwaite, Susan; Matthews, Keith


    Trypanosomes represent an excellent model for the post-transcriptional regulation of gene expression because their genome is organized into polycistronic transcription units. However, few signals governing developmental stage-specific expression have been identified, with there being no compelling evidence for widespread conservation of regulatory motifs. As a tool to search for common regulatory sequences we have used the nuclear-encoded components of the cytochrome oxidase (COX) complex of the trypanosome respiratory chain. Components of this complex represent a form of post-transcriptional operon because trypanosome mitochondrial activity is unusual in being developmentally programmed. By genome analysis we identified the genes for seven components of the COX complex. Each mRNA exhibits bloodstream stage-specific instability, which is not mediated by the RNA silencing pathway but which is alleviated by cycloheximide. Reporter assays have identified regulatory regions within the 3′-untranslated regions of three COX mRNAs operating principally at the translational level, but also via mRNA stability. Interrogation of the mapped regions via oligonucleotide frequency scoring provides evidence for genome-wide conservation of regulatory sequences among a large cohort of procyclic-enriched transcripts. Analysis of the co-regulated subunits of a stage-specific enzyme is therefore a novel approach to uncover cryptic regulatory sequences controlling gene expression at the post-transcriptional level. PMID:17012283

  4. Perspectives of bacterial ACC deaminase in phytoremediation.


    Arshad, Muhammad; Saleem, Muhammad; Hussain, Sarfraz


    Phytoremediation of contaminated soil and water environments is regulated and coordinated by the plant root system, yet root growth is often inhibited by pollutant-induced stress. Prolific root growth could maximize rates of hyperaccumulation of inorganic contaminants or rhizodegradation of organic pollutants, and thus accelerate phytoremediation. Accelerated ethylene production in response to stress induced by contaminants is known to inhibit root growth and is considered as a major limitation in improving phytoremediation efficiency. Recent work shows that bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase regulates ethylene levels in plants by metabolizing its precursor ACC into alpha-ketobutyric acid and ammonia. Plants inoculated with ACC deaminase bacteria or transgenic plants that express bacterial ACC deaminase genes can regulate their ethylene levels and consequently contribute to a more extensive root system. Such proliferation of roots in contaminated soil can lead to enhanced uptake of heavy metals or rhizodegradation of xenobiotics. PMID:17573137

  5. Transcriptional coupling of synaptic transmission and energy metabolism: Role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons

    PubMed Central

    Dhar, Shilpa S.; Liang, Huan Ling; Wong-Riley, Margaret T. T.


    SUMMARY Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts downregulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level. PMID:19615412

  6. Coupling of energy metabolism and synaptic transmission at the transcriptional level: Role of nuclear respiratory factor 1 in regulating both cytochrome c oxidase and NMDA glutamate receptor subunit genes

    PubMed Central

    Dhar, Shilpa S.; Wong-Riley, Margaret T. T.


    Neuronal activity and energy metabolism are tightly coupled processes. Regions high in neuronal activity, especially of the glutamatergic type, have high levels of cytochrome c oxidase (COX). Perturbations in neuronal activity affect the expressions of COX and glutamatergic N-methyl-D-aspartate receptor subunit 1 (NR1). The present study sought to test our hypothesis that the coupling extends to the transcriptional level, whereby NR1 and possibly other NR subunits and COX are co-regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), which regulates all COX subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutations, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Grin 1 (NR1), Grin 2b (NR2b) and COX subunit genes, but not of Grin2a and Grin3a genes. These transcripts were up-regulated by KCl and down-regulated by TTX in cultured primary neurons. However, silencing of NRF-1 with small interference RNA blocked the up-regulation of Grin1, Grin2b, and COX induced by KCl, and over-expression of NRF-1 rescued these transcripts that were suppressed by TTX. NRF-1 binding sites on Grin1 and Grin2b genes are also highly conserved among mice, rats, and humans. Thus, NRF-1 is an essential transcription factor critical in the co-regulation of NR1, NR2b, and COX, and coupling exists at the transcriptional level to ensure coordinated expressions of proteins important for synaptic transmission and energy metabolism. PMID:19144849

  7. Incorporation of copper into lysyl oxidase.


    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B


    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

  9. Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress1[OPEN

    PubMed Central

    Kumar, Deepak; Hazra, Saptarshi; Chattopadhyay, Sharmila


    Glutathione (GSH) plays a fundamental role in plant defense-signaling network. Recently, we have established the involvement of GSH with ethylene (ET) to combat environmental stress. However, the mechanism of GSH-ET interplay still remains unexplored. Here, we demonstrate that GSH induces ET biosynthesis by modulating the transcriptional and posttranscriptional regulations of its key enzymes, 1-aminocyclopropane-1-carboxylate synthase (ACS) and 1-aminocyclopropane-1-carboxylate oxidase (ACO). Transgenic Arabidopsis (Arabidopsis thaliana) plants with enhanced GSH content (AtECS) exhibited remarkable up-regulation of ACS2, ACS6, and ACO1 at transcript as well as protein levels, while they were down-regulated in the GSH-depleted phytoalexin deficient2-1 (pad2-1) mutant. We further observed that GSH induced ACS2 and ACS6 transcription in a WRKY33-dependent manner, while ACO1 transcription remained unaffected. On the other hand, the messenger RNA stability for ACO1 was found to be increased by GSH, which explains our above observations. In addition, we also identified the ACO1 protein to be a subject for S-glutathionylation, which is consistent with our in silico data. However, S-glutathionylation of ACS2 and ACS6 proteins was not detected. Further, the AtECS plants exhibited resistance to necrotrophic infection and salt stress, while the pad2-1 mutant was sensitive. Exogenously applied GSH could improve stress tolerance in wild-type plants but not in the ET-signaling mutant ethylene insensitive2-1, indicating that GSH-mediated resistance to these stresses occurs via an ET-mediated pathway. Together, our investigation reveals a dual-level regulation of ET biosynthesis by GSH during stress. PMID:26463088

  10. ACC Study Guide Series (Revised Edition).

    ERIC Educational Resources Information Center

    Staples, Katherine; And Others

    Designed for the beginning college student who needs to search for information, prepare written assignments, or take tests, the ACC (Austin Community College) Study Guide Series comprises 17 one-page study guides. Printed on card stock with colored headings, the guides are highlighted with cartoon illustrations and are intended to provide…

  11. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene (AccGSTD) in response to thermal stress.


    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua


    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee (Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees. PMID:23275971

  12. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua


    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  13. Pleiotropic Effect of AccD5 and AccE5 Depletion in Acyl-Coenzyme A Carboxylase Activity and in Lipid Biosynthesis in Mycobacteria

    PubMed Central

    Bazet Lyonnet, Bernardo; Diacovich, Lautaro; Cabruja, Matías; Bardou, Fabienne; Quémard, Annaïk; Gago, Gabriela; Gramajo, Hugo


    Mycobacteria contain a large variety of fatty acids which are used for the biosynthesis of several complex cell wall lipids that have been implicated in the ability of the organism to resist host defenses. The building blocks for the biosynthesis of all these lipids are provided by a fairly complex set of acyl-CoA carboxylases (ACCases) whose subunit composition and roles within these organisms have not yet been clearly established. Previous biochemical and structural studies provided strong evidences that ACCase 5 from Mycobacterium tuberculosis is formed by the AccA3, AccD5 and AccE5 subunits and that this enzyme complex carboxylates acetyl-CoA and propionyl-CoA with a clear substrate preference for the latest. In this work we used a genetic approach to unambiguously demonstrate that the products of both accD5 and accE5 genes are essential for the viability of Mycobacterium smegmatis. By obtaining a conditional mutant on the accD5-accE5 operon, we also demonstrated that the main physiological role of this enzyme complex was to provide the substrates for fatty acid and mycolic acid biosynthesis. Furthermore, enzymatic and biochemical analysis of the conditional mutant provided strong evidences supporting the notion that AccD5 and/or AccE5 have an additional role in the carboxylation of long chain acyl-CoA prior to mycolic acid condensation. These studies represent a significant step towards a better understanding of the roles of ACCases in mycobacteria and confirm ACCase 5 as an interesting target for the development of new antimycobacterial drugs. PMID:24950047

  14. Mechanism of enhanced responses after combination photodynamic therapy (cPDT) in carcinoma cells involves C/EBP-mediated transcriptional upregulation of the coproporphyrinogen oxidase (CPO) gene

    NASA Astrophysics Data System (ADS)

    Anand, Sanjay; Hasan, Tayyaba; Maytin, Edward V.


    Photodynamic therapy (PDT) with aminolevulinate (ALA) is widely accepted as an effective treatment for superficial carcinomas and pre-cancers. However, PDT is still suboptimal for deeper tumors, mainly due to inadequate ALA penetration and subsequent conversion to PpIX. We are interested in improving the effectiveness of photodynamic therapy (PDT) for deep tumors, using a combination approach (cPDT) in which target protoporphyrin (PpIX) levels are significantly enhanced by differentiation caused by giving Vitamin D or methotrexate (MTX) for 3 days prior to ALAPDT. In LNCaP and MEL cells, a strong correlation between inducible differentiation and expression of C/EBP transcription factors, as well as between differentiation and mRNA levels of CPO (a key heme-synthetic enzyme), indicates the possibility of CPO transcriptional regulation by the C/EBPs. Sequence analysis of the first 1300 base pairs of the murine CPO upstream region revealed 15 consensus C/EBP binding sites. Electrophoretic Mobility Shift Assays (EMSA) proved that these sites form specific complexes that have strong, moderate or weak affinities for C/EBPs. However, in the context of the full-length CPO promoter, inactivation of any type of site (strong or weak) reduced CPO promoter activity (luciferase assay) to nearly the same extent, suggesting cooperative interactions. A comparative analysis of murine and human CPO promoters revealed possible protein-protein interactions between C/EBPs and several neighboring transcription factors such as NFkB, Sp1, AP-1, CBP/p300 and CREB (an enhanceosome complex). Overall, these results confirm that C/EBP's are important for CPO expression via complex mechanisms which upregulate PpIX and enhance the outcome of cPDT.

  15. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua


    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  16. Molecular cloning, expression and antioxidant characterisation of a typical thioredoxin gene (AccTrx2) in Apis cerana cerana.


    Yao, Pengbo; Hao, Lili; Wang, Fang; Chen, Xiaobo; Yan, Yan; Guo, Xingqi; Xu, Baohua


    Thioredoxins (Trxs) are a family of small, highly conserved and ubiquitous proteins that are involved in protecting organisms against toxic reactive oxygen species (ROS). In this study, a typical thioredoxin 2 gene was isolated from Apis cerana cerana, AccTrx2. The full-length cDNA sequence of AccTrx2 was composed of 407 bp containing a 318 bp open reading frame (ORF) that encodes a predicted protein of 105 amino acids, 11.974 kDa and an isoelectric point of 4.45. Expression profile of AccTrx2 as determined by a quantitative real-time PCR (qRT-PCR) analysis was higher in brain than in other tissues, with its highest transcript occurring on the 15day post-emergence adult and upregulated by such abiotic stresses as 4 °C, 16 °C, 25 °C, H2O2, cyhalothrin, acaricide, paraquat, phoxime and mercury (HgCl2) treatments. However, AccTrx2 was slightly repressed when exposed to 42 °C treatment. Characterisation of the recombinant protein showed that the purified AccTrx2 had insulin disulfide reductase activity and could protect DNA from ROS damage. These results indicate that AccTrx2 functions as an antioxidant that plays an important role in response to oxidative stress. PMID:23747404

  17. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana.


    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua


    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses. PMID:26922780

  18. Monoamine oxidase B levels are highly expressed in human gliomas and are correlated with the expression of HiF-1α and with transcription factors Sp1 and Sp3

    PubMed Central

    Sharpe, Martyn A.; Baskin, David S.


    Monoamine oxidases A and B (MAOA and MAOB) are highly expressed in many cancers. Here we investigated the level of MAOB in gliomas and confirmed its high expression. We found that MAOB levels correlated with tumor grade and hypoxia-inducible factor 1-alpha (HiF-1α) expression. HiF-1α was localized to the nuclei in high-grade gliomas, but it was primarily cytosolic in low-grade gliomas and normal human astrocytes. Expression of both glial fibrillary acidic protein (GFAP) and MAOB are correlated to HiF-1α expression levels. Levels of MAOB are correlated by the levels of transcription factor Sp3 in the majority of GBM examined, but this control of MAOB expression by Sp3 in low grade astrocytic gliomas is significantly different from control in the in the majority of glioblastomas. The current findings support previous suggestions that MAOB can be exploited for the killing of cancer cells. Selective cell toxicity can be achieved by designing non-toxic prodrugs that require MAOB for their catalytic conversion into mature cytotoxic chemotherapeutics. PMID:26689994

  19. 5th International ACC Symposium: Hereditary Predisposition to Childhood ACC and the Associated Molecular Phenotype: 5th International ACC Symposium Session: Not Just for Kids!


    Else, Tobias; Rodriguez-Galindo, Carlos


    Adrenocortical carcinoma (ACC) affects children and adults. Roughly 50% of very early onset ACCs occur in children with germline TP53 mutations. Several recent studies have extended our understanding in basic, clinical, and translational genetics with regard to TP53 germline predisposition in ACC patients. The recent description of the molecular landscape of pediatric ACCs provided insight into differences of tumors arising in patients with and without TP53 germline mutation. Another recent important finding is that not all TP53 mutations are equal in their tumor suppressing potential. It has now been shown that family histories as well as molecular characteristics of preserved TP53 functions vary greatly between mutations. It also has become clear that adult patients with ACC often harbor germline mutations causing hereditary syndromes, including Li-Fraumeni syndrome (LFS), Lynch syndrome, and multiple endocrine neoplasia type 1 (MEN1). PMID:26660147

  20. ACLY and ACC1 Regulate Hypoxia-Induced Apoptosis by Modulating ETV4 via α-ketoglutarate

    PubMed Central

    Keenan, Melissa M.; Liu, Beiyu; Tang, Xiaohu; Wu, Jianli; Cyr, Derek; Stevens, Robert D.; Ilkayeva, Olga; Huang, Zhiqing; Tollini, Laura A.; Murphy, Susan K.; Lucas, Joseph; Muoio, Deborah M.; Kim, So Young; Chi, Jen-Tsan


    In order to propagate a solid tumor, cancer cells must adapt to and survive under various tumor microenvironment (TME) stresses, such as hypoxia or lactic acidosis. To systematically identify genes that modulate cancer cell survival under stresses, we performed genome-wide shRNA screens under hypoxia or lactic acidosis. We discovered that genetic depletion of acetyl-CoA carboxylase (ACACA or ACC1) or ATP citrate lyase (ACLY) protected cancer cells from hypoxia-induced apoptosis. Additionally, the loss of ACLY or ACC1 reduced levels and activities of the oncogenic transcription factor ETV4. Silencing ETV4 also protected cells from hypoxia-induced apoptosis and led to remarkably similar transcriptional responses as with silenced ACLY or ACC1, including an anti-apoptotic program. Metabolomic analysis found that while α-ketoglutarate levels decrease under hypoxia in control cells, α-ketoglutarate is paradoxically increased under hypoxia when ACC1 or ACLY are depleted. Supplementation with α-ketoglutarate rescued the hypoxia-induced apoptosis and recapitulated the decreased expression and activity of ETV4, likely via an epigenetic mechanism. Therefore, ACC1 and ACLY regulate the levels of ETV4 under hypoxia via increased α-ketoglutarate. These results reveal that the ACC1/ACLY-α-ketoglutarate-ETV4 axis is a novel means by which metabolic states regulate transcriptional output for life vs. death decisions under hypoxia. Since many lipogenic inhibitors are under investigation as cancer therapeutics, our findings suggest that the use of these inhibitors will need to be carefully considered with respect to oncogenic drivers, tumor hypoxia, progression and dormancy. More broadly, our screen provides a framework for studying additional tumor cell stress-adaption mechanisms in the future. PMID:26452058

  1. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng


    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  2. Characterization of a Decapentapletic Gene (AccDpp) from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress

    PubMed Central

    Wang, Hongfang; Guo, Xulei; Guo, Xingqi; Sun, Qinghua; Xu, Baohua


    To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ) signal pathway. Decapentapletic gene (Dpp) belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana). In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp. PMID:26881804

  3. C-terminal phosphorylation is essential for regulation of ethylene synthesizing ACC synthase enzyme.


    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    The genetic and molecular biological studies mainly in Arabidopsis and in some other plants have begun to uncover the various components of ripening signaling pathway in plants. Although transcriptional regulation of major ripening genes have been studied in detail, information on role of phosphorylation in regulating the activity and stability of core ripening pathway associated proteins in relation to ethylene biosynthesis during fruit ripening is still limited. Recently we have demonstrated the evidence for post-translational regulation of MA-ACS1 (Musa acuminata ACC synthase 1), the rate limiting step enzyme regulating ripening ethylene production in banana, through phosphorylation at the C-terminal Ser 476 and 479 residues by a 41-kDa Ser/Thr protein kinase. (1) Here we have further discussed role of protein phosphorylation in regulation of stability and activity of ACS enzymes and the mechanistic and evolutionary perspective of phosphorylation pattern of Type I ACC synthase enzymes. PMID:23221778

  4. Increased ability of transgenic plants expressing the bacterial enzyme ACC deaminase to accumulate Cd, Co, Cu, Ni, Pb, and Zn.


    Grichko, V P; Filby, B; Glick, B R


    Transgenic tomato plants Lycopersicon esculentum (Solanaceae) cv. Heinz 902 expressing the bacterial gene 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, under the transcriptional control of either two tandem 35S cauliflower mosaic virus promoters (constitutive expression), the rolD promoter from Agrobacterium rhizogenes (root specific expression) or the pathogenesis related PRB-1b promoter from tobacco, were compared to non-transgenic tomato plants in their ability to grow in the presence of Cd, Co, Cu, Mg, Ni, Pb, or Zn and to accumulate these metals. Parameters that were examined include metal concentration and ACC deaminase activity in both plant shoots and roots; root and shoot development; and leaf chlorophyll content. In general, transgenic tomato plants expressing ACC deaminase, especially those controlled by the PRB-1b promoter, acquired a greater amount of metal within the plant tissues, and were less subject to the deleterious effects of the metals on plant growth than were non-transgenic plants. PMID:10936659

  5. 24 CFR 982.154 - ACC reserve account.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated...

  6. Acc homoeoloci and the evolution of wheat genomes

    PubMed Central

    Chalupska, D.; Lee, H. Y.; Faris, J. D.; Evrard, A.; Chalhoub, B.; Haselkorn, R.; Gornicki, P.


    The DNA sequences of wheat Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, were analyzed with a view to understanding the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Acc-1 and Acc-2 loci from each of the wheats Triticum urartu (A genome), Aegilops tauschii (D genome), Triticum turgidum (AB genome), and Triticum aestivum (ABD genome), as well as two Acc-2-related pseudogenes from T. urartu were sequenced. The 2.3–2.4 Mya divergence time calculated here for the three homoeologous chromosomes, on the basis of coding and intron sequences of the Acc-1 genes, is at the low end of other estimates. Our clock was calibrated by using 60 Mya for the divergence between wheat and maize. On the same time scale, wheat and barley diverged 11.6 Mya, based on sequences of Acc and other genes. The regions flanking the Acc genes are not conserved among the A, B, and D genomes. They are conserved when comparing homoeologous genomes of diploid, tetraploid, and hexaploid wheats. Substitution rates in intergenic regions consisting primarily of repetitive sequences vary substantially along the loci and on average are 3.5-fold higher than the Acc intron substitution rates. The composition of the Acc homoeoloci suggests haplotype divergence exceeding in some cases 0.5 Mya. Such variation might result in a significant overestimate of the time since tetraploid wheat formation, which occurred no more than 0.5 Mya. PMID:18599450

  7. Acc homoeoloci and the evolution of wheat genomes.


    Chalupska, D; Lee, H Y; Faris, J D; Evrard, A; Chalhoub, B; Haselkorn, R; Gornicki, P


    The DNA sequences of wheat Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, were analyzed with a view to understanding the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Acc-1 and Acc-2 loci from each of the wheats Triticum urartu (A genome), Aegilops tauschii (D genome), Triticum turgidum (AB genome), and Triticum aestivum (ABD genome), as well as two Acc-2-related pseudogenes from T. urartu were sequenced. The 2.3-2.4 Mya divergence time calculated here for the three homoeologous chromosomes, on the basis of coding and intron sequences of the Acc-1 genes, is at the low end of other estimates. Our clock was calibrated by using 60 Mya for the divergence between wheat and maize. On the same time scale, wheat and barley diverged 11.6 Mya, based on sequences of Acc and other genes. The regions flanking the Acc genes are not conserved among the A, B, and D genomes. They are conserved when comparing homoeologous genomes of diploid, tetraploid, and hexaploid wheats. Substitution rates in intergenic regions consisting primarily of repetitive sequences vary substantially along the loci and on average are 3.5-fold higher than the Acc intron substitution rates. The composition of the Acc homoeoloci suggests haplotype divergence exceeding in some cases 0.5 Mya. Such variation might result in a significant overestimate of the time since tetraploid wheat formation, which occurred no more than 0.5 Mya. PMID:18599450

  8. Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin–sensitizing effects of metformin

    PubMed Central

    Fullerton, Morgan D.; Galic, Sandra; Marcinko, Katarina; Sikkema, Sarah; Pulinilkunnil, Thomas; Chen, Zhi–Ping; O’Neill, Hayley M.; Ford, Rebecca J.; Palanivel, Rengasamy; O’Brien, Matthew; Hardie, D. Grahame; Macaulay, S. Lance; Schertzer, Jonathan D.; Dyck, Jason R. B.; van Denderen, Bryce J.; Kemp, Bruce E.; Steinberg, Gregory R.


    The obesity epidemic has led to an increased incidence of non–alcoholic fatty liver disease (NAFLD) and type 2 diabetes. AMP–activated protein kinase (Ampk) regulates energy homeostasis and is activated by cellular stress, hormones and the widely prescribed anti–type 2 diabetic drug metformin1,2. Ampk phosphorylates murine acetyl–CoA carboxylase3,4 (Acc) 1 at Ser79 and Acc2 at Ser212, inhibiting the conversion of acetyl–CoA to malonyl–CoA, a precursor in fatty acid synthesis5 as well as an allosteric inhibitor of fatty acid transport into mitochondria for oxidation6. To test the physiological impact of these phosphorylation events we generated mice with alanine knock–in mutations in both Acc1 (Ser79) and Acc2 (Ser212) (Acc double knock–in, AccDKI). These mice have elevated lipogenesis and lower fatty acid oxidation compared to wild–type (WT) mice, which contribute to the progression of insulin resistance, glucose intolerance and NAFLD, but not obesity. Remarkably, AccDKI mice made obese by high–fat feeding, are refractory to the lipid–lowering and insulin–sensitizing effects of metformin. These findings establish that inhibitory phosphorylation of Acc by Ampk is essential for the control of lipid metabolism, and in the setting of obesity, for metformin–induced improvements in insulin action. PMID:24185692

  9. Estrogen related receptor α (ERRα) a promising target for the therapy of adrenocortical carcinoma (ACC).


    Casaburi, Ivan; Avena, Paola; De Luca, Arianna; Chimento, Adele; Sirianni, Rosa; Malivindi, Rocco; Rago, Vittoria; Fiorillo, Marco; Domanico, Francesco; Campana, Carmela; Cappello, Anna Rita; Sotgia, Federica; Lisanti, Michael P; Pezzi, Vincenzo


    The pathogenesis of the adrenocortical cancer (ACC) involves integration of molecular signals and the interplay of different downstream pathways (i.e. IGFII/IGF1R, β-catenin, Wnt, ESR1). This tumor is characterized by limited therapeutic options and unsuccessful treatments. A useful strategy to develop an effective therapy for ACC is to identify a common downstream target of these multiple pathways. A good candidate could be the transcription factor estrogen-related receptor alpha (ERRα) because of its ability to regulate energy metabolism, mitochondrial biogenesis and signalings related to cancer progression. In this study we tested the effect of ERRα inverse agonist, XCT790, on the proliferation of H295R adrenocortical cancer cell line. Results from in vitro and in vivo experiments showed that XCT790 reduced H295R cell growth. The inhibitory effect was associated with impaired cell cycle progression which was not followed by any apoptotic event. Instead, incomplete autophagy and cell death by a necrotic processes, as a consequence of the cell energy failure, induced by pharmacological reduction of ERRα was evidenced. Our results indicate that therapeutic strategies targeting key factors such as ERRα that control the activity and signaling of bioenergetics processes in high-energy demanding tumors could represent an innovative/alternative therapy for the treatment of ACC. PMID:26312764

  10. Estrogen related receptor α (ERRα) a promising target for the therapy of adrenocortical carcinoma (ACC)

    PubMed Central

    Chimento, Adele; Sirianni, Rosa; Malivindi, Rocco; Rago, Vittoria; Fiorillo, Marco; Domanico, Francesco; Campana, Carmela; Cappello, Anna Rita; Sotgia, Federica; Lisanti, Michael P.; Pezzi, Vincenzo


    The pathogenesis of the adrenocortical cancer (ACC) involves integration of molecular signals and the interplay of different downstream pathways (i.e. IGFII/IGF1R, β-catenin, Wnt, ESR1). This tumor is characterized by limited therapeutic options and unsuccessful treatments. A useful strategy to develop an effective therapy for ACC is to identify a common downstream target of these multiple pathways. A good candidate could be the transcription factor estrogen-related receptor alpha (ERRα) because of its ability to regulate energy metabolism, mitochondrial biogenesis and signalings related to cancer progression. In this study we tested the effect of ERRα inverse agonist, XCT790, on the proliferation of H295R adrenocortical cancer cell line. Results from in vitro and in vivo experiments showed that XCT790 reduced H295R cell growth. The inhibitory effect was associated with impaired cell cycle progression which was not followed by any apoptotic event. Instead, incomplete autophagy and cell death by a necrotic processes, as a consequence of the cell energy failure, induced by pharmacological reduction of ERRα was evidenced. Our results indicate that therapeutic strategies targeting key factors such as ERRα that control the activity and signaling of bioenergetics processes in high-energy demanding tumors could represent an innovative/alternative therapy for the treatment of ACC. PMID:26312764

  11. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.


    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  12. Adrenocortical cancer (ACC) - literature overview and own experience.


    Dworakowska, Dorota; Drabarek, Agata; Wenzel, Ingrid; Babińska, Anna; Świątkowska-Stodulska, Renata; Sworczak, Krzysztof


    Adrenocortical carcinoma (ACC) is a malignant endocrine tumour. The rarity of the disease has stymied therapeutic development. Age distribution shows two peaks: the first and fifth decades of life, with children and women more frequently affected. Although 60-70% of ACCs are biochemically found to overproduce hormones, it is not clinically apparent in many cases. If present, endocrine symptoms include signs of hypercortisolaemia, virilisation or gynaecomastia. ACC carries a poor prognosis, and a cure can be achieved only by complete surgical resection. Mitotane is used both as an adjuvant treatment and also in non-operative patients. The role of radio- and chemotherapy is still controversial. The post-operative disease free survival is low and oscillates around 30% due to high tumour recurrence rate. The diagnosis is based on tumour histological assessment with the use of the Weiss score, however urinary steroid profiling (if available) can serve to differentiate between ACC and other adrenal tumours. Conventional prognostic markers in ACC include stage and grade of disease, and, as currently reported, the presence of hypercortisolaemia. Molecular analysis has had a significant impact on the understanding of the pathogenetic mechanism of ACC development and the evaluation of prognostic and predictive markers, among which alterations of the IGF system, the Wnt pathway, p53 and molecules involved in cancer cell invasion properties and angiogenesis seem to be very promising. We here summarise our own experience related to the management of ACC and present a literature overview. We have not aimed to include a detailed summary of the molecular alterations biology described in ACC, as this has already been addressed in other papers. PMID:25554619

  13. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.


    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W


    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  14. NAC Transcription Factor SPEEDY HYPONASTIC GROWTH Regulates Flooding-Induced Leaf Movement in Arabidopsis[W

    PubMed Central

    Rauf, Mamoona; Arif, Muhammad; Fisahn, Joachim; Xue, Gang-Ping; Balazadeh, Salma; Mueller-Roeber, Bernd


    In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important architectural stress response that critically determines plant performance in natural habitats. The directional growth is based on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis thaliana, governed by the NAC transcription factor SPEEDY HYPONASTIC GROWTH (SHYG). Overexpression of SHYG in transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several EXPANSIN and XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE genes encoding cell wall–loosening proteins was enhanced in SHYG overexpressors but lowered in shyg. We identified ACC OXIDASE5 (ACO5), encoding a key enzyme of ET biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging. PMID:24363315

  15. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  16. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.


    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit


    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  17. Discovery and optimization of antibacterial AccC inhibitors

    SciTech Connect

    Cheng, Cliff C.; Shipps, Jr., Gerald W.; Yang, Zhiwei; Sun, Binyuan; Kawahata, Noriyuki; Soucy, Kyle A.; Soriano, Aileen; Orth, Peter; Xiao, Li; Mann, Paul; Black, Todd


    The biotin carboxylase (AccC) is part of the multi-component bacterial acetyl coenzyme-A carboxylase (ACCase) and is essential for pathogen survival. We describe herein the affinity optimization of an initial hit to give 2-(2-chlorobenzylamino)-1-(cyclohexylmethyl)-1H-benzo[d]imidazole-5-carboxamide (1), which was identified using our proprietary Automated Ligand Identification System (ALIS). The X-ray co-crystal structure of 1 was solved and revealed several key interactions and opportunities for further optimization in the ATP site of AccC. Structure Based Drug Design (SBDD) and parallel synthetic approaches resulted in a novel series of AccC inhibitors, exemplified by (R)-2-(2-chlorobenzylamino)-1-(2,3-dihydro-1H-inden-1-yl)-1H-imidazo[4,5-b]pyridine-5-carboxamide (40). This compound is a potent and selective inhibitor of bacterial AccC with an IC{sub 50} of 20 nM and a MIC of 0.8 {micro}g/mL against a sensitized strain of Escherichia coli (HS294 E. coli).

  18. The ACCE 2012 Study Tour: Reflections on Reoccurring Themes

    ERIC Educational Resources Information Center

    Clements, Di; Grover, David; Grover, Pam; Hearne, Dominic; Knipe, Steven; Martin, Kim; Pazzi, Georgina; Pollard, Edward; Prestridge, Sarah


    Transformational leadership is essential in education as it empowers educators to make positive changes to the way they think, feel and act in improving learning for all. Reflection is a vital element of leading the change process. In relation to participating in the ACCE study tour experience, reflection allows one to sit and think about the…


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  20. Improving production of malonyl coenzyme A-derived metabolites by abolishing Snf1-dependent regulation of Acc1.


    Shi, Shuobo; Chen, Yun; Siewers, Verena; Nielsen, Jens


    ABSTRACT Acetyl coenzyme A (acetyl-CoA) carboxylase (ACCase) plays a central role in carbon metabolism and has been the site of action for the development of therapeutics or herbicides, as its product, malonyl-CoA, is a precursor for production of fatty acids and other compounds. Control of Acc1 activity in the yeast Saccharomyces cerevisiae occurs mainly at two levels, i.e., regulation of transcription and repression by Snf1 protein kinase at the protein level. Here, we demonstrate a strategy for improving the activity of ACCase in S. cerevisiae by abolishing posttranslational regulation of Acc1 via site-directed mutagenesis. It was found that introduction of two site mutations in Acc1, Ser659 and Ser1157, resulted in an enhanced activity of Acc1 and increased total fatty acid content. As Snf1 regulation of Acc1 is particularly active under glucose-limited conditions, we evaluated the effect of the two site mutations in chemostat cultures. Finally, we showed that our modifications of Acc1 could enhance the supply of malonyl-CoA and therefore successfully increase the production of two industrially important products derived from malonyl-CoA, fatty acid ethyl esters and 3-hydroxypropionic acid. IMPORTANCE ACCase is responsible for carboxylation of acetyl-CoA to produce malonyl-CoA, which is a crucial step in the control of fatty acid metabolism. ACCase opened the door for pharmaceutical treatments of obesity and diabetes as well as the development of new herbicides. ACCase is also recognized as a promising target for developing cell factories, as its malonyl-CoA product serves as a universal precursor for a variety of high-value compounds in white biotechnology. Yeast ACCase is a good model in understanding the enzyme's catalysis, regulation, and inhibition. The present study describes the importance of protein phosphorylation in regulation of yeast ACCase and identifies potential regulation sites. This study led to the generation of a more efficient ACCase, which

  1. An Open Letter to the Professional Communities of Australian Council for Computers in Education (ACCE)

    ERIC Educational Resources Information Center

    Williams, Michelle


    This article presents an open letter to the Professional Communities of Australian Council for Computers in Education (ACCE). In preparing for this article, the author looked back over the contributions of other fellows in publications and ACCE Minutes, and recognized that each had led the ACCE family in this endeavor. Creating direction was the…

  2. In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes

    SciTech Connect

    Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan; Krejci, Minna R.; Weigand, Steven; Joester, Derk


    We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

  3. Direct observations of the ACC transport across the Kerguelen Plateau

    NASA Astrophysics Data System (ADS)

    Park, Young-Hyang; Vivier, Frédéric; Roquet, Fabien; Kestenare, Elodie


    Major pathways and transport of the Antarctic Circumpolar Current (ACC) crossing the Kerguelen Plateau were directly observed during the 2009 Track cruise. The net eastward transport to the south of the Heard/McDonald Islands is estimated as 56 Sv (1 Sv = 106 m3 s-1), 43 Sv of which is tightly channelled into the Fawn Trough that appears as a predominant cross-plateau gateway of circumpolar flow associated with the Southern ACC Front (SACCF). There are also two secondary passages, with one (6 Sv) being attached to the nearshore slope just south of the Heard/McDonald Islands and the other (7 Sv) passing through the northern Princess Elizabeth Trough. With an additional 2 Sv inferred just south of the Kerguelen Islands, the transport across the entire plateau amounts to 58 Sv, accounting for ˜40% of the total ACC transport transiting through the region, 147-152 Sv, quantities consistent with other independent estimates in the Indian sector of the Southern Ocean.

  4. Reward salience and risk aversion underlie differential ACC activity in substance dependence

    PubMed Central

    Alexander, William H.; Fukunaga, Rena; Finn, Peter; Brown, Joshua W.


    The medial prefrontal cortex, especially the dorsal anterior cingulate cortex (ACC), has long been implicated in cognitive control and error processing. Although the association between ACC and behavior has been established, it is less clear how ACC contributes to dysfunctional behavior such as substance dependence. Evidence from neuroimaging studies investigating ACC function in substance users is mixed, with some studies showing disengagement of ACC in substance dependent individuals (SDs), while others show increased ACC activity related to substance use. In this study, we investigate ACC function in SDs and healthy individuals performing a change signal task for monetary rewards. Using a priori predictions derived from a recent computational model of ACC, we find that ACC activity differs between SDs and controls in factors related to reward salience and risk aversion between SDs and healthy individuals. Quantitative fits of a computational model to fMRI data reveal significant differences in best fit parameters for reward salience and risk preferences. Specifically, the ACC in SDs shows greater risk aversion, defined as concavity in the utility function, and greater attention to rewards relative to reward omission. Furthermore, across participants risk aversion and reward salience are positively correlated. The results clarify the role that ACC plays in both the reduced sensitivity to omitted rewards and greater reward valuation in SDs. Clinical implications of applying computational modeling in psychiatry are also discussed. PMID:26106528

  5. ACC2 Is Expressed at High Levels Human White Adipose and Has an Isoform with a Novel N-Terminus

    PubMed Central

    Raymond, Christopher K.; Garrett-Engele, Philip; Ohwaki, Kenji; Kan, Zhengyan; Kusunoki, Jun; Johnson, Jason M.


    Acetyl-CoA carboxylases ACC1 and ACC2 catalyze the carboxylation of acetyl-CoA to malonyl-CoA, regulating fatty-acid synthesis and oxidation, and are potential targets for treatment of metabolic syndrome. Expression of ACC1 in rodent lipogenic tissues and ACC2 in rodent oxidative tissues, coupled with the predicted localization of ACC2 to the mitochondrial membrane, have suggested separate functional roles for ACC1 in lipogenesis and ACC2 in fatty acid oxidation. We find, however, that human adipose tissue, unlike rodent adipose, expresses more ACC2 mRNA relative to the oxidative tissues muscle and heart. Human adipose, along with human liver, expresses more ACC2 than ACC1. Using RT-PCR, real-time PCR, and immunoprecipitation we report a novel isoform of ACC2 (ACC2.v2) that is expressed at significant levels in human adipose. The protein generated by this isoform has enzymatic activity, is endogenously expressed in adipose, and lacks the N-terminal sequence. Both ACC2 isoforms are capable of de novo lipogenesis, suggesting that ACC2, in addition to ACC1, may play a role in lipogenesis. The results demonstrate a significant difference in ACC expression between human and rodents, which may introduce difficulties for the use of rodent models for development of ACC inhibitors. PMID:19190759

  6. Permethrin Induces Overexpression of Cytochrome c Oxidase Subunit 3 in Aedes aegypti

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using quantitative PCR (QPCR), the relative transcriptional levels of cytochrome c oxidase subunit 3 (CO3) were studied in Aedes aegypti (L.) in response to treatments with acetone, permethrin, or fipronil. The transcriptional levels of CO3 were significantly (p <0.05) higher in acetone-treated Ae. ...

  7. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi


    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  8. Proline dehydrogenase (oxidase) in cancer.


    Liu, Wei; Phang, James M


    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and Δ(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing α-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPARγ), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  9. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G


    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  10. Further studies of auxin and ACC induced feminization in the cucumber plant using ethylene inhibitors

    NASA Technical Reports Server (NTRS)

    Takahashi, H.; Jaffe, M. J.


    The present study was designed to establish the role of an essential hormone controlling sex expression in cucumber. A potent anti-ethylene agent, AgNO3, completely inhibited pistillate flower formation caused by IAA, ACC or ethephon. Inhibitors of ethylene biosynthesis, AVG and CoCl2 also suppressed feminization due to exogenous IAA or ACC. Though AVG also suppressed ethephon-induced feminization, this may be due to the second effect of AVG rather than the effect on ACC biosynthesis. These results confirm that ethylene is a major factor regulating feminization and that exogenous auxin induces pistillate flower formation through its stimulation of ethylene production, rather than ACC production.

  11. Differential regulation of genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase in etiolated pea seedlings: effects of indole-3-acetic acid, wounding, and ethylene.


    Peck, S C; Kende, H


    Treatment of 5- to 6-day-old etiolated pea (Pisum sativum L.) seedlings with indole-3-acetic acid (IAA) induced within 15 min an increase in the transcript levels of two genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase, Ps-ACS1 and Ps-ACS2. Simultaneous treatment with ethylene inhibited this increase and also caused a decrease in ACC synthase enzyme activity as compared to that of seedlings treated with IAA alone. These results indicate that ethylene inhibits its own biosynthesis by decreasing ACC synthase transcript levels via a negative feedback loop. Wounding of pea stems had no effect on the expression of Ps-ACS1, but led within 10 min to an increase in the mRNA levels of Ps-ACS2. This increase was also inhibited by ethylene. The wound signal was transmitted over a distance of at least 4 cm through the stem with no delay in induction or response intensity. The rapid transmission of the wound response is consistent with the possibility that a hydraulic or electric signal is responsible for the spread of the wound response. PMID:9869404

  12. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2010 CFR


    ... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Default under the Annual Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development Regulations Relating...

  13. 24 CFR 985.109 - Default under the Annual Contributions Contract (ACC).

    Code of Federal Regulations, 2011 CFR


    ... § 985.109 Default under the Annual Contributions Contract (ACC). HUD may determine that an PHA's failure... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Default under the Annual Contributions Contract (ACC). 985.109 Section 985.109 Housing and Urban Development REGULATIONS RELATING...

  14. ACCE/ACS National Educator and Leader of the Year Winners: AEC Congratulates These Outstanding Educators

    ERIC Educational Resources Information Center

    Australian Educational Computing, 2012


    This article presents the ACCE/ACS National Educator and Leader of the Year winners. Anne Mirtschin is the recipient of the ACCE/ACS 2012 Educator of the Year Award. Mirtschin is an innovative teacher at Hawkesdale P-12 College a small rural school that is isolated culturally and geographically. She uses online tools and technology to create…

  15. Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

    PubMed Central

    Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.


    Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

  16. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.


    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  17. Minimal impact of age and housing temperature on the metabolic phenotype of Acc2-/- mice.


    Brandon, Amanda E; Stuart, Ella; Leslie, Simon J; Hoehn, Kyle L; James, David E; Kraegen, Edward W; Turner, Nigel; Cooney, Gregory J


    An important regulator of fatty acid oxidation (FAO) is the allosteric inhibition of CPT-1 by malonyl-CoA produced by the enzyme acetyl-CoA carboxylase 2 (ACC2). Initial studies suggested that deletion of Acc2 (Acacb) increased fat oxidation and reduced adipose tissue mass but in an independently generated strain of Acc2 knockout mice we observed increased whole-body and skeletal muscle FAO and a compensatory increase in muscle glycogen stores without changes in glucose tolerance, energy expenditure or fat mass in young mice (12-16 weeks). The aim of the present study was to determine whether there was any effect of age or housing at thermoneutrality (29 °C; which reduces total energy expenditure) on the phenotype of Acc2 knockout mice. At 42-54 weeks of age, male WT and Acc2(-/-) mice had similar body weight, fat mass, muscle triglyceride content and glucose tolerance. Consistent with younger Acc2(-/-) mice, aged Acc2(-/-) mice showed increased whole-body FAO (24 h average respiratory exchange ratio=0.95±0.02 and 0.92±0.02 for WT and Acc2(-/-) mice respectively, P<0.05) and skeletal muscle glycogen content (+60%, P<0.05) without any detectable change in whole-body energy expenditure. Hyperinsulinaemic-euglycaemic clamp studies revealed no difference in insulin action between groups with similar glucose infusion rates and tissue glucose uptake. Housing Acc2(-/-) mice at 29 °C did not alter body composition, glucose tolerance or the effects of fat feeding compared with WT mice. These results confirm that manipulation of Acc2 may alter FAO in mice, but this has little impact on body composition or insulin action. PMID:26668208

  18. Coupling in cytochrome c oxidase

    PubMed Central

    Kessler, R. J.; Blondin, G. A.; Zande, H. Vande; Haworth, R. A.; Green, D. E.


    Cytochrome c oxidase (ferrocytochrome c: oxygen oxidoreductase; EC can be resolved into an electron transfer complex (ETC) and an ionophore transfer complex (ITC). Coupling requires an interaction between the moving electron in the ETC and a moving, positively charged ionophore-cation adduct in the ITC. The duplex character of cytochrome oxidase facilitates this interaction. The ITC mediates cyclical cation transport. It can be replaced as the coupling partner by the combination of valinomycin and nigericin in the presence of K+ when cytochrome oxidase is incorporated into liposomes containing acidic phospholipids or by the combination of lipid cytochrome c and bile acids in an ITC-resolved preparation of the ETC. Respiratory control can be induced by incorporating cytochrome oxidase into vesicles of unfractionated whole mitochondrial lipid. The activity of the ITC is suppressed by such incorporation and this suppression leads to the emergence of respiratory control. The ionophoroproteins of the ITC can be extracted into organic solvents; some 50% of the total protein of cytochrome oxidase is extractable. The release of free ionophore is achieved by tryptic digestion of the ionophoroprotein. Preliminary to this release the ionophoroprotein is degraded to an ionophoropeptide. Electrogenic ionophores, as well as uncoupler, are liberated by such proteolysis. The ITC contains a set of ionophoroproteins imbedded in a matrix of phospholipid. Images PMID:198794

  19. New synthetic AICAR derivatives with enhanced AMPK and ACC activation.


    Scudiero, Olga; Nigro, Ersilia; Monaco, Maria Ludovica; Oliviero, Giorgia; Polito, Rita; Borbone, Nicola; D'Errico, Stefano; Mayol, Luciano; Daniele, Aurora; Piccialli, Gennaro


    5-Aminoimidazole-4-carboxamide riboside (AICAR) has an important role in the regulation of the cellular metabolism showing a broad spectrum of therapeutic activities against different metabolic processes. Due to these proven AICAR properties, we have designed, synthesized and tested the biological activity of two ribose-modified AICAR derivatives, named A3 and A4, in comparison to native AICAR and its 5'-phosphorylated counterpart ZMP. Our findings have shown that A3 and A4 derivatives induce the phosphorylation of 5'-AMP activated protein kinase α (AMPKα), which leads to the inhibition of acetyl-CoA carboxylase (ACC), and down-regulate the activity of the extracellular signal-regulated kinases (ERK1/2). Cytotoxicity tests demonstrated that A3 and A4 do not significantly reduce cell viability up to 24 h. Taken together our results indicate that A3 and A4 have a comparable activity to AICAR and ZMP at 0.5 and 1 mM suggesting their potential use in future pharmacological strategies relating to metabolic diseases. PMID:26446934

  20. Astronomical Image Compression Techniques Based on ACC and KLT Coder

    NASA Astrophysics Data System (ADS)

    Schindler, J.; Páta, P.; Klíma, M.; Fliegel, K.

    This paper deals with a compression of image data in applications in astronomy. Astronomical images have typical specific properties -- high grayscale bit depth, size, noise occurrence and special processing algorithms. They belong to the class of scientific images. Their processing and compression is quite different from the classical approach of multimedia image processing. The database of images from BOOTES (Burst Observer and Optical Transient Exploring System) has been chosen as a source of the testing signal. BOOTES is a Czech-Spanish robotic telescope for observing AGN (active galactic nuclei) and the optical transient of GRB (gamma ray bursts) searching. This paper discusses an approach based on an analysis of statistical properties of image data. A comparison of two irrelevancy reduction methods is presented from a scientific (astrometric and photometric) point of view. The first method is based on a statistical approach, using the Karhunen-Loève transform (KLT) with uniform quantization in the spectral domain. The second technique is derived from wavelet decomposition with adaptive selection of used prediction coefficients. Finally, the comparison of three redundancy reduction methods is discussed. Multimedia format JPEG2000 and HCOMPRESS, designed especially for astronomical images, are compared with the new Astronomical Context Coder (ACC) coder based on adaptive median regression.

  1. 1-aminocyclopropane-1-carboxylic acid (ACC) in plants: more than just the precursor of ethylene!

    PubMed Central

    Van de Poel, Bram; Van Der Straeten, Dominique


    Ethylene is a simple two carbon atom molecule with profound effects on plants. There are quite a few review papers covering all aspects of ethylene biology in plants, including its biosynthesis, signaling and physiology. This is merely a logical consequence of the fascinating and pleiotropic nature of this gaseous plant hormone. Its biochemical precursor, 1-aminocyclopropane-1-carboxylic acid (ACC) is also a fairly simple molecule, but perhaps its role in plant biology is seriously underestimated. This triangularly shaped amino acid has many more features than just being the precursor of the lead-role player ethylene. For example, ACC can be conjugated to three different derivatives, but their biological role remains vague. ACC can also be metabolized by bacteria using ACC-deaminase, favoring plant growth and lowering stress susceptibility. ACC is also subjected to a sophisticated transport mechanism to ensure local and long-distance ethylene responses. Last but not least, there are now a few exciting studies where ACC has been reported to function as a signal itself, independently from ethylene. This review puts ACC in the spotlight, not to give it the lead-role, but to create a picture of the stunning co-production of the hormone and its precursor. PMID:25426135

  2. OpenARC: Extensible OpenACC Compiler Framework for Directive-Based Accelerator Programming Study

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    Directive-based, accelerator programming models such as OpenACC have arisen as an alternative solution to program emerging Scalable Heterogeneous Computing (SHC) platforms. However, the increased complexity in the SHC systems incurs several challenges in terms of portability and productivity. This paper presents an open-sourced OpenACC compiler, called OpenARC, which serves as an extensible research framework to address those issues in the directive-based accelerator programming. This paper explains important design strategies and key compiler transformation techniques needed to implement the reference OpenACC compiler. Moreover, this paper demonstrates the efficacy of OpenARC as a research framework for directive-based programming study, by proposing and implementing OpenACC extensions in the OpenARC framework to 1) support hybrid programming of the unified memory and separate memory and 2) exploit architecture-specific features in an abstract manner. Porting thirteen standard OpenACC programs and three extended OpenACC programs to CUDA GPUs shows that OpenARC performs similarly to a commercial OpenACC compiler, while it serves as a high-level research framework.

  3. Report of the American College of Cardiology (ACC) Scientific Sessions 2016, Chicago.


    Mano, Toshiaki; Yamamoto, Kazuhiro


    The 65(th)Annual Scientific Sessions of the American College of Cardiology (ACC) were held at McCormick Place, Chicago, from April 2-4, 2016. The ACC Scientific Sessions are one of the 2 major scientific cardiology meetings in the USA and one of the major scientific meetings of cardiology in the world. It had an attendance of 18,769 and over 2,000 oral and poster abstracts, including 8 late-breaking clinical trials. This report presents the key presentations and the highlights from the ACC Scientific Sessions 2016 in Chicago. (Circ J 2016; 80: 1308-1313). PMID:27151567

  4. Report of the American College of Cardiology (ACC) Scientific Sessions 2015, San Diego.


    Murohara, Toyoaki


    The 64th Annual Scientific Sessions and Exposition of the American College of Cardiology (ACC) were held at the San Diego Convention Center from March 14-16, 2015. The ACC Scientific Sessions are 1 of 2 major scientific cardiology meetings in the United States, with nearly 20,000 attendees, including 15,000 cardiovascular professionals. There were over 2,100 oral and poster abstracts, and more than 15 late-breaking clinical trials (LBCTs) abstructs. This report presents the highlights and several key presentations, especially the LBCTs, from the ACC Scientific Sessions 2015. I hope this review will help cardiologists update to the latest information. PMID:25959559

  5. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central


    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  6. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  7. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.


    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  8. Technology Awareness Workshop on Active Combustion Control (ACC) in Propulsion Systems: JANNAF Combustion Subcommittee Workshop

    NASA Technical Reports Server (NTRS)

    Fry, Ronald S. (Editor); Gannaway, Mary T. (Editor)


    A JANNAF Combustion Subcommittee Technology Awareness Seminar on Active Combustion Control (ACC) in Propulsion Systems' was held 12 November 1997 at the NASA Lewis Research Center (LeRC), Cleveland, Ohio. The objectives of the seminar were: 1) Define the need and potential of ACC to meet future requirements for gas turbines and ramjets; 2) Explain general principles of ACC and discuss recent successes to suppress combustion instabilities, increase combustion efficiency, reduce emission, and extend flammability limits; 3) Identify R&D barriers/needs for practical implementation of ACC; 4) Explore potential for improving coordination of future R&D activities funded by various government agencies. Over 40 individuals representing senior management from over 20 industry and government organizations participated. This document summarizes the presentations and findings of this seminar.

  9. IMPACC: A Tightly Integrated MPI+OpenACC Framework Exploiting Shared Memory Parallelism

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    We propose IMPACC, an MPI+OpenACC framework for heterogeneous accelerator clusters. IMPACC tightly integrates MPI and OpenACC, while exploiting the shared memory parallelism in the target system. IMPACC dynamically adapts the input MPI+OpenACC applications on the target heterogeneous accelerator clusters to fully exploit target system-specific features. IMPACC provides the programmers with the unified virtual address space, automatic NUMA-friendly task-device mapping, efficient integrated communication routines, seamless streamlining of asynchronous executions, and transparent memory sharing. We have implemented IMPACC and evaluated its performance using three heterogeneous accelerator systems, including Titan supercomputer. Results show that IMPACC can achieve easier programming, higher performance, and better scalability than the current MPI+OpenACC model.

  10. OpenACC programs of the Swendsen-Wang multi-cluster spin flip algorithm

    NASA Astrophysics Data System (ADS)

    Komura, Yukihiro


    We present sample OpenACC programs of the Swendsen-Wang multi-cluster spin flip algorithm. OpenACC is a directive-based programming model for accelerators without requiring modification to the underlying CPU code itself. In this paper, we deal with the classical spin models as with the sample CUDA programs (Komura and Okabe, 2014), that is, two-dimensional (2D) Ising model, three-dimensional (3D) Ising model, 2D Potts model, 3D Potts model, 2D XY model and 3D XY model. We explain the details of sample OpenACC programs and compare the performance of the present OpenACC implementations with that of the CUDA implementations for the 2D and 3D Ising models and the 2D and 3D XY models.

  11. Polyphenol oxidase expression in potato (Solanum tuberosum) tubers inhibited to sprouting by treatment with iodine atmosphere.


    Eolini, Francesco; Hochkoeppler, Alejandro; Credi, Andrea; Rodríguez, Antonio Gonzàlez Vara Y; Poggi, Valeria


    Iodine-saturated atmosphere was found to inhibit the sprouting of potato (Solanum tuberosum L.) tubers. The iodine concentration in tuber tissues increased as a function of exposure length, and the onset of inhibition of sprouting was found to depend on tubers genotype. During the time-course of the treatment, the transcription of polyphenol oxidases (EC and EC was undetectable in tuber peel, whereas in bud tissues featured an increase, followed by a decrease occurring simultaneously with the suppression of sprouting. The treatment of tubers with iodine strongly affected the expression of polyphenol oxidases at the transcriptional level. Polyphenol oxidase activity in buds poorly reflected the corresponding level of transcription; similarly, little differences were found among the enzyme isoforms expressed in buds as a function of length of exposure to iodine. These findings suggest that the induction of polyphenol oxidases mRNAs transcription could probe the inhibition of sprouting by iodine. PMID:15587701

  12. Effect of dexamethasone and ACC on bacteria-induced mucin expression in human airway mucosa.


    Hauber, Hans-Peter; Goldmann, Torsten; Vollmer, Ekkehard; Wollenberg, Barbara; Zabel, Peter


    Gram-negative bacteria can stimulate mucin production, but excessive mucus supports bacterial infection and consequently leads to airway obstruction. Therefore, the effect of dexamethasone (DEX) and the antioxidant acetyl-cysteine (ACC) on bacteria-induced mucus expression was investigated. Explanted human airway mucosa and mucoepidermoid cells (Calu-3) were stimulated with lipopolysaccharide (LPS) or PAM3 (a synthetic lipoprotein). DEX or ACC were added to either LPS- or PAM3-stimulated airway mucosa or Calu-3 cells. Mucin mRNA expression (MUC5AC) and total mucus glycoconjugates (mucin protein) were quantified using real-time PCR and periodic acid Schiff staining. LPS and PAM3 significantly increased mucin expression in airway mucosa and Calu-3 cells (P < 0.05). DEX alone had no significant effect on mucin expression in airway mucosa or Calu-3 cells (P > 0.05). In contrast, DEX significantly reduced LPS- and PAM3-induced mucin expression in explanted mucosal tissue and mucin expression in Calu-3 cells (P < 0.05). In explanted human airway mucosa ACC alone significantly increased mucin expression (P < 0.05). In contrast, ACC significantly decreased LPS- and PAM3-induced mucin expression (P < 0.05). In Calu-3 cells ACC alone had no significant effect on mucin expression (P > 0.05). ACC decreased LPS- and PAM3-induced mucin expression, but this effect was not significant (P > 0.05). These data suggest that DEX can effectively reduce bacteria-induced mucin expression in the airways. ACC alone may increase mucin expression in noninfected mucosa, but it decreased bacteria-induced mucin expression. Further studies are warranted to evaluate whether the effect of DEX or ACC is clinically relevant. PMID:17600317

  13. Effectiveness of rhizobacteria containing ACC deaminase for growth promotion of peas (Pisum sativum) under drought conditions.


    Zahir, Z A; Munir, A; Asghar, H N; Shaharoona, B; Arshad, M


    A series of experiments were conducted to assess the effectiveness of rhizobacteria containing 1-aminocyclopropane- 1-carboxylate (ACC) deaminase for growth promotion of peas under drought conditions. Ten rhizobacteria isolated from the rhizosphere of different crops (peas, wheat, and maize) were screened for their growth promoting ability in peas under axenic condition. Three rhizobacterial isolates, Pseudomonas fluorescens biotype G (ACC-5), P. fluorescens (ACC-14), and P. putida biotype A (Q-7), were selected for pot trial on the basis of their source, ACC deaminase activity, root colonization, and growth promoting activity under axenic conditions. Inoculated and uninoculated (control) seeds of pea cultivar 2000 were sown in pots (4 seeds/pot) at different soil moisture levels (25, 50, 75, and 100% of field capacity). Results revealed that decreasing the soil moisture levels from 100 to 25% of field capacity significantly decreased the growth of peas. However, inoculation of peas with rhizobacteria containing ACC deaminase significantly decreased the "drought stress imposed effects" on growth of peas, although with variable efficacy at different moisture levels. At the lowest soil moisture level (25% field capacity), rhizobacterial isolate Pseudomonas fluorescens biotype G (ACC-5) was found to be more promising compared with the other isolates, as it caused maximum increases in fresh weight, dry weight, root length, shoot length, number of leaves per plant, and water use efficiency on fresh and dry weight basis (45, 150, 92, 45, 140, 46, and 147%, respectively) compared with respective uninoculated controls. It is highly likely that rhizobacteria containing ACC deaminase might have decreased the drought-stress induced ethylene in inoculated plants, which resulted in better growth of plants even at low moisture levels. Therefore, inoculation with rhizobacteria containing ACC deaminase could be helpful in eliminating the inhibitory effects of drought stress on the

  14. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )


    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  15. Mechanisms of placebo analgesia: rACC recruitment of a subcortical antinociceptive network.


    Bingel, U; Lorenz, J; Schoell, E; Weiller, C; Büchel, C


    Placebo analgesia is one of the most striking examples of the cognitive modulation of pain perception and the underlying mechanisms are finally beginning to be understood. According to pharmacological studies, the endogenous opioid system is essential for placebo analgesia. Recent functional imaging data provides evidence that the rostral anterior cingulate cortex (rACC) represents a crucial cortical area for this type of endogenous pain control. We therefore hypothesized that placebo analgesia recruits other brain areas outside the rACC and that interactions of the rACC with these brain areas mediate opioid-dependent endogenous antinociception as part of a top-down mechanism. Nineteen healthy subjects received and rated painful laser stimuli to the dorsum of both hands, one of them treated with a fake analgesic cream (placebo). Painful stimulation was preceded by an auditory cue, indicating the side of the next laser stimulation. BOLD-responses to the painful laser-stimulation during the placebo and no-placebo condition were assessed using event-related fMRI. After having confirmed placebo related activity in the rACC, a connectivity analysis identified placebo dependent contributions of rACC activity with bilateral amygdalae and the periaqueductal gray (PAG). This finding supports the view that placebo analgesia depends on the enhanced functional connectivity of the rACC with subcortical brain structures that are crucial for conditioned learning and descending inhibition of nociception. PMID:16364549

  16. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T


    Urate oxidase, or uricase (EC, is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  17. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.


    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim


    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  18. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim


    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  19. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.


    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  20. Elevated Monoamine Oxidase-A Distribution Volume in Borderline Personality Disorder Is Associated With Severity Across Mood Symptoms, Suicidality, and Cognition

    PubMed Central

    Kolla, Nathan J.; Chiuccariello, Lina; Wilson, Alan A.; Houle, Sylvain; Links, Paul; Bagby, R. Michael; McMain, Shelley; Kellow, Charis; Patel, Jalpa; Rekkas, Paraskevi V.; Pasricha, Suvercha; Meyer, Jeffrey H.


    BACKGROUND Monoamine oxidase-A (MAO-A) is a treatment target in neurodegenerative illness and mood disorders that increases oxidative stress and predisposition toward apoptosis. Increased MAO-A levels in prefrontal cortex (PFC) and anterior cingulate cortex (ACC) occur in rodent models of depressive behavior and human studies of depressed moods. Extreme dysphoria is common in borderline personality disorder (BPD), especially when severe, and the molecular underpinnings of severe BPD are largely unknown. We hypothesized that MAO-A levels in PFC and ACC would be highest in severe BPD and would correlate with symptom magnitude. METHODS [11C] Harmine positron emission tomography measured MAO-A total distribution volume (MAO-A VT), an index of MAO-A density, in severe BPD subjects (n = 14), moderate BPD subjects (n = 14), subjects with a major depressive episode (MDE) only (n = 14), and healthy control subjects (n = 14). All subjects were female. RESULTS Severe BPD was associated with greater PFC and ACC MAO-A VT compared with moderate BPD, MDE, and healthy control subjects (multivariate analysis of variance group effect: F6,102 = 5.6, p < .001). In BPD, PFC and ACC MAO-A VT were positively correlated with mood symptoms (PFC: r = .52, p = .005; ACC: r = .53, p = .004) and suicidality (PFC: r = .40, p = .037; ACC: r = .38, p = .046), while hippocampus MAO-A VT was negatively correlated with verbal memory (r = −.44, p = .023). CONCLUSIONS These results suggest that elevated MAO-A VT is associated with multiple indicators of BPD severity, including BPD symptomatology, mood symptoms, suicidality, and neurocognitive impairment. PMID:25698585

  1. The Function of Ascorbate Oxidase in Tobacco1

    PubMed Central

    Pignocchi, Cristina; Fletcher, John M.; Wilkinson, Joy E.; Barnes, Jeremy D.; Foyer, Christine H.


    The function of the apoplastic enzyme ascorbate oxidase (AO) was investigated in tobacco (Nicotiana tabacum). The abundance of AO mRNA was up-regulated by light. Cytosolic ascorbate peroxidase (APX1) transcripts were also highest in the light. In contrast, l-galactono-γ-lactone dehydrogenase, stromal APX, and thylakoid APX transcripts remained constant over the day/night cycle. Salicylic acid inhibited growth, increased expression of the pathogenesis-related protein (PR) 1a, and decreased AO transcript abundance. In contrast, the application of auxin enhanced growth and increased AO and PR 1a gene expression. Therefore, AO transcript abundance varied in a manner similar to hormone-mediated changes in plant growth. To study the effects of modified AO expression on growth, transformed tobacco plants expressing AO in the sense and antisense orientations were generated. The resultant large changes in apoplastic AO activity in the transformed tobacco plants had little effect on whole leaf ascorbate (AA) content, but they had dramatic effects on apoplastic AA levels. Enhanced AO activity oxidized the apoplastic AA pool, whereas decreased AO activity increased the amount of AA compared with dehydroascorbate. A relationship was observed between AO activity and plant height and biomass. Native AO transcript levels were no longer subject to light/dark regulation in AO sense and antisense plants. Taken together, these data show that there is an interaction between hormone, redox, and light signals at the level of the apoplast via modulation of ion of AA content. PMID:12857842

  2. OpenACC to FPGA: A Framework for Directive-based High-Performance Reconfigurable Computing

    SciTech Connect

    Lee, Seyong; Vetter, Jeffrey S


    This paper presents a directive-based, high-level programming framework for high-performance reconfigurable computing. It takes a standard, portable OpenACC C program as input and generates a hardware configuration file for execution on FPGAs. We implemented this prototype system using our open-source OpenARC compiler; it performs source-to-source translation and optimization of the input OpenACC program into an OpenCL code, which is further compiled into a FPGA program by the backend Altera Offline OpenCL compiler. Internally, the design of OpenARC uses a high- level intermediate representation that separates concerns of program representation from underlying architectures, which facilitates portability of OpenARC. In fact, this design allowed us to create the OpenACC-to-FPGA translation framework with minimal extensions to our existing system. In addition, we show that our proposed FPGA-specific compiler optimizations and novel OpenACC pragma extensions assist the compiler in generating more efficient FPGA hardware configuration files. Our empirical evaluation on an Altera Stratix V FPGA with eight OpenACC benchmarks demonstrate the benefits of our strategy. To demonstrate the portability of OpenARC, we show results for the same benchmarks executing on other heterogeneous platforms, including NVIDIA GPUs, AMD GPUs, and Intel Xeon Phis. This initial evidence helps support the goal of using a directive-based, high-level programming strategy for performance portability across heterogeneous HPC architectures.

  3. Positive coping styles and perigenual ACC volume: two related mechanisms for conferring resilience?


    Holz, Nathalie E; Boecker, Regina; Jennen-Steinmetz, Christine; Buchmann, Arlette F; Blomeyer, Dorothea; Baumeister, Sarah; Plichta, Michael M; Esser, Günter; Schmidt, Martin; Meyer-Lindenberg, Andreas; Banaschewski, Tobias; Brandeis, Daniel; Laucht, Manfred


    Stress exposure has been linked to increased rates of depression and anxiety in adults, particularly in females, and has been associated with maladaptive changes in the anterior cingulate cortex (ACC), which is an important brain structure involved in internalizing disorders. Coping styles are important mediators of the stress reaction by establishing homeostasis, and may thus confer resilience to stress-related psychopathology. Anatomical scans were acquired in 181 healthy participants at age 25 years. Positive coping styles were determined using a self-report questionnaire (German Stress Coping Questionnaire, SVF78) at age 22 years. Adult anxiety and depression symptoms were assessed at ages 22, 23 and 25 years with the Young Adult Self-Report. Information on previous internalizing diagnoses was obtained by diagnostic interview (2-19 years). Positive coping styles were associated with increased ACC volume. ACC volume and positive coping styles predicted anxiety and depression in a sex-dependent manner with increased positive coping and ACC volume being related to lower levels of psychopathology in females, but not in males. These results remained significant when controlled for previous internalizing diagnoses. These findings indicate that positive coping styles and ACC volume are two linked mechanisms, which may serve as protective factors against internalizing disorders. PMID:26743466

  4. Breast- and salivary gland-derived adenoid cystic carcinomas: potential post-transcriptional divergencies. A pilot study based on miRNA expression profiling of four cases and review of the potential relevance of the findings.


    Kiss, Orsolya; Tőkés, Anna-Mária; Spisák, Sándor; Szilágyi, Anna; Lippai, Norbert; Székely, Borbála; Szász, A Marcell; Kulka, Janina


    Adenoid cystic carcinoma (ACC) is a malignant tumor of the salivary glands but identical tumors can also arise from the breast. Despite their similar histomorphological appearance the salivary gland- and the breast-derived forms differ in their clinical features: while ACC of the salivary glands (sACC) have an aggressive clinical course, the breast-derived form (bACC) shows a very favourable clinical outcome. To date no exact molecular alterations have yet been identified which would explain the diverse clinical features of the ACCs of different origin. In our pilot experiment we investigated the post-transcriptional features of ACC cases by performing microRNA-profiling on 2-2 bACC and sACC tissues and on 1-1 normal breast and salivary gland tissue. By comparing the microRNA-profiles of the investigated samples we identified microRNAs which were expressed differently in bACC and sACC cases according to their normal controls: 7 microRNAs were overexpressed in sACC cases and downexpressed in bACC tumors (let-7b, let-7c, miR-17, miR-20a, miR-24, miR-195, miR-768-3) while 9 microRNAs were downexpressed in sACC cases and overexpressed in bACC tissues (let-7e, miR-23b, miR-27b, miR-193b, miR-320a, miR-320c, miR-768-5p, miR-1280 and miR-1826) relative to their controls. We also identified 8 microRNAs which were only expressed in sACCs and one microRNA (miR-1234) which was only absent in sACC cases. By target predictor online databases potential targets of the these microRNAs were detected to identify genes that may play central role in the diverse clinical outcome of bACC and sACC cases. PMID:25240490

  5. Studies on the Mechanism of Aldehyde Oxidase and Xanthine Oxidase

    PubMed Central

    Alfaro, Joshua F.


    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp2 carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the anti-bonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations, and tend to support this mechanism. PMID:18998731

  6. Studies on the mechanism of aldehyde oxidase and xanthine oxidase.


    Alfaro, Joshua F; Jones, Jeffrey P


    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp(2) carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the antibonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations and tend to support this mechanism. PMID:18998731

  7. Precipitation of ACC in liposomes-a model for biomineralization in confined volumes

    SciTech Connect

    Tester, Chantel C; Wu, Ching-Hsuan; Weigand, Steven; Joester, Derk


    Biomineralizing organisms frequently precipitate minerals in small phospholipid bilayer-delineated compartments. We have established an in vitro model system to investigate the effect of confinement in attoliter to femtoliter volumes on the precipitation of calcium carbonate. In particular, we analyze the growth and stabilization of liposome-encapsulated amorphous calcium carbonate (ACC) nanoparticles using a combination of in situ techniques, cryo-transmission electron microscopy (Cryo-TEM), and small angle X-ray scattering (SAXS). Herein, we discuss ACC nanoparticle growth rate as a function of liposome size, carbon dioxide flux across the liposome membrane, pH, and osmotic pressure. Based on these experiments, we argue that the stabilization of ACC nanoparticles in liposomes is a consequence of a low nucleation rate (high activation barrier) of crystalline polymorphs of calcium carbonate.

  8. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen


    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  9. A feasibility study on porting the community land model onto accelerators using OpenACC


    Wang, Dali; Wu, Wei; Winkler, Frank; Ding, Wei; Hernandez, Oscar R.


    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflowmore » procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.« less

  10. A feasibility study on porting the community land model onto accelerators using OpenACC

    SciTech Connect

    Wang, Dali; Wu, Wei; Winkler, Frank; Ding, Wei; Hernandez, Oscar R.


    As environmental models (such as Accelerated Climate Model for Energy (ACME), Parallel Reactive Flow and Transport Model (PFLOTRAN), Arctic Terrestrial Simulator (ATS), etc.) became more and more complicated, we are facing enormous challenges regarding to porting those applications onto hybrid computing architecture. OpenACC appears as a very promising technology, therefore, we have conducted a feasibility analysis on porting the Community Land Model (CLM), a terrestrial ecosystem model within the Community Earth System Models (CESM)). Specifically, we used automatic function testing platform to extract a small computing kernel out of CLM, then we apply this kernel into the actually CLM dataflow procedure, and investigate the strategy of data parallelization and the benefit of data movement provided by current implementation of OpenACC. Even it is a non-intensive kernel, on a single 16-core computing node, the performance (based on the actual computation time using one GPU) of OpenACC implementation is 2.3 time faster than that of OpenMP implementation using single OpenMP thread, but it is 2.8 times slower than the performance of OpenMP implementation using 16 threads. On multiple nodes, MPI_OpenACC implementation demonstrated very good scalability on up to 128 GPUs on 128 computing nodes. This study also provides useful information for us to look into the potential benefits of “deep copy” capability and “routine” feature of OpenACC standards. In conclusion, we believe that our experience on the environmental model, CLM, can be beneficial to many other scientific research programs who are interested to porting their large scale scientific code using OpenACC onto high-end computers, empowered by hybrid computing architecture.

  11. Frontal and rostral anterior cingulate (rACC) theta EEG in depression: implications for treatment outcome?


    Arns, Martijn; Etkin, Amit; Hegerl, Ulrich; Williams, Leanne M; DeBattista, Charles; Palmer, Donna M; Fitzgerald, Paul B; Harris, Anthony; deBeuss, Roger; Gordon, Evian


    In major depressive disorder (MDD), elevated theta current density in the rostral anterior cingulate (rACC), as estimated by source localization of scalp-recorded electroencenphalogram (EEG), has been associated with response to antidepressant treatments, whereas elevated frontal theta has been linked to non-response. This study used source localization to attempt to integrate these apparently opposite results and test, whether antidepressant response is associated with elevated rACC theta and non-response with elevated frontal theta and whether theta activity is a differential predictor of response to different types of commonly used antidepressants. In the international Study to Predict Optimized Treatment in Depression (iSPOT-D), a multi-center, international, randomized, prospective practical trial, 1008 MDD participants were randomized to escitalopram, sertraline or venlafaxine-XR. The study also recruited 336 healthy controls. Treatment response and remission were established after eight weeks using the 17-item Hamilton Rating Scale for Depression (HRSD17). The resting-state EEG was assessed at baseline with eyes closed and source localization (eLORETA) was employed to extract theta from the rACC and frontal cortex. Patients with MDD had elevated theta in both frontal cortex and rACC, with small effect sizes. High frontal and rACC theta were associated with treatment non-response, but not with non-remission, and this effect was most pronounced in a subgroup with previous treatment failures. Low theta in frontal cortex and rACC are found in responders to antidepressant treatments with a small effect size. Future studies should investigate in more detail the role of previous treatment (failure) in the association between theta and treatment outcome. PMID:25936227

  12. An OpenACC-Based Unified Programming Model for Multi-accelerator Systems

    SciTech Connect

    Kim, Jungwon; Lee, Seyong; Vetter, Jeffrey S


    This paper proposes a novel SPMD programming model of OpenACC. Our model integrates the different granularities of parallelism from vector-level parallelism to node-level parallelism into a single, unified model based on OpenACC. It allows programmers to write programs for multiple accelerators using a uniform programming model whether they are in shared or distributed memory systems. We implement a prototype of our model and evaluate its performance with a GPU-based supercomputer using three benchmark applications.

  13. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz


    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  14. Complete plastid genome sequence of Primula sinensis (Primulaceae): structure comparison, sequence variation and evidence for accD transfer to nucleus

    PubMed Central

    Liu, Tong-Jian; Zhang, Cai-Yun; Yan, Hai-Fei; Zhang, Lu


    Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp) were separated by a large single-copy region (82,064 bp) and a small single-copy region (17,725 bp). The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF) were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis. PMID:27375965

  15. Enhancement of heavy metal accumulation by tissue specific co-expression of iaaM and ACC deaminase genes in plants.


    Zhang, Yong; Zhao, Lihong; Wang, Yao; Yang, Baoyu; Chen, Shiyun


    1-Aminocyclopropane deaminase (ACC) and tryptophan monooxygenase are two enzymes involved in plant senescence-inhibiting and growth-promoting regulation, respectively. In this study, two binary vectors were constructed in which the Agrobacterium iaaM gene was under the transcriptional control of a xylem-specific glycine-rich protein promoter alone, or co-expressed with the bacterial ACC deaminase gene, which was driven by the constitutive CaMV 35S promoter. Transgenic petunia shoots co-expressing both genes were able to root on medium supplemented with 7.5 mg l(-1) CoCl2. When T1 transgenic tobacco plants were grown in sand supplemented with Cu2+ and Co2+, tissue specific co-expression of both iaaM and ACC deaminase genes showed faster growth with larger biomass with a more extensive root system, and accumulated a greater amount of heavy metals than the empty vector control plants. When T1 transgenic tobacco plants were grown in soil watered with different concentrations of CuSO4, xylem specific expression of the iaaM gene caused the accumulation of more Cu2+ than the empty vector control at lower CuSO4 concentrations, but showed severe toxic symptoms at concentration of 100 mg l(-1) CuSO4. T1 transgenic plants co-expressing both genes accumulated more heavy metals into the plant shoots and can tolerate CuSO4 at 150 mg l(-1). In addition, plants co-expressing these two genes can grow well in a complex contaminated soil containing both inorganic and organic pollutants, while the growth of the control plants was greatly inhibited. PMID:18471863

  16. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )


    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  17. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre


    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  18. Characterization of transcriptional profiles of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding, cold and different photoperiods during ripening in banana fruit.


    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N


    The ripening-specific genes MA-ACS1 (Musa acuminata ACC synthase1) and MA-ACO1 (M. acuminata ACC oxidase 1) are regulated in response to a wide variety of factors. Here, we have studied the differential transcript accumulation pattern and protein levels of MA-ACS1 and MA-ACO1 genes in response to ethylene, auxin, wounding and low temperature in preclimacteric banana fruit. We have shown that exogenous application of ethylene and auxin induced the expression of MA-ACS1, while MA-ACO1 showed marginal expression following ethylene treatment in preclimacteric stage. Auxin did not induce MA-ACO1 expression. Thus, auxin-treated banana fruits showed lower ethylene production rate as compared to ethylene-treated fruits. Conversely, wounding and cold treatment down-regulated the expression of both the genes and thus inhibited ethylene production. Furthermore, we have detected a GCC-box putative ethylene-responsive element (ERE)- and an auxin-responsive element (ARE)-specific DNA-binding activity in the banana pulp and studied the ethylene and auxin responsive characteristics of the GCC-box and ARE (TGTCTC) containing synthetic promoter fragments. In addition, we have detected an enhanced ethylene production rate and expression level of MA-ACS1 and MA-ACO1 genes along with a strong GCC-box-specific DNA-binding activity following exposure to constant dark period for 8d at the preclimacteric stage. Together, our study provides interesting information about the regulation of expression of MA-ACS1 and MA-ACO1 genes in response to various factors during ripening in banana fruit, which may have physiological relevance concerning ethylene biosynthesis during post-harvest conditions. PMID:18554749

  19. NADPH Oxidase Biology and the Regulation of Tyrosine Kinase Receptor Signaling and Cancer Drug Cytotoxicity

    PubMed Central

    Paletta-Silva, Rafael; Rocco-Machado, Nathália; Meyer-Fernandes, José Roberto


    The outdated idea that reactive oxygen species (ROS) are only dangerous products of cellular metabolism, causing toxic and mutagenic effects on cellular components, is being replaced by the view that ROS have several important functions in cell signaling. In aerobic organisms, ROS can be generated from different sources, including the mitochondrial electron transport chain, xanthine oxidase, myeloperoxidase, and lipoxygenase, but the only enzyme family that produces ROS as its main product is the NADPH oxidase family (NOX enzymes). These transfer electrons from NADPH (converting it to NADP−) to oxygen to make O2•−. Due to their stability, the products of NADPH oxidase, hydrogen peroxide, and superoxide are considered the most favorable ROS to act as signaling molecules. Transcription factors that regulate gene expression involved in carcinogenesis are modulated by NADPH oxidase, and it has emerged as a promising target for cancer therapies. The present review discusses the mechanisms by which NADPH oxidase regulates signal transduction pathways in view of tyrosine kinase receptors, which are pivotal to regulating the hallmarks of cancer, and how ROS mediate the cytotoxicity of several cancer drugs employed in clinical practice. PMID:23434665

  20. Cloning and characterization of polyphenol oxidase cDNAs of Phytolacca americana.

    PubMed Central

    Joy, R W; Sugiyama, M; Fukuda, H; Komamine, A


    Two cDNA clones encoding polyphenol oxidases were isolated from a cDNA library constructed from a log-phase suspension culture of Phytolacca americana (pokeweed) producing betalains. The clones exhibit 93 and 86% sequence identity at the nucleotide and deduced amino acid levels, respectively. Both clones contain two copper-binding domains characterized by histidine-rich regions, which are found ubiquitously in all polyphenol oxidases/tyrosinases, and a putative third histidine-rich, copper-binding region, which is common to all plant polyphenol oxidases. One of the Phytolacca cDNA deduced amino acid sequences contains the ubiquitous transit peptide for all proteins targeted to the internal lumen of thylakoid membranes of plastids and is considered to be 98 residues in length based on a proposed sequence cleavage site motif. This would produce a processed peptide of approximately 54 kD. In addition to common features of transit peptides, it was found that an additional conserved region for polyphenol oxidases was located between the hydroxy amino acid-rich region and the thylakoid transfer domain. Spatial and temporal expression was investigated by northern blot analysis of total RNA from various organs of Phytolacca plants. Transcripts of the two clones were found to be 2.1 and 2.3 kb, respectively. Both transcripts were present only at substantial levels in ripening, betalain-containing fruit. PMID:7539531

  1. 24 CFR 969.105 - Extension of ACC upon payment of operating subsidy.

    Code of Federal Regulations, 2010 CFR


    ... are subject to the Consolidated ACC (see 24 CFR part 990). Accordingly, if a PHA, before submitting a..., under 24 CFR part 990, for determination of the total amount of Operating Subsidy payable under the... HOUSING AND URBAN DEVELOPMENT PHA-OWNED PROJ- ECTS-CONTINUED OPERATION AS LOW-INCOME HOUSING...

  2. Mentoring in 2 + 2 Programs: LISD/ACC 2 + 2 Articulation Project.

    ERIC Educational Resources Information Center

    Center for Occupational Research and Development, Inc., Waco, TX.

    The role of mentoring in the 2 + 2 Instrumentation and Control (I&C) articulation project between the Leander Independent School District (LISD) and Austin Community College (ACC) is discussed in this document. Following a brief history of the origin and function of the mentor, the paper explains the need for the mentoring system in the I&C…

  3. ACCE Study Tour to ISTE2011 (San Francisco, New York, Washington, Philadelphia)

    ERIC Educational Resources Information Center

    Gronn, Donna; Romeo, Geoff


    In June/July this year a group of 28 educators from across Australia travelled to the US on the 2011 ACCE ISTE Study Tour. The group comprised a very broad section of educators--primary, secondary and tertiary classroom teachers, ICT coordinators, managers, private consultants and regional office managers. The government, catholic and independent…

  4. GPER agonist G-1 decreases adrenocortical carcinoma (ACC) cell growth in vitro and in vivo

    PubMed Central

    Zolea, Fabiana; Rizza, Pietro; Avena, Paola; Malivindi, Rocco; De Luca, Arianna; Campana, Carmela; Martire, Emilia; Domanico, Francesco; Fallo, Francesco; Carpinelli, Giulia; Cerquetti, Lidia; Amendola, Donatella; Stigliano, Antonio; Pezzi, Vincenzo


    We have previously demonstrated that estrogen receptor (ER) alpha (ESR1) increases proliferation of adrenocortical carcinoma (ACC) through both an estrogen-dependent and -independent (induced by IGF-II/IGF1R pathways) manner. Then, the use of tamoxifen, a selective estrogen receptor modulator (SERM), appears effective in reducing ACC growth in vitro and in vivo. However, tamoxifen not only exerts antiestrogenic activity, but also acts as full agonist on the G protein-coupled estrogen receptor (GPER). Aim of this study was to investigate the effect of a non-steroidal GPER agonist G-1 in modulating ACC cell growth. We found that G-1 is able to exert a growth inhibitory effect on H295R cells both in vitro and, as xenograft model, in vivo. Treatment of H295R cells with G-1 induced cell cycle arrest, DNA damage and cell death by the activation of the intrinsic apoptotic mechanism. These events required sustained extracellular regulated kinase (ERK) 1/2 activation. Silencing of GPER by a specific shRNA partially reversed G-1-mediated cell growth inhibition without affecting ERK activation. These data suggest the existence of G-1 activated but GPER-independent effects that remain to be clarified. In conclusion, this study provides a rational to further study G-1 mechanism of action in order to include this drug as a treatment option to the limited therapy of ACC. PMID:26131713

  5. GPER agonist G-1 decreases adrenocortical carcinoma (ACC) cell growth in vitro and in vivo.


    Chimento, Adele; Sirianni, Rosa; Casaburi, Ivan; Zolea, Fabiana; Rizza, Pietro; Avena, Paola; Malivindi, Rocco; De Luca, Arianna; Campana, Carmela; Martire, Emilia; Domanico, Francesco; Fallo, Francesco; Carpinelli, Giulia; Cerquetti, Lidia; Amendola, Donatella; Stigliano, Antonio; Pezzi, Vincenzo


    We have previously demonstrated that estrogen receptor (ER) alpha (ESR1) increases proliferation of adrenocortical carcinoma (ACC) through both an estrogen-dependent and -independent (induced by IGF-II/IGF1R pathways) manner. Then, the use of tamoxifen, a selective estrogen receptor modulator (SERM), appears effective in reducing ACC growth in vitro and in vivo. However, tamoxifen not only exerts antiestrogenic activity, but also acts as full agonist on the G protein-coupled estrogen receptor (GPER). Aim of this study was to investigate the effect of a non-steroidal GPER agonist G-1 in modulating ACC cell growth. We found that G-1 is able to exert a growth inhibitory effect on H295R cells both in vitro and, as xenograft model, in vivo. Treatment of H295R cells with G-1 induced cell cycle arrest, DNA damage and cell death by the activation of the intrinsic apoptotic mechanism. These events required sustained extracellular regulated kinase (ERK) 1/2 activation. Silencing of GPER by a specific shRNA partially reversed G-1-mediated cell growth inhibition without affecting ERK activation. These data suggest the existence of G-1 activated but GPER-independent effects that remain to be clarified. In conclusion, this study provides a rational to further study G-1 mechanism of action in order to include this drug as a treatment option to the limited therapy of ACC. PMID:26131713

  6. Waste management facility accident analysis (WASTE ACC) system: software for analysis of waste management alternatives

    SciTech Connect

    Kohout, E.F.; Folga, S.; Mueller, C.; Nabelssi, B.


    This paper describes the Waste Management Facility Accident Analysis (WASTE{underscore}ACC) software, which was developed at Argonne National Laboratory (ANL) to support the US Department of Energy`s (DOE`s) Waste Management (WM) Programmatic Environmental Impact Statement (PEIS). WASTE{underscore}ACC is a decision support and database system that is compatible with Microsoft{reg_sign} Windows{trademark}. It assesses potential atmospheric releases from accidents at waste management facilities. The software provides the user with an easy-to-use tool to determine the risk-dominant accident sequences for the many possible combinations of process technologies, waste and facility types, and alternative cases described in the WM PEIS. In addition, its structure will allow additional alternative cases and assumptions to be tested as part of the future DOE programmatic decision-making process. The WASTE{underscore}ACC system demonstrates one approach to performing a generic, systemwide evaluation of accident risks at waste management facilities. The advantages of WASTE{underscore}ACC are threefold. First, the software gets waste volume and radiological profile data that were used to perform other WM PEIS-related analyses directly from the WASTE{underscore}MGMT system. Second, the system allows for a consistent analysis across all sites and waste streams, which enables decision makers to understand more fully the trade-offs among various policy options and scenarios. Third, the system is easy to operate; even complex scenario runs are completed within minutes.

  7. A Comparative Analysis of the Integration of Faith and Learning between ACSI and ACCS Accredited Schools

    ERIC Educational Resources Information Center

    Peterson, Daniel Carl


    The purpose of this descriptive quantitative study was to analyze and compare the integration of faith and learning occurring in Christian schools accredited by the Association of Christian Schools International (ACSI) and classical Christian schools accredited by the Association of Classical and Christian Schools (ACCS). ACSI represents the…

  8. National Computing Studies Summit: Open Learning Approaches to Computing Studies--An ACCE Discussion Paper

    ERIC Educational Resources Information Center

    Webb, Ian


    In 2005 the Australian Council for Computers in Education (ACCE) was successful in obtaining a grant from National Centre of Science, Information and Communication Technology and Mathematics Education for Rural and Regional Australia (SiMERR) to undertake the Computing Studies Teachers Network Rural and Regional Focus Project. The project had five…

  9. Usability of AcceSS for Web Site Accessibility. Research Report

    ERIC Educational Resources Information Center

    Hackett, Stephanie; Parmanto, Bambang


    The standard display of web pages is inadequate for users who are visually impaired. Most visually impaired people obtain information from a web page in a linear fashion via a screen reader, whereas sighted users can immediately obtain a bird's-eye view of a web page's organization and content by quickly scanning the page. AcceSS (which stands for…

  10. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false HUD approval of demolition or disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development Regulations Relating to Housing and Urban Development (Continued) OFFICE OF ASSISTANT SECRETARY FOR PUBLIC AND INDIAN HOUSING, DEPARTMENT OF HOUSING AND...

  11. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2011 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  12. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2013 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  13. 24 CFR 969.107 - HUD approval of demolition or disposition before ACC expiration.

    Code of Federal Regulations, 2012 CFR


    ... expiration. This part is not intended to preclude or restrict the demolition or disposition of a project pursuant to HUD approval in accordance with 24 CFR part 970. Subject to the requirements of 24 CFR part 970... disposition before ACC expiration. 969.107 Section 969.107 Housing and Urban Development REGULATIONS...

  14. RRM analysis of protoporphyrinogen oxidase.


    Sauren, M; Pirogova, E; Cosic, I


    Enzymes are crucial in accelerating metabolic reactions in living organisms. Protoporphyrinogen oxidase (PpOI) is an enzyme that catalyses the production of protoporphyrin IX (PpIX), a protein used in a cancer treatment known as photodynamic therapy (PDT). In this study, a structure-function analysis of PpOI was carried out using the Resonant Recognition Model (RRM), a physico-mathematical approach for analysis of proteins interactions. This method is based on the finding that the distribution of delocalised electron energies along the protein plays a crucial role in determining the protein's biological activity. Two digital signal processing (DSP) methods were used: Fourier Transform (FT) and Continuous Wavelet Transform (CWT). Here we have determined the characteristic frequencies and the "hot spot" amino acids, and predicted the location of proteins' active site(s). Several proteins that potentially belong to the PpOI functional group were also analysed to distinguish their viability in this role. PMID:15712584

  15. Crosstalk between mitochondria and NADPH oxidases

    PubMed Central

    Dikalov, Sergey


    Reactive oxygen species (ROS) play an important role in physiological and pathological processes. In recent years, a feed-forward regulation of the ROS sources has been reported. The interaction between main cellular sources of ROS, such as mitochondria and NADPH oxidases, however, remain obscure. This work summarizes the latest findings on the role of crosstalk between mitochondria and NADPH oxidases in pathophysiological processes. Mitochondria have the highest levels of antioxidants in the cell and play an important role in the maintenance of cellular redox status, thereby acting as an ROS and redox sink and limiting NADPH oxidase activity. Mitochondria, however, are not only a target for ROS produced by NADPH oxidase but also a significant source of ROS, which under certain condition may stimulate NADPH oxidases. This crosstalk between mitochondria and NADPH oxidases, therefore, may represent a feed-forward vicious cycle of ROS production which can be pharmacologically targeted under conditions of oxidative stress. It has been demonstrated that mitochondria-targeted antioxidants break this vicious cycle, inhibiting ROS production by mitochondria and reducing NADPH oxidase activity. This may provide a novel strategy for treatment of many pathological conditions including aging, atherosclerosis, diabetes, hypertension and degenerative neurological disorders in which mitochondrial oxidative stress seems to play a role. It is conceivable that the use of mitochondria-targeted treatments would be effective in these conditions. PMID:21777669

  16. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.


    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  17. Human lysyl oxidase-like 2.


    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae


    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2. PMID:25146937

  18. NADPH Oxidases and Angiotensin II Receptor Signaling

    PubMed Central

    Garrido, Abel Martin; Griendling, Kathy K.


    Over the last decade many studies have demonstrated the importance of reactive oxygen species (ROS) production by NADPH oxidases in angiotensin II (Ang II) signaling, as well as a role for ROS in the development of different diseases in which Ang II is a central component. In this review, we summarize the mechanism of activation of NADPH oxidases by Ang II and describe the molecular targets of ROS in Ang II signaling in the vasculature, kidney and brain. We also discuss the effects of genetic manipulation of NADPH oxidase function on the physiology and pathophysiology of the renin angiotensin system. PMID:19059306

  19. Regulation of NADPH oxidases in skeletal muscle.


    Ferreira, Leonardo F; Laitano, Orlando


    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  20. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.


    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  1. Towards a multi-node OpenACC Implementation of the ICON Model

    NASA Astrophysics Data System (ADS)

    Sawyer, Will; Zaengl, Guenther; Linardakis, Leonidas


    We have ported the Icosahedral Non-hydrostatic (ICON) model's dynamics solver to Graphical Processing Units (GPUs), which is a task within the Partnership for Advanced Computing in Europe (PRACE) Second Implementation Phase (2IP) Work Package 8 (WP8). Initial single-node OpenCL and CUDA-Fortran implementations of ICON's non-hydrostatic dynamical core (NHDC) resulted in a maximum factor of two speedup over the latest CPU nodes, e.g., a dual-socket Intel Sandybridge. While this performance was promising, ICON developers viewed neither OpenCL nor CUDA-Fortran as viable programming paradigms for the actual production code, and suggested instead the OpenACC standard as the proper paradigm for the multi-node GPU implementation, which was then undertaken in WP8. We will present the results of the multi-node OpenACC implementation of the ICON NHDC for hybrid multicore platforms. The code baseline is the ICON "DSL" (Domain Specific Language) testbed code, which is essentially a stripped-down version of the ICON model for dynamics simulations only. We will discuss on the OpenACC directives used for the port of the computational as well as the communication code to GPUs, and report the resulting GPU performance on NVIDIA K20x as compared to contemporary CPU architectures. In addition, the future roadmap for an accelerated ICON version will be presented. As a first step, we are now incorporating the OpenACC directives into the ICON development trunk, based on the feedback given to us from the ICON developers at the Max Planck Institute for Meteorology (MPI-M) and the German Weather Service (DWD). Moreover, we plan to port the ICON Climate physical parameterizations stemming from the ECHAM model to OpenACC. This step should enable the full ICON on many core platforms which support OpenACC. The resulting model should benefit climate researchers world-wide who plan to transition from ECHAM to ICON in the coming years.

  2. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases.


    Giacomelli, Lisa; Rota-Stabelli, Omar; Masuero, Domenico; Acheampong, Atiako Kwame; Moretto, Marco; Caputi, Lorenzo; Vrhovsek, Urska; Moser, Claudio


    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  3. Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

    PubMed Central

    Giacomelli, Lisa


    Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

  4. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.


    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge


    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  5. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.


    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  6. 5th International ACC Symposium: Future and Current Therapeutic Trials in Adrenocortical Carcinoma.


    Hoff, Ana O; Berruti, Alfredo


    Adrenocortical carcinoma (ACC) is a rare and complex disease associated with a high mortality rate. Despite intensive translational and clinical research, prognosis remains poor. Over the past decade, a significant effort has been made to develop multinational, collaborative studies to better understand the pathogenesis and clinical features of this rare disease in attempt to improve the therapeutic strategies and patient outcome. The results of both standard and newer treatments are discussed in this review as well as the recent discovery of pathways involved in ACC pathogenesis that provide the rationale to introduce new molecular target therapies. Finally, remaining issues regarding how to improve available therapies in adjuvant setting are raised and addressed. PMID:26728470

  7. Biochemistry and genetics of ACC deaminase: a weapon to “stress ethylene” produced in plants

    PubMed Central

    Singh, Rajnish P.; Shelke, Ganesh M.; Kumar, Anil; Jha, Prabhat N.


    1-aminocyclopropane-1-carboxylate deaminase (ACCD), a pyridoxal phosphate-dependent enzyme, is widespread in diverse bacterial and fungal species. Owing to ACCD activity, certain plant associated bacteria help plant to grow under biotic and abiotic stresses by decreasing the level of “stress ethylene” which is inhibitory to plant growth. ACCD breaks down ACC, an immediate precursor of ethylene, to ammonia and α-ketobutyrate, which can be further metabolized by bacteria for their growth. ACC deaminase is an inducible enzyme whose synthesis is induced in the presence of its substrate ACC. This enzyme encoded by gene AcdS is under tight regulation and regulated differentially under different environmental conditions. Regulatory elements of gene AcdS are comprised of the regulatory gene encoding LRP protein and other regulatory elements which are activated differentially under aerobic and anaerobic conditions. The role of some additional regulatory genes such as AcdB or LysR may also be required for expression of AcdS. Phylogenetic analysis of AcdS has revealed that distribution of this gene among different bacteria might have resulted from vertical gene transfer with occasional horizontal gene transfer (HGT). Application of bacterial AcdS gene has been extended by developing transgenic plants with ACCD gene which showed increased tolerance to biotic and abiotic stresses in plants. Moreover, distribution of ACCD gene or its homolog's in a wide range of species belonging to all three domains indicate an alternative role of ACCD in the physiology of an organism. Therefore, this review is an attempt to explore current knowledge of bacterial ACC deaminase mediated physiological effects in plants, mode of enzyme action, genetics, distribution among different species, ecological role of ACCD and, future research avenues to develop transgenic plants expressing foreign AcdS gene to cope with biotic and abiotic stressors. Systemic identification of regulatory circuits

  8. Adolescent neighborhood quality predicts adult dACC response to social exclusion

    PubMed Central

    Beckes, Lane; Chango, Joanna; Allen, Joseph P.; Coan, James A.


    Neuroimaging studies using the social-exclusion paradigm Cyberball indicate increased dorsal anterior cingulate cortex (dACC) and right insula activity as a function of exclusion. However, comparatively less work has been done on how social status factors may moderate this finding. This study used the Cyberball paradigm with 85 (45 females) socio-economically diverse participants from a larger longitudinal sample. We tested whether neighborhood quality during adolescence would predict subsequent neural responding to social exclusion in young adulthood. Given previous behavioral studies indicating greater social vigilance and negative evaluation as a function of lower status, we expected that lower adolescent neighborhood quality would predict greater dACC activity during exclusion at young adulthood. Our findings indicate that young adults who lived in low-quality neighborhoods in adolescence showed greater dACC activity to social exclusion than those who lived in higher quality neighborhoods. Lower neighborhood quality also predicted greater prefrontal activation in the superior frontal gyrus, dorsal medial prefrontal cortex and the middle frontal gyrus, possibly indicating greater regulatory effort. Finally, this effect was not driven by subsequent ratings of distress during exclusion. In sum, adolescent neighborhood quality appears to potentiate neural responses to social exclusion in young adulthood, effects that are independent of felt distress. PMID:25349459

  9. WASTE-ACC: A computer model for analysis of waste management accidents

    SciTech Connect

    Nabelssi, B.K.; Folga, S.; Kohout, E.J.; Mueller, C.J.; Roglans-Ribas, J.


    In support of the U.S. Department of Energy`s (DOE`s) Waste Management Programmatic Environmental Impact Statement, Argonne National Laboratory has developed WASTE-ACC, a computational framework and integrated PC-based database system, to assess atmospheric releases from facility accidents. WASTE-ACC facilitates the many calculations for the accident analyses necessitated by the numerous combinations of waste types, waste management process technologies, facility locations, and site consolidation strategies in the waste management alternatives across the DOE complex. WASTE-ACC is a comprehensive tool that can effectively test future DOE waste management alternatives and assumptions. The computational framework can access several relational databases to calculate atmospheric releases. The databases contain throughput volumes, waste profiles, treatment process parameters, and accident data such as frequencies of initiators, conditional probabilities of subsequent events, and source term release parameters of the various waste forms under accident stresses. This report describes the computational framework and supporting databases used to conduct accident analyses and to develop source terms to assess potential health impacts that may affect on-site workers and off-site members of the public under various DOE waste management alternatives.

  10. The ACC strategy in biomineralization: the case of earthworm's amorphous spherulites

    NASA Astrophysics Data System (ADS)

    Briones, Maria J. I.; Alvarez-Otero, Rosa; Méndez, Jesús; Gago Duport, Luis


    The occurrence of amorphous calcium carbonate (ACC), an hydrated and highly soluble form of solid CaCO3, seems to be a common feature in all carbonate forming organisms such as mollusks, corals, echinoderms and crustaceans. The ubiquity of ACC in these Ca-carbonate biomineralizing systems, as a precursor of further crystalline phases, has recently open the interesting question about if the formation of an amorphous phase is a necessary step in the calcification process of all organisms and consequently, whether it would be possible to define the "amorphous precursor estategy" as a general mechanism in biomineralization. Neverthelees, although ACC appears to be widespread in these organisms very little is known about its particular role in the biomineralization scheme of the different phyla. The formation of CaCO3 spherulites in the calciferous glands of earthworms is a particular case of calcareous biomineralization involving the presence of ACC as a transient precursor phase [2]. Interestingly, the formation of crystalline carbonates via ACC in these organisms is not connected with skeleton building so it must play another functional role. In addition, the transient transformation stages can be followed by in situ spectrometric techniques and therefore, earthworms provide and adequate model to analyse the mutual interactions between ACC-solvent-and crystalline phases. In this study, we have analysed the morphological and structural transformations from the initial ACC spherulites until the formation of the crystalline phases: vaterite (and/or aragonite) and finally calcite, is accomplished. The characterization of ACC was done by performing in situ FT-IR, together with and HREM and Debye scherrer -XRD. The structural results were interpreted in the light of the histological study of the gland. The geometry of the secretory epithelium of the calciferous gland, as evidenced by TEM [2], shows the presence of irregulary shaped cells with their apical surface

  11. Trait impulsivity is related to ventral ACC and amygdala activity during primary reward anticipation

    PubMed Central

    Kerr, Kara L.; Avery, Jason A.; Barcalow, Joel C.; Moseman, Scott E.; Bodurka, Jerzy; Bellgowan, Patrick S. F.


    Trait impulsivity is characterized by behavioral disinhibition and rash decision-making that contribute to many maladaptive behaviors. Previous research demonstrates that trait impulsivity is related to the activity of brain regions underlying reward sensitivity and emotion regulation, but little is known about this relationship in the context of immediately available primary reward. This is unfortunate, as impulsivity in these contexts can lead to unhealthy behaviors, including poor food choices, dangerous drug use and risky sexual practices. In addition, little is known about the relationship between integration of reward and affective neurocircuitry, as measured by resting-state functional connectivity, and trait impulsivity in everyday life, as measured with a commonly used personality inventory. We therefore asked healthy adults to undergo a functional magnetic resonance imaging task in which they saw cues indicating the imminent oral administration of rewarding taste, as well as a resting-state scan. Trait impulsivity was associated with increased activation during anticipation of primary reward in the anterior cingulate cortex (ACC) and amygdala. Additionally, resting-state functional connectivity between the ACC and the right amygdala was negatively correlated with trait impulsivity. These findings demonstrate that trait impulsivity is related not only to ACC-amygdala activation but also to how tightly coupled these regions are to one another. PMID:24526181

  12. Trait impulsivity is related to ventral ACC and amygdala activity during primary reward anticipation.


    Kerr, Kara L; Avery, Jason A; Barcalow, Joel C; Moseman, Scott E; Bodurka, Jerzy; Bellgowan, Patrick S F; Simmons, W Kyle


    Trait impulsivity is characterized by behavioral disinhibition and rash decision-making that contribute to many maladaptive behaviors. Previous research demonstrates that trait impulsivity is related to the activity of brain regions underlying reward sensitivity and emotion regulation, but little is known about this relationship in the context of immediately available primary reward. This is unfortunate, as impulsivity in these contexts can lead to unhealthy behaviors, including poor food choices, dangerous drug use and risky sexual practices. In addition, little is known about the relationship between integration of reward and affective neurocircuitry, as measured by resting-state functional connectivity, and trait impulsivity in everyday life, as measured with a commonly used personality inventory. We therefore asked healthy adults to undergo a functional magnetic resonance imaging task in which they saw cues indicating the imminent oral administration of rewarding taste, as well as a resting-state scan. Trait impulsivity was associated with increased activation during anticipation of primary reward in the anterior cingulate cortex (ACC) and amygdala. Additionally, resting-state functional connectivity between the ACC and the right amygdala was negatively correlated with trait impulsivity. These findings demonstrate that trait impulsivity is related not only to ACC-amygdala activation but also to how tightly coupled these regions are to one another. PMID:24526181

  13. On the representation of the ACC circulation around the Kerguelen Plateau in an OGCM

    NASA Astrophysics Data System (ADS)

    Roquet, F.; Park, Y. H.; Madek, G.


    Due to its great meridional extent and relatively shallow depths, the Kerguelen Plateau constitutes a major barrier to the eastward flowing Antarctic Circumpolar Current (ACC) in the Indian sector of the Southern Ocean. While most of the ACC transport is deflected north of the Kerguelen Islands, the remainder (~50 x 106 m3 s-1) must pass south of the islands, most probably through the Fawn Trough (56°S, 77°E, 2650m) and Princess Elizabeth Trough (64°S, 82°E, 3650 m). Yet, lack of observations in this area still hampers our knowledge on the exact partitioning and its temporal variability of the circumpolar flow through the abovementioned three passages. We have developed a regional configuration of the Southern Indian Ocean using the eddy-permitting (1/4°) global ocean/sea-ice model NEMO. A 20-year long simulation has been performed, using the open boundary conditions derived from the KAB001 interannual experiment. The KAB001 experiment is characterized by a slight 3D TS restoring in polar areas, which allows the continuous maintaining of adequate bottom properties around Antarctica, and thus yielding a realistic and stable ACC transport (~150 x 106 m3 s-1 at Drake Passage). The main ACC veins detected from satellite and in situ observations are consistently well represented in our regional model. In particular, the presence of a strong topographically controlled northeastward current through the Fawn Trough channelling most of the Enderby Basin water has been confirmed. The lagrangian diagnostic tool ARIANE has been used on the model velocity field to show the ACC circulation splitting into several branches. It also allows a precise diagnostic of the temporal variability of these branches as well as the transformation of water masses along their trajectories. We verified that the area just downstream of the Fawn Trough in the Australian-Antarctic Basin is an outstanding region of enhanced water mass transformation where waters of different origins collide and

  14. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus).


    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo


    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  15. Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

    PubMed Central

    Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo


    Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

  16. NADPH oxidase mediates radiation-induced oxidative stress in rat brain microvascular endothelial cells.


    Collins-Underwood, J Racquel; Zhao, Weiling; Sharpe, Jessica G; Robbins, Mike E


    The need to both understand and minimize the side effects of brain irradiation is heightened by the ever-increasing number of patients with brain metastases that require treatment with whole brain irradiation (WBI); some 200,000 cancer patients/year receive partial or WBI. At the present time, there are no successful treatments for radiation-induced brain injury, nor are there any known effective preventive strategies. Data support a role for chronic oxidative stress in radiation-induced late effects. However, the pathogenic mechanism(s) involved remains unknown. One candidate source of reactive oxygen species (ROS) is nicotinamide adenosine dinucleotide phosphate (NADPH) oxidase, which converts molecular oxygen (O(2)) to the superoxide anion (O(2)(-)) on activation. We hypothesize that brain irradiation leads to activation of NADPH oxidase. We report that irradiating rat brain microvascular endothelial cells in vitro leads to increased (i) intracellular ROS generation, (ii) activation of the transcription factor NFkappaB, (iii) expression of ICAM-1 and PAI-1, and (iv) expression of Nox4, p22(phox), and p47(phox). Pharmacologic and genetic inhibition of NADPH oxidase blocked the radiation-mediated upregulation of intracellular ROS, activation of NFkappaB, and upregulation of ICAM-1 and PAI-1. These results suggest that activation of NADPH oxidase may play a role in radiation-induced oxidative stress. PMID:18640264

  17. The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

    SciTech Connect

    Xu, Yun-Ling; Li, Li; Wu, Keqiang


    The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.

  18. The composition of milk xanthine oxidase

    PubMed Central

    Hart, L. I.; McGartoll, Mary A.; Chapman, Helen R.; Bray, R. C.


    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed `de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in `milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed `inactivated xanthine oxidase', causes variability in activity relative to E450 or to Mo content and formation of it decreases these ratios

  19. NADPH oxidases: new actors in thyroid cancer?


    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne


    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  20. Assessing the effects of heavy metals in ACC deaminase and IAA production on plant growth-promoting bacteria.


    Carlos, Mendoza-Hernández José; Stefani, Perea-Vélez Yazmin; Janette, Arriola-Morales; Melani, Martínez-Simón Sara; Gabriela, Pérez-Osorio


    This study poses a methodology in order to simultaneously quantify ACC deaminase and IAA levels in the same culture medium. Ten bacterial strains isolated from plant rhizosphere naturally settled in mining residues were chosen. These bacterial strains were characterized as PGPB, and all of them showed at least three characteristics (indole-3 acetic acid and siderophore production, ACC deaminase enzyme activity, and inorganic phosphate solubilization). Taxonomic identification showed that the strains belong to Enterobacter, Serratia, Klebsiella, and Escherichia genera. Similarly, both the ACC deaminase enzyme activity and the IAA synthesis in the presence of Cu, As, Pb, Ni, Cd, and Mn were measured. The results showed that both the ACC deaminase enzyme activity and the IAA synthesis were higher with the Pb, As, and Cu treatments than with the Escherichia N16, Enterobacter K131, Enterobacter N9, and Serratia K120 control treatments. On the other hand, Ni, Cd, and Mn negatively affected both the ACC deaminase enzyme activity and the IAA production on every bacterium except on the Klebsiella Mc173 strain. Serratia K120 bacterium got a positive correlation between ACC deaminase and IAA in the presence of every heavy metal, and it also promoted Helianthus annuus plant growth, showing a potential use in phytoremediation systems. PMID:27296962

  1. The human ACC2 CT-domain C-terminus is required for full functionality and has a novel twist

    SciTech Connect

    Madauss, Kevin P.; Burkhart, William A.; Consler, Thomas G.; Cowan, David J.; Gottschalk, William K.; Miller, Aaron B.; Short, Steven A.; Tran, Thuy B.; Williams, Shawn P.


    The use of biophysical assays permitted the identification of a specific human ACC2 carboxyl transferase (CT) domain mutant that binds inhibitors and crystallizes in their presence. This mutant led to determination of the human ACC2 CT domain–CP-640186 complex crystal structure, which revealed differences in the inhibitor conformation from the yeast protein complex that are caused by differing residues in the binding pocket. Inhibition of acetyl-CoA carboxylase (ACC) may prevent lipid-induced insulin resistance and type 2 diabetes, making the enzyme an attractive pharmaceutical target. Although the enzyme is highly conserved amongst animals, only the yeast enzyme structure is available for rational drug design. The use of biophysical assays has permitted the identification of a specific C-terminal truncation of the 826-residue human ACC2 carboxyl transferase (CT) domain that is both functionally competent to bind inhibitors and crystallizes in their presence. This C-terminal truncation led to the determination of the human ACC2 CT domain–CP-640186 complex crystal structure, which revealed distinctions from the yeast-enzyme complex. The human ACC2 CT-domain C-terminus is comprised of three intertwined α-helices that extend outwards from the enzyme on the opposite side to the ligand-binding site. Differences in the observed inhibitor conformation between the yeast and human structures are caused by differing residues in the binding pocket.


    PubMed Central

    Howe, Howard A.; Mellors, Robert C.


    Manometric determinations of cytochrome oxidase activity were carried out on grey matter from the thalamus and anterior horn of cats and monkeys under various experimental conditions. The thalamus of the cat was studied following the degeneration of virtually all the thalamic neurons secondary to decortication. In comparing the deneuronated thalamus with the normal one, it was found that approximately 34 per cent of the cytochrome oxidase activity was contributed by the neurons and the balance by neuroglia and mesodermal tissues which on the operated side remained comparable to that of the normal side. Total activity of the normal thalamus averaged 5.52 units per mg. of dry weight where I unit is defined as the amount of cytochrome oxidase required to produce a net oxygen consumption of 10 per hour under the specified conditions of the experiment. The grey matter of the anterior horns of the spinal cord was isolated by a special technique and its cytochrome oxidase activity was compared with anterior horns in which motoneurons had been stimulated to regenerative activity by section of peripheral nerves. Each animal was studied in relation to an anterior horn which was normal and one in which only the functional state of the motoneurons had been changed. Average normal levels of 2.23 units were found for cat anterior horn and 0.69 units for the monkey. Reductions of cytochrome oxidase activity in the range of 22 to 23 per cent were observed for both cat and monkey following nerve section. In the latter the time sequence was carefully studied in relation to the cytological cycle known as chromatolysis and a virus refractory state previously described by us. It was found that maximal reduction of cytochrome oxidase activity coincided with maximal refractoriness of the cells to poliomyelitis virus (30 to 70 days following nerve section). Neither of these states could be correlated in time with maximal chromatolysis (10 to 15 days). PMID:19871471

  3. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata


    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  4. ACC2 gene polymorphisms, metabolic syndrome, and gene-nutrient interactions with dietary fat

    PubMed Central

    Phillips, Catherine M.; Goumidi, Louisa; Bertrais, Sandrine; Field, Martyn R.; Cupples, L. Adrienne; Ordovas, Jose M.; McMonagle, Jolene; Defoort, Catherine; Lovegrove, Julie A.; Drevon, Christian A.; Blaak, Ellen E.; Kiec-Wilk, Beata; Riserus, Ulf; Lopez-Miranda, Jose; McManus, Ross; Hercberg, Serge; Lairon, Denis; Planells, Richard; Roche, Helen M.


    Acetyl-CoA carboxylase β (ACC2) plays a key role in fatty acid synthesis and oxidation pathways. Disturbance of these pathways is associated with impaired insulin responsiveness and metabolic syndrome (MetS). Gene-nutrient interactions may affect MetS risk. This study determined the relationship between ACC2 polymorphisms (rs2075263, rs2268387, rs2284685, rs2284689, rs2300453, rs3742023, rs3742026, rs4766587, and rs6606697) and MetS risk, and whether dietary fatty acids modulate this in the LIPGENE-SU.VI.MAX study of MetS cases and matched controls (n = 1754). Minor A allele carriers of rs4766587 had increased MetS risk (OR 1.29 [CI 1.08, 1.58], P = 0.0064) compared with the GG homozygotes, which may in part be explained by their increased body mass index (BMI), abdominal obesity, and impaired insulin sensitivity (P < 0.05). MetS risk was modulated by dietary fat intake (P = 0.04 for gene-nutrient interaction), where risk conferred by the A allele was exacerbated among individuals with a high-fat intake (>35% energy) (OR 1.62 [CI 1.05, 2.50], P = 0.027), particularly a high intake (>5.5% energy) of n-6 polyunsaturated fat (PUFA) (OR 1.82 [CI 1.14, 2.94], P = 0.01; P = 0.05 for gene-nutrient interaction). Saturated and monounsaturated fat intake did not modulate MetS risk. Importantly, we replicated some of these findings in an independent cohort. In conclusion, the ACC2 rs4766587 polymorphism influences MetS risk, which was modulated by dietary fat, suggesting novel gene-nutrient interactions. PMID:20855566

  5. Capteurs monopodes pour mesures accélérométriques

    NASA Astrophysics Data System (ADS)

    Delaite, R.; Valentin, J.-P.


    A new design for accelerometric measurements sensors is described. It uses a plate vibrating in thickness shear mode, maintained by the means of a single holder located at the crystal edge. This mounting does cancel the mechanical and thermal stresses which generally modify the sensor output signal. So the ratio signal/noise of a thickness shear accelerometer is improved and the intrinsic sensitivity is multiplied by a factor 40, by comparison with the sensitivity of a thickness shear plate bonded by the means of two opposite holders. Un nouveau dispositif destiné aux mesures d'accélération est présenté. Il met en œuvre une lame vibrant en cisaillement d'épaisseur, fixée à sa structure de maintien par l'intermédiaire d'une unique liaison. Ce montage permet d'éliminer les contraintes mécaniques et thermiques qui perturbent habituellement le signal de mesure, et qui sont liées soit au montage des éléments du capteur, soit aux variations rapides de température qui interviennent lors de la mise en fonctionnement du capteur. Le rapport signal/bruit d'un accéléromètre à lame vibrant en cisaillement d'épaisseur s'en trouve amélioré et la sensibilité à l'accélération est multipliée par un facteur 40, comparée à celle d'un capteur qui serait constitué d'une lame vibrant en cisaillement d'épaisseur, fixée par deux liaisons diamétralement opposées.

  6. Higher Order Modes HOM___s in Coupled Cavities of the Flash Module ACC39

    SciTech Connect

    Shinton, I.R.R.; Jones, R.M.; Li, Z.; Zhang, P.; /Manchester U. /Cockcroft Inst. Accel. Sci. Tech. /DESY


    We analyse the higher order modes (HOM's) in the 3.9GHz bunch shaping cavities installed in the FLASH facility at DESY. A suite of finite element computer codes (including HFSS and ACE3P) and globalised scattering matrix calculations (GSM) are used to investigate the modes in these cavities. This study is primarily focused on the dipole component of the multiband expansion of the wakefield, with the emphasis being on the development of a HOM-based BPM system for ACC39. Coupled inter-cavity modes are simulated together with a limited band of trapped modes.

  7. BACCHUS: Brussels Automatic Code for Characterizing High accUracy Spectra

    NASA Astrophysics Data System (ADS)

    Masseron, Thomas; Merle, Thibault; Hawkins, Keith


    BACCHUS (Brussels Automatic Code for Characterizing High accUracy Spectra) derives stellar parameters (Teff, log g, metallicity, microturbulence velocity and rotational velocity), equivalent widths, and abundances. The code includes on the fly spectrum synthesis, local continuum normalization, estimation of local S/N, automatic line masking, four methods for abundance determinations, and a flagging system aiding line selection. BACCHUS relies on the grid of MARCS model atmospheres, Masseron's model atmosphere thermodynamic structure interpolator, and the radiative transfer code Turbospectrum (ascl:1205.004).

  8. Copper distributed by Atx1 is available to copper amine oxidase 1 in Schizosaccharomyces pombe.


    Peter, Chardeen; Laliberté, Julie; Beaudoin, Jude; Labbé, Simon


    Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The requirement for copper is absolute for their activity. In the fission yeast Schizosaccharomyces pombe, cao1(+) and cao2(+) genes are predicted to encode members of the CAO family. While both genes are expressed in wild-type cells, we determined that the expression of only cao1(+) but not cao2(+) results in the production of an active enzyme. Site-directed mutagenesis identified three histidine residues within the C-terminal region of Cao1 that are necessary for amine oxidase activity. By use of a cao1(+)-GFP allele that retained wild-type function, Cao1-GFP was localized in the cytosol (GFP is green fluorescent protein). Under copper-limiting conditions, disruption of ctr4(+), ctr5(+), and cuf1(+) produced a defect in amine oxidase activity, indicating that a functionally active Cao1 requires Ctr4/5-mediated copper transport and the transcription factor Cuf1. Likewise, atx1 null cells exhibited substantially decreased levels of amine oxidase activity. In contrast, deletion of ccc2, cox17, and pccs had no significant effect on Cao1 activity. Residual amine oxidase activity in cells lacking atx1(+) can be restored to normal levels by returning an atx1(+) allele, underscoring the critical importance of the presence of Atx1 in cells. Using two-hybrid analysis, we demonstrated that Cao1 physically interacts with Atx1 and that this association is comparable to that of Atx1 with the N-terminal region of Ccc2. Collectively, these results describe the first example of the ability of Atx1 to act as a copper carrier for a molecule other than Ccc2 and its critical role in delivering copper to Cao1. PMID:18723604

  9. Reactive Oxygen Species and Angiogenesis: NADPH Oxidase as Target for Cancer Therapy

    PubMed Central

    Ushio-Fukai, Masuko; Nakamura, Yoshimasa


    Angiogenesis is essential for tumor growth, metastasis, arteriosclerosis as well as embryonic development and wound healing. Its process is dependent on cell proliferation, migration and capillary tube formation in endothelia cells (ECs). High levels of reactive oxygen species (ROS) such as superoxide and H2O2 are observed in various cancer cells. Accumulating evidence suggests that ROS function as signaling molecules to mediate various growth-related responses including angiogenesis. ROS-dependent angiogenesis can be regulated by endogenous antioxidant enzymes such as SOD and thioredoxin. Vascular endothelial growth factor (VEGF), one of the major angiogenesis factor, is induced in growing tumors and stimulates EC proliferation and migration primarily through the VEGF receptor type2 (VEGFR2, Flk1/KDR). Major source of ROS in ECs is a NADPH oxidase which consists of Nox1, Nox2, Nox4, Nox5, p22phox, p47phox and the small G protein Rac1. NADPH oxidase is activated by various growth factors including VEGF and angiopoietin-1 as well as hypoxia and ischemia, and ROS derived from this oxidase are involved in VEGFR2 autophosphorylation, and diverse redox signaling pathways leading to induction of transcription factors and genes involved in angiogenesis. Dietary antioxidants appear to be effective for treatment of tumor angiogenesis. The aim of this review is to provide an overview of the recent progress on role of ROS derived from NADPH oxidase and redox signaling events involved in angiogenesis. Understanding these mechanisms may provide insight into the NADPH oxidase and redox signaling components as potential therapeutic targets for tumor angiogenesis. PMID:18406051

  10. Parkin degrades estrogen-related receptors to limit the expression of monoamine oxidases.


    Ren, Yong; Jiang, Houbo; Ma, Dingyuan; Nakaso, Kazuhiro; Feng, Jian


    Parkin, whose mutations cause Parkinson disease (PD), controls oxidative stress by limiting the expression of monoamine oxidases (MAO)--mitochondrial enzymes responsible for the oxidative de-amination of dopamine. Here, we show that parkin performed this function by increasing the ubiquitination and degradation of estrogen-related receptors (ERR), orphan nuclear receptors that play critical roles in the transcription regulation of many nuclear-encoded mitochondrial proteins. All three ERRs (α, β and γ) increased the transcription of MAOs A and B; the effects were abolished by parkin, but not by its PD-linked mutants. Parkin bound to ERRs and increased their ubiquitination and degradation. In fibroblasts from PD patients with parkin mutations or brain slices from parkin knockout mice, degradation of ERRs was significantly attenuated. The results reveal the molecular mechanism by which parkin suppresses the transcription of MAOs to control oxidative stress induced by dopamine oxidation. PMID:21177257

  11. Parkin degrades estrogen-related receptors to limit the expression of monoamine oxidases

    PubMed Central

    Ren, Yong; Jiang, Houbo; Ma, Dingyuan; Nakaso, Kazuhiro; Feng, Jian


    Parkin, whose mutations cause Parkinson disease (PD), controls oxidative stress by limiting the expression of monoamine oxidases (MAO)—mitochondrial enzymes responsible for the oxidative de-amination of dopamine. Here, we show that parkin performed this function by increasing the ubiquitination and degradation of estrogen-related receptors (ERR), orphan nuclear receptors that play critical roles in the transcription regulation of many nuclear-encoded mitochondrial proteins. All three ERRs (α, β and γ) increased the transcription of MAOs A and B; the effects were abolished by parkin, but not by its PD-linked mutants. Parkin bound to ERRs and increased their ubiquitination and degradation. In fibroblasts from PD patients with parkin mutations or brain slices from parkin knockout mice, degradation of ERRs was significantly attenuated. The results reveal the molecular mechanism by which parkin suppresses the transcription of MAOs to control oxidative stress induced by dopamine oxidation. PMID:21177257

  12. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan


    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  13. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João


    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  14. Oxidative stress, NADPH oxidases, and arteries.


    Sun, Qi-An; Runge, Marschall S; Madamanchi, Nageswara R


    Atherosclerosis and its major complications - myocardial infarction and stroke - remain major causes of death and disability in the United States and world-wide. Indeed, with dramatic increases in obesity and diabetes mellitus, the prevalence and public health impact of cardiovascular diseases (CVD) will likely remain high. Major advances have been made in development of new therapies to reduce the incidence of atherosclerosis and CVD, in particular for treatment of hypercholesterolemia and hypertension. Oxidative stress is the common mechanistic link for many CVD risk factors. However, only recently have the tools existed to study the interface between oxidative stress and CVD in animal models. The most important source of reactive oxygen species (and hence oxidative stress) in vascular cells are the multiple forms of enzymes nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Recently published and emerging studies now clearly establish that: 1) NADPH oxidases are of critical importance in atherosclerosis and hypertension in animal models; 2) given the tissue-specific expression of key components of NADPH oxidase, it may be possible to target vascular oxidative stress for prevention of CVD. PMID:25649240

  15. The substrate tolerance of alcohol oxidases.


    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt


    Alcohols are a rich source of compounds from renewable sources, but they have to be activated in order to allow the modification of their carbon backbone. The latter can be achieved via oxidation to the corresponding aldehydes or ketones. As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. In order to facilitate the selection of the optimal enzyme for a given biocatalytic application, the substrate tolerance of alcohol oxidases is compiled and discussed: Substrates are classified into groups (non-activated prim- and sec-alcohols; activated allylic, cinnamic and benzylic alcohols; hydroxy acids; sugar alcohols; nucleotide alcohols; sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. PMID:26153139

  16. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.


    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  17. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry


    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  18. ACC deaminase and IAA producing growth promoting bacteria from the rhizosphere soil of tropical rice plants.


    Bal, Himadri Bhusan; Das, Subhasis; Dangar, Tushar K; Adhya, Tapan K


    Beneficial plant-associated bacteria play a key role in supporting and/or promoting plant growth and health. Plant growth promoting bacteria present in the rhizosphere of crop plants can directly affect plant metabolism or modulate phytohormone production or degradation. We isolated 355 bacteria from the rhizosphere of rice plants grown in the farmers' fields in the coastal rice field soil from five different locations of the Ganjam district of Odisha, India. Six bacteria producing both ACC deaminase (ranging from 603.94 to 1350.02 nmol α-ketobutyrate mg(-1)  h(-1) ) and indole acetic acid (IAA; ranging from 10.54 to 37.65 μM ml(-1) ) in pure cultures were further identified using polyphasic taxonomy including BIOLOG((R)) , FAME analysis and the 16S rRNA gene sequencing. Phylogenetic analyses of the isolates resulted into five major clusters to include members of the genera Bacillus, Microbacterium, Methylophaga, Agromyces, and Paenibacillus. Seed inoculation of rice (cv. Naveen) by the six individual PGPR isolates had a considerable impact on different growth parameters including root elongation that was positively correlated with ACC deaminase activity and IAA production. The cultures also had other plant growth attributes including ammonia production and at least two isolates produced siderophores. Study indicates that presence of diverse rhizobacteria with effective growth-promoting traits, in the rice rhizosphere, may be exploited for a sustainable crop management under field conditions. PMID:23681643

  19. The 2013 ACC/AHA Cholesterol Treatment Guidelines: Applicability to Patients with Diabetes.


    Ziaeian, Boback; Dinkler, John; Guo, Yuanlin; Watson, Karol


    Atherosclerotic cardiovascular disease (ASCVD) is the leading cause of death worldwide and the management of blood cholesterol is a cornerstone of medical therapy for the primary and secondary prevention of cardiovascular disease. Patients with diabetes represent an important high-risk group in whom clinicians should advocate the use of statins and lifestyle modification for the reduction of ASCVD. The recent 2013 ACC/AHA guidelines on managing blood cholesterol provide an important framework for the effective implementation of this important risk reduction strategy. The guidelines identify four groups of individuals who have been shown to benefit from statin therapy and update the dosing and monitoring recommendations based on evidence from published, large-scale randomized controlled trials (RCTs) with clinical hard endpoints. Primary care physicians and specialists play key roles in identifying populations at elevated ASCVD risk and providing effective care for patients, especially those with diabetes. This article will summarize the 2013 ACC/AHA guidelines on managing blood cholesterol and provide a practical management overview in order to facilitate implementation of these guidelines for patients with diabetes. PMID:26803649

  20. Various effects of fluorescent bacteria of the genus Pseudomonas containing ACC deaminase on wheat seedling growth.


    Magnucka, Elżbieta G; Pietr, Stanisław J


    The study evaluates the effect of rhizobacteria having 1-aminocyclopropane-1-carboxylate deaminase (ACCd) on the development of wheat seedlings. This enzyme has been proposed to play a key role in microbe-plant association. Three fluorescent pseudomonads containing this deaminase were selected from 70 strains of pseudomonads isolated from rhizosphere of wheat (Triticum aestivum L.) and rape (Brassica napus L.). These bacteria, varied significantly in the ability to both biosynthesize auxins and hydrolyze ACC. Among them, Pseudomonas brassicacearum subsp. brassicacearum strain RZ310 presented the highest activities of ACC deaminase during 96h of growth in liquid Dworkin and Foster (DF) salt medium. Additionally, this rape rhizosphere strain did not produce indoles. Two other isolates, Pseudomonas sp. PO283 and Pseudomonas sp. PO366, secreted auxins only in the presence of their precursor. Phylogenetic analysis of the 16S rRNA gene and four other protein-encoding genes indicated that these wheat rhizosphere isolates belonged to the fluorescent Pseudomonas group. Moreover, the effects of these strains on wheat seedling growth under in vitro conditions were markedly dependent on both their cell suspensions used to grain inoculation and nutrient conditions. Strains tested had beneficial influence on wheat seedlings mainly at low cell densities. In addition, access to nutrients markedly changed bacteria action on cereal growth. Their presence generally favored the positive effects of pseudomonads on length and the estimated biomasses of wheat coleoptiles. Despite these general rules, impacts of each isolate on the growth parameters of cereal seedlings were unique. PMID:25983132

  1. 5th International ACC Symposium: Classification of Adrenocortical Cancers from Pathology to Integrated Genomics: Real Advances or Lost in Translation?


    de Krijger, Ronald E; Bertherat, Jérôme


    For the clinician, despite its rarity, adrenocortical cancer is a heterogeneous tumor both in term of steroid excess and tumor evolution. For patient management, it is crucial to have an accurate vision of this heterogeneity, in order to use a correct tumor classification. Pathology is the best way to classify operated adrenocortical tumors: to recognize their adrenocortical nature and to differentiate benign from malignant tumors. Among malignant tumors pathology also aims at prognosis assessment. Although progress has being made for prognosis assessment, there is still a need for improvement. Recent studies have established the value of Ki67 for adrenocortical cancer (ACC) prognostication, aiming also at standardization to reduce variability. The use of genomics to study adrenocortical tumors gives a very new insight in their pathogenesis and molecular classification. Genomics studies of ACC give now a clear description of the mRNA (transcriptome) and miRNA expression profile, as well as chromosomal and methylation alterations. Exome sequencing also established firmly the list of the main ACC driver genes. Interestingly, genomics study of ACC also revealed subtypes of malignant tumors with different pattern of molecular alterations, associated with different outcome. This leads to a new vision of adrenocortical tumors classification based on molecular analysis. Interestingly, these molecular classifications meet also the results of pathological analysis. This opens new perspectives on the development and use of various molecular tools to classify, along with pathological analysis, ACC, and guides patient management at the area of precision medicine. PMID:26676358

  2. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming


    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the ACV-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  3. Monitoring apoptosis of TK-GFP-expressing ACC-M cells induced by ACV using FRET technique

    NASA Astrophysics Data System (ADS)

    Xiong, Tao; Zhang, Zhihong; Lin, Juqiang; Yang, Jie; Zeng, Shaoqun; Luo, Qingming


    Apoptosis is an evolutionary conserved cellular process that plays an important role during development, but it is also involved in tissue homeostasis and in many diseases. To study the characteristics of suicide gene system of the herpes simplex virus thymidine kinase (HSV-tk) gene in tumor cells and explore the apoptosis phenomena in this system and its effect on the human adenoid cystic carcinoma line ACC-M cell, we detected apoptosis of CD3- (ECFP-CRS-DsRed) and TK-GFP-expressing ACC-M (ACC-M-TK-GFP-CD3) cells induced by acyclovir (ACV) using fluorescence resonance energy transfer (FRET) technique. CD3 is a FRET-based indicator for activity of caspase-3, which is composed of an enhanced cyan fluorescent protein, a caspase-3 sensitive linker, and a red fluorescent protein from Discosoma with efficient maturation property. FRET from ECFP to DsRed could be detected in normal ACC-M-TK-GFP-CD3 cells, and the FRET efficient was remarkably decreased and then disappeared during the cells apoptosis induced by ACV. It was due to the activated caspase-3 cleaved the CD3 fusion protein. In this study, the results suggested that the AVC-induced apoptosis of ACC-M-TK-GFP-CD3 cells was through caspase-3 pathway.

  4. Monoclonal antibodies to the alternative oxidase of higher plant mitochondria

    SciTech Connect

    Elthon, T.E.; Nickels, R.L.; McIntosh, L. )


    The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain which terminates with cytochrome oxidase, an alternative pathway that terminates with an alternative oxidase. The alternative oxidase of Sauromatum guttatum Schott has recently been identified as a cluster of proteins with apparent M{sub r} of 37, 36, and 35 kilodaltons (kD). Monoclonal antibodies have now been prepared to these proteins and designated as AOA (binding all three proteins of the alternative oxidase cluster), AOU (binding the upper or 37 kD protein), and AOL (binding the lower or 36 and 35 kD proteins). All three antibodies bind to their respective alternative oxidase proteins whether the proteins are in their native or denatured states. AOA and AOU inhibit alternative oxidase activity around 49%, whereas AOL inhibits activity only 14%. When coupled individually to Sepharose 4B, all three monoclonal resins were capable of retaining the entire cluster of alternative oxidase proteins, suggesting that these proteins are physically associated in some manner. The monoclonals were capable of binding similar mitochondrial proteins in a number of thermogenic and nonthermogenic species, indicating that they will be useful in characterizing and purifying the alternative oxidase of different systems. The ability of the monoclonal-Sepharose 4B resins to retain the cluster of previously identified alternative oxidase proteins, along with the inhibition of alternative oxidase activity by these monoclonals, supports the role of these proteins in constituting the alternative oxidase.

  5. Coexistence of Two Forms of LTP in ACC Provides a Synaptic Mechanism for the Interactions between Anxiety and Chronic Pain

    PubMed Central

    Koga, Kohei; Descalzi, Giannina; Chen, Tao; Ko, Hyoung-Gon; Lu, Jinshan; Li, Shermaine; Son, Junehee; Kim, TaeHyun; Kwak, Chuljung; Huganir, Richard L.; Zhao, Ming-gao; Kaang, Bong-Kiun; Collingridge, Graham L.; Zhuo, Min


    SUMMARY Chronic pain can lead to anxiety and anxiety can enhance the sensation of pain. Unfortunately, little is known about the synaptic mechanisms that mediate these re-enforcing interactions. Here we characterized two forms of long-term potentiation (LTP) in the anterior cingulate cortex (ACC); a presynaptic form (pre-LTP) that requires kainate receptors and a postsynaptic form (post-LTP) that requires N-methyl-D-aspartate receptors. Pre-LTP also involves adenylyl cyclase and protein kinase A and is expressed via a mechanism involving hyperpolarization-activated cyclic nucleotide-gated (HCN) channels. Interestingly, chronic pain and anxiety both result in selective occlusion of pre-LTP. Significantly, microinjection of the HCN blocker ZD7288 into the ACC in vivo produces both anxiolytic and analgesic effects. Our results provide a mechanism by which two forms of LTP in the ACC may converge to mediate the interaction between anxiety and chronic pain. PMID:25556835

  6. Transport of sup 14 C-IAA and sup 14 C-ACC within floral organs of Ipomoea nil

    SciTech Connect

    Kiss, H.G. ); Maurice, H.R. ); Koning, R.E. ); Daie, J. )


    The transport of {sup 14}C-IAA {sup 14}C-ACC from agarose donor blocks applied to I. nil filaments their recovery as {sup 14}C-accumulation into floral organs was examined. The accumulation of the isotopes in the corolla tissue was greater when {sup 14}C-ACC was applied than {sup 14}C-IAA in intact isolated flower buds. Greater levels of the isotopes accumulated in the pistil, with minimal levels in receptacle and calyx tissues from isolated buds. With intact buds, greater levels of the isotopes were recovered in pistil, calyx receptacle tissues. This study provides further evidence for the role of the filaments as transport vectors for IAA ACC for the production of ethylene.

  7. The effect of native and ACC deaminase-containing Azospirillum brasilense Cd1843 on the rooting of carnation cuttings.


    Li, Qiaosi; Saleh-Lakha, Saleema; Glick, Bernard R


    Carnation cuttings treated with non-transformed and 1-aminocyclopropane (ACC) deaminase-containing Azospirillum brasilense Cd1843 produced significantly more roots than untreated controls and fewer roots than cuttings treated with 0.1% indolebutyric acid (IBA). The roots produced by cuttings treated with ACC deaminase-containing Azospirillum brasilense Cd1843 were the longest roots resulting from any of the treatments, followed by non-transformed Azospirillum brasilense Cd1843, 0.1% IBA, and treatment with water. The results are interpreted in terms of a previously proposed model of bacterial promotion of plant growth by ACC deaminase and indoleacetic acid, and may have implications for the use of plant growth-promoting bacteria in the flower industry. PMID:16121231

  8. Zonal Variations of Eddy Diffusivities in an ACC-like Channel: Discrete Transport Corridors.

    NASA Astrophysics Data System (ADS)

    Lazar, A.; Thompson, A. F.


    The meridional overturning circulation in a wind-driven re-entrant channel arises from a balance between an Eulerian mean overturning and an eddy overturning. These cancel to leading order in the Southern Ocean's Antarctic Circumpolar Current (ACC). An ACC-like flow, with realistic stratification, zonal transport and distributions of eddy kinetic energy, develops even when these two overturning components cancel completely. Many studies have noted that an enhancement of the Eulerian overturning circulation, which tends to steepen isopycnals, is balanced in part by an enhancement of the eddy circulation that relaxes isopycnal tilt. Thus the domain-averaged isopycnal slope and zonal transport are relatively insensitive to changes in wind forcing. However, the response of the system's mesoscale variability and eddy fluxes is not uniform throughout the domain. We present a process study of an idealized eddy-resolving ACC-like channel with negligible residual overturning to explore how the along-stream distribution of eddy characteristics establishes a balance between wind and eddy overturning circulations. For each simulation, we decompose the overturning circulation into mean, standing and transient components. As the surface wind stress increases, the standing component balances a larger portion of the mean overturning. This in turn leads to an increasing departure from zonally-symmetric eddy characteristics. A zonal-mean, or net, eddy diffusivity Κnet is defined as the eddy diffusivity required to exactly balance the mean overturning based on the zonal-mean isopycnal slope, s. This gives Κnet=τ/ρ0fs, where τ is the wind stress, ρ0 is a reference density and f is the Coriolis parameter. Κnet is compared to local eddy diffusivities, Κlocal, diagnosed directly from the divergent component of the eddy buoyancy flux divided by the local isopycnal slope. We find that with a simple topographic ridge and moderate wind forcing, along-stream averages of

  9. Acceleration of a Particle-in-Cell Code for Space Plasma Simulations with OpenACC

    NASA Astrophysics Data System (ADS)

    Peng, Ivy Bo; Markidis, Stefano; Vaivads, Andris; Vencels, Juris; Deca, Jan; Lapenta, Giovanni; Hart, Alistair; Laure, Erwin


    We simulate space plasmas with the Particle-in-cell (PIC) method that uses computational particles to mimic electrons and protons in solar wind and in Earth magnetosphere. The magnetic and electric fields are computed by solving the Maxwell's equations on a computational grid. In each PIC simulation step, there are four major phases: interpolation of fields to particles, updating the location and velocity of each particle, interpolation of particles to grids and solving the Maxwell's equations on the grid. We use the iPIC3D code, which was implemented in C++, using both MPI and OpenMP, for our case study. By November 2014, heterogeneous systems using hardware accelerators such as Graphics Processing Unit (GPUs) and the Many Integrated Core (MIC) coprocessors for high performance computing continue growth in the top 500 most powerful supercomputers world wide. Scientific applications for numerical simulations need to adapt to using accelerators to achieve portability and scalability in the coming exascale systems. In our work, we conduct a case study of using OpenACC to offload the computation intensive parts: particle mover and interpolation of particles to grids, in a massively parallel Particle-in-Cell simulation code, iPIC3D, to multi-GPU systems. We use MPI for inter-node communication for halo exchange and communicating particles. We identify the most promising parts suitable for GPUs accelerator by profiling using CrayPAT. We implemented manual deep copy to address the challenges of porting C++ classes to GPU. We document the necessary changes in the exiting algorithms to adapt for GPU computation. We present the challenges and findings as well as our methodology for porting a Particle-in-Cell code to multi-GPU systems using OpenACC. In this work, we will present the challenges, findings and our methodology of porting a Particle-in-Cell code for space applications as follows: We profile the iPIC3D code by Cray Performance Analysis Tool (CrayPAT) and identify

  10. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)


    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  11. NADPH oxidases in the arbuscular mycorrhizal symbiosis.


    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa


    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  12. Human copper-dependent amine oxidases.


    Finney, Joel; Moon, Hee-Jung; Ronnebaum, Trey; Lantz, Mason; Mure, Minae


    Copper amine oxidases (CAOs) are a class of enzymes that contain Cu(2+) and a tyrosine-derived quinone cofactor, catalyze the conversion of a primary amine functional group to an aldehyde, and generate hydrogen peroxide and ammonia as byproducts. These enzymes can be classified into two non-homologous families: 2,4,5-trihydroxyphenylalanine quinone (TPQ)-dependent CAOs and the lysine tyrosylquinone (LTQ)-dependent lysyl oxidase (LOX) family of proteins. In this review, we will focus on recent developments in the field of research concerning human CAOs and the LOX family of proteins. The aberrant expression of these enzymes is linked to inflammation, fibrosis, tumor metastasis/invasion and other diseases. Consequently, there is a critical need to understand the functions of these proteins at the molecular level, so that strategies targeting these enzymes can be developed to combat human diseases. PMID:24407025

  13. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean


    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.


    PubMed Central

    Bainbridge, Shannon A.; Deng, Jau-Shyong; Roberts, James M.


    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened pro-inflammatory cytokine production this enzyme is preferentially in it’s oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress and hyperuricemia it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from non-pregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggest maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia. PMID:19196876

  15. [2013 Guidelines ACC/AHA cardiovascular risk. Incomplete evidence and failed attempt at simplification].


    Corral, Pablo


    After almost a decade, finally Guidelines for the management of hypercholesterolemia in adults by the AHA/ACC were published. The substantial change in the paradigm of this new recommendation is the treatment decision basically statin, based on a recalculation of cardiovascular risk. Four groups were identified and based on them different statins indication, according to the power applied. As is apparent, have been used only randomized clinical trials (RCT) as the sole basis for the drafting of these new guidelines. Two basic issues are reviewed and revised in the following article: leaving aside other types of evidence to generate the recommendation and on the other hand the attempt to simplify the interpretation and management of this condition. We stress the need for any recommendation to clinical reasoning to interpret different scenarios involved in each patient. PMID:25496959

  16. Reward sensitivity modulates brain activity in the prefrontal cortex, ACC and striatum during task switching.


    Fuentes-Claramonte, Paola; Ávila, César; Rodríguez-Pujadas, Aina; Ventura-Campos, Noelia; Bustamante, Juan C; Costumero, Víctor; Rosell-Negre, Patricia; Barrós-Loscertales, Alfonso


    Current perspectives on cognitive control acknowledge that individual differences in motivational dispositions may modulate cognitive processes in the absence of reward contingencies. This work aimed to study the relationship between individual differences in Behavioral Activation System (BAS) sensitivity and the neural underpinnings involved in processing a switching cue in a task-switching paradigm. BAS sensitivity was hypothesized to modulate brain activity in frontal regions, ACC and the striatum. Twenty-eight healthy participants underwent fMRI while performing a switching task, which elicited activity in fronto-striatal regions during the processing of the switch cue. BAS sensitivity was negatively associated with activity in the lateral prefrontal cortex, anterior cingulate cortex and the ventral striatum. Combined with previous results, our data indicate that BAS sensitivity modulates the neurocognitive processes involved in task switching in a complex manner depending on task demands. Therefore, individual differences in motivational dispositions may influence cognitive processing in the absence of reward contingencies. PMID:25875640

  17. Reward Sensitivity Modulates Brain Activity in the Prefrontal Cortex, ACC and Striatum during Task Switching

    PubMed Central

    Fuentes-Claramonte, Paola; Ávila, César; Rodríguez-Pujadas, Aina; Ventura-Campos, Noelia; Bustamante, Juan C.; Costumero, Víctor; Rosell-Negre, Patricia; Barrós-Loscertales, Alfonso


    Current perspectives on cognitive control acknowledge that individual differences in motivational dispositions may modulate cognitive processes in the absence of reward contingencies. This work aimed to study the relationship between individual differences in Behavioral Activation System (BAS) sensitivity and the neural underpinnings involved in processing a switching cue in a task-switching paradigm. BAS sensitivity was hypothesized to modulate brain activity in frontal regions, ACC and the striatum. Twenty-eight healthy participants underwent fMRI while performing a switching task, which elicited activity in fronto-striatal regions during the processing of the switch cue. BAS sensitivity was negatively associated with activity in the lateral prefrontal cortex, anterior cingulate cortex and the ventral striatum. Combined with previous results, our data indicate that BAS sensitivity modulates the neurocognitive processes involved in task switching in a complex manner depending on task demands. Therefore, individual differences in motivational dispositions may influence cognitive processing in the absence of reward contingencies. PMID:25875640

  18. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.


    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey


    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines. PMID:25893781

  19. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  20. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  1. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

    PubMed Central

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.


    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426

  2. cDNA cloning and expression of potato polyphenol oxidase.


    Hunt, M D; Eannetta, N T; Yu, H; Newman, S M; Steffens, J C


    Polyphenol oxidases (PPOs) of plants are copper metalloproteins which catalyze the oxidation of mono- and o-diphenols to o-diquinones. Although PPOs are believed to be primarily responsible for the deleterious browning of many fruit and vegetable crops and are thought to be involved in plant-pest interactions, direct evidence for these roles is lacking. We report the cloning of two PPO cDNAs from Solanum tuberosum leaves. These cDNAs exhibit 97% and 98% sequence similarity at the DNA and deduced amino acid levels, respectively. Putative copper-binding regions of both cDNAs are very similar to those of mammalian, bacterial and Neurospora tyrosinases. Both leaf PPO cDNAs appear to encode polypeptides which are processed to a mature molecular weight of 57,000. In potato leaves, petioles, roots, and flowers, PPO is encoded by ca. 2 kb transcripts. Leaf PPO mRNA is developmentally regulated and only detectable in young foliage. In contrast, the protein profile of immunologically detectable PPO remains constant from the apical node through the eleventh leaf node. PMID:7678763

  3. Brain monoamine oxidase A activity predicts trait aggression.


    Alia-Klein, Nelly; Goldstein, Rita Z; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D; Fowler, Joanna S


    The genetic deletion of monoamine oxidase A (MAO A), an enzyme that breaks down the monoamine neurotransmitters norepinephrine, serotonin, and dopamine, produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, Mendelian Inheritance in Men database number 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in vivo in healthy nonsmoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the multidimensional personality questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions, the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than one-third of the variability. Because trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  4. Brain Monoamine Oxidase-A Activity Predicts Trait Aggression

    PubMed Central

    Alia-Klein, Nelly; Goldstein, Rita Z.; Kriplani, Aarti; Logan, Jean; Tomasi, Dardo; Williams, Benjamin; Telang, Frank; Shumay, Elena; Biegon, Anat; Craig, Ian W.; Henn, Fritz; Wang, Gene-Jack; Volkow, Nora D.; Fowler, Joanna S.


    The genetic deletion of monoamine oxidase A (MAO A, an enzyme which breaks down the monoamine neurotransmitters norepinephrine, serotonin and dopamine) produces aggressive phenotypes across species. Therefore, a common polymorphism in the MAO A gene (MAOA, MIM 309850, referred to as high or low based on transcription in non-neuronal cells) has been investigated in a number of externalizing behavioral and clinical phenotypes. These studies provide evidence linking the low MAOA genotype and violent behavior but only through interaction with severe environmental stressors during childhood. Here, we hypothesized that in healthy adult males the gene product of MAO A in the brain, rather than the gene per se, would be associated with regulating the concentration of brain amines involved in trait aggression. Brain MAO A activity was measured in-vivo in healthy non-smoking men with positron emission tomography using a radioligand specific for MAO A (clorgyline labeled with carbon 11). Trait aggression was measured with the Multidimensional Personality Questionnaire (MPQ). Here we report for the first time that brain MAO A correlates inversely with the MPQ trait measure of aggression (but not with other personality traits) such that the lower the MAO A activity in cortical and subcortical brain regions the higher the self-reported aggression (in both MAOA genotype groups) contributing to more than a third of the variability. Since trait aggression is a measure used to predict antisocial behavior, these results underscore the relevance of MAO A as a neurochemical substrate of aberrant aggression. PMID:18463263

  5. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.


    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P


    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  6. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia


    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  7. The human ACC2 CT-domain C-terminus is required for full functionality and has a novel twist

    SciTech Connect

    Madauss, Kevin P.; Burkhart, William A.; Consler, Thomas G.; Cowan, David J.; Gottschalk, William K.; Miller, Aaron B; Short, Steven A.; Tran, Thuy B.; Williams, Shawn P.


    Inhibition of acetyl-CoA carboxylase (ACC) may prevent lipid-induced insulin resistance and type 2 diabetes, making the enzyme an attractive pharmaceutical target. Although the enzyme is highly conserved amongst animals, only the yeast enzyme structure is available for rational drug design. The use of biophysical assays has permitted the identification of a specific C-terminal truncation of the 826-residue human ACC2 carboxyl transferase (CT) domain that is both functionally competent to bind inhibitors and crystallizes in their presence. This C-terminal truncation led to the determination of the human ACC2 CT domain-CP-640186 complex crystal structure, which revealed distinctions from the yeast-enzyme complex. The human ACC2 CT-domain C-terminus is comprised of three intertwined -helices that extend outwards from the enzyme on the opposite side to the ligand-binding site. Differences in the observed inhibitor conformation between the yeast and human structures are caused by differing residues in the binding pocket.

  8. Improved Performance of an Air Cooled Condenser (ACC) Using SPX Wind Guide Technology at Coal-Based Thermoelectric Power Plants

    SciTech Connect

    Ken Mortensen


    This project added a new airflow enhancement technology to an existing ACC cooling process at a selected coal power plant. Airflow parameters and efficiency improvement for the main plant cooling process using the applied technology were determined and compared with the capabilities of existing systems. The project required significant planning and pre-test execution in order to reach the required Air Cooled Condenser system configuration for evaluation. A host Power Plant ACC system had to be identified, agreement finalized, and addition of the SPX ACC Wind Guide Technology completed on that site. Design of the modification, along with procurement, fabrication, instrumentation, and installation of the new airflow enhancement technology were executed. Baseline and post-modification cooling system data was collected and evaluated. The improvement of ACC thermal performance after SPX wind guide installation was clear. Testing of the improvement indicates there is a 5% improvement in heat transfer coefficient in high wind conditions and 1% improvement at low wind speed. The benefit increased with increasing wind speed. This project was completed on schedule and within budget.

  9. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2013 CFR


    ... 24 Housing and Urban Development 4 2013-04-01 2013-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  10. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2014 CFR


    ... 24 Housing and Urban Development 4 2014-04-01 2014-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  11. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2012 CFR


    ... 24 Housing and Urban Development 4 2012-04-01 2012-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  12. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2011 CFR


    ... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development REGULATIONS RELATING TO HOUSING AND URBAN DEVELOPMENT (CONTINUED) OFFICE OF ASSISTANT...

  13. 24 CFR 982.102 - Allocation of budget authority for renewal of expiring consolidated ACC funding increments.

    Code of Federal Regulations, 2010 CFR


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Allocation of budget authority for renewal of expiring consolidated ACC funding increments. 982.102 Section 982.102 Housing and Urban Development Regulations Relating to Housing and Urban Development (Continued) OFFICE OF ASSISTANT...

  14. Characterization of ACC deaminase gene in Pseudomonas entomophila strain PS-PJH isolated from the rhizosphere soil.


    Kamala-Kannan, Seralathan; Lee, Kui-Jae; Park, Seung-Moon; Chae, Jong-Chan; Yun, Bong-Sik; Lee, Yong Hoon; Park, Yool-Jin; Oh, Byung-Taek


    The enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase cleaves the ethylene precursor ACC into alpha-ketobutyrate and ammonia. The decreased level of ethylene allows the plant to be more resistant to a wide environmental stress including plant pathogens. In the present study, we characterized the ACC deaminase activity of a Pseudomonas entomophila strain PS-PJH isolated from the red pepper rhizosphere region of red pepper grown at Jinan, Korea. The isolate produced 23.8 +/- 0.4 micromol of alpha-ketobutyrate/mg of protein/h during ACC deamination under in vitro conditions. Polymerase chain reaction for acdS gene showed that the isolated P. entomophila strain PS-PJH carry sequences similar to the known acdS genes. Results of the multiple sequence alignment revealed >99% identity (nucleotide and amino acid) with acdS gene of Pseudomonas putida strains AM15 and UW4. The isolated bacteria promoted 43.3 and 34.1% of growth in Raphanus sativus and Lactuca sativa plants, respectively. Based on the 16S-23S internal transcribed spacer region sequences, the isolate was identified as P. entomophila. To the best of our knowledge this is the first study to report the acdS gene in P. entomophila. PMID:20082369

  15. Basement membrane heparan sulfate proteoglycan (perlecan) synthesized by ACC3, adenoid cystic carcinoma cells of human salivary gland origin.


    Kimura, S; Cheng, J; Toyoshima, K; Oda, K; Saku, T


    The biosynthesis of basement membrane heparan sulfate proteoglycan (HSPG), known as perlecan, in ACC3 cells established from a adenoid cystic carcinoma of the human salivary gland was studied using metabolic labeling and immunoprecipitation with discriminative antibodies specific for HSPG core protein. Treatment of immunoprecipitated HSPG with HNO2, heparitinase, and chondroitinase ABC revealed that ACC3 cells synthesized HSPG molecules composed of 470-kDa core protein and heparan sulfate but not of chondroitin sulfate. The core protein was shown to contain complex type N-linked oligosaccharides by digestion with N-glycanase and endoglycosidase H. Pulse-chase experiments showed that the mature form of HSPG was formed in the cells in 30 min and released into the medium thereafter. Degradation of HSPG was also found in the chase period of 3 h. In time course experiments, HSPG was found to be synthesized maximally at day 4 after plating, deposited in the cell layer maximally at day 6, and secreted maximally at day 8. This was also confirmed by immunofluorescence, Northern blotting, and in-situ hybridization. The results indicate that ACC3 cells synthesize, secrete and degrade basement membrane type HSPG, which is analogous to those produced by other cell types, and that the biosynthesis and secretion of HSPG in ACC3 cells are strictly regulated by the cell growth, that may be reflected in the characteristic histology of adenoid cystic carcinomas. PMID:9990141

  16. Implementation and efficiency analysis of parallel computation using OpenACC: a case study using flow field simulations

    NASA Astrophysics Data System (ADS)

    Zhang, Shanghong; Yuan, Rui; Wu, Yu; Yi, Yujun


    The Open Accelerator (OpenACC) application programming interface is a relatively new parallel computing standard. In this paper, particle-based flow field simulations are examined as a case study of OpenACC parallel computation. The parallel conversion process of the OpenACC standard is explained, and further, the performance of the flow field parallel model is analysed using different directive configurations and grid schemes. With careful implementation and optimisation of the data transportation in the parallel algorithm, a speedup factor of 18.26× is possible. In contrast, a speedup factor of just 11.77× was achieved with the conventional Open Multi-Processing (OpenMP) parallel mode on a 20-kernel computer. These results demonstrate that optimised feature settings greatly influence the degree of speedup, and models involving larger numbers of calculations exhibit greater efficiency and higher speedup factors. In addition, the OpenACC parallel mode is found to have good portability, making it easy to implement parallel computation from the original serial model.

  17. Sound the Alarm: The Effect of Narcissism on Retaliatory Aggression Is Moderated by dACC Reactivity to Rejection.


    Chester, David S; DeWall, C Nathan


    Narcissists behave aggressively when their egos are threatened by interpersonal insults. This effect has been explained in terms of narcissists' motivation to reduce the discrepancy between their grandiose self and its threatened version, though no research has directly tested this hypothesis. If this notion is true, the link between narcissism and retaliatory aggression should be moderated by neural structures that subserve discrepancy detection, such as the dorsal anterior cingulate cortex (dACC). This study tested the hypothesis that narcissism would only predict greater retaliatory aggression in response to social rejection when the dACC was recruited by the threat. Thirty participants (15 females; Mage  = 18.86, SD = 1.25; 77% White) completed a trait narcissism inventory, were socially accepted and then rejected while undergoing fMRI, and then could behave aggressively toward one of the rejecters by blasting him or her with unpleasant noise. When narcissists displayed greater dACC activation during rejection, they behaved aggressively. But there was only a weak or nonsignificant relation between narcissism and aggression among participants with a blunted dACC response. Narcissism's role in aggressive retaliation to interpersonal threats is likely determined by the extent to which the brain's discrepancy detector registers the newly created gap between the grandiose and threatened selves. PMID:25564936

  18. Expression of recombinant AccMRJP1 protein from royal jelly of Chinese honeybee in Pichia pastoris and its proliferation activity in an insect cell line

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Main royal jelly protein 1 (MRJP1) is the most abundant member of the main royal jelly protein (MRJP) family among honeybees. Mature MRJP1 cDNA of the Chinese honeybee (Apis cerana cerana MRJP1, or AccMRJP1) was expressed in Pichia pastoris. SDS-PAGE showed that recombinant AccMRJP1 was identical in...

  19. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)


    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  20. Lysyl oxidase-like 2 deaminates lysine 4 in histone H3.


    Herranz, Nicolás; Dave, Natàlia; Millanes-Romero, Alba; Morey, Lluis; Díaz, Víctor M; Lórenz-Fonfría, Víctor; Gutierrez-Gallego, Ricardo; Jerónimo, Celia; Di Croce, Luciano; García de Herreros, Antonio; Peiró, Sandra


    Methylation of lysine 4 (K4) within histone H3 has been linked to active transcription and is removed by LSD1 and the JmjC domain-containing proteins by amino-oxidation or hydroxylation, respectively. Here, we describe the deamination catalyzed by Lysyl oxidase-like 2 protein (LOXL2) as an unconventional chemical mechanism for H3K4 modification. Infrared spectroscopy and mass spectrometry analyses demonstrated that recombinant LOXL2 specifically deaminates trimethylated H3K4. Moreover, LOXL2 activity is linked with the transcriptional control of CDH1 gene by regulating H3K4me3 deamination. These results reveal another H3 modification and provide a different mechanism for H3K4 modification. PMID:22483618

  1. An overview on alcohol oxidases and their potential applications.


    Goswami, Pranab; Chinnadayyala, Soma Sekhar R; Chakraborty, Mitun; Kumar, Adepu Kiran; Kakoti, Ankana


    Alcohol oxidases (Alcohol: O₂ Oxidoreductase; EC 1.1.3.x) are flavoenzymes that catalyze the oxidation of alcohols to the corresponding carbonyl compounds with a concomitant release of hydrogen peroxide. Based on substrate specificity, alcohol oxidases may be categorized broadly into four different groups namely, (a) short chain alcohol oxidase (SCAO), (b) long chain alcohol oxidase (LCAO), (c) aromatic alcohol oxidase (AAO), and (d) secondary alcohol oxidase (SAO). The sources reported for these enzymes are mostly limited to bacteria, yeast, fungi, plant, insect, and mollusks. However, the quantum of reports for each category of enzymes considerably varies across these sources. The enzymes belonging to SCAO and LCAO are intracellular in nature, whereas AAO and SAO are mostly secreted to the medium. SCAO and LCAO are invariably reported as multimeric proteins with very high holoenzyme molecular masses, but the molecular characteristics of these enzymes are yet to be clearly elucidated. One of the striking features of the alcohol oxidases that make them distinct from the widely known alcohol dehydrogenase is the avidly bound cofactor to the redox center of these enzymes that obviate the need to supplement cofactor during the catalytic reaction. These flavin-based redox enzymes have gained enormous importance in the development of various industrial processes and products primarily for developing biosensors and production of various industrially useful carbonyl compounds. The present review provides an overview on alcohol oxidases from different categories focusing research on these oxidases during the last decade along with their potential industrial applications. PMID:23525937

  2. Xanthine oxidase status in ethanol-intoxicated rat liver.


    Abbondanza, A; Battelli, M G; Soffritti, M; Cessi, C


    The status of xanthine oxidase in ethanol-induced liver injury has been investigated in the rat, by acute and chronic ethanol treatments. A 38% increase of the enzyme O-form was observed after repeated ethanol administration. Chronic intoxication caused a significant decrease of total xanthine oxidase activity after both prolonged ethanol feeding and life span ethanol ingestion. The intermediate D/O-form of xanthine oxidase (that can act either as an oxidase or as a dehydrogenase, being able to react with O2 as well as with NAD+ as electron acceptor) increased 5.5-fold after prolonged ethanol feeding. PMID:2690670

  3. Doctors’ knowledge, attitudes, and compliance with 2013 ACC/AHA guidelines for prevention of atherosclerotic cardiovascular disease in Singapore

    PubMed Central

    Setia, Sajita; Fung, Selwyn Sze-Wang; Waters, David D


    Purpose There is an unmet need for strategies to prevent atherosclerotic cardiovascular disease in Singapore. The main objective of this study was to investigate Singapore physicians’ response to the 2013 American College of Cardiology and American Heart Association (ACC/AHA) guidelines for treatment of cholesterol and their impact on clinical practice. Methods This survey was conducted in two stages, qualitative and quantitative. Physicians were initially screened on the basis of an initial screener questionnaire, and eligible physicians were then included in the study. Results Qualitative (n=19) and quantitative (n=66) surveys were completed by eligible physicians from Singapore. Physicians were less familiar with the 2013 ACC/AHA guidelines (35%) as compared with the Singapore Ministry of Health (MoH) lipid guidelines 2006 (49%). Of the physicians whose opinion was sought on the ACC/AHA guidelines, more than 50% disagreed with the definition of high-, moderate-, and low-intensity statin therapy; recommendation of atorvastatin 40–80 mg and rosuvastatin 20–40 mg as medications for high-intensity statin therapy; and classification of individuals who would benefit from moderate- to high-intensity statin therapy. Most physicians assumed that Asians may be intolerant to high-intensity statin therapy. Conclusion Although embracing the 2013 ACC/AHA guidelines in clinical practice is expected to provide better clinical care to patients, our study revealed high reluctance by physicians, especially in the use of high-dose statins. However, ACC/AHA guidelines can be easily adopted in Asia as there is a wealth of data available for atorvastatin in primary and secondary prevention of atherosclerotic cardiovascular disease with similar efficacy and safety profiles in the white and Asian populations. PMID:26082642

  4. Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

    PubMed Central

    Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.


    Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

  5. Effects of wintertime fasting and seasonal adaptation on AMPK and ACC in hypothalamus, adipose tissue and liver of the raccoon dog (Nyctereutes procyonoides).


    Kinnunen, Sanni; Mänttäri, Satu; Herzig, Karl-Heinz; Nieminen, Petteri; Mustonen, Anne-Mari; Saarela, Seppo


    The raccoon dog (Nyctereutes procyonoides) is a canid with autumnal fattening and passive wintering strategy. We examined the effects of wintertime fasting and seasonality on AMP-activated protein kinase (AMPK), a regulator of metabolism, and its target, acetyl-CoA carboxylase (ACC) on the species. Twelve farmed raccoon dogs (eleven females/one male) were divided into two groups: half were fasted for ten weeks in December-March (winter fasted) and the others were fed ad libitum (winter fed). A third group (autumn fed, eight females) was fed ad libitum and sampled in December. Total AMPK, ACC and their phosphorylated forms (pAMPK, pACC) were measured from hypothalamus, liver, intra-abdominal (iWAT) and subcutaneous white adipose tissues (sWAT). The fasted animals lost 32% and the fed 20% of their body mass. Hypothalamic AMPK expression was lower and pACC levels higher in the winter groups compared to the autumn fed group. Liver pAMPK was lower in the winter fasted group, with consistently decreased ACC and pACC. AMPK and pAMPK were down-regulated in sWAT and iWAT of both winter groups, with a parallel decline in pACC in sWAT. The responses of AMPK and ACC to fasting were dissimilar to the effects observed previously in non-seasonal mammals and hibernators. Differences between the winter fed and autumn fed groups indicate that the functions of AMPK and ACC could be regulated in a season-dependent manner. Furthermore, the distinctive effects of prolonged fasting and seasonal adaptation on AMPK-ACC pathway could contribute to the wintering strategy of the raccoon dog. PMID:26603554

  6. Successful treatment of c-kit-positive metastatic Adenoid Cystic Carcinoma (ACC) with a combination of curcumin plus imatinib: A case report.


    Demiray, M; Sahinbas, H; Atahan, S; Demiray, H; Selcuk, D; Yildirim, I; Atayoglu, A T


    Adenoid cystic carcinoma (ACC) is an aggressive malignant neoplasm of the secretory glands. Conventional chemotherapy has poor effectiveness against metastatic ACC. Thus, a novel effective therapy is needed against metastatic ACC. A majority of ACCs (up to 94%) express c-kit. Imatinib is monoclonal antibody with specific activity against c-kit but has not been found to be effective in treating patients with ACC in which c-kit is overexpressed and activated. The NF-κB and mTOR pathways have been shown that ubiquitously and concurrently activated, indicating that the inhibition of these pathways may represent a novel treatment approach for patients with ACC. Curcumin has been shown to inhibit NF-κB and NF-κB-related pathways. 43-year-old patient was diagnosed ACC from submandibular salivary gland. After complete resection of tumor adjuvant radiotherapy was initiated. Seven years later multiple lung metastases were detected and ACC was confirmed by re-biopsy. First-line chemotherapy failed. NF-κB and c-kit were overexpressed in the metastatic specimens. Therefore, we treated the patient with metastatic chemoresistant ACC with imatinib 400mg/day and intravenous curcumin 225mg/m(2) twice a week plus oral bioavailable curcumin Arantal(®) 2×84mg/day. At 24 months, we observed near complete anatomic and complete metabolic response. To our knowledge, this is the first report of a patient with a c-kit-positive ACC that is successfully treated with the combination of imatinib and curcumin in an integrative approach. PMID:27515884

  7. ALTERNATIVE OXIDASE1a modulates the oxidative challenge during moderate Cd exposure in Arabidopsis thaliana leaves.


    Keunen, Els; Schellingen, Kerim; Van Der Straeten, Dominique; Remans, Tony; Colpaert, Jan; Vangronsveld, Jaco; Cuypers, Ann


    This study aims to unravel the functional significance of alternative oxidase1a (AOX1a) induction in Arabidopsis thaliana leaves exposed to cadmium (Cd) by comparing wild-type (WT) plants and aox1a knockout mutants. In the absence of AOX1a, differences in stress-responsive transcript and glutathione levels suggest an increased oxidative challenge during moderate (5 µM) and prolonged (72h) Cd exposure. Nevertheless, aox1a knockout leaves showed lower hydrogen peroxide (H2O2) accumulation as compared to the WT due to both acute (24h) and prolonged (72h) exposure to 5 µM Cd, but not to 10 µM Cd. Taken together, we propose a working model where AOX1a acts early in the response to Cd and activates or maintains a mitochondrial signalling pathway impacting on cellular antioxidative defence at the post-transcriptional level. This fine-tuning pathway is suggested to function during moderate (5 µM) Cd exposure while being overwhelmed during more severe (10 µM) Cd stress. Within this framework, ethylene is required - either directly or indirectly via NADPH oxidase isoform C - to fully induce AOX1 expression. In addition, reciprocal crosstalk between these components was demonstrated in leaves of A. thaliana plants exposed to Cd. PMID:25743159

  8. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.


    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  9. NADPH oxidase promotes neutrophil extracellular trap formation in pulmonary aspergillosis.


    Röhm, Marc; Grimm, Melissa J; D'Auria, Anthony C; Almyroudis, Nikolaos G; Segal, Brahm H; Urban, Constantin F


    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47(phox-/-)) mice which had resolved in wild-type mice by day 5 but progressed in p47(phox-/-) mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47(phox-/-) mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  10. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.


    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  11. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.


    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan


    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  12. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )


    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  13. Effect of contraceptive steroids on monoamine oxidase activity

    PubMed Central

    Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.


    Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

  14. Xanthine oxidase inhibitors from Garcinia esculenta twigs.


    Zhu, Lun-Lun; Fu, Wen-Wei; Watanabe, Shimpei; Shao, Yi-Nuo; Tan, Hong-Sheng; Zhang, Hong; Tan, Chang-Heng; Xiu, Yan-Feng; Norimoto, Hisayoshi; Xu, Hong-Xi


    The EtOAc-soluble portion of the 80 % (v/v) EtOH extract from the twigs of Garcinia esculenta exhibited strong xanthine oxidase inhibition in vitro. Bioassay-guided purification led to the isolation of 1,3,6,7-tetrahydroxyxanthone (3) and griffipavixanthone (8) as the main xanthine oxidase inhibitors, along with six additional compounds (1, 2, 4-7), including two new compounds (1 and 2). This enzyme inhibition was dose dependent with an IC50 value of approximately 1.2 µM for 3 and 6.3 µM for 8. The inhibitory activity of 3 was stronger than the control allopurinol (IC50 value: 5.3 µM). To our knowledge, compound 8 is the first bixanthone that demonstrated potent XO inhibitory activity in vitro. The structures of the new compounds were established by spectroscopic analysis, and the optical properties and absolute stereochemistry of racemic (±) esculentin A (2) were further determined by the calculation of the DP4 probability and analysis of its MTPA ester derivatives. PMID:25340468

  15. Activation of antibacterial autophagy by NADPH oxidases

    PubMed Central

    Huang, Ju; Canadien, Veronica; Lam, Grace Y.; Steinberg, Benjamin E.; Dinauer, Mary C.; Magalhaes, Marco A. O.; Glogauer, Michael; Grinstein, Sergio; Brumell, John H.


    Autophagy plays an important role in immunity to microbial pathogens. The autophagy system can target bacteria in phagosomes, promoting phagosome maturation and preventing pathogen escape into the cytosol. Recently, Toll-like receptor (TLR) signaling from phagosomes was found to initiate their targeting by the autophagy system, but the mechanism by which TLR signaling activates autophagy is unclear. Here we show that autophagy targeting of phagosomes is not exclusive to those containing TLR ligands. Engagement of either TLRs or the Fcγ receptors (FcγRs) during phagocytosis induced recruitment of the autophagy protein LC3 to phagosomes with similar kinetics. Both receptors are known to activate the NOX2 NADPH oxidase, which plays a central role in microbial killing by phagocytes through the generation of reactive oxygen species (ROS). We found that NOX2-generated ROS are necessary for LC3 recruitment to phagosomes. Antibacterial autophagy in human epithelial cells, which do not express NOX2, was also dependent on ROS generation. These data reveal a coupling of oxidative and nonoxidative killing activities of the NOX2 NADPH oxidase in phagocytes through autophagy. Furthermore, our results suggest a general role for members of the NOX family in regulating autophagy. PMID:19339495

  16. Anatomically shaped cranial collimation (ACC) for lateral cephalometric radiography: a technical report.


    Hoogeveen, R C; van der Stelt, P F; Berkhout, W E R


    Lateral cephalograms in orthodontic practice display an area cranial of the base of the skull that is not required for diagnostic evaluation. Attempts have been made to reduce the radiation dose to the patient using collimators combining the shielding of the areas above the base of the skull and below the mandible. These so-called "wedge-shaped" collimators have not become standard equipment in orthodontic offices, possibly because these collimators were not designed for today's combination panoramic-cephalometric imaging systems. It also may be that the anatomical variability of the area below the mandible makes this area unsuitable for standardized collimation. In addition, a wedge-shaped collimator shields the cervical vertebrae; therefore, assessment of skeletal maturation, which is based on the stage of development of the cervical vertebrae, cannot be performed. In this report, we describe our investigations into constructing a collimator to be attached to the cephalostat and shield the cranial area of the skull, while allowing the visualization of diagnostically relevant structures and markedly reducing the size of the irradiated area. The shape of the area shielded by this "anatomically shaped cranial collimator" (ACC) was based on mean measurements of cephalometric landmarks of 100 orthodontic patients. It appeared that this collimator reduced the area of irradiation by almost one-third without interfering with the imaging system or affecting the quality of the image. Further research is needed to validate the clinical efficacy of the collimator. PMID:24170799

  17. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.


    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong


    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts. PMID:26865376

  18. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.


    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  19. Ascorbic acid and L-gulonolactone oxidase in lagomorphs.


    Jenness, R; Birney, E C; Ayaz, K L


    1. The activity of L-gulonolactone oxidase (EC in the liver of eastern cottontail rabbits (Sylvilagus floridanus) is about 10-fold greater in winter than in summer. 2. L-gulonolactone oxidase activity is low and tissue ascorbate high during all seasons in snowshoe hares (Lepus americanus). 3. Liver contents of ascorbate fall to low levels in L. americanus fed on rabbit chow in the laboratory. 4. The activity of L-gulonolactone oxidase in liver of Sylvilagus and Oryctolagus is depressed by feeding high levels of L-ascorbic acid. 5. The New Zealand White breed of domestic rabbit (Oryctolagus cuniculus) has considerably higher levels of L-gulonolactone oxidase and liver ascorbate than does the Dutch breed. 6. In a wild population of Oryctolagus sampled in Australia L-gulonolactone oxidase levels were intermediate between those of the two domestic breeds and more variable than either. PMID:318384

  20. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.


    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N


    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  1. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.


    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  2. 2016 ESC and ACC/AHA/HFSA heart failure guideline update - what is new and why is it important?


    Jessup, Mariell; Marwick, Thomas H; Ponikowski, Piotr; Voors, Adriaan A; Yancy, Clyde W


    Heart failure (HF) is a global epidemic affecting millions of individuals worldwide. Although important progress has been made in the management of HF, this condition remains a common cause of morbidity and death. Since the publication of the previous sets of guidelines for the management of HF, new diagnostic and therapeutic options for HF have emerged. Now, both the ESC and the ACC/AHA/HFSA have simultaneously published an update of their guidelines incorporating, among others, recommendations for the use of new pharmacological therapies for the treatment of HF. For this Viewpoint article, we have asked the chairs of the ESC Task Force, the chairs of the ACC/AHA/HFSA Writing Committee, and an independent opinion leader in the field to offer their expert insight into the new guidelines, highlighting what is new, what the main differences are between the two sets of guidelines, and what steps should be taken to improve the guidelines in future updates. PMID:27625120

  3. A comparison of native GPU computing versus OpenACC for implementing flow-routing algorithms in hydrological applications

    NASA Astrophysics Data System (ADS)

    Rueda, Antonio J.; Noguera, José M.; Luque, Adrián


    In recent years GPU computing has gained wide acceptance as a simple low-cost solution for speeding up computationally expensive processing in many scientific and engineering applications. However, in most cases accelerating a traditional CPU implementation for a GPU is a non-trivial task that requires a thorough refactorization of the code and specific optimizations that depend on the architecture of the device. OpenACC is a promising technology that aims at reducing the effort required to accelerate C/C++/Fortran code on an attached multicore device. Virtually with this technology the CPU code only has to be augmented with a few compiler directives to identify the areas to be accelerated and the way in which data has to be moved between the CPU and GPU. Its potential benefits are multiple: better code readability, less development time, lower risk of errors and less dependency on the underlying architecture and future evolution of the GPU technology. Our aim with this work is to evaluate the pros and cons of using OpenACC against native GPU implementations in computationally expensive hydrological applications, using the classic D8 algorithm of O'Callaghan and Mark for river network extraction as case-study. We implemented the flow accumulation step of this algorithm in CPU, using OpenACC and two different CUDA versions, comparing the length and complexity of the code and its performance with different datasets. We advance that although OpenACC can not match the performance of a CUDA optimized implementation (×3.5 slower in average), it provides a significant performance improvement against a CPU implementation (×2-6) with by far a simpler code and less implementation effort.

  4. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488.


    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar


    Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  5. Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488

    PubMed Central

    Dixit, Ritu; Agrawal, Lalit; Gupta, Swati; Kumar, Manoj; Yadav, Sumit; Chauhan, Puneet Singh; Nautiyal, Chandra Shekhar


    abstract Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed. PMID:26825539

  6. Alternative oxidase involvement in Daucus carota somatic embryogenesis.


    Frederico, António Miguel; Campos, Maria Doroteia; Cardoso, Hélia Guerra; Imani, Jafargholi; Arnholdt-Schmitt, Birgit


    Plant alternative oxidase (AOX) is a mitochondrial inner membrane enzyme involved in alternative respiration. The critical importance of the enzyme during acclimation upon stress of plant cells is not fully understood and is still an issue of intensive research and discussion. Recently, a role of AOX was suggested for the ability of plant cells to change easily its fate upon stress. In order to get new insights about AOX involvement in cell reprogramming, quantitative real-time polymerase chain reaction (PCR) and inhibitor studies were performed during cell redifferentiation and developmental stages of Daucus carota L. somatic embryogenesis. Transcript level analysis shows that D. carota AOX genes (DcAOX1a and DcAOX2a) are differentially expressed during somatic embryogenesis. DcAOX1a shows lower expression levels, being mainly down-regulated, whereas DcAOX2a presented a large up-regulation during initiation of the realization phase of somatic embryogenesis. However, when globular embryos start to develop, both genes are down-regulated, being this state transient for DcAOX2a. In addition, parallel studies were performed using salicylhydroxamic acid (SHAM) in order to inhibit AOX activity during the realization phase of somatic embryogenesis. Embryogenic cells growing in the presence of the inhibitor were unable to develop embryogenic structures and its growth rate was diminished. This effect was reversible and concentration dependent. The results obtained contribute to the hypothesis that AOX activity supports metabolic reorganization as an essential part of cell reprogramming and, thus, enables restructuring and de novo cell differentiation. PMID:19863756

  7. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre


    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  8. Reduced AMPK-ACC and mTOR signaling in muscle from older men, and effect of resistance exercise.


    Li, Mengyao; Verdijk, Lex B; Sakamoto, Kei; Ely, Brian; van Loon, Luc J C; Musi, Nicolas


    AMP-activated protein kinase (AMPK) is a key energy-sensitive enzyme that controls numerous metabolic and cellular processes. Mammalian target of rapamycin (mTOR) is another energy/nutrient-sensitive kinase that controls protein synthesis and cell growth. In this study we determined whether older versus younger men have alterations in the AMPK and mTOR pathways in skeletal muscle, and examined the effect of a long term resistance type exercise training program on these signaling intermediaries. Older men had decreased AMPKα2 activity and lower phosphorylation of AMPK and its downstream signaling substrate acetyl-CoA carboxylase (ACC). mTOR phosphylation also was reduced in muscle from older men. Exercise training increased AMPKα1 activity in older men, however, AMPKα2 activity, and the phosphorylation of AMPK, ACC and mTOR, were not affected. In conclusion, older men have alterations in the AMPK-ACC and mTOR pathways in muscle. In addition, prolonged resistance type exercise training induces an isoform-selective up regulation of AMPK activity. PMID:23000302

  9. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.


    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li


    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors. PMID:27409598

  10. NADPH Oxidases in Chronic Liver Diseases

    PubMed Central

    Jiang, Joy X.; Török, Natalie J.


    Oxidative stress is a common feature observed in a wide spectrum of chronic liver diseases including viral hepatitis, alcoholic, and nonalcoholic steatohepatitis. The nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs) are emerging as major sources of reactive oxygen species (ROS). Several major isoforms are expressed in the liver, including NOX1, NOX2, and NOX4. While the phagocytic NOX2 has been known to play an important role in Kupffer cell and neutrophil phagocytic activity and inflammation, the nonphagocytic NOX homologues are increasingly recognized as key enzymes in oxidative injury and wound healing. In this review, we will summarize the current advances in knowledge on the regulatory pathways of NOX activation, their cellular distribution, and their role in the modulation of redox signaling in liver diseases. PMID:26436133

  11. Degradation of pentachlorophenol by potato polyphenol oxidase.


    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu


    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  12. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.


    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  13. Drugs related to monoamine oxidase activity.


    Fišar, Zdeněk


    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions. PMID:26944656

  14. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie


    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  15. Modeling dioxygen reduction at multicopper oxidase cathodes.


    Agbo, Peter; Heath, James R; Gray, Harry B


    We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate. PMID:25188422

  16. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  17. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.


    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu


    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25061821

  18. Lysyl oxidase binds transforming growth factor-beta and regulates its signaling via amine oxidase activity.


    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Kaku, Masaru; Fong, Keith S K; Csiszar, Katalin; Yamauchi, Mitsuo


    Lysyl oxidase (LOX), an amine oxidase critical for the initiation of collagen and elastin cross-linking, has recently been shown to regulate cellular activities possibly by modulating the functions of growth factors. In this study, we investigated the interaction between LOX and transforming growth factor-beta1 (TGF-beta1), a potent growth factor abundant in bone, the effect of LOX on TGF-beta1 signaling, and its potential mechanism. The specific binding between mature LOX and mature TGF-beta1 was demonstrated by immunoprecipitation and glutathione S-transferase pulldown assay in vitro. Both proteins were colocalized in the extracellular matrix in an osteoblastic cell culture system, and the binding complex was identified in the mineral-associated fraction of bone matrix. Furthermore, LOX suppressed TGF-beta1-induced Smad3 phosphorylation likely through its amine oxidase activity. The data indicate that LOX binds to mature TGF-beta1 and enzymatically regulates its signaling in bone and thus may play an important role in bone maintenance and remodeling. PMID:18835815

  19. Circumpolar Estimates of Isopycnal Mixing in the ACC from Argo Floats

    NASA Astrophysics Data System (ADS)

    Roach, C. J.; Balwada, D.; Speer, K. G.


    There are few direct observations of cross-stream isopycnal mixing in the interior of the Southern Ocean, yet such measurements are needed to determine the role of eddies transporting properties across the ACC, and key to progress toward testing theories of meridional overturning. In light of this we examine if it is possible to obtain estimates of mixing from Argo float trajectories. We divided the Southern Ocean into overlapping 15ο longitude bins before estimating mixing. Resulting diffusivities ranged from 300 to 3000 m2s-1, with peaks corresponding to the Scotia Sea; Kerguelen and Campbell Plateaus. Comparison of our diffusivities with previous regional studies demonstrated good agreement. Tests of the methodology in the DIMES region found that mixing from Argo floats agreed closely with mixing from RAFOS floats. To further test the method we used the Southern Ocean State Estimate velocity fields to advect particles with Argo and RAFOS float like behaviours. Stirring estimates from the particles agreed well with each other in the Kerguelen Island region, South Pacific and Scotia Sea, despite the differences in the imposed behaviour. Finally, these estimates were compared to mixing length suppression theory presented in Ferrari and Nikurashin 2010. This mixing length suppression theory quantifies horizontal diffusivity similar to Prandtl (1925), but the mixing length is suppressed in the presence of mean flows and eddy phase speeds. Our results suggest that the theory can explain both the structure and magnitude of mixing using mean flow data. An exception is near the Kerguelen and Campbell Plateaus where theory under-estimates mixing relative to our results.

  20. Phagocyte NADPH oxidase and specific immunity.


    Cachat, Julien; Deffert, Christine; Hugues, Stephanie; Krause, Karl-Heinz


    The phagocyte NADPH oxidase NOX2 produces reactive oxygen species (ROS) and is a well-known player in host defence. However, there is also increasing evidence for a regulatory role of NOX2 in adaptive immunity. Deficiency in phagocyte NADPH oxidase causes chronic granulomatous disease (CGD) in humans, a condition that can also be studied in CGD mice. Clinical observations in CGD patients suggest a higher susceptibility to autoimmune diseases, in particular lupus, idiopathic thrombocytopenic purpura and rheumatoid arthritis. In mice, a strong correlation exists between a polymorphism in a NOX2 subunit and the development of autoimmune arthritis. NOX2 deficiency in mice also favours lupus development. Both CGD patients and CGD mice exhibit increased levels of immunoglobulins, including autoantibodies. Despite these phenotypes suggesting a role for NOX2 in specific immunity, mechanistic explanations for the typical increase of CGD in autoimmune disease and antibody levels are still preliminary. NOX2-dependent ROS generation is well documented for dendritic cells and B-lymphocytes. It is unclear whether T-lymphocytes produce ROS themselves or whether they are exposed to ROS derived from dendritic cells during the process of antigen presentation. ROS are signalling molecules in virtually any cell type, including T- and B-lymphocytes. However, knowledge about the impact of ROS-dependent signalling on T- and B-lymphocyte phenotype and response is still limited. ROS might contribute to Th1/Th2/Th17 cell fate decisions during T-lymphocyte activation and might enhance immunoglobulin production by B-lymphocytes. In dendritic cells, NOX2-derived ROS might be important for antigen processing and cell activation. PMID:25760962

  1. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio


    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  2. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.


    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof


    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

  3. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.


    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  4. Boosting transcription by transcription: enhancer-associated transcripts.


    Darrow, Emily M; Chadwick, Brian P


    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  5. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D


    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  6. Direct observations of the ACC transport across the Kerguelen Plateau from the 2009-2010 TRACK cruises

    NASA Astrophysics Data System (ADS)

    Hyang Park, Young; Vivier, Frédéric; Roquet, Fabien; Kestenare, Elodie; Sekma, Hela; Durand, Isabelle


    The Kerguelen Plateau is considered as a major barrier to the eastward flowing Antarctic Circumpolar Current (ACC), diverting about 2/3 of its transport to the north of the plateau and the remaining transport across the vast plateau developed between the Kerguelen Islands and Antarctica. However, due to the lack of systematic high-quality observations especially across the Fawn Trough, our knowledge of ACC branches and associated transports across the Kerguelen Plateau has been largely indirect and debated, with previous transport estimates ranging from 30 to 100 Sv. In order to fill this knowledge gap, we undertook full-depth CTD and LADCP measurements in the Fawn Trough area and moored three lines of a total of 9 current-meters across the Fawn Trough in February-March 2009 during the TRACK-1 cruise. The TRACK-1 data have permitted us to document for the first time a detailed vertical current structure especially across the Fawn Trough as well as the Deep Western Boundary Current (DWBC) on the eastern flank of the Kerguelen Plateau at 58°S. The Fawn Trough Current appears as a principal across-plateau jet associated with the Southern ACC Front, concentrating the majority (43 Sv) of the eastward transport passing to the south of the Kerguelen Islands (58 Sv), compared to ~92 Sv at the Subantarctic Front as estimated previously to the north of the islands. This yields a total transport of ~150 Sv for the ACC transiting through the Kerguelen longitude, consistent with other independent estimates in the other sectors of the Southern Ocean, but with an up-to-date partition of ~60% of the transport passing to the north of the Kerguelen Plateau and ~40% across the plateau. The DWBC transport at 58°S is estimated as 43 Sv, of which 36 Sv come from the northward turning of the westward flowing Antarctic Slope Current and the rest (7 Sv) originates from the southernmost branch of the ACC passing through the northern Princess Elizabeth Trough. Two other transport branches

  7. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin


    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  8. The terminal oxidase in the marine bacterium Pseudomonas nautica 617.


    Simpson, H; Denis, M; Malatesta, F


    The molecular properties of a novel membrane quinol oxidase from the marine bacterium Pseudomonas nautica 617 are presented. The protein contains 2b hemes/mole which may be distinguished by EPR spectroscopy but not by optical spectroscopy and electrochemistry. Respiration, though being cyanide insensitive, is not inhibited by carbon monoxide and oxygen reduction is carried out only half-way with production of hydrogen peroxide. The terminal oxidase represents, therefore, a unique example in the large family of terminal oxidases known up to date. PMID:9337488

  9. Identification of yeasts from clinical specimens by oxidase test.


    Kumar, S; Arora, B S; Mathur, M D


    A total of 100 yeasts and yeast like fungi isolates from clinical specimens were negative for oxidase production on Sabouraud dextrose agar. When grown on Columbia agar, chocolate agar, tryptose agar, Mueller-Hinton agar, brain heart infusion and a medium resembling Sabouraud's dextrose agar but with starch instead of dextrose, all the isolate of Candida albicans (55), C. guilliermondii (6), C. parapsilosis (14), C. tropicalis (6), C. pseudotropicalis (6) and Crytococcus neoformans (2) were positive for oxidase producation. Torulopsis glabrata (2), Saccharomyces cervisiae (2) and two out of seven isolates of C. krusei were negative for oxidase test. PMID:11344606

  10. Aiding and abetting roles of NOX oxidases in cellular transformation

    PubMed Central

    Block, Karen; Gorin, Yves


    NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415

  11. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina


    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  12. Cardiac-specific deletion of acetyl CoA carboxylase 2 (ACC2) prevents metabolic remodeling during pressure-overload hypertrophy

    PubMed Central

    Kolwicz, Stephen C.; Olson, David P.; Marney, Luke C.; Garcia-Menendez, Lorena; Synovec, Robert E.; Tian, Rong


    Rationale Decreased fatty acid oxidation (FAO) with increased reliance on glucose are hallmarks of metabolic remodeling that occurs in pathological cardiac hypertrophy and is associated with decreased myocardial energetics and impaired cardiac function. To date, it has not been tested whether prevention of the metabolic switch that occurs during the development of cardiac hypertrophy has unequivocal benefits on cardiac function and energetics. Objectives Since malonyl CoA production via acetyl CoA carboxylase 2 (ACC2) inhibits mitochondrial fatty acid transport, we hypothesized that mice with a cardiac-specific deletion of ACC2 (ACC2H−/−) would maintain cardiac fatty acid oxidation (FAO) and improve function and energetics during the development of pressure-overload hypertrophy. Methods and Results ACC2 deletion led to a significant reduction in cardiac malonyl CoA levels. In isolated perfused heart experiments, left ventricular (LV) function and oxygen consumption were similiar in ACC2H−/− mice despite an ~60% increase in FAO compared to controls (CON). After 8 weeks of pressure-overload via transverse aortic constriction (TAC), ACC2H−/− mice exhibited a substrate utilization profile similar to sham animals while CON-TAC hearts had decreased FAO with increased glycolysis and anaplerosis. Myocardial energetics, assessed by 31P NMR spectroscopy, and cardiac function were maintained in ACC2H−/− after 8 weeks of TAC. Furthermore, ACC2H−/−-TAC demonstrated an attenuation of cardiac hypertrophy with a significant reduction in fibrosis relative to CON-TAC. Conclusions These data suggest that reversion to the fetal metabolic profile in chronic pathological hypertrophy is associated with impaired myocardial function and energetics and maintenance of the inherent cardiac metabolic profile and mitochondrial oxidative capacity is a viable therapeutic strategy. PMID:22730442

  13. Characterization of ethylene biosynthesis associated with ripening in banana fruit.


    Liu, X; Shiomi, S; Nakatsuka, A; Kubo, Y; Nakamura, R; Inaba, A


    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  14. Characterization of Ethylene Biosynthesis Associated with Ripening in Banana Fruit1

    PubMed Central

    Liu, Xuejun; Shiomi, Shinjiro; Nakatsuka, Akira; Kubo, Yasutaka; Nakamura, Reinosuke; Inaba, Akitsugu


    We investigated the characteristics of ethylene biosynthesis associated with ripening in banana (Musa sp. [AAA group, Cavendish subgroup] cv Grand Nain) fruit. MA-ACS1 encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase in banana fruit was the gene related to the ripening process and was inducible by exogenous ethylene. At the onset of the climacteric period in naturally ripened fruit, ethylene production increased greatly, with a sharp peak concomitant with an increase in the accumulation of MA-ACS1 mRNA, and then decreased rapidly. At the onset of ripening, the in vivo ACC oxidase activity was enhanced greatly, followed by an immediate and rapid decrease. Expression of the MA-ACO1 gene encoding banana ACC oxidase was detectable at the preclimacteric stage, increased when ripening commenced, and then remained high throughout the later ripening stage despite of a rapid reduction in the ACC oxidase activity. This discrepancy between enzyme activity and gene expression of ACC oxidase could be, at least in part, due to reduced contents of ascorbate and iron, cofactors for the enzyme, during ripening. Addition of these cofactors to the incubation medium greatly stimulated the in vivo ACC oxidase activity during late ripening stages. The results suggest that ethylene production in banana fruit is regulated by transcription of MA-ACS1 until climacteric rise and by reduction of ACC oxidase activity possibly through limited in situ availability of its cofactors once ripening has commenced, which in turn characterizes the sharp peak of ethylene production. PMID:10594112

  15. Structural Evidence for Direct Interactions Between the BRCT Domains of Human BRCA1 and a Phospho-Peptide from Human ACC1

    SciTech Connect

    Shen,Y.; Tong, L.


    The tandem BRCA1 C-terminal (BRCT) domains are phospho-serine/threonine recognition modules essential for the function of BRCA1. Recent studies suggest that acetyl-CoA carboxylase 1 (ACC1), an enzyme with crucial roles in de novo fatty acid biosynthesis and lipogenesis and essential for cancer cell survival, may be a novel binding partner for BRCA1, through interactions with its BRCT domains. We report here the crystal structure at 3.2 Angstroms resolution of human BRCA1 BRCT domains in complex with a phospho-peptide from human ACC1 (p-ACC1 peptide, with the sequence 1258-DSPPQ-pS-PTFPEAGH-1271), which provides molecular evidence for direct interactions between BRCA1 and ACC1. The p-ACC1 peptide is bound in an extended conformation, located in a groove between the tandem BRCT domains. There are recognizable and significant structural differences to the binding modes of two other phospho-peptides to these domains, from BACH1 and CtIP, even though they share a conserved pSer-Pro-(Thr/Val)-Phe motif. Our studies establish a framework for understanding the regulation of lipid biosynthesis by BRCA1 through its inhibition of ACC1 activity, which could be a novel tumor suppressor function of BRCA1.

  16. Cloning, expression patterns, and preliminary characterization of AccCPR24, a novel RR-1 type cuticle protein gene from Apis cerana cerana.


    Chu, Xiaoqian; Lu, Wenjing; Zhang, Yuanying; Guo, Xingqi; Sun, Rujiang; Xu, Baohua


    Cuticular proteins (CPs) are key components of insect cuticle, a structure that plays a pivotal role in insect development and defense. In this study, we cloned the full-length cDNA of a CP gene from Apis cerana cerana (AccCPR24). An amino acid sequence alignment indicated that AccCPR24 contains the conserved Rebers and Riddiford consensus sequence and shares high similarity with the genes from other hymenopteran insects. We then isolated the genomic DNA and found that the first intron, which is present in other CP genes, is absent in AccCPR24. Real-time quantitative polymerase chain reaction (qPCR) analysis revealed that AccCPR24 is highly expressed in the late pupal stage and midgut. Expression was inhibited by an exogenous ecdysteroid in vitro but was enhanced by this hormone in vivo; environmental stressors, such as heavy metals and pesticides, also influenced gene expression. In addition, a disc diffusion assay showed that AccCPR24 enhanced the ability of bacterial cells to resist multiple stresses. We infer from our results that AccCPR24 acts in honeybee development and in protecting these insects from abiotic stresses. PMID:24115354

  17. A novel 1-Cys thioredoxin peroxidase gene in Apis cerana cerana: characterization of AccTpx4 and its role in oxidative stresses.


    Huaxia, Yifeng; Wang, Fang; Yan, Yan; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua


    Thioredoxin peroxidase (Tpx), also named peroxiredoxin (Prx), is an important peroxidase that can protect organisms against stressful environments. AccTpx4, a 1-Cys thioredoxin peroxidase gene from the Chinese honey bee Apis cerana cerana, was cloned and characterized. The AccTpx4 gene encodes a protein that is predicted to contain the conserved PVCTTE motif from 1-Cys peroxiredoxin. Quantitative real-time PCR (Q-PCR) and Western blotting revealed that AccTpx4 was induced by various oxidative stresses, such as cold, heat, insecticides, H(2)O(2), and HgCl(2). The in vivo peroxidase activity assay showed that recombinant AccTpx4 protein could efficiently degrade H(2)O(2) in the presence of DL-dithiothreitol (DTT). In addition, disc fusion assays revealed that AccTpx4 could function to protect cells against oxidative stresses. These results indicate that AccTpx4 plays an important role in oxidative stress responses and may contribute to the conservation of honeybees. PMID:25971604

  18. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.


    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire


    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  19. Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

    PubMed Central

    Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.


    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host. PMID:23844180

  20. The NADPH oxidase inhibitor apocynin induces nitric oxide synthesis via oxidative stress

    SciTech Connect

    Riganti, Chiara


    We have recently shown that apocynin elicits an oxidative stress in N11 mouse glial cells and other cell types. Here we report that apocynin increased the accumulation of nitrite, the stable derivative of nitric oxide (NO), in the extracellular medium of N11 cell cultures, and the NO synthase (NOS) activity in cell lysates. The increased synthesis of NO was associated with increased expression of inducible NOS (iNOS) mRNA, increased nuclear translocation of the redox-sensitive transcription factor NF-{kappa}B and decreased intracellular level of its inhibitor IkB{alpha}. These effects, accompanied by increased production of H{sub 2}O{sub 2}, were very similar to those observed after incubation with bacterial lipopolysaccharide (LPS) and were inhibited by catalase. These results suggest that apocynin, similarly to LPS, induces increased NO synthesis by eliciting a generation of reactive oxygen species (ROS), which in turn causes NF-{kappa}B activation and increased expression of iNOS. Therefore, the increased bioavailability of NO reported in the literature after in vivo or in vitro treatments with apocynin might depend, at least partly, on the drug-elicited induction of iNOS, and not only on the inhibition of NADPH oxidase and the subsequent decreased scavenging of NO by oxidase-derived ROS, as it is often supposed.

  1. Quinone compounds regulate the level of ROS production by the NADPH oxidase Nox4.


    Nguyen, Minh Vu Chuong; Lardy, Bernard; Rousset, Francis; Hazane-Puch, Florence; Zhang, Leilei; Trocmé, Candice; Serrander, Lena; Krause, Karl-Heinz; Morel, Françoise


    NADPH oxidase Nox4 is expressed in a wide range of tissues and plays a role in cellular signaling by providing reactive oxygen species (ROS) as intracellular messengers. Nox4 oxidase activity is thought to be constitutive and regulated at the transcriptional level; however, we challenge this point of view and suggest that specific quinone derivatives could modulate this activity. In fact, we demonstrated a significant stimulation of Nox4 activity by 4 quinone derivatives (AA-861, tBuBHQ, tBuBQ, and duroquinone) observed in 3 different cellular models, HEK293E, T-REx™, and chondrocyte cell lines. Our results indicate that the effect is specific toward Nox4 versus Nox2. Furthermore, we showed that NAD(P)H:quinone oxidoreductase (NQO1) may participate in this stimulation. Interestingly, Nox4 activity is also stimulated by reducing agents that possibly act by reducing the disulfide bridge (Cys226, Cys270) located in the extracellular E-loop of Nox4. Such model of Nox4 activity regulation could provide new insight into the understanding of the molecular mechanism of the electron transfer through the enzyme, i.e., its potential redox regulation, and could also define new therapeutic targets in diseases in which quinones and Nox4 are implicated. PMID:23583257

  2. Isolation and analysis of a cDNA clone encoding an S. guttatum alternataive oxidase protein

    SciTech Connect

    Rhoads, D.M.; McIntosh, L. Michigan State Univ., East Lansing )


    Antibodies that recognize the 35, 36, and 37 kilodalton (kDa) alternative oxidase proteins were used to isolate a cDNA proteins were used to isolate a cDNA clone of a nuclearly encoded protein of Sauromatum guttatum. The amino acid sequence deduced from clone pAOSG81 revealed a protein with a predicted molecular mass of 44 kDa, while a 42 kDa protein is immunoprecipitated from in vitro translation products made using S. guttatum poly A+ RNA. The protein contains a 60-65 amino acid transit peptide which is predicted to form amphiphilic helices. We have also identified regions of the mature 42 kDa protein which are likely to be membrane associated. Clone pAOSG81 is being used to screen a genomic library. The genomic clone encoding the 42 kDa protein will be used to investigate the salicylic-acid-controlled transcriptional regulation of the S. guttatum alternative oxidase proteins.

  3. NADPH oxidase mediates glucolipotoxicity-induced beta cell dysfunction--clinical implications.


    McCarty, Mark F; Barroso-Aranda, Jorge; Contreras, Francisco


    An impairment of glucose-stimulated insulin secretion--reflecting decreased glucokinase expression--and a moderate decrease in beta cell mass attributable to increased apoptosis, constitute the key features of beta cell failure in type 2 diabetes. Oxidative stress, provoked by prolonged exposure to excessive levels of glucose and/or fatty acids (glucolipotoxicity), appears to be a key mediator of these defects. Oxidant-provoked JNK activation induces nuclear export of the PDX-1 transcription factor, required for expression of glucokinase and other beta cell proteins. Conversely, increases in cAMP induced by incretin hormones promote the nuclear importation of PDX-1, counteracting the diabetogenic impact of oxidant stress; this may explain the utility of measures that slow dietary carbohydrate absorption for diabetes prevention. The ability of oxidative stress to boost apoptosis in beta cells is poorly understood, but may also entail JNK activation. Recent work establishes a phagocyte-type NADPH oxidase as the chief source of glucotoxicity-mediated oxidative stress in beta cells. Since bilirubin is now known to function physiologically as an inhibitor of NADPH oxidase, and phycocyanobilin (PCB) derived from spirulina likewise can inhibit this enzyme complex, supplemental PCB may have utility in the prevention and control of diabetes, and Gilbert syndrome, associated with chronically elevated free bilirubin, may be associated with decreased diabetes risk. PMID:19576699

  4. Alternative oxidase: a respiratory electron transport chain pathway essential for maintaining photosynthetic performance during drought stress.


    Vanlerberghe, Greg C; Martyn, Greg D; Dahal, Keshav


    Photosynthesis and respiration are the hubs of energy metabolism in plants. Drought strongly perturbs photosynthesis as a result of both diffusive limitations resulting from stomatal closure, and in some cases biochemical limitations that are associated with a reduced abundance of key photosynthetic components. The effects of drought on respiration, particularly respiration in the light (RL ), are less understood. The plant mitochondrial electron transport chain includes a non-energy conserving terminal oxidase called alternative oxidase (AOX). Several studies have shown that drought increases AOX transcript, protein and maximum capacity. Here we review recent studies comparing wild-type (WT) tobacco to transgenic lines with altered AOX protein amount. Specifically during drought, RL was compromised in AOX knockdown plants and enhanced in AOX overexpression plants, compared with WT. Significantly, these differences in RL were accompanied by dramatic differences in photosynthetic performance. Knockdown of AOX increased the susceptibility of photosynthesis to drought-induced biochemical limitations, while overexpression of AOX delayed the development of such biochemical limitations, compared with WT. Overall, the results indicate that AOX is essential to maintaining RL during drought, and that this non-energy conserving respiration maintains photosynthesis during drought by promoting energy balance in the chloroplast. This review also outlines several areas for future research, including the possibility that enhancement of non-energy conserving respiratory electron sinks may be a useful biotechnological approach to increase plant performance during stress. PMID:27080742

  5. Molecular cloning and functional characterization of a putative sulfite oxidase (SO) ortholog from Nicotiana benthamiana.


    Xia, Zongliang; Su, Xinhong; Wu, Jianyu; Wu, Ke; Zhang, Hua


    Sulfite oxidase (SO) catalyzes the oxidation of sulfite to sulfate and thus has important roles in diverse metabolic processes. However, systematic molecular and functional investigations on the putative SO from tobacco (Nicotiana benthamiana) have hitherto not been reported. In this work, a full-length cDNA encoding putative sulfite oxidase from N. benthamiana (NbSO) was isolated. The deduced NbSO protein shares high homology and typical structural features with other species SOs. Phylogenetic analysis indicates that NbSO cDNA clone encodes a tobacco SO isoform. Southern blot analysis suggests that NbSO is a single-copy gene in the N. benthamiana genome. The NbSO transcript levels were higher in aerial tissues and were up-regulated in N. benthamiana during sulfite stress. Reducing the SO expression levels through virus-induced gene silencing caused a substantial accumulation in sulfite content and less sulfate accumulation in N. benthamiana leaves when exposed to sulfite stress, and thus resulted in decreased tolerance to sulfite stress. Taken together, this study improves our understanding on the molecular and functional properties of plant SO and provides genetic evidence on the involvement of SO in sulfite detoxification in a sulfite-oxidizing manner in N. benthamiana plants. PMID:21667106

  6. Leishmania major possesses a unique HemG-type protoporphyrinogen IX oxidase

    PubMed Central

    Zwerschke, Dagmar; Karrie, Simone; Jahn, Dieter; Jahn, Martina


    Leishmania major was proposed to either utilize haem from its host or partially synthesize the tetrapyrrole from host provided precursors. However, only indirect evidence was available for this partial late haem biosynthetic pathway. Here, we demonstrate that the LMJF_06_1280 gene of L. major encodes a HemG-type PPO (protoporphyrinogen IX oxidase) catalysing the oxidation of protoporphyrinogen IX to protoporphyrin IX. Interestingly, trypanosomatids are currently the only known eukaryotes possessing HemG-type enzymes. The LMJF_06_1280 gene forms a potential transcriptional unit with LMJF_06_1270 encoding CPO (coproporphyrinogen III oxidase) and with LMJF_06_1290 for a cytochrome b5. In vivo function of the L. major hemG gene was shown by the functional complementation of the Escherichia coli ΔhemG strain LG285. Restored haem formation in E. coli was observed using HPLC analyses. Purified recombinant L. major HemG revealed PPO activity in vitro using different ubiquinones and triphenyltetrazolium as electron acceptors. FMN was identified as the L. major HemG cofactor. Active site residues were found to be essential for HemG catalysis. These data in combination with the solved crystal structures of L. major CPO and the physiological proof of a ferrochelatase activity provide clear-cut evidence for a partial haem biosynthetic pathway in L. major. PMID:24962471

  7. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.


    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  8. Inhibition of plant and mammalian diamine oxidase by substrate analogues.


    Biegański, T; Osińska, Z; Masliński, C


    Imidazoles, aliphatic substrate analogues and the natural dipeptides, carnosine and anserine, were investigated as inhibitors of diamine oxidase from the pig kidney, human pregnancy plasma and pea seedlings. Imidazole, methylimidazoles, N-acetylimidazole, histamine and N tau-methylhistamine are relatively potent inhibitors of mammalian diamine oxidase showing no influence on plant enzymes. Anserine and carnosine are inhibitors of pig kidney and pea seedling enzymes. Ki values are 2 microM and 10 microM respectively. Investigated natural derivatives of putrescine and cadaverine have no influence on diamine oxidase of different origin. In conclusion, we present some evidence to suggest that mammalian diamine oxidase, despite a high reaction rate with putrescine, is better adapted to histamine oxidation, whereas for plant enzymes the diamines are preferred substrates. PMID:6805264

  9. [Heterogeneity of molecular forms of phenol oxidase from grape leaves].


    Pruidze, G N; Zaprometov, M N; Durmishidze, S V; Kintsurashvili, D F


    The substrate specificity and some kinetic properties of the monomeric (Mr = 26 000--35 000) and dimeric (Mr = 55 000--70 000) forms of phenol oxidase from vine leaves were studied. These forms possess different hydroxylating and o-diphenol oxidase activities. A kinetic analysis demonstrated that the monomeric form of the enzyme possesses a higher affinity for monophenols and can more effectively accomplish the hydroxylation reaction as compared to the dimeric one. During vine vegetation the ratio of molecular forms of phenol oxidase is altered manifesting itself in quantitative and qualitative changes of enzymatic activity. During plant maturation the dimeric fraction is predominant. The maturation process is associated with a sharp rise of the o-phenol oxidase activity, a disappearance of the hydroxylating activity and a substantial deceleration of phenol compounds production. PMID:6412775

  10. Austrian Carbon Calculator (ACC) - modelling soil carbon dynamics in Austrian soils

    NASA Astrophysics Data System (ADS)

    Sedy, Katrin; Freudenschuss, Alexandra; Zethner, Gehard; Spiegel, Heide; Franko, Uwe; Gründling, Ralf; Xaver Hölzl, Franz; Preinstorfer, Claudia; Haslmayr, Hans Peter; Formayer, Herbert


    Austrian Carbon Calculator (ACC) - modelling soil carbon dynamics in Austrian soils. The project funded by the Klima- und Energiefonds, Austrian Climate Research Programme, 4th call Authors: Katrin Sedy, Alexandra Freudenschuss, Gerhard Zethner (Environment Agency Austria), Heide Spiegel (Austrian Agency for Health and Food Safety), Uwe Franko, Ralf Gründling (Helmholtz Centre for Environmental Research) Climate change will affect plant productivity due to weather extremes. However, adverse effects could be diminished and satisfying production levels may be maintained with proper soil conditions. To sustain and optimize the potential of agricultural land for plant productivity it will be necessary to focus on preserving and increasing soil organic carbon (SOC). Carbon sequestration in agricultural soils is strongly influenced by management practice. The present management is affected by management practices that tend to speed up carbon loss. Crop rotation, soil cultivation and the management of crop residues are very important measures to influence carbon dynamics and soil fertility. For the future it will be crucial to focus on practical measures to optimize SOC and to improve soil structure. To predict SOC turnover the existing humus balance model the application of the "Carbon Candy Balance" was verified by results from Austrian long term field experiments and field data of selected farms. Thus the main aim of the project is to generate a carbon balancing tool box that can be applied in different agricultural production regions to assess humus dynamics due to agricultural management practices. The toolbox will allow the selection of specific regional input parameters for calculating the C-balance at field level. However farmers or other interested user can also apply their own field data to receive the result of C-dynamics under certain management practises within the next 100 years. At regional level the impact of predefined changes in agricultural management

  11. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)


    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  12. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera

    PubMed Central

    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  13. Multicopper oxidase-1 is required for iron homeostasis in Malpighian tubules of Helicoverpa armigera.


    Liu, Xiaoming; Sun, Chengxian; Liu, Xiaoguang; Yin, Xinming; Wang, Baohai; Du, Mengfang; An, Shiheng


    Multicopper oxidases (MCOs) are enzymes that contain 10 conserved histidine residues and 1 cysteine residue. MCO1 has been extensively investigated in the midgut because this MCO is implicated in ascorbate oxidation, iron homeostasis and immune responses. However, information regarding the action of MCO1 in Malpighian tubules is limited. In this study, Helicoverpa armigera was used as a model to investigate the function of MCO1 in Malpighian tubules. Sequence analysis results revealed that HaMCO1 exhibits typical MCO characteristics, with 10 histidine and 1 cysteine residues for copper ion binding. HaMCO1 was also found to be highly abundant in Malpighian tubules. Temporal expression patterns indicated that HaMCO1 is mainly expressed during larval molting stages. Hormone treatments [the molting hormone 20-hydroxyecdysone (20E) and juvenile hormone (JH)] revealed that 20E inhibits HaMCO1 transcript expression via its heterodimer receptor, which consists of ecdysone receptor (EcR) and ultraspiracle (USP), and that JH counteracts the action of 20E to activate HaMCO1 transcript expression via its intracellular receptor methoprene-tolerant (Met). HaMCO1 knockdown caused a significant decrease in iron accumulation and also significantly reduced transferrin and ferritin transcript expression. Therefore, HaMCO1 is coordinately regulated by 20E and JH and is required for iron homeostasis in Malpighian tubules. PMID:26437857

  14. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    SciTech Connect

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. )


    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

  15. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.


    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D


    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  16. Polyphenol oxidase from hybrid poplar. Cloning and expression in response to wounding and herbivory.


    Constabel, C P; Yip, L; Patton, J J; Christopher, M E


    The inducible expression of polyphenol oxidase (PPO), a presumed antiherbivore enzyme, was examined in hybrid poplar (Populus trichocarpa x Populus deltoides). Following mechanical wounding simulating insect damage, PPO activity increased dramatically in wounded and unwounded leaves on wounded plants beginning at 24 and 48 h, respectively. A hybrid poplar PPO cDNA was isolated and its nucleotide sequence determined. On northern blots, PPO transcripts were detected within 8 h of wounding, and reached peak levels at 16 and 24 h in wounded and unwounded leaves, respectively. Methyl jasmonate spray and feeding by forest tent caterpillar also induced PPO expression. The induction of PPO was strongest in the youngest four leaves, which were generally avoided by caterpillars in free feeding experiments. This wound- and herbivore-induced expression of PPO in hybrid poplar supports the defensive role of this protein against insect pests. PMID:10982443

  17. Biochemistry, Physiology and Pathophysiology of NADPH Oxidases in the Cardiovascular System

    PubMed Central

    Lassègue, Bernard; San Martín, Alejandra; Griendling, Kathy K.


    The NADPH oxidase (Nox) enzymes are critical mediators of cardiovascular physiology and pathophysiology. These proteins are expressed in virtually all cardiovascular cells, and regulate such diverse functions as differentiation, proliferation, apoptosis, senescence, inflammatory responses and oxygen sensing. They target a number of important signaling molecules, including kinases, phosphatases, transcription factors, ion channels and proteins that regulate the cytoskeleton. Nox enzymes have been implicated in many different cardiovascular pathologies: atherosclerosis, hypertension, cardiac hypertrophy and remodeling, angiogenesis and collateral formation, stroke and heart failure. In this review, we discuss in detail the biochemistry of Nox enzymes expressed in the cardiovascular system (Nox1, 2, 4 and 5), their roles in cardiovascular cell biology, and their contributions to disease development. PMID:22581922

  18. Genetic and genomic analysis of Rhizoctonia solani interactions with Arabidopsis; evidence of resistance mediated through NADPH oxidases.


    Foley, Rhonda C; Gleason, Cynthia A; Anderson, Jonathan P; Hamann, Thorsten; Singh, Karam B


    Rhizoctonia solani is an important soil-borne necrotrophic fungal pathogen, with a broad host range and little effective resistance in crop plants. Arabidopsis is resistant to R. solani AG8 but susceptible to R. solani AG2-1. A screen of 36 Arabidopsis ecotypes and mutants affected in the auxin, camalexin, salicylic acid, abscisic acid and ethylene/jasmonic acid pathways did not reveal any variation in response to R. solani and demonstrated that resistance to AG8 was independent of these defense pathways. The Arabidopsis Affymetrix ATH1 Genome array was used to assess global gene expression changes in plants infected with AG8 and AG2-1 at seven days post-infection. While there was considerable overlap in the response, some gene families were differentially affected by AG8 or AG2-1 and included those involved in oxidative stress, cell wall associated proteins, transcription factors and heat shock protein genes. Since a substantial proportion of the gene expression changes were associated with oxidative stress responses, we analysed the role of NADPH oxidases in resistance. While single NADPH oxidase mutants had no effect, a NADPH oxidase double mutant atrbohf atrbohd resulted in an almost complete loss of resistance to AG8, suggesting that reactive oxidative species play an important role in Arabidopsis's resistance to R. solani. PMID:23451091

  19. Aspirin suppresses cardiac fibroblast proliferation and collagen formation through downregulation of angiotensin type 1 receptor transcription

    SciTech Connect

    Wang, Xianwei Lu, Jingjun; Khaidakov, Magomed; Mitra, Sona; Ding, Zufeng; Raina, Sameer; Goyal, Tanu; Mehta, Jawahar L.


    Aspirin (acetyl salicylic acid, ASA) is a common drug used for its analgesic and antipyretic effects. Recent studies show that ASA not only blocks cyclooxygenase, but also inhibits NADPH oxidase and resultant reactive oxygen species (ROS) generation, a pathway that underlies pathogenesis of several ailments, including hypertension and tissue remodeling after injury. In these disease states, angiotensin II (Ang II) activates NADPH oxidase via its type 1 receptor (AT1R) and leads to fibroblast growth and collagen synthesis. In this study, we examined if ASA would inhibit NADPH oxidase activation, upregulation of AT1R transcription, and subsequent collagen generation in mouse cardiac fibroblasts challenged with Ang II. Mouse heart fibroblasts were isolated and treated with Ang II with or without ASA. As expected, Ang II induced AT1R expression, and stimulated cardiac fibroblast growth and collagen synthesis. The AT1R blocker losartan attenuated these effects of Ang II. Similarly to losartan, ASA, and its SA moiety suppressed Ang II-mediated AT1R transcription and fibroblast proliferation as well as expression of collagens and MMPs. ASA also suppressed the expression of NADPH oxidase subunits (p22{sup phox}, p47{sup phox}, p67{sup phox}, NOX2 and NOX4) and ROS generation. ASA did not affect total NF-κB p65, but inhibited its phosphorylation and activation. These observations suggest that ASA inhibits Ang II-induced NADPH oxidase expression, NF-κB activation and AT1R transcription in cardiac fibroblasts, and fibroblast proliferation and collagen expression. The critical role of NADPH oxidase activity in stimulation of AT1R transcription became apparent in experiments where ASA also inhibited AT1R transcription in cardiac fibroblasts challenged with H{sub 2}O{sub 2}. Since SA had similar effect as ASA on AT1R expression, we suggest that ASA's effect is mediated by its SA moiety. -- Highlights: ► Aspirin in therapeutic concentrations decreases mouse cardiac fibroblast

  20. Molecular aspects of monoamine oxidase B.


    Ramsay, Rona R


    Monoamine oxidases (MAO) influence the monoamine levels in brain by virtue of their role in neurotransmitter breakdown. MAO B is the predominant form in glial cells and in platelets. MAO B structure, function and kinetics are described as a background for the effect of alterations in its activity on behavior. The need to inhibit MAO B to combat decreased brain amines continues to drive the search for new drugs. Reversible and irreversible inhibitors are now designed using data-mining, computational screening, docking and molecular dynamics. Multi-target ligands designed to combat the elevated activity of MAO B in Alzheimer's and Parkinson's Diseases incorporate MAO inhibition (usually irreversible) as well as iron chelation, antioxidant or neuroprotective properties. The main focus of drug design is the catalytic activity of MAO, but the imidazoline I2 site in the entrance cavity of MAO B is also a pharmacological target. Endogenous regulation of MAO B expression is discussed briefly in light of new studies measuring mRNA, protein, or activity in healthy and degenerative samples, including the effect of DNA methylation on the expression. Overall, this review focuses on examples of recent research on the molecular aspects of the expression, activity, and inhibition of MAO B. PMID:26891670

  1. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).


    Neves, Valdir Augusto; da Silva, Maraiza Aparecida


    Polyphenol oxidase (E.C. (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  2. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  3. Origin and evolution of lysyl oxidases.


    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando


    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311


    SciTech Connect



    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  5. Photodynamic therapy using a protoporphyrinogen oxidase inhibitor.


    Fingar, V H; Wieman, T J; McMahon, K S; Haydon, P S; Halling, B P; Yuhas, D A; Winkelman, J W


    The use of endogenously created porphyrins as an alternative to photosensitizer injection for photodynamic therapy is a rapidly evolving area of study. One common method to induce porphyrin synthesis and accumulation in cells is the topical, oral, or parenteral administration of 5-aminolevulinic acid, a precursor for heme biosynthesis. Porphyrin accumulation may also be elicited by the use of enzyme inhibitors of the heme biosynthetic pathway. Groups of DBA/2 mice bearing SMT-F mammary tumors were placed on a diet containing 0-4000 ppm of a protoporphyrinogen oxidase inhibitor, FP-846. This agent blocks a critical step in porphyrin metabolism and results in elevated intracellular levels of protoporphyrin IX. Light treatment of tumors produced both initial and long-term regression that was dependent on the amount of inhibitor, the duration of inhibitor exposure to animals, and the amount of light used in PDT. Tumor regression occurred without significant destruction of normal tissues in the treatment field and without initial vascular constriction or blood flow stasis. Tumor cure in animals given 4000 ppm FP-846 in feed for 3 days and 300 J/cm2 602-670 nm light (23% cure) was similar to the response in animals given 10 mg/kg Photofrin and the same light dose (20%). PMID:9377568

  6. Analyzing the electrogenicity of cytochrome c oxidase.


    Kim, Ilsoo; Warshel, Arieh


    Measurements of voltage changes in response to charge separation within membrane proteins can offer fundamental information on spectroscopically "invisible" steps. For example, results from studies of voltage changes associated with electron and proton transfer in cytochrome c oxidase could, in principle, be used to discriminate between different theoretical models describing the molecular mechanism of proton pumping. Earlier analyses of data from these measurements have been based on macroscopic considerations that may not allow for exploring the actual molecular mechanisms. Here, we have used a coarse-grained model describing the relation between observed voltage changes and specific charge-transfer reactions, which includes an explicit description of the membrane, the electrolytes, and the electrodes. The results from these calculations offer mechanistic insights at the molecular level. Our main conclusion is that previously assumed mechanistic evidence that was based on electrogenic measurements is not unique. However, the ability of our calculations to obtain reliable voltage changes means that we have a tool that can be used to describe a wide range of electrogenic charge transfers in channels and transporters, by combining voltage measurements with other experiments and simulations to analyze new mechanistic proposals. PMID:27357681

  7. Molecularly "wired" cholesterol oxidase for biosensing.


    Leonida, Mihaela D; Aurian-Blajeni, Benedict


    The influence of several factors on the activity of cholesterol oxidase (ChOx) transiently exposed to a room temperature ionic liquid (RTIL) was studied. Presence of flavin adenine dinucleotide (FAD, prosthetic group of ChOx) during exposure to RTIL makes the procedure enzyme-friendly, while the use of RTIL (green reagent) makes it environmentally-friendly. Following exposure to RTIL and its subsequent removal, FAD becomes part of the molecular structure of the refolded protein (a molecular "wire"). This makes the procedure used here a molecular one. The factors studied were: FAD presence in RTIL during modification, water presence during exposure to RTIL, and ratio FAD:RTIL during "wiring". Performance parameters monitored were: enzyme activity before and after "wiring" (expressed as (dA/dt)/mg enzyme, and measured spectrophotometrically), peak current in an amperometric biosensor for cholesterol detection, and linearity of the biosensor response depending on cholesterol concentration. After RTIL removal, the modified enzyme (ME) retained a high percentage of the added FAD, which supplemented that of the native enzyme (functioning as a "wire" and enhancing electron transfer kinetics), and a fraction of the initial activity. Used in an amperometric biosensor, ME showed catalytic activity, linear behavior as a function of cholesterol concentration, and stability. PMID:25579496

  8. Crystallization of carbohydrate oxidase from Microdochium nivale.


    Dusková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Stepánková, Andrea; Hasek, Jindrich


    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 A resolution, with unit-cell parameters a = b = 55.7, c = 610.4 A and apparent space group P6(2)22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 A, beta = 95.7 degrees . Data sets were collected to a resolution of 2.4 A. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  9. Crystallization of carbohydrate oxidase from Microdochium nivale

    PubMed Central

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich


    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 Å resolution, with unit-cell parameters a = b = 55.7, c = 610.4 Å and apparent space group P6222. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 Å, β = 95.7°. Data sets were collected to a resolution of 2.4 Å. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  10. Monoamine oxidase: Radiotracer chemistry and human studies


    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.


    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variablesmore » which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.« less

  11. Monoamine oxidase: Radiotracer chemistry and human studies

    SciTech Connect

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.


    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.

  12. An ultrafiltration assay for lysyl oxidase.


    Shackleton, D R; Hulmes, D J


    A modification of the original microdistillation assay for lysyl oxidase is described in which Amicon C-10 microconcentrators are used to separate, by ultrafiltration, the 3H-labeled products released from a [4,5-3H]-lysine-labeled elastin substrate. Enzyme activity is determined by scintillation counting of the ultrafiltrate, after subtraction of radioactivity released in the presence of beta-aminopropionitrile, a specific inhibitor of the enzyme. Conditions are described which optimize both the sensitivity and the efficient use of substrate. The assay shows linear inhibition of activity in up to 1 M urea; hence, as the enzyme is normally diluted in the assay, samples in 6 M urea can be assayed directly, without prior dialysis, and corrected for partial inhibition. Comparable results are obtained when enzyme activity is assayed by ultrafiltration or microdistillation. The assay is simple and convenient and, by using disposable containers throughout, it eliminates the need for time-consuming decontamination of radioactive glassware. PMID:1971160

  13. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.


    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P


    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  14. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.


    Zhou, Yuchan; Underhill, Steven J R


    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  15. Characterization of gibberellin 20-oxidases in the citrus hybrid Carrizo citrange.


    Huerta, Laura; Garcia-Lor, Andres; Garcia-Martinez, Jose L


    CcGA20ox1 is a gene encoding a GA 20-oxidase, a gibberellin (GA) biosynthetic enzyme, previously isolated from the citrus hybrid Carrizo citrange (Citrus sinensis (L.) Osbeck x Poncirus trifoliata (L.) Raf.). Southern blot analysis of genomic DNA of Carrizo citrange with CcGA20ox1 suggested the presence in the hybrid of another gene encoding another GA 20-oxidase. A cDNA clone from this new gene (CcGA20ox2) was isolated using RNA from the other parent C. sinensis. CcGA20ox2 encoded a protein of 372 amino acids that showed 67.1% identity with CcGA20ox1, and its expression product catalyzed the in vitro conversion of GA12 to GA9, confirming that it corresponds to another active GA20ox. Amplification of genomic DNA and isolation of genomic clones of CcGA20ox1 and CcGA20ox2 revealed that the parental sources of these genes in the hybrid were P. trifoliata and C. sinensis, respectively. The sequences of CcGA20ox1 and CcGA20ox2 showed that both genes contained two introns, which are also conserved in GA20ox genes of other species like Arabidopsis thaliana L., Pisum sativum L. and Solanum lycopersicum L. Determination of transcript levels in the Carrizo citrange hybrid by quantitative real-time polymerase chain reaction showed that CcGA20ox1 was expressed mainly in internodes, leaves and seeds, and CcGA20ox2 in flower buds and flowers at anthesis, with the genes having similar transcript levels in young developing fruits. PMID:19203975

  16. Characterization of an Apis cerana cerana cytochrome P450 gene (AccCYP336A1) and its roles in oxidative stresses responses.


    Zhu, Ming; Zhang, Weixing; Liu, Feng; Chen, Xiaobo; Li, Han; Xu, Baohua


    Cytochrome P450 monooxygenases (P450), widely distributed multifunctional enzymes, that play an important role in the oxidative metabolism of endogenous compounds and xenobiotics. Studies have found that these enzymes show peroxidase-like activity and may thus be involved in protecting organisms against reactive oxygen species (ROS). In this work, Apis cerana cerana was used to investigate the molecular mechanisms of P450 family genes in resisting ROS damage. A cytochrome P450 gene was isolated, AccCYP336A1. The open reading frame (ORF) of AccCYP336A1 is 1491bp in length and encodes a predicted protein of 496 amino acids. The obtained amino acid sequence of AccCYP336A1 shared a high sequence identity with homologous proteins and contained the highly conserved features of this protein family. Quantitative real-time PCR (qRT-PCR) analysis showed that AccCYP336A1 was present in some fast developmental stages and had a higher expression in the epidermis than in other tissues. Additionally, the expression levels of AccCYP336A1 were up-regulated by cold (4°C), heat (42°C), ultraviolet (UV) radiation, H2O2 and pesticide (thiamethoxam, deltamethrin, methomyl and phoxim) treatments. These results were confirmed by the western blot assays. Furthermore, the recombinant AccCYP336A1 protein acted as an antioxidant that resisted paraquat-induced oxidative stress. Taken together, these results suggest that AccCYP336A1 may play a very significant role in antioxidant defense against ROS damage. PMID:26877110

  17. The ROS Wheel: Refining ROS Transcriptional Footprints1[OPEN

    PubMed Central

    Noctor, Graham


    In the last decade, microarray studies have delivered extensive inventories of transcriptome-wide changes in messenger RNA levels provoked by various types of oxidative stress in Arabidopsis (Arabidopsis thaliana). Previous cross-study comparisons indicated how different types of reactive oxygen species (ROS) and their subcellular accumulation sites are able to reshape the transcriptome in specific manners. However, these analyses often employed simplistic statistical frameworks that are not compatible with large-scale analyses. Here, we reanalyzed a total of 79 Affymetrix ATH1 microarray studies of redox homeostasis perturbation experiments. To create hierarchy in such a high number of transcriptomic data sets, all transcriptional profiles were clustered on the overlap extent of their differentially expressed transcripts. Subsequently, meta-analysis determined a single magnitude of differential expression across studies and identified common transcriptional footprints per cluster. The resulting transcriptional footprints revealed the regulation of various metabolic pathways and gene families. The RESPIRATORY BURST OXIDASE HOMOLOG F-mediated respiratory burst had a major impact and was a converging point among several studies. Conversely, the timing of the oxidative stress response was a determining factor in shaping different transcriptome footprints. Our study emphasizes the need to interpret transcriptomic data sets in a systematic context, where initial, specific stress triggers can converge to common, aspecific transcriptional changes. We believe that these refined transcriptional footprints provide a valuable resource for assessing the involvement of ROS in biological processes in plants. PMID:27246095

  18. An alcohol oxidase of Phanerochaete chrysosporium with a distinct glycerol oxidase activity.


    Linke, Diana; Lehnert, Nicole; Nimtz, Manfred; Berger, Ralf G


    An intracellular alcohol oxidase (AOX) was isolated from the white-rot basidiomycete Phanerochaete chrysosporium (Pch), grown on l-lactate induction medium, and purified to electrophoretic homogeneity. The dimeric protein consisted of two identical 75kDa subunits. The open reading frame of 1,956bp resulted in a monomer consisting of 651 amino acids. The enzyme showed a pI at 5.4, a pH optimum of 9, a temperature optimum at 50°C, possessed putative conserved domains of the GMC superfamily, a FAD binding domain, and showed up to 86% homology to alcohol oxidase sequences of Gloeophyllum trabeum and Coprinopsis cinerea. As was shown for the first time for an AOX from a basidiomycete, not only methanol, but also lower primary alcohols and glycerol were accepted as substrates. An assay based on aldehyde dehydrogenase confirmed d-glyceraldehyde as the product of the reaction. A bioprocess based on this enzyme could alleviate the problems associated with the huge side-stream of glycerol occurring during the manufacture of biodiesel, yielding the green oxidant hydrogen peroxide. PMID:24910330

  19. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal


    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  20. Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.


    Sytykiewicz, Hubert


    Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. PMID:27178208

  1. Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene

    PubMed Central

    Irfan, Mohammad; Ghosh, Sumit; Meli, Vijaykumar S.; Kumar, Anil; Kumar, Vinay; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis


    α-Mannosidase (α-Man), a fruit ripening-specific N-glycan processing enzyme, is involved in ripening-associated fruit softening process. However, the regulation of fruit-ripening specific expression of α-Man is not well understood. We have identified and functionally characterized the promoter of tomato (Solanum lycopersicum) α-Man to provide molecular insights into its transcriptional regulation during fruit ripening. Fruit ripening-specific activation of the α-Man promoter was revealed by analysing promoter driven expression of beta-glucuronidase (GUS) reporter in transgenic tomato. We found that RIPENING INHIBITOR (RIN), a MADS box family transcription factor acts as positive transcriptional regulator of α-Man during fruit ripening. RIN directly bound to the α-Man promoter sequence and promoter activation/α-Man expression was compromised in rin mutant fruit. Deletion analysis revealed that a promoter fragment (567 bp upstream of translational start site) that contained three CArG boxes (binding sites for RIN) was sufficient to drive GUS expression in fruits. In addition, α-Man expression was down-regulated in fruits of Nr mutant which is impaired in ethylene perception and promoter activation/α-Man expression was induced in wild type following treatment with a precursor of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC). Although, α-Man expression was induced in rin mutant after ACC treatment, the transcript level was less as compared to ACC-treated wild type. Taken together, these results suggest RIN-mediated direct transcriptional regulation of α-Man during fruit ripening and ethylene may acts in RIN-dependent and -independent ways to regulate α-Man expression. PMID:26834776

  2. Fruit Ripening Regulation of α-Mannosidase Expression by the MADS Box Transcription Factor RIPENING INHIBITOR and Ethylene.


    Irfan, Mohammad; Ghosh, Sumit; Meli, Vijaykumar S; Kumar, Anil; Kumar, Vinay; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis


    α-Mannosidase (α-Man), a fruit ripening-specific N-glycan processing enzyme, is involved in ripening-associated fruit softening process. However, the regulation of fruit-ripening specific expression of α-Man is not well understood. We have identified and functionally characterized the promoter of tomato (Solanum lycopersicum) α-Man to provide molecular insights into its transcriptional regulation during fruit ripening. Fruit ripening-specific activation of the α-Man promoter was revealed by analysing promoter driven expression of beta-glucuronidase (GUS) reporter in transgenic tomato. We found that RIPENING INHIBITOR (RIN), a MADS box family transcription factor acts as positive transcriptional regulator of α-Man during fruit ripening. RIN directly bound to the α-Man promoter sequence and promoter activation/α-Man expression was compromised in rin mutant fruit. Deletion analysis revealed that a promoter fragment (567 bp upstream of translational start site) that contained three CArG boxes (binding sites for RIN) was sufficient to drive GUS expression in fruits. In addition, α-Man expression was down-regulated in fruits of Nr mutant which is impaired in ethylene perception and promoter activation/α-Man expression was induced in wild type following treatment with a precursor of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylic acid (ACC). Although, α-Man expression was induced in rin mutant after ACC treatment, the transcript level was less as compared to ACC-treated wild type. Taken together, these results suggest RIN-mediated direct transcriptional regulation of α-Man during fruit ripening and ethylene may acts in RIN-dependent and -independent ways to regulate α-Man expression. PMID:26834776

  3. Monoamine oxidase and agitation in psychiatric patients.


    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela


    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  4. Structure and function of mammalian aldehyde oxidases.


    Terao, Mineko; Romão, Maria João; Leimkühler, Silke; Bolis, Marco; Fratelli, Maddalena; Coelho, Catarina; Santos-Silva, Teresa; Garattini, Enrico


    Mammalian aldehyde oxidases (AOXs; EC1.2.3.1) are a group of conserved proteins belonging to the family of molybdo-flavoenzymes along with the structurally related xanthine dehydrogenase enzyme. AOXs are characterized by broad substrate specificity, oxidizing not only aromatic and aliphatic aldehydes into the corresponding carboxylic acids, but also hydroxylating a series of heteroaromatic rings. The number of AOX isoenzymes expressed in different vertebrate species is variable. The two extremes are represented by humans, which express a single enzyme (AOX1) in many organs and mice or rats which are characterized by tissue-specific expression of four isoforms (AOX1, AOX2, AOX3, and AOX4). In vertebrates each AOX isoenzyme is the product of a distinct gene consisting of 35 highly conserved exons. The extant species-specific complement of AOX isoenzymes is the result of a complex evolutionary process consisting of a first phase characterized by a series of asynchronous gene duplications and a second phase where the pseudogenization and gene deletion events prevail. In the last few years remarkable advances in the elucidation of the structural characteristics and the catalytic mechanisms of mammalian AOXs have been made thanks to the successful crystallization of human AOX1 and mouse AOX3. Much less is known about the physiological function and physiological substrates of human AOX1 and other mammalian AOX isoenzymes, although the importance of these proteins in xenobiotic metabolism is fairly well established and their relevance in drug development is increasing. This review article provides an overview and a discussion of the current knowledge on mammalian AOX. PMID:26920149

  5. Monoamine oxidase inhibitory activities of heterocyclic chalcones.


    Minders, Corné; Petzer, Jacobus P; Petzer, Anél; Lourens, Anna C U


    Studies have shown that natural and synthetic chalcones (1,3-diphenyl-2-propen-1-ones) possess monoamine oxidase (MAO) inhibition activities. Of particular importance to the present study is a report that a series of furanochalcones acts as MAO-B selective inhibitors. Since the effect of heterocyclic substitution, other than furan (and more recently thiophene, piperidine and quinoline) on the MAO inhibitory properties of the chalcone scaffold remains unexplored, the aim of this study was to synthesise and evaluate further heterocyclic chalcone analogues as inhibitors of the human MAOs. For this purpose, heterocyclic chalcone analogues that incorporate pyrrole, 5-methylthiophene, 5-chlorothiophene and 6-methoxypyridine substitution were examined. Seven of the nine synthesised compounds exhibited IC50 values <1 μM for the inhibition of MAO-B, with all compounds exhibiting higher affinities for MAO-B compared to the MAO-A isoform. The most potent MAO-B inhibitor (4h) displays an IC50 value of 0.067 μM while the most potent MAO-A inhibitor (4e) exhibits an IC50 value of 3.81 μM. It was further established that selected heterocyclic chalcones are reversible and competitive MAO inhibitors. 4h, however, may exhibit tight-binding to MAO-B, a property linked to its thiophene moiety. We conclude that high potency chalcones such as 4h represent suitable leads for the development of MAO-B inhibitors for the treatment of Parkinson's disease and possibly other neurodegenerative disorders. PMID:26432037

  6. Role of NADPH Oxidases in Liver Fibrosis

    PubMed Central

    Paik, Yong-Han; Kim, Jonghwa; Aoyama, Tomonori; De Minicis, Samuele; Bataller, Ramon


    Abstract Significance: Hepatic fibrosis is the common pathophysiologic process resulting from chronic liver injury, characterized by the accumulation of an excessive extracellular matrix. Multiple lines of evidence indicate that oxidative stress plays a pivotal role in the pathogenesis of liver fibrosis. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) is a multicomponent enzyme complex that generates reactive oxygen species (ROS) in response to a wide range of stimuli. In addition to phagocytic NOX2, there are six nonphagocytic NOX proteins. Recent Advances: In the liver, NOX is functionally expressed both in the phagocytic form and in the nonphagocytic form. NOX-derived ROS contributes to various kinds of liver disease caused by alcohol, hepatitis C virus, and toxic bile acids. Recent evidence indicates that both phagocytic NOX2 and nonphagocytic NOX isoforms, including NOX1 and NOX4, mediate distinct profibrogenic actions in hepatic stellate cells, the main fibrogenic cell type in the liver. The critical role of NOX in hepatic fibrogenesis provides a rationale to assess pharmacological NOX inhibitors that treat hepatic fibrosis in patients with chronic liver disease. Critical Issues: Although there is compelling evidence indicating a crucial role for NOX-mediated ROS generation in hepatic fibrogenesis, little is known about the expression, subcellular localization, regulation, and redox signaling of NOX isoforms in specific cell types in the liver. Moreover, the exact mechanism of NOX-mediated fibrogenic signaling is still largely unknown. Future Directions: A better understanding through further research about NOX-mediated fibrogenic signaling may enable the development of novel anti-fibrotic therapy using NOX inhibition strategy. Antioxid. Redox Signal. 20, 2854–2872. PMID:24040957

  7. Dose reduction in orthodontic lateral cephalography: dosimetric evaluation of a novel cephalographic thyroid protector (CTP) and anatomical cranial collimation (ACC)

    PubMed Central

    Rottke, D; van der Stelt, P F; Berkhout, W E R


    Objectives: To test the dose-reducing capabilities of a novel thyroid protection device and a recently introduced cranial collimator to be used in orthodontic lateral cephalography. Methods: Cephalographic thyroid protector (CTP) was designed to shield the thyroid while leaving the cervical vertebrae depicted. Using a RANDO® head phantom (The Phantom Laboratory, Salem, NY) equipped with dosemeters and a Proline XC (Planmeca, Helsinki, Finland) cephalograph, lateral cephalograms were taken, and the effective dose (ED) was calculated for four protocols: (1) without shielding; (2) with CTP; (3) with CTP and anatomical cranial collimator (ACC); and (4) with a thyroid collar (TC). Results: The ED for the respective protocols was (1) 8.51; (2) 5.39; (3) 3.50; and (4) 4.97 µSv. The organ dose for the thyroid was reduced from 30.17 to 4.50 µSv in Protocols 2 and 3 and to 3.33 µSv in Protocol 4. Conclusions: The use of just the CTP (Protocol 2) resulted in a 36.8% reduction of the ED of a lateral cephalogram. This was comparable to the classical TC (Protocol 4). A 58.8% reduction of the ED was obtained when combining CTP and ACC (Protocol 3). The dose to the radiosensitive thyroid gland was reduced by 85% in Protocols 2 and 3 and by 89% in Protocol 4. PMID:25564885

  8. Reward Sensitivity of ACC as an Intermediate Phenotype between DRD4-521T and Substance Misuse.


    Baker, Travis E; Stockwell, Tim; Barnes, Gordon; Haesevoets, Roderick; Holroyd, Clay B


    The development and expression of the midbrain dopamine system is determined in part by genetic factors that vary across individuals such that dopamine-related genes are partly responsible for addiction vulnerability. However, a complete account of how dopamine-related genes predispose individuals to drug addiction remains to be developed. Adopting an intermediate phenotype approach, we investigated whether reward-related electrophysiological activity of ACC-a cortical region said to utilize dopamine reward signals to learn the value of extended, context-specific sequences of goal-directed behaviors-mediates the influence of multiple dopamine-related functional polymorphisms over substance use. We used structural equation modeling to examine whether two related electrophysiological phenomena associated with the control and reinforcement learning functions of ACC-theta power and the reward positivity-mediated the relationship between the degree of substance misuse and genetic polymorphisms that regulate dopamine processing in frontal cortex. Substance use data were collected from 812 undergraduate students. One hundred ninety-six returned on a subsequent day to participate in an electrophysiological experiment and to provide saliva samples for DNA analysis. We found that these electrophysiological signals mediated a relationship between the DRD4-521T dopamine receptor genotype and substance misuse. Our results provide a theoretical framework that bridges the gap between genes and behavior in drug addiction and illustrate how future interventions might be individually tailored for specific genetic and neurocognitive profiles. PMID:26601911

  9. OpenACC acceleration of an unstructured CFD solver based on a reconstructed discontinuous Galerkin method for compressible flows


    Xia, Yidong; Lou, Jialin; Luo, Hong; Edwards, Jack; Mueller, Frank


    Here, an OpenACC directive-based graphics processing unit (GPU) parallel scheme is presented for solving the compressible Navier–Stokes equations on 3D hybrid unstructured grids with a third-order reconstructed discontinuous Galerkin method. The developed scheme requires the minimum code intrusion and algorithm alteration for upgrading a legacy solver with the GPU computing capability at very little extra effort in programming, which leads to a unified and portable code development strategy. A face coloring algorithm is adopted to eliminate the memory contention because of the threading of internal and boundary face integrals. A number of flow problems are presented to verify the implementationmore » of the developed scheme. Timing measurements were obtained by running the resulting GPU code on one Nvidia Tesla K20c GPU card (Nvidia Corporation, Santa Clara, CA, USA) and compared with those obtained by running the equivalent Message Passing Interface (MPI) parallel CPU code on a compute node (consisting of two AMD Opteron 6128 eight-core CPUs (Advanced Micro Devices, Inc., Sunnyvale, CA, USA)). Speedup factors of up to 24× and 1.6× for the GPU code were achieved with respect to one and 16 CPU cores, respectively. The numerical results indicate that this OpenACC-based parallel scheme is an effective and extensible approach to port unstructured high-order CFD solvers to GPU computing.« less

  10. OpenACC acceleration of an unstructured CFD solver based on a reconstructed discontinuous Galerkin method for compressible flows

    SciTech Connect

    Xia, Yidong; Lou, Jialin; Luo, Hong; Edwards, Jack; Mueller, Frank


    Here, an OpenACC directive-based graphics processing unit (GPU) parallel scheme is presented for solving the compressible Navier–Stokes equations on 3D hybrid unstructured grids with a third-order reconstructed discontinuous Galerkin method. The developed scheme requires the minimum code intrusion and algorithm alteration for upgrading a legacy solver with the GPU computing capability at very little extra effort in programming, which leads to a unified and portable code development strategy. A face coloring algorithm is adopted to eliminate the memory contention because of the threading of internal and boundary face integrals. A number of flow problems are presented to verify the implementation of the developed scheme. Timing measurements were obtained by running the resulting GPU code on one Nvidia Tesla K20c GPU card (Nvidia Corporation, Santa Clara, CA, USA) and compared with those obtained by running the equivalent Message Passing Interface (MPI) parallel CPU code on a compute node (consisting of two AMD Opteron 6128 eight-core CPUs (Advanced Micro Devices, Inc., Sunnyvale, CA, USA)). Speedup factors of up to 24× and 1.6× for the GPU code were achieved with respect to one and 16 CPU cores, respectively. The numerical results indicate that this OpenACC-based parallel scheme is an effective and extensible approach to port unstructured high-order CFD solvers to GPU computing.

  11. 2013 ACC/AHA guideline recommends fixed-dose strategies instead of targeted goals to lower blood cholesterol.


    Smith, Sidney C; Grundy, Scott M


    The American College of Cardiology (ACC)/American Heart Association (AHA) Task Force on Practice Guidelines recently issued the 2013 ACC/AHA Guideline on the Treatment of Blood Cholesterol to Reduce Atherosclerotic Cardiovascular Risk in Adults. This new guideline endorses a paradigm shift in strategies for reducing atherosclerotic cardiovascular disease (ASCVD) events by lowering blood cholesterol. Whereas previous guidelines focused on therapy to decrease low-density lipoprotein and non-high-density lipoprotein cholesterol to specific target levels, the new guideline instead proposes implementation of cholesterol-lowering treatment using evidenced-based intensity of statin therapy without such targets. The guideline also provides a new risk estimator for primary prevention decisions, including stroke outcomes and data on African Americans, which will significantly increase the number of patients recommended for outcome-related benefits of cholesterol-lowering therapy. The first section of this paper reviews the process by which the task force developed the new evidence-based guideline, the major findings and recommendations, and their implications. The second section primarily focuses on the question of how much low-density lipoprotein cholesterol should be lowered and on additional considerations in risk assessment. PMID:25104531

  12. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation.


    Barnawal, Deepti; Bharti, Nidhi; Maji, Deepamala; Chanotiya, Chandan Singh; Kalra, Alok


    Ocimum sanctum grown as rain-fed crop, is known to be poorly adapted to waterlogged conditions. Many a times the crop suffers extreme damages because of anoxia and excessive ethylene generation due to waterlogging conditions present under heavy rain. The usefulness of 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing plant growth promoting rhizobacteria was investigated under waterlogging stress. The comparison of herb yield and stress induced biochemical changes of waterlogged and non-waterlogged plants with and without ACC deaminase-containing microbiological treatments were monitored in this study. Ten plant growth promoting rhizobacteria strains containing ACC-deaminase were isolated and characterized. Four selected isolates Fd2 (Achromobacter xylosoxidans), Bac5 (Serratia ureilytica), Oci9 (Herbaspirillum seropedicae) and Oci13 (Ochrobactrum rhizosphaerae) had the potential to protect Ocimum plants from flood induced damage under waterlogged glass house conditions. Pot experiments were conducted to evaluate the potential of these ACC deaminase-containing selected strains for reducing the yield losses caused by waterlogging conditions. Bacterial treatments protected plants from waterlogging induced detrimental changes like stress ethylene production, reduced chlorophyll concentration, higher lipid peroxidation, proline concentration and reduced foliar nutrient uptake. Fd2 (A. xylosoxidans) induced maximum waterlogging tolerance as treated waterlogged plants recorded maximum growth and herb yield (46.5% higher than uninoculated waterlogged plants) with minimum stress ethylene levels (53% lower ACC concentration as compared to waterlogged plants without bacterial inoculation) whereas under normal non-waterlogged conditions O. rhizosphaerae was most effective in plant growth promotion. PMID:22846334

  13. New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.


    Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich


    NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906

  14. NOX2β: A Novel Splice Variant of NOX2 That Regulates NADPH Oxidase Activity in Macrophages

    PubMed Central

    Guida, Elizabeth; King, Paul T.; Sobey, Christopher G.; Drummond, Grant R.


    Nox2 oxidase is one isoform in a family of seven NADPH oxidases that generate reactive oxygen species (ROS) and thereby contribute to physiological and pathological processes including host defense, redox signaling and oxidative tissue damage. While alternative mRNA splicing has been shown to influence the activity of several Nox-family proteins, functionally relevant splice variants of Nox2 have not previously been identified. We immunoscreened several mouse tissues and cells for the presence of truncated Nox2 proteins and identified a 30 kDa protein in lung, spleen and macrophages. RT-PCR analysis of mRNA from primary and immortalised (RAW264.7) mouse macrophages, and from human alveolar macrophages, identified a truncated Nox2 transcript which, upon sequence analysis, was found to be a product of the ‘exon skipping’ mode of alternative splicing, lacking exons 4–10 of the Nox2 gene. The predicted protein is comparable in size to that identified by immunoscreening and contains two transmembrane helices and an extended cytosolic C-terminus with binding sites for NADPH and the Nox organiser protein p47phox. Importantly, selective siRNA-mediated knockdown of the transcript reduced expression of the 30 kDa protein in macrophages, and suppressed phorbol ester-stimulated ROS production by 50%. We thus provide the first evidence that Nox2 undergoes alternative mRNA splicing to yield a 30 kDa protein – herein termed Nox2β – that regulates NADPH oxidase activity in macrophages from mice and humans. The discovery of Nox2β paves the way for future examination of its role in physiological and pathological processes. PMID:23118986

  15. Terminal Oxidases of Bacillus subtilis Strain 168: One Quinol Oxidase, Cytochrome aa3 or Cytochrome bd, Is Required for Aerobic Growth

    PubMed Central

    Winstedt, Lena; von Wachenfeldt, Claes


    The gram-positive endospore-forming bacterium Bacillus subtilis has, under aerobic conditions, a branched respiratory system comprising one quinol oxidase branch and one cytochrome oxidase branch. The system terminates in one of four alternative terminal oxidases. Cytochrome caa3 is a cytochrome c oxidase, whereas cytochrome bd and cytochrome aa3 are quinol oxidases. A fourth terminal oxidase, YthAB, is a putative quinol oxidase predicted from DNA sequence analysis. None of the terminal oxidases are, by themselves, essential for growth. However, one quinol oxidase (cytochrome aa3 or cytochrome bd) is required for aerobic growth of B. subtilis strain 168. Data indicating that cytochrome aa3 is the major oxidase used by exponentially growing cells in minimal and rich medium are presented. We show that one of the two heme-copper oxidases, cytochrome caa3 or cytochrome aa3, is required for efficient sporulation of B. subtilis strain 168 and that deletion of YthAB in a strain lacking cytochrome aa3 makes the strain sporulation deficient. PMID:11073895

  16. Evolution of the nuclear-encoded cytochrome oxidase subunits in vertebrates.


    Little, A G; Kocha, K M; Lougheed, S C; Moyes, C D


    Vertebrate mitochondrial cytochrome c oxidase (COX) possesses 10 nuclear-encoded subunits. Six subunits have paralogs in mammals, but the origins and distribution of isoforms among vertebrates have not been analyzed. We used Bayesian phylogenetic analysis to interpret the origins of each subunit, inferring the roles of gene and genome duplications. The paralogous ancestries of five genes were identical throughout the major vertebrate taxa: no paralogs of COX6c and COX7c, two paralogs of COX4 and COX6a, and three paralogs of COX7a. Two genes had an extra copy in teleosts (COX5a, COX5b), and three genes had additional copies in mammals (COX6b, COX7b, COX8). Focusing on early vertebrates, we examined structural divergence and explored transcriptional profiles across zebrafish tissues. Quantitative transcript profiles revealed dramatic differences in transcript abundance for different subunits. COX7b and COX4 transcripts were typically present at very low levels, whereas COX5a and COX8 were in vast excess in all tissues. For genes with paralogs, two general patterns emerged. For COX5a and COX8, there was ubiquitous expression of one paralog, with the other paralog in lower abundance in all tissues. COX4 and COX6a shared a distinct expression pattern, with one paralog dominant in brain and gills and the other in muscles. The isoform profiles in combination with phylogenetic analyses show that vertebrate COX isoform patterns are consistent with the hypothesis that early whole genome duplications in basal vertebrates governed the isoform repertoire in modern fish and tetrapods, though more recent lineage-specific gene/genome duplications also play a role in select subunits. PMID:20233836

  17. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf


    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908



    Filip-Ciubotaru, Florina; Manciuc, Carmen; Stoleriu, Gabriela; Foia, Liliana


    NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase), with its generically termed NOX isoforms, is the major source of ROS (reactive oxigen species) in biological systems. ROS are small oxygen-derived molecules with an important role in various biological processes (physiological or pathological). If under physiological conditions some processes are beneficial and necessary for life, under pathophysiological conditions they are noxious, harmful. NADPH oxidases are present in phagocytes and in a wide variety of nonphagocytic cells. The enzyme generates superoxide by transferring electrons from NADPH inside the cell across the membrane and coupling them to molecular oxygen to produce superoxide anion, a reactive free-radical. Structurally, NADPH oxidase is a multicomponent enzyme which includes two integral membrane proteins, glycoprotein gp9 1 Phox and adaptor protein p22(phox), which together form the heterodimeric flavocytochrome b558 that constitutes the core of the enzyme. During the resting state, the multidomain regulatory subunits p40P(phox), p47(phox), p67(Phox) are located in the cytosol organized as a complex. The activation of phagocytic NADPH oxidase occurs through a complex series of protein interactions. PMID:27125069

  19. Sulfide inhibition of and metabolism by cytochrome c oxidase.


    Nicholls, Peter; Marshall, Doug C; Cooper, Chris E; Wilson, Mike T


    Hydrogen sulfide (H2S), a classic cytochrome c oxidase inhibitor, is also an in vitro oxidase substrate and an in vivo candidate hormonal ('gasotransmitter') species affecting sleep and hibernation. H2S, nitric oxide (NO) and carbon monoxide (CO) share some common features. All are low-molecular-mass physiological effectors and also oxidase inhibitors, capable of binding more than one enzyme site, and each is an oxidizable 'substrate'. The oxidase oxidizes CO to CO2, NO to nitrite and sulfide to probable persulfide species. Mitochondrial cytochrome c oxidase in an aerobic steady state with ascorbate and cytochrome c is rapidly inhibited by sulfide in a biphasic manner. At least two successive inhibited species are involved, probably partially reduced. The oxidized enzyme, in the absence of turnover, occurs in at least two forms: the 'pulsed' and 'resting' states. The pulsed form reacts aerobically with sulfide to form two intermediates, 'P' and 'F', otherwise involved in the reaction of oxygen with reduced enzyme. Sulfide can directly reduce the oxygen-reactive a3CuB binuclear centre in the pulsed state. The resting enzyme does not undergo such a step, but only a very slow one-electron reduction of the electron-transferring haem a. In final reactivation phases, both the steady-state inhibition of catalysis and the accumulation of P and F states are reversed by slow sulfide oxidation. A model for this complex reaction pattern is presented. PMID:24059525

  20. Crystal Structure of Alcohol Oxidase from Pichia pastoris.


    Koch, Christian; Neumann, Piotr; Valerius, Oliver; Feussner, Ivo; Ficner, Ralf


    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  1. Bone marrow purging by a xanthine oxidase-antibody conjugate.


    Dinota, A; Tazzari, P L; Abbondanza, A; Battelli, M G; Gobbi, M; Stirpe, F


    The selective cytotoxicity of the xanthine oxidase conjugated to an 8A monoclonal antibody recognizing a human plasma cell-associated antigen has been described. The selectivity and the toxicity of the hypoxanthine/conjugated xanthine oxidase system was increased by removing the excess of conjugate and by adding chelated iron. Under these experimental conditions the cytotoxicity of the conjugate exceeded that of free xanthine oxidase by one order of magnitude. The conjugate effectively purged bone marrow from infiltrating neoplastic plasma cells and added target Raji cells, provided blood was removed and bone marrow peroxidases were exhausted. In conditions of purging effectiveness the conjugate had no toxicity to CFU-GM. No toxicity to mice was observed after i.v. injection of xanthine oxidase-antibody conjugate up to 2.9 U/kg body weight. Thus the hypoxanthine/conjugated xanthine oxidase system could be an effective and nontoxic tool for the ex vivo bone marrow purging in multiple myeloma patients for autologous transplantation. PMID:2390631

  2. Transcription Regulation in Archaea.


    Gehring, Alexandra M; Walker, Julie E; Santangelo, Thomas J


    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  3. Regulation of Ascorbate Oxidase Expression in Pumpkin by Auxin and Copper 1

    PubMed Central

    Esaka, Muneharu; Fujisawa, Kouichi; Goto, Miwa; Kisu, Yasutomo


    Ascorbate oxidase expression in pumpkin (Cucurbita spp.) tissues was studied. Specific ascorbate oxidase activities in pumpkin leaf and stem tissues were about 2 and 1.5 times that in the fruit tissues, respectively. In seeds, little ascorbate oxidase activity was detected. Northern blot analyses showed an abundant ascorbate oxidase mRNA in leaf and stem tissues. Fruit tissues had lower levels of ascorbate oxidase mRNA than leaf and stem tissues. Ascorbate oxidase mRNA was not detected in seeds. Specific ascorbate oxidase activity gradually increased during early seedling growth of pumpkin seeds. The increase was accompanied by an increase in ascorbate oxidase mRNA. When ascorbate oxidase activity in developing pumpkin fruits was investigated, the activities in immature fruits that are rapidly growing at 0, 2, 4, and 7 d after anthesis were much higher than those in mature fruits at 14 and 30 d after anthesis. The specific activity and mRNA of ascorbate oxidase markedly increased after inoculation of pumpkin fruit tissues into Murashige and Skoog's culture medium in the presence of an auxin such as 2,4-dichlorophenoxyacetic acid (2,4-D) but not in the absence of 2,4-D. In the presence of 10 mg/L of 2,4-D, ascorbate oxidase mRNA was the most abundant. Thus, ascorbate oxidase is induced by 2,4-D. These results indicate that ascorbate oxidase is involved in cell growth. In pumpkin callus, ascorbate oxidase activity could be markedly increased by adding copper. Furthermore, immunological blotting showed that the amount of ascorbate oxidase protein was also increased by adding copper. However, northern blot analyses showed that ascorbate oxidase mRNA was not increased by adding copper. We suggest that copper may control ascorbate oxidase expression at translation or at a site after translation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:16652952

  4. Regulation of ascorbate oxidase expression in pumpkin by auxin and copper.


    Esaka, M; Fujisawa, K; Goto, M; Kisu, Y


    Ascorbate oxidase expression in pumpkin (Cucurbita spp.) tissues was studied. Specific ascorbate oxidase activities in pumpkin leaf and stem tissues were about 2 and 1.5 times that in the fruit tissues, respectively. In seeds, little ascorbate oxidase activity was detected. Northern blot analyses showed an abundant ascorbate oxidase mRNA in leaf and stem tissues. Fruit tissues had lower levels of ascorbate oxidase mRNA than leaf and stem tissues. Ascorbate oxidase mRNA was not detected in seeds. Specific ascorbate oxidase activity gradually increased during early seedling growth of pumpkin seeds. The increase was accompanied by an increase in ascorbate oxidase mRNA. When ascorbate oxidase activity in developing pumpkin fruits was investigated, the activities in immature fruits that are rapidly growing at 0, 2, 4, and 7 d after anthesis were much higher than those in mature fruits at 14 and 30 d after anthesis. The specific activity and mRNA of ascorbate oxidase markedly increased after inoculation of pumpkin fruit tissues into Murashige and Skoog's culture medium in the presence of an auxin such as 2,4-dichlorophenoxyacetic acid (2,4-D) but not in the absence of 2,4-D. In the presence of 10 mg/L of 2,4-D, ascorbate oxidase mRNA was the most abundant. Thus, ascorbate oxidase is induced by 2,4-D. These results indicate that ascorbate oxidase is involved in cell growth. In pumpkin callus, ascorbate oxidase activity could be markedly increased by adding copper. Furthermore, immunological blotting showed that the amount of ascorbate oxidase protein was also increased by adding copper. However, northern blot analyses showed that ascorbate oxidase mRNA was not increased by adding copper. We suggest that copper may control ascorbate oxidase expression at translation or at a site after translation. PMID:16652952

  5. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf


    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  6. Plant transcription factors.


    Meshi, T; Iwabuchi, M


    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  7. Transcriptional activators in yeast

    PubMed Central


    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  8. pACC1 peptide loaded chitosan nanoparticles induces apoptosis via reduced fatty acid synthesis in MDA-MB-231 cells

    NASA Astrophysics Data System (ADS)

    Kaliaperumal, Jagatheesh; Hari, Natarajan; Pavankumar, Padarthi; Elangovan, Namasivayam


    The development of formulations with therapeutic peptides has been restricted to poor cell penetration and in this attempt; we developed pACC1 peptide loaded chitosan nanoparticles. The prepared nanoparticles were characterized with FT-IR, XRD, SEM and TEM. In addition, the suitable formulation was evaluated for hemocompatibility, plasma stability and embryo toxicity using Danio rerio embryo model. The results showed that pACC1 peptide loaded chitosan nanoparticles were compatible with plasma. They possess sustained release pattern and also found to be safe up to 300 mg/L in embryo toxicity tests. Cytotoxicity assays with MDA-MB-231 cell lines suggested that, pACC1 peptide loaded chitosan nanoparticles were capable of enhanced cellular penetration and reduced palmitic acid content, which was confirmed by H1 NMR. Hence, these nanoparticles could be employed as excellent adjuvant therapeutics while treating solid tumors with multi-drug resistance.

  9. pACC1 peptide loaded chitosan nanoparticles induces apoptosis via reduced fatty acid synthesis in MDA-MB-231 cells

    NASA Astrophysics Data System (ADS)

    Kaliaperumal, Jagatheesh; Hari, Natarajan; Pavankumar, Padarthi; Elangovan, Namasivayam


    The development of formulations with therapeutic peptides has been restricted to poor cell penetration and in this attempt; we developed pACC1 peptide loaded chitosan nanoparticles. The prepared nanoparticles were characterized with FT-IR, XRD, SEM and TEM. In addition, the suitable formulation was evaluated for hemocompatibility, plasma stability and embryo toxicity using Danio rerio embryo model. The results showed that pACC1 peptide loaded chitosan nanoparticles were compatible with plasma. They possess sustained release pattern and also found to be safe up to 300 mg/L in embryo toxicity tests. Cytotoxicity assays with MDA-MB-231 cell lines suggested that, pACC1 peptide loaded chitosan nanoparticles were capable of enhanced cellular penetration and reduced palmitic acid content, which was confirmed by H1 NMR. Hence, these nanoparticles could be employed as excellent adjuvant therapeutics while treating solid tumors with multi-drug resistance.

  10. Expression of alternative oxidase in Drosophila ameliorates diverse phenotypes due to cytochrome oxidase deficiency

    PubMed Central

    Kemppainen, Kia K.; Rinne, Juho; Sriram, Ashwin; Lakanmaa, Matti; Zeb, Akbar; Tuomela, Tea; Popplestone, Anna; Singh, Satpal; Sanz, Alberto; Rustin, Pierre; Jacobs, Howard T.


    Mitochondrial dysfunction is a significant factor in human disease, ranging from systemic disorders of childhood to cardiomyopathy, ischaemia and neurodegeneration. Cytochrome oxidase, the terminal enzyme of the mitochondrial respiratory chain, is a frequent target. Lower eukaryotes possess alternative respiratory-chain enzymes that provide non-proton-translocating bypasses for respiratory complexes I (single-subunit reduced nicotinamide adenine dinucleotide dehydrogenases, e.g. Ndi1 from yeast) or III + IV [alternative oxidase (AOX)], under conditions of respiratory stress or overload. In previous studies, it was shown that transfer of yeast Ndi1 or Ciona intestinalis AOX to Drosophila was able to overcome the lethality produced by toxins or partial knockdown of complex I or IV. Here, we show that AOX can provide a complete or substantial rescue of a range of phenotypes induced by global or tissue-specific knockdown of different cIV subunits, including integral subunits required for catalysis, as well as peripheral subunits required for multimerization and assembly. AOX was also able to overcome the pupal lethality produced by muscle-specific knockdown of subunit CoVb, although the rescued flies were short lived and had a motility defect. cIV knockdown in neurons was not lethal during development but produced a rapidly progressing locomotor and seizure-sensitivity phenotype, which was substantially alleviated by AOX. Expression of Ndi1 exacerbated the neuronal phenotype produced by cIV knockdown. Ndi1 expressed in place of essential cI subunits produced a distinct residual phenotype of delayed development, bang sensitivity and male sterility. These findings confirm the potential utility of alternative respiratory chain enzymes as tools to combat mitochondrial disease, while indicating important limitations thereof. PMID:24293544

  11. Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity1[C][W

    PubMed Central

    Kim, Dong Wook; Watanabe, Kanako; Murayama, Chihiro; Izawa, Sho; Niitsu, Masaru; Michael, Anthony J.; Berberich, Thomas; Kusano, Tomonobu


    The major plant polyamines (PAs) are the tetraamines spermine (Spm) and thermospermine (T-Spm), the triamine spermidine, and the diamine putrescine. PA homeostasis is governed by the balance between biosynthesis and catabolism; the latter is catalyzed by polyamine oxidase (PAO). Arabidopsis (Arabidopsis thaliana) has five PAO genes, AtPAO1 to AtPAO5, and all encoded proteins have been biochemically characterized. All AtPAO enzymes function in the back-conversion of tetraamine to triamine and/or triamine to diamine, albeit with different PA specificities. Here, we demonstrate that AtPAO5 loss-of-function mutants (pao5) contain 2-fold higher T-Spm levels and exhibit delayed transition from vegetative to reproductive growth compared with that of wild-type plants. Although the wild type and pao5 are indistinguishable at the early seedling stage, externally supplied low-dose T-Spm, but not other PAs, inhibits aerial growth of pao5 mutants in a dose-dependent manner. Introduction of wild-type AtPAO5 into pao5 mutants rescues growth and reduces the T-Spm content, demonstrating that AtPAO5 is a T-Spm oxidase. Recombinant AtPAO5 catalyzes the conversion of T-Spm and Spm to triamine spermidine in vitro. AtPAO5 specificity for T-Spm in planta may be explained by coexpression with T-Spm synthase but not with Spm synthase. The pao5 mutant lacking T-Spm oxidation and the acl5 mutant lacking T-Spm synthesis both exhibit growth defects. This study indicates a crucial role for T-Spm in plant growth and development. PMID:24906355

  12. Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

    SciTech Connect

    Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W. . E-mail:


    High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an {alpha}-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10{sup 4} U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions.

  13. X-ray absorption spectroscopy of chicken sulfite oxidase crystals

    SciTech Connect

    George, G.N.; Pickering, I.J.; Kisker, C.


    Sulfite oxidase catalyzes the physiologically vital oxidation of sulfite to sulfate. Recently, the crystal structure of chicken sulfite oxidase has been reported at 1.9 {angstrom} resolution. In contrast to the information available from previous X-ray absorption spectroscopic studies, the active site indicated by crystallography was a mono-oxo species. Because of this the possibility that the crystals did in fact contain a reduced molybdenum species was considered in the crystallographic work. The authors report herein an X-ray absorption spectroscopic study of polycrystalline sulfite oxidase prepared in the same manner as the previous single-crystal samples, and compare this with data for frozen solutions of oxidized and reduced enzyme.

  14. Protoporphyrinogen oxidase as a molecular target for diphenyl ether herbicides.

    PubMed Central

    Matringe, M; Camadro, J M; Labbe, P; Scalla, R


    Diphenyl ether herbicides induce an accumulation of protoporphyrin IX in plant tissues. By analogy to human porphyria, the accumulation could be attributed to decreased (Mg or Fe)-chelatase or protoporphyrinogen oxidase activities. Possible effects of acifluorfen-methyl on these enzymes were investigated in isolated corn (maize, Zea mays) etioplasts, potato (Solanum tuberosum) and mouse mitochondria, and yeast mitochondrial membranes. Acifluorfen-methyl was strongly inhibitory to protoporphyrinogen oxidase activities whatever their origins [concn. causing 50% inhibition (IC50) = 4 nM for the corn etioplast enzyme]. By contrast, it was roughly 100,000 times less active on (Mg or Fe)-chelatase activities (IC50 = 80-100 microM). Our results lead us to propose protoporphyrinogen oxidase as a cellular target for diphenyl ether herbicides. PMID:2775186

  15. [Amperometric enzyme biosensor with a glucose oxidase-polyaniline membrane].


    Dziadevich, S V; Doldatkin, A P; Rossokhatyĭ, V K; Shram, N F; Shul'ga, A A; Strikha, V I


    An amperometric glucose biosensor was made by electrochemical polymerization of aniline onto the gold electrodes in presence of the enzyme glucose oxidase in the phosphate buffer solution with pH 7.0. Aniline is easily polymerized forming a thin film, which adheres tightly on the electrodes surface. During the electropolymerization process glucose oxidase was entrapped into polyaniline film which then became the catalyst of the enzyme reaction of glucose hydrolysis. Experiments were performed to determine optimal conditions of polyaniline-glucose oxidase film preparation. Glucose was amperometrically determined with the electrochemically fabricated biosensor in the concentration range 10(-4) M to 2 x 10(-2) M. The linearity of the enzyme electrode response ranged from 2 x 10(-4) M to 6 x 10(-3) M. The electrochemical synthesis of a polyaniline-enzyme thin film a high-technologic one and this permits fabricating various microbiosensors and multisensors in the continuous technological cycle. PMID:7754558

  16. The alternative oxidases: simple oxidoreductase proteins with complex functions.


    Young, Luke; Shiba, Tomoo; Harada, Shigeharu; Kita, Kiyoshi; Albury, Mary S; Moore, Anthony L


    The alternative oxidases are membrane-bound monotopic terminal electron transport proteins found in all plants and in some agrochemically important fungi and parasites including Trypansoma brucei, which is the causative agent of trypanosomiasis. They are integral membrane proteins and reduce oxygen to water in a four electron process. The recent elucidation of the crystal structure of the trypanosomal alternative oxidase at 2.85 Å (1 Å=0.1 nm) has revealed salient structural features necessary for its function. In the present review we compare the primary and secondary ligation spheres of the alternative oxidases with other di-iron carboxylate proteins and propose a mechanism for the reduction of oxygen to water. PMID:24059524

  17. Forage polyphenol oxidase and ruminant livestock nutrition

    PubMed Central

    Lee, Michael R. F.


    Polyphenol oxidase (PPO) is predominately associated with the detrimental effect of browning fruit and vegetables, however, interest within PPO containing forage crops (crops to be fed to animals) has grown since the browning reaction was associated with reduced nitrogen (N) losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage) increased the quality of protein, improving N-use efficiency [feed N into product N (e.g., Milk): NUE] when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis (cleaving of glycerol-based lipid) in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA) in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalyzing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP). If the protein is an enzyme (e.g., protease or lipase) the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase undegraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated

  18. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.


    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K


    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology. PMID:26164855

  19. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.


    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu


    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  20. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.


    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui


    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  1. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  2. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    SciTech Connect

    Qin, Ling; Mills, Denise A.; Buhrow, Leann; Hiser, Carrie; Ferguson-Miller, Shelagh


    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  3. RHON1 Mediates a Rho-Like Activity for Transcription Termination in Plastids of Arabidopsis thaliana[C][W

    PubMed Central

    Chi, Wei; He, Baoye; Manavski, Nikolay; Mao, Juan; Ji, Daili; Lu, Congming; Rochaix, Jean David; Meurer, Jörg; Zhang, Lixin


    Although transcription termination is essential to generate functional RNAs, its underlying molecular mechanisms are still poorly understood in plastids of vascular plants. Here, we show that the RNA binding protein RHON1 participates in transcriptional termination of rbcL (encoding large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase) in Arabidopsis thaliana. Inactivation of RHON1 leads to enhanced rbcL read-through transcription and to aberrant accD (encoding β-subunit of the acetyl-CoA carboxylase) transcriptional initiation, which may result from inefficient transcription termination of rbcL. RHON1 can bind to the mRNA as well as to single-stranded DNA of rbcL, displays an RNA-dependent ATPase activity, and terminates transcription of rbcL in vitro. These results suggest that RHON1 terminates rbcL transcription using an ATP-driven mechanism similar to that of Rho of Escherichia coli. This RHON1-dependent transcription termination occurs in Arabidopsis but not in rice (Oryza sativa) and appears to reflect a fundamental difference between plastomes of dicotyledonous and monocotyledonous plants. Our results point to the importance and significance of plastid transcription termination and provide insights into its machinery in an evolutionary context. PMID:25480370

  4. Divergent RNA transcription

    PubMed Central

    Naughton, Catherine; Corless, Samuel; Gilbert, Nick


    New approaches using biotinylated-psoralen as a probe for investigating DNA structure have revealed new insights into the relationship between DNA supercoiling, transcription and chromatin compaction. We explore a hypothesis that divergent RNA transcription generates negative supercoiling at promoters facilitating initiation complex formation and subsequent promoter clearance. PMID:23863199

  5. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.


    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  6. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam


    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  7. SCAI/AATS/ACC/STS operator and institutional requirements for transcatheter valve repair and replacement, Part III: Pulmonic valve.


    Hijazi, Ziyad M; Ruiz, Carlos E; Zahn, Evan; Ringel, Richard; Aldea, Gabriel S; Bacha, Emile A; Bavaria, Joseph; Bolman, R Morton; Cameron, Duke E; Dean, Larry S; Feldman, Ted; Fullerton, David; Horlick, Eric; Mack, Michael J; Miller, D Craig; Moon, Marc R; Mukherjee, Debabrata; Trento, Alfredo; Tommaso, Carl L


    With the evolution of transcatheter valve replacement, an important opportunity has arisen for cardiologists and surgeons to collaborate in identifying the criteria for performing these procedures. Therefore, The Society for Cardiovascular Angiography and Interventions (SCAI), American Association for Thoracic Surgery (AATS), American College of Cardiology (ACC), and The Society of Thoracic Surgeons (STS) have partnered to provide recommendations for institutions to assess their potential for instituting and/or maintaining a transcatheter valve program. This article concerns transcatheter pulmonic valve replacement (tPVR). tPVR procedures are in their infancy with few reports available on which to base an expert consensus statement. Therefore, many of these recommendations are based on expert consensus and the few reports available. As the procedures evolve, technology advances, experience grows, and more data accumulate, there will certainly be a need to update this consensus statement. The writing committee and participating societies believe that the recommendations in this report serve as appropriate requisites. In some ways, these recommendations apply to institutions more than to individuals. There is a strong consensus that these new valve therapies are best performed using a Heart Team approach; thus, these credentialing criteria should be applied at the institutional level. Partnering societies used the ACC's policy on relationships with industry (RWI) and other entities to author this document ( To avoid actual, potential, or perceived conflicts of interest due to industry relationships or personal interests, all members of the writing committee, as well as peer reviewers of the document, were asked to disclose all current healthcare-related relationships including those existing 12 months before the initiation of the writing effort. A committee of interventional cardiologists and

  8. Removal of Asbestos-Containing Coatings (ACC) from gas transmission pipelines. Final report, January 1991-October 1993

    SciTech Connect

    Petersen, L.E.; Blackburn, M.L.


    Corrosion control coatings on transmission pipelines may contain asbestos as a secondary component of the coating. Current environmental and health regulations require a wet removal process for asbestos materials that provides close control of airborne emissions and asbestos fibers in effluent water. Modification of current line-traveling, water jet equipment was successfully completed in developing an economic removal process for asbestos-containing coatings (ACC). Materials handling components were added in yard experiments that permitted water jet removal, slurry filtration, and residue containerization meeting emission control levels, while providing pipe cleanliness suitable for recoating. Field evaluations under in-the-ditch and over-the-ditch conditions on 16-, 26- and 30-inch pipelines verified the achievement of design coating removal rates and asbestos emission control that meets current regulations.

  9. Pre-LTP requires extracellular signal-regulated kinase in the ACC

    PubMed Central

    Yamanaka, Manabu; Tian, Zhen; Darvish-Ghane, Soroush


    The extracellular signal-regulated kinase is an important protein kinase for cortical plasticity. Long-term potentiation in the anterior cingulate cortex is believed to play important roles in chronic pain, fear, and anxiety. Previous studies of extracellular signal-regulated kinase are mainly focused on postsynaptic form of long-term potentiation (post-long-term potentiation). Little is known about the relationship between extracellular signal-regulated kinase and presynaptic long-term potentiation (pre-long-term potentiation) in cortical synapses. In this study, we examined whether pre-long-term potentiation in the anterior cingulate cortex requires the activation of presynaptic extracellular signal-regulated kinase. We found that p42/p44 mitogen-activated protein kinase inhibitors, PD98059 and U0126, suppressed the induction of pre-long-term potentiation. By contrast, these inhibitors did not affect the maintenance of pre-long-term potentiation. Using pharmacological inhibitors, we found that pre-long-term potentiation recorded for 1 h did not require transcriptional or translational processes. Our results strongly indicate that the activation of presynaptic extracellular signal-regulated kinase is required for the induction of pre-long-term potentiation, and this involvement may explain the contribution of extracellular signal-regulated kinase to mood disorders. PMID:27178245

  10. Pre-LTP requires extracellular signal-regulated kinase in the ACC.


    Yamanaka, Manabu; Tian, Zhen; Darvish-Ghane, Soroush; Zhuo, Min


    The extracellular signal-regulated kinase is an important protein kinase for cortical plasticity. Long-term potentiation in the anterior cingulate cortex is believed to play important roles in chronic pain, fear, and anxiety. Previous studies of extracellular signal-regulated kinase are mainly focused on postsynaptic form of long-term potentiation (post-long-term potentiation). Little is known about the relationship between extracellular signal-regulated kinase and presynaptic long-term potentiation (pre-long-term potentiation) in cortical synapses. In this study, we examined whether pre-long-term potentiation in the anterior cingulate cortex requires the activation of presynaptic extracellular signal-regulated kinase. We found that p42/p44 mitogen-activated protein kinase inhibitors, PD98059 and U0126, suppressed the induction of pre-long-term potentiation. By contrast, these inhibitors did not affect the maintenance of pre-long-term potentiation. Using pharmacological inhibitors, we found that pre-long-term potentiation recorded for 1 h did not require transcriptional or translational processes. Our results strongly indicate that the activation of presynaptic extracellular signal-regulated kinase is required for the induction of pre-long-term potentiation, and this involvement may explain the contribution of extracellular signal-regulated kinase to mood disorders. PMID:27178245

  11. 2015 ACC Health Policy Statement on Cardiovascular Team-Based Care and the Role of Advanced Practice Providers.


    Brush, John E; Handberg, Eileen M; Biga, Cathleen; Birtcher, Kim K; Bove, Alfred A; Casale, Paul N; Clark, Michael G; Garson, Arthur; Hines, Jerome L; Linderbaum, Jane A; Rodgers, George P; Shor, Robert A; Thourani, Vinod H; Wyman, Janet F


    The mission of the American College of Cardiology is "to transform cardiovascular care and improve heart health." Cardiovascular team-based care is a paradigm for practice that can transform care, improve heart health, and help meet the demands of the future. One strategic goal of the College is to help members successfully transition their clinical practices to the future, with all its complexity, challenges, and opportunities. The ACC's strategic plan is aligned with the triple aim of improved care, improved population health, and lower costs per capita. The traditional understanding of quality, access, and cost is that you cannot improve one component without diminishing the others. With cardiovascular team-based care, it is possible to achieve the triple aim of improving quality, access, and cost simultaneously to also improve cardiovascular health. Striving to serve the best interests of patients is the true north of our guiding principles. Cardiovascular team-based care is a model that can improve care coordination and communication and allow each team member to focus more on the quality of care. In addition, the cardiovascular team-based care model increases access to cardiovascular care and allows expansion of services to populations and geographic areas that are currently underserved. This document will increase awareness of the important components of cardiovascular team-based care and create an opportunity for more discussion about the most creative and effective means of implementing it. We hope that this document will stimulate further discussions and activities within the ACC and beyond about team-based care. We have identified areas that need improvement, specifically in APP education and state regulation. The document encourages the exploration of collaborative care models that should enable team members to optimize their education, training, experience, and talent. Improved team leadership, coordination, collaboration, engagement, and efficiency

  12. A new role for LOX and LOXL2 proteins in transcription regulation.


    Iturbide, Ane; García de Herreros, Antonio; Peiró, Sandra


    The lysyl oxidase (LOX) family of proteins (LOX and LOXL1-LOXL4) oxidize amino groups located in the ε-position in lysines to generate an aldehyde group. In general, they are considered as extracellular proteins and have elastin and collagen as their main substrates. However, recent findings suggest a critical intracellular role for LOX and LOXL2 in transcriptional regulation. In this review, we highlight what is known about the transcriptional role of these two members of the family. Intriguingly, both the intracellular localization of these proteins and the fact that histones have been revealed to be their substrates place this family of proteins within the epigenetic field. PMID:25103872

  13. Computer-controlled system for the study of oxidase reactions: application to the peroxidase-oxidase oscillator.


    McDonald, Andrew G; Tipton, Keith F


    An apparatus for the study of bisubstrate oxidase reactions at maintained steady-state substrate concentrations is described, and its specific application to the peroxidase-oxidase biochemical oscillator is reported. Instrument control and data acquisition are provided by custom software written in LabVIEW. The software allows measurement, recording, and control of dissolved oxygen through a Clark-type oxygen electrode, reaction monitoring by a UV/vis spectrophotometer, and controlled substrate delivery by a syringe infusion pump. For peroxidase from horseradish, the optimal pH for oscillatory behavior was found to be in the range 4.5-5.5. PMID:21049952

  14. Diiron centre mutations in Ciona intestinalis alternative oxidase abolish enzymatic activity and prevent rescue of cytochrome oxidase deficiency in flies

    PubMed Central

    Andjelković, Ana; Oliveira, Marcos T.; Cannino, Giuseppe; Yalgin, Cagri; Dhandapani, Praveen K.; Dufour, Eric; Rustin, Pierre; Szibor, Marten; Jacobs, Howard T.


    The mitochondrial alternative oxidase, AOX, carries out the non proton-motive re-oxidation of ubiquinol by oxygen in lower eukaryotes, plants and some animals. Here we created a modified version of AOX from Ciona instestinalis, carrying mutations at conserved residues predicted to be required for chelation of the diiron prosthetic group. The modified protein was stably expressed in mammalian cells or flies, but lacked enzymatic activity and was unable to rescue the phenotypes of flies knocked down for a subunit of cytochrome oxidase. The mutated AOX transgene is thus a potentially useful tool in studies of the physiological effects of AOX expression. PMID:26672986

  15. Enhanced nitrogen fixation in a Rhizobium etli ntrC mutant that overproduces the Bradyrhizobium japonicum symbiotic terminal oxidase cbb{sub 3}

    SciTech Connect

    Soberon, M.; Lopez, O.; Morera, C.; Girard, M.L.; Tabche, M.L.; Miranda, J.


    The ntrC gene codes for a transcriptional activator protein that modulates gene expression in response to nitrogen. The cytochrome production pattern of a Rhizobium etli ntrC mutant (CFN2012) was studied. CO difference spectral analysis of membranes showed that CFN2012 produced a terminal oxidase similar to the symbiotic terminal oxidase of bacteroids in free-living cells under aerobic conditions, with a characteristic trough at 553 nm. CFN2012 produced two c-type cytochromes with molecular masses of 27 and 32 kDa in contrast with the wild-type strain, which produced only a 32-kDa c-tye cytochrome. The expression levels of the R. etli fix/NOQP operon, which codes for terminal oxidase cbb{sub 3}, were not affected by the ntrC mutation. However, the production levels of the two c-type cytochromes (27 and 32 kDa) were enhanced at least eightfold when the Bradyrhizobium japonicum fixNOQP operon was expressed in CFN2012 from the nptII promoter (pMSfix{sup c}), suggesting that these proteins are subunits FixO (27 kDa) and FixP (32 kDa) of cbb{sub 3} and that CFN2012/pMSfix{sup c} overproduced this terminal oxidase. CFN2012/pMSfix{sup c} showed a significant increase in its symbiotic performance as judged by the determination of nitrogenase activities of plants inoculated with this strain, suggesting that the overproduction of cbb{sub 3} terminal oxidase correlates with an enhancement in symbiotic nitrogen fixation.

  16. NADPH oxidase activity is essential for Keap1/Nrf2-mediated induction of GCLC in response to 2-indol-3-yl-methylenequinuclidin-3-ols.


    Sekhar, Konjeti R; Crooks, Peter A; Sonar, Vijayakumar N; Friedman, David B; Chan, Jeff Y; Meredith, Michael J; Starnes, Joseph H; Kelton, Kathy R; Summar, Samantha R; Sasi, Soumya; Freeman, Michael L


    Glutamate cysteine ligase, the rate-limiting enzyme for the synthesis of glutathione, represents an important component of chemoprevention paradigms. GCLC and GCLM, the genes encoding glutamate cysteine ligase subunits, are induced by indoles, such as indomethacin. Novel functionalized indole analogues and other structurally related compounds were synthesized and used for a comparative structure analysis of GCLC induction. Use of mouse embryo fibroblasts null for Nrf2 (nuclear factor-erythroid 2p45-related transcription factor) and HepG2 cells overexpressing Keap1 demonstrated that indole analogue-mediated GCLC expression was regulated by Nrf2-Keap1 interactions. Indole analogues capable of inducing GCLC were found to increase NADPH oxidase activity. Indole analogues unable to induce GCLC did not increase oxidase activity. HepG2 cells transfected with FLAG/Keap1 were exposed to indomethacin, and the redox state of Keap1 cysteine residues was assessed. The data indicated that Keap1 exhibited several oxidation states that were sensitive to indomethacin treatment. These indomethacin-mediated changes in thiol oxidation states were suppressed by diphenyleneiodonium, a NADPH oxidase inhibitor. Diphenyleneiodonium also suppressed indole analogue-mediated increases in GCLC mRNA. In summary, the use of the indole analogues identified NADPH oxidase activity as a novel upstream activity regulating Nrf2/Keap1 signaling of GCLC, provided data supporting the hypothesis that Keap1 is a downstream effector for oxidase activity, and afforded in vivo data to support the hypothesis that Keap1 thiols can act as molecular sensors of reactive oxygen species. Finally, the comparative structure analysis suggests that 2-indol-3-yl-methylenequinuclidin-3-ols may represent a prototype for the development of novel chemopreventative agents able to activate Keap1/Nrf2 signaling. PMID:14500406

  17. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan


    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  18. The plasma membrane NADPH oxidase OsRbohA plays a crucial role in developmental regulation and drought-stress response in rice.


    Wang, Xiang; Zhang, Mao-Mao; Wang, Ya-Jing; Gao, Yin-Tao; Li, Ri; Wang, Gang-Feng; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming


    Plasma membrane NADPH oxidases are major producers of reactive oxygen species (ROS) in plant cells under normal growth and stress conditions. In the present study the total activity of rice NADPH oxidases and the transcription of OsRbohA, which encodes an Oryza sativa plasma membrane NADPH oxidase, were stimulated by drought. OsRbohA was expressed in all tissues examined throughout development. Its mRNA was upregulated by a number of factors, including heat, drought, salt, oxidative stress and methyl jasmonate treatment. Compared with wild-type (WT), the OsRbohA-knockout mutant osrbohA exhibited upregulated expression of other respiratory burst oxidase homolog genes and multiple abnormal agronomic traits, including reduced biomass, low germination rate and decreased pollen viability and seed fertility. However, OsRbohA-overexpressing transgenic plants showed no differences in these traits compared with WT. Although osrbohA leaves and roots produced more ROS than WT, the mutant had lesser intracellular ROS. In contrast, OsRbohA-overexpressing transgenic plants exhibited higher ROS production at the intracellular level and in tissues. Ablation of OsRbohA impaired the tolerance of plants to various water stresses, whereas its overexpression enhanced the tolerance. In addition, a number of genes related to energy supply, substrate transport, stress response and transcriptional regulation were differentially expressed in osrbohA plants even under normal growth conditions, suggesting that OsRbohA has fundamental and broad functions in rice. These results indicate that OsRbohA-mediated processes are governed by complex signaling pathways that function during the developmental regulation and drought-stress response in rice. PMID:26400148

  19. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.


    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  20. Redox mechanisms in pathological angiogenesis in the retina: roles for NADPH oxidase.


    Chan, Elsa C; Liu, Guei-Sheung; Dusting, Gregory J


    Pathological angiogenesis in the retina is a leading cause of serious vision loss in potentially blinding eye diseases, including proliferative diabetic retinopathy, retinopathy of prematurity and the wet form of age-related macular degeneration. Hypoxia is thought to be the driver of pathological angiogenesis, and transcription factors such as hypoxia-inducible factor (HIF) and vascular endothelial growth factor (VEGF) are key mediators in these processes. Current treatments employ either laser photocoagulation or intravitreal injection of therapeutic antibodies for VEGF, in order to arrest the growth of leaky blood vessels in the avascular vitreous cavity and to restore visual acuity. However, all such therapeutic approaches are limited by low or variable efficacy, and the inconvenience, risk and financial burden of such treatments, which need to be given frequently. The lack of noninvasive and efficacious therapy has therefore driven the search for alternative strategies. We have been interested in the roles of reactive oxygen species (ROS), such as superoxide and hydrogen peroxide, which when produced intracellularly at low concentration can act as second messengers to regulate physiological and pathological angiogenesis. Accumulating evidence suggests NADPH oxidase-dependent ROS are involved in regulation of the angiogenic signalling pathways of HIF and VEGF. Suppressing pathological neovascularisation in the retina by manipulating such redox mechanisms appears to be an attractive and clinically translatable therapeutic strategy to treat proliferative neovascular eye diseases. Here we provide a brief overview of the roles of NADPH oxidase in the sensing and regulation processes involving HIF and VEGF that contribute to the development of pathological angiogenesis in the retina. PMID:26510439


    EPA Science Inventory

    The iron chelator deferoxamine has been reported to inhibit both xanthine oxidase (XO) and xanthine dehydrogenase activity, but the relationship of this effect to the availability of iron in the cellular and tissue environment remains unexplored. XO and total xanthine oxidoreduct...

  2. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catecholase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and oth...

  3. Reducing peanut allergens by high pressure combined with polyphenol oxidase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) has been shown to reduce major peanut allergens (Ara h 1 and Ara h 2). Because high pressure (HP) can increase enzyme activity, we postulated that further reduction of peanut allergens can be achieved through HP combined with PPO. Peanut extracts were treated with each of th...

  4. HypC, the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  5. Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.


    Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie


    Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols. PMID:26305170

  6. Structural Changes and Proton Transfer in Cytochrome c Oxidase

    PubMed Central

    Vilhjálmsdóttir, Jóhanna; Johansson, Ann-Louise; Brzezinski, Peter


    In cytochrome c oxidase electron transfer from cytochrome c to O2 is linked to transmembrane proton pumping, which contributes to maintaining a proton electrochemical gradient across the membrane. The mechanism by which cytochrome c oxidase couples the exergonic electron transfer to the endergonic proton translocation is not known, but it presumably involves local structural changes that control the alternating proton access to the two sides of the membrane. Such redox-induced structural changes have been observed in X-ray crystallographic studies at residues 423–425 (in the R. sphaeroides oxidase), located near heme a. The aim of the present study is to investigate the functional effects of these structural changes on reaction steps associated with proton pumping. Residue Ser425 was modified using site-directed mutagenesis and time-resolved spectroscopy was used to investigate coupled electron-proton transfer upon reaction of the oxidase with O2. The data indicate that the structural change at position 425 propagates to the D proton pathway, which suggests a link between redox changes at heme a and modulation of intramolecular proton-transfer rates. PMID:26310633

  7. Glucose oxidase-magnetite nanoparticle bioconjugate for glucose sensing.


    Rossi, Liane M; Quach, Ashley D; Rosenzweig, Zeev


    Immobilization of bioactive molecules on the surface of magnetic nanoparticles is of great interest, because the magnetic properties of these bioconjugates promise to greatly improve the delivery and recovery of biomolecules in biomedical applications. Here we present the preparation and functionalization of magnetite (Fe3O4) nanoparticles 20 nm in diameter and the successful covalent conjugation of the enzyme glucose oxidase to the amino-modified nanoparticle surface. Functionalization of the magnetic nanoparticle surface with amino groups greatly increased the amount and activity of the immobilized enzyme compared with immobilization procedures involving physical adsorption. The enzymatic activity of the glucose oxidase-coated magnetic nanoparticles was investigated by monitoring oxygen consumption during the enzymatic oxidation of glucose using a ruthenium phenanthroline fluorescent complex for oxygen sensing. The glucose oxidase-coated magnetite nanoparticles could function as nanometric glucose sensors in glucose solutions of concentrations up to 20 mmol L(-1). Immobilization of glucose oxidase on the nanoparticles also increased the stability of the enzyme. When stored at 4 degrees C the nanoparticle suspensions maintained their bioactivity for up to 3 months. PMID:15448967

  8. Molecular dynamics in cytochrome c oxidase Moessbauer spectra deconvolution

    SciTech Connect

    Bossis, Fabrizio; Palese, Luigi L.


    Research highlights: {yields} Cytochrome c oxidase molecular dynamics serve to predict Moessbauer lineshape widths. {yields} Half height widths are used in modeling of Lorentzian doublets. {yields} Such spectral deconvolutions are useful in detecting the enzyme intermediates. -- Abstract: In this work low temperature molecular dynamics simulations of cytochrome c oxidase are used to predict an experimentally observable, namely Moessbauer spectra width. Predicted lineshapes are used to model Lorentzian doublets, with which published cytochrome c oxidase Moessbauer spectra were simulated. Molecular dynamics imposed constraints to spectral lineshapes permit to obtain useful information, like the presence of multiple chemical species in the binuclear center of cytochrome c oxidase. Moreover, a benchmark of quality for molecular dynamic simulations can be obtained. Despite the overwhelming importance of dynamics in electron-proton transfer systems, limited work has been devoted to unravel how much realistic are molecular dynamics simulations results. In this work, molecular dynamics based predictions are found to be in good agreement with published experimental spectra, showing that we can confidently rely on actual simulations. Molecular dynamics based deconvolution of Moessbauer spectra will lead to a renewed interest for application of this approach in bioenergetics.

  9. Polyphenol oxidase activity in co-ensiled temperate grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) and its o-diphenol substrates have been shown to effectively decrease proteolytic activity during the ensiling of forages such as red clover. Orchardgrass and smooth bromegrass both contain high levels of PPO activity, but lack appropriate levels of o-diphenols to adequately...

  10. Phosphoproteins and the activation of the neutrophil respiratory burst oxidase

    SciTech Connect

    Okamura, N.; Curnutte, J.T.; Babior, B.M.


    The respiratory burst oxidase is a neutrophil enzyme that converts oxygen to O/sub 2//sup -/. It is dormant in resting cells but is activated when the cells are exposed to phorbol myristate acetate (PMA). PMA also induces the incorporation of /sup 32/P into certain neutrophil proteins. To determine whether phosphorylation of these proteins is related to oxidase activation, protein phosphorylation was studied in patients with chronic granulomatous disease (GCD), a group of inherited conditions in which oxidase activity is missing. In normals, neutrophil activation by PMA is associated with the phosphorylation inter alia of 48K proteins at pI 7.3 and 7.8. There is also inconstant phosphorylation of a 48K protein at pI 6.8. In 4 patients with X-linked chronic granulomatous disease (CGD), phosphorylation of pp48/6.8 and pp48/7.3 was absent, while in autosomal recessive CGD, phosphorylation of all 3 of these proteins was absent in 3 patients and significantly diminished in a fourth. These results suggest that the phosphorylation of these proteins is related to the activation of the respiratory burst oxidase. By peptide mapping, these 3 proteins appear to consist of a single peptide species whose pI variability may be due to post-translational modification. The only phosphoamino acid found in pp48/7.3 was phosphoserine.

  11. Purification of gibberellin sub 53 -oxidase from spinach

    SciTech Connect

    Wilson, T.M.; Zeevaart, J.A.D. )


    Spinach is a long-day rosette plants, in which stem growth is mediated by gibberellins. It has been shown that two enzymatic steps, GA{sub 53}-oxidase and GA{sub 19}-oxidase, are controlled by light. To develop an understanding into this light regulation, purification of GA{sub 53}-oxidase has been undertaken. The original assay relied on the HPLC separation of the product and substrate, but was considered too slow for the development of a purification scheme. A TLC system was developed which in conjunction with improvements to the assay conditions was sensitive and gave rapid results. The partial purification of the GA{sub 53}-oxidase is achieved by a high speed centrifugation, 40-55% ammonium sulfate precipitation, an hydroxyapatite column, Sephadex G-100 column and an anion exchange FPLC column, Mono Q HR10/10, yielding 1000-fold purification and 15% recovery. Monoclonal antibodies to the protein will be raised and used to further characterize the enzyme.

  12. Activity of glucose oxidase functionalized onto magnetic nanoparticles

    PubMed Central

    Kouassi, Gilles K; Irudayaraj, Joseph; McCarty, Gregory


    Background Magnetic nanoparticles have been significantly used for coupling with biomolecules, due to their unique properties. Methods Magnetic nanoparticles were synthesized by thermal co-precipitation of ferric and ferrous chloride using two different base solutions. Glucose oxidase was bound to the particles by direct attachment via carbodiimide activation or by thiophene acetylation of magnetic nanoparticles. Transmission electron microscopy was used to characterize the size and structure of the particles while the binding of glucose oxidase to the particles was confirmed using Fourier transform infrared spectroscopy. Results The direct binding of glucose oxidase via carbodiimide activity was found to be more effective, resulting in bound enzyme efficiencies between 94–100% while thiophene acetylation was 66–72% efficient. Kinetic and stability studies showed that the enzyme activity was more preserved upon binding onto the nanoparticles when subjected to thermal and various pH conditions. The overall activity of glucose oxidase was improved when bound to magnetic nanoparticles Conclusion Binding of enzyme onto magnetic nanoparticles via carbodiimide activation is a very efficient method for developing bioconjugates for biological applications PMID:15762994

  13. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  14. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  15. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  16. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...

  17. 21 CFR 866.2420 - Oxidase screening test for gonorrhea.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420...


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC or EC catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  19. Involvement of NADPH oxidases in alkali burn-induced corneal injury

    PubMed Central



    Chemical burns are a major cause of corneal injury. Oxidative stress, inflammatory responses and neovascularization after the chemical burn aggravate corneal damage, and lead to loss of vision. Although NADPH oxidases (Noxs) play a crucial role in the production of reactive oxygen species (ROS), the role of Noxs in chemical burn-induced corneal injury remains to be elucidated. In the present study, the transcription and expression of Noxs in corneas were examined by RT-qPCR, western blot analysis and immunofluorescence staining. It was found that alkali burns markedly upregulated the transcription and expression of Nox2 and Nox4 in human or mouse corneas. The inhibition of Noxs by diphenyleneiodonium (DPI) or apocynin (Apo) effectively attenuated alkali burn-induced ROS production and decreased 3-nitrotyrosine (3-NT) protein levels in the corneas. In addition, Noxs/CD11b double-immunofluorescence staining indicated that Nox2 and Nox4 were partially co-localized with CD11b. DPI or Apo prevented the infiltration of CD11b-positive inflammatory cells, and inhibited the transcription of inflammatory cytokines following alkali burn-induced corneal injury. In our mouse model of alkali burn-induced corneal injury, corneal neovascularization (CNV) occurred on day 3, and it affected 50% of the whole area of the cornea on day 7, and on day 14, CNV coverage of the cornea reached maximum levels. DPI or Apo effectively attenuated alkali burn-induced CNV and decreased the mRNA levels of angiogenic factors, including vascular endothelial growth factor (VEGF), VEGF receptors and matrix metalloproteinases (MMPs). Taken together, our data indicate that Noxs play a role in alkali burn-induced corneal injury by regulating oxidative stress, inflammatory responses and CNV, and we thus suggest that Noxs are a potential therapeutic target in the future treatment of chemical-induced corneal injury. PMID:27221536

  20. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)


    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  1. The glossyhead1 Allele of ACC1 Reveals a Principal Role for Multidomain Acetyl-Coenzyme A Carboxylase in the Biosynthesis of Cuticular Waxes by Arabidopsis

    SciTech Connect

    Lu, S.; Xu, C.; Zhao, H.; Parsons, E. P.; Kosma, D. K.; Xu, X.; Chao, D.; Lohrey, G.; Bangarusamy, D. K.; Wang, G.; Bressan, R. A.; Jenks, M. A.


    A novel mutant of Arabidopsis (Arabidopsis thaliana), having highly glossy inflorescence stems, postgenital fusion in floral organs, and reduced fertility, was isolated from an ethyl methanesulfonate-mutagenized population and designated glossyhead1 (gsd1). The gsd1 locus was mapped to chromosome 1, and the causal gene was identified as a new allele of Acetyl-Coenzyme A Carboxylase1 (ACC1), a gene encoding the main enzyme in cytosolic malonyl-coenzyme A synthesis. This, to our knowledge, is the first mutant allele of ACC1 that does not cause lethality at the seed or early germination stage, allowing for the first time a detailed analysis of ACC1 function in mature tissues. Broad lipid profiling of mature gsd1 organs revealed a primary role for ACC1 in the biosynthesis of the very-long-chain fatty acids (C{sub 20:0} or longer) associated with cuticular waxes and triacylglycerols. Unexpectedly, transcriptome analysis revealed that gsd1 has limited impact on any lipid metabolic networks but instead has a large effect on environmental stress-responsive pathways, especially senescence and ethylene synthesis determinants, indicating a possible role for the cytosolic malonyl-coenzyme A-derived lipids in stress response signaling.

  2. Structure of the trypanosome cyanide-insensitive alternative oxidase

    PubMed Central

    Shiba, Tomoo; Kido, Yasutoshi; Sakamoto, Kimitoshi; Inaoka, Daniel Ken; Tsuge, Chiaki; Tatsumi, Ryoko; Takahashi, Gen; Balogun, Emmanuel Oluwadare; Nara, Takeshi; Aoki, Takashi; Honma, Teruki; Tanaka, Akiko; Inoue, Masayuki; Matsuoka, Shigeru; Saimoto, Hiroyuki; Moore, Anthony L.; Harada, Shigeharu; Kita, Kiyoshi


    In addition to haem copper oxidases, all higher plants, some algae, yeasts, molds, metazoans, and pathogenic microorganisms such as Trypanosoma brucei contain an additional terminal oxidase, the cyanide-insensitive alternative oxidase (AOX). AOX is a diiron carboxylate protein that catalyzes the four-electron reduction of dioxygen to water by ubiquinol. In T. brucei, a parasite that causes human African sleeping sickness, AOX plays a critical role in the survival of the parasite in its bloodstream form. Because AOX is absent from mammals, this protein represents a unique and promising therapeutic target. Despite its bioenergetic and medical importance, however, structural features of any AOX are yet to be elucidated. Here we report crystal structures of the trypanosomal alternative oxidase in the absence and presence of ascofuranone derivatives. All structures reveal that the oxidase is a homodimer with the nonhaem diiron carboxylate active site buried within a four-helix bundle. Unusually, the active site is ligated solely by four glutamate residues in its oxidized inhibitor-free state; however, inhibitor binding induces the ligation of a histidine residue. A highly conserved Tyr220 is within 4 Å of the active site and is critical for catalytic activity. All structures also reveal that there are two hydrophobic cavities per monomer. Both inhibitors bind to one cavity within 4 Å and 5 Å of the active site and Tyr220, respectively. A second cavity interacts with the inhibitor-binding cavity at the diiron center. We suggest that both cavities bind ubiquinol and along with Tyr220 are required for the catalytic cycle for O2 reduction. PMID:23487766

  3. Structure of the trypanosome cyanide-insensitive alternative oxidase.


    Shiba, Tomoo; Kido, Yasutoshi; Sakamoto, Kimitoshi; Inaoka, Daniel Ken; Tsuge, Chiaki; Tatsumi, Ryoko; Takahashi, Gen; Balogun, Emmanuel Oluwadare; Nara, Takeshi; Aoki, Takashi; Honma, Teruki; Tanaka, Akiko; Inoue, Masayuki; Matsuoka, Shigeru; Saimoto, Hiroyuki; Moore, Anthony L; Harada, Shigeharu; Kita, Kiyoshi


    In addition to haem copper oxidases, all higher plants, some algae, yeasts, molds, metazoans, and pathogenic microorganisms such as Trypanosoma brucei contain an additional terminal oxidase, the cyanide-insensitive alternative oxidase (AOX). AOX is a diiron carboxylate protein that catalyzes the four-electron reduction of dioxygen to water by ubiquinol. In T. brucei, a parasite that causes human African sleeping sickness, AOX plays a critical role in the survival of the parasite in its bloodstream form. Because AOX is absent from mammals, this protein represents a unique and promising therapeutic target. Despite its bioenergetic and medical importance, however, structural features of any AOX are yet to be elucidated. Here we report crystal structures of the trypanosomal alternative oxidase in the absence and presence of ascofuranone derivatives. All structures reveal that the oxidase is a homodimer with the nonhaem diiron carboxylate active site buried within a four-helix bundle. Unusually, the active site is ligated solely by four glutamate residues in its oxidized inhibitor-free state; however, inhibitor binding induces the ligation of a histidine residue. A highly conserved Tyr220 is within 4 Å of the active site and is critical for catalytic activity. All structures also reveal that there are two hydrophobic cavities per monomer. Both inhibitors bind to one cavity within 4 Å and 5 Å of the active site and Tyr220, respectively. A second cavity interacts with the inhibitor-binding cavity at the diiron center. We suggest that both cavities bind ubiquinol and along with Tyr220 are required for the catalytic cycle for O2 reduction. PMID:23487766

  4. Localization of the Dual Oxidase BLI-3 and Characterization of Its NADPH Oxidase Domain during Infection of Caenorhabditis elegans.


    van der Hoeven, Ransome; Cruz, Melissa R; Chávez, Violeta; Garsin, Danielle A


    Dual oxidases (DUOX) are enzymes that contain an NADPH oxidase domain that produces hydrogen peroxide (H2O2) and a peroxidase domain that can utilize H2O2 to carry out a variety of reactions. The model organism Caenorhabditis elegans produces the DUOX, BLI-3, which has roles in both cuticle development and in protection against infection. In previous work, we demonstrated that while certain peroxidases were protective against the human bacterial pathogen Enterococcus faecalis, the peroxidase domain of BLI-3 was not, leading to the postulate that the NADPH oxidase domain is the basis for BLI-3's protective effects. In this work, we show that a strain carrying a mutation in the NADPH oxidase domain of BLI-3, bli-3(im10), is more susceptible to E. faecalis and the human fungal pathogen Candida albicans. Additionally, less H2O2 is produced in response to pathogen using both an established Amplex Red assay and a strain of C. albicans, WT-OXYellow, which acts as a biosensor of reactive oxygen species (ROS). Finally, a C. elegans line containing a BLI-3::mCherry transgene was generated. Previous work suggested that BLI-3 is produced in the hypodermis and the intestine. Expression of the transgene was observed in both these tissues, and additionally in the pharynx. The amount and pattern of localization of BLI-3 did not change in response to pathogen exposure. PMID:25909649

  5. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.


    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu


    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  6. Inheritance of polyphenol oxidase activity in wheat breeding lines derived from matings of low polyphenol oxidase parents

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) in grain plays a major role in time-dependent discoloration of wheat (Triticum aestivum L.) products, especially fresh noodles. Breeding wheat cultivars with low or nil PPO activity can reduce the undesirable product darkening. The low PPO line PI 117635 was crossed to two...

  7. Possible Role of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Activity of Sinorhizobium sp. BL3 on Symbiosis with Mung Bean and Determinate Nodule Senescence

    PubMed Central

    Tittabutr, Panlada; Sripakdi, Sudarat; Boonkerd, Nantakorn; Tanthanuch, Waraporn; Minamisawa, Kiwamu; Teaumroong, Neung


    Sinorhizobium sp. BL3 forms symbiotic interactions with mung bean (Vigna radiata) and contains lrpL-acdS genes, which encode the 1-aminocyclopropane-1-carboxylate (ACC) deaminase enzyme that cleaves ACC, a precursor of plant ethylene synthesis. Since ethylene interferes with nodule formation in some legumes and plays a role in senescence in plant cells, BL3-enhancing ACC deaminase activity (BL3+) and defective mutant (BL3−) strains were constructed in order to investigate the effects of this enzyme on symbiosis and nodule senescence. Nodulation competitiveness was weaker in BL3− than in the wild-type, but was stronger in BL3+. The inoculation of BL3− into mung bean resulted in less plant growth, a lower nodule dry weight, and smaller nodule number than those in the wild-type, whereas the inoculation of BL3+ had no marked effects. However, similar nitrogenase activity was observed with all treatments; it was strongly detected 3 weeks after the inoculation and gradually declined with time, indicating senescence. The rate of plant nodulation by BL3+ increased in a time-dependent manner. Nodules occupied by BL3− formed smaller symbiosomes, and bacteroid degradation was more prominent than that in the wild-type 7 weeks after the inoculation. Changes in biochemical molecules during nodulation were tracked by Fourier Transform Infrared (FT-IR) microspectroscopy, and the results obtained confirmed that aging processes differed in nodules occupied by BL3 and BL3−. This is the first study to show the possible role of ACC deaminase activity in senescence in determinate nodules. Our results suggest that an increase in ACC deaminase activity in this strain does not extend the lifespan of nodules, whereas the lack of this activity may accelerate nodule senescence. PMID:26657304

  8. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.


    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi


    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1. PMID:27110861

  9. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases.


    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze theo-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme's interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate-enzyme complexes were performed, and a key residue was identified that influences the plant PPO's acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their--so far unknown--natural substrates in vivo. PMID:26976571

  10. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    PubMed Central

    Molitor, Christian; Mauracher, Stephan Gerhard


    Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571

  11. Lysyl oxidase-like 2 (LOXL2) and E47 EMT factor: novel partners in E-cadherin repression and early metastasis colonization.


    Canesin, G; Cuevas, E P; Santos, V; López-Menéndez, C; Moreno-Bueno, G; Huang, Y; Csiszar, K; Portillo, F; Peinado, H; Lyden, D; Cano, A


    Epithelial-mesenchymal transition (EMT) has been associated with increased aggressiveness and acquisition of migratory properties providing tumor cells with the ability to invade into adjacent tissues. Downregulation of E-cadherin, a hallmark of EMT, is mediated by several transcription factors (EMT-TFs) that act also as EMT inducers, among them, Snail1 and the bHLH transcription factor E47. We previously described lysyl oxidase-like 2 (LOXL2), a member of the lysyl oxidase family, as a Snail1 regulator and EMT inducer. Here we show that LOXL2 is also an E47-interacting partner and functionally collaborates in the repression of E-cadherin promoter. Loss and gain of function analyses combined with in vivo studies in syngeneic breast cancer models demonstrate the participation of LOXL2 and E47 in tumor growth and their requirement for lung metastasis. Furthermore, LOXL2 and E47 contribute to early steps of metastatic colonization by cell and noncell autonomous functions regulating the recruitment of bone marrow progenitor cells to the lungs and by direct transcriptional regulation of fibronectin and cytokines TNFα, ANG-1 and GM-CSF. Moreover, fibronectin and GM-CSF proved to be necessary for LOXL2/E47-mediated modulation of tumor growth and lung metastasis. PMID:24632622

  12. Phenol oxidase activity in secondary transformed peat-moorsh soils

    NASA Astrophysics Data System (ADS)

    Styła, K.; Szajdak, L.


    The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci

  13. Induction of nicotinamide-adenine dinucleotide phosphate oxidase and apoptosis by biodegradable polymers in macrophages: implications for stents.


    Potnis, Pushya A; Tesfamariam, Belay; Wood, Steven C


    The drug-eluting stent platform has a limited surface area, and a polymer carrier matrix is coated to enable sufficient loading of drugs. The development of a suitable polymer has been challenging because it must exhibit biocompatibility with the intravascular milieu. The use of biodegradable polymers seems to be attractive because it enables drug release as it degrades and is eventually eliminated from the body leaving the permanent metallic stent polymer-free. The aim of this study was to investigate the biocompatibility of biodegradable polymers using the human monocyte cell line. Cultured monocytes differentiated into functional macrophages (THP-1) were incubated with various polymers including poly-L-lactide (PLA), polycaprolactone (PCL), or poly-D, L-lactide-co-glycolide (PLGA) for up to 5 days. Exposure of cells to the polymers resulted in macrophage-polymer adhesion and induced marked pro-oxidant species as measured by calcein AM uptake assay and flow cytometric analysis of 2',7'-dichlorofluorescin fluorescence, respectively. Real-time reverse-transcription polymerase chain reaction and Western blot analysis of expression of nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases revealed enhanced expression of NADPH oxidase subunits in response to PLA and PLGA compared with that of PCL. Flow cytometric analysis of fluorescein isothiocyanate-Annexin V and propium iodide-stained PLA and PGLA polymer-exposed THP-1 cells showed early and late apoptotic changes. Similarly, exposure to the PLA and PGLA polymers, but not to the PCL polymer, resulted in enhanced staining for cleaved poly(ADP-ribose) polymerase-1, a protein fragment produced by caspase cleavage. These results indicate that biodegradable polymers are associated with cell adhesion, NADPH oxidase-induced generation of reactive oxygen species and excess apoptosis. PMID:21436724

  14. NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

    SciTech Connect

    Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin; Park, Ji-hoon; Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook; Kim, Soon Ha


    Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.


    Xin, Shan; Tao, Chengcheng; Li, Hongbin


    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  16. Oxygen reactivity of mammalian sulfite oxidase provides a concept for the treatment of sulfite oxidase deficiency.


    Belaidi, Abdel A; Röper, Juliane; Arjune, Sita; Krizowski, Sabina; Trifunovic, Aleksandra; Schwarz, Guenter


    Mammalian sulfite oxidase (SO) is a dimeric enzyme consisting of a molybdenum cofactor- (Moco) and haem-containing domain and catalyses the oxidation of toxic sulfite to sulfate. Following sulfite oxidation, electrons are passed from Moco via the haem cofactor to cytochrome c, the terminal electron acceptor. In contrast, plant SO (PSO) lacks the haem domain and electrons shuttle from Moco to molecular oxygen. Given the high similarity between plant and mammalian SO Moco domains, factors that determine the reactivity of PSO towards oxygen, remained unknown. In the present study, we generated mammalian haem-deficient and truncated SO variants and demonstrated their oxygen reactivity by hydrogen peroxide formation and oxygen-consumption studies. We found that intramolecular electron transfer between Moco and haem showed an inverse correlation to SO oxygen reactivity. Haem-deficient SO variants exhibited oxygen-dependent sulfite oxidation similar to PSO, which was confirmed further using haem-deficient human SO in a cell-based assay. This finding suggests the possibility to use oxygen-reactive SO variants in sulfite detoxification, as the loss of SO activity is causing severe neurodegeneration. Therefore we evaluated the potential use of PEG attachment (PEGylation) as a modification method for future enzyme substitution therapies using oxygen-reactive SO variants, which might use blood-dissolved oxygen as the electron acceptor. PEGylation has been shown to increase the half-life of other therapeutic proteins. PEGylation resulted in the modification of up to eight surface-exposed lysine residues of SO, an increased conformational stability and similar kinetic properties compared with wild-type SO. PMID:26171830

  17. Essential Role of Cytochrome bd-Related Oxidase in Cyanide Resistance of Pseudomonas pseudoalcaligenes CECT5344▿ †

    PubMed Central

    Quesada, Alberto; Guijo, M. Isabel; Merchán, Faustino; Blázquez, Blas; Igeño, M. Isabel; Blasco, Rafael


    Pseudomonas pseudoalcaligenes CECT5344 grows in minimal medium containing cyanide as the sole nitrogen source. Under these conditions, an O2-dependent respiration highly resistant to cyanide was detected in cell extracts. The structural genes for the cyanide-resistant terminal oxidase, cioA and cioB, are clustered and encode the integral membrane proteins that correspond to subunits I and II of classical cytochrome bd, although the presence of heme d in the membrane could not be detected by difference spectra. The cio operon from P. pseudoalcaligenes presents a singular organization, starting upstream of cioAB by the coding sequence of a putative ferredoxin-dependent sulfite or nitrite reductase and spanning downstream two additional open reading frames that encode uncharacterized gene products. PCR amplifications of RNA (reverse transcription-PCR) indicated the cyanide-dependent up-regulation and cotranscription along the operon. The targeted disruption of cioA eliminates both the expression of the cyanide-stimulated respiratory activity and the growth with cyanide as the nitrogen source, which suggests a critical role of this cytochrome bd-related oxidase in the metabolism of cyanide by P. pseudoalcaligenes CECT5344. PMID:17574992

  18. Neolignans as xanthine oxidase inhibitors from Hyptis rhomboides.


    Tsai, Sheng-Fa; Lee, Shoei-Sheng


    The active fraction from the EtOH extract of Hyptis rhomboides against xanthine oxidase was identified by use of an HPLC microfractionation-centrifugal vacuum evaporation-bioassay hyphenated technique. Scale-up separation of the active subfractions using semi-preparative RP-HPLC provided 13 phenylpropanoid compounds, including O-styrenylneolignans, hyprhombins A-C, epihyprhombin B, and hyprhombin B methyl ester, and O-caffeoylnorneolignans, hyprhombins D and E. All of these compounds shared a common 1,4-benzodioxane skeleton, as established by spectroscopic analyses. Hyprhombin C and epihyprhombin B exhibited better anti-xanthine oxidase activity than allopurinol, with IC50 values of 0.6 and 2.0 μM, respectively. PMID:24559911

  19. Bilirubin oxidases in bioelectrochemistry: features and recent findings.


    Mano, Nicolas; Edembe, Lise


    Bilirubin oxidases, a sub class of the Multicopper oxidases family, were discovered in 1981 by Tanaka and Murao (Murao and Tanaka, 1981) and first used for the detection of bilirubin. Since 2001 and the pioneering work of Tsujimura, these BODs have attracted a lot of attention for the reduction of O2. Unlike laccases, these BODs are stable in physiological conditions (20mM phosphate buffer, pH 7.4, 0.14 M NaCl, 37 °C) and more than 120 papers have been published in the last 7 years. Here, we will first briefly describe some general features of BODs and then review the use of BODs for bilirubin biosensors and the recent achievements and progress toward the elaboration of efficient O2 reducing cathodes. PMID:23911663

  20. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )


    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  1. Alternative oxidase expression in aged potato tuber slices

    SciTech Connect

    Hiser, C.; Herdies, L.; McIntosh, L. )


    Higher plant mitochondria posses a cyanide-resistant, hydroxamate-sensitive alternative pathway of electron transport that does not conserve energy. Aging of potato tuber slices for 24 hours leads to the development of an alternative pathway capacity. We have shown that a monoclonal antibody raised against the alternative pathway terminal oxidase of Sauromatum guttatum crossreacts with a protein of similar size in aged potato slice mitochondria. This protein was partially purified and characterized by two-dimensional gel electrophoresis, and its relative levels parallel the rise in cyanide-resistant respiration. We are using a putative clone of the S. guttatum alternative oxidase gene to isolate the equivalent gene from potato and to examine its expression.

  2. Tyrosinase versus Catechol Oxidase: One Asparagine Makes the Difference.


    Solem, Even; Tuczek, Felix; Decker, Heinz


    Tyrosinases mediate the ortho-hydroxylation and two-electron oxidation of monophenols to ortho-quinones. Catechol oxidases only catalyze the oxidation of diphenols. Although it is of significant interest, the origin of the functional discrimination between tyrosinases and catechol oxidases has been unclear. Recently, it has been postulated that a glutamate and an asparagine bind and activate a conserved water molecule towards deprotonation of monophenols. Here we demonstrate for the first time that a polyphenoloxidase, which exhibits only diphenolase activity, can be transformed to a tyrosinase by mutation to introduce an asparagine. The asparagine and a conserved glutamate are necessary to properly orient the conserved water in order to abstract a proton from the monophenol. These results provide direct evidence for the crucial importance of a proton shuttle for tyrosinase activity of type 3 copper proteins, allowing a consistent understanding of their different chemical reactivities. PMID:26773413

  3. Glycosides and xanthine oxidase inhibitors from Conyza bonariensis.


    Kong, L D; Abliz, Z; Zhou, C X; Li, L J; Cheng, C H; Tan, R X


    Fractionation of the xanthine oxidase inhibitory methanol extract of Conyza bonariensis afforded three glycosides, in addition to nine known compounds including amyrin, beta-sitostero1 daucosterol, syringic acid 3-hydroxy-5-methoxybenzoic acid, eugenol 4-O-glucopyranoside, and luteolin, apigenin and takakin 8-O-glucuronide. The structures of the glycosides were established by a combination of spectroscopic methods (IR, MS, 1H and 13C NMR, DEPT, COSY, HMQC and HMBC) as 4-hydroxypyridin-3-carboxylic acid 4-O-glucopyranoside, 8-hydroxy-6,7-dihydrolinalool 8-O-glucopyranoside and bonaroside [viz. 1,3,4,12-tetrahydroxy-2-(9-hexadecenoylamino)octadecane 1-O-glucopyranoside]. The in vitro enzyme assay showed that syringic acid and takakin 8-O-glucuronide displayed weak inhibitory activity against xanthine oxidase with IC50 values of 500+/-41 microM and 170+/-12 microM, respectively. PMID:11576616

  4. A new crystal form of human diamine oxidase.


    McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Dooley, David M; Guss, J Mitchell


    Copper amine oxidases (CAOs) are ubiquitous in nature and catalyse the oxidative deamination of primary amines to the corresponding aldehydes. Humans have three viable CAO genes (AOC1-3). AOC1 encodes human diamine oxidase (hDAO), which is the frontline enzyme for histamine metabolism. hDAO is unique among CAOs in that it has a distinct substrate preference for diamines. The structure of hDAO in space group P2(1)2(1)2(1) with two molecules in the asymmetric unit has recently been reported. Here, the structure of hDAO refined to 2.1 A resolution in space group C222(1) with one molecule in the asymmetric unit is reported. PMID:20124708

  5. NADPH oxidase-derived reactive oxygen species in cardiac pathophysiology

    PubMed Central

    Cave, Alison; Grieve, David; Johar, Sofian; Zhang, Min; Shah, Ajay M


    Chronic heart failure, secondary to left ventricular hypertrophy or myocardial infarction, is a condition with increasing morbidity and mortality. Although the mechanisms underlying the development and progression of this condition remain a subject of intense interest, there is now growing evidence that redox-sensitive pathways play an important role. This article focuses on the involvement of reactive oxygen species derived from a family of superoxide-generating enzymes, termed NADPH oxidases (NOXs), in the pathophysiology of ventricular hypertrophy, the accompanying interstitial fibrosis and subsequent heart failure. In particular, the apparent ability of the different NADPH oxidase isoforms to define the response of a cell to a range of physiological and pathophysiological stimuli is reviewed. If confirmed, these data would suggest that independently targeting different members of the NOX family may hold the potential for therapeutic intervention in the treatment of cardiac disease. PMID:16321803

  6. T lymphocyte killing by a xanthine-oxidase-containing immunotoxin.


    Battelli, M G; Abbondanza, A; Tazzari, P L; Bolognesi, A; Lemoli, R M; Stirpe, F


    We report on the preparation of an immunotoxin consisting of xanthine oxidase, a free-radical-producing enzyme, covalently linked to an anti-CD3 monoclonal antibody. The immunotoxin retained both enzymic and immunological properties and its toxicity to target cells (a) was greater than that of the free enzyme, (b) was proportional to the enzyme concentration, and (c) was reduced either in the absence of hypoxanthine or by an excess of free anti-CD3 monoclonal antibody. The cytotoxicity and selectivity of the hypoxanthine/conjugated xanthine oxidase system were potentiated by the addition of chelated iron and by washing away the unbound immunotoxin prior to the addition of substrate. The same system was not toxic to bone marrow progenitor cells. A possible use of this immunotoxin for the ex vivo purging of organs to be transplanted from T lymphocytes, to avoid the graft-versus-host reaction, is suggested. PMID:1394345

  7. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

    PubMed Central

    Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping


    Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

  8. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.


    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo


    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  9. Crystal structures of intermediates in the nitroalkane oxidase reaction.


    Héroux, Annie; Bozinovski, Dragana M; Valley, Michael P; Fitzpatrick, Paul F; Orville, Allen M


    The flavoenzyme nitroalkane oxidase is a member of the acyl-CoA dehydrogenase superfamily. Nitroalkane oxidase catalyzes the oxidation of neutral nitroalkanes to nitrite and the corresponding aldehydes or ketones. Crystal structures to 2.2 A resolution or better of enzyme complexes with bound substrates and of a trapped substrate-flavin adduct are described. The D402N enzyme has no detectable activity with neutral nitroalkanes [Valley, M. P., and Fitzpatrick, P. F. (2003) J. Am. Chem. Soc. 125, 8738-8739]. The structure of the D402N enzyme crystallized in the presence of 1-nitrohexane or 1-nitrooctane shows the presence of the substrate in the binding site. The aliphatic chain of the substrate extends into a tunnel leading to the enzyme surface. The oxygens of the substrate nitro group interact both with amino acid residues and with the 2'-hydroxyl of the FAD. When nitroalkane oxidase oxidizes nitroalkanes in the presence of cyanide, an electrophilic flavin imine intermediate can be trapped [Valley, M. P., Tichy, S. E., and Fitzpatrick, P. F. (2005) J. Am. Chem. Soc. 127, 2062-2066]. The structure of the enzyme trapped with cyanide during oxidation of 1-nitrohexane shows the presence of the modified flavin. A continuous hydrogen bond network connects the nitrogen of the CN-hexyl-FAD through the FAD 2'-hydroxyl to a chain of water molecules extending to the protein surface. Together, our complementary approaches provide strong evidence that the flavin cofactor is in the appropriate oxidation state and correlates well with the putative intermediate state observed within each of the crystal structures. Consequently, these results provide important structural descriptions of several steps along the nitroalkane oxidase reaction cycle. PMID:19265437

  10. Crystal Structures of Intermediates in the Nitroalkane Oxidase Reaction

    SciTech Connect

    Heroux, A.; Bozinovski, D; Valley, M; Fitzpatrick, P; Orville, A


    The flavoenzyme nitroalkane oxidase is a member of the acyl-CoA dehydrogenase superfamily. Nitroalkane oxidase catalyzes the oxidation of neutral nitroalkanes to nitrite and the corresponding aldehydes or ketones. Crystal structures to 2.2 {angstrom} resolution or better of enzyme complexes with bound substrates and of a trapped substrate-flavin adduct are described. The D402N enzyme has no detectable activity with neutral nitroalkanes. The structure of the D402N enzyme crystallized in the presence of 1-nitrohexane or 1-nitrooctane shows the presence of the substrate in the binding site. The aliphatic chain of the substrate extends into a tunnel leading to the enzyme surface. The oxygens of the substrate nitro group interact both with amino acid residues and with the 2'-hydroxyl of the FAD. When nitroalkane oxidase oxidizes nitroalkanes in the presence of cyanide, an electrophilic flavin imine intermediate can be trapped (Valley, M. P., Tichy, S. E., and Fitzpatrick, P. F. (2005) J. Am. Chem. Soc. 127, 2062-2066). The structure of the enzyme trapped with cyanide during oxidation of 1-nitrohexane shows the presence of the modified flavin. A continuous hydrogen bond network connects the nitrogen of the CN-hexyl-FAD through the FAD 2'-hydroxyl to a chain of water molecules extending to the protein surface. Together, our complementary approaches provide strong evidence that the flavin cofactor is in the appropriate oxidation state and correlates well with the putative intermediate state observed within each of the crystal structures. Consequently, these results provide important structural descriptions of several steps along the nitroalkane oxidase reaction cycle.

  11. Characterization of two brassinosteroid C-6 oxidase genes in pea.


    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B


    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  12. Use of a xanthine oxidase inhibitor in autoimmune hepatitis.


    Al-Shamma, Safa; Eross, Balint; Mclaughlin, Simon


    A 62-year-old woman with type 1 autoimmune hepatitis (AIH) failed to sustain remission when steroids were withdrawn from a regimen of steroids and azathioprine (AZA). Thiopurine metabolites revealed elevated 6-MMP (6-methyl mercaptopurine) and low 6-TGN (6-thioguanine nucleotide) consistent with AZA-induced hepatotoxicity. Introducing the xanthine oxidase inhibitor allopurinol led to rapid normalization of alanine aminotransferase (ALT) and discontinuation of steroids. PMID:23238820

  13. Structures and Mechanism of the Monoamine Oxidase Family

    PubMed Central

    Gaweska, Helena; Fitzpatrick, Paul F.


    Members of the monoamine oxidase family of flavoproteins catalyze the oxidation of primary and secondary amines, polyamines, amino acids, and methylated lysine side chains in proteins. The enzymes have similar overall structures, with conserved FAD-binding domains and varied substrate-binding sites. Multiple mechanisms have been proposed for the catalytic reactions of these enzymes. The present review compares the structures of different members of the family and the various mechanistic proposals. PMID:22022344

  14. Studies of GA sub 53 oxidase from spinach

    SciTech Connect

    Wilson, T.; Zeevaart, J.A.D. )


    GA{sub 53} oxidase was purified 1,750-fold with 1% recovery of activity from spinach after exposure to 8 long days. This preparation was injected into balb/c mice and hybridomas from spleen cells were produced. Upon preliminary screening by immunoprecipitation of enzyme activity, three positive cell lines were selected. These are being cloned to select a true monoclonal antibody cell line. This antibody will be used to study the light/dark regulation of this enzyme.

  15. Functional characterization of alcohol oxidases from Aspergillus terreus MTCC 6324.


    Kumar, A Kiran; Goswami, Pranab


    Short chain alcohol oxidase (SCAO), long chain alcohol oxidase (LCAO), secondary alcohol oxidase (SAO), and aryl alcohol oxidase (AAO) activities were localized in the microsome of Aspergillus terreus during growth of the fungi on n-hexadecane. Zymogram analysis of the microsomes of n-hexadecane-grown cells in polyacrylamide gel electrophoresis showed distinct bands, H4, H3, H2, and H1, in a sequence of their molecular weight (Mr) from high to low. The Mr of the isozymes corresponding to the bands H4, H3, and H2 were close to each other and were higher than 272 kDa. While, the Mr of the isozyme H1 was found to be approximately 48 kDa. H1 gave activity only as SCAO. Although the substrates for other bands were varied, strong (S), medium (M), and weak (W) activity for the bands were as follows: H2: SAO (S), AAO (S), LCAO (M), SCAO (S); H3: LCAO (S), SCAO (S); H4: SCAO (S), LCAO (W), SAO (W). The pH and temperature optima of these isozymes were found to be 8.5+/-0.5 and 30+/-1 degrees C, respectively. The stability of the isozymes was drastically decreased beyond 30 degrees C. The SAO showed 33% enantiomeric excess for the R(-)2-octanol over S(+)2-octanol, which may be correlated with the lower Michaelis-Menten constant (K (M)) values of the enzyme for the R(-)2-octanol than the S(+)2-octanol. The fluorescence emission spectra of the chromatographically purified SCAO at 443 nm excitation were similar to that obtained with authentic flavin adenine dinucleotide. PMID:16547701

  16. Four novel mutations of the coproporphyrinogen III oxidase gene.


    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G


    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  17. Copper Transport Protein Antioxidant-1 Promotes Inflammatory Neovascularization via Chaperone and Transcription Factor Function.


    Chen, Gin-Fu; Sudhahar, Varadarajan; Youn, Seock-Won; Das, Archita; Cho, Jaehyung; Kamiya, Tetsuro; Urao, Norifumi; McKinney, Ronald D; Surenkhuu, Bayasgalan; Hamakubo, Takao; Iwanari, Hiroko; Li, Senlin; Christman, John W; Shantikumar, Saran; Angelini, Gianni D; Emanueli, Costanza; Ushio-Fukai, Masuko; Fukai, Tohru


    Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and recently discovered as a Cu-dependent transcription factor, in inflammatory neovascularization. Atox1 expression is upregulated in patients and mice with critical limb ischemia. Atox1-deficient mice show impaired limb perfusion recovery with reduced arteriogenesis, angiogenesis, and recruitment of inflammatory cells. In vivo intravital microscopy, bone marrow reconstitution, and Atox1 gene transfer in Atox1(-/-) mice show that Atox1 in endothelial cells (ECs) is essential for neovascularization and recruitment of inflammatory cells which release VEGF and TNFα. Mechanistically, Atox1-depleted ECs demonstrate that Cu chaperone function of Atox1 mediated through Cu transporter ATP7A is required for VEGF-induced angiogenesis via activation of Cu enzyme lysyl oxidase. Moreover, Atox1 functions as a Cu-dependent transcription factor for NADPH oxidase organizer p47phox, thereby increasing ROS-NFκB-VCAM-1/ICAM-1 expression and monocyte adhesion in ECs inflamed with TNFα in an ATP7A-independent manner. These findings demonstrate a novel linkage between Atox1 and NADPH oxidase involved in inflammatory neovascularization and suggest Atox1 as a potential therapeutic target for treatment of ischemic disease. PMID:26437801

  18. Copper Transport Protein Antioxidant-1 Promotes Inflammatory Neovascularization via Chaperone and Transcription Factor Function

    PubMed Central

    Chen, Gin-Fu; Sudhahar, Varadarajan; Youn, Seock-Won; Das, Archita; Cho, Jaehyung; Kamiya, Tetsuro; Urao, Norifumi; McKinney, Ronald D.; Surenkhuu, Bayasgalan; Hamakubo, Takao; Iwanari, Hiroko; Li, Senlin; Christman, John W.; Shantikumar, Saran; Angelini, Gianni D.; Emanueli, Costanza; Ushio-Fukai, Masuko; Fukai, Tohru


    Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and recently discovered as a Cu-dependent transcription factor, in inflammatory neovascularization. Atox1 expression is upregulated in patients and mice with critical limb ischemia. Atox1-deficient mice show impaired limb perfusion recovery with reduced arteriogenesis, angiogenesis, and recruitment of inflammatory cells. In vivo intravital microscopy, bone marrow reconstitution, and Atox1 gene transfer in Atox1−/− mice show that Atox1 in endothelial cells (ECs) is essential for neovascularization and recruitment of inflammatory cells which release VEGF and TNFα. Mechanistically, Atox1-depleted ECs demonstrate that Cu chaperone function of Atox1 mediated through Cu transporter ATP7A is required for VEGF-induced angiogenesis via activation of Cu enzyme lysyl oxidase. Moreover, Atox1 functions as a Cu-dependent transcription factor for NADPH oxidase organizer p47phox, thereby increasing ROS-NFκB-VCAM-1/ICAM-1 expression and monocyte adhesion in ECs inflamed with TNFα in an ATP7A-independent manner. These findings demonstrate a novel linkage between Atox1 and NADPH oxidase involved in inflammatory neovascularization and suggest Atox1 as a potential therapeutic target for treatment of ischemic disease. PMID:26437801

  19. Alkylamino derivatives of 4-aminomethylpyridine as inhibitors of copper-containing amine oxidases.


    Bertini, Vincenzo; Buffoni, Franca; Ignesti, Giovanni; Picci, Nevio; Trombino, Sonia; Iemma, Francesca; Alfei, Silvana; Pocci, Marco; Lucchesini, Francesco; De Munno, Angela


    The first substratelike, reversible inhibitors of different copper amine oxidases (CAOs) with IC50 (M) as low as 2.0 x 10(-8) corresponding to derivatives of 4-aminomethylpyridine with alkoxy (1a-d), alkylthio (2a,b), and alkylamino (3a-e, 4a-j) groups in the positions 3 and 5 have been prepared and studied. The inhibitors 1a-d are active on benzylamine oxidase and semicarbazide-sensitive amine oxidase and are very selective with respect to diamine oxidase, lysyl oxidase, and monoamine oxidases. The inhibitors 2a,b are selective for benzylamine oxidase whereas 2a is also a new type of good substrate of diamine oxidase. The inhibitors 3a-e and 4a-j are substratelike, reversible, nonselective inhibitors of various CAOs including pea seedling amine oxidase and Hansenula polymorpha amine oxidase, whose enzymatic sites are known from X-ray structure determinations. The inhibitors 3b,c and 4b,c are excellent substratelike tools for studies correlating CAOs that afford crystals suitable for X-ray structure determinations with CAOs from mammals. PMID:15689151

  20. [Respiratory oxidases: the enzymes which use most of the oxygen which living things breathe].


    Toledo-Cuevas, E M


    The respiratory oxidases are the last enzymes of the aerobic respiratory chain. They catalize the reduction of molecular oxygen to water, with generation of an electrochemical gradient useful for the energy demanding cellular processes. Most of the oxidases belong to the heme-copper superfamily. They possess a heme-copper center, constituted of a high spin heme and a CuB center, where the reduction of oxygen takes place and probably where the link to proton pumping is located. The superfamily is divided in two classes: the quinol- and the cytochrome c-oxidases. The latter are divided in the aa3 and the cbb3-type cytochrome c oxidases. The main difference between quinol- and the aa3-type cytochrome c-oxidases is the CuA center, which is absent in the quinol oxidases. The cbb3-type cytochrome oxidases have the binuclear center, but lack the CuA center. They also does not have the classical subunits II and III. These differences seem not to affect the oxygen reduction or the proton pumping. Probably the oxidases have evolved from some denitrification enzymes and prior the photosynthetic process. Also is possible that the cbb3-type cytochrome oxidases or others very similar have been the first oxidases to appear. PMID:10932727

  1. Characterization of Euphorbia characias Latex Amine Oxidase1

    PubMed Central

    Padiglia, Alessandra; Medda, Rosaria; Lorrai, Anita; Murgia, Barbara; Pedersen, Jens Z.; Finazzi Agró, Alessandro; Floris, Giovanni


    A copper-containing amine oxidase from the latex of Euphorbia characias was purified to homogeneity and the copper-free enzyme obtained by a ligand-exchange procedure. The interactions of highly purified apo- and holoenzyme with several substrates, carbonyl reagents, and copper ligands were investigated by optical spectroscopy under both aerobic and anaerobic conditions. The extinction coefficients at 278 and 490 nm were determined as 3.78 × 105 m−1 cm−1 and 6000 m−1 cm−1, respectively. Active-site titration of highly purified enzyme with substrates and carbonyl reagents showed the presence of one cofactor at each enzyme subunit. In anaerobiosis the native enzyme oxidized one equivalent substrate and released one equivalent aldehyde per enzyme subunit. The apoenzyme gave exactly the same 1:1:1 stoichiometry in anaerobiosis and in aerobiosis. These findings demonstrate unequivocally that copper-free amine oxidase can oxidize substrates with a single half-catalytic cycle. The DNA-derived protein sequence shows a characteristic hexapeptide present in most 6-hydroxydopa quinone-containing amine oxidases. This hexapeptide contains the tyrosinyl residue that can be modified into the cofactor 6-hydroxydopa quinone. PMID:9701592

  2. Potential xanthine oxidase inhibitory activity of endophytic Lasiodiplodia pseudotheobromae.


    Kapoor, Neha; Saxena, Sanjai


    Xanthine oxidase is considered as a potential target for treatment of hyperuricemia. Hyperuricemia is predisposing factor for gout, chronic heart failure, atherosclerosis, tissue injury, and ischemia. To date, only two inhibitors of xanthine oxidase viz. allopurinol and febuxostat have been clinically approved for used as drugs. In the process of searching for new xanthine oxidase inhibitors, we screened culture filtrates of 42 endophytic fungi using in vitro qualitative and quantitative XO inhibitory assays. The qualitative assay exhibited potential XO inhibition by culture filtrates of four isolates viz. #1048 AMSTITYEL, #2CCSTITD, #6AMLWLS, and #96 CMSTITNEY. The XO inhibitory activity was present only in the chloroform extract of the culture filtrates. Chloroform extract of culture filtrate #1048 AMSTITYEL exhibited the highest inhibition of XO with an IC50 value of 0.61 μg ml(-1) which was better than allopurinol exhibiting an IC50 of 0.937 μg ml(-1) while febuxostat exhibited a much lower IC50 of 0.076 μg ml(-1). Further, molecular phylogenetic tools and morphological studies were used to identify #1048 AMSTITYEL as Lasiodiplodia pseudotheobromae. This is the first report of an endophytic Lasiodiplodia pseudotheobromae from Aegle marmelos exhibiting potential XO Inhibitory activity. PMID:24801403

  3. Phagocyte NADPH oxidase: a multicomponent enzyme essential for host defenses.


    El-Benna, Jamel; Dang, Pham My-Chan; Gougerot-Pocidalo, Marie-Anne; Elbim, Carole


    Phagocytes such as neutrophils and monocytes play an essential role in host defenses against microbial pathogens. Reactive oxygen species (ROS), such as superoxide anion, hydrogen peroxide, the hydroxyl radical, and hypochlorous acid, together with microbicidal peptides and proteases, constitute their antimicrobial arsenal. The enzyme responsible for superoxide anion production and, consequently, ROS generation, is called NADPH oxidase or respiratory burst oxidase. This multicomponent enzyme system is composed of cytosolic proteins (p47phox, p67phox, p40phox, and rac1/2) and membrane proteins (p22phox and gp91phox, which form cytochrome b558) which assemble at membrane sites upon cell activation. The importance of this enzyme in host defenses is illustrated by a life-threatening genetic disorder called chronic granulomatous disease in which the phagocyte enzyme is dysfunctional, leading to life-threatening bacterial and fungal infections. Also, because ROS can damage surrounding tissues, their production, and thus NADPH oxidase activation, must be tightly regulated. This review describes the structure and activation of the neutrophil NADPH enzyme complex. PMID:15995580

  4. Androgen receptor and monoamine oxidase polymorphism in wild bonobos.


    Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho


    Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

  5. Reaction mechanism of mammalian mitochondrial cytochrome c oxidase.


    Yoshikawa, Shinya; Muramoto, Kazumasa; Shinzawa-Itoh, Kyoko


    Cytochrome c oxidase (COX) is the terminal oxidase of the mitochondrial respiratory system. This enzyme reduces molecular oxygen (O(2)) to water in a reaction coupled with the pumping of protons across the mitochondrial inner membrane. Progress in investigating the reaction mechanism of this enzyme has been limited by the resolution of its X-ray structure. Bovine heart COX has provided the highest resolution (1.8 Å) X-ray structure presently available among the terminal oxidases. The reaction mechanism of the bovine heart enzyme has been the most extensively studied, particularly with respect to (1) the reduction of O(2) to water without release of reactive oxygen species, (2) the mechanism of coupling between the O(2) reduction process and proton pumping, (3) the structural basis for unidirectional proton transfer (proton pumping), and (4) the effective prevention of proton leakage from the proton-pumping pathway to the proton pathway used for generation of water molecules. In this chapter, we will review recent structural studies of bovine heart COX and discuss the mechanisms described earlier in context of the structural data. PMID:22729860

  6. The Transcription Factor Encyclopedia

    PubMed Central


    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at PMID:22458515

  7. The transcription factor encyclopedia.


    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W


    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at PMID:22458515

  8. Disruption of cytochrome c oxidase function induces the Warburg effect and metabolic reprogramming.


    Srinivasan, S; Guha, M; Dong, D W; Whelan, K A; Ruthel, G; Uchikado, Y; Natsugoe, S; Nakagawa, H; Avadhani, N G


    Defects in mitochondrial oxidative phosphorylation complexes, altered bioenergetics and metabolic shift are often seen in cancers. Here we show a role for the dysfunction of the electron transport chain component cytochrome c oxidase (CcO) in cancer progression. We show that genetic silencing of the CcO complex by shRNA expression and loss of CcO activity in multiple cell types from the mouse and human sources resulted in metabolic shift to glycolysis, loss of anchorage-dependent growth and acquired invasive phenotypes. Disruption of the CcO complex caused loss of transmembrane potential and induction of Ca2+/Calcineurin-mediated retrograde signaling. Propagation of this signaling includes activation of PI3-kinase, IGF1R and Akt, Ca2(+)-sensitive transcription factors and also TGFβ1, MMP16 and periostin, which are involved in oncogenic progression. Whole-genome expression analysis showed the upregulation of genes involved in cell signaling, extracellular matrix interactions, cell morphogenesis, cell motility and migration. The transcription profiles reveal extensive similarity to retrograde signaling initiated by partial mitochondrial DNA depletion, although distinct differences are observed in signaling induced by CcO dysfunction. The possible CcO dysfunction as a biomarker for cancer progression was supported by data showing that esophageal tumors from human patients show reduced CcO subunits IVi1 and Vb in regions that were previously shown to be the hypoxic core of the tumors. Our results show that mitochondrial electron transport chain defect initiates a retrograde signaling. These results suggest that a defect in the CcO complex can potentially induce tumor progression. PMID:26148236

  9. Inhibition of xanthine oxidase by the aldehyde oxidase inhibitor raloxifene: implications for identifying molybdopterin nitrite reductases.


    Weidert, E R; Schoenborn, S O; Cantu-Medellin, N; Choughule, K V; Jones, J P; Kelley, E E


    Sources of nitric oxide alternative to nitric oxide synthases are gaining significant traction as crucial mediators of vessel function under hypoxic inflammatory conditions. For example, capacity to catalyze the one electron reduction of nitrite (NO2-) to ·NO has been reported for hemoglobin, myoglobin and molybdopterin-containing enzymes including xanthine oxidoreductase (XOR) and aldehyde oxidase (AO). For XOR and AO, use of selective inhibition strategies is therefore crucial when attempting to assign relative contributions to nitrite-mediated ·NO formation in cells and tissue. To this end, XOR inhibition has been accomplished with application of classic pyrazolopyrimidine-based inhibitors allo/oxypurinol or the newly FDA-approved XOR-specific inhibitor, Uloric® (febuxostat). Likewise, raloxifene, an estrogen receptor antagonist, has been identified as a potent (Ki=1.0 nM) inhibitor of AO. Herein, we characterize the inhibition kinetics of raloxifene for XOR and describe the resultant effects on inhibiting XO-catalyzed ·NO formation. Exposure of purified XO to raloxifene (PBS, pH 7.4) resulted in a dose-dependent (12.5-100 μM) inhibition of xanthine oxidation to uric acid. Dixon plot analysis revealed a competitive inhibition process with a Ki=13 μM. This inhibitory process was more effective under acidic pH; similar to values encountered under hypoxic/inflammatory conditions. In addition, raloxifene also inhibited anoxic XO-catalyzed reduction of NO2- to NO (EC50=64 μM). In contrast to having no effect on XO-catalyzed uric acid production, the AO inhibitor menadione demonstrated potent inhibition of XO-catalyzed NO2- reduction (EC50=60 nM); somewhat similar to the XO-specific inhibitor, febuxostat (EC50=4 nM). Importantly, febuxostat was found to be a very poor inhibitor of human AO (EC50=613 μM) suggesting its usefulness for validating XO-dependent contributions to NO2- reduction in biological systems. Combined, these data indicate care should be taken

  10. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance.


    Li, Li; Steffens, John C


    Polyphenol oxidases (PPOs; EC or EC catalyzing the oxygen-dependent oxidation of phenols to quinones are ubiquitous among angiosperms and assumed to be involved in plant defense against pests and pathogens. In order to investigate the role of PPO in plant disease resistance, we made transgenic tomato ( Lycopersicon esculentum Mill. cv. Money Maker) plants that overexpressed a potato ( Solanum tuberosum L.) PPO cDNA under control of the cauliflower mosaic virus 35S promoter. The transgenic plants expressed up to 30-fold increases in PPO transcripts and 5- to 10-fold increases in PPO activity and immunodetectable PPO. As expected, these PPO-overexpressing transgenic plants oxidized the endogenous phenolic substrate pool at a higher rate than control plants. Three independent transgenic lines were selected to assess their interaction with the bacterial pathogen Pseudomonas syringae pv. tomato. The PPO-overexpressing tomato plants exhibited a great increase in resistance to P. syringae. Compared with control plants, these transgenic lines showed less severity of disease symptoms, with over 15-fold fewer lesions, and strong inhibition of bacterial growth, with over 100-fold reduction of bacterial population in the infected leaves. These results demonstrate the importance of PPO-mediated phenolic oxidation in restricting plant disease development. PMID:12029473

  11. Cell-free protein synthesis enables high yielding synthesis of an active multicopper oxidase.


    Li, Jian; Lawton, Thomas J; Kostecki, Jan S; Nisthal, Alex; Fang, Jia; Mayo, Stephen L; Rosenzweig, Amy C; Jewett, Michael C


    Multicopper oxidases (MCOs) are broadly distributed in all kingdoms of life and perform a variety of important oxidative reactions. These enzymes have potential biotechnological applications; however, the applications are impeded by low expression yields in traditional recombinant hosts, solubility issues, and poor copper cofactor assembly. As an alternative to traditional recombinant protein expression, we show the ability to use cell-free protein synthesis (CFPS) to produce complex MCO proteins with high soluble titers. Specifically, we report the production of MCOs in an Escherichia coli-based cell-free transcription-translation system. Total yields as high as 1.2 mg mL(-1) were observed after a 20-h batch reaction. More than 95% of the protein was soluble and activity was obtained by simple post-CFPS addition of copper ions in the form of CuSO4 . Scale-up reactions were achieved from 15 to 100 µL without a decrease in productivity and solubility. CFPS titers were higher than in vivo expression titers and more soluble, avoiding the formation of inclusion bodies. Our work extends the utility of the cell-free platform to the production of active proteins containing copper cofactors and demonstrates a simple method for producing MCOs. PMID:26356243

  12. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.


    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua


    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small. PMID:12555234

  13. Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress.


    Daurelio, Lucas Damián; Checa, Susana Karina; Barrio, Jorgelina Morán; Ottado, Jorgelina; Orellano, Elena Graciela


    The higher plant mitochondrial electron transport chain contains an alternative pathway that ends with the AOX (alternative oxidase). The AOX proteins are encoded by a small gene family composed of two discrete gene subfamilies. Aox1 is present in both monocot and eudicot plants, whereas Aox2 is only present in eudicot plants. We isolated a genomic clone from Citrus sinensis containing the Aox1a gene. The orange Aox1a consists of four exons interrupted by three introns and its promoter harbours diverse putative stress-specific regulatory motifs including pathogen response elements. The role of the Aox1a gene was evaluated during the compatible interaction between C. sinensis and Xanthomonas axonopodis pv. citri and no induction of the Aox1a at the transcriptional level was observed. On the other hand, Aox1a was studied in orange plants during non-host interactions with Pseudomonas syringae pv. tomato and Xanthomonas campestris pv. vesicatoria, which result in hypersensitive response. Both phytopathogens produced a strong induction of Aox1a, reaching a maximum at 8 h post-infiltration. Exogenous application of salicylic acid produced a slight increase in the steady-state level of Aox1a, whereas the application of fungi elicitors showed the highest induction. These results suggest that AOX1a plays a role during biotic stress in non-host plant pathogen interaction. PMID:19257856

  14. Aberrant Processing of Polyphenol Oxidase in a Variegated Grapevine Mutant 1

    PubMed Central

    Rathjen, Anne H.; Robinson, Simon P.


    Bruce's Sport is a mutant grapevine (Vitis vinifera L.) with green and white variegated fruit derived from the Sultana variety. The white regions of tissue have decreased polyphenol oxidase (PPO) activity resulting in a reduced capacity for browning. Active PPO from Sultana grapes was purified and had an apparent molecular weight of 40,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Western blots indicated that mature Sultana grapes contained a single 40-kilodalton PPO, and young Sultana berries also had small quantities of a 60-kilodalton protein. Bruce's Sport grapes had much less of the 40-kilodalton PPO and greater amounts of the 60-kilodalton band. Protease digestion of Bruce's Sport extracts decreased the proportion of the 60-kilodalton protein and increased the 40-kilodalton band. A cDNA clone of grape PPO was used to probe a northern blot of Sultana and Bruce's Sport RNA and hybridized to a 2.2-kilobase transcript in both grapevines. The level of PPO mRNA was high in the early stages of berry development but then declined. The results suggest that in grapevine the active 40-kilodalton form of PPO is synthesized as a precursor protein of at least 60 kilodaltons, and normal processing is interrupted in Bruce's Sport resulting in the accumulation of the 60-kilodalton inactive preform of PPO. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6 PMID:16669082

  15. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.


    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S


    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  16. Crucial involvement of xanthine oxidase in the intracellular signalling networks associated with human myeloid cell function

    PubMed Central

    Abooali, Maryam; Lall, Gurprit S.; Coughlan, Karen; Lall, Harjinder S.; Gibbs, Bernhard F.; Sumbayev, Vadim V.


    Xanthine oxidase (XOD) is an enzyme which plays a central role in purine catabolism by converting hypoxanthine into xanthine and then further into uric acid. Here we report that XOD is activated in THP-1 human myeloid cells in response to pro-inflammatory and growth factor stimulation. This effect occurred following stimulation of THP-1 cells with ligands of plasma membrane associated TLRs 2 and 4, endosomal TLRs 7 and 8 as well as stem cell growth factor (SCF). Hypoxia-inducible factor 1 (HIF-1) and activator protein 1 (AP-1) transcription complexes were found to be responsible for XOD upregulation. Importantly, the mammalian target of rapamycin (mTOR), a major myeloid cell translation regulator, was also found to be essential for XOD activation. Specific inhibition of XOD by allopurinol and sodium tungstate led to an increase in intracellular AMP levels triggering downregulation of mTOR activation by phosphorylation of its T2446 residue. Taken together, our results demonstrate for the first time that XOD is not only activated by pro-inflammatory stimuli or SCF but also plays an important role in maintaining mTOR-dependent translational control during the biological responses of human myeloid cells. PMID:25200751

  17. The cytochrome c oxidase biogenesis factor AtCOX17 modulates stress responses in Arabidopsis.


    Garcia, Lucila; Welchen, Elina; Gey, Uta; Arce, Agustín L; Steinebrunner, Iris; Gonzalez, Daniel H


    COX17 is a soluble protein from the mitochondrial intermembrane space that participates in the transfer of copper for cytochrome c oxidase (COX) assembly in eukaryotic organisms. In this work, we studied the function of both Arabidopsis thaliana AtCOX17 genes using plants with altered expression levels of these genes. Silencing of AtCOX17-1 in a cox17-2 knockout background generates plants with smaller rosettes and decreased expression of genes involved in the response of plants to different stress conditions, including several genes that are induced by mitochondrial dysfunctions. Silencing of either of the AtCOX17 genes does not affect plant development or COX activity but causes a decrease in the response of genes to salt stress. In addition, these plants contain higher reactive oxygen and lipid peroxidation levels after irrigation with high NaCl concentrations and are less sensitive to abscisic acid. In agreement with a role of AtCOX17 in stress and abscisic acid responses, both AtCOX17 genes are induced by several stress conditions, abscisic acid and mutation of the transcription factor ABI4. The results indicate that AtCOX17 is required for optimal expression of a group of stress-responsive genes, probably as a component of signalling pathways that link stress conditions to gene expression responses. PMID:26436309

  18. Crucial involvement of xanthine oxidase in the intracellular signalling networks associated with human myeloid cell function.


    Abooali, Maryam; Lall, Gurprit S; Coughlan, Karen; Lall, Harjinder S; Gibbs, Bernhard F; Sumbayev, Vadim V


    Xanthine oxidase (XOD) is an enzyme which plays a central role in purine catabolism by converting hypoxanthine into xanthine and then further into uric acid. Here we report that XOD is activated in THP-1 human myeloid cells in response to pro-inflammatory and growth factor stimulation. This effect occurred following stimulation of THP-1 cells with ligands of plasma membrane associated TLRs 2 and 4, endosomal TLRs 7 and 8 as well as stem cell growth factor (SCF). Hypoxia-inducible factor 1 (HIF-1) and activator protein 1 (AP-1) transcription complexes were found to be responsible for XOD upregulation. Importantly, the mammalian target of rapamycin (mTOR), a major myeloid cell translation regulator, was also found to be essential for XOD activation. Specific inhibition of XOD by allopurinol and sodium tungstate led to an increase in intracellular AMP levels triggering downregulation of mTOR activation by phosphorylation of its T2446 residue. Taken together, our results demonstrate for the first time that XOD is not only activated by pro-inflammatory stimuli or SCF but also plays an important role in maintaining mTOR-dependent translational control during the biological responses of human myeloid cells. PMID:25200751

  19. Mapping Yeast Transcriptional Networks

    PubMed Central

    Hughes, Timothy R.; de Boer, Carl G.


    The term “transcriptional network” refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms. PMID:24018767

  20. Automatic Music Transcription

    NASA Astrophysics Data System (ADS)

    Klapuri, Anssi; Virtanen, Tuomas

    Written musical notation describes music in a symbolic form that is suitable for performing a piece using the available musical instruments. Traditionally, musical notation indicates the pitch, target instrument, timing, and duration of each sound to be played. The aim of music transcription either by humans or by a machine is to infer these musical parameters, given only the acoustic recording of a performance.

  1. Asymmetric Total Synthesis of (+)- and (−)-Clusianone and (+)- and (−)Clusianone Methyl Enol Ether via ACC Alkylation and Evaluation of their Anti-HIV Activity

    PubMed Central

    Garnsey, Michelle R.; Matous, James A.; Kwiek, Jesse J.; Coltart, Don M.


    The total asymmetric synthesis of (+)- and (−)-clusianone and (+)- and (−)-clusianone methyl enol ether is reported. Asymmetric induction is achieved through the use of ACC alkylation, providing the key intermediates with an er of 99:1. The four synthetic compounds were evaluated for their anti-HIV activity. Both (+)- and (−)-clusianone displayed significant anti-HIV activity. PMID:21414776

  2. Forebrain-specific Expression of Monoamine Oxidase A Reduces Neurotransmitter Levels, Restores the Brain Structure, and Rescues Aggressive Behavior in Monoamine Oxidase A-deficient Mice*

    PubMed Central

    Chen, Kevin; Cases, Olivier; Rebrin, Igor; Wu, Weihua; Gallaher, Timothy K.; Seif, Isabelle; Shih, Jean Chen


    Previous studies have established that abrogation of monoamine oxidase (MAO) A expression leads to a neurochemical, morphological, and behavioral specific phenotype with increased levels of serotonin (5-HT), norepinephrine, and dopamine, loss of barrel field structure in mouse somatosensory cortex, and an association with increased aggression in adults. Forebrain-specific MAO A transgenic mice were generated from MAO A knock-out (KO) mice by using the promoter of calcium-dependent kinase IIα (CaMKIIα). The presence of human MAO A transgene and its expression were verified by PCR of genomic DNA and reverse transcription-PCR of mRNA and Western blot, respectively. Significant MAO A catalytic activity, autoradiographic labeling of 5-HT, and immunocytochemistry of MAO A were found in the frontal cortex, striatum, and hippocampus but not in the cerebellum of the forebrain transgenic mice. Also, compared with MAO A KO mice, lower levels of 5-HT, norepinephrine, and DA and higher levels of MAO A metabolite 5-hydroxyin-doleacetic acid were found in the forebrain regions but not in the cerebellum of the transgenic mice. These results suggest that MAO A is specifically expressed in the forebrain regions of transgenic mice. This forebrain-specific differential expression resulted in abrogation of the aggressive phenotype. Furthermore, the disorganization of the somatosensory cortex barrel field structure associated with MAO A KO mice was restored and became morphologically similar to wild type. Thus, the lack of MAO A in the forebrain of MAO A KO mice may underlie their phenotypes. PMID:17090537

  3. Support for a history-dependent predictive model of dACC activity in producing the bivalency effect: an event-related potential study.


    Grundy, John G; Shedden, Judith M


    In the present study, we examine electrophysiological correlates of factors influencing an adjustment in cognitive control known as the bivalency effect. During task-switching, the occasional presence of bivalent stimuli in a block of univalent trials is enough to elicit a response slowing on all subsequent univalent trials. Bivalent stimuli can be congruent or incongruent with respect to the response afforded by the irrelevant stimulus feature. Here we show that the incongruent bivalency effect, the congruent bivalency effect, and an effect of a simple violation of expectancy are captured at a frontal ERP component (between 300 and 550ms) associated with ACC activity, and that the unexpectedness effect is distinguished from both congruent and incongruent bivalency effects at an earlier component (100-120ms) associated with the temporal parietal junction. We suggest that the frontal component reflects the dACC's role in predicting future cognitive load based on recent history. In contrast, the posterior component may index early visual feature extraction in response to bivalent stimuli that cue currently ongoing tasks; dACC activity may trigger the temporal parietal activity only when specific task cueing is involved and not for simple violations of expectancy. PMID:24686093

  4. Quantitation of rat liver xanthine oxidase by radioimmunoassay. A mechanism for sex-specific differences

    SciTech Connect

    Decker, D.E.; Levinson, D.J.


    To further delineate the mechanism responsible for the differences in xanthine oxidase activity in male and female Sprague-Dawley rats, a sensitive and specific radioimmunoassay (RIA) was developed for the measurement of hepatic xanthine oxidase. The RIA could detect as little as 5 mg of liver enzyme. Specificity of the RIA was confirmed by 1) Ouchterlony double immuno-diffusion in which a single precipitin band exhibited xanthine oxidase activity, when crude liver homogenate and an enzyme-specific stain were used; 2) parallelism between purified 125I-labeled xanthine oxidase and serial dilutions of crude liver homogenate; 3) a linear correlation between xanthine oxidase activity and the level of enzyme protein; and 4) a single protein band coincident with purified xanthine oxidase, when an immunoprecipitate prepared from antisera and crude liver homogenate was analyzed on sodium dodecyl sulfate (SDS) polyacrylamide gels. Whether xanthine oxidase activity was assayed in the absence of nicotinamide adenine dinucleotide (NAD+) (oxidase form) or in the presence of NAD+ (dehydrogenase), male values were consistently higher, and both forms of the enzyme correlated significantly with each other. When purified to homogeneity, neither form of the enzyme was appreciably affected by 17 beta-estradiol or testosterone propionate. When the RIA was employed, levels of hepatic xanthine oxidase were significantly greater in male than in female rats. We concluded from these data that increased xanthine oxidase activity in the male corresponds to a greater quantitative complement of xanthine oxidase protein. Furthermore, lower xanthine oxidase activity in the female cannot be explained by immunologically cross-reactive material without enzyme activity nor by a direct sex-steroid enzyme interaction.

  5. Changes in lysyl oxidase (LOX) distribution and its decreased activity in keratoconus corneas.


    Dudakova, Lubica; Liskova, Petra; Trojek, Tomas; Palos, Michalis; Kalasova, Sarka; Jirsova, Katerina


    Inadequate cross-linking between collagen lamellae is a characteristic feature of keratoconus corneas. The formation of covalent bonds between collagen and elastin fibrils, which maintain the biomechanical properties of the cornea, is mediated by the cuproenzyme lysyl oxidase and four lysyl oxidase-like enzymes. The aim of this study was to determine the distribution of lysyl oxidase and the total lysyl oxidase activity (lysyl oxidase and the four lysyl oxidase-like enzymes) in control and keratoconic corneas. Seven control and eight keratoconic corneas were used for the imunohistochemical detection of lysyl oxidase in corneal cryosections using two different antibodies. The total lysyl oxidase activity in the culture medium of corneal fibroblasts from six explanted keratoconic and four control corneas was measured using a fluorometric assay in the presence and absence of the lysyl oxidase inhibitor beta-aminopropionitrile and determined as the production of H(2)O(2) in nM per μg of total protein. In the control tissue, the most intense signal for lysyl oxidase was present in the corneal epithelium, in which perinuclear dots brightly projecting from more or less homogenous cytoplasmic staining may represent the lysyl oxidase propeptide. Less intense staining was present in keratocytes, the extracellular matrix and in the corneal endothelium. The epithelium of the limbus and the perilimbal conjunctiva showed intense to very intense staining. The distribution of lysyl oxidase was clearly decreased in at least five of the eight keratoconic specimens. The most marked signal reduction was observed in the stromal matrix and in keratocytes. Moreover, the signal in pathological specimens revealed a more irregular pattern, including the presence of intra- and extracellular clumps in the epithelium. Interestingly, endothelial cells showed no or very weak staining in areas just beneath negative stromal tissue. The mean activity of total lysyl oxidase in the keratoconic

  6. The Terminal Oxidase Cytochrome bd Promotes Sulfide-resistant Bacterial Respiration and Growth

    PubMed Central

    Forte, Elena; Borisov, Vitaliy B.; Falabella, Micol; Colaço, Henrique G.; Tinajero-Trejo, Mariana; Poole, Robert K.; Vicente, João B.; Sarti, Paolo; Giuffrè, Alessandro


    Hydrogen sulfide (H2S) impairs mitochondrial respiration by potently inhibiting the heme-copper cytochrome c oxidase. Since many prokaryotes, including Escherichia (E.) coli, generate H2S and encounter high H2S levels particularly in the human gut, herein we tested whether bacteria can sustain sulfide-resistant O2-dependent respiration. E. coli has three respiratory oxidases, the cyanide-sensitive heme-copper bo3 enzyme and two bd oxidases much less sensitive to cyanide. Working on the isolated enzymes, we found that, whereas the bo3 oxidase is inhibited by sulfide with half-maximal inhibitory concentration IC50 = 1.1 ± 0.1 μM, under identical experimental conditions both bd oxidases are insensitive to sulfide up to 58 μM. In E. coli respiratory mutants, both O2-consumption and aerobic growth proved to be severely impaired by sulfide when respiration was sustained by the bo3 oxidase alone, but unaffected by ≤200 μM sulfide when either bd enzyme acted as the only terminal oxidase. Accordingly, wild-type E. coli showed sulfide-insensitive respiration and growth under conditions favouring the expression of bd oxidases. In all tested conditions, cyanide mimicked the functional effect of sulfide on bacterial respiration. We conclude that bd oxidases promote sulfide-resistant O2-consumption and growth in E. coli and possibly other bacteria. The impact of this discovery is discussed. PMID:27030302

  7. Deep sea water modulates blood pressure and exhibits hypolipidemic effects via the AMPK-ACC pathway: an in vivo study.


    Sheu, Ming-Jyh; Chou, Pei-Yu; Lin, Wen-Hsin; Pan, Chun-Hsu; Chien, Yi-Chung; Chung, Yun-Lung; Liu, Fon-Chang; Wu, Chieh-Hsi


    Deep sea water (DSW), originally pumped from the Pacific Rim off the coast of Hualien County (Taiwan), and its mineral constituents, were concentrated by a low-temperature vacuum evaporation system to produce a hardness of approximately 400,000 mg/L of seawater mineral concentrate. The primary composition of this seawater mineral concentrate was ionic magnesium (Mg²⁺), which was approximately 96,000 mg/L. Referring to the human recommended daily allowance (RDA) of magnesium, we diluted the mineral concentrate to three different dosages: 0.1 × DSW (equivalent to 3.75 mg Mg²⁺/kg DSW); 1 × DSW (equivalent to 37.5 mg Mg²⁺/kg DSW); and 2 × DSW (equivalent to 75 mg Mg²⁺/kg DSW). Additionally, a magnesium chloride treatment was conducted for comparison with the DSW supplement. The study indicated that 0.1 × DSW, 1 × DSW and 2 × DSW decreased the systolic and diastolic pressures in spontaneous hypertensive rats in an eight-week experiment. DSW has been shown to reduce serum lipids and prevent atherogenesis in a hypercholesterolemic rabbit model. Our results demonstrated that 1 × DSW and 2 × DSW significantly suppressed the serum cholesterol levels, reduced the lipid accumulation in liver tissues, and limited aortic fatty streaks. These findings indicated that the antiatherogenic effects of DSW are associated with 5'-adenosine monophosphate-activated protein kinase (AMPK) stimulation and the consequent inhibition of phosphorylation of acetyl-CoA carboxylase (ACC) in atherosclerotic rabbits. We hypothesize that DSW could potentially be used as drinking water because it modulates blood pressure, reduces lipids, and prevents atherogenesis. PMID:23774889

  8. Photochemical reactions of cytochrome oxidase at low temperatures.


    Orii, Y


    The unique of CO-cytochrome oxidase as first noted by Yonetani et al. (22) is that after its photodissociation at low temperatures recombination occurs as the sample temperature is raised, but at temperatures considerably higher than those for other CO-heme and CO-hemoprotein complexes; that is, the half recombination temperature is 180 K contrary to 25-30 K for other CO complexes. The photodissociability, however, disappeared when monomeric cytochrome oxidase was treated with pCMB to remove an intrinsic copper, the significance of which in CO complex formation was thus demonstrated. It is proposed that the copper is situated close to heme a and traps the photodissociated CO. The access of the trapped CO to the heme a to resume the original binding is effected only when sufficient energy for thermal agitation is provided by elevating the sample temperature. During the course of this study, new photo- and thermochromic properties were observed with the reduced enzyme by cooling it in liquid nitrogen after preincubation at pH 8.6 to 10.5. The characteristic bands appeared at 575 and 428 nm and diminished when this ample was illuminated at 26 K. As the sample temperature was raised these bands were restored with a half transition temperature of 80 K. When the reduced oxidase had been complexed with CO, cyanide or azide, or treated with pCMB, such a unique species did not appear. The enthalpy change of 1.16 kcal/mol for the formation of this species as well as the above-described properties suggests that the hydrogen bond between the formyl side group of heme a and one of seven sulfhydryl groups in cytochrome oxidase is responsible for the appearance and disappearance of this new species. Based on these results a schematic model has been proposed for the photo- and thermochromism of cytochrome oxidase at cryogenic temperatures and for the microenvironment of the prosthetic heme a and copper in this enzyme. On the other hand, contrary to the central dogma of Warburg

  9. Vaccinia virus transcription.


    Broyles, Steven S


    Vaccinia virus replication takes place in the cytoplasm of the host cell. The nearly 200 kbp genome owes part of its complexity to encoding most of the proteins involved in genome and mRNA synthesis. The multisubunit vaccinia virus RNA polymerase requires a separate set of virus-encoded proteins for the transcription of the early, intermediate and late classes of genes. Cell fractionation studies have provided evidence for a role for host cell proteins in the initiation and termination of vaccinia virus intermediate and late gene transcription. Vaccinia virus resembles nuclear DNA viruses in the integration of viral and host proteins for viral mRNA synthesis, yet is markedly less reliant on host proteins than its nuclear counterparts. PMID:12917449

  10. Catalase-peroxidases (KatG) exhibit NADH oxidase activity.


    Singh, Rahul; Wiseman, Ben; Deemagarn, Taweewat; Donald, Lynda J; Duckworth, Harry W; Carpena, Xavi; Fita, Ignacio; Loewen, Peter C


    Catalase-peroxidases (KatG) produced by Burkholderia pseudomallei, Escherichia coli, and Mycobacterium tuberculosis catalyze the oxidation of NADH to form NAD+ and either H2O2 or superoxide radical depending on pH. The NADH oxidase reaction requires molecular oxygen, does not require hydrogen peroxide, is not inhibited by superoxide dismutase or catalase, and has a pH optimum of 8.75, clearly differentiating it from the peroxidase and catalase reactions with pH optima of 5.5 and 6.5, respectively, and from the NADH peroxidase-oxidase reaction of horseradish peroxidase. B. pseudomallei KatG has a relatively high affinity for NADH (Km=12 microm), but the oxidase reaction is slow (kcat=0.54 min(-1)) compared with the peroxidase and catalase reactions. The catalase-peroxidases also catalyze the hydrazinolysis of isonicotinic acid hydrazide (INH) in an oxygen- and H2O2-independent reaction, and KatG-dependent radical generation from a mixture of NADH and INH is two to three times faster than the combined rates of separate reactions with NADH and INH alone. The major products from the coupled reaction, identified by high pressure liquid chromatography fractionation and mass spectrometry, are NAD+ and isonicotinoyl-NAD, the activated form of isoniazid that inhibits mycolic acid synthesis in M. tuberculosis. Isonicotinoyl-NAD synthesis from a mixture of NAD+ and INH is KatG-dependent and is activated by manganese ion. M. tuberculosis KatG catalyzes isonicotinoyl-NAD formation from NAD+ and INH more efficiently than B. pseudomallei KatG. PMID:15280362

  11. Intrinsic disorder in transcription factors†

    PubMed Central

    Liu, Jiangang; Perumal, Narayanan B.; Oldfield, Christopher J.; Su, Eric W.; Uversky, Vladimir N.; Dunker, A. Keith


    Intrinsic disorder (ID) is highly abundant in eukaryotes, which reflect the greater need for disorder-associated signaling and transcriptional regulation in nucleated cells. Although several well-characterized examples of intrinsically disordered proteins in transcriptional regulation have been reported, no systematic analysis has been reported so far. To test for a general prevalence of intrinsic disorder in transcriptional regulation, we used the Predictor Of Natural Disorder Regions (PONDR) to analyze the abundance of intrinsic disorder in three transcription factor datasets and two control sets. This analysis revealed that from 94.13% to 82.63% of transcription factors posses extended regions of intrinsic disorder, relative to 54.51% and 18.64% of the proteins in two control datasets, which indicates the significant prevalence of intrinsic disorder in transcription factors. This propensity of transcription factors for intrinsic disorder was confirmed by cumulative distribution function analysis and charge-hydropathy plots. The amino acid composition analysis showed that all three transcription factor datasets were substantially depleted in order-promoting residues, and significantly enriched in disorder-promoting residues. Our analysis of the distribution of disorder within the transcription factor datasets revealed that: (a) The AT-hooks and basic regions of transcription factor DNA-binding domains are highly disordered; (b) The degree of disorder in transcription factor activation regions is much higher than that in DNA-binding domains; (c) The degree of disorder is significantly higher in eukaryotic transcription factors than in prokaryotic transcription factors; (d) The level of α-MoRFs (molecular recognition feature) prediction is much higher in transcription factors. Overall, our data reflected the fact that the eukaryotes with well-developed gene transcription machinery require transcription factor flexibility to be more efficient. PMID:16734424

  12. A Simple Litmus Test for Aldehyde Oxidase Metabolism of Heteroarenes

    PubMed Central


    The bioavailability of aromatic azaheterocyclic drugs can be affected by the activity of aldehyde oxidase (AO). Susceptibility to AO metabolism is difficult to predict computationally and can be complicated in vivo by differences between species. Here we report the use of bis(((difluoromethyl)sulfinyl)oxy)zinc (DFMS) as a source of CF2H radical for a rapid and inexpensive chemical “litmus test” for the early identification of heteroaromatic drug candidates that have a high probability of metabolism by AO. PMID:24472070

  13. Cell-free NADPH oxidase activation assays: "in vitro veritas".


    Pick, Edgar


    The superoxide (O2 (∙-))-generating NADPH oxidase complex of phagocytes comprises a membrane-imbedded heterodimeric flavocytochrome, known as cytochrome b 558 (consisting of Nox2 and p22 (phox) ) and four cytosolic regulatory proteins, p47 (phox) , p67 (phox) , p40 (phox) , and the small GTPase Rac. Under physiological conditions, in the resting phagocyte, O2 (∙-) generation is initiated by engagement of membrane receptors by a variety of stimuli, followed by specific signal transduction sequences leading to the translocation of the cytosolic components to the membrane and their association with the cytochrome. A consequent conformational change in Nox2 initiates the electron "flow" along a redox gradient, from NADPH to oxygen, leading to the one-electron reduction of molecular oxygen to O2 (∙-). Methodological difficulties in the dissection of this complex mechanism led to the design "cell-free" systems (also known as "broken cells" or in vitro systems). In these, membrane receptor stimulation and all or part of the signal transduction sequence are missing, the accent being placed on the actual process of "NADPH oxidase assembly," thus on the formation of the complex between cytochrome b 558 and the cytosolic components and the resulting O2 (∙-) generation. Cell-free assays consist of a mixture of the individual components of the NADPH oxidase complex, derived from resting phagocytes or in the form of purified recombinant proteins, exposed in vitro to an activating agent (distinct from and unrelated to whole cell stimulants), in the presence of NADPH and oxygen. Activation is commonly quantified by measuring the primary product of the reaction, O2 (∙-), trapped immediately after its generation by an appropriate acceptor in a kinetic assay, permitting the calculation of the linear rate of O2 (∙-) production, but numerous variations exist, based on the assessment of reaction products or the consumption of substrates. Cell-free assays played a paramount

  14. Functions of the hydrophilic channels in protonmotive cytochrome c oxidase

    PubMed Central

    Rich, Peter R.; Maréchal, Amandine


    The structures and functions of hydrophilic channels in electron-transferring membrane proteins are discussed. A distinction is made between proton channels that can conduct protons and dielectric channels that are non-conducting but can dielectrically polarize in response to the introduction of charge changes in buried functional centres. Functions of the K, D and H channels found in A1-type cytochrome c oxidases are reviewed in relation to these ideas. Possible control of function by dielectric channels and their evolutionary relation to proton channels is explored. PMID:23864498

  15. "Ping-pong gaze" secondary to monoamine oxidase inhibitor overdose.


    Attaway, Amy; Sroujieh, Laila; Mersfelder, Tracey L; Butler, Christopher; Ouellette, Daniel


    An infrequent manifestation of monoamine oxidase inhibitor (MAOI) toxicity is "ping-pong gaze" (PPG). We describe the case of a 26-year-old female who was found unresponsive after taking 40 tablets of phenelzine. On presentation to the hospital, her eyes were moving in characteristic "ping pong" fashion. After 6 hours her gaze terminated. The following day her neurologic exam was benign and she had no long-term sequelae. While the etiology of PPG is unknown, it is most often seen with irreversible structural brain damage. However, a detailed literature review revealed that previous cases of MAOI toxicity where the patient survived have all had complete neurologic recovery. PMID:27127395

  16. Xanthine oxidase inhibitors from Vietnamese Blumea balsamifera L.


    Nguyen, Mai Thanh Thi; Nguyen, Nhan Trung


    From the MeOH extract of the aerial part of Blumea balsamifera L., a new dihydroflavonol, (2R,3S)-(-)-4'-O-methyldihydroquercetin (1), together with seven known compounds has been isolated. Their structures were elucidated on the basis of spectroscopic data. Compounds 1-4 and 6-8 displayed significant xanthine oxidase inhibitory activity in a concentration-dependent manner, and compounds 1, 6 and 8 showed more potent inhibitory activity, with IC₅₀ values ranging from 0.23 to 1.91 µM, than that of a positive control allopurinol (IC₅₀ 2.50 µM). PMID:22821854

  17. The Role of Monoamine Oxidase Inhibitors in Current Psychiatric Practice

    PubMed Central

    Fiedorowicz, Jess G.; Swartz, Karen L.


    The use of monoamine oxidase inhibitors (MAOIs) by psychiatrists has declined over the past several decades with the expansion of psychiatrists’ pharmacologic armamentarium. This trend has also been driven by concern about food and drug interactions and side effects, as well as waning physician experience with these medications. Many psychiatrists, in fact, never prescribe MAOIs. Recent research has liberalized the MAOI diet and identified symptom presentations more likely to respond to these medications. Thus, clinicians must continue to familiarize themselves with the properties of and indications for prescribing MAOIs. PMID:15552546

  18. Purification and properties of human amniotic fluid diamine oxidase.


    Tufvesson, G


    Diamine oxidase (DAO) was purified from amniotic fluid. The activity was separated in two DAO fractions with pI values of 5.8 and 4.0. Molecular weight were found to be 245,000 and 485,000, respectively, with subunit molecular weight of 110,000. This indicated that they probably are dimer and tetramer of the same DAO subunit. The enzyme was active against putrescine and histamine and was strongly inhibited by carbonyl group reagents. A Ping Pong Bi Ter enzyme reaction mechanism is probable. The diamine, with one amino group protonized, is suggested to be responsible for interaction with the enzyme. PMID:30164

  19. Electronic Structure Contributions to Reactivity in Xanthine Oxidase Family Enzymes

    PubMed Central

    Stein, Benjamin W.; Kirk, Martin L.


    We review the xanthine oxidase (XO) family of pyranopterin molybdenum enzymes with a specific emphasis on electronic structure contributions to reactivity. In addition to xanthine and aldehyde oxidoreductases, which catalyze the 2-electron oxidation of aromatic heterocycles and aldehyde substrates, this mini-review highlights recent work on the closely related carbon monoxide dehydrogenase (CODH) that catalyzes the oxidation of CO using a unique Mo-Cu heterobimetallic active site. A primary focus of this mini-review relates to how spectroscopy and computational methods have been used to develop an understanding of critical relationships between geometric structure, electronic structure, and catalytic function. PMID:25425163

  20. Reductive trapping of substrate to bovine plasma amine oxidase

    SciTech Connect

    Hartmann, C.; Klinman, J.P.


    Plasma amine oxidases catalyze the oxidative deamination of amines to aldehydes, followed by a 2e- reduction of O/sub 2/ to H/sub 2/O/sub 2/. Pyrroloquinoline quinone (PQQ), previously believed to be restricted to prokaryotes, has recently been proposed to be the cofactor undergoing reduction in the first half-reaction of bovine plasma amine oxidase (Ameyama, M., Hayashi, U., Matsushita, K., Shinagawa, E., and Adachi, O. (1984) Agric. Biol. Chem. 48, 561-565; Lobenstein-Verbeek, C. L., Jongejan, J. A., Frank, J., and Duine, J. A. (1984) FEBS Lett. 170, 305-309). This result is unexpected, since model studies with PQQ implicate Schiff's base formation between a reactive carbonyl and substrates, whereas experiments with bovine plasma amine oxidase have failed to provide evidence for a carbonyl cofactor. We have, therefore, re-examined putative adducts between substrate and enzyme-bound cofactor, employing a combination of (/sup 14/C)benzylamine and (/sup 3/H)NaCNBH/sub 3/. The use of the relatively weak reductant, NaCNBH/sub 3/, affords Schiff's base specificity and permits the study of enzyme below pH 7.0. As we show, enzyme can only be inactivated by NaCNBH/sub 3/ in the presence of substrate, leading to the incorporation of 1 mol of (/sup 14/C)benzylamine/mol of enzyme subunit at complete inactivation. By contrast, we are unable to detect any labeling with (/sup 3/H)NaCNBH/sub 3/, analogous to an earlier study with (/sup 3/H)NaCNBH/sub 4/ (Suva, R. H., and Abeles, R. H. (1978) Biochemistry 17, 3538-3545). We conclude, first, that our inability to obtain adducts containing both carbon 14 and tritium rules out the reductive trapping either of amine substrate with pyridoxal phosphate or of aldehyde product with a lysyl side chain and, second, that the observed pattern of labeling is fully consistent with the presence of PQQ at the active site of bovine plasma amine oxidase.