Science.gov

Sample records for acc synthase genes

  1. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    PubMed

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  2. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    PubMed

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  3. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )

    1993-05-01

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  4. Isoelectric focusing of wound-induced tomato ACC synthase

    SciTech Connect

    White, J.A.; Kende, H. )

    1990-05-01

    Several techniques of electrofocusing have been used to determine whether 1-aminocyclopropane-1-carboxylate (ACC) synthase isolated from wounded tomato pericarp tissue exists in different isoforms, each with its characteristic isoelectric point (pI). The pI of the native enzyme was found to be 6.0 {plus minus} 0.2. When radiolabeled, denatured ACC synthase was electrofocused by non-equilibrium pH gradient electrophoresis (NEpHGE), the enzyme separated into four discernible spots which, upon reaching equilibrium, ranged in pI from 6.6 to 6.9. Immunopurified ACC synthase from four tomato cultivars (Duke, Cornell, Mountain Pride and Pik Red) migrated in each case as a 50-kDa protein on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE). We propose that native ACC synthase in extracts of tomato pericarp tissue exists in one single form and that the charge heterogeneities observed upon electrofocusing of denatured enzyme result from modifications of preexisting protein.

  5. C-terminal phosphorylation is essential for regulation of ethylene synthesizing ACC synthase enzyme.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2013-02-01

    The genetic and molecular biological studies mainly in Arabidopsis and in some other plants have begun to uncover the various components of ripening signaling pathway in plants. Although transcriptional regulation of major ripening genes have been studied in detail, information on role of phosphorylation in regulating the activity and stability of core ripening pathway associated proteins in relation to ethylene biosynthesis during fruit ripening is still limited. Recently we have demonstrated the evidence for post-translational regulation of MA-ACS1 (Musa acuminata ACC synthase 1), the rate limiting step enzyme regulating ripening ethylene production in banana, through phosphorylation at the C-terminal Ser 476 and 479 residues by a 41-kDa Ser/Thr protein kinase. (1) Here we have further discussed role of protein phosphorylation in regulation of stability and activity of ACS enzymes and the mechanistic and evolutionary perspective of phosphorylation pattern of Type I ACC synthase enzymes. PMID:23221778

  6. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  7. Radiolabeling of a wound-inducible pyridoxal phosphate utilizing protein from tomato: evidence for its identification as ACC synthase

    SciTech Connect

    Privalle, L.S.; Graham, J.S.; Caughey, P.A.

    1986-05-01

    Aminocyclopropane 1-carboxylic acid (ACC) synthase, a pyridoxal phosphate utilizing enzyme, catalyzes the conversion of S-adenosylmethionine to ACC, the rate limiting step in the biosynthesis of the plant hormone, ethylene. Ethylene, besides being involved in normal plant growth processes, is also produced in response to stress, e.g. wounding, pathogen infection, etc. The authors report the partial purification (400 fold) of ACC synthase from wounded pink tomato pericarp by classical techniques including ammonium sulfate precipitation, ion exchange and phenyl sepharose chromatography. Further purification results in a decrease in specific activity apparently due to the instability of the enzyme and the low levels present in plant tissue. Radiolabeling of a pyridoxal phosphate-utilizing protein in the ACC synthase enriched fraction was achieved. Evidence that this radiolabeled protein is ACC synthase will be presented. Amino acid sequence determination of putative ACC synthase-derived peptides is underway.

  8. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  9. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  10. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    PubMed

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  11. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits

    SciTech Connect

    Olson, D.C.; White, J.A.; Edelman, L.; Kende, H. ); Harkins, R.N. )

    1991-06-15

    1-Aminocyclopropane-1-carboxylate synthase is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits. The authors report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5{prime} and 3{prime} ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes.

  12. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  13. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    PubMed

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  14. ACC deaminase genes are conserved among Mesorhizobium species able to nodulate the same host plant.

    PubMed

    Nascimento, Francisco X; Brígido, Clarisse; Glick, Bernard R; Oliveira, Solange

    2012-11-01

    Rhizobia strains expressing the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase have been reported to display an augmented symbiotic performance as a consequence of lowering the plant ethylene levels that inhibit the nodulation process. Genes encoding ACC deaminase (acdS) have been studied in Rhizobium spp.; however, not much is known about the presence of acdS genes in Mesorhizobium spp. The aim of this study was to assess the prevalence and phylogeny of acdS genes in Mesorhizobium strains including a collection of chickpea-nodulating mesorhizobia from Portugal. ACC deaminase genes were detected in 10 of 12 mesorhizobia type strains as well as in 18 of 18 chickpea Mesorhizobium isolates studied in this work. No ACC deaminase activity was detected in any Mesorhizobium strain tested under free-living conditions. Despite the lack of ACC deaminase activity, it was possible to demonstrate that in Mesorhizobium ciceri UPM-Ca7(T) , the acdS gene is transcribed under symbiotic conditions. Phylogenetic analysis indicates that strains belonging to different species of Mesorhizobium, but nodulating the same host plant, have similar acdS genes, suggesting that acdS genes are horizontally acquired by transfer of the symbiosis island. This data, together with analysis of the symbiosis islands from completely sequenced Mesorhizobium genomes, suggest the presence of the acdS gene in a Mesorhizobium common ancestor that possessed this gene in a unique symbiosis island.

  15. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz

    2016-01-01

    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  16. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  17. Surrogate splicing for functional analysis of sesquiterpene synthase genes.

    PubMed

    Wu, Shuiqin; Schoenbeck, Mark A; Greenhagen, Bryan T; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M; Chappell, Joseph

    2005-07-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing beta-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for alpha-barbatene, thujopsene, and beta-chamigrene biosynthesis. PMID:15965019

  18. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  19. Phylogeny and molecular evolution of the Acc1 gene within the StH genome species in Triticeae (Poaceae).

    PubMed

    Fan, Xing; Sha, Li-Na; Wang, Xiao-Li; Zhang, Hai-Qin; Kang, Hou-Yang; Wang, Yi; Zhou, Yong-Hong

    2013-10-15

    To estimate the phylogeny and molecular evolution of a single-copy gene encoding plastid acetyl-CoA carboxylase (Acc1) within the StH genome species, two Acc1 homoeologous sequences were isolated from nearly all the sampled StH genome species and were analyzed with those from 35 diploid taxa representing 19 basic genomes in Triticeae. Sequence diversity patterns and genealogical analysis suggested that (1) the StH genome species from the same areas or neighboring geographic regions are closely related to each other; (2) the Acc1 gene sequences of the StH genome species from North America and Eurasia are evolutionarily distinct; (3) Dasypyrum has contributed to the nuclear genome of Elymus repens and Elymus mutabilis; (4) the StH genome polyploids have higher levels of sequence diversity in the H genome homoeolog than the St genome homoeolog; and (5) the Acc1 sequence may evolve faster in the polyploid species than in the diploids. Our result provides some insight on evolutionary dynamics of duplicate Acc1 gene, the polyploidy speciation and phylogeny of the StH genome species.

  20. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  1. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  2. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  3. Heterologous over-expression of ACC SYNTHASE8 (ACS8) in Populus tremula x P. alba clone 717-1B4 results in elevated levels of ethylene and induces stem dwarfism and reduced leaf size through separate genetic pathways.

    PubMed

    Plett, Jonathan M; Williams, Martin; LeClair, Gaetan; Regan, Sharon; Beardmore, Tannis

    2014-01-01

    Plant height is an important agronomic and horticultural trait that impacts plant productivity, durability and esthetic appeal. A number of the plant hormones such as gibberellic acid (GA), auxin and ethylene have been linked to control of plant architecture and size. Reduction in GA synthesis and auxin transport result in dwarfism while ethylene may have a permissive or repressive effect on tissue growth depending upon the age of plant tissues or the environmental conditions considered. We describe here an activation-tagged mutant of Populus tremula x P. alba clone 717-1B4 identified from 2000 independent transgenic lines due to its significantly reduced growth rate and smaller leaf size. Named dwarfy, the phenotype is due to increased expression of PtaACC SYNTHASE8, which codes for an enzyme in the first committed step in the biosynthesis of ethylene. Stems of dwarfy contain fiber and vessel elements that are reduced in length while leaves contain fewer cells. These morphological differences are linked to PtaACS8 inducing different transcriptomic programs in the stem and leaf, with genes related to auxin diffusion and sensing being repressed in the stem and genes related to cell division found to be repressed in the leaves. Altogether, our study gives mechanistic insight into the genetics underpinning ethylene-induced dwarfism in a perennial model organism. PMID:25414707

  4. Heterologous over-expression of ACC SYNTHASE8 (ACS8) in Populus tremula x P. alba clone 717-1B4 results in elevated levels of ethylene and induces stem dwarfism and reduced leaf size through separate genetic pathways

    PubMed Central

    Plett, Jonathan M.; Williams, Martin; LeClair, Gaetan; Regan, Sharon; Beardmore, Tannis

    2014-01-01

    Plant height is an important agronomic and horticultural trait that impacts plant productivity, durability and esthetic appeal. A number of the plant hormones such as gibberellic acid (GA), auxin and ethylene have been linked to control of plant architecture and size. Reduction in GA synthesis and auxin transport result in dwarfism while ethylene may have a permissive or repressive effect on tissue growth depending upon the age of plant tissues or the environmental conditions considered. We describe here an activation-tagged mutant of Populus tremula x P. alba clone 717-1B4 identified from 2000 independent transgenic lines due to its significantly reduced growth rate and smaller leaf size. Named dwarfy, the phenotype is due to increased expression of PtaACC SYNTHASE8, which codes for an enzyme in the first committed step in the biosynthesis of ethylene. Stems of dwarfy contain fiber and vessel elements that are reduced in length while leaves contain fewer cells. These morphological differences are linked to PtaACS8 inducing different transcriptomic programs in the stem and leaf, with genes related to auxin diffusion and sensing being repressed in the stem and genes related to cell division found to be repressed in the leaves. Altogether, our study gives mechanistic insight into the genetics underpinning ethylene-induced dwarfism in a perennial model organism. PMID:25414707

  5. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  6. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  7. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  8. Precise spatio-temporal modulation of ACC synthase by MPK6 cascade mediates the response of rose flowers to rehydration.

    PubMed

    Meng, Yonglu; Ma, Nan; Zhang, Qian; You, Qi; Li, Na; Ali Khan, Muhammad; Liu, Xiaojing; Wu, Lin; Su, Zhen; Gao, Junping

    2014-09-01

    Drought is a major abiotic stress that affects the development and growth of most plants, and limits crop yield worldwide. Although the response of plants to drought has been well documented, much less is known about how plants respond to the water recovery process, namely rehydration. Here, we describe the spatio-temporal response of plant reproductive organs to rehydration using rose flowers as an experimental system. We found that rehydration triggered rapid and transient ethylene production in the gynoecia. This ethylene burst serves as a signal to ensure water recovery in flowers, and promotes flower opening by influencing the expression of a set of rehydration-responsive genes. An in-gel kinase assay suggested that the rehydration-induced ethylene burst resulted from transient accumulation of RhACS1/2 proteins in gynoecia. Meanwhile, RhMPK6, a rose homolog of Arabidopsis thaliana MPK6, is rapidly activated by rehydration within 0.5 h. Furthermore, RhMPK6 was able to phosphorylate RhACS1 but not RhACS2 in vitro. Application of the kinase inhibitor K252a suppressed RhACS1 accumulation and rehydration-induced ethylene production in gynoecia, and the protein phosphatase inhibitor okadaic acid had the opposite effect, confirming that accumulation of RhACS1 was phosphorylation-dependent. Finally, silencing of RhMPK6 significantly reduced ethylene production in gynoecia when flowers were subjected to rehydration. Taken together, our results suggest that temporal- and spatial-specific activation of an RhMPK6-RhACS1 cascade is responsible for rehydration-induced ethylene production in gynoecia, and that the resulting ethylene-mediated signaling pathway is a key factor in flower rehydration.

  9. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

    PubMed

    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

    2016-06-01

    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

  10. Characterization of a Decapentapletic Gene (AccDpp) from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress

    PubMed Central

    Wang, Hongfang; Guo, Xulei; Guo, Xingqi; Sun, Qinghua; Xu, Baohua

    2016-01-01

    To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ) signal pathway. Decapentapletic gene (Dpp) belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana). In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp. PMID:26881804

  11. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei.

    PubMed

    Woo, Patrick C Y; Tam, Emily W T; Chong, Ken T K; Cai, James J; Tung, Edward T K; Ngan, Antonio H Y; Lau, Susanna K P; Yuen, Kwok-Yung

    2010-09-01

    Despite the unique phenotypic properties and clinical importance of Penicillium marneffei, the polyketide synthase genes in its genome have never been characterized. Twenty-three putative polyketide synthase genes and two putative polyketide synthase nonribosomal peptide-synthase hybrid genes were identified in the P. marneffei genome, a diversity much higher than found in other pathogenic thermal dimorphic fungi, such as Histoplasma capsulatum (one polyketide synthase gene) and Coccidioides immitis (10 polyketide synthase genes). These genes were evenly distributed on the phylogenetic tree with polyketide synthase genes of Aspergillus and other fungi, indicating that the high diversity was not a result of lineage-specific gene expansion through recent gene duplication. The melanin-biosynthesis gene cluster had gene order and orientations identical to those in the Talaromyces stipitatus (a teleomorph of Penicillium emmonsii) genome. Phylogenetically, all six genes of the melanin-biosynthesis gene cluster in P. marneffei were also most closely related to those in T. stipitatus, with high bootstrap supports. The polyketide synthase gene of the melanin-biosynthesis gene cluster (alb1) in P. marneffei was knocked down, which was accompanied by loss of melanin pigment production and reduced ornamentation in conidia. The survival of mice challenged with the alb1 knockdown mutant was significantly better than those challenged with wild-type P. marneffei (P < 0.005). The sterilizing doses of hydrogen peroxide, leading to a 50% reduction in survival of conidia, were 11 min for wild-type P. marneffei and 6 min for the alb1 knockdown mutant of P. marneffei, implying that the melanin-biosynthesis gene cluster contributed to virulence through decreased susceptibility to killing by hydrogen peroxide. PMID:20718860

  12. A novel 1-Cys thioredoxin peroxidase gene in Apis cerana cerana: characterization of AccTpx4 and its role in oxidative stresses.

    PubMed

    Huaxia, Yifeng; Wang, Fang; Yan, Yan; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2015-07-01

    Thioredoxin peroxidase (Tpx), also named peroxiredoxin (Prx), is an important peroxidase that can protect organisms against stressful environments. AccTpx4, a 1-Cys thioredoxin peroxidase gene from the Chinese honey bee Apis cerana cerana, was cloned and characterized. The AccTpx4 gene encodes a protein that is predicted to contain the conserved PVCTTE motif from 1-Cys peroxiredoxin. Quantitative real-time PCR (Q-PCR) and Western blotting revealed that AccTpx4 was induced by various oxidative stresses, such as cold, heat, insecticides, H(2)O(2), and HgCl(2). The in vivo peroxidase activity assay showed that recombinant AccTpx4 protein could efficiently degrade H(2)O(2) in the presence of DL-dithiothreitol (DTT). In addition, disc fusion assays revealed that AccTpx4 could function to protect cells against oxidative stresses. These results indicate that AccTpx4 plays an important role in oxidative stress responses and may contribute to the conservation of honeybees. PMID:25971604

  13. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  14. Expression of Acc-Royalisin gene from royal jelly of Chinese honeybee in Escherichia coli and its antibacterial activity.

    PubMed

    Shen, Lirong; Ding, Meihui; Zhang, Liwen; Jin, Feng; Zhang, Weiguang; Li, Duo

    2010-02-24

    Royalisin is an antibacterial peptide found in Royal Jelly. Two gene fragments of Chinese honeybee (Apis cerana cerana) head, 280 bp cDNA encoding pre-pro-Acc-royalisin (PPAR) of 95 amino acid residues, and 165 bp cDNA encoding mature Acc-royalisin (MAR) of 51 amino acid residues were cloned into the pGEX-4T-2 vector. They were then transformed individually into Escherichia coli for expression. Two expressed fusion proteins, glutathione S-transferase (GST)-PPAR of 36 kDa and GST-MAR of 32 kDa were obtained, which were cross reacted with GST antibody accounting for up to 16.3% and 15.4% of bacterial protein, respectively. In addition, 41% of GST-PPAR and nearly 100% of GST-MAR were soluble proteins. Both lysates of the two purified fusion proteins displayed antibacterial activities, similar to that of nisin against Gram-positive bacteria strains, Staphylococcus aureus, Bacillus subtilis and Micrococcus luteus. MAR peptide released from the thrombin-cleaved GST-MAR fusion protein has a stronger antibacterial activity than that of GST-MAR fusion protein.

  15. Virus-Induced Silencing of a Plant Cellulose Synthase Gene

    PubMed Central

    Burton, Rachel A.; Gibeaut, David M.; Bacic, Antony; Findlay, Kim; Roberts, Keith; Hamilton, Andrew; Baulcombe, David C.; Fincher, Geoffrey B.

    2000-01-01

    Specific cDNA fragments corresponding to putative cellulose synthase genes (CesA) were inserted into potato virus X vectors for functional analysis in Nicotiana benthamiana by using virus-induced gene silencing. Plants infected with one group of cDNAs had much shorter internode lengths, small leaves, and a “dwarf” phenotype. Consistent with a loss of cell wall cellulose, abnormally large and in many cases spherical cells ballooned from the undersurfaces of leaves, particularly in regions adjacent to vascular tissues. Linkage analyses of wall polysaccharides prepared from infected leaves revealed a 25% decrease in cellulose content. Transcript levels for at least one member of the CesA cellulose synthase gene family were lower in infected plants. The decrease in cellulose content in cell walls was offset by an increase in homogalacturonan, in which the degree of esterification of carboxyl groups decreased from ∼50 to ∼33%. The results suggest that feedback loops interconnect the cellular machinery controlling cellulose and pectin biosynthesis. On the basis of the phenotypic features of the infected plants, changes in wall composition, and the reduced abundance of CesA mRNA, we concluded that the cDNA fragments silenced one or more cellulose synthase genes. PMID:10810144

  16. Characterization of an Apis cerana cerana cytochrome P450 gene (AccCYP336A1) and its roles in oxidative stresses responses.

    PubMed

    Zhu, Ming; Zhang, Weixing; Liu, Feng; Chen, Xiaobo; Li, Han; Xu, Baohua

    2016-06-15

    Cytochrome P450 monooxygenases (P450), widely distributed multifunctional enzymes, that play an important role in the oxidative metabolism of endogenous compounds and xenobiotics. Studies have found that these enzymes show peroxidase-like activity and may thus be involved in protecting organisms against reactive oxygen species (ROS). In this work, Apis cerana cerana was used to investigate the molecular mechanisms of P450 family genes in resisting ROS damage. A cytochrome P450 gene was isolated, AccCYP336A1. The open reading frame (ORF) of AccCYP336A1 is 1491bp in length and encodes a predicted protein of 496 amino acids. The obtained amino acid sequence of AccCYP336A1 shared a high sequence identity with homologous proteins and contained the highly conserved features of this protein family. Quantitative real-time PCR (qRT-PCR) analysis showed that AccCYP336A1 was present in some fast developmental stages and had a higher expression in the epidermis than in other tissues. Additionally, the expression levels of AccCYP336A1 were up-regulated by cold (4 °C), heat (42 °C), ultraviolet (UV) radiation, H2O2 and pesticide (thiamethoxam, deltamethrin, methomyl and phoxim) treatments. These results were confirmed by the western blot assays. Furthermore, the recombinant AccCYP336A1 protein acted as an antioxidant that resisted paraquat-induced oxidative stress. Taken together, these results suggest that AccCYP336A1 may play a very significant role in antioxidant defense against ROS damage. PMID:26877110

  17. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  18. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    PubMed

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  19. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  20. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  1. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    PubMed

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  2. Identification and characterization of the Populus sucrose synthase gene family.

    PubMed

    An, Xinmin; Chen, Zhong; Wang, Jingcheng; Ye, Meixia; Ji, Lexiang; Wang, Jia; Liao, Weihua; Ma, Huandi

    2014-04-10

    In this study, we indentified 15 sucrose synthase (SS) genes in Populus and the results of RT-qPCR revealed that their expression patterns were constitutive and partially overlapping but diverse. The release of the most recent Populus genomic data in Phytozome v9.1 has revealed the largest SS gene family described to date, comprising 15 distinct members. This information will now enable the analysis of transcript expression profiles for those that have not been previously reported. Here, we performed a comprehensive analysis of SS genes in Populus by describing the gene structure, chromosomal location and phylogenetic relationship of each family member. A total of 15 putative SS gene members were identified in the Populus trichocarpa (Torr. & Gray) genome using the SS domain and amino acid sequences from Arabidopsis thaliana as a probe. A phylogenetic analysis indicated that the 15 members could be classified into four groups that fall into three major categories: dicots, monocots & dicots 1 (M & D 1), and monocots & dicots 2 (M & D 2). In addition, the 15 SS genes were found to be unevenly distributed on seven chromosomes. The two conserved domains (sucrose synthase and glycosyl transferase) were found in this family. Meanwhile, the expression profiles of all 15 gene members in seven different organs were investigated in Populus tomentosa (Carr.) by using RT-qPCR. Additional analysis indicated that the poplar SS gene family is also involved in response to water-deficit. The current study provides basic information that will assist in elucidating the functions of poplar SS family. PMID:24508272

  3. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  4. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  5. Polymorphism and expression of isoflavone synthase genes from soybean cultivars.

    PubMed

    Kim, Hyo-Kyoung; Jang, Yun-Hee; Baek, Il-Sun; Lee, Jeong-Hwan; Park, Min Joo; Chung, Young-Soo; Chung, Jong-Il; Kim, Jeong-Kook

    2005-02-28

    Isoflavones are synthesized by isoflavone synthases via the phenylpropanoid pathway in legumes. We have cloned two isoflavone synthase genes, IFS1 and IFS2, from a total of 18 soybean cultivars. The amino acid residues of the proteins that differed between cultivars were dispersed over the entire coding region. However, amino acid sequence variation did not occur in conserved domains such as the ERR triad region, except that one conserved amino acid was changed in the IFS2 protein of the GS12 cultivar (R374G) and the IFS1 proteins of the 99M06 and Soja99s65 cultivars (A109T, F105I). In three cultivars (99M06, 99M116, and Simheukpi), most of amino acid changes were such that the difference between the amino acid sequences of IFS1 and IFS2 was reduced. The expression profiles of three enzymes that convert naringenin to the isoflavone, genistein, chalcone isomerase (CHI), isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) were examined. In general, IFS mRNA was more abundant in etiolated seedlings than mature plants whereas the levels of CHI and F3H mRNAs were similar in the two stages. During seed development, IFS was expressed a little later than CHI and F3H but expression of these three genes was barely detectable, if at all, during later seed hardening. In addition, we found that the levels of CHI, F3H, and IFS mRNAs were under circadian control. We also showed that IFS was induced by wounding and by application of methyl jasmonate to etiolated soybean seedlings. PMID:15750342

  6. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  7. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  8. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  9. Phylogenetic analysis of the genus Avena based on chloroplast intergenic spacer psbA-trnH and single-copy nuclear gene Acc1.

    PubMed

    Yan, Hong-Hai; Baum, Bernard R; Zhou, Ping-Ping; Zhao, Jun; Wei, Yu-Ming; Ren, Chang-Zhong; Xiong, Fang-Qiu; Liu, Gang; Zhong, Lin; Zhao, Gang; Peng, Yuan-Ying

    2014-05-01

    Two uncorrelated nucleotide sequences, chloroplast intergenic spacer psbA-trnH and acetyl CoA carboxylase gene (Acc1), were used to perform phylogenetic analyses in 75 accessions of the genus Avena, representing 13 diploids, seven tetraploid, and four hexaploids by maximum parsimony and Bayesian inference. Phylogenic analyses based on the chloroplast intergenic spacer psbA-trnH confirmed that the A genome diploid might be the maternal donor of species of the genus Avena. Two haplotypes of the Acc1 gene region were obtained from the AB genome tetraploids, indicating an allopolyploid origin for the tetraploid species. Among the AB genome species, both gene trees revealed differences between Avena agadiriana and the other species, suggesting that an AS genome diploid might be the A genome donor and the other genome diploid donor might be the Ac genome diploid Avena canariensis or the Ad genome diploid Avena damascena. Three haplotypes of the Acc1 gene have been detected among the ACD genome hexaploid species. The haplotype that seems to represent the D genome clustered with the tetraploid species Avena murphyi and Avena maroccana, which supported the CD genomic designation instead of AC for A. murphyi and A. maroccana.

  10. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  11. Adaptive Cruise Control (ACC)

    NASA Astrophysics Data System (ADS)

    Reif, Konrad

    Die adaptive Fahrgeschwindigkeitsregelung (ACC, Adaptive Cruise Control) ist eine Weiterentwicklung der konventionellen Fahrgeschwindigkeitsregelung, die eine konstante Fahrgeschwindigkeit einstellt. ACC überwacht mittels eines Radarsensors den Bereich vor dem Fahrzeug und passt die Geschwindigkeit den Gegebenheiten an. ACC reagiert auf langsamer vorausfahrende oder einscherende Fahrzeuge mit einer Reduzierung der Geschwindigkeit, sodass der vorgeschriebene Mindestabstand zum vorausfahrenden Fahrzeug nicht unterschritten wird. Hierzu greift ACC in Antrieb und Bremse ein. Sobald das vorausfahrende Fahrzeug beschleunigt oder die Spur verlässt, regelt ACC die Geschwindigkeit wieder auf die vorgegebene Sollgeschwindigkeit ein (Bild 1). ACC steht somit für eine Geschwindigkeitsregelung, die sich dem vorausfahrenden Verkehr anpasst.

  12. [Chitin Synthase 2 (CHS2) gene of Malassezia species].

    PubMed

    Kano, Rui

    2005-01-01

    Malassezia species have been recognized as members of the microbiological flora of human and animal skin; they are also considered to play an important role in the pathogenesis of folliculitis, atopic dermatitis and otitis externa. Therefore, the molecular characteristics were investigated to clarify the epidemiology and the pathogenesis of diseases associated with Malassezia species in human and animals. Molecular investigation was made of 105 clinical isolates of M. pachydermatis from dogs and cats by random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene sequence analyses. The RAPD analysis and CHS2 gene analysis indicated that clinical isolates of M. pachydermatis were divided into four distinct genetic types (A, B, C and D). Type A was isolated from lesions of atopic dermatitis, flea allergic dermatitis, otitis externa, pyoderma and seborrheic (dermatitidis) in dogs and cats, and might be predominant on this. The phylogenetic analysis of the nucleotide sequences of CHS2 gene fragments of standard strains of 11 Malassezia species showed 11 distinct clusters of this species. PMID:16094288

  13. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  14. Arabidopsis protein phosphatase 2C ABI1 interacts with type I ACC synthases and is involved in the regulation of ozone-induced ethylene biosynthesis.

    PubMed

    Ludwików, Agnieszka; Cieśla, Agata; Kasprowicz-Maluśki, Anna; Mituła, Filip; Tajdel, Małgorzata; Gałgański, Łukasz; Ziółkowski, Piotr A; Kubiak, Piotr; Małecka, Arleta; Piechalak, Aneta; Szabat, Marta; Górska, Alicja; Dąbrowski, Maciej; Ibragimow, Izabela; Sadowski, Jan

    2014-06-01

    Ethylene plays a crucial role in various biological processes and therefore its biosynthesis is strictly regulated by multiple mechanisms. Posttranslational regulation, which is pivotal in controlling ethylene biosynthesis, impacts 1-aminocyclopropane 1-carboxylate synthase (ACS) protein stability via the complex interplay of specific factors. Here, we show that the Arabidopsis thaliana protein phosphatase type 2C, ABI1, a negative regulator of abscisic acid signaling, is involved in the regulation of ethylene biosynthesis under oxidative stress conditions. We found that ABI1 interacts with ACS6 and dephosphorylates its C-terminal fragment, a target of the stress-responsive mitogen-activated protein kinase, MPK6. In addition, ABI1 controls MPK6 activity directly and by this means also affects the ACS6 phosphorylation level. Consistently with this, ozone-induced ethylene production was significantly higher in an ABI1 knockout strain (abi1td) than in wild-type plants. Importantly, an increase in stress-induced ethylene production in the abi1td mutant was compensated by a higher ascorbate redox state and elevated antioxidant activities. Overall, the results of this study provide evidence that ABI1 restricts ethylene synthesis by affecting the activity of ACS6. The ABI1 contribution to stress phenotype underpins its role in the interplay between the abscisic acid (ABA) and ethylene signaling pathways. PMID:24637173

  15. The y1 gene of maize codes for phytoene synthase.

    PubMed

    Buckner, B; Miguel, P S; Janick-Buckner, D; Bennetzen, J L

    1996-05-01

    The cloned y1 locus of maize was sequenced and found to encode phytoene synthase. Different "wild-type" alleles of the locus were found to differ by the insertion of transposable elements in their promoter and polyA addition regions, and by the length of a CCA tandem repeat series, without any obvious effect on function of the gene. A dominant Y1 ("wild-type") allele was observed to be expressed at highest levels in the seedling but also in the embryo and endosperm. The Mu3 transposable element insertion responsible for a pastel allele of y1, which gives lowered levels of carotenoids in the endosperm of kernels and seedlings grown at high temperatures, was located in the 5' end of the gene. Although the size of the transcript from this y1 mutation suggests that the Mu3 element provides the promoter for this allele, leaf tissue in this mutant line contained approximately normal amounts of y1 mRNA. A recessive allele of y1, which conditions normal levels of carotenoids in the embryo and seedling, but almost no carotenoids in the endosperm, was found to accumulate normal amounts of y1 mRNA in the seedling and embryo, while y1 transcripts were not detected in the endosperm.

  16. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  17. Dual-level regulation of ACC synthase activity by MPK3/MPK6 cascade and its downstream WRKY transcription factor during ethylene induction in Arabidopsis.

    PubMed

    Li, Guojing; Meng, Xiangzong; Wang, Ruigang; Mao, Guohong; Han, Ling; Liu, Yidong; Zhang, Shuqun

    2012-06-01

    Plants under pathogen attack produce high levels of ethylene, which plays important roles in plant immunity. Previously, we reported the involvement of ACS2 and ACS6, two Type I ACS isoforms, in Botrytis cinerea-induced ethylene biosynthesis and their regulation at the protein stability level by MPK3 and MPK6, two Arabidopsis pathogen-responsive mitogen-activated protein kinases (MAPKs). The residual ethylene induction in the acs2/acs6 double mutant suggests the involvement of additional ACS isoforms. It is also known that a subset of ACS genes, including ACS6, is transcriptionally induced in plants under stress or pathogen attack. However, the importance of ACS gene activation and the regulatory mechanism(s) are not clear. In this report, we demonstrate using genetic analysis that ACS7 and ACS11, two Type III ACS isoforms, and ACS8, a Type II ACS isoform, also contribute to the B. cinerea-induced ethylene production. In addition to post-translational regulation, transcriptional activation of the ACS genes also plays a critical role in sustaining high levels of ethylene induction. Interestingly, MPK3 and MPK6 not only control the stability of ACS2 and ACS6 proteins via direct protein phosphorylation but also regulate the expression of ACS2 and ACS6 genes. WRKY33, another MPK3/MPK6 substrate, is involved in the MPK3/MPK6-induced ACS2/ACS6 gene expression based on genetic analyses. Furthermore, chromatin-immunoprecipitation assay reveals the direct binding of WRKY33 to the W-boxes in the promoters of ACS2 and ACS6 genes in vivo, suggesting that WRKY33 is directly involved in the activation of ACS2 and ACS6 expression downstream of MPK3/MPK6 cascade in response to pathogen invasion. Regulation of ACS activity by MPK3/MPK6 at both transcriptional and protein stability levels plays a key role in determining the kinetics and magnitude of ethylene induction.

  18. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  19. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    PubMed Central

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide as well as other sphingolipid levels. Because SMS2 also has CPE synthase activity, we prepared Smsr/Sms2 double KO mice. We found that CPE levels were not significantly changed in macrophages, suggesting that CPE levels are not exclusively dependent on SMSr and SMS2 activities. We then measured CPE levels in Sms1 KO mice and found that Sms1 deficiency also reduced plasma CPE levels. Importantly, we found that expression of Sms1 or Sms2 in SF9 insect cells significantly increased not only SM but also CPE formation, indicating that SMS1 also has CPE synthase activity. Moreover, we measured CPE synthase Km and Vmax for SMS1, SMS2, and SMSr using different NBD ceramides. Our study reveals that all mouse SMS family members (SMSr, SMS1, and SMS2) have CPE synthase activity. However, neither CPE nor SMSr appears to be a critical regulator of ceramide levels in vivo. PMID:25605874

  20. Expression of potato S-adenosyl-L-methionine synthase (SbSAMS) gene altered developmental characteristics and stress responses in transgenic Arabidopsis plants.

    PubMed

    Kim, Sun Hee; Kim, Sang Hyon; Palaniyandi, Sasikumar Arunachalam; Yang, Seung Hwan; Suh, Joo-Won

    2015-02-01

    S-adenosyl-L-methionine (SAM) synthase (SAMS) catalyze the biosynthesis of SAM, which is a precursor for ethylene and polyamines, and a methyl donor for a number of biomolecules. A full-length cDNA of SAMS from Solanum brevidens was expressed in Arabidopsis thaliana to study its physiological function. RT-PCR analysis showed that SbSAMS expression was enhanced significantly in S. brevidens leaves upon treatment with salt, mannitol, ethephon, IAA and ABA. The transgenic SbSAMS overexpression lines accumulated higher levels S-adenosyl homocysteine (SAHC) and ethylene concomitantly with increased SAM level. Expression levels of genes related to ethylene biosynthesis such as ACC synthase, but not polyamine biosynthesis genes were enhanced in SbSAMS overexpressing Arabidopsis lines. In addition, ABA responsive, wound and pathogen-inducible genes were upregulated in SbSAMS transgenic Arabidopsis plants. Transgenic Arabidopsis lines exhibited higher salt and drought stress tolerance compared to those of vector control. Based on these results we conclude that SbSAMS is expressed under abiotic stress to produce SAM as a broad-spectrum signal molecule to upregulate stress-related genes including ethylene and ABA biosynthetic pathway genes responsible for ABA, pathogen and wound responses. PMID:25559387

  1. Deletion of the trichodiene synthase gene of Fusarium venenatum: two systems for repeated gene deletions.

    PubMed

    Royer, J C; Christianson, L M; Yoder, W T; Gambetta, G A; Klotz, A V; Morris, C L; Brody, H; Otani, S

    1999-10-01

    The trichodiene synthase (tri5) gene of Fusarium venenatum was cloned from a genomic library. Vectors were created in which the tri5 coding sequence was replaced with the Neurospora crassa nitrate reductase (nit3) gene and with the Aspergillus nidulans acetamidase (amdS) gene flanked by direct repeats. The first vector was utilized to transform a nitrate reductase (niaD) mutant of F. venenatum to prototrophy, and the second vector was utilized to confer acetamide utilization to the wild-type strain. Several of the transformants lost the capacity to produce the trichothecene diacetoxyscirpenol and were shown by hybridization analysis to have gene replacements at the tri5 locus. The nit3 gene was removed by retransformation with a tri5 deletion fragment and selection on chlorate. The amdS gene was shown to excise spontaneously via the flanking direct repeats when spores were plated onto fluoroacetamide. PMID:10512673

  2. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  3. The Cellulose Synthase Gene Superfamily and Biochemical Functions of Xylem-Specific Cellulose Synthase-Like Genes in Populus trichocarpa1[W][OA

    PubMed Central

    Suzuki, Shiro; Li, Laigeng; Sun, Ying-Hsuan; Chiang, Vincent L.

    2006-01-01

    Wood from forest trees modified for more cellulose or hemicelluloses could be a major feedstock for fuel ethanol. Xylan and glucomannan are the two major hemicelluloses in wood of angiosperms. However, little is known about the genes and gene products involved in the synthesis of these wood polysaccharides. Using Populus trichocarpa as a model angiosperm tree, we report here a systematic analysis in various tissues of the absolute transcript copy numbers of cellulose synthase superfamily genes, the cellulose synthase (CesA) and the hemicellulose-related cellulose synthase-like (Csl) genes. Candidate Csl genes were characterized for biochemical functions in Drosophila Schneider 2 (S2) cells. Of the 48 identified members, 37 were found expressed in various tissues. Seven CesA genes are xylem specific, suggesting gene networks for the synthesis of wood cellulose. Four Csl genes are xylem specific, three of which belong to the CslA subfamily. The more xylem-specific CslA subfamily is represented by three types of members: PtCslA1, PtCslA3, and PtCslA5. They share high sequence homology, but their recombinant proteins produced by the S2 cells exhibited distinct substrate specificity. PtCslA5 had no catalytic activity with the substrates for xylan or glucomannan. PtCslA1 and PtCslA3 encoded mannan synthases, but PtCslA1 further encoded a glucomannan synthase for the synthesis of (1→4)-β-d-glucomannan. The expression of PtCslA1 is most highly xylem specific, suggesting a key role for it in the synthesis of wood glucomannan. The results may help guide further studies to learn about the regulation of cellulose and hemicellulose synthesis in wood. PMID:16950861

  4. Expression of genes responsible for ethylene production and wilting are differently regulated in carnation (Dianthus caryophyllus L.) petals.

    PubMed

    Kosugi; Shibuya; Tsuruno; Iwazaki; Mochizuki; Yoshioka; Hashiba; Satoh

    2000-09-01

    Carnation petals exhibit autocatalytic ethylene production and wilting during senescence. The autocatalytic ethylene production is caused by the expression of 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase genes, whereas the wilting of petals is related to the expression of the cysteine proteinase (CPase) gene. So far, it has been believed that the ethylene production and wilting are regulated in concert in senescing carnation petals, since the two events occurred closely in parallel with time. In the present study, we investigated the expression of these genes in petals of a transgenic carnation harboring a sense ACC oxidase transgene and in petals of carnation flowers treated with 1,1-dimethyl-4-(phenylsulfonyl)semicarbazide (DPSS). In petals of the transgenic carnation flowers, treatment with exogenous ethylene caused accumulation of the transcript for CPase and in-rolling (wilting), whereas it caused no or little accumulation of the transcripts for ACC oxidase and ACC synthase and negligible ethylene production. In petals of the flowers treated with DPSS, the transcripts for ACC synthase and ACC oxidase were accumulated, but no significant change in the level of the transcript for CPase was observed. These results suggest that the expression of ACC synthase and ACC oxidase genes, which leads to ethylene production, is differentially regulated from the expression of CPase, which leads to wilting, in carnation petals.

  5. Molecular evolution and functional divergence of soluble starch synthase genes in cassava (manihot esculenta crantz).

    PubMed

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes.

  6. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  7. Expression of the trichodiene synthase gene of Fusarium sporotrichioides in Escherichia coli results in sesquiterpene production.

    PubMed

    Hohn, T M; Plattner, R D

    1989-11-15

    Trichodiene synthase is a sesquiterpene cyclase involved in the biosynthesis of trichothecene mycotoxins. We report that insertion of the unaltered trichodiene synthase gene of Fusarium sporotrichioides into the Escherichia coli expression vector pDR540 produced an inactive polypeptide with a molecular weight approximately 2000 greater than that of trichodiene synthase. This result is consistent with the presence of an intron in the trichodiene synthase gene, and prompted us to specifically delete a putative 60-nucleotide intron sequence. Insertion of the intron-deleted open reading frame into pDR540 resulted in the production of active enzyme. Trichodiene synthase activity in crude extracts from induced cultures was 0.07 nmol/min/mg of protein and represented 0.05-0.10% of the total cell protein. A cross-reactive protein was present with the same apparent molecular weight as the subunit of native trichodiene synthase. The recombinant enzyme was partially purified and shown to have properties closely resembling those of the native enzyme. Trichodiene was detected in ethyl acetate extracts from induced cultures at a concentration of 60 micrograms/liter after 4.5 h. These findings support the primary structure recently reported for trichodiene synthase and demonstrate that the expression of a sesquiterpene cyclase in E. coli results in sesquiterpene production. PMID:2817906

  8. Production of geranylgeraniol on overexpression of a prenyl diphosphate synthase fusion gene in Saccharomyces cerevisiae.

    PubMed

    Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

    2010-07-01

    An acyclic diterpene alcohol, (E,E,E)-geranylgeraniol (GGOH), is one of the important compounds used as perfume and pharmacological agents. A deficiency of squalene (SQ) synthase activity allows yeasts to accumulate an acyclic sesquiterpene alcohol, (E,E)-farnesol, in their cells. Since sterols are essential for the growth of yeasts, a deficiency of SQ synthase activity makes the addition of supplemental sterols to the culture media necessary. To develop a GGOH production method not requiring any supplemental sterols, we overexpressed HMG1 encoding hydroxymethylglutaryl-CoA reductase and the genes of two prenyl diphosphate synthases, ERG20 and BTS1, in Saccharomyces cerevisiae. A prototrophic diploid coexpressing HMG1 and the ERG20-BTS1 fusion accumulated GGOH with neither disruption of the SQ synthase gene nor the addition of any supplemental sterols. The GGOH content on the diploid cultivation in a 5-l jar fermenter reached 138.8 mg/l under optimal conditions.

  9. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  10. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  11. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Isolation and gene disruption of the Tox5 gene encoding trichodiene synthase in Gibberella pulicaris.

    PubMed

    Hohn, T M; Desjardins, A E

    1992-01-01

    The trichodiene synthase gene (Tox5) was isolated from Gibberella pulicaris, and its nucleotide sequence was determined. Tox5 was disrupted through transformation with a plasmid carrying a doubly truncated copy of the coding region and a selectable marker for resistance to hygromycin B (Hygr). Analysis of 82 transformants for their ability to produce the trichothecene, 4,15-diacetoxyscirpenol (DAS), resulted in the identification of five DAS- strains. Southern hybridization analysis of DAS- Hygr transformants indicated that the plasmid integrated at the Tox5 locus. The disrupted Tox5 gene was shown to be mitotically stable. Analysis of nine tetrads revealed either the cosegregation of the disrupter plasmid and the DAS- phenotype or the loss of the disrupter plasmid. These results demonstrate the feasibility of using gene disruption in G. pulicaris and suggest a general method for obtaining Tox5- mutants in other trichothecene-producing fungi. PMID:1421511

  13. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  14. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  15. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  16. The human liver glycogen synthase isozyme gene is located on the short arm of chromosome 12

    SciTech Connect

    Nuttall, F.Q.; Gannon, M.C. ); Kubic, V.L.; Hoyt, K.J. )

    1994-01-15

    Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis. Its activity is regulated by a complex phosphorylation-dephosphorylation mechanism and by allosteric stimulators and inhibitors. Two isozymes of synthase, a skeletal muscle type and liver type, have been identified in rabbit and rat tissues using specific polyclonal antibodies. The skeletal muscle type isozyme is present in several organs in addition to skeletal muscle; the liver isozyme has been identified only in liver. Recently, we have purified and characterized the human liver synthase isozyme. We also have cloned and sequenced the gene from a human liver cDNA library. Using the entire cDNA coding sequence as a probe, we report here the localization of the liver synthase isozyme gene to the short arm of chromosome 12. These studies revealed a centromeric signal on chromosome 12 together with signal to glycogen synthase on the short arm of this chromosome in the p11.2-p12.2 region. Measurements of the relative distance from the midpoint of the centromere to the signal corresponding to glycogen synthase suggests that the locus is in the p12.2 band rather than in the more centromeric location.

  17. Gene therapy inhibiting neointimal vascular lesion: in vivo transfer of endothelial cell nitric oxide synthase gene.

    PubMed Central

    von der Leyen, H E; Gibbons, G H; Morishita, R; Lewis, N P; Zhang, L; Nakajima, M; Kaneda, Y; Cooke, J P; Dzau, V J

    1995-01-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as beta-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessels. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia. Images Fig. 1 Fig. 2 Fig. 5 PMID:7532305

  18. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.

    1995-02-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  19. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering.

  20. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  1. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    PubMed

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  2. Identification, genomic organization, and oxidative stress response of a sigma class glutathione S-transferase gene (AccGSTS1) in the honey bee, Apis cerana cerana.

    PubMed

    Yan, Huiru; Jia, Haihong; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-07-01

    Glutathione S-transferases (GSTs) are members of a multifunctional antioxidant enzyme superfamily that play pivotal roles in both detoxification and protection against oxidative damage caused by reactive oxygen species. In this study, a complementary DNA (cDNA) encoding a sigma class GST was identified in the Chinese honey bee, Apis cerana cerana (AccGSTS1). AccGSTS1 was constitutively expressed in all tissues of adult worker bees, including the brain, fat body, epidermis, muscle, and midgut, with particularly robust transcription in the fat body. Relative messenger RNA expression levels of AccGSTS1 at different developmental stages varied, with the highest levels of expression observed in adults. The potential function of AccGSTS1 in cellular defenses against abiotic stresses (cold, heat, UV, H2O2, HgCl2, and insecticides) was investigated. AccGSTS1 was significantly upregulated in response to all of the treatment conditions examined, although the induction levels were varied. Recombinant AccGSTS1 protein showed characteristic glutathione-conjugating catalytic activity toward 1-chloro-2,4-dinitrobenzene. Functional assays revealed that AccGSTS1 could remove H2O2, thereby protecting DNA from oxidative damage. Escherichia coli overexpressing AccGSTS1 showed long-term resistance under conditions of oxidative stress. Together, these results suggest that AccGSTS1 is a crucial antioxidant enzyme involved in cellular antioxidant defenses and honey bee survival.

  3. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  4. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    PubMed

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  5. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  6. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp.

    PubMed Central

    Schendel, F J; August, P R; Anderson, C R; Hanson, R S; Flickinger, M C

    1992-01-01

    The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (Mr, 84,500) with a subunit with an Mr of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes. PMID:1311544

  7. Cloning, sequencing, and expression of the gene for NADH-sensitive citrate synthase of Pseudomonas aeruginosa.

    PubMed Central

    Donald, L J; Molgat, G F; Duckworth, H W

    1989-01-01

    The structural gene for the allosteric citrate synthase of Pseudomonas aeruginosa has been cloned from a genomic library by using the Escherichia coli citrate synthase gene as a hybridization probe under conditions of reduced stringency. Subcloning of portions of the original 10-kilobase-pair (kbp) clone led to isolation of the structural gene, with its promoter, within a 2,083-bp length of DNA flanked by sites for KpnI and BamHI. The nucleotide sequence of this fragment is presented; the inferred amino acid sequence was 70 and 76% identical, respectively, with the citrate synthase sequences from E. coli and Acinetobacter anitratum, two other gram-negative bacteria. DEAE-cellulose chromatography of P. aeruginosa citrate synthase from an E. coli host harboring the cloned P. aeruginosa gene gave three peaks of activity. All three enzyme peaks had subunit molecular weights of 48,000; the proteins were identical by immunological criteria and very similar in kinetics of substrate saturation and NADH inhibition. Because the cloned gene contained only one open reading frame large enough to encode a polypeptide of such a size, the three peaks must represent different forms of the same protein. A portion of the cloned P. aeruginosa gene was used as a hybridization probe under stringent conditions to identify highly homologous sequences in genomic DNA of a second strain classified as P. aeruginosa and isolates of P. putida, P. stutzeri, and P. alcaligenes. When crude extracts of each of these four isolates were mixed with antiserum raised against purified P. aeruginosa citrate synthase, however, only the P. alcaligenes extract cross-reacted. Images PMID:2507528

  8. Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway.

    PubMed Central

    Niyogi, K K; Fink, G R

    1992-01-01

    Arabidopsis thaliana has two genes, ASA1 and ASA2, encoding the alpha subunit of anthranilate synthase, the enzyme catalyzing the first reaction in the tryptophan biosynthetic pathway. As a branchpoint enzyme in aromatic amino acid biosynthesis, anthranilate synthase has an important regulatory role. The sequences of the plant genes are homologous to their microbial counterparts. Both predicted proteins have putative chloroplast transit peptides at their amino termini and conserved amino acids involved in feedback inhibition by tryptophan. ASA1 and ASA2 cDNAs complement anthranilate synthase alpha subunit mutations in the yeast Saccharomyces cerevisiae and in Escherichia coli, confirming that both genes encode functional anthranilate synthase proteins. The distributions of ASA1 and ASA2 mRNAs in various parts of Arabidopsis plants are overlapping but nonidentical, and ASA1 mRNA is approximately 10 times more abundant in whole plants. Whereas ASA2 is expressed at a constitutive basal level, ASA1 is induced by wounding and bacterial pathogen infiltration, suggesting a novel role for ASA1 in the production of tryptophan pathway metabolites as part of an Arabidopsis defense response. Regulation of key steps in aromatic amino acid biosynthesis in Arabidopsis appears to involve differential expression of duplicated genes. PMID:1392592

  9. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  10. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  11. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  12. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  13. Pleiotropic Effect of AccD5 and AccE5 Depletion in Acyl-Coenzyme A Carboxylase Activity and in Lipid Biosynthesis in Mycobacteria

    PubMed Central

    Bazet Lyonnet, Bernardo; Diacovich, Lautaro; Cabruja, Matías; Bardou, Fabienne; Quémard, Annaïk; Gago, Gabriela; Gramajo, Hugo

    2014-01-01

    Mycobacteria contain a large variety of fatty acids which are used for the biosynthesis of several complex cell wall lipids that have been implicated in the ability of the organism to resist host defenses. The building blocks for the biosynthesis of all these lipids are provided by a fairly complex set of acyl-CoA carboxylases (ACCases) whose subunit composition and roles within these organisms have not yet been clearly established. Previous biochemical and structural studies provided strong evidences that ACCase 5 from Mycobacterium tuberculosis is formed by the AccA3, AccD5 and AccE5 subunits and that this enzyme complex carboxylates acetyl-CoA and propionyl-CoA with a clear substrate preference for the latest. In this work we used a genetic approach to unambiguously demonstrate that the products of both accD5 and accE5 genes are essential for the viability of Mycobacterium smegmatis. By obtaining a conditional mutant on the accD5-accE5 operon, we also demonstrated that the main physiological role of this enzyme complex was to provide the substrates for fatty acid and mycolic acid biosynthesis. Furthermore, enzymatic and biochemical analysis of the conditional mutant provided strong evidences supporting the notion that AccD5 and/or AccE5 have an additional role in the carboxylation of long chain acyl-CoA prior to mycolic acid condensation. These studies represent a significant step towards a better understanding of the roles of ACCases in mycobacteria and confirm ACCase 5 as an interesting target for the development of new antimycobacterial drugs. PMID:24950047

  14. Identification of a novel gene coding for neoxanthin synthase from Solanum tuberosum.

    PubMed

    Al-Babili, S; Hugueney, P; Schledz, M; Welsch, R; Frohnmeyer, H; Laule, O; Beyer, P

    2000-11-24

    The polymerase chain reaction analysis of potato plants, transformed with capsanthin capsorubin synthase ccs, revealed the presence of a highly related gene. The cloned cDNA showed at the protein level 89.6% identity to CCS. This suggested that the novel enzyme catalyzes a mechanistically similar reaction. Such a reaction is represented by neoxanthin synthase (NXS), forming the xanthophyll neoxanthin, a direct substrate for abscisic acid formation. The function of the novel enzyme could be proven by transient expression in plant protoplasts and high performance liquid chromatography analysis. The cloned NXS was imported in vitro into plastids, the compartment of carotenoid biosynthesis.

  15. Phylogenetic relationships and Y genome origin in Elymus L. sensu lato (Triticeae; Poaceae) based on single-copy nuclear Acc1 and Pgk1 gene sequences.

    PubMed

    Fan, Xing; Sha, Li-Na; Dong, Zhen-Zhen; Zhang, Hai-Qin; Kang, Hou-Yang; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong

    2013-12-01

    To estimate the origin and genomic relationships of the polyploid species within Elymus L. sensu lato, two unlinked single-copy nuclear gene (Acc1 and Pgk1) sequences of eighteen tetraploids (StH and StY genomes) and fourteen hexaploids (StStH, StYP, StYH, and StYW genomes) were analyzed with those of 35 diploid taxa representing 18 basic genomes in Triticeae. Sequence and phylogenetic analysis suggested that: (1) the St, H, W, and P genomes were donated by Pseudoroegneria, Hordeum, Australopyrum, and Agropyron, respectively, while the Y genome is closely related to the Xp genome in Peridictyon sanctum; (2) different hexaploid Elymus s.l. species may derived their StY genome from different StY genome tetraploid species via independent origins; (3) due to incomplete lineage sorting and/or hybridization events, the genealogical conflict between the two gene trees suggest introgression involving some Elymus s.l. species, Pseudoroegneria, Agropyron and Aegilops/Triticum; (4) it is reasonable to recognize the StH genome species as Elymus sensu stricto, the StY genome species as Roegneria, the StYW genome species as Anthosachne, the StYH genome species as Campeiostachys, and the StYP genome species as Kengyilia. The occurrence of multiple origin and introgression could account for the rich diversity and ecological adaptation of Elymus s.l. species. PMID:23816902

  16. Disruption of homocitrate synthase genes in Candida albicans affects growth but not virulence.

    PubMed

    Kur, Krzysztof; Gabriel, Iwona; Morschhäuser, Joachim; Barchiesi, Francesco; Spreghini, Elisabetta; Milewski, Sławomir

    2010-12-01

    Two genes, LYS21 and LYS22, encoding isoforms of homocitrate synthase, an enzyme catalysing the first committed step in the lysine biosynthetic pathway, were disrupted in Candida albicans using the SAT1 flipper strategy. The double null lys21Δ/lys22Δ mutant lacked homocitrate synthase activity and exhibited lysine auxotrophy in minimal media that could be fully rescued by the addition of 0.5-0.6 mM L: -lysine. On the other hand, its virulence in vivo in the model of disseminated murine candidiasis appeared identical to that of the mother, wild-type strain. These findings strongly question a possibility of exploitation of homocitrate synthase and possibly also other enzymes of the lysine biosynthetic pathway as targets in chemotherapy of disseminated fungal infections.

  17. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    PubMed

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  18. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes.

  19. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  20. mRNA expressions of inducible nitric oxide synthase, endothelial nitric oxide synthase, and neuronal nitric oxide synthase genes in meningitis patients.

    PubMed

    Oztuzcu, Serdar; Igci, Yusuf Ziya; Arslan, Ahmet; Sivasli, Ercan; Ozkara, Esma; Igci, Mehri; Demiryürek, Seniz; Cengiz, Beyhan; Gogebakan, Bulent; Namiduru, Mustafa; Coskun, Mehmet Yavuz; Cakmak, Ecir Ali

    2011-03-01

    Meningitis is an inflammation of the protective membranes covering the brain and spinal cord caused by bacteria, fungi, or viruses with various clinical symptoms. Although meningitis is not so prevalent, it remains the most serious contagious disease. The aim of our study was to investigate the effect of gene expressions of nitric oxide synthases (NOS) on meningitis patients. Using samples taken from 61 meningitis patients, inducible NOS, endothelial NOS (eNOS), and neuronal NOS mRNA levels were assessed in both blood and cerebrospinal fluid (CSF). A control group was constructed of 64 healthy persons. The gene expression analysis was made using real-time polymerase chain reaction method. There was no neuronal NOS expression in either group, whereas inducible NOS expression was detected in 40 blood samples and 12 CSF samples from meningitis patients. However, there were no marked differences between groups (p=0.5104). eNOS expression was detected in all blood and CSF samples, which was markedly higher in patients (p=0.0367). Because the increase in eNOS expression increases NO production, eNOS expression in meningitis patients is of great importance. This increase of eNOS in meningitis patients compared with healthy subjects may lead to novel treatments for reducing the severity of the disease.

  1. [Advances of resveratrol synthase gene in the application of genetic engineering and biofunctional investigation].

    PubMed

    Zheng, Shigang; Li, Zhen; Zhao, Shancang; Wang, Qingguo; Liu, Wei

    2014-03-01

    Resveratrol synthase (RS) plays a key role in resveratrol (Res) biosynthesis. RS gene has been formerly reported to be transformed into many plant species and microorganisms, and to play certain roles in metabolic and regulation processes. In this paper, the transformations of RS gene in plants, and the related changes of biological properties, such as metabolites, anti-pathogen activities, anti-radical properties, and developmental characters in transgenic plants, as well as the production of resveratrol in microbes by utilizing RS gene were summarized. Moreover, the application prospects of RS gene in bioengineering were also addressed.

  2. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  3. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria x ananassa).

    PubMed

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria x ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus.

  4. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  5. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    PubMed Central

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment.These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  6. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    PubMed

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  7. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  8. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  9. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  10. Expression pattern of the coparyl diphosphate synthase gene in developing rice anthers.

    PubMed

    Fukuda, Ari; Nemoto, Keisuke; Chono, Makiko; Yamaguchi, Shinjiro; Nakajima, Masatoshi; Yamagishi, Junko; Maekawa, Masahiko; Yamaguchi, Isomaro

    2004-08-01

    Rice anthers contain high concentrations of gibberellins A(4) and A(7). To understand their physiological roles, we examined the site of their biosynthesis by analyzing the expression pattern of a gene (OsCPS) encoding coparyl diphosphate synthase in developing rice flowers. Expression was apparent in the anthers 1-2 days before flowering, and CPS mRNA accumulated in the maturing pollen.

  11. Suppression of vascular smooth muscle cell responses induced by TNF-α in GM3 synthase gene transfected cells.

    PubMed

    Park, Sung-Suk; Kim, Wun-Jae; Moon, Sung-Kwon

    2011-01-01

    The natural accumulation of ganglioside GM3 (N-glycolylneuraminic acid) on atherosclerotic lesions is a common theory. The present study is the first to examine the effects of the GM3 synthase gene on the responses of vascular smooth muscle cells (VSMC) to tumor necrosis factor-α (TNF-α). We found that overexpression of the GM3 synthase gene inhibited DNA synthesis and ERK1/2 activity induced by TNF-α in VSMC, whereas the basal levels of DNA synthesis and ERK1/2 activity remained unchanged. In addition, GM3 synthase gene transfectants significantly reduced the migration and invasion of VSMC following TNF-α treatment, compared with empty vector transfectants. Furthermore, TNF-α-induced matrix metalloproteinase-9 (MMP-9) expression and promoter activity were also decreased in GM3 synthase gene transfectants. GM3 synthase gene expression markedly suppressed the TNF-α-stimulated transcriptional activity of activator protein-1 (AP-1) and nuclear factor-κB (NF-κB), which are the controlling factors of MMP-9 expression. Consistent with these results, the addition of anti-GM3 antibody into the GM3 synthase gene transfectants blocked inhibition of DNA synthesis, ERK1/2 activity, migration and invasion. Finally, GM3 synthase gene transfectants treated with anti-GM3 antibody reversed the suppression of MMP-9 expression by reducing AP-1 and NF-κB binding activity. These results suggest regulatory roles for the GM3 synthase gene in VSMC proliferation and migration during the formation of atherosclerotic lesions.

  12. Phylogenetically diverse cultivable fungal community and polyketide synthase (PKS), non-ribosomal peptide synthase (NRPS) genes associated with the South China Sea sponges.

    PubMed

    Zhou, Kang; Zhang, Xia; Zhang, Fengli; Li, Zhiyong

    2011-10-01

    Compared with sponge-associated bacteria, the phylogenetic diversity of fungi in sponge and the association of sponge fungi remain largely unknown. Meanwhile, no detection of polyketide synthase (PKS) or non-ribosomal peptide synthase (NRPS) genes in sponge-associated fungi has been attempted. In this study, diverse and novel cultivable fungi including 10 genera (Aspergillus, Ascomycete, Fusarium, Isaria, Penicillium, Plectosphaerella, Pseudonectria, Simplicillium, Trichoderma, and Volutella) in four orders (Eurotiales, Hypocreales, Microascales, and Phyllachorales) of phylum Ascomycota were isolated from 10 species marine sponges in the South China Sea. Eurotiales and Hypocreales fungi were suggested as sponge generalists. The predominant isolates were Penicillium and Aspergillus in Eurotiales followed by Volutella in Hypocreales. Based on the conserved Beta-ketosynthase of PKS and A domain of NRPS, 15 polyketide synthases, and four non-ribosomal peptides synthesis genes, including non-reducing and reducing PKSs and hybrid PKS-NRPS, were detected in these fungal isolates. A lateral gene transfer event was indicated in the comparison between the phylogenetic diversity of 18S rRNA genes and β-ketoacyl synthase domain sequences. Some fungi, especially those with PKS or NRPS genes, showed antimicrobial activity against P. fluorescens, S. aureus and B. subtilis. It was the first time to investigate PKS and NRPS genes in sponge-associated fungi. Based on the detected antibiotics biosynthesis-related PKS and NRPS genes and antimicrobial activity, the potential ecological role of sponge-associated fungi in the chemical defense for sponge host was suggested. This study extended our knowledge of sponge-associated fungal phylogenetic diversity and their potential roles in the chemical defense.

  13. Detecting adaptive evolution and functional divergence in aminocyclopropane-1-carboxylate synthase (ACS) gene family.

    PubMed

    Zhang, Ti-Cao; Qiao, Qin; Zhong, Yang

    2012-06-01

    Ethylene is an essential plant gaseous hormone that controls many aspects of plant growth and development, especially the fruit ripening. It is important to know how this hormone is synthesized and how its production is regulated to understand the roles of ethylene in plant development. The aminocyclopropane-1-carboxylate synthase (ACS) gene is a rate-limiting enzyme in the ethylene biosynthesis pathway, which is encoded by a highly divergent multi-gene family in plant species. Although many ACS genes have been cloned from a wide variety of plant species previously, their origin and evolutionary process are still not clear. In this study, we conducted a phylogenetic analysis based on an updated dataset including 107 members of plant ACS genes and eight ACS-like genes from animal as well as six AATase genes. The motifs were identified and the positive selection and functional divergence in the ACS gene family were detected. The results obtained from these analyses are consistent with previous division of the ACS gene family in angiosperm, i.e., three distinct clades, and show that the duplications of three subclades (I, II and III) ACS genes have occurred after the divergence of gymnosperm and angiosperm. We conclude that the ACS genes could have experienced three times significant positive selection as they underwent expansion in land plants and gain the full-scale ethylene biosynthesis and regulatory functions, and all plant ACS genes originated from plant-ACS-like genes which come from AATase genes.

  14. Evolutionary analyses of the small subunit of glutamate synthase: gene order conservation, gene fusions, and prokaryote-to-eukaryote lateral gene transfers.

    PubMed

    Andersson, Jan O; Roger, Andrew J

    2002-04-01

    Lateral gene transfer has been identified as an important mode of genome evolution within prokaryotes. Except for the special case of gene transfer from organelle genomes to the eukaryotic nucleus, only a few cases of lateral gene transfer involving eukaryotes have been described. Here we present phylogenetic and gene order analyses on the small subunit of glutamate synthase (encoded by gltD) and its homologues, including the large subunit of sulfide dehydrogenase (encoded by sudA). The scattered distribution of the sudA and sudB gene pair and the phylogenetic analysis strongly suggest that lateral gene transfer was involved in the propagation of the genes in the three domains of life. One of these transfers most likely occurred between a prokaryote and an ancestor of diplomonad protists. Furthermore, phylogenetic analyses indicate that the gene for the small subunit of glutamate synthase was transferred from a low-GC gram-positive bacterium to a common ancestor of animals, fungi, and plants. Interestingly, in both examples, the eukaryotes encode a single gene that corresponds to a conserved operon structure in prokaryotes. Our analyses, together with several recent publications, show that lateral gene transfers from prokaryotes to unicellular eukaryotes occur with appreciable frequency. In the case of the genes for sulfide dehydrogenase, the transfer affected only a limited group of eukaryotes--the diplomonads--while the transfer of the glutamate synthase gene probably happened earlier in evolution and affected a wider range of eukaryotes.

  15. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  16. Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1-carboxylate synthase gene.

    PubMed

    Gupta, Aarti; Pal, Ram Krishna; Rajam, Manchikatla Venkat

    2013-07-15

    The ripening hormone, ethylene is known to initiate, modulate and co-ordinate the expression of various genes involved in the ripening process. The burst in ethylene production is the key event for the onset of ripening in climacteric fruits, including tomatoes. Therefore ethylene is held accountable for the tons of post-harvest losses due to over-ripening and subsequently resulting in fruit rotting. In the present investigation, delayed ripening tomatoes were generated by silencing three homologs of 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) gene during the course of ripening using RNAi technology. The chimeric RNAi-ACS construct designed to target ACS homologs, effectively repressed the ethylene production in tomato fruits. Fruits from such lines exhibited delayed ripening and extended shelf life for ∼45 days, with improved juice quality. The ethylene suppression brought about compositional changes in these fruits by enhancing polyamine (PA) levels. Further, decreased levels of ethylene in RNAi-ACS fruits has led to the altered levels of various ripening-specific transcripts, especially the up-regulation of PA biosynthesis and ascorbic acid (AsA) metabolism genes and down-regulation of cell wall hydrolyzing enzyme genes. These results suggest that the down-regulation of ACS homologs using RNAi can be an effective approach for obtaining delayed ripening with longer shelf life and an enhanced processing quality of tomato fruits. Also, the chimeric gene fusion can be used as an effective design for simultaneous silencing of more than one gene. These observations would be useful in better understanding of the ethylene and PA signaling during fruit ripening and molecular mechanisms underlying the interaction of these two molecules in affecting fruit quality traits.

  17. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  18. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  19. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland. PMID:11272819

  20. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.

    PubMed

    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia

    2002-12-01

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  1. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  2. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  3. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    PubMed Central

    2012-01-01

    Background Chrysanthemyl diphosphate synthase (CDS) is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS) gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS. PMID:23137178

  4. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.

    PubMed

    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K

    2015-09-01

    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology. PMID:26164855

  5. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.

    PubMed

    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K

    2015-09-01

    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology.

  6. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  7. Chalcone synthase gene lineage diversification confirms allopolyploid evolutionary relationships of European rostrate violets.

    PubMed

    van den Hof, Kevin; van den Berg, Ronald G; Gravendeel, Barbara

    2008-10-01

    Phylogenetic relationships among and within the subsections of the genus Viola are still far from resolved. We present the first organismal phylogeny of predominantly western European species of subsection Rostratae based on the plastid trnS-trnG intron and intergenic spacer and the nuclear low-copy gene chalcone synthase (CHS) sequences. CHS is a key enzyme in the synthesis of flavonoids, which are important for flower pigmentation. Genes encoding for CHS are members of a multigene family. In Viola, 3 different CHS copies are present. CHS gene lineages obtained confirmed earlier hypotheses about reticulate relationships between species of Viola subsection Rostratae based on karyotype data. Comparison of the CHS gene lineage tree and the plastid species phylogeny of Viola reconstructed in this study indicates that the different CHS copies present in Viola are the products of both recent and more ancient duplications.

  8. Harvesting of novel polyhydroxyalkanaote (PHA) synthase encoding genes from a soil metagenome library using phenotypic screening.

    PubMed

    Schallmey, Marcus; Ly, Anh; Wang, Chunxia; Meglei, Gabriela; Voget, Sonja; Streit, Wolfgang R; Driscoll, Brian T; Charles, Trevor C

    2011-08-01

    We previously reported the construction of metagenomic libraries in the IncP cosmid vector pRK7813, enabling heterologous expression of these broad-host-range libraries in multiple bacterial hosts. Expressing these libraries in Sinorhizobium meliloti, we have successfully complemented associated phenotypes of polyhydroxyalkanoate synthesis mutants. DNA sequence analysis of three clones indicates that the complementing genes are homologous to, but substantially different from, known polyhydroxyalkanaote synthase-encoding genes. Thus we have demonstrated the ability to isolate diverse genes for polyhydroxyalkanaote synthesis by functional complementation of defined mutants. Such genes might be of use in the engineering of more efficient systems for the industrial production of bioplastics. The use of functional complementation will also provide a vehicle to probe the genetics of polyhydroxyalkanaote metabolism and its relation to carbon availability in complex microbial assemblages. PMID:21631577

  9. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  10. Congenital hyperreninemic hypoaldosteronism unlinked to the aldosterone synthase (CYP11B2) gene.

    PubMed

    Kayes-Wandover, K M; Tannin, G M; Shulman, D; Peled, D; Jones, K L; Karaviti, L; White, P C

    2001-11-01

    Isolated hyperreninemic hypoaldosteronism presenting in infancy is usually caused by mutations in the CYP11B2 gene encoding aldosterone synthase. We studied five patients in four unrelated kindreds with hyperreninemic hypoaldosteronism, in whom we were unable to find such mutations. All presented in infancy with failure to thrive, hyponatremia, hyperkalemia, markedly elevated plasma renin activity, and low or inappropriately normal aldosterone levels. All had normal cortisol levels and no signs or symptoms of congenital adrenal hyperplasia. All responded to fludrocortisone treatment. There were no mutations detected in exons or splice junctions of CYP11B2. Linkage of the disorder to CYP11B2 was studied in two unrelated consanguineous patients and in an affected sib pair. The consanguineous patients were each heterozygous for at least one of three polymorphic microsatellite markers near CYP11B2, excluding linkage to CYP11B2. However, linkage of the disease to CYP11B2 could not be excluded in the affected sib pair. Genes involved in the regulation of aldosterone biosynthesis, including those encoding angiotensinogen, angiotensin-converting enzyme, and the AT1 angiotensin II receptor were similarly excluded from linkage. These results demonstrate the existence of an inherited form of hyperreninemic hypoaldosteronism distinct from aldosterone synthase deficiency. The affected gene(s) remain to be determined.

  11. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  12. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  13. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae

    PubMed Central

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-01-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  14. Three New Non-reducing Polyketide Synthase Genes from the Lichen-Forming Fungus Usnea longissima

    PubMed Central

    Wang, Yi; Wang, Juan; Cheong, Yong Hwa

    2014-01-01

    Usnea longissima has a long history of use as a traditional medicine. Several bioactive compounds, primarily belonging to the polyketide family, have been isolated from U. longissima. However, the genes for the biosynthesis of these compounds are yet to be identified. In the present study, three different types of non-reducing polyketide synthases (UlPKS2, UlPKS4, and UlPKS6) were identified from a cultured lichen-forming fungus of U. longissima. Phylogenetic analysis of product template domains showed that UlPKS2 and UlPKS4 belong to group IV, which includes the non-reducing polyketide synthases with an methyltransferase (MeT) domain that are involved in methylorcinol-based compound synthesis; UlPKS6 was found to belong to group I, which includes the non-reducing polyketide synthases that synthesize single aromatic ring polyketides, such as orsellinic acid. Reverse transcriptase-PCR analysis demonstrated that UlPKS2 and UlPKS4 were upregulated by sucrose; UlPKS6 was downregulated by asparagine, glycine, and alanine. PMID:24808732

  15. Codon usage bias analysis for the spermidine synthase gene from Camellia sinensis (L.) O. Kuntze.

    PubMed

    You, E; Wang, Y; Ding, Z T; Zhang, X F; Pan, L L; Zheng, C

    2015-07-03

    The spermidine synthase (SPDS) gene exists widely in all types of plants. In this paper, the codon usage of the SPDS gene from Camellia sinensis (CsSPDS) was analyzed. The results showed that the codon usage of the CsSPDS gene is biased towards the T-ended or A-ended codons, which is similar to that observed in 73 genes selected from the C. sinensis genome. An ENC-plot for 15 SPDS genes from various plant species suggested that mutational bias was the major factor in shaping codon usage in these genes. Codon usage frequency analysis indicated that there was little difference between the CsSPDS gene and dicot genomes, such as Arabidopsis thaliana and Nicotiana tabacum, but significant differences in codon usage were observed between the CsSPDS gene and monocot genomes, such as Triticum aestivum and Zea mays. Therefore, A. thaliana and N. tabacum expression systems may be more suitable for the expression of the CsSPDS gene.

  16. Noncholinergic penile erection in mice lacking the gene for endothelial nitric oxide synthase.

    PubMed

    Burnett, Arthur L; Chang, Alex G; Crone, Julie K; Huang, Paul L; Sezen, Sena E

    2002-01-01

    With the current understanding that nitric oxide (NO) mediates penile erection, the endothelial isoform of NO synthase (eNOS) has been implicated in this function. We undertook this study applying transgenic mice with targeted deletion of the eNOS gene (eNOS-/- mice) as an experimental approach to evaluate the importance of eNOS in cholinergically stimulated erectile function in vivo. Combined pharmacostimulation with intracavernosal carbachol (3 ng) administration and submaximal cavernous nerve (CN) electrical stimulation (16 Hz, 5 millisecond, 1 V) simultaneous with intracavernosal pressure (ICP) monitoring, and both biochemical assay of NO synthase activity and Western blot analysis of eNOS protein content in penile tissue, were performed on eNOS-/- mice and wild-type controls. Combined intracavernosal carbachol administration and submaximal CN electrical stimulation raised the recorded ICP, elicited by CN electrical stimulation alone in wild-type mice (from 35.7 +/- 2.7 to 48.1 +/- 5.5 mm Hg, P < .05) but not in eNOS-/ - mice (from 54.9 +/- 6.3 to 51.0 +/- 9.5 mm Hg, not significant [NS]). Pretreatment with the nonselective nitric oxide synthase inhibitor nitro-L-arginine methyl ester (L-NAME; 100 mg intracavernosally) blocked electrically stimulated ICP responses in eNOS-/- mice to baseline levels (37.8 +/- 4.4 vs 12.7 +/- 4.0 mm Hg, P < .05). In penes of eNOS-/- mice, approximately 60% NO synthase activity of wild-type penis levels was retained (NS), and eNOS protein was absent. We concluded that eNOS-/- mice preserve erectile function on the basis of a noncholinergic but NO-dependent mechanism and that eNOS physiologically mediates penile erection under cholinergic stimulation. PMID:11780929

  17. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia.

    PubMed

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-11-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure. These results are consistent with the possibility of an incidental acquisition and transmission of P. jiroveci mutant types, either by person to person transmission or from an environmental source.

  18. Molecular cloning and in vitro expression of a silent phenoxazinone synthase gene from Streptomyces lividans.

    PubMed

    Madu, A C; Jones, G H

    1989-12-14

    Phenoxazinone synthase (PHS) catalyzes a step in actinomycin D biosynthesis in Streptomyces antibioticus. Two sequences from Streptomyces lividans that hybridize to the phs gene of S. antibioticus have been cloned in Escherichia coli K-12 using the plasmid pBR322. Although there was some similarity in the restriction maps of the two cloned fragments, neither insert appeared to be a direct subset of the other nor of the S. antibioticus phs gene. In vitro expression studies, in a streptomycete coupled transcription-translation system, showed that a 3.98-kb SphI fragment encoded a PHS-related protein. These observations provide additional support for the existence of silent genes for antibiotic production in streptomycetes.

  19. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  20. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  1. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  2. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  3. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  4. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  5. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  6. Characterization of a non-reducing polyketide synthase gene from lichen Dirinaria applanata.

    PubMed

    Valarmathi, R; Hariharan, G N; Venkataraman, Gayatri; Parida, Ajay

    2009-04-01

    Lichens are known to produce a variety of secondary metabolites including polyketides that have diverse biological role(s). The biosynthesis of fungal polyketides is governed by type I polyketide synthases (PKS), enzymes with a multidomain structure, including the beta-ketoacyl synthase (KS), acyl transferase (AT), ketoreductase (KR), dehydratase (DH), enoyl reductase (ER) and acyl carrier protein (ACP) domains. Established soredial cultures of Dirinaria applanata (Fée) producing atranorin and divaricatic acid were used to characterize a polyketide synthase gene (DnPKS). A 743bp fragment corresponding to the ketosynthase domain (KS) was isolated using degenerate primers. Complete sequence information for DnPKS (8162bp) was obtained by walking in the 5'and 3' directions of the isolated KS domain using TAIL PCR. A translation of the DnPKS sequence identified the presence of KS, AT, two ACP and TE domains with eight intervening introns. TBLASTX analysis and comparison with other PKS sequences suggest that the coding region of DnPKS sequence is complete with the identification of putative start and stop codons and a stretch of 1226 upstream of the start codon corresponding to the putative promoter. This sequence shows the presence of putative binding sites for fungal transcription factors such as AflR, AreA and PacC. Southern blot analysis suggests that additional DnPKS-like genes may be present in the D. applanata genome. Additionally, expression of a DnPKS-like transcript was examined under different culture conditions and found to be down-regulated by sucrose and up-regulated by mannitol, UV and neutral pH. PMID:19427006

  7. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  8. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  9. Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants.

    PubMed

    Song, Jian; Liu, Jing; Weng, Manli; Huang, Yanyan; Luo, Lei; Cao, Pengxiu; Sun, Haiwei; Liu, Jie; Zhao, Jinhong; Feng, Dianqi; Wang, Bin

    2013-01-15

    A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants.

  10. SUI-family genes encode phosphatidylserine synthases and regulate stem development in rice.

    PubMed

    Yin, Hengfu; Gao, Peng; Liu, Chengwu; Yang, Jun; Liu, Zhongchi; Luo, Da

    2013-01-01

    In vascular plants, the regulation of stem cell niche determines development of aerial shoot which consists of stems and lateral organs. Intercalary meristem (IM) controls internode elongation in rice and other grasses, however little attention has been paid to the underlying mechanism of stem cell maintenance. Here, we investigated the stem development in rice and showed that the Shortened Uppermost Internode 1 (SUI1) family of genes are pivotal for development of rice stems. We demonstrated that SUI-family genes regulate the development of IM for internode elongation and also the cell expansion of the panicle stem rachis in rice. The SUI-family genes encoded base-exchange types of phosphatidylserine synthases (PSSs), which possessed enzymatic activity in a yeast complementary assay. Overexpression of SUI1 and SUI2 caused outgrowths of internodes during vegetative development, and we showed that expression patterns of Oryza Sativa Homeobox 15 (OSH15) and Histone4 were impaired. Furthermore, genome-wide gene expression analysis revealed that overexpression and RNA knockdown of SUI-family genes affected downstream gene expression related to phospholipid metabolic pathways. Moreover, using Ultra-performance liquid chromatography-quadrupole time of flight-mass spectrometry, we analyzed PS contents in different genetic backgrounds of rice and showed that the quantity of very long chain fatty acids PS is affected by transgene of SUI-family genes. Our study reveals a new mechanism conveyed by the SUI1 pathway and provides evidence to link lipid metabolism with plant stem cell maintenance.

  11. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    PubMed

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  12. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  13. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    PubMed

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  14. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    PubMed

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  15. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    PubMed

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  16. Metabolic changes of Brassica rapa transformed with a bacterial isochorismate synthase gene.

    PubMed

    Simoh, Sanimah; Linthorst, Huub J M; Lefeber, Alfons W M; Erkelens, Cornelis; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert

    2010-12-15

    Metabolome analysis by 1-dimensional proton nuclear magnetic resonance (¹H NMR) coupled with multivariate data analysis was carried out in Brassica rapa plants transformed with a gene encoding bacterial isochorismate synthase (ICS). Partial least square-discrimination analysis (PLS-DA) on selected signals suggested that the resonances that were dominant in the transgenic plants corresponded to a glucosinolate (neoglucobrassicin), phenylpropanoids (sinapoyl malate, feruloyl malate, caffeoyl malate), organic acids (succinic acid and fumaric acid) and sugars (α- and β-glucose). In contrast, amino acids alanine threonine, valine, leucine were dominant in the untransformed controls. In addition, HPLC data showed that the transgenic plant accumulated salicylic acid (SA) at significantly higher levels than the control plants, whereas the phylloquinone levels were not affected. The results suggest that the expression of the bacterial isochorismate synthase gene in B. rapa does not affect fluxes into pathways to other groups of secondary metabolites through competition for the same precursor. On the contrary, the biosynthesis of isochorismate-derived products (SA) seems to induce the competitive pathways via phenylalanine (phenylpropanoids) and tryptophan (IAA and indole glucosinolates).

  17. Primary structure of the dihydrofolate reductase-thymidylate synthase gene from Toxoplasma gondii.

    PubMed

    Roos, D S

    1993-03-25

    We have determined the primary genomic and cDNA sequences encoding the bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) enzyme of the protozoan parasite Toxoplasma gondii (dihydrofolate reductase, EC 1.5.1.3; thymidylate synthase EC 2.1.1.45). The DHFR-TS gene of T. gondii (strain RH) spans more than 6 kilobases of genomic DNA. Unlike the DHFR-TS genes of other protists, sequences encoding the Toxoplasma protein are interrupted by numerous intervening sequences. Analysis of processed T. gondii DHFR-TS cDNAs reveals a single open reading frame of 1830 nucleotides, predicting a 610-amino acid protein of molecular mass of 69 kilodaltons. Because its nucleotide composition and codon usage are roughly comparable to those observed in "higher" eukaryotes, the Toxoplasma DHFR-TS sequence is particularly useful for assessing evolutionary relationships between eukaryotic species. The predicted amino acid sequence for the DHFR-TS protein shows conservation of the major structural features identified in other DHFR and TS enzymes, while revealing certain differences which may be exploited for the design of novel antifolates for treatment of toxoplasmosis associated with AIDS.

  18. Cloning and Characterization of a Squalene Synthase Gene from the Chaga Medicinal Mushroom, Inonotus obliquus (Agaricomycetes).

    PubMed

    Zhang, Panpan; Cao, Xiaoying; Li, Changgen; Zheng, Zhujun; Yong, Sun; Jiang, Ji-Hong

    2016-01-01

    Squalene synthase catalyzes the condensation of 2 molecules of farnesyl diphosphate to produce squalene, the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. A squalene synthase gene, designated IoSQS, was isolated from Inonotus obliquus, a medicinal mushroom that produces a plethora of bioactive triterpenes. IoSQS complementary DNA was found to contain an open reading frame of 1476 bp, encoding a protein of 491 amino acids with a calculated molecular mass of 55.85 kDa. The IoSQS genomic DNA sequence consisted of 1813 bp and contained 4 exons and 3 introns. The restriction fragment polymorphisms revealed by Southern blot analysis suggested that IoSQS was a single-copy gene. Promoter analysis indicated that the 5' upstream region of IoSQS possessed various potential elements associated with physiological and environmental factors. The expression pattern of IoSQS in different stages and under methyl jasmonate treatment correlated with the accumulation of total triterpenoids and was consistent with the predicted results of the IoSQS promoter region. The N-terminal 466 residues of the hydrophilic sequence were expressed as a His-tagged protein in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. Squalene was detected in vitro in reaction mixture by high-performance liquid chromatography analysis. These results suggest that the IoSQS enzyme is involved in squalene production in I. obliquus. PMID:27649606

  19. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  20. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi.

    PubMed

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1-A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  1. Determination of 1-aminocycopropane-1-carboxylic acid (ACC) to assess the effects of ACC deaminase-containing bacteria on roots of canola seedlings.

    PubMed

    Penrose, D M; Moffatt, B A; Glick, B R

    2001-01-01

    Previously, it was proposed that plant growth-promoting bacteria that possess the enzyme, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, can reduce the amount of ethylene produced by a plant and thereby promote root elongation. To test this model, canola seeds were imbibed in the presence of the chemical ethylene inhibitor, 2-aminoethoxyvinyl glycine (AVG), various strains of plant growth-promoting bacteria, and a psychrophilic bacterium containing an ACC deaminase gene on a broad host range plasmid. The extent of root elongation and levels of ACC, the immediate precursor of ethylene, were measured in the canola seedling roots. A modification of the Waters AccQ.Tag Amino Acid Analysis Method was used to quantify ACC in the root extracts. It was found that, in the presence of the ethylene inhibitor, AVG, or any one of several ACC deaminase-containing strains of bacteria, the growth of canola seedling roots was enhanced and the ACC levels in these roots were lowered.

  2. [Mechanism of genuineness of Glycyrrhiza uralensis based on SNP of β-Amyrin synthase gene].

    PubMed

    Zang, Yi-mei; Li, Yan-peng; Qiao, Jing; Chen, Hong-hao; Liu, Chun-sheng

    2015-07-01

    β-Amyrin synthase (β-AS) genes of Glycyrrhiza uralensis from 6 different regions were analyzed by PCR-SSCP and sequenced, then the correlationship between β-AS SNP and regions of Glycyrrhiza uralensis were determined. According to the 1 coding single nucleotide polymorphism on the first exon of β-AS gene at 94 bp site, Glycyrrhiza uralensis could be divided into 3 genotypes. In these genotypes, the percentage of 94A type in genuine regions was much higher, and it had significant differences with the percentage in non-genuine regions (P < 0.001). The results of the experiment proved that different β-AS genotypes at 94 bp site from different regions may be one of the important reasons to result in the genuineness of Glycyrrhiza uralensis. PMID:26552155

  3. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  4. Glyphosate selected amplification of the 5-enolpyruvylshikimate-3-phosphate synthase gene in cultured carrot cells.

    PubMed

    Shyr, Y Y; Hepburn, A G; Widholm, J M

    1992-04-01

    CAR and C1, two carrot (Daucus carota L.) suspension cultures of different genotypes, were subjected to stepwise selection for tolerance to the herbicide glyphosate [(N-phosphonomethyl)glycine]. The specific activity of the target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), as well as the mRNA level and copy number of the structural gene increased with each glyphosate selection step. Therefore, the tolerance to glyphosate is due to stepwise amplification of the EPSPS genes. During the amplification process, DNA rearrangement did not occur within the EPSPS gene of the CAR cell line but did occur during the selection step from 28 to 35 mM glyphosate for the C1 cell line, as determined by Southern hybridization of selected cell DNA following EcoRI restriction endonuclease digestion. Two cell lines derived from a previously selected glyphosate-tolerant cell line (PR), which also had undergone EPSPS gene amplification but have been maintained in glyphosate-free medium for 2 and 5 years, have lost 36 and 100% of the increased EPSPS activity, respectively. Southern blot analysis of these lines confirms that the amplified DNA is relatively stable in the absence of selection. These studies demonstrate that stepwise selection for glyphosate resistance reproducibly produces stepwise amplification of the EPSPS genes. The relative stability of this amplification indicates that the amplified genes are not extrachromosomal.

  5. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    PubMed

    Kondrák, Mihály; Marincs, Ferenc; Kalapos, Balázs; Juhász, Zsófia; Bánfalvi, Zsófia

    2011-01-01

    Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1) gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  6. Structural characterization of 15-hydroxytrichodiene, a sesquiterpenoid produced by transformed tobacco cell suspension cultures expressing a trichodiene synthase gene from Fusarium sporotrichioides.

    PubMed

    Zook, M; Johnson, K; Hohn, T; Hammerschmidt, R

    1996-12-01

    Tobacco (Nicotiana tabaccum) cell suspension cultures transformed with a gene encoding trichodiene synthase, a sesquiterpene synthase from the fungus Fusarium sporotrichioides, produced a novel sesquiterpenoid derived from the in vivo production of trichodiene. Mass and nuclear magnetic resonance spectroscopic analyses identified the new compound as 15-hydroxytrichodiene. The in vivo hydroxylation of trichodiene by transformant tobacco cell suspension cultures demonstrates that the introduction of a foreign sesquiterpene synthase gene can result in the production of novel sesquiterpenoid metabolites. PMID:8987907

  7. Analysis of gene expression profiles for cell wall modifying proteins and ACC synthases in soybean cyst nematode colonized roots, adventitious rooting hypocotyls, root tips, flooded roots, and IBA and ACC treatment roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We hypothesized that soybean cyst nematode (SCN) co-opts a part or all of one or more innate developmental process in soybean to establish its feeding structure, syncytium, in soybean roots. The syncytium in soybean roots is formed in a predominantly lateral direction within the vascular bundle by ...

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  9. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  10. Protection of rabbit lungs from endotoxin injury by in vivo hyperexpression of the prostaglandin G/H synthase gene.

    PubMed Central

    Conary, J T; Parker, R E; Christman, B W; Faulks, R D; King, G A; Meyrick, B O; Brigham, K L

    1994-01-01

    A recombinant prostaglandin G/H (PGH) synthase gene has been expressed in vitro in bovine pulmonary artery endothelial cells and in vivo in rabbits by transfection with a plasmid using cationic liposomes. Transfection of bovine pulmonary artery endothelial cells with the PGH synthase cDNA resulted in increased intracellular PGH synthase protein (determined by Western blot analysis) and increased release of prostacyclin. Rabbits intravenously transfected with the PGH synthase gene had increased plasma levels of prostacyclin and PGE2, and their lungs produced increased amounts of the same eicosanoids. In an in situ, perfused preparation of PGH synthase transfected rabbit lungs, the pressor response to endotoxin was markedly attenuated. In addition, pulmonary edema and release of thromboxane B2 into the perfusate after endotoxin infusion were markedly decreased in transfected lungs compared to controls (animals transfected with a pCMV4 construct that did not contain a cDNA insert). The data suggest that augmented endogenous production of prostacyclin and PGE2, achieved by liposome-mediated gene transfer, protects the lungs from endotoxin. This may be caused in part by suppression of endotoxin-stimulated thromboxane B2 production. Modification of lipid mediator responses by in vivo transfection is a potential approach to the therapy of acute lung injury. Images PMID:8163682

  11. Association of thymidylate synthase gene with endometrial cancer risk in a Chinese population

    PubMed Central

    Xu, Wang-Hong; Long, Ji-Rong; Zheng, Wei; Ruan, Zhi-Xian; Cai, Qiuyin; Cheng, Jia-Rong; Zhao, Gen-Ming; Xiang, Yong-Bing; Shu, Xiao-Ou

    2009-01-01

    We comprehensively evaluated genetic variants in the thymidylate synthase (TYMS) gene in association with endometrial cancer risk in a population-based case-control study of 1,199 incident endometrial cancer cases and 1,212 age frequency-matched population controls. Exposure information was obtained via in-person interview and DNA samples (blood or buccal cell) were collected. Genotyping of 11 haplotype-tagging SNPs (htSNPs) for the TYMS gene plus the 5kb flanking regions was performed for 1,028 cases and 1,003 controls by using the Affymetrix MegAllele Targeted Genotyping System. Of eleven htSNPs identified, seven that are located in flanking regions of the TYMS gene are also in the ENOSF1 (rTS) gene. The SNP rs3819102, located in the 3′ flanking region of the TYMS gene and in an intron of the ENOSF1 gene, was associated with risk of endometrial cancer. The odds ratio (OR) for the CC genotype was 1.5 (95% confidence interval (CI) =1.0–2.2) compared to the TT genotype. Haplotype TTG in block 2 of the TYMS gene, which includes SNPs rs10502289, rs2298583, and rs2298581 (located in introns of the ENOSF1 gene), was associated with a marginally significant decrease in risk of endometrial cancer under the dominant model (OR=0.8, 95%CI=0.6–1.0). This study suggests that genetic polymorphisms in the TYMS or ENOSF1 genes may play a role in the development of endometrial cancer among Chinese women. PMID:19190136

  12. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    PubMed Central

    2012-01-01

    Background In plants, sucrose synthase (Sus) is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7) identified from diploid fiber cotton (Gossypium arboreum). Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development. PMID:22694895

  13. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    PubMed

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  14. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  15. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  16. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  17. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  18. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    PubMed

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  19. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    PubMed

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme.

  20. Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase.

    PubMed Central

    Corey, E J; Matsuda, S P; Bartel, B

    1994-01-01

    We report the cloning, characterization, and overexpression of Saccharomyces cerevisiae ERG7, which encodes lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7], the enzyme responsible for the complex cyclization/rearrangement step in sterol biosynthesis. Oligonucleotide primers were designed corresponding to protein sequences conserved between Candida albicans ERG7 and the related Arabidopsis thaliana cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A PCR product was amplified from yeast genomic DNA using these primers and was used to probe yeast libraries by hybridization. Partial-length clones homologous to the two known epoxysqualene mutases were isolated, but a full-length sequence was found neither in cDNA nor genomic libraries, whether in phage or plasmids. Two overlapping clones were assembled to make a functional reconstruction of the gene, which contains a 2196-bp open reading frame capable of encoding an 83-kDa protein. The reconstruction complemented the erg7 mutation when driven from either its native promoter or the strong ADH1 promoter. Images PMID:8134375

  1. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  2. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  3. Disruption of Spodoptera exigua larval development by silencing chitin synthase gene A with RNA interference.

    PubMed

    Chen, X; Tian, H; Zou, L; Tang, B; Hu, J; Zhang, W

    2008-12-01

    RNA interference (RNAi) is a powerful tool for rapidly analyzing gene functions. However, little is known about the possible use of dsRNA/siRNA as a pest control method. Here, we demonstrate that dsRNA/siRNA can induce the silence of chitin synthase gene A (CHSA), which is an important gene for the growth and development of cuticles and trachea in beet armyworm, Spodoptera exigua. Based on the in vitro RNAi experiments in an insect cell line (Trichoplusia ni High 5), in vivo RNAi was performed by injecting synthesized dsRNA/siRNA into the 4th instar larvae of S. exigua. Significantly lower levels of CHSA transcripts were detected. In addition, the cuticle of these insects was disordered and the epithelial walls of larval trachea did not expand uniformly in injected individuals. Moreover, Injections significantly increased abnormalities relative to control larvae. These results highlighted the possibility of dsRNA/siRNA for gene function studies in lepidopteran insects and future pest control. PMID:18662430

  4. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  5. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  6. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed Central

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-01-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence. PMID:8550512

  7. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-02-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence.

  8. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  9. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  10. Ethylene-Enhanced 1-Aminocyclopropane-1-carboxylic Acid Synthase Activity in Ripening Apples 1

    PubMed Central

    Bufler, Gebhard

    1984-01-01

    Apples (Malus sylvestris Mill, cv Golden Delicious) were treated before harvest with aminoethoxyvinylglycine (AVG). AVG is presumed to reversibly inhibit 1-aminocyclopropane-1-carboxylic acid (ACC) activity, but not the formation of ACC synthase. AVG treatment effectively blocked initiation of autocatalytic ethylene production and ripening of harvested apples. Exogenous ethylene induced extractable ACC synthase activity and ripening in AVG-treated apples. Removal of exogenous ethylene caused a rapid decline in ACC synthase activity and in CO2 production. The results with ripened, AVG-treated apples indicate (a) a dose-response relationship between ethylene and enhancement of ACC synthase activity with a half-maximal response at approximately 0.8 μl/l ethylene; (b) reversal of ethylene-enhanced ACC synthase activity by CO2; (c) enhancement of ACC synthase activity by the ethylene-activity analog propylene. Induction of ACC synthase activity, autocatalytic ethylene production, and ripening of preclimacteric apples not treated with AVG were delayed by 6 and 10% CO2, but not by 1.25% CO2. However, each of these CO2 concentrations reduced the rate of increase of ACC synthase activity. PMID:16663569

  11. Ethylene biosynthetic genes are differentially expressed during carnation (Dianthus caryophyllus L.) flower senescence.

    PubMed

    ten Have, A; Woltering, E J

    1997-05-01

    Ethylene production and expression patterns of an 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase (CARAO1) and of two ACC synthase (EC 4.4.1.14) genes (CARACC3 and CARAS1) were studied in floral organs of cut carnation flowers (Dianthus caryophyllus L.) cv. White Sim. During the vase life and after treatment of fresh flowers with ethylene, production of ethylene and expression of ethylene biosynthetic genes first started in the ovary followed by the styles and the petals. ACC oxidase was expressed in all the floral organs whereas, during the vase life, tissue-specific expression of the two ACC synthase genes was observed. After treatment with a high ethylene concentration, tissue specificity of the two ACC synthase genes was lost and only a temporal difference in expression remained. In styles, poor correlation between ethylene production and ACC synthase (CARAS1) gene expression was observed suggesting that either activity is regulated at the translational level or that the CARAS1 gene product requires an additional factor for activity. Isolated petals showed no increase in ethylene production and expression of ethylene biosynthetic genes when excised from the flower before the increase in petal ethylene production (before day 7); showed rapid cessation of ethylene production and gene expression when excised during the early phase of petal ethylene production (day 7) and showed a pattern of ethylene production and gene expression similar to the pattern observed in the attached petals when isolated at day 8. The interorgan regulation of gene expression and ethylene as a signal molecule in flower senescence are discussed.

  12. Isolation of the Inositol Phosphoceramide Synthase Gene (AUR1) from Stress-Tolerant Yeast Pichia kudriavzevii.

    PubMed

    Yoo, Boung-Hyuk; Kim, Myoung-Dong

    2015-11-01

    This study is the first report of the entire nucleotide sequence of an inositol phosphoceramide synthase gene from the stress-tolerant yeast Pichia kudriavzevii (PkAUR1). Sequence analysis revealed an open reading frame that spans 1,443 bp and encodes a 480-amino-acid-residue protein with the highest sequence similarity (41.7%) to Aur1 from Spathaspora passalidarum. A phenotypic assay with transformed S. cerevisiae and P. kudriavzevii indicated that two amino acid residues, Phe166 and Gly249, play crucial roles in the resistance to aureobasidin A, which is consistent with previous reports for other fungal Aur1s. The GenBank Accession No. for PkAUR1 is KP729614. PMID:26323269

  13. ACC Synthase Genes are Polymorphic in Watermelon (Citrullus spp.) and Differentially Expressed in Flowers and in Response to Auxin and Gibberellin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The flowering pattern of watermelon species (Citrullus) is either monoecious or andromonoecious. In watermelon (Citrullus lanatus L.), ethylene promotes male flower development while inhibitors of ethylene promote pistillate (pistil-bearing) flower formation. This is opposite to the feminizing effec...

  14. Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit.

    PubMed Central

    Niyogi, K K; Last, R L; Fink, G R; Keith, B

    1993-01-01

    Suppressors of the blue fluorescence phenotype of the Arabidopsis trp1-100 mutant can be used to identify mutations in genes involved in plant tryptophan biosynthesis. Two recessive suppressor mutations define a new gene, TRP4. The trp4 mutant and the trp1-100 mutant are morphologically normal and grow without tryptophan, whereas the trp4; trp1-100 double mutant requires tryptophan for growth. The trp4; trp1-100 double mutant does not segregate at expected frequencies in genetic crosses because of a female-specific defect in transmission of the double mutant genotype, suggesting a role for the tryptophan pathway in female gametophyte development. Genetic and biochemical evidence shows that trp4 mutants are defective in a gene encoding the beta subunit of anthranilate synthase (AS). Arabidopsis AS beta subunit genes were isolated by complementation of an Escherichia coli anthranilate synthase mutation. The trp4 mutation cosegregates with one of the genes, ASB1, located on chromosome 1. Sequence analysis of the ASB1 gene from trp4-1 and trp4-2 plants revealed different single base pair substitutions relative to the wild type. Anthranilate synthase alpha and beta subunit genes are regulated coordinately in response to bacterial pathogen infiltration. PMID:8400875

  15. Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans.

    PubMed

    Sagane, Yoshimasa; Zech, Karin; Bouquet, Jean-Marie; Schmid, Martina; Bal, Ugur; Thompson, Eric M

    2010-05-01

    Extracellular matrices play important, but poorly investigated, roles in morphogenesis. Extracellular cellulose is central to regulation of pattern formation in plants, but among metazoans only tunicates are capable of cellulose biosynthesis. Cellulose synthase (CesA) gene products are present in filter-feeding structures of all tunicates and also regulate metamorphosis in the ascidian Ciona. Ciona CesA is proposed to have been acquired by lateral gene transfer from a prokaryote. We identified two CesA genes in the sister-class larvacean Oikopleura dioica. Each has a mosaic structure of a glycoslyltransferase 2 domain upstream of a glycosyl hydrolase family 6 cellulase-like domain, a signature thus far unique to tunicates. Spatial-temporal expression analysis revealed that Od-CesA1 produces long cellulose fibrils along the larval tail, whereas Od-CesA2 is responsible for the cellulose scaffold of the post-metamorphic filter-feeding house. Knockdown of Od-CesA1 inhibited cellulose production in the extracellular matrix of the larval tail. Notochord cells either failed to align or were misaligned, the tail did not elongate properly and tailbud embryos also exhibited a failure to hatch. Knockdown of Od-CesA2 did not elicit any of these phenotypes and instead caused a mild delay in pre-house formation. Phylogenetic analyses including Od-CesAs indicate that a single lateral gene transfer event from a prokaryote at the base of the lineage conferred biosynthetic capacity in all tunicates. Ascidians possess one CesA gene, whereas duplicated larvacean genes have evolved distinct temporal and functional specializations. Extracellular cellulose microfibrils produced by the pre-metamorphic Od-CesA1 duplicate have a role in notochord and tail morphogenesis.

  16. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  17. Endothelin-1 gene and endothelial nitric oxide synthase gene polymorphisms in adolescents with juvenile and obesity-associated hypertension.

    PubMed

    Baráth, A; Endreffy, E; Bereczki, Cs; Gellén, B; Szücs, B; Németh, I; Túri, S

    2007-03-01

    Hypertension is an increasing public health problem all over the world. Essential hypertension accounts for more than 90% of cases of hypertension. It is a complex genetic, environmental and demographic trait. New method in molecular biology has been proposed a number of candidate genes, but the linkage or association with hypertension has been problematic (lack of gene-gene and gene-environment interaction). It is well known that genetic influences are more important in younger hypertensives, because children are relatively free from the common environmental factors contributing to essential hypertension. The association studies compare genotype ferquencies of the candidate gene between patient groups and the controls, in pathways known to be involved in blood pressure regulation. This study examined three polymorphisms of these factors encoding genes (ET-1 G+5665T (Lys198Asn), endothelial nitric oxide synthase (eNOS) T-786C promoter polymorphism and 27-bp repeat polymorphism in intron 4) in adolescents with juvenile essential and obesity-associated hypertension. Significant differences were found in the G/T genotype of the ET-1 polymorphism in the hypertensive and obese+hypertensive patients (body mass index (BMI) > 30). A strong association was detected between the BMI and the polymorphism of the ET-1 gene. It seems that ET-1 gene polymorphism plays a role in the development of juvenile hypertension associated with obesity. Although no significant differences were seen in the case of the eNOS promoter polymorphism and the eNOS 4th intron 27-bp repeat polymorphism. It seems that eNOS may play a role, but this is not the main factor in the control of blood pressure; it is rather a fine regulator in this process. This study with adolescents facilitates an understanding of the genetic factors promoting juvenile hypertension and obesity. PMID:17444275

  18. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed.

  19. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed. PMID:25014656

  20. Primary structure of the gene encoding the bifunctional dihydrofolate reductase-thymidylate synthase of Leishmania major.

    PubMed Central

    Beverley, S M; Ellenberger, T E; Cordingley, J S

    1986-01-01

    We have determined the nucleotide sequence of the dihydrofolate reductase-thymidylate synthetase (DHFR-TS) gene of the protozoan parasite Leishmania major (dihydrofolate reductase, EC 1.5.1.3 and thymidylate synthase, EC 2.1.1.45). The DHFR-TS protein is encoded by a single 1560-base-pair open reading frame within genomic DNA, in contrast to vertebrate DHFRs or mouse and phage T4 TSs, which contain intervening sequences. Comparisons of the DHFR-TS sequence with DHFR and TS sequences of other organisms indicate that the order of enzymatic activities within the bifunctional polypeptide chain is DHFR followed by TS, the Leishmania bifunctional DHFR-TS evolved independently and not through a phage T4-related intermediate, and the rate of evolution of both the DHFR and TS domains has not detectably changed despite the acquisition of new functional properties by the bifunctional enzyme. The Leishmania gene is 86% G+C in the third codon position, in contrast to genes of the parasite Plasmodium falciparum, which exhibit an opposite bias toward A+T. The DHFR-TS locus is encoded within a region of DNA amplified in methotrexate-resistant lines, as previously proposed. PMID:3458220

  1. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  2. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  3. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    PubMed

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  4. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  5. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  6. Human molybdopterin synthase gene: genomic structure and mutations in molybdenum cofactor deficiency type B.

    PubMed Central

    Reiss, J; Dorche, C; Stallmeyer, B; Mendel, R R; Cohen, N; Zabot, M T

    1999-01-01

    Biosynthesis of the molybdenum cofactor (MoCo) can be divided into (1) the formation of a precursor and (2) the latter's subsequent conversion, by molybdopterin synthase, into the organic moiety of MoCo. These two steps are reflected by the complementation groups A and B and the two formally distinguished types of MoCo deficiency that have an identical phenotype. Both types of MoCo deficiency result in a pleiotropic loss of all molybdoenzyme activities and cause severe neurological damage. MOCS1 is defective in patients with group A deficiency and has been shown to encode two enzymes for early synthesis via a bicistronic transcript with two consecutive open reading frames (ORFs). MOCS2 encodes the small and large subunits of molybdopterin synthase via a single transcript with two overlapping reading frames. This gene was mapped to 5q and comprises seven exons. The coding sequence and all splice site-junction sequences were screened for mutations, in MoCo-deficient patients in whom a previous search for MOCS1 mutations had been negative. In seven of the eight patients whom we investigated, we identified MOCS2 mutations that, by their nature, are most likely responsible for the deficiency. Three different frameshift mutations were observed, with one of them found on 7 of 14 identified alleles. Furthermore, a start-codon mutation and a missense mutation of a highly conserved amino acid residue were found. The locations of the mutations confirm the functional role of both ORFs. One of the patients with identified MOCS2 mutations had been classified as type B, in complementation studies. These findings support the hypothetical mechanism, for both forms of MoCo deficiency, that formerly had been established by cell-culture experiments. PMID:10053004

  7. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea.

  8. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  9. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  10. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  11. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  12. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  13. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose.

  14. Ventilation and oxygenation induce endothelial nitric oxide synthase gene expression in the lungs of fetal lambs.

    PubMed Central

    Black, S M; Johengen, M J; Ma, Z D; Bristow, J; Soifer, S J

    1997-01-01

    At birth, ventilation and oxygenation immediately decrease pulmonary vascular resistance (PVR) and increase pulmonary blood flow (PBF); more gradual changes occur over the next several hours. Nitric oxide, produced by endothelial nitric oxide synthase (eNOS), mediates these gradual changes. To determine how ventilation and oxygenation affect eNOS gene expression, 12 fetal lambs were ventilated for 8 h without changing fetal descending aortic blood gases or pH (rhythmic distension) or with 100% oxygen (O2 ventilation). Vascular pressures and PBF were measured. Total RNA, protein, and tissue sections were prepared from lung tissue for RNase protection assays, Western blotting, and in situ hybridization. O2 ventilation increased PBF and decreased PVR more than rhythmic distension (P < 0.05). Rhythmic distension increased eNOS mRNA expression; O2 ventilation increased eNOS mRNA expression more and increased eNOS protein expression (P < 0.05). To define the mechanisms responsible for these changes, ovine fetal pulmonary arterial endothelial cells were exposed to 1, 21, or 95% O2 or to shear stress. 95% O2 increased eNOS mRNA and protein expression (P < 0.05). Shear stress increased eNOS mRNA and protein expression (P < 0.05). Increased oxygenation but more importantly increased PBF with increased shear stress induce eNOS gene expression and contribute to pulmonary vasodilation after birth. PMID:9294110

  15. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    PubMed

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  16. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  17. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  18. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  19. Endothelial nitric oxide synthase (eNOS) gene polymorphism in early term chronic allograft nephropathy.

    PubMed

    Yilmaz, E; Mir, S; Berdeli, A

    2009-12-01

    Chronic allograft nephropathy (CAN) is a complex phenomenon caused by underlying kidney disease with superimposed enviromental and genetic factors. CAN development begins with progressive renal microvascular injury. Endothelial cells play key roles in the regulation of vascular tone, permeability, and remodeling. A reduction in basal nitric oxide (NO) release as a result of genetic variation in endothelial NO synthase (eNOS) function may predispose to hypertension, thrombosis, vasospasm, and atherosclerosis, all contributing to the development of CAN. We analyzed the G894T mutation at exon 7 of the eNOS gene in relationship to CAN among 81 children with renal transplantations. The 20 patients who developed CAN underwent renal biopsies for histological confirmation. Proteinuria and hypertension were observed in CAN. We selected 173 healthy reference subjects. The G894T polymorphism of the eNOS gene was determined by PCR-restriction fragment-length polymorphism analysis. The group included 33 male and 48 female subjects who received 32 living-related grafts and 49 from deceased donors (DD) donors. Donor age (y) was 32.7 +/- 13.7 and the HLA A,B,DR mismatch number of the cadaveric cases was 3.5 +/- 0.79. The distribution of the genotypes were ENOS GG/GT/TT 48%, 33%, 19%, respectively. G-alleles frequency was 64.8%; T-allele frequency was 35.2%. ENOS G894T gene polymorphism did not seem to influence long-term renal allograft outcome. Recipient ENOS G894T gene polymorphism did not alter the risk of chronic allograft failure. Even if NO synthesis and bioactivity are influenced by this polymorphism, many vasoactive factors may have roles to suppress the advantageous effects of NO. PMID:20005399

  20. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. Citrate synthase mutants of Agrobacterium are attenuated in virulence and display reduced vir gene induction.

    PubMed

    Suksomtip, Maneewan; Liu, Pu; Anderson, Tamara; Tungpradabkul, Sumalee; Wood, Derek W; Nester, Eugene W

    2005-07-01

    A citrate synthase (CS) deletion mutant of Agrobacterium tumefaciens C58 is highly attenuated in virulence. The identity of the mutant was initially determined from its amino acid sequence, which is 68% identical to Escherichia coli and 77% identical to Brucella melitensis. The mutant lost all CS enzymatic activity, and a cloned CS gene complemented a CS mutation in Sinorhizobium. The CS mutation resulted in a 10-fold reduction in vir gene expression, which likely accounts for the attenuated virulence. When a plasmid containing a constitutive virG [virG(Con)] locus was introduced into this mutant, the level of vir gene induction was restored to nearly wild-type level. Further, the virG(Con)-complemented CS mutant strain induced tumors that were similar in size and number to those induced by the parental strain. The CS mutation resulted in only a minor reduction in growth rate in a glucose-salts medium. Both the CS mutant and the virG(Con)-complemented CS strain displayed similar growth deficiencies in a glucose-salts medium, indicating that the reduced growth rate of the CS mutant could not be responsible for the attenuated virulence. A search of the genome of A. tumefaciens C58 revealed four proteins, encoded on different replicons, with conserved CS motifs. However, only the locus that when mutated resulted in an attenuated phenotype has CS activity. Mutations in the other three loci did not result in attenuated virulence and any loss of CS activity, and none were able to complement the CS mutation in Sinorhizobium. The function of these loci remains unknown. PMID:15995199

  3. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  4. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  5. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  6. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  7. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  8. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii.

    PubMed

    Awasthi, Praveen; Mahajan, Vidushi; Jamwal, Vijay Lakshmi; Kapoor, Nitika; Rasool, Shafaq; Bedi, Yashbir S; Gandhi, Sumit G

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant-microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plant CHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C. forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction of CfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, our in silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34. PMID:27659336

  9. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications. PMID:26428312

  10. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  11. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  12. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  13. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  14. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  15. Epidemiology and clinical relevance of Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations.

    PubMed

    Matos, O; Esteves, F

    2010-09-01

    A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS) mutations in patients with P. jirovecii pneumonia (PcP), in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  16. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  17. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  18. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  19. ACC deaminase activity in avirulent Agrobacterium tumefaciens D3.

    PubMed

    Hao, Youai; Charles, Trevor C; Glick, Bernard R

    2011-04-01

    Some plant-growth-promoting bacteria encode the enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase, which breaks down ACC, the direct precursor of ethylene biosynthesis in all higher plants, into ammonia and α-ketobutyrate and, as a result, reduces stress ethylene levels in plants caused by a wide range of biotic and abiotic stresses. It was previously shown that ACC deaminase can inhibit crown gall development induced by Agrobacterium tumefaciens and can partially protect plants from this disease. Agrobacterium tumefaciens D3 has been previously reported to contain a putative ACC deaminase structural gene (acdS) and a regulatory gene (acdR = lrpL). In the present study, it was found that A. tumefaciens D3 is an avirulent strain. ACC deaminase activity and its regulation were also characterized. Under gnotobiotic conditions, wild-type A. tumefaciens D3 was shown to be able to promote plant root elongation, while the acdS and lrpL double mutant strain A. tumefaciens D3-1 lost that ability. When co-inoculated with the virulent strain, A. tumefaciens C58, in wounded castor bean plants, both the wild-type A. tumefaciens D3 and the mutant A. tumefaciens D3-1 were found to be able to significantly inhibit crown gall development induced by A. tumefaciens C58. PMID:21491979

  20. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  1. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    PubMed

    Tai, Deqiang; Tian, Ji; Zhang, Jie; Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  2. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  3. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  4. Expression of Sucrose Synthase Genes Involved in Enhanced Elongation of Pondweed (Potamogeton distinctus) Turions under Anoxia

    PubMed Central

    HARADA, TARO; SATOH, SHIGERU; YOSHIOKA, TOSHIHITO; ISHIZAWA, KIMIHARU

    2005-01-01

    • Background and Aims Overwintering buds (turions) of the monocot aquatic pondweed species (Potamogeton distinctus) are highly tolerant to anoxic stress. Sucrose metabolism accompanied by enhanced activity of sucrose synthase (SuSy) operates actively during anaerobic elongation of pondweed turions. The aim of this study is to isolate SuSy genes from the turions and to investigate their transcriptional changes in response to anoxia and other stimuli. • Methods SuSy genes were isolated from pondweed turions by PCR methods and transcript levels of SuSy genes were examined in response to anoxia, sugars and plant hormones. In addition, the effects of anoxia on SuSy activity were examined both in the soluble fraction and in the microsomal fraction. • Key Results cDNAs of two SuSy genes (PdSUS1 and PdSUS2) were cloned from pondweed turions. The levels of PdSUS1 transcripts increased under anoxia but did not with sugar treatments. Anoxia-stimulated elongation of turions was further enhanced by 2,4-dichlorophenoxyacetic acid (2,4-D) and suppressed by treatments with sorbitol, 2-deoxyglucose (2-dGlc) and abscisic acid (ABA). The levels of PdSUS1 transcripts were increased by 2,4-D and decreased by sorbitol under anoxia. The levels of PdSUS2 transcripts were not significantly affected by anoxia and any other treatments. SuSy activity of turions under anoxia was enhanced in the soluble fraction, but not in the microsomal fraction. • Conclusions Up-regulation of PdSUS1 transcription under anoxia may not be attributed to sugar starvation under anoxia. A positive correlation between stem elongation and the level of PdSUS1 transcripts was observed in turions treated with anoxic conditions, 2,4-D and sorbitol. The increase in SuSy activity in the cytosol may contribute to sugar metabolism and sustain stem elongation under anoxia. PMID:16033779

  5. Recombination and horizontal transfer of nodulation and ACC deaminase (acdS) genes within Alpha- and Betaproteobacteria nodulating legumes of the Cape Fynbos biome.

    PubMed

    Lemaire, Benny; Van Cauwenberghe, Jannick; Chimphango, Samson; Stirton, Charles; Honnay, Olivier; Smets, Erik; Muasya, A Muthama

    2015-11-01

    The goal of this work is to study the evolution and the degree of horizontal gene transfer (HGT) within rhizobial genera of both Alphaproteobacteria (Mesorhizobium, Rhizobium) and Betaproteobacteria (Burkholderia), originating from South African Fynbos legumes. By using a phylogenetic approach and comparing multiple chromosomal and symbiosis genes, we revealed conclusive evidence of high degrees of horizontal transfer of nodulation genes among closely related species of both groups of rhizobia, but also among species with distant genetic backgrounds (Rhizobium and Mesorhizobium), underscoring the importance of lateral transfer of symbiosis traits as an important evolutionary force among rhizobia of the Cape Fynbos biome. The extensive exchange of symbiosis genes in the Fynbos is in contrast with a lack of significant events of HGT among Burkholderia symbionts from the South American Cerrado and Caatinga biome. Furthermore, homologous recombination among selected housekeeping genes had a substantial impact on sequence evolution within Burkholderia and Mesorhizobium. Finally, phylogenetic analyses of the non-symbiosis acdS gene in Mesorhizobium, a gene often located on symbiosis islands, revealed distinct relationships compared to the chromosomal and symbiosis genes, suggesting a different evolutionary history and independent events of gene transfer. The observed events of HGT and incongruence between different genes necessitate caution in interpreting topologies from individual data types.

  6. Circular RNA of the human sphingomyelin synthase 1 gene: Multiple splice variants, evolutionary conservatism and expression in different tissues

    PubMed Central

    Filippenkov, Ivan B; Sudarkina, Olga Yu; Limborska, Svetlana A; Dergunova, Lyudmila V

    2015-01-01

    The human sphingomyelin synthase 1 gene (SGMS1) encodes an essential enzyme that is involved in the synthesis of sphingomyelin and diacylglycerol from phosphatidylcholine and ceramide. Among the products of SGMS1, we found new transcripts, circular RNAs (circRNAs), that contain sequences of the gene's 5′ untranslated region (5′UTR). Some of them include the gene's coding region and fragments of introns. An analysis of the abundance of circRNAs in human tissues showed that the largest transcripts were predominantly found in different parts of the brain. circRNAs of rat and mouse sphingomyelin synthase 1 orthologous genes were detected and are highly similar to the human SGMS1 gene transcripts. A quantitative analysis of the abundance of such transcripts also revealed their elevated amount in the brain. A computational analysis of sequences of human circRNAs showed their high potential of binding microRNAs (miRNAs), including the miRNAs that form complexes with Ago proteins and the mRNA of SGMS1. We assume that the circRNAs identified here participate in the regulation of the function of the SGMS1 gene in the brain. PMID:26274505

  7. Effects of feeding transgenic corn with mCry1Ac or maroACC gene to laying hens for 12 weeks on growth, egg quality and organ health.

    PubMed

    Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F

    2016-08-01

    The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar

  8. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  9. Absence of mutations associated with sulfa resistance in Pneumocystis carinii dihydropteroate synthase gene from non-human primates.

    PubMed

    Demanche, C; Guillot, J; Berthelemy, M; Petitt, T; Roux, P; Wakefield, A E

    2002-06-01

    The dihydropteroate synthase (DHPS) gene from Pneumocystis carinii isolated from non-human primates was amplified using a polymerase chain reaction (PCR) and sequenced to analyse point mutations associated with sulfa resistance. P. carinii DHPS gene amplification was obtained from eight lung samples from five New World primate species and one Old World primate species. None of the animals had been exposed to sulfa drugs and only the wild-type P. carinii DHPS sequence at codons 55 and 57 was observed. These data support the hypothesis that high rates of DHPS mutants in P. carinii f. sp. hominis have arisen with increased use of sulfa drugs for P. carinii pneumonia prophylaxis.

  10. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases.

    PubMed

    Lopez, J C; Ryan, S; Blankenship, R E

    1996-06-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  11. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    PubMed

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  12. Analysis of THCA synthase gene expression in cannabis: a preliminary study by real-time quantitative PCR.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Boschi, Ilaria

    2013-09-10

    In this paper we describe analyses performed by Real-Time Reverse-Transcriptase Polymerase Chain Reaction (real-time RT-PCR) on RNA of 12 samples, carried out for forensic purposes to investigate a correlation between tetrahydrocannabinol (THC) concentration in Cannabis and the tetrahydrocannabinol acid synthase (THCAS) gene expression. Samples were obtained from an experimental cultivation of declared potency Cannabis variety seeds and from seizures. The Rubisco gene and the 26S ribosomal RNA gene were used as internal control genes for their constant expression and stability. As results we found minor gene expression in samples from leaves of young plants. Further, grouping results for cannabis samples with similar characteristics, we have found an increased relative expression in samples with the highest percentage of THC coming from seized sample and adult plants.

  13. Characterization of GaWRKY1, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-delta-cadinene synthase-A.

    PubMed

    Xu, Yan-Hua; Wang, Jia-Wei; Wang, Shui; Wang, Jian-Ying; Chen, Xiao-Ya

    2004-05-01

    The cotton (+)-delta-cadinene synthase (CAD1), a sesquiterpene cyclase, catalyzes a branch-point step leading to biosynthesis of sesquiterpene phytoalexins, including gossypol. CAD1-A is a member of CAD1 gene family, and its promoter contains a W-box palindrome with two reversely oriented TGAC repeats, which are the proposed binding sites of WRKY transcription factors. We isolated several WRKY cDNAs from Gossypium arboreum. One of them, GaWRKY1, encodes a protein containing a single WRKY domain and a putative N-terminal Leu zipper. Similar to genes encoding enzymes of cotton sesquiterpene pathway, GaWRKY1 was down-regulated in a glandless cotton cultivar that contained much less gossypol. GaWRKY1 showed a temporal and spatial pattern of expression comparable to that of CAD1-A in various aerial organs examined, including sepal, stigma, anther, and developing seeds. In suspension cells, expression of both GaWRKY1 and CAD1-A genes and biosynthesis of sesquiterpene aldehydes were strongly induced by a fungal elicitor preparation and methyl jasmonate. GaWRKY1 interacted with the 3x W-box derived from CAD1-A promoter in yeast (Saccharomyces cerevisiae) one-hybrid system and in vitro. Furthermore, in transgenic Arabidopsis plants, overexpression of GaWRKY1 highly activated the CAD1-A promoter, and transient assay in tobacco (Nicotiana tabacum) leaves demonstrated that W-box was required for this activation. These results suggest that GaWRKY1 participates in regulation of sesquiterpene biosynthesis in cotton, and CAD1-A is a target gene of this transcription factor. PMID:15133151

  14. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese. PMID:26579574

  15. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese.

  16. Endothelial nitric oxide synthase gene intron4 VNTR polymorphism in patients with chronic kidney disease.

    PubMed

    Elshamaa, Manal F; Sabry, Samar; Badr, Ahmed; El-Ahmady, Mostafa; Elghoroury, Eman A; Thabet, Eman H; Kandil, Dina; Kamel, Solaf

    2011-09-01

    Nitric oxide production is reduced in renal disease, partially due to decreased endothelial nitric oxide production. Evidence indicates that nitric oxide deficiency contributes to cardiovascular events and progression of kidney damage. A polymorphism in intron 4 of the endothelial constitutive nitric oxide synthase (ecNOS) gene is a candidate gene in cardiovascular and renal diseases. We investigated a potential involvement of this polymorphism in chronic renal failure. A case-control study involved 78 children with chronic kidney disease (CKD) and 30 healthy controls. All participants were genotyped for the ecNOS4 polymorphism by the polymerase chain reaction (PCR). Dialyzed (maintenance hemodialysis) and conservative treatment children had significantly higher frequency of the aa genotype and ecNOS4a allele (P<0.05) compared with controls. The combined genotype aa+ab vs. bb comparison validated that a allele is a high-risk allele for end-stage renal disease (ESRD) (P<0.05). Serum nitric oxide level was found to be lower in carriers of the ecNOS 4a allele than in noncarriers (100.29±27.32 vs. 152.73±60.39 μmol/l, P=0.04). Interestingly, 85.95% of the ecNOS 4a allele ESRD patients were found hypertensive in comparison to the 60.67% patients of non noncarriers (bb genotype) (P=0.04). Also, 35.90% of the ecNOS 4a allele ESRD patients were found to have cardiovascular disease in comparison to the 5.13% patients of noncarriers (bb genotype) (P=0.01). On multiple linear regression analysis, a allele was independently associated with hypertension (P=0.03). There was a significantly higher frequency of the ecNOS4a allele carriers among CKD children, both on MHD and conservative treatment than in controls. This suggests that the ecNOS gene polymorphism may be associated with an increased risk of chronic renal failure. PMID:21519233

  17. Cloning and characterization of a novel gene that encodes (S)-beta-bisabolene synthase from ginger, Zingiber officinale.

    PubMed

    Fujisawa, Masaki; Harada, Hisashi; Kenmoku, Hiromichi; Mizutani, Satoru; Misawa, Norihiko

    2010-06-01

    Ginger, Zingiber officinale Roscoe, contains a fragrant oil mainly composed of sesquiterpenes and monoterpenes. We isolated a cDNA that codes for a sesquiterpene synthase from young rhizomes of ginger, Z. officinale Roscoe, Japanese cultivar "Kintoki". The cDNA, designated ZoTps1, potentially encoded a protein that comprised 550 amino acid residues and exhibited 49-53% identity with those of the sesquiterpene synthases already isolated from the genus Zingiber. Recombinant Escherichia coli cells, in which ZoTps1 was coexpressed along with genes for D-mevalonate utilization, resulted in the production of a sesquiterpene (S)-beta-bisabolene exclusively with a D-mevalonolactone supplement. This result indicated that ZoTps1 was the (S)-beta-bisabolene synthase gene in ginger. ZoTPS1 was suggested to catalyze (S)-beta-bisabolene formation with the conversion of farnesyl diphosphate to nerolidyl diphosphate followed by the cyclization between position 1 and 6 carbons. The ZoTps1 transcript was detected in young rhizomes, but not in leaves, roots and mature rhizomes of the ginger "Kintoki". PMID:20229191

  18. Evaluating Performance Portability of OpenACC

    SciTech Connect

    Sabne, Amit J; Sakdhnagool, Putt; Lee, Seyong; Vetter, Jeffrey S

    2015-01-01

    Accelerator-based heterogeneous computing is gaining momentum in High Performance Computing arena. However, the increased complexity of the accelerator architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle the problem. While the abstraction endowed by OpenACC offers productivity, it raises questions on its portability. This paper evaluates the performance portability obtained by OpenACC on twelve OpenACC programs on NVIDIA CUDA, AMD GCN, and Intel MIC architectures. We study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.

  19. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis.

  20. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  1. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  2. Genomic organization and expression analysis of a farnesyl diphosphate synthase gene (FPPS2) in apples (Malus domestica Borkh.).

    PubMed

    Yuan, Kejun; Wang, Changjun; Xin, Li; Zhang, Anning; Ai, Chengxiang

    2013-07-25

    A farnesyl diphosphate synthase gene (FPPS2), which contains 11 introns and 12 exons, was isolated from the apple cultivar "White Winter Pearmain". When it was compared to our previously reported FPPS1, its each intron size was different, its each exon size was the same as that of FPPS1 gene, 30 nucleotide differences were found in its coding sequence. Based on these nucleotide differences, specific primers were designed to perform expression analysis; the results showed that it expressed in both fruit and leaf, its expression level was obviously lower than that of FPPS1 gene in fruit which was stored at 4°C for 5 weeks. This is the first report concerning two FPPS genes and their expression comparison in apples.

  3. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  4. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  5. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  6. The human TruB family of pseudouridine synthase genes, including the Dyskeratosis Congenita 1 gene and the novel member TRUB1.

    PubMed

    Zucchini, Cinzia; Strippoli, Pierluigi; Biolchi, Alessia; Solmi, Rossella; Lenzi, Luca; D'Addabbo, Pietro; Carinci, Paolo; Valvassori, Luisa

    2003-06-01

    A novel human gene denominated TruB pseudouridine (psi) synthase homolog 1 (E. coli) (approved symbol, TRUB1) has been identified and characterized. Spanning approximately 40 kb on chromosome 10 and including 8 exons, TRUB1 is the first described human ortholog of bacterial TruB/psi55, a gene involved in tRNA pseudouridinilation. TRUB1 gene encodes a 349-amino acid product, with a VFAVHKPKGPTSA box in positions 71-83 corresponding to motif I of the TruB family (probably involved in conserving protein structure). The TruB domain of TRUB1 lies between W104 and I255, and contains another short motif, GGTLDS AARGVLVV, including the highly conserved D residue that characterizes motif II (involved in uridine recognition and in catalytic function of psi synthases). Northern blot analysis revealed that TRUB1 mRNA is widely expressed in various human tissues (especially heart, skeletal muscle and liver). Phylogenetic analysis of the TruB domain revealed another human gene (approved symbol TRUB2) encoding a conserved TruB domain, located on human chromosome 9. Thus, the human TruB family includes at least three members: i.e. DKC1 (previously identified), TRUB1 and TRUB2. The TRUB1 and TRUB2 products could be the hitherto unidentified human tRNA psi synthases. Although TRUB1 is not highly similar to DKC1/dyskerin (whose mutations cause X-linked dyskeratosis congenita) and putatively affects tRNA rather than rRNA modification, it is the most similar human protein to dyskerin. Study of TRUB1 (and TRUB2) should facilitate understanding of the molecular mechanisms of RNA modification and the involvement of psi synthases in human pathology, including dyskeratosis-like diseases.

  7. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    PubMed

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  8. Physiological Roles of the β-Substituted Alanine Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Watanabe, Mutsumi; Kusano, Miyako; Oikawa, Akira; Fukushima, Atsushi; Noji, Masaaki; Saito, Kazuki

    2008-01-01

    The β-substituted alanine (Ala) synthase (Bsas) family in the large superfamily of pyridoxal 5′-phosphate-dependent enzymes comprises cysteine (Cys) synthase (CSase) [O-acetyl-serine (thiol) lyase] and β-cyano-Ala synthase (CASase) in plants. Nine genomic sequences encode putative Bsas proteins in Arabidopsis thaliana. The physiological roles of these Bsas isoforms in vivo were investigated by the characterization of T-DNA insertion mutants. Analyses of gene expression, activities of CSase and CASase, and levels of Cys and glutathione in the bsas mutants indicated that cytosolic Bsas1;1, plastidic Bsas2;1, and mitochondrial Bsas2;2 play major roles in Cys biosynthesis. Cytosolic Bsas1;1 has the most dominant contribution both in leaf and root, and mitochondrial Bsas2;2 plays a significant role in root. Mitochondrial Bsas3;1 is a genuine CASase. Nontargeted metabolome analyses of knockout mutants were carried out by a combination of gas chromatography time-of-flight mass spectrometry and capillary electrophoresis time-of-flight mass spectrometry. The level of γ-glutamyl-β-cyano-Ala decreased in the mutant bsas3;1, indicating the crucial role of Bsas3;1 in β-cyano-Ala metabolism in vivo. PMID:18024555

  9. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

    2011-01-01

    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  10. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  11. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana.

    PubMed

    Taji, Teruaki; Ohsumi, Chieko; Iuchi, Satoshi; Seki, Motoaki; Kasuga, Mie; Kobayashi, Masatomo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2002-02-01

    Raffinose family oligosaccharides (RFO) accumulating during seed development are thought to play a role in the desiccation tolerance of seeds. However, the functions of RFO in desiccation tolerance have not been elucidated. Here we examine the functions of RFO in Arabidopsis thaliana plants under drought- and cold-stress conditions, based on the analyses of function and expression of genes involved in RFO biosynthesis. Sugar analysis showed that drought-, high salinity- and cold-treated Arabidopsis plants accumulate a large amount of raffinose and galactinol, but not stachyose. Raffinose and galactinol were not detected in unstressed plants. This suggests that raffinose and galactinol are involved in tolerance to drought, high salinity and cold stresses. Galactinol synthase (GolS) catalyses the first step in the biosynthesis of RFO from UDP-galactose. We identified three stress-responsive GolS genes (AtGolS1, 2 and 3) among seven Arabidopsis GolS genes. AtGolS1 and 2 were induced by drought and high-salinity stresses, but not by cold stress. By contrast, AtGolS3 was induced by cold stress but not by drought or salt stress. All the GST fusion proteins of GST-AtGolS1, 2 and 3 expressed in Escherichia coli had galactinol synthase activities. Overexpression of AtGolS2 in transgenic Arabidopsis caused an increase in endogenous galactinol and raffinose, and showed reduced transpiration from leaves to improve drought tolerance. These results show that stress-inducible galactinol synthase plays a key role in the accumulation of galactinol and raffinose under abiotic stress conditions, and that galactinol and raffinose may function as osmoprotectants in drought-stress tolerance of plants.

  12. Association between endothelial nitric oxide synthase gene polymorphism (-786T>C) and interleukin-6 in acute coronary syndrome.

    PubMed

    Piccoli, J C E; Manfredini, V; Faoro, D; Farias, F M; Bodanese, L C; Bogo, M R

    2014-04-01

    Atherosclerosis is morphologically an inflammatory disease, where endothelial dysfunction plays a key role in all the stages. The nitric oxide (NO) synthase 3 (NOS3) gene is responsible for the synthesis of endothelial NO synthase (eNOS) in humans and some genetic polymorphisms are considered "polymorphisms associated with risk" for the development of coronary artery diseases, such as acute coronary syndrome. Thus, the present study aimed to evaluate the influence of the -786T>C polymorphism of the eNOS gene on inflammatory and oxidative process. A prospective cohort study of 125 consecutive patients with clinical diagnosis of non-ST-elevation acute coronary syndromes was conducted. Patients were assessed using a standardized questionnaire. Blood samples were drawn to measure serum levels of high-sensitivity C-reactive protein, soluble CD40 ligand, interleukin-6 (IL-6), N-terminal prohormone of brain natriuretic peptide, immunoglobulin G antibodies against oxidized low-density lipoprotein. The genotypes for the -786T>C polymorphism in the 5'-flanking region of eNOS gene were determined. The -786C allele was found in 92 of 250 alleles (38.8%). No statistical association was observed between demographic and clinical characteristics and distribution of eNOS-786T>C polymorphism. We found that -786CC was associated with lower levels of IL-6. No significant differences were observed between the distribution of -786T>C polymorphism and other investigated markers.

  13. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    PubMed

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  14. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  15. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  16. Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis.

    PubMed

    Cordero, Baldo F; Couso, Inmaculada; León, Rosa; Rodríguez, Herminia; Vargas, M Angeles

    2011-07-01

    The isolation and characterization of the phytoene synthase gene from the green microalga Chlorella zofingiensis (CzPSY), involved in the first step of the carotenoids biosynthetic pathway, have been performed. CzPSY gene encodes a polypeptide of 420 amino acids. A single copy of CzPSY has been found in C. zofingiensis by Southern blot analysis. Heterologous genetic complementation in Escherichia coli showed the ability of the predicted protein to catalyze the condensation of two molecules of geranylgeranyl pyrophosphate (GGPP) to form phytoene. Phylogenetic analysis has shown that the deduced protein forms a cluster with the rest of the phytoene synthases (PSY) of the chlorophycean microalgae studied, being very closely related to PSY of plants. This new isolated gene has been adequately inserted in a vector and expressed in Chlamydomonas reinhardtii. The overexpression of CzPSY in C. reinhardtii, by nuclear transformation, has led to an increase in the corresponding CzPSY transcript level as well as in the content of the carotenoids violaxanthin and lutein which were 2.0- and 2.2-fold higher than in untransformed cells. This is an example of manipulation of the carotenogenic pathway in eukaryotic microalgae, which can open up the possibility of enhancing the productivity of commercial carotenoids by molecular engineering. PMID:21519934

  17. Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes.

    PubMed

    Senda, Mineo; Masuta, Chikara; Ohnishi, Shizen; Goto, Kazunori; Kasai, Atsushi; Sano, Teruo; Hong, Jin-Sung; MacFarlane, Stuart

    2004-04-01

    Most commercial Glycine max (soybean) varieties have yellow seeds because of loss of pigmentation in the seed coat. It has been suggested that inhibition of seed coat pigmentation in yellow G. max may be controlled by homology-dependent silencing of chalcone synthase (CHS) genes. Our analysis of CHS mRNA and short-interfering RNAs provide clear evidence that the inhibition of seed coat pigmentation in yellow G. max results from posttranscriptional rather than transcriptional silencing of the CHS genes. Furthermore, we show that mottling symptoms present on the seed coat of G. max plants infected with some viruses can be caused by suppression of CHS posttranscriptional gene silencing (PTGS) by a viral silencing suppressor protein. These results demonstrate that naturally occurring PTGS plays a key role in expression of a distinctive phenotype in plants and present a simple clear example of the elucidation of the molecular mechanism for viral symptom induction. PMID:15037735

  18. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  19. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  20. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  1. "Macrophage" nitric oxide synthase is a glucocorticoid-inhibitable primary response gene in 3T3 cells.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-10-01

    Both nitric oxide and prostaglandins are potent paracrine mediators of intercellular communication. An endotoxin-lipopolysaccharide (LPS) inducible form of nitric oxide synthase (mac-NOS) has recently been cloned from murine macrophages. An inducible prostaglandin synthase (TIS10/PGS-2), cloned from 3T3 cells, is also induced in LPS-activated macrophage. Because of the wide range of ligands that induce primary response genes in 3T3 cells, the ease of studying chimeric promoter constructs in 3T3 cells, and the importance of both nitric oxide and prostaglandins as paracrine mediators, we examined expression of mac-NOS in 3T3 cells. Tetradecanoyl phorbol-13-acetate (TPA), forskolin, platelet-derived growth factor, fibroblast growth factor, and serum all induce mac-NOS expression in Swiss 3T3 cells. Thus the mac-NOS gene can respond to a far wider range of inducers than previously suspected. mac-NOS is a primary response gene; cycloheximide does not block induction. TPA-induced mac-NOS and TIS10/PGS-2 mRNA accumulation patterns are similar. LPS is a potent inducer of mac-NOS in Swiss 3T3 cells but cannot induce TIS10/PGS-2. In contrast, v-src expression induces TIS10/PGS-2 message, but not iNOS message in a BALB/c 3T3 cell line containing a temperature-sensitive v-src gene. Dexamethasone (DEX) prevents induction of TIS10/PGS-2, but not most other primary response genes. DEX also blocks mac-NOS induction in Swiss 3T3 cells. The inducible TIS10/PGS-2 and mac-NOS genes, responsible for the production of two distinct paracrine agents, appear to share many regulatory features in 3T3 cells.

  2. The application of the mutated acetolactate synthase gene from rice as the selectable marker gene in the production of transgenic soybeans.

    PubMed

    Tougou, Makoto; Yamagishi, Noriko; Furutani, Noriyuki; Kaku, Koichiro; Shimizu, Tsutomu; Takahata, Yoshihito; Sakai, Jun-ichi; Kanematsu, Seiji; Hidaka, Soh

    2009-05-01

    We investigated selective culturing conditions for the production of transgenic soybeans. In this culturing system, we used the acetolactate synthase (ALS)-inhibiting herbicide-resistance gene derived from rice (Os-mALS gene) as a selectable marker gene instead of that derived from bacteria, which interfered with the cultivation and practical usage of transgenic crops. T(1) soybeans grown from one regenerated plant after selection of the ALS-targeting pyrimidinyl carboxy (PC) herbicide bispyribac-sodium (BS) exhibited herbicide resistance, and the introduction and expression of the Os-mALS gene were confirmed by genetic analysis. The selective culturing system promoted by BS herbicide, in which the Os-mALS gene was used as a selectable marker, was proved to be applicable to the production of transgenic soybeans, despite the appearance of escaped soybean plants that did not contain the Os-mALS transgene.

  3. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.

    2014-01-01

    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  4. In vitro effect of nanosilver on gene expression of superoxide dismutases and nitric oxide synthases in chicken Sertoli cells.

    PubMed

    Hassanpour, H; Mirshokraei, P; Sadrabad, E Khalili; Dehkordi, A Esmailian; Layeghi, S; Afzali, A; Mohebbi, A

    2015-02-01

    To evaluate effects of different concentrations of nanosilver colloid on the cell culture of Sertoli cells, the proportion of lipid peroxidation, antioxidant capacity, nitric oxide (NO) production and genes expression of superoxide dismutases (SOD1 and SOD2) and nitric oxide synthases (eNOS and iNOS) were measured. Sertoli cells were incubated at concentrations of 25, 75 and 125 ppm nanosilver for 48 h. There was progressive lipid peroxidation in treatments according to increasing of nanosilver. Lipid peroxidation, as indicated by malondialdehyde levels, was significantly elevated by the highest concentration of silver colloid (125 ppm), although antioxidant capacity, as measured by ferric ion reduction, was unaffected. Nitrite, as an index of NO production was reduced only in 125 ppm of nanosilver. Expression of SOD1 gene was reduced in nanosilver-treated cells at all concentrations, whereas expression of SOD2 gene was reduced only in cells treated with 125 ppm nanosilver. Expression of iNOS gene was progressively increased with higher concentrations of nanosilver. Expression of eNOS gene was also increased in 125 ppm of nanosilver. In conclusion, toxic effects of nanosilver could be due to high lipid peroxidation and suppression of antioxidant mechanisms via reduced expression of SOD genes and increased expression of NOS genes.

  5. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  6. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans.

    PubMed

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed.

  7. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  8. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  9. Methylation and Gene Expression Responses to Ethanol Feeding and Betaine Supplementation in the Cystathionine Beta Synthase-Deficient Mouse

    PubMed Central

    Medici, Valentina; Schroeder, Diane I.; Woods, Rima; LaSalle, Janine M.; Geng, Yongzhi; Shibata, Noreene M.; Peerson, Janet; Hodzic, Emir; Dayal, Sanjana; Tsukamoto, Hidekazu; Kharbanda, Kusum K.; Tillman, Brittany; French, Samuel W.; Halsted, Charles H.

    2014-01-01

    Background Alcoholic steatohepatitis (ASH) is caused in part by the effects of ethanol on hepatic methionine metabolism. Methods To investigate the phenotypic and epigenetic consequences of altered methionine metabolism in this disease, we studied the effects of 4-wk intragastric ethanol feeding with and without the methyl donor betaine in cystathionine beta synthase (CβS) heterozygous C57BL/6J mice. Results The histopathology of early ASH was induced by ethanol feeding and prevented by betaine supplementation, while ethanol feeding reduced and betaine supplementation maintained the hepatic methylation ratio of the universal methyl donor S-adenosylmethionine (SAM) to the methyltransferase inhibitor S-adenosylhomocysteine (SAH). MethylC-Seq genomic sequencing of heterozygous liver samples from each diet group found 2–4% reduced methylation in gene bodies but not promoter regions of all autosomes of ethanol fed mice, each of which were normalized in samples from mice fed the betaine supplemented diet. The transcript levels of inducible nitric oxide synthase (Nos2) and DNA methyltransferase 1 (Dnmt1) were increased, while those of peroxisome proliferator receptor-a (Pparα) were reduced in ethanol fed mice, and each was normalized in mice fed the betaine supplemented diet. DNA pyrosequencing of CβS heterozygous samples found reduced methylation in a gene body of Nos2 by ethanol feeding that was restored by betaine supplementation, and was correlated inversely with its expression and positively with SAM: SAH ratios. Conclusions The present studies have demonstrated relationships among ethanol induction of ASH with aberrant methionine metabolism that was associated with gene body DNA hypomethylation in all autosomes and was prevented by betaine supplementation. The data imply that ethanol-induced changes in selected gene transcript levels and hypomethylation in gene bodies during the induction of ASH is a result of altered methionine metabolism that can be reversed

  10. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  11. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  12. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  13. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids.

  14. Rapid detection of mutations in the human-derived Pneumocystis carinii dihydropteroate synthase gene associated with sulfa resistance.

    PubMed

    Ma, L; Kovacs, J A

    2001-03-01

    Recent studies have shown that point mutations in the dihydropteroate synthase (DHPS) gene of human-derived Pneumocystis carinii are related to exposure to sulfa drugs and possibly represent the emergence of sulfa resistance. We developed a simple single-strand conformation polymorphism (SSCP) method to permit rapid detection of these mutations. With plasmid constructs, SSCP was able to detect as little as 10% of a minority population. The SSCP assay was compared to direct sequencing for typing the DHPS gene by examining 37 clinical isolates with known DHPS sequences and 41 clinical isolates with unknown DHPS sequences. The typing results were consistent between these two methods for all isolates except 11 in which mutations were detected by SSCP but not by direct sequencing. Sequencing of individual clones after subcloning confirmed the presence of mutations in a minority population as determined by SSCP. SSCP is a very simple and sensitive method for rapid identification of P. camii DHPS mutations.

  15. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    PubMed

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene.

  16. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].

    PubMed

    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V

    2008-01-01

    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  17. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-12-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome.

  18. Endogenous, tissue-specific short interfering RNAs silence the chalcone synthase gene family in glycine max seed coats.

    PubMed

    Tuteja, Jigyasa H; Zabala, Gracia; Varala, Kranthi; Hudson, Matthew; Vodkin, Lila O

    2009-10-01

    Two dominant alleles of the I locus in Glycine max silence nine chalcone synthase (CHS) genes to inhibit function of the flavonoid pathway in the seed coat. We describe here the intricacies of this naturally occurring silencing mechanism based on results from small RNA gel blots and high-throughput sequencing of small RNA populations. The two dominant alleles of the I locus encompass a 27-kb region containing two perfectly repeated and inverted clusters of three chalcone synthase genes (CHS1, CHS3, and CHS4). This structure silences the expression of all CHS genes, including CHS7 and CHS8, located on other chromosomes. The CHS short interfering RNAs (siRNAs) sequenced support a mechanism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that become substrates for dicer-like ribonuclease. The resulting primary siRNAs become guides that target the mRNAs of the nonlinked, highly expressed CHS7 and CHS8 genes, followed by subsequent amplification of CHS7 and CHS8 secondary siRNAs by RNA-dependent RNA polymerase. Most remarkably, this silencing mechanism occurs only in one tissue, the seed coat, as shown by the lack of CHS siRNAs in cotyledons and vegetative tissues. Thus, production of the trigger double-stranded RNA that initiates the process occurs in a specific tissue and represents an example of naturally occurring inhibition of a metabolic pathway by siRNAs in one tissue while allowing expression of the pathway and synthesis of valuable secondary metabolites in all other organs/tissues of the plant.

  19. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.

    2002-01-01

    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills Attached Labs"; (5)…

  20. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  1. Identification and characterization of a class III chitin synthase gene of Moniliophthora perniciosa, the fungus that causes witches' broom disease of cacao.

    PubMed

    Souza, Catiane S; Oliveira, Bruno M; Costa, Gustavo G L; Schriefer, Albert; Selbach-Schnadelbach, Alessandra; Uetanabaro, Ana Paula T; Pirovani, Carlos P; Pereira, Gonçalo A G; Taranto, Alex G; Cascardo, Júlio Cézar de M; Góes-Neto, Aristóteles

    2009-08-01

    Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches' broom disease of cacao.

  2. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation

    PubMed Central

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process. PMID:26161530

  3. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation.

    PubMed

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process.

  4. Genome-Wide Identification and Evolution Analysis of Trehalose-6-Phosphate Synthase Gene Family in Nelumbo nucifera

    PubMed Central

    Jin, Qijiang; Hu, Xin; Li, Xin; Wang, Bei; Wang, Yanjie; Jiang, Hongwei; Mattson, Neil; Xu, Yingchun

    2016-01-01

    Trehalose-6-phosphate synthase (TPS) plays a key role in plant carbohydrate metabolism and the perception of carbohydrate availability. In the present work, the publicly available Nelumbo nucifera (lotus) genome sequence database was analyzed which led to identification of nine lotus TPS genes (NnTPS). It was found that at least two introns are included in the coding sequences of NnTPS genes. When the motif compositions were analyzed we found that NnTPS generally shared the similar motifs, implying that they have similar functions. The dN/dS ratios were always less than 1 for different domains and regions outside domains, suggesting purifying selection on the lotus TPS gene family. The regions outside TPS domain evolved relatively faster than NnTPS domains. A phylogenetic tree was constructed using all predicted coding sequences of lotus TPS genes, together with those from Arabidopsis, poplar, soybean, and rice. The result indicated that those TPS genes could be clearly divided into two main subfamilies (I-II), where each subfamily could be further divided into 2 (I) and 5 (II) subgroups. Analyses of divergence and adaptive evolution show that purifying selection may have been the main force driving evolution of plant TPS genes. Some of the critical sites that contributed to divergence may have been under positive selection. Transcriptome data analysis revealed that most NnTPS genes were predominantly expressed in sink tissues. Expression pattern of NnTPS genes under copper and submergence stress indicated that NNU_014679 and NNU_022788 might play important roles in lotus energy metabolism and participate in stress response. Our results can facilitate further functional studies of TPS genes in lotus. PMID:27746792

  5. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  6. Bacterial lipopolysaccharide induction of the prostaglandin G/H synthase 2 gene causes thromboxane-dependent pulmonary hypertension in rabbits.

    PubMed

    Delong, P; O'Sullivan, M G; Huggins, E; Hubbard, C L; McCall, C

    1999-03-01

    Two genes encode proteins with prostaglandin G/H synthase (PGHS) activity. PGHS-1 is primarily a constitutively expressed gene, whereas inflammatory agents such as bacterial lipopolysaccharide (LPS) endotoxin rapidly induce the PGHS-2 gene in leukocytes. Both PGHS-1 and PGHS-2 are rate-limiting enzymes for the production of prostaglandins and thromboxane following release of arachidonic acid by phospholipases. We previously reported that LPS perfusion into the circulation of isolated perfused rabbit lung (IPL) results in thromboxane-dependent pulmonary hypertension and lung edema when the LPS-primed lung is subsequently stimulated with platelet activating factor (PAF) (J. Clin. Invest. 1990;85:1135). In this study, we showed that the mechanism by which LPS primes IPL for enhanced production of thromboxane and pulmonary hypertension in response to PAF depends on specific upregulation of the PGHS-2 gene in the rabbit lung. LPS perfusion of IPL induced PGHS-2 gene expression, which correlated with the conversion of free arachidonic acid to thromboxane-B2 (TXB2) and the onset of pulmonary hypertension. LPS-induced PGHS-2 expression, TXB2 release, and pulmonary hypertension were inhibited by actinomycin D (an inhibitor of transcription) and cycloheximide (an inhibitor of protein synthesis). The constitutively expressed PGHS-1 remained unchanged with LPS perfusion, and did not convert free arachidonic acid to TXB2, suggesting that PGHS-1 does not contribute to the induction of pulmonary hypertension by LPS. These studies reveal a pathogenic role for induction of PGHS-2 in lung injury.

  7. Suppression of the Barley uroporphyrinogen III synthase Gene by a Ds Activation Tagging Element Generates Developmental Photosensitivity[W

    PubMed Central

    Ayliffe, Michael A.; Agostino, Anthony; Clarke, Bryan C.; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J.

    2009-01-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen. PMID:19336693

  8. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  9. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade.

  10. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  11. Identification, characterization and functional analysis of a chitin synthase gene in the brown citrus aphid, Toxoptera citricida (Hemiptera, Aphididae).

    PubMed

    Shang, F; Xiong, Y; Xia, W-K; Wei, D-D; Wei, D; Wang, J-J

    2016-08-01

    Chitin synthase (CHS) is a crucial enzyme involved in the final step of the insect chitin biosynthetic pathway. In this study, we cloned the full-length cDNA sequence of a chitin synthase gene (TCiCHS) from the brown citrus aphid, Toxoptera citricida, an important citrus pest and the main vector of citrus tristeza virus worldwide. TCiCHS was expressed during the entire lifecycle and in all insect tissues examined. Expression was highest in first-second-instar nymphs, nymph-adult transitions and in the abdomen (6.7-fold higher than head). Embryos had a higher expression level than the integument. Fourth-instar nymphs were exposed to 5 and 500 mg/l concentrations of the chitin synthesis inhibitor diflubenzuron (DFB) for 48 h and had the highest mortality at the 500 mg/l concentration. The mRNA expression levels of TCiCHS were significantly enhanced upon the exposure of nymphs to both low and high DFB concentrations. Silencing of TCiCHS occurred through plant-mediated double-stranded RNA (dsRNA) feeding. Most dsRNA-fed nymphs were unable to moult to the next stage, and the expression of TCiCHS decreased 48% compared with controls. These results demonstrate that TCiCHS plays an important role in nymph to adult development, is possibly help identify molecular targets for To. citricida control. PMID:26991909

  12. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    PubMed Central

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  13. Thymidylate synthase and methylenetetrahy-drofolate reductase gene polymorphisms and gastric cancer susceptibility in a population of Northern Brazil.

    PubMed

    Araújo, M D; Borges, B N; Rodrigues-Antunes, S; Burbano, R M R; Harada, M L

    2015-01-01

    The folate metabolic pathway, which is involved in DNA synthesis and methylation, is associated with individual susceptibility to several diseases, including gastric tumors. In this study, we investigated four polymorphisms [thymidylate synthase enhancer region, single nucleotide polymorphism thymidylate synthase 5' (TS5'), TS3' untranslated region, and methylenetetrahydrofolate reductase (MTHFR) 677C> T] in 2 genes related to the folate pathway, TS and MTHFR, and their possible association with the risk gastric cancer development in a population from Pará state, Brazil. For the TS enhancer region, TS3' untranslated region, and single nucleotide polymorphism TS5' polymorphisms, no significant results were obtained. For the MTHFR 677C>T polymorphism, TT genotype carriers had a higher risk of developing tumors in the antrum (P = 0.19 vs CC and P = 0.02 vs CT) and intestine (odds ratio = 4.18, 95% confidence interval = 0.66-26.41; P = 0.252 vs CC and odds ratio = 2.25, 95% confidence interval = 0.32-15.75; P = 0.725 vs CT). Those carrying at least 1 T allele had an increased risk of lymph node metastasis (odds ratio = 3.00, 95% confidence interval = 0.88-10.12; P = 0.133). Our results suggest that polymorphisms in MTHFR affect the susceptibility to gastric tumors in the Brazilian population and may be a factor causing poor prognosis in such patients. PMID:26345936

  14. A case of primary selective hypoaldosteronism carrying three mutations in the aldosterone synthase (Cyp11b2) gene.

    PubMed

    Taranta, Anna; Bizzarri, Carla; Masotti, Andrea; Sciré, Giuseppe; Pampanini, Valentina; Cappa, Marco

    2012-05-25

    An infant with a clinical phenotype of early onset hypoaldosteronism has been screened for mutation analysis of the Cyp11b2 gene encoding aldosterone synthase enzyme. We have described a novel nonsense mutation in exon 3 (c.508C>T) that gave rise to a shorter protein (Q170X) and two known concurrent missense mutations (c.594A>C in exon 3 and c.1157T>C in exon 7) that led to substitution of glutamic acid for aspartic acid at amino acid position 198 (E198D) and of valine for alanine at amino acid position 386 (V386A). The father, who carried E198D plus V386A mutations, showed a fractional sodium excretion of 1.25% that was unmodified by dietary salt restriction, suggesting a mild haploinsufficiency. We examined by in silico analysis the effect of the mutations on the secondary and tertiary structures of aldosterone synthase to explain the inefficient enzymatic activity. The Q170X mutation produced a truncated protein, which was consequently associated with a loss of catalytic activity. As predicted by JPred web system and Dock 6.3 software, the concurrent expression of E198D and V386A mutations induced a significant secondary structure rearrangement and a shift of the heme group and the 18-hydroxycorticosterone substrate from their optimal placement.

  15. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    PubMed

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  16. Effects of inefficient transcription termination of rbcL on the expression of accD in plastids of Arabidopsis thaliana.

    PubMed

    He, Baoye; Mu, Ying; Chi, Wei

    2015-12-01

    The plastid accD gene encodes one subunit of a multimeric acetyl-CoA carboxylase that is required for fatty acid biosynthesis. In Arabidopsis thaliana, the accD gene is transcribed by the nuclear-encoded phage-type RNA polymerase, and the accumulation of accD transcripts is subjected to a dynamic pattern during chloroplast development. However, the mechanisms underlying the regulation of accD expression remain unknown. Here, we showed that the inefficient transcription termination of rbcL due to the absence of RHON1 impaired the developmental profile of accD, resulting in the constitutive expression of accD during chloroplast development. Moreover, the accumulation of accD transcripts accordingly resulted in an increase in accD protein levels, suggesting that transcript abundance is critical for accD gene production. Our study demonstrates that the interplay between accD and upstream rbcL regulates the expression of accD and highlights the significance of transcriptional regulation in plastid gene expression in higher plants.

  17. Cloning and Characterization of a Flavonol Synthase Gene from Scutellaria baicalensis

    PubMed Central

    Kim, Yeon Bok; Kim, KwangSoo; Kim, YeJi; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  18. Cloning and expression of sesquiterpene synthase genes from lettuce (Lactuca sativa L.).

    PubMed

    Bennett, Mark H; Mansfield, John W; Lewis, Mervyn J; Beale, Michael H

    2002-06-01

    Sesquiterpenoid lactones (SLs) from lettuce (Lactuca sativa L.) include constitutive components of latex such as lactucin and the induced phytoalexin, lettucenin A. A redundant primer strategy was used to recover two full length cDNA clones (LTC1 and LTC2) encoding sesquiterpene synthases from a cDNA library derived from seedlings with the red spot disorder, which accumulate phytoalexins. Recombinant enzymes produced from LTC1 and LTC2 in Escherichia coli catalysed the cyclisation of farnesyl diphosphate to germacrene A, potentially an early step in the biosynthesis of SLs. RT-PCR analysis showed LTC1 and LTC2 were expressed constitutively in roots, hypocotyls and true leaves but not in cotyledons. Expression in cotyledons was induced by challenge with the downy mildew pathogen Bremia lactucae in the disease resistant cultivar Diana. Southern hybridisation experiments showed that LTC1 and LTC2 were not part of a multigene family. The germacrene A synthases provide targets for modified expression to generate beneficial modifications to the SL profile in lettuce. PMID:12031443

  19. Expression of the inducible nitric oxide synthase gene in diaphragm and skeletal muscle.

    PubMed

    Thompson, M; Becker, L; Bryant, D; Williams, G; Levin, D; Margraf, L; Giroir, B P

    1996-12-01

    Nitric oxide (NO) is a pluripotent molecule that can be secreted by skeletal muscle through the activity of the neuronal constitutive isoform of NO synthase. To determine whether skeletal muscle and diaphragm might also express the macrophage-inducible form of NO synthase (iNOS) during provocative states, we examined tissue from mice at serial times after intravenous administration of Escherichia coli endotoxin. In these studies, iNOS mRNA was strongly expressed in the diaphragm and skeletal muscle of mice 4 h after intravenous endotoxin and was significantly diminished by 8 h after challenge. Induction of iNOS mRNA was followed by expression of iNOS immunoreactive protein on Western immunoblots. Increased iNOS activity was demonstrated by conversion of arginine to citrulline. Immunochemical analysis of diaphragmatic explants exposed to endotoxin in vitro revealed specific iNOS staining in myocytes, in addition to macrophages and endothelium. These results may be important in understanding the pathogenesis of respiratory pump failure during septic shock, as well as skeletal muscle injury during inflammation or metabolic stress.

  20. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  1. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum.

    PubMed

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-08-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  2. Sequence variation of chalcone synthase gene in a spontaneous white-flower mutant of Chinese cabbage-pak-choi.

    PubMed

    Jiang, Ming; Cao, Jiashu

    2008-12-01

    A spontaneous white-flower mutant of Chinese cabbage-pak-choi (Brassica campestris ssp. chinenesis, syn. B. rapa ssp. chinenesis) was found in our test fields, and all the plant characters except flower color were identical with wild type ones. We hypothesized that a mutational event had occurred in the gene coding for chalcone synthase (CHS), the key enzyme of flavonoid biosynthesis pathway. Two genes, later designated BcCHS and BcCHS-wf, were isolated from wild type and mutant Chinese cabbage-pak-choi, respectively, using gene-specific primer pairs. Comparison of the genomic sequences revealed two mutations in BcCHS-wf, both with A to G transitions, one at position +37 bp and the other at +970 bp. Both nucleotide substitutions occurred in AGA codes for arginine into GGA for glycin at residue +13 and into AGC coding for serine at residue +229, respectively. Homologous genes of BcCHS were isolated from another four cruciferous plants, though there were some differences among the genomic and deduced amino acid sequences, the mutation locus of the mutant, as we called it, were identical to the wild type Chinese cabbage-pak-choi.

  3. Saccharomyces cerevisiae has a single glutamate synthase gene coding for a plant-like high-molecular-weight polypeptide.

    PubMed Central

    Cogoni, C; Valenzuela, L; González-Halphen, D; Olivera, H; Macino, G; Ballario, P; González, A

    1995-01-01

    Purification of the glutamate synthase (GOGAT) enzyme from Saccharomyces cerevisiae showed that it is an oligomeric enzyme composed of three identical 199-kDa subunits. The GOGAT structural gene was isolated by screening a yeast genomic library with a yeast PCR probe. This probe was obtained by amplification with degenerate oligonucleotides designed from conserved regions of known GOGAT genes. The derived amino-terminal sequence of the GOGAT gene was confirmed by direct amino-terminal sequence analysis of the purified protein of 199 kDa. Northern (RNA) analysis allowed the identification of an mRNA of about 7 or 8 kb. An internal fragment of the GOGAT gene was used to obtain null GOGAT mutants completely devoid of GOGAT activity. The results show that S. cerevisiae has a single NADH-GOGAT enzyme, consisting of three 199-kDa monomers, that differs from the one found in prokaryotic microorganisms but is similar to those found in other eukaryotic organisms such as alfalfa. PMID:7836314

  4. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  5. The significance and effect of tandem repeats within the Mycobacterium tuberculosis leuA gene on alpha-isopropylmalate synthase.

    PubMed

    Chanchaem, Wimon; Palittapongarnpim, Prasit

    2008-09-01

    The 57-bp tandem repeats located in the Mycobacterium tuberculosis leuA gene code for the alpha-isopropylmalate synthase (alpha-IPMS). It is unique to this pathogen. It was previously demonstrated that the leuA-coding sequence Rv3710, containing the tandem repeats, can be translated to an active alpha-IPMS. The objective of the present study was to investigate the significance and effect of the two 57-bp tandem repeats upon gene expression and the general properties of alpha-IPMS. The putative M. tuberculosis H37Rv leuA gene with and without the tandem repeats was cloned by PCR and expressed in an Escherichia coli host. The enzyme product was studied for general properties, comparing that from a native leuA gene containing two repeats and that from the 57-bp tandem repeats deletion mutant. Upon deletion of the two 57-bp tandem repeats, the expression level of leuA from M. tuberculosis H37Rv was comparable with that of the native form. The general properties of the two types of enzymes were similar. They were both functional with the same range of optimal temperature and optimal pH for activity and with similar enzyme stability. Deletion of the repeats had no detectable effect on leuA expression level or the general properties of the enzyme product. PMID:18647358

  6. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    PubMed Central

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  7. Prodigiosin induces the proapoptotic gene NAG-1 via glycogen synthase kinase-3beta activity in human breast cancer cells.

    PubMed

    Soto-Cerrato, Vanessa; Viñals, Francesc; Lambert, James R; Kelly, Julie A; Pérez-Tomás, Ricardo

    2007-01-01

    Prodigiosin (2-methyl-3-pentyl-6-methoxyprodigiosene) is a bacterial metabolite that has anticancer and antimetastatic properties. However, the molecular mechanisms responsible for these abilities are not fully understood. Gene expression profiling of the human breast cancer cell line MCF-7 treated with prodigiosin was analyzed by cDNA array technology. The majority of the significantly modified genes were related to apoptosis, cell cycle, cellular adhesion, or transcription regulation. The dramatic increase of the nonsteroidal anti-inflammatory drug-activated gene 1 (NAG-1) made this gene an interesting candidate regarding the possible mechanism by which prodigiosin induces cytotoxicity in MCF-7 cells. Our results show that prodigiosin triggers accumulation of the DNA-damage response tumor-suppressor protein p53 but that NAG-1 induction was independent of p53 accumulation. Moreover, prodigiosin caused AKT dephosphorylation and glycogen synthase kinase-3beta (GSK-3beta) activation, which correlated with NAG-1 expression. Prodigiosin-induced apoptosis was recovered by inhibiting GSK-3beta, which might be due, at least in part, to the blockade of the GSK-3beta-dependent up-regulation of death receptors 4 and 5 expression. These findings suggest that prodigiosin-mediated GSK-3beta activation is a key event in regulating the molecular pathways that trigger the apoptosis induced by this anticancer agent.

  8. Association between allelic variation at the Phytoene synthase 1 gene and yellow pigment content in the wheat grain.

    PubMed

    Zhang, W; Dubcovsky, J

    2008-03-01

    A better understanding of the genetic factors controlling grain yellow pigment content (GYPC) is important for both pasta (high GYPC) and bread wheat (low GYPC) quality improvement. Quantitative trait loci (QTL) for GYPC have been mapped repeatedly on the distal regions of chromosome arms 7AL and 7BL in wheat, and the Phytoene synthase 1 (PSY-1) gene located in this region has been proposed as a candidate gene. We show here that PSY-E1, the tall wheatgrass orthologue, is completely linked to differences in GYPC, and that selection for white endosperm mutants in recombinant lines carrying this gene resulted in the identification of a mutation in a conserved amino acid of PSY-E1. These results, together with the association between GYPC and allelic differences in PSY-1 in hexaploid wheat, suggest that this gene plays an important role in the determination of GYPC. However, a second white endosperm mutant previously mapped to chromosome arm 7EL showed no mutations in PSY-E1 suggesting the existence of additional gene(s) affecting GYPC in this chromosome region. This hypothesis was further supported by the mapping of QTL for GYPC on 7AL proximal to PSY-1 in a cross between pasta wheat varieties UC1113 and Kofa. Interestingly, the Kofa PSY-B1 allele showed unusually high levels of polymorphisms as a result of a conversion event involving the PSY-A1 allele. In summary, our results support the hypothesis that allelic differences in PSY-1 and at least one additional gene in the distal region of the long arm of homoeologous group 7L are associated with differences in GYPC. PMID:18193186

  9. A peculiar VNTR in the cystathionine β-synthase gene is a risk factor for Down Syndrome.

    PubMed

    Salemi, M; Barone, C; Romano, C; Salluzzo, M G; Giambirtone, M; Morale, M C; Calogero, A E; Grillo, L; Bosco, P; Romano, C

    2015-01-01

    In the present study, we analysed a 31bp variable number of tandem repeats (VNTR) of the cystathionine ß-synthase (CBS) gene in 427 subjects: 127 patients with Down syndrome (DS) and in 60 of their mothers; 172 age-and sex-matched controls and in 68 of their mothers. A significant statistical difference in the distribution of the 21 repeat allele was found comparing mothers of subjects with DS versus mothers of children without DS (χ2= 4.166; P = 0.0413; Table 2). Since CBS 21 repeats allele carriers show a decrease of CBS enzyme activity possibly leading to lower intracellular glutathione concentration, these results could be explained by a higher not disjunction probability of chromosome 21 in oocytes, due to poor antioxidative protection against reactive oxygen species (ROS) toxic activity.

  10. Production of a freeze-thaw-stable potato starch by antisense inhibition of three starch synthase genes.

    PubMed

    Jobling, Stephen A; Westcott, Roger J; Tayal, Akash; Jeffcoat, Roger; Schwall, Gerhard P

    2002-03-01

    The use of unmodified starches in frozen foods is severely limited by the undesirable textural changes that occur after freezing and thawing. Retrogradation of glucan chains leads to syneresis, a separation of the starch gel and water phases. Stabilization of the starch structure is normally achieved by chemical modification to prevent these changes from occurring. We have now created a freeze-thaw-stable potato starch by alteration of starch composition and structure by genetic modification. An amylose-free starch with short-chain amylopectin was produced by simultaneous antisense downregulation of three starch synthase genes. This starch is extremely freeze-thaw-stable and shows no syneresis even after five freeze-thaw cycles. The use of this starch has potential for environmental and consumer benefits because its production requires no chemical modification.

  11. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  12. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    PubMed

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. PMID:26839981

  13. Characterization of the acc operon from the nopaline-type Ti plasmid pTiC58, which encodes utilization of agrocinopines A and B and susceptibility to agrocin 84.

    PubMed

    Kim, H; Farrand, S K

    1997-12-01

    The acc locus from the Ti plasmid pTiC58 confers utilization of and chemotaxis toward agrocinopines A and B (A+B), as well as susceptibility to a highly specific antiagrobacterial antibiotic, agrocin 84. DNA sequence analyses revealed that acc is composed of eight open reading frames, accR and accA through accG. Previous work showed that accR encodes the repressor which regulates this locus, and accA codes for the periplasmic binding protein of the agrocinopine transport system (S. Beck Von Bodman, G. T. Hayman, and S. K. Farrand, Proc. Natl. Acad. Sci. USA 89:643-647, 1992; G. T. Hayman, S. Beck Von Bodman, H. Kim, P. Jiang, and S. K. Farrand, J. Bacteriol. 175:5575-5584, 1993). The predicted proteins from accA through accE, as a group, have homology to proteins that belong to the ABC-type transport system superfamily. The predicted product of accF is related to UgpQ of Escherichia coli, which is a glycerophosphoryl diester phosphodiesterase, and also to agrocinopine synthase coded for by acs located on the T-DNA. The translated product of accG is related to myoinositol 1 (or 4) monophosphatases from various eucaryotes. Analyses of insertion mutations showed that accA through accE are required for transport of both agrocin 84 and agrocinopines A+B, while accF and accG are required for utilization of the opines as the sole source of carbon. Mutations in accF or accG did not abolish transport of agrocin 84, although we observed slower removal of the antibiotic from the medium by the accF mutant compared to the wild type. However, the insertion mutation in accF abolished detectable uptake of agrocinopines A+B. A mutation in accG had no effect on transport of the opines. The accF mutant was not susceptible to agrocin 84 although it took up the antibiotic. This finding suggests that agrocin 84 is activated by AccF after being transported into the bacterial cell. PMID:9393724

  14. Overexpression of erg20 gene encoding farnesyl pyrophosphate synthase has contrasting effects on activity of enzymes of the dolichyl and sterol branches of mevalonate pathway in Trichoderma reesei.

    PubMed

    Piłsyk, Sebastian; Perlińska-Lenart, Urszula; Górka-Nieć, Wioletta; Graczyk, Sebastian; Antosiewicz, Beata; Zembek, Patrycja; Palamarczyk, Grażyna; Kruszewska, Joanna S

    2014-07-10

    The mevalonate pathway is the most diverse metabolic route resulting in the biosynthesis of at least 30,000 isoprenoid compounds, many of which, such as sterols or dolichols, are indispensable for living cells. In the filamentous fungus Trichoderma of major biotechnological interest isoprenoid metabolites are also involved in the biocontrol processes giving the mevalonate pathway an additional significance. On the other hand, little is known about genes coding for enzymes of the mevalonate pathway in Trichoderma. Here, we present cloning and functional analysis of the erg20 gene from Trichoderma reesei coding for farnesyl pyrophosphate (FPP) synthase (EC 2.5.1.10), an enzyme located at the branching point of the mevalonate pathway. Expression of the gene in a thermosensitive erg20-2 mutant of Saccharomyces cerevisiae impaired in the FPP synthase activity suppressed the thermosensitive phenotype. The same gene overexpressed in T. reesei significantly enhanced the FPP synthase activity and also stimulated the activity of cis-prenyltransferase, an enzyme of the dolichyl branch of the mevalonate pathway. Unexpectedly, the activity of squalene synthase from the other, sterol branch, was significantly decreased without, however, affecting ergosterol level.

  15. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    PubMed

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast. PMID:24951963

  16. Differential methylation of the gene encoding myo-inositol 3-phosphate synthase (Isyna1) in rat tissues

    PubMed Central

    Seelan, Ratnam S; Pisano, M Michele; Greene, Robert M; Casanova, Manuel F; Parthasarathy, Ranga N

    2011-01-01

    Aims Myo-inositol levels are frequently altered in several brain disorders. Myo-inositol 3-phosphate synthase, encoded by the Isyna1 gene, catalyzes the synthesis of myo-inositol in cells. Very little is known about the mechanisms regulating Isyna1 expression in brain and other tissues. In this study, we have examined the role of DNA methylation in regulating Isyna1 expression in rat tissues. Materials & methods Transfection analysis using in vitro methylated promoter constructs, Southern blot analysis of genomic DNA from various tissues digested with a methylation-sensitive enzyme and CpG methylation profiling of genomic DNA from different tissues were used to determine differential methylation of Isyna1 in tissues. Transfection analysis using plasmids harboring mutated CpG residues in the 5’-upstream region of Isyna1 was used to identify critical residues mediating promoter activity. Results The −700 bp to −500 bp region (region 1) of Isyna1 exhibited increased methylation in brain cortex compared with other tissues; it also exhibited sex-specific methylation differences between matched male and female brain cortices. Mutation analysis identified one CpG residue in region 1 necessary for promoter activity in neuronal cells. A tissue-specific differentially methylated region (T-DMR) was found to be localized between +450 bp and +650 bp (region 3). This DMR was comparatively highly methylated in spleen, moderately methylated in brain cortex and poorly methylated in testis, consistent with mRNA levels observed in these tissues. Conclusion Rat Isyna1 exhibits tissue-specific DNA methylation. Brain DNA was uniquely methylated in the 5’-upstream region and displayed gender specificity. A T-DMR was identified within the gene body of Isyna1. These findings suggest that Isyna1 is regulated, in part, by DNA methylation and that significant alterations in methylation patterns during development could have a major impact on inositol phosphate synthase expression in

  17. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    PubMed Central

    2012-01-01

    Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (−)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils. PMID:22682202

  18. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    PubMed Central

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes. PMID:25784918

  19. Galactinol synthase gene of Coptis japonica is involved in berberine tolerance.

    PubMed

    Takanashi, Kojiro; Shitan, Nobukazu; Sugiyama, Akifumi; Kamimoto, Yoshihisa; Hamamoto, Masafumi; Iwaki, Tomoko; Takegawa, Kaoru; Yazaki, Kazufumi

    2008-02-01

    Many plant secondary metabolites show strong biological activities and are potentially also toxic to plants, while plants producing such active compounds are usually insensitive to their own metabolites, suggesting that they have species-specific detoxification mechanisms. In order to clarify the detoxification mechanism of alkaloids, we used cultured cells of Coptis japonica, which are capable of producing a yellow benzylisoquinoline alkaloid, berberine, and accumulate it in the vacuole. Unlike other plant cells that do not produce berberine, C. japonica shows strong tolerance to this alkaloid. We established a fission yeast strain that was sensitive to berberine and performed functional screening using a C. japonica cDNA library. One cDNA clone, which conferred clear berberine tolerance, encoded galactinol synthase (CjGolS). The possible role of CjGolS in berberine tolerance is discussed.

  20. Cloning and heterologous expression of Plasmodium ovale dihydrofolate reductase-thymidylate synthase gene

    PubMed Central

    Tirakarn, Srisuda; Riangrungroj, Pinpunya; Kongsaeree, Palangpon; Imwong, Mallika; Yuthavong, Yongyuth; Leartsakulpanich, Ubolsree

    2012-01-01

    Plasmodial bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is a validated antimalarial drug target. In this study, expression of the putative dhfr-ts of Plasmodium ovale rescued the DHFR chemical knockout and a TS null bacterial strain, demonstrating its DHFR and TS catalytic functions. PoDHFR-TS was expressed in Escherichia coli BL21 (DE3) and affinity purified by Methotrexate Sepharose column. Biochemical and enzyme kinetics characterizations indicated that PoDHFR-TS is similar to other plasmodial enzymes, albeit with lower catalytic activity but better tolerance of acidic pH. Importantly, the PoDHFR from Thai isolate EU266602 remains sensitive to the antimalarials pyrimethamine and cycloguanil, in contrast to P. falciparum and P. vivax isolates where resistance to these drugs is widespread. PMID:22234170

  1. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

    2015-01-01

    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  2. Transforming growth factor beta differentially modulates the inducible nitric oxide synthase gene in distinct cell types.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-08-31

    Nitric oxide is a mediator of paracrine cell signalling. An inducible form of nitric oxide synthase (iNOS) is expressed in macrophages and in Swiss 3T3 cells. Transforming growth factor beta (TGF-beta) is a cytokine that modulates many cellular functions. We find that TGF-beta cannot induce iNOS mRNA expression, either in macrophage cell lines or in Swiss 3T3 cells. However, TGF-beta attenuates lipopolysaccharide induction of iNOS mRNA in macrophages. In contrast, TGF-beta enhances iNOS induction by phorbol ester, serum or lipopolysaccharide in 3T3 cells. Thus TGF-beta can inhibit or augment iNOS mRNA induction in response to primary inducers, depending on the cell type in question.

  3. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  4. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  5. The orphan nuclear receptor, steroidogenic factor 1, regulates neuronal nitric oxide synthase gene expression in pituitary gonadotropes.

    PubMed

    Wei, Xueying; Sasaki, Masayuki; Huang, Hui; Dawson, Valina L; Dawson, Ted M

    2002-12-01

    Steroidogenic factor 1 (SF-1), an essential nuclear receptor, plays key roles in steroidogenic cell function within the adrenal cortex and gonads. It also contributes to reproductive function at all three levels of the hypothalamic-pituitary-gonadal axis. SF-1 regulates genes in the steroidogenic pathway, such as LHbeta, FSHbeta, and steroid hydroxylase. Abundant evidence suggests that nitric oxide (NO) has an important role in the control of reproduction due to its ability to control GnRH secretion from the hypothalamus and the preovulatory LH surge in pituitary gonadotropes. Recently, we cloned and characterized the promoter of mouse neuronal NO synthase (nNOS). nNOS is localized at all three levels of the hypothalamic-pituitary-gonadal axis to generate NO. We find that its major promoter resides at exon 2 in the pituitary gonadotrope alphaT3-1 cell line and that there is a nuclear hormone receptor binding site in this region, to which SF-1 can bind and regulate nNOS transcription. Mutation of the nuclear hormone receptor binding site dramatically decreases basal promoter activity and abolishes SF-1 responsiveness. A dominant negative of SF-1, in which the transactivation (AF-2) domain of SF-1 was deleted, inhibits nNOS exon 2 promoter activity. Dosage-sensitive reversal- adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX-1), which colocalizes and interferes with SF-1 actions in multiple cell lineages, negatively modulates SF-1 regulation of nNOS transcription. These findings demonstrate that mouse nNOS gene expression is regulated by the SF-1 gene family in pituitary gonadotropes. nNOS, a member of the cytochrome p450 gene family, could be one of the downstream effector genes, which mediates SF-1's reproductive function and developmental patterning.

  6. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life

    PubMed Central

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  7. Epistatic interaction and functional compensation between the two tissue- and cell-specific sucrose synthase genes in maize.

    PubMed Central

    Chourey, P S; Taliercio, E W

    1994-01-01

    A tissue-specific epistatic mode of gene interaction was observed between molecularly homologous genes Sh1 and Sus1 (hereafter, Sh and Sus), encoding the sucrose synthase (SS) isozymes, SS1 and SS2, respectively. In Sh Sus genotype, both SS genes were expressed simultaneously and approximately equally in young seedlings; however, only the Sus-encoded SS2 protein was seen in the developing embryos. By contrast, the mutant sus genotype, lacking detectable levels of the SS2 protein in various tissues tested, showed expression of the Sh locus as judged by the detection of the SS1 protein in such embryos. Ectopic expression in embryos was seen from two separate Sh alleles, Sh-W22 and Sh'-5 (a revertant allele derived upon Ds excision from sh-m5933). In each case, the Sh expression at the protein level in embryos was unique to genotypes with the mutant sus gene. Based on the observed lack of phenotypic change in the sus mutant, we suggest that the ectopic expression of the Sh in otherwise Sus-specific tissues leads to functional compensation. There was no epistatic interaction of Sh and Sus at the RNA level as SS1 transcripts were detectable in both Sus and sus embryos. Thus, embryo specificity between the two SS genes was determined at posttranscriptional or at translational level of control. We surmise on the basis of these data that metabolic regulatory controls seem to override the normal constraints of tissue and cell specificity of the nonallelic isozyme genes to maintain efficient use of the pathways. Images PMID:8058735

  8. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla

    2016-01-01

    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  9. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  10. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  11. Bioinformatic comparisons and tissue expression of the neuronal nitric oxide synthase (nNOS) gene from the red drum (Sciaenops ocellatus).

    PubMed

    Zhou, Libin; Bai, Ru; Tian, Jianxiao; Liu, Xiaochun; Lu, Danqi; Zhu, Pei; Liu, Yun; Zeng, Lujiao; Luo, Wenna; Zhang, Yong; Wang, Anli

    2009-10-01

    The full length cDNA sequence for neuronal nitric oxide synthase (nNOS) gene from red drum (Sciaenops ocellatus) has been cloned, subjected to bioinformatic analysis, and examined for expression in different tissues. Red drum nNOS showed high identity to nNOS of mammals and other fish species. Notably, a unique 7-aa insertion was found in the important catalytic sites of the NO synthase domain, possibly affecting the function of red drum nNOS. Furthermore, this nNOS was expressed not only in brain but also in most of the internal organs including liver, intestine, spleen, head kidney and thymus. PMID:19647082

  12. Increase in the astaxanthin synthase gene (crtS) dose by in vivo DNA fragment assembly in Xanthophyllomyces dendrorhous

    PubMed Central

    2013-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that is relevant to biotechnology, as it can synthesize the carotenoid astaxanthin. However, the astaxanthin levels produced by wild-type strains are low. Although different approaches for promoting increased astaxanthin production have been attempted, no commercially competitive results have been obtained thus far. A promising alternative to facilitate the production of carotenoids in this yeast involves the use of genetic modification. However, a major limitation is the few available molecular tools to manipulate X. dendrorhous. Results In this work, the DNA assembler methodology that was previously described in Saccharomyces cerevisiae was successfully applied to assemble DNA fragments in vivo and integrate these fragments into the genome of X. dendrorhous by homologous recombination in only one transformation event. Using this method, the gene encoding astaxanthin synthase (crtS) was overexpressed in X. dendrorhous and a higher level of astaxanthin was produced. Conclusions This methodology could be used to easily and rapidly overexpress individual genes or combinations of genes simultaneously in X. dendrorhous, eliminating numerous steps involved in conventional cloning methods. PMID:24103677

  13. Functional characterization of the three genes encoding 1-deoxy-D-xylulose 5-phosphate synthase in maize.

    PubMed

    Cordoba, Elizabeth; Porta, Helena; Arroyo, Analilia; San Román, Carolina; Medina, Luis; Rodríguez-Concepción, Manuel; León, Patricia

    2011-03-01

    The 1-deoxy-D-xylulose 5-phosphate synthase (DXS) enzyme catalyses the first biosynthetic step of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. In plants the MEP pathway is involved in the synthesis of the common precursors to the plastidic isoprenoids, isopentenyl diphosphate and dimethylallyl diphosphate, in plastids. DXS is recognized as limiting this pathway and is a potential target for manipulation to increase various isoprenoids such as carotenoids. In Zea mays three dxs genes exist that encode plastid-targeted functional enzymes. Evidence is provided that these genes represent phylogenetically distinctive clades conserved among plants preceding monocot-dicot divergence. There is differential accumulation for each dxs gene transcript, during development and in response to external signals such as light. At the protein level, the analysis demonstrates that in Z. mays, DXS protein is feedback regulated in response to the inhibition of the pathway flow. The results support that the multilevel regulation of DXS activity is conserved in evolution.

  14. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  15. Analysis of 6-pyruvyl tetrahydropterin synthase, a target gene product of su(s) suppressor in Drosophila

    SciTech Connect

    Yim, J.J.; Park, Y.S.; Kim, J.H.; Jacobson, K.B. . Dept. of Microbiology; Oak Ridge National Lab., TN )

    1989-01-01

    Of the 20 suppressor mutants listed in Drosophila, su(s){sup 2} has been studied for the biochemical characterization of the suppression. In su(s){sup 2} suppression, some mutants at vermilion (v, 1-33.0), sable (s, 1-43.0), speck (sp, 2-107.0), and purple (pr, 2-54.5) are suppressible by mutants at the suppressor of sable (su(s)) locus. There have been many reports of suppression mechanism studies in purple led to purple loci. The biochemical studies in purple led to in vitro demonstration of a su(s){sup +} gene product as a negative effector against suppressed purple PPH{sub 4} synthase, which has been also demonstrated in the gene product of vermilion more recently. Both studies led to a proposal for a posttranslational mechanism in which the su(s){sup +} gene produces a substance that interferes with the function of the target enzymes from the purple and vermilion mutant. In contrast to the transcriptional regulation of the su(s) locus the posttranslational mechanism is based on qualitative differences between wild and suppressed enzyme. Therefore this investigation was to determine if any quantitative or qualitative differences exist between the mutant and wild type target enzymes. 7 refs., 4 figs.

  16. Expression pattern of (+)-delta-cadinene synthase genes and biosynthesis of sesquiterpene aldehydes in plants of Gossypium arboreum L.

    PubMed

    Tan, X P; Liang, W Q; Liu, C J; Luo, P; Heinstein, P; Chen, X Y

    2000-03-01

    The cotton (+)-delta-cadinene synthase, a sesquiterpene cyclase, is encoded by a complex gene family which, based on homology, can be divided into two subfamilies: cad1-A and cad1-C. Southern blots revealed several members of the cad1-C subfamily, and a single member of the cad1-A subfamily, in the diploid Gossypium arboreum genome. One of the cad1-C genes, cad1-C3, was isolated from this species. According to reverse transcriptase-polymerase chain reaction, transcripts of both cad1-C and cad1-A genes appeared in roots from the second day post germination and in 1-d-old cotyledons, whereas the transcription levels were too low to be detected in the hypocotyls. Initially, sesquiterpene cyclase activities were found to be high in the seedlings, then dropped in aerial organs but increased in roots during development. Sesquiterpene aldehyde contents followed the same pattern. In fully developed plants, the transcripts of cad1-C were detected in stems, leaves and pericarps, as well as in the sepals and petals 3 d before anthesis, but not at the day of anthesis. In contrast, cad1-A transcripts were not detected in any of these aerial organs. The sesquiterpene aldehyde contents increased in petals but decreased in sepals after anthesis. Treatment of G. arboreum stems with a Verticillium dahliae elicitor-preparation activated cad1-A transcription, but a significant level of cad1-C transcripts was detected both before and after elicitation. In G. hirsutum cv. GL-5, a glandless cultivar, the cad1-C gene was activated by the same fungal elicitor, followed by the synthesis of the sesquiterpene cyclase, and accumulation of sesquiterpene aldehydes. The cad1 gene expression during development and in response to elicitation, as well as the spatial and temporal pattern of sesquiterpene biosynthesis, constitute a chemical defense machinery in cotton plants. PMID:10787059

  17. Endothelial nitric oxide synthase gene intron 4, 27 bp repeat polymorphism and essential hypertension in the Kazakh Chinese population.

    PubMed

    Deng, Fengmei; Hu, Qinghua; Tang, Bin; He, Fang; Guo, Shuxia; Chen, Jiang; Li, Feng; Wu, Xuehua; Zhang, Jun; Zhang, Huimin; Zhao, Juan; Zhong, Hua; He, Ling; Li, Jun; Zhang, Le; Wang, Shuren

    2007-05-01

    To investigate the relationship between 27 bp repeat polymorphism in intron 4 in the endothelial nitric oxide synthase (eNOS4) gene and essential hypertension in the Kazakh Chinese population, 151 patients with essential hypertension and 138 healthy people were selected from the Boertonggu countryside of Shawan region in the Xinjiang uygur autonomous region of China in 2006. The polymorphism of eNOS in the two groups was detected with polymerase chain reaction assays and the genotype frequencies in each group were calculated following the Hardy-Weinberg law. Four and five tandem 27 bp repeats were designated as "a" and "b", respectively. It was found that the frequencies of b/b, b/a and a/a genotypes of the eNOS4 gene were 84.06%, 15.22% and 0.72% in the control group, and 81.46%, 15.89% and 2.65% in the hypertension group, respectively. The frequencies of gene "a" and "b" were 91.67% and 8.33% in the control group and 89.40% and 10.60% in the hypertension group, respectively. It was found that plasma eNOS activity was not associated with genotypes and alleles of eNOS gene. Plasma eNOS activity in the hypertension group was significantly decreased compared with the control group (P<0.01). The results suggest that eNOS4 gene polymorphisms are unlikely to be the major genetic susceptibility factors for essential hypertension in the Xinjiang Kazakh population. However, a positive association between plasma eNOS activity and essential hypertension has been revealed. PMID:17492127

  18. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    PubMed

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  19. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    PubMed Central

    Vasudevan, R; Ismail, P; Jaafar, NI; Mohamad, NA; Etemad, E; Wan Aliaa, WS; Eshkor, S

    2014-01-01

    The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR) polymorphism of the endothelial nitric oxide synthase (eNOS) gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R) in Malaysian end-stage renal disease (ESRD) subjects. A total of 150 ESRD patients were recruited from the National Kidney Foundation’s (NKF)dialysis centers in Malaysia and compared with 150 normal healthy individuals. Genomic DNA was extracted from buccal cells of all the subjects. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was carried out to amplify the products and the restricted fragments were separated by agarose gel electrophoresis. Statistical analyses were carried out using software where a level of p <0.05 was considered to be statistically significant. The genotypic and allelic frequencies of the B2R gene (c.181C>T, 4b/a) and eNOS gene (c.894G>T) polymorphisms were not statistically significant (p >0.05) when compared to the control subjects. The B2R and eNOS gene polymorphisms may not be considered as genetic susceptibility markers for Malaysian ESRD subjects. PMID:25741213

  20. Analysis of human bradykinin receptor gene and endothelial nitric oxide synthase gene polymorphisms in end-stage renal disease among malaysians.

    PubMed

    Vasudevan, R; Ismail, P; Jaafar, Ni; Mohamad, Na; Etemad, E; Wan Aliaa, Ws; Eshkor, S

    2014-06-01

    The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR) polymorphism of the endothelial nitric oxide synthase (eNOS) gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R) in Malaysian end-stage renal disease (ESRD) subjects. A total of 150 ESRD patients were recruited from the National Kidney Foundation's (NKF)dialysis centers in Malaysia and compared with 150 normal healthy individuals. Genomic DNA was extracted from buccal cells of all the subjects. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was carried out to amplify the products and the restricted fragments were separated by agarose gel electrophoresis. Statistical analyses were carried out using software where a level of p <0.05 was considered to be statistically significant. The genotypic and allelic frequencies of the B2R gene (c.181C>T, 4b/a) and eNOS gene (c.894G>T) polymorphisms were not statistically significant (p >0.05) when compared to the control subjects. The B2R and eNOS gene polymorphisms may not be considered as genetic susceptibility markers for Malaysian ESRD subjects. PMID:25741213

  1. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  2. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  3. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  4. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity. PMID:23832368

  5. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  6. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea

    PubMed Central

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  7. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    SciTech Connect

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  8. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    PubMed

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-01-01

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain. PMID:26782579

  9. Development of a gene delivery system in Streptococcus gordonii using thymidylate synthase as a selection marker.

    PubMed

    Lee, Song F; Hulbah, Maram; Halperin, Scott A

    2016-06-01

    Streptococcus gordonii, a commensal bacterium of the human oral cavity, is a potential live vaccine vector. In this study, we have developed a system that delivers a vaccine antigen gene onto the chromosome of S. gordonii. The system consisted of a recipient strain, that is a thymidine auxotroph constructed by deletion of a portion of thyA gene, and a linear gene delivery construct, composed of the functional thyA gene, the vaccine antigen gene, and a DNA fragment immediately downstream of thyA. The construct is assembled by a ligation and polymerase chain reaction strategy. Upon introduction into the thyA mutant, the vaccine antigen gene integrated into the chromosome via a double crossing-over event. Using the above strategy, a test vaccine antigen gene coding for a fusion protein composed of the Bordetella pertussis filamentous hemagglutinin type I domain and the single chain antibody against complement receptor 1 was successfully delivered to S. gordonii. The resulting S. gordonii expressed the fusion protein and the delivered gene was stable in the bacterium in vitro and in a mouse colonization experiment. Mice colonized by the fusion protein-expressing S. gordonii developed antibodies that recognized the native filamentous hemagglutinin protein suggesting that an immune response was elicited. PMID:27062990

  10. In silico identification and analysis of phytoene synthase genes in plants.

    PubMed

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  11. Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer

    SciTech Connect

    Hur, Hyuk; Kang, Jeonghyun; Kim, Nam Kyu; Min, Byung Soh; Lee, Kang Young; Shin, Sang Joon; Keum, Ki Chang; Choi, Junjeong; Kim, Hoguen; Choi, Sung Ho; Lee, Mi-Young

    2011-11-01

    Purpose: This study aims to correlate thymidylate synthase (TS) gene polymorphisms with the tumor response to preoperative 5-fluorouracil (5-FU)-based chemoradiation therapy (CRT) in patients with rectal cancer. Methods and Materials: Forty-four patients with rectal cancer treated with 5-FU-based preoperative CRT were prospectively enrolled in this study. Thymidylate synthase expression and TS gene polymorphisms were evaluated in tumor obtained before preoperative CRT and were correlated with the pathologic response, as assessed by histopathologic staging (pTNM) and tumor regression grade. Results: Patients exhibited 2R/3R and 3R/3R tandem repeat polymorphisms in the TS gene. With regard to TS expression in these genotypes, 2R/3RC and 3RC/3RC were defined as the low-expression group and 2R/3RG, 3RC/3RG, and 3RG/3RG as the high-expression group. There was no significant correlation between TS expression and tumor response. There was no significant difference in the tumor response between patients homozygous for 3R/3R and patients heterozygous for 2R/3R. However, 13 of 14 patients in the low-expression group with a G>C single-nucleotide polymorphism (SNP) (2R/3RC [n = 5] or 3RC/3RC [n = 9]) exhibited a significantly greater tumor downstaging rate, as compared with only 12 of 30 patients in the high-expression group without the SNP (2R/3RG [n = 10], 3RC/3RG [n = 9], or 3RG/3RG [n = 11]) (p = 0.001). The nodal downstaging rate was also significantly greater in this low-expression group, as compared with the high-expression group (12 of 14 vs. 14 of 30, p = 0.014). However, there was no significant difference in the tumor regression grade between these groups. Conclusions: This study suggests that SNPs within the TS enhancer region affect the tumor response to preoperative 5-FU-based CRT in rectal cancer.

  12. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    SciTech Connect

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  13. Differential regulation of host genes including hepatic fatty acid synthase in HBV-transgenic mice.

    PubMed

    Zhang, Hongmin; Li, Hong; Yang, Yixuan; Li, Sanglin; Ren, Hong; Zhang, Dazhi; Hu, Huaidong

    2013-06-01

    Hepatitis B virus (HBV) is the most common of the hepatitis viruses that cause chronic liver infections in humans, and it is considered to be a major global health problem. To gain a better understanding of HBV pathogenesis, and identify novel putative targets for anti-HBV therapy, this study was designed to elucidate the differential expression of host proteins in liver tissue from HBV-transgenic mice. Liver samples from two groups, (1) HBV-transgenic (Tg) mice, (2) corresponding background normal mice, wild-type (WT) mice, were collected and subjected to iTRAQ and mass spectrometry analysis. In total, 1950 unique proteins were identified, and 68 proteins were found to be differentially expressed in HBV-Tg mice as compared with that in WT mice. Several differentially expressed proteins were further validated by real-time quantitative RT-PCR, Western blot and immunohistochemical analysis. Furthermore, the association of HBV replication with fatty acid synthase (FASN), one of the highly expressed proteins in HBV-Tg mice, was verified. Silencing of FASN expression in HepG2.2.15 cells suppressed viral replication through the IFN signaling pathway, and some downstream antiviral effectors. The implicated role of FASN in HBV replication provides an opportunity to test existing compounds against FASN for adjuvant therapy and/or treatment of HBV replication. PMID:23675653

  14. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  15. Induction of isoprenyl diphosphate synthases, plant hormones and defense signalling genes correlates with traumatic resin duct formation in Norway spruce (Picea abies).

    PubMed

    Schmidt, Axel; Nagel, Raimund; Krekling, Trygve; Christiansen, Erik; Gershenzon, Jonathan; Krokene, Paal

    2011-12-01

    Norway spruce (Picea abies) defends itself against herbivores and pathogens by formation of traumatic resin ducts filled with terpenoid-based oleoresin. An important group of enzymes in terpenoid biosynthesis are the short-chain isoprenyl diphosphate synthases which produce geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)) as precursors of monoterpenes, sesquiterpenes, and diterpene resin acids, respectively. After treatment with methyl jasmonate (MJ) we investigated the expression of all isoprenyl diphosphate synthase genes characterized to date from Norway spruce and correlated this with formation of traumatic resin ducts and terpene accumulation. Formation of traumatic resin ducts correlated with higher amounts of monoterpenes, sesquiterpenes and diterpene resin acids and an upregulation of isoprenyl diphosphate synthase genes producing geranyl diphosphate or geranylgeranyl diphosphate. Among defense hormones, jasmonate and jasmonate-isoleucine conjugate accumulated to higher levels in trees with extensive traumatic resin duct formation, whereas salicylate did not. Jasmonate and ethylene are likely to both be involved in formation of traumatic resin ducts based on elevated transcripts of genes encoding lipoxygenase and 1-aminocyclopropane-1-carboxylic acid oxidase associated with resin duct formation. Other genes involved in defense signalling in other systems, mitogen-activated protein kinase3 and nonexpressor of pathogenesis-related gene1, were also associated with traumatic resin duct formation. These responses were detected not only at the site of MJ treatment, but also systemically up to 60 cm above the site of treatment on the trunk.

  16. Screening of fungi for the presence of the trichodiene synthase encoding sequence by hybridization to the Tri5 gene cloned from Fusarium poae.

    PubMed

    Fekete, C; Logrieco, A; Giczey, G; Hornok, L

    1997-01-01

    A trichodiene synthase gene (Tri5) was amplified from F. poae by polymerase chain reaction using synthetic primers constructed on the basis of the coding portion of the same gene from F. sporotrichioides. Sequence analysis showed a high degree of similarity with other trichodiene synthase genes. A 378 bp HindIII fragment of the gene that contains the genetic information for the putative active site of the trichodiene synthase enzyme was radiolabelled and used for dot blot analysis. This probe could detect Tri5 hybridization in 1-10 ng DNA of fusaria that have the genetic potentiality to synthesize toxic trichothecene compounds, but gave no reaction with trichothecene nonproducing members of the genus. When other fungi reported to produce trichothecenes (Myrothecium, Stachybotrys, Trichoderma, Trichothecium spp.) were tested, only strains of Myrothecium and Stachybotrys gave strong positive reaction. Faint but consistent hybridization signals were obtained in four species (F. semitectum, F. tricinctum, Trichoderma viride and Trichothecium roseum) indicating the presence of nonhomologous evolutionary variants or inactive remnants of the Tri5 gene in these fungi. PMID:9433809

  17. Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1

    PubMed Central

    Wang, Liuqing; Wang, Yan; Wang, Qi; Liu, Fei; Selvaraj, Jonathan Nimal; Liu, Lingna; Xing, Fuguo; Zhao, Yueju; Zhou, Lu; Liu, Yang

    2015-01-01

    Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the β-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production. PMID:26213966

  18. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  19. Association between single-nucleotide polymorphisms of fatty acid synthase gene and meat quality traits in Datong Yak (Bos grunniens).

    PubMed

    Chu, M; Wu, X Y; Guo, X; Pei, J; Jiao, F; Fang, H T; Liang, C N; Ding, X Z; Bao, P J; Yan, P

    2015-03-30

    Fatty acid synthase (FASN) is a key enzyme in fatty acid anabolism that plays an important role in the fat deposit of eukaryotic cells. Therefore, in this study, we detected 2 novel single-nucleotide polymorphisms (SNPs) in the FASN gene in 313 adult individuals of Datong yak using polymerase chain reaction-single strand conformation polymorphism and DNA sequencing techniques. SNP g.5477C>T is located in intron 3 of FASN, and 3 genotypes, HH, HG, and GG, were detected in this mutation site. SNP g.16930T>A is located in exon 37 of FASN, and 2 genotypes, EE and EF, were detected in this site. Association analysis of these 2 SNPs with meat quality traits showed that in SNP g.5477C>T, yaks with the HH genotype and HG genotype had significantly higher intramuscular fat content than individuals with the GG genotype (P < 0.01). In SNP g.16930T>A, yaks with the EE genotype also had significantly higher IMF content than individuals with the EF genotype (P < 0.01). The results indicate that FASN may be used as a candidate gene affecting intramuscular fat content in Datong yaks.

  20. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    PubMed

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  1. Francisella tularensis live vaccine strain folate metabolism and pseudouridine synthase gene mutants modulate macrophage caspase-1 activation.

    PubMed

    Ulland, Tyler K; Janowski, Ann M; Buchan, Blake W; Faron, Matthew; Cassel, Suzanne L; Jones, Bradley D; Sutterwala, Fayyaz S

    2013-01-01

    Francisella tularensis is a Gram-negative bacterium and the causative agent of the disease tularemia. Escape of F. tularensis from the phagosome into the cytosol of the macrophage triggers the activation of the AIM2 inflammasome through a mechanism that is not well understood. Activation of the AIM2 inflammasome results in autocatalytic cleavage of caspase-1, resulting in the processing and secretion of interleukin-1β (IL-1β) and IL-18, which play a crucial role in innate immune responses to F. tularensis. We have identified the 5-formyltetrahydrofolate cycloligase gene (FTL_0724) as being important for F. tularensis live vaccine strain (LVS) virulence. Infection of mice in vivo with a F. tularensis LVS FTL_0724 mutant resulted in diminished mortality compared to infection of mice with wild-type LVS. The FTL_0724 mutant also induced increased inflammasome-dependent IL-1β and IL-18 secretion and cytotoxicity in macrophages in vitro. In contrast, infection of macrophages with a F. tularensis LVS rluD pseudouridine synthase (FTL_0699) mutant resulted in diminished IL-1β and IL-18 secretion from macrophages in vitro compared to infection of macrophages with wild-type LVS. In addition, the FTL_0699 mutant was not attenuated in vivo. These findings further illustrate that F. tularensis LVS possesses numerous genes that influence its ability to activate the inflammasome, which is a key host strategy to control infection with this pathogen in vivo.

  2. Francisella tularensis Live Vaccine Strain Folate Metabolism and Pseudouridine Synthase Gene Mutants Modulate Macrophage Caspase-1 Activation

    PubMed Central

    Ulland, Tyler K.; Janowski, Ann M.; Buchan, Blake W.; Faron, Matthew; Cassel, Suzanne L.; Jones, Bradley D.

    2013-01-01

    Francisella tularensis is a Gram-negative bacterium and the causative agent of the disease tularemia. Escape of F. tularensis from the phagosome into the cytosol of the macrophage triggers the activation of the AIM2 inflammasome through a mechanism that is not well understood. Activation of the AIM2 inflammasome results in autocatalytic cleavage of caspase-1, resulting in the processing and secretion of interleukin-1β (IL-1β) and IL-18, which play a crucial role in innate immune responses to F. tularensis. We have identified the 5-formyltetrahydrofolate cycloligase gene (FTL_0724) as being important for F. tularensis live vaccine strain (LVS) virulence. Infection of mice in vivo with a F. tularensis LVS FTL_0724 mutant resulted in diminished mortality compared to infection of mice with wild-type LVS. The FTL_0724 mutant also induced increased inflammasome-dependent IL-1β and IL-18 secretion and cytotoxicity in macrophages in vitro. In contrast, infection of macrophages with a F. tularensis LVS rluD pseudouridine synthase (FTL_0699) mutant resulted in diminished IL-1β and IL-18 secretion from macrophages in vitro compared to infection of macrophages with wild-type LVS. In addition, the FTL_0699 mutant was not attenuated in vivo. These findings further illustrate that F. tularensis LVS possesses numerous genes that influence its ability to activate the inflammasome, which is a key host strategy to control infection with this pathogen in vivo. PMID:23115038

  3. Association of a functional variant of the nitric oxide synthase 1 gene with personality, anxiety, and depressiveness.

    PubMed

    Kurrikoff, Triin; Lesch, Klaus-Peter; Kiive, Evelyn; Konstabel, Kenn; Herterich, Sabine; Veidebaum, Toomas; Reif, Andreas; Harro, Jaanus

    2012-11-01

    A functional promoter polymorphism of the nitric oxide synthase 1 gene first exon 1f variable number tandem repeat (NOS1 ex1f-VNTR) is associated with impulsivity and related psychopathology. Facets of impulsivity are strongly associated with personality traits; maladaptive impulsivity with neuroticism; and adaptive impulsivity with extraversion. Both high neuroticism and low extraversion predict anxiety and depressive symptoms. The aim of the present study was to evaluate the effect of the NOS1 ex1f-VNTR genotype and possible interaction with environmental factors on personality, anxiety, and depressiveness in a population-representative sample. Short allele carriers had higher neuroticism and anxiety than individuals with the long/long (l/l) genotype. Male short/short homozygotes also had higher extraversion. In the face of environmental adversity, females with a short allele had higher scores of neuroticism, anxiety, and depressiveness compared to the l/l genotype. Males were more sensitive to environmental conditions when they had the l/l genotype and low extraversion. In conclusion, the NOS1 ex1f-VNTR influences personality and emotional regulation dependent on gender and environment. Together with previous findings on the effect of the NOS1 genotype on impulse control, these data suggest that NOS1 should be considered another plasticity gene, because its variants are associated with different coping strategies.

  4. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  5. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    PubMed Central

    2010-01-01

    Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X) and a novel frameshift mutation (966_967delGA/insC) which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions. PMID:20051115

  6. Relationship of aldosterone synthase gene (C-344T) and mineralocorticoid receptor (S810L) polymorphisms with gestational hypertension.

    PubMed

    Ramírez-Salazar, M; Romero-Gutiérrez, G; Zaina, S; Malacara, J M; Kornhauser, C; Pérez-Luque, E

    2011-05-01

    The extent of genetic influence in the aetiology of gestational hypertension has not been completely determined. The aim of this study was to analyse the relationship between aldosterone levels and the -344T/C polymorphism of the aldosterone synthase gene (CYP11B2) and to investigate the frequency of the S810L mutation of mineralocorticoid receptor (MR) in gestational hypertension. One hundred women with pregnancy-induced hypertension and 100 with normal pregnancy were studied to measure serum aldosterone and progesterone levels and for the genotypification of the -344T/C polymorphism of CYP11B2 gene and the S810L mutation of MR by RFLP-PCR and SSP, respectively. Serum aldosterone levels were reduced (<0.000001) and serum progesterone levels increased (<0.000001) in gestational hypertensive women as compared with normal pregnant women. The -344T/C of CYP11B2 genotypic frequencies were similar in the hypertensive and normotensive pregnant women. The 810L-mutated allele of MR was found in 12% of the hypertensive and 9.4% of the normotensive pregnant women. In contrast to the observations made in preeclampsia, the genotype of -344T/C of CYP11B2 was neither related with gestational hypertension nor with aldosterone levels at delivery. The frequency of the S810L mutation was similar in the hypertensive and normotensive women but higher than observed in other reports.

  7. Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

    PubMed

    Zhu, L

    2015-01-01

    We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion.

  8. Nitric oxide synthase gene polymorphism (G894T) influences arterial stiffness in adults: The Bogalusa Heart Study.

    PubMed

    Chen, Wei; Srinivasan, Sathanur R; Bond, M Gene; Tang, Rong; Urbina, Elaine M; Li, Shengxu; Boerwinkle, Eric; Berenson, Gerald S

    2004-07-01

    The endothelial nitric oxide synthase (eNOS) gene is known to influence the regulation of blood pressure (BP) levels. However, whether the eNOS gene locus influences arterial stiffness independently of BP is unknown. This study examines the independent effect of the eNOS gene polymorphism (G894T) on arterial stiffness in 118 African American and 285 white young adults, aged 25 to 37 years. Arterial stiffness was measured from M-mode ultrasounds of common carotid artery using Peterson's (Ep) and Young's (YEM) elastic modulus. African Americans displayed a lower frequency of the T allele than did whites (0.131 v 0.321, P <.001). The T allele was associated with lower systolic BP in African Americans (P =.04) but not in whites. African Americans showed significantly higher values of Ep (that is, increased stiffness) than did whites (49.9 kPa vs 45.5 kPa, P =.003), whereas no such difference in ethnicity was found for YEM, a measure of elasticity adjusted for relative wall thickness. After controlling for sex, age, body mass index, insulin, heart rate, and mean arterial pressure, the T allele was associated with significantly lower values of Ep (P =.037) and YEM (P =.068) in African Americans. Although the genotype effect on Ep and YEM was not significant in whites, trends were similar to those in African Americans. In the total sample, including ethnicity as an additional covariate, the G894T genotype was significantly associated with Ep (P =.046) and YEM (P =.035). These results suggest that the allelic variation (G894T) of the eNOS gene or a locus closely linked to it is associated with lower arterial wall stiffness, adjusting for BP levels, in young adults.

  9. Cloning and sequence characterization of a non-reducing polyketide synthase gene from the lichen Xanthoparmelia semiviridis.

    PubMed

    Chooi, Yit-Heng; Stalker, David M; Davis, Meryl A; Fujii, Isao; Elix, John A; Louwhoff, Simone H J J; Lawrie, Ann C

    2008-02-01

    Lichens produce a diverse array of secondary metabolites that have shown various biological activities. Of particular interest are the coupled phenolics that originate from polyketide pathways, such as depsides, depsidones and usnic acids, which are produced almost solely by lichens. Based on the presumed catalytic domains required for the synthesis of the key intermediates beta-orsellinic acid and methylphloroacetophenone, two pairs of degenerate primers were designed to target specifically the beta-ketoacylsynthase (KS) and C-methyltransferase (CMeT) domains of fungal non-reducing polyketide synthase (NR-PKS) genes with CMeT domains. These primers were used to explore the genome of the lichen Xanthoparmelia semiviridis, which produces beta-orcinol depsidones and usnic acid. One of the two KS domains amplified from genomic DNA of field-collected X. semiviridis was used as a probe to recover the candidate PKS gene. A 13 kb fragment containing an intact putative PKS gene (xsepks1) of 6555 bp was recovered from a partial genomic library. The inferred amino acid sequence indicated that xsepks1 encodes a protein of 2164 amino acids and contains KS, acyltransferase (AT), acyl carrier protein (ACP) and CMeT domains as expected. This demonstrated a successful strategy for targeting non-reducing PKS genes with CMeT domains. Integration of the 5' fragment of xsepks1, including the native promoter, into Aspergillus nidulans by cotransformation resulted in the transcription of the 5'xsepks1 and the splicing of a 63 bp intron, suggesting that A. nidulans could be a suitable heterologous host for xsepks1 expression.

  10. Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture.

    PubMed

    Saleem, Muhammad; Arshad, Muhammad; Hussain, Sarfraz; Bhatti, Ahmad Saeed

    2007-10-01

    Ethylene is a gaseous plant growth hormone produced endogenously by almost all plants. It is also produced in soil through a variety of biotic and abiotic mechanisms, and plays a key role in inducing multifarious physiological changes in plants at molecular level. Apart from being a plant growth regulator, ethylene has also been established as a stress hormone. Under stress conditions like those generated by salinity, drought, waterlogging, heavy metals and pathogenicity, the endogenous production of ethylene is accelerated substantially which adversely affects the root growth and consequently the growth of the plant as a whole. Certain plant growth promoting rhizobacteria (PGPR) contain a vital enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, which regulates ethylene production by metabolizing ACC (an immediate precursor of ethylene biosynthesis in higher plants) into alpha-ketobutyrate and ammonia. Inoculation with PGPR containing ACC deaminase activity could be helpful in sustaining plant growth and development under stress conditions by reducing stress-induced ethylene production. Lately, efforts have been made to introduce ACC deaminase genes into plants to regulate ethylene level in the plants for optimum growth, particularly under stressed conditions. In this review, the primary focus is on giving account of all aspects of PGPR containing ACC deaminase regarding alleviation of impact of both biotic and abiotic stresses onto plants and of recent trends in terms of introduction of ACC deaminase genes into plant and microbial species.

  11. Exclusion of the neuronal nitric oxide synthase gene and the human achaete-scute homologue 1 gene as candidate loci for spinal cerebellar ataxia 2 (SCA2)

    SciTech Connect

    Twells, R.; Xu, W. |; Ball, D.

    1994-09-01

    The autosomal dominant ataxias are a heterogeneous group of disorders, characterized by progressive degeneration of the cerebellum, pons and inferior olives, as well as the spinal cord. We previously mapped the spinal cerebellar ataxia 2 locus (SCA2) to chromosome 12q23-24.1 in a large Cuban founder population, flanked by the markers D12S58 and PLA2. Anticipation is a common feature of this disorder and therefore we have examined genes in this region which contain trinucleotide repeat motifs as candidate loci for SCA2. The neuronal nitric oxide synthase gene (NOS) has recently been assigned to chromosome 12q24.2-24.3 by fluorescent in situ hybridization. Neuronal NOS is responsible for the production of nitric oxide, a neurotransmitter expressed in high levels in the cerebellum as well as other regions of the nervous system. We report here the identification and analysis of an (AAT){sub n} repeat motif in an intronic region of the neuronal NOS gene, genetic mapping data and its exclusion from being involved in SCA2. We also report the exclusion of the human achaete-scute homologue 1 gene (HASH1), instrumental in neurosensory development in mouse, from being involved in SCA2 by the analysis of a proximal (CAG){sub n} repeat motif in the Cuban pedigrees, and its genetic location on chromosome 12q.

  12. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product.

    PubMed

    Wenz, P; Schwank, S; Hoja, U; Schüller, H J

    2001-11-15

    The fatty acid synthase genes FAS1 and FAS2 of the yeast Saccharomyces cerevisiae are transcriptionally co-regulated by general transcription factors (such as Reb1, Rap1 and Abf1) and by the phospholipid-specific heterodimeric activator Ino2/Ino4, acting via their corresponding upstream binding sites. Here we provide evidence for a positive autoregulatory influence of FAS1 on FAS2 expression. Even with a constant FAS2 copy number, a 10-fold increase of FAS2 transcript amount was observed in the presence of FAS1 in multi-copy, compared to a fas1 null mutant. Surprisingly, the first 66 nt of the FAS2 coding region turned out as necessary and sufficient for FAS1-dependent gene expression. FAS2-lacZ fusion constructs deleted for this region showed high reporter gene expression even in the absence of FAS1, arguing for a negatively-acting downstream repression site (DRS) responsible for FAS1-dependent expression of FAS2. Our data suggest that the FAS1 gene product, in addition to its catalytic function, is also required for the coordinate biosynthetic control of the yeast FAS complex. An excess of uncomplexed Fas1 may be responsible for the deactivation of an FAS2-specific repressor, acting via the DRS. PMID:11713312

  13. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips.

    PubMed

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A

    2013-09-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound.

  14. Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.

    PubMed Central

    Richter, G; Volk, R; Krieger, C; Lahm, H W; Röthlisberger, U; Bacher, A

    1992-01-01

    3,4-Dihydroxy-2-butanone 4-phosphate is biosynthesized from ribulose 5-phosphate and serves as the biosynthetic precursor for the xylene ring of riboflavin. The gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli has been cloned and sequenced. The gene codes for a protein of 217 amino acid residues with a calculated molecular mass of 23,349.6 Da. The enzyme was purified to near homogeneity from a recombinant E. coli strain and had a specific activity of 1,700 nmol mg-1 h-1. The N-terminal amino acid sequence and the amino acid composition of the protein were in agreement with the deduced sequence. The molecular mass as determined by ion spray mass spectrometry was 23,351 +/- 2 Da, which is in agreement with the predicted mass. The previously reported loci htrP, "luxH-like," and ribB at 66 min of the E. coli chromosome are all identical to the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase, but their role had not been hitherto determined. Sequence homology indicates that gene luxH of Vibrio harveyi and the central open reading frame of the Bacillus subtilis riboflavin operon code for 3,4-dihydroxy-2-butanone 4-phosphate synthase. Images PMID:1597419

  15. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  16. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens.

    PubMed

    Chen, J; Zhang, D; Yao, Q; Zhang, J; Dong, X; Tian, H; Chen, J; Zhang, W

    2010-12-01

    The brown planthopper, Nilaparvata lugens, is the most devastating rice insect pest to have given rise to an outbreak in recent years. RNA interference (RNAi) is a technological breakthrough that has been developed as a powerful tool for studying gene function and for the highly targeted control of insect pests. Here, we examined the effects of using a feeding-based RNAi technique to target the gene trehalose phosphate synthase (TPS) in N. lugens. The full-length cDNA of N. lugens TPS (NlTPS) is 3235 bp and has an open reading frame of 2424 bp, encoding a protein of 807 amino acids. NlTPS was expressed in the fat body, midgut and ovary. Quantitative real-time PCR (qRT-PCR) analysis revealed that NlTPS mRNA is expressed continuously with little change during the life of the insect. Efficient silencing of the TPS gene through double-stranded RNA (dsRNA) feeding led to rapid and significant reduction levels of TPS mRNA and enzymatic activity. Additionally, the development of N. lugens larvae that had been fed with the dsRNA was disturbed, resulting in lethality, and the cumulative survival rates dropped to 75.56, 64.44, 55.56 and 40.00% after continuous ingestion of 0.5 µg/µl dsRNA for 2, 4, 7 and 10 days, respectively. These values were significantly lower than those of the insects in the control group, suggesting that NlTPS dsRNA may be useful as a means of insect pest control. PMID:20726907

  17. Endothelial NO Synthase Gene Polymorphisms and Risk of Ischemic Stroke in Asian Population: A Meta-Analysis

    PubMed Central

    Wu, Wenlong; Zhang, Dongfeng

    2013-01-01

    Background The association between polymorphism 4b/a, T-786C and G894T in endothelial NO synthase gene (eNOS) and ischemic stroke (IS) remains controversial in Asian. A meta-analysis was performed to better clarify the association between eNOS gene and IS risk. Methods Based on the search of PubMed, Web of Science (ISI), CNKI (National Knowledge Infrastructure), Wan Fang Med Online and CBM (Chinese Biology Medical Literature Database) databases, all eligible case-control or cohort studies were identified. Pooled odds ratios (ORs) with 95% confidence intervals (CIs) from fixed and random effect models were calculated. Heterogeneity among studies was evaluated using the I2. Meta-regression was used to explore the potential sources of between-study heterogeneity. Begg's test was used to estimate publication bias. Results Our study included 27 articles, contained 28 independent case–control studies, involved a total of 3,742 cases and 3,691 controls about 4b/a, 1,800 cases and 1,751 controls about T-786C and 2,747 cases and 2,872 controls about G894T. A significant association of 4a allele with increased risk of IS was found in dominant (FEM: OR = 1.498, 95% CI = 1.329–1.689), recessive (FEM: OR = 2.132, 95% CI = 1.383–3.286) and codominant (REM: OR = 1.456, 95% CI = 1.235–1.716) models. For T-786C and G894T, there were significant associations with dominant and codominant genetic models, but not with recessive genetic model. Conclusions The meta-analysis indicated that eNOS gene 4b/a, T-786C, G894T polymorphism might be associated with IS. PMID:23544143

  18. Construction and characterization of two Citrus BAC libraries and identification of clones containing the phytoene synthase gene.

    PubMed

    Baig, M N R; Yu, An; Guo, Wenwu; Deng, Xiuxin

    2009-05-01

    Two deep-coverage Bacterial Artificial Chromosome (BAC) libraries of Citrus sinensis (L.) Osbeck 'Cara Cara' navel orange and Citrus reticulata (L.) Blanco 'Egan No. 1' Ponkan mandarin, which belong to the two most important species of the Citrus genus, have been constructed and characterized to facilitate gene cloning and to analyze variety-specific genome composition. The C. sinensis BAC library consists of 36 000 clones with negligible false-positive clones and an estimated average insert size of 126 kb covering ~4.5 x 109 bp and thus providing an 11.8-fold coverage of haploid genome equivalents, whereas the C. reticulata library consists of 21 000 clones also with negligible false-positive clones and an estimated average of 120 kb covering ~2.5 x 109 bp representing a 6.6-fold coverage of haploid genome equivalents. Both libraries were evaluated for contamination with high-copy vector, empty pIndigoBAC536 vector, and organellar DNA sequences. Screening has been performed by Southern hybridization of BAC filters, which results in <0.5% chloroplast DNA contamination and no mitochondrial DNA contamination in both libraries. Eight and five positive clones harboring the gene encoding Phytoene synthase (Psy (EC 2.5.1.32)) were identified from the C. sinensis and C. reticulata libraries, respectively, using the filter hybridization procedure. These results suggest that the two BAC libraries are useful tools for the isolation of functional genes and advanced genomics research in the two important species C. sinensis and C. reticulata. Resources, high-density filters, individual clones, and whole libraries are available for public distribution and are accessible at the National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University.

  19. Bromelain improves decrease in defecation in postoperative rats: modulation of colonic gene expression of inducible nitric oxide synthase.

    PubMed

    Wen, Suping; Huang, Tom H W; Li, George Q; Yamahara, Johji; Roufogalis, Basil D; Li, Yuhao

    2006-01-25

    Ileus continues to be a common consequence of abdominal surgery, causing significant patient discomfort and often leading to more serious problems. The therapy available is limited, hence, ileus remains an important clinical problem. Activation of inducible nitric oxide synthase (iNOS) directly modulates intestinal dysmotility after bowel manipulation and plays an essential role in initiating intestinal inflammation. Nuclear factor (NF)-kappaB is known to be a critical component of iNOS gene transcriptional activation in response to inflammatory stimuli. Bromelain is a crude extract from the pineapple stem, which is sold as a nutritional supplement to "promote digestive health" and as an anti-inflammatory medication in some developed countries. Here, we have found that oral administration of bromelain improves decrease in defecation in abdominal postoperative rats. Results showed that bromelain increased the wet weight, dry weight, water content and number of fecal pellets in laparotomized plus mechanically manipulated rats, suggesting improvement of postoperative ileus. Furthermore, bromelain treatment inhibited overexpressed iNOS mRNA and restored down-regulated inhibitor kappaBalpha mRNA in the colon of the postoperative rats. From the in vitro experiments, bromelain inhibits lipopolysaccharide (LPS)-induced nitrite overproduction in macrophage cell lines and LPS-induced NF-kappaB luciferase reporter gene expression in RAW264.7 macrophages transfected with NF-kappaB luciferase reporter gene. Thus, our findings suggest that bromelain improves decrease in defecation in postoperative rats, at least in part, by inhibiting colonic iNOS overexpression via NF-kappaB pathway. Our data indicates that bromelain may benefit patients with postoperative ileus.

  20. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarity with FLSs from other plant species. Using quantitative real-time PCR and high-performance liquid chromatography (HPLC), the expression of FtFLS1/2 and the production of 3 main flavonols (kaempferol, myricetin and quercetin) was detected in roots, leaves, stems, flowers and different stages of developing seeds. The relationship between the expression of the 2 FLS genes and the accumulation of the 3 basic flavonols was analyzed in 2 tartary buckwheat cultivars. FtFLS1 and FtFLS2 exhibited differential transcriptional levels between the tartary buckwheat cultivars 'Hokkai T10' and 'Hokkai T8'. Generally, higher transcript levels of FtFLS1 and FtFLS2 and a higher amount of flavonols were observed in the 'Hokkai T10' cultivar than 'Hokkai T8'. The content of flavonols showed tissue-specific accumulation between the 2 cultivars. The transcription of FtFLS1 was inhibited by the exogenous application of abscisic acid (ABA), salicylic acid (SA) and sodium chloride (NaCl), while FtFLS2 was not affected by ABA but up-regulated by SA and NaCl. These data indicate that the 2 FtFLS isoforms of buckwheat have different functions in the response of buckwheat to environmental stress.

  1. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    PubMed

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  2. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  3. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    PubMed

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae.

  4. Involvement of multiple phytoene synthase genes in tissue- and cultivar-specific accumulation of carotenoids in loquat.

    PubMed

    Fu, Xiumin; Feng, Chao; Wang, Chunyan; Yin, Xueren; Lu, Pengjun; Grierson, Don; Xu, Changjie; Chen, Kunsong

    2014-08-01

    Differences in carotenoid accumulation between tissues and cultivars is common in plants. White-fleshed loquat cultivars had low levels of carotenoids in the flesh, but accumulated carotenoids in peel when ripe, and the leaves accumulated similar carotenoids to those in the red-fleshed loquat cultivars. The catalytic activity and expression patterns of four phytoene synthase (PSY) genes, EjPSY1, EjPSY2A, EjPSY2B, and EjPSY3, were analysed to understand their roles in different loquat (Eriobotrya japonica Lindl.) types. EjPSY1 was responsible for carotenoid synthesis in the fruit peel but not the flesh, whereas EjPSY2A was responsible for carotenoid accumulation in flesh of ripening fruit. A mutant EjPSY2A (d) , with the same tissue specificity and expression level as EjPSY2A, but lacking the C-terminal region and corresponding catalytic activity, was discovered in white-fleshed varieties, explaining the lack of carotenoids in the white flesh. The catalytic role of EjPSY2B was most significant in leaves. The tissue-specific expression of EjPSY1 and EjPSY2B explained well how peel and leaf tissues can still accumulate carotenoids in white-fleshed cultivars, which have lost the functional EjPSY2A. EjPSY3 mRNA abundance was ~1000-fold less than that of other PSY mRNAs in all tissues examined. In addition, neither the normal sized transcript nor two alternatively spliced forms, EjPSY3α in LYQ and EjPSY3β in BS cultivars, encoded functional enzymes, and it is concluded that EjPSY3 plays no role in carotenoid accumulation. In addition, it was noted that recruitment of PSY genes for expression in specific tissues of different plants has occurred independently of gene structure and evolutionary origin.

  5. Polymorphisms in endothelial nitric oxide synthase gene in early and late severe preeclampsia.

    PubMed

    Alpoim, Patrícia Nessralla; Gomes, Karina Braga; Pinheiro, Melina de Barros; Godoi, Lara Carvalho; Jardim, Letícia Lemos; Muniz, Ludmila Gomes; Sandrim, Valéria C; Fernandes, Ana Paula; Dusse, Luci Maria S

    2014-11-15

    Preeclampsia (PE) is characterized by hypertension and proteinuria, occurring after the 20th week of pregnancy in women who have had no previous symptoms. The disease progresses with generalized vasoconstriction and endothelial dysfunction. Clinically, it is important to diagnose the severe form of the disease (sPE), in which blood pressure and proteinuria are much higher. Recently, the gestational age (GA) of the onset of PE has led to the classification of this disease as early (GA <34 weeks) and late (GA ≥34 weeks). Several genetic polymorphisms affecting endothelial nitric oxide synthase (eNOS) levels or function were described, including G894T (Glu298Asp), VNTR b/a (variable-number 27-bp tandem repeat) and T-786C (promoter) polymorphisms. Thus, the aim of this study was to compare the distribution of G894T, VNTR b/a and T-786C polymorphisms and their haplotypes in Brazilian early and late sPE, as well as in normotensive pregnant. A total of 201 women were evaluated, 53 with early sPE, 45 with late sPE and 103 as normotensive pregnant women. The frequency of 894T allele was higher in late sPE vs normotensive pregnant, and 894TT genotype was higher in late sPE vs early sPE and normotensive pregnant. For VNTR b/a polymorphism, higher frequencies of aa genotype and a allele were observed in early sPE vs late sPE and normotensive pregnant. Besides, the frequency of haplotype T-b-C was higher in late sPE vs early sPE and normotensive pregnant. Considering the results found for eNOS polymorphisms, it is possible to suggest that the functional alterations induced by these two polymorphisms may influence the time of severe PE onset, although both alterations are putatively associated with low NO bioavailability. However, other studies are necessary to validate these findings and clarify this issue. PMID:25106888

  6. Versatile enzyme expression and characterization system for Aspergillus nidulans, with the Penicillium brevicompactum polyketide synthase gene from the mycophenolic acid gene cluster as a test case.

    PubMed

    Hansen, Bjarne G; Salomonsen, Bo; Nielsen, Morten T; Nielsen, Jakob B; Hansen, Niels B; Nielsen, Kristian F; Regueira, Torsten B; Nielsen, Jens; Patil, Kiran R; Mortensen, Uffe H

    2011-05-01

    Assigning functions to newly discovered genes constitutes one of the major challenges en route to fully exploiting the data becoming available from the genome sequencing initiatives. Heterologous expression in an appropriate host is central in functional genomics studies. In this context, filamentous fungi offer many advantages over bacterial and yeast systems. To facilitate the use of filamentous fungi in functional genomics, we present a versatile cloning system that allows a gene of interest to be expressed from a defined genomic location of Aspergillus nidulans. By a single USER cloning step, genes are easily inserted into a combined targeting-expression cassette ready for rapid integration and analysis. The system comprises a vector set that allows genes to be expressed either from the constitutive PgpdA promoter or from the inducible PalcA promoter. Moreover, by using the vector set, protein variants can easily be made and expressed from the same locus, which is mandatory for proper comparative analyses. Lastly, all individual elements of the vectors can easily be substituted for other similar elements, ensuring the flexibility of the system. We have demonstrated the potential of the system by transferring the 7,745-bp large mpaC gene from Penicillium brevicompactum to A. nidulans. In parallel, we produced defined mutant derivatives of mpaC, and the combined analysis of A. nidulans strains expressing mpaC or mutated mpaC genes unequivocally demonstrated that mpaC indeed encodes a polyketide synthase that produces the first intermediate in the production of the medically important immunosuppressant mycophenolic acid. PMID:21398493

  7. Lycopene cyclase and phytoene synthase activities in the marine yeast Rhodosporidium diobovatum are encoded by a single gene crtYB.

    PubMed

    Guo, Wenjing; Tang, Hui; Zhang, Liping

    2014-10-01

    crtYB, encoding lycopene cyclase and phytoene synthase was cloned from Rhodosporidium diobovatum ATCC 2527 by rapid amplification of cDNA ends method. The full-length cDNA of crtYB is 2, 330 bp and contains eight introns. The gene products is a 594 amino acids, with a predicted molecular mass of 65.63 kDa and a pI of 6.73. The N-terminus of the protein contains six transmembrane regions, which has been characterized as a lycopene beta-cyclase. The C-terminal half has squalene and phytoene synthase signatures that identified as phytoene synthetase. By heterologous complementary detection of this gene in E. coli and HPLC analysis, the regions responsible for phytoene synthesis and lycopene cyclization were localized within the protein.

  8. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  9. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars.

    PubMed

    Chizzali, Cornelia; Swiddan, Asya K; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in 'Harrow Sweet', while only PcBIS2 transcripts were detected in 'Alexander Lucas' and 'Conference'. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of 'Harrow Sweet', whereas the concentrations were ten times lower in 'Conference' and not even detectable in 'Alexander Lucas'. In 'Harrow Sweet', the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of 'Alexander Lucas' and 'Conference' advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  10. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana

    PubMed Central

    Liu, Degao; Patil, Gunvant B.; Zhai, Hong; Wang, Feibing; Stephenson, Troy J.; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T.; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  11. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    PubMed

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest. PMID:26228353

  12. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  13. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity.

    PubMed

    Zaragoza, O; Blazquez, M A; Gancedo, C

    1998-08-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30 degreesC was indistinguishable from that of the wild type. However, at 42 degreesC it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37 degreesC, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42 degreesC, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 10(6) CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation.

  14. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    PubMed Central

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  15. Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum.

    PubMed

    Tijerino, Anamariela; Cardoza, R Elena; Moraga, Javier; Malmierca, Mónica G; Vicente, Francisca; Aleu, Josefina; Collado, Isidro G; Gutiérrez, Santiago; Monte, Enrique; Hermosa, Rosa

    2011-03-01

    Trichoderma brevicompactum produces trichodermin, a simple trichothecene-type toxin that shares the first steps of the sesquiterpene biosynthetic pathway with other phytotoxic trichothecenes from Fusarium spp. Trichodiene synthase catalyses the conversion of farnesyl pyrophosphate to trichodiene and it is encoded by the tri5 gene that was cloned and analysed functionally by homologous overexpression in T. brevicompactum. tri5 expression was up-regulated in media with glucose, H(2)O(2) or glycerol. tri5 repression was observed in cultures supplemented with the antioxidants ferulic acid and tyrosol. Acetone extracts of tri5-overexpressing transformants displayed higher antifungal activity than those from the wild-type. Chromatographic and spectroscopic analyses revealed that tri5 overexpression led to an increased production of trichodermin and tyrosol. Agar diffusion assays with these two purified metabolites from the tri5-overexpressing transformant T. brevicompactum Tb41tri5 showed that only trichodermin had antifungal activity against Saccharomyces cerevisiae, Kluyveromyces marxianus, Candida albicans, Candida glabrata, Candida tropicalis and Aspergillus fumigatus, in most cases such activity being higher than that observed for amphotericin B and hygromycin. Our results point to the significant role of tri5 in the production of trichodermin and in the antifungal activity of T. brevicompactum. PMID:21145409

  16. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    PubMed

    Chen, Wei; He, Shaozhen; Liu, Degao; Patil, Gunvant B; Zhai, Hong; Wang, Feibing; Stephenson, Troy J; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  17. Functional analysis of the gene encoding the clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in Streptomyces clavuligerus.

    PubMed Central

    Paradkar, A S; Jensen, S E

    1995-01-01

    A Streptomyces clavuligerus mutant disrupted in cas2, encoding the clavaminate synthase (CAS2) isoenzyme, was constructed by a gene replacement procedure. The resulting cas2 mutant showed no clavulanic acid production when grown in starch-asparagine medium. However, in soy medium, the cas2 mutant did produce clavulanic acid, although in amounts less than those produced by wild-type cultures. This medium-dependent leaky phenotype correlated well with the presence of the cas1 transcript, encoding the CAS1 isoenzyme, in cultures grown in soy medium and with its absence from those grown in starch-asparagine medium. This suggested that CAS1 and CAS2 both contribute to clavulanic acid production but that their production is regulated differently. Under nutritional conditions in which cas1 expression is blocked, cas2 becomes essential for clavulanic acid production. Northern (RNA) analysis revealed that while cas1 is transcribed as a 1.4-kb monocistronic transcript only, cas2 is transcribed both as a 1.2-kb monocistronic transcript and as part of a 5.3-kb polycistronic transcript. High-resolution S1 nuclease analysis located the transcription start point of the monocistronic cas2 transcript at a C residue 103 nucleotides upstream from the cas2 start codon. PMID:7868606

  18. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    PubMed Central

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  19. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family.

    PubMed

    Houston, Kelly; Burton, Rachel A; Sznajder, Beata; Rafalski, Antoni J; Dhugga, Kanwarpal S; Mather, Diane E; Taylor, Jillian; Steffenson, Brian J; Waugh, Robbie; Fincher, Geoffrey B

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two--rowed and 288 six--rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with cellulose synthase A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the genes that

  20. Endothelial nitric oxide synthase gene polymorphisms and the risk of hypertension in an Indian population.

    PubMed

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2014-01-01

    Genetic variants of eNOS gene play a significant role in the pathogenesis of hypertension. Many environmental factors have, also, been implicated in the aetiology of hypertension. We carried out an age-matched case-control study among adults. Hypertension was defined according to JNC-VII criteria and eNOS gene polymorphisms were determined by PCR and PCR followed by PCR-RFLP. eNOS intron 4 aa genotype (adjusted OR 6.81; 95% CI 2.29-20.25) and eNOS 894TT genotype (adjusted OR 7.84; 95% CI 2.57-23.96) were associated with the risk of hypertension. Tobacco users (either smoking/chewing or both) with eNOS intron 4 aa genotype (OR 14.00: 95% CI 1.20-163.37), eNOS 894GG genotype (OR 5.56: 95% CI 3.72-8.31), and eNOS T-786C CC genotype (OR 9.00: 95% CI 1.14-71.04) were at an increased risk of hypertension. Similarly a significant gene-environment interaction was observed between individuals consuming alcohol with eNOS intron 4 aa genotype (OR 12.00: 95% CI 1.20-143.73) and eNOS 894GG genotype (OR 1.95: 95% CI 1.35-2.81). The present study identified few susceptible genotypes of the eNOS gene with the risk of hypertension. Moreover, the interactive effects between the environmental factors and the risk of hypertension were dependent on the eNOS genotypes. PMID:25165716

  1. Divergent properties and phylogeny of cyanobacterial 5-enol-pyruvyl-shikimate-3-phosphate synthases: evidence for horizontal gene transfer in the Nostocales.

    PubMed

    Forlani, Giuseppe; Bertazzini, Michele; Barillaro, Donatella; Rippka, Rosmarie

    2015-01-01

    As it represents the target of the successful herbicide glyphosate, great attention has been paid to the shikimate pathway enzyme 5-enol-pyruvyl-shikimate-3-phosphate (EPSP) synthase. However, inconsistent results have been reported concerning the sensitivity of the enzyme from cyanobacteria, and consequent inhibitory effects on cyanobacterial growth. The properties of EPSP synthase were investigated in a set of 42 strains representative of the large morphological diversity of these prokaryotes. Publicly available protein sequences were analyzed, and related to enzymatic features. In most cases, the native protein showed an unusual homodimeric composition and a general sensitivity to micromolar doses of glyphosate. By contrast, eight out of 15 Nostocales strains were found to possess a monomeric EPSP synthase, whose activity was inhibited only at concentrations exceeding 1 mM. Sequence analysis showed that these two forms are only distantly related, the latter clustering separately in a clade composed of diverse bacterial phyla. The results are consistent with the occurrence of a horizontal gene transfer event involving an evolutionarily distant organism. Moreover, data suggest that the existence of class I (glyphosate-sensitive) and class II (glyphosate-tolerant) EPSP synthases representing two distinct phylogenetic clades is an oversimplification because of the limited number of analyzed samples. PMID:25229999

  2. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    PubMed

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  3. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    PubMed

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid.

  4. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers.

  5. Large-Scale Phylogenetic Classification of Fungal Chitin Synthases and Identification of a Putative Cell-Wall Metabolism Gene Cluster in Aspergillus Genomes

    PubMed Central

    Pacheco-Arjona, Jose Ramon; Ramirez-Prado, Jorge Humberto

    2014-01-01

    The cell wall is a protective and versatile structure distributed in all fungi. The component responsible for its rigidity is chitin, a product of chitin synthase (Chsp) enzymes. There are seven classes of chitin synthase genes (CHS) and the amount and type encoded in fungal genomes varies considerably from one species to another. Previous Chsp sequence analyses focused on their study as individual units, regardless of genomic context. The identification of blocks of conserved genes between genomes can provide important clues about the interactions and localization of chitin synthases. On the present study, we carried out an in silico search of all putative Chsp encoded in 54 full fungal genomes, encompassing 21 orders from five phyla. Phylogenetic studies of these Chsp were able to confidently classify 347 out of the 369 Chsp identified (94%). Patterns in the distribution of Chsp related to taxonomy were identified, the most prominent being related to the type of fungal growth. More importantly, a synteny analysis for genomic blocks centered on class IV Chsp (the most abundant and widely distributed Chsp class) identified a putative cell wall metabolism gene cluster in members of the genus Aspergillus, the first such association reported for any fungal genome. PMID:25148134

  6. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    PubMed Central

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  7. Variants of endothelial nitric oxide synthase gene are associated with components of metabolic syndrome in an Arab population.

    PubMed

    Alkharfy, Khalid M; Al-Daghri, Nasser M; Al-Attas, Omar S; Alokail, Majed S; Mohammed, Abdul Khader; Vinodson, Benjamin; Clerici, Mario; Kazmi, Usamah; Hussain, Tajamul; Draz, Hossam M

    2012-01-01

    Genetics plays a crucial role in the development of metabolic syndrome (MetS). Here we examined the association between endothelial nitric oxide synthase (eNOS) gene polymorphisms and MetS in a Saudi Arabian cohort to extend the understanding of the genetic basis of MetS in diverse ethnic populations. Anthropometric, clinical and biochemical parameters as well as genotyping for 894G>T, -786T>C variants of eNOS gene by PCR-RFLP and 4a/b by direct PCR were performed in 886 Saudi Arabians (477 MetS and 409 Non-MetS). The genotype distribution (TT, p=0.001; TC, p=0.001; TC+CC, p=0.001) and allele (T, p=0.007; C, p=0.007) frequency of the -786T>C SNP were significantly different between Non-MetS and MetS subjects which remained significant after Bonferroni correction. Moreover: 1) the GT and GT+TT genotypes of the 894G>T SNP were associated with elevated blood pressure (p=0.017, and p=0.022, respectively); 2) the ab variant of 4a/b polymorphism was associated with decreased HDL levels (p= 0.044); and 3) the TC+CC genotype and C allele of the -786T>C SNP were associated with increased fasting glucose levels (p=0.039, and p=0.028, respectively). Also, G-a-C was identified as the risk haplotype for MetS susceptibility (p=0.034). The results suggest a significant association of 894G>T, 4a/b and -786T>C polymorphisms with MetS and its components is present in an Arab population. A genetic predisposition to develop abnormal metabolic phenotypes, consistent with an increased prevalence of metabolic phenotypes can be detected in this ethnic group.

  8. Physiological roles of trehalose in Leptinotarsa larvae revealed by RNA interference of trehalose-6-phosphate synthase and trehalase genes.

    PubMed

    Shi, Ji-Feng; Xu, Qing-Yu; Sun, Qiang-Kun; Meng, Qing-Wei; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-10-01

    Trehalose is proposed to serve multiple physiological roles in insects. However, its importance remains largely unconfirmed. In the present paper, we knocked down either a trehalose biosynthesis gene (trehalose-6-phosphate synthase, LdTPS) or each of three degradation genes (soluble trehalases LdTRE1a, LdTRE1b or membrane-bound LdTRE2) in Leptinotarsa decemlineata by RNA interference (RNAi). Knockdown of LdTPS decreased trehalose content and caused larval and pupal lethality. The LdTPS RNAi survivors consumed a greater amount of foliage, obtained a heavier body mass, accumulated more glycogen, lipid and proline, and had a smaller amount of chitin compared with the controls. Ingestion of trehalose but not glucose rescued the food consumption increase and larval mass rise, increased survivorship, and recovered glycogen, lipid and chitin to the normal levels. In contrast, silencing of LdTRE1a increased trehalose content and resulted in larval and pupal lethality. The surviving LdTRE1a RNAi hypomorphs fed a smaller quantity of food, had a lighter body weight, depleted lipid and several glucogenic amino acids, and contained a smaller amount of chitin. Neither trehalose nor glucose ingestion rescued these LdTRE1a RNAi defects. Silencing of LdTRE1b caused little effects. Knockdown of LdTRE2 caused larval death, increased trehalose contents in several tissues and diminished glycogen in the brain-corpora cardiaca-corpora allata complex (BCC). Feeding glucose but not trehalose partially rescued the high mortality rate and recovered glycogen content in the BCC. It seems that trehalose is involved in feeding regulation, sugar absorption, brain energy supply and chitin biosynthesis in L. decemlineata larvae. PMID:27524277

  9. A type-B response regulator drives the expression of the hydroxymethylbutenyl diphosphate synthase gene in periwinkle.

    PubMed

    Ginis, Olivia; Oudin, Audrey; Guirimand, Grégory; Chebbi, Mouadh; Courdavault, Vincent; Glévarec, Gaëlle; Papon, Nicolas; Crèche, Joel; Courtois, Martine

    2012-10-15

    In plant cytokinin (CK) signaling, type-B response regulators (RRs) act as major players in orchestrating the transcriptome changes in response to CK. However, their direct targets are poorly known. The identification of putative type-ARR1 motifs located within the promoter of the CK-responsive hydroxyl methyl butenyl diphosphate synthase (HDS) gene from the methyl erythritol phosphate (MEP) pathway prompted us to investigate the ability of a previously isolated periwinkle type-B RR (CrRR5) that presents high homologies with ARR1 to interact with the promoter. Electrophoretic mobility shift assays (EMSAs) demonstrated that the CrRR5 DNA-binding domain binds specifically type-ARR1 motifs within the HDS promoter. We also established through yellow fluorescent protein (YFP) imaging the targeting of CrRR5 into cell nucleus in accordance with its putative function of transcription factor. In transient assays performed on periwinkle cells cultivated with CK, overexpression of the full-length CrRR5 or a truncated CrRR5 engineering a constitutive active form (35S:ΔDDK) did not affect the HDS promoter activity that reached a threshold. By contrast, in absence of CK, overexpression of CrRR5ΔDDK enhanced promoter activity up to the threshold level observed in cells grown with CK. Our results strongly suggest that CrRR5 directly transactivates the HDS promoter. CrRR5 is the first identified transcription factor mediating the CK signaling that targets a gene from the MEP pathway involved in isoprenoid metabolism. Moreover, CrRR5 could play a role in a regulatory mechanism controlling CK homeostasis in periwinkle cells.

  10. Overexpression of a potato sucrose synthase gene in cotton accelerates leaf expansion, reduces seed abortion, and enhances fiber production.

    PubMed

    Xu, Shou-Min; Brill, Elizabeth; Llewellyn, Danny J; Furbank, Robert T; Ruan, Yong-Ling

    2012-03-01

    Sucrose synthase (Sus) is a key enzyme in the breakdown of sucrose and is considered a biochemical marker for sink strength, especially in crop species, based on mutational and gene suppression studies. It remains elusive, however, whether, or to what extent, increase in Sus activity may enhance sink development. We aimed to address this question by expressing a potato Sus gene in cotton where Sus expression has been previously shown to be critical for normal seed and fiber development. Segregation analyses at T1 generation followed by studies in homozygous progeny lines revealed that increased Sus activity in cotton (1) enhanced leaf expansion with the effect evident from young leaves emerging from shoot apex; (2) improved early seed development, which reduced seed abortion, hence enhanced seed set, and (3) promoted fiber elongation. In young leaves of Sus overexpressing lines, fructose concentrations were significantly increased whereas, in elongating fibers, both fructose and glucose levels were increased. Since hexoses contribute little to osmolality in leaves, in contrast to developing fibers, it is concluded that high Sus activity promotes leaf development independently of osmotic regulation, probably through sugar signaling. The analyses also showed that doubling the Sus activity in 0-d cotton seeds increased their fresh weight by about 30%. However, further increase in Sus activity did not lead to any further increase in seed weight, indicating an upper limit for the Sus overexpression effect. Finally, based on the observed additive effect on fiber yield from increased fiber length and seed number, a new strategy is proposed to increase cotton fiber yield by improving seed development as a whole, rather than solely focusing on manipulating fiber growth.

  11. A new quantitative PCR method for the detection of Anaplasma platys in dogs based on the citrate synthase gene.

    PubMed

    da Silva, Claudia B; Pires, Marcus S; Vilela, Joice A R; Peckle, Maristela; da Costa, Renata L; Vitari, Gabriela L V; Santos, Leandro A; Santos, Huarrisson A; Massard, Carlos L

    2016-09-01

    Anaplasma platys is an obligate intracellular bacterium that primarily affects dogs, but it can also infect humans. Our study aimed to standardize a quantitative real-time (q)PCR method using the citrate synthase gene (gltA) as a specific target for A. platys detection in naturally infected dogs. Primers (gltA84F and gltA84R) and probe (PLATYSp) were designed to amplify an 84-bp fragment based on the gltA gene sequences of A. platys available in GenBank. A total of 186 dog blood samples originating from the Brazilian state of Rio de Janeiro were tested by qPCR. Additionally, the same samples were tested by cytology and a nested (n)PCR that targeted the 16S ribosomal DNA to determine the performance of our qPCR method compared to these existing techniques. Among the samples tested with qPCR, 17.2% were considered positive, significantly more than detected by nPCR (14.0%). Under optical microscopy, inclusions were observed in platelets of 25.3% of the samples, and among these samples, only 33.9% were identified as positive for A. platys using qPCR. The qPCR technique proved to be more specific than cytology and to have superior sensitivity to nPCR for detecting A. platys in dogs. The development of this new qPCR method contributes to the advancement of research involving A. platys Furthermore, it can be used to quantify the presence of this bacterium to evaluate the treatment of infected animals, or even as a more sensitive and specific tool for situations indicating possible clinical disease but with negative cytology. PMID:27423737

  12. Endothelial nitric oxide synthase, angiotensin-converting enzyme and angiotensinogen gene polymorphisms in hypertensive disorders of pregnancy.

    PubMed

    Aggarwal, Pardeep Kumar; Jain, Vanita; Jha, Vivekanand

    2010-05-01

    We investigated the variations in genes encoding endothelial nitric oxide synthase (NOS3), angiotensin-converting enzyme (ACE) and angiotensinogen (AGT) in hypertensive disorders of pregnancy and the relationship between the polymorphisms and circulating nitric oxide (NO) and ACE levels in pregnant north Indian women. Frequencies of NOS3 G894T, 4b/a and T(-786) --> C, AGT T704C and ACE ins/del polymorphisms were studied in 342 subjects: 120 with preeclampsia (PE), 104 with gestational hypertension and 118 normotensive pregnant women. Variations were evaluated by polymerase chain reaction-restriction fragment length polymorphism. NO and ACE levels were determined using ELISA. There was no difference in the distribution of individual NOS3 and ACE polymorphisms in the study groups. Haplotype analysis showed a global difference in the NOS3 haplotype distribution between the PE and non-PE subjects (P=0.03). The presence of AGT 704C allele was associated with a reduced risk of developing PE (odds ratio: 0.33, 95% CI: 0.19-0.59 in recessive mode). Circulating total NO and ACE levels were similar in three groups. No relationship was found between circulating NO levels and any of the NOS3 polymorphisms, but the circulating ACE levels were higher in those with DD genotype (P<0.05). In conclusion, there was no association between individual NOS3 and the ACE gene polymorphisms and hypertensive disorders of pregnancy in north Indian women. The presence of minor alleles at all the three sites in NOS3 seemed to increase the risk of PE, and AGT 704C allele was associated with a reduced PE risk. The complexity of interaction between these genetic abnormalities requires further studies. PMID:20186148

  13. Mutations in the human CYP11B2 (aldosterone synthase) gene causing corticosterone methyloxidase II deficiency.

    PubMed Central

    Pascoe, L; Curnow, K M; Slutsker, L; Rösler, A; White, P C

    1992-01-01

    Corticosterone methyloxidase II (CMO-II) deficiency is an autosomal recessive disorder of aldosterone biosynthesis, characterized by an elevated ratio of 18-hydroxycorticosterone to aldosterone in serum. It is genetically linked to the CYP11B1 and CYP11B2 genes that, respectively, encode two cytochrome P450 isozymes, P450XIB1 and P450XIB2. Whereas P450XIB1 only catalyzes hydroxylation at position 11 beta of 11-deoxycorticosterone and 11-deoxycortisol, P450XIB2 catalyzes the synthesis of aldosterone from deoxycorticosterone, a process that successively requires hydroxylation at positions 11 beta and 18 and oxidation at position 18. To determine the molecular genetic basis of CMO-II deficiency, seven kindreds of Iranian-Jewish origin were studied in which members suffered from CMO-II deficiency. No mutations were found in the CYP11B1 genes, but two candidate mutations, R181W and V386A, were found in the CYP11B2 genes. When these mutations were individually introduced into CYP11B2 cDNA and expressed in cultured cells, R181W reduced 18-hydroxylase and abolished 18-oxidase activities but left 11 beta-hydroxylase activity intact, whereas V386A caused a small but consistent reduction in the production of 18-hydroxycorticosterone. All individuals affected with CMO-II deficiency were homozygous for both mutations, whereas eight asymptomatic subjects were homozygous for R181W alone and three were homozygous for V386A alone. These findings confirm that P450XIB2 is the major enzyme mediating oxidation at position 18 in the adrenal and suggest that a small amount of residual activity undetectable in in vitro assays is sufficient to synthesize normal amounts of aldosterone. Images PMID:1594605

  14. Localization of the human gene for inducible nitric oxide synthase (NOS2) to chromosome 17q11. 2-q12

    SciTech Connect

    Marsden, P.A.; Hall, A.V. ); Heng, H.Q.; Duff, C.L.; Shi, X.M.; Tsui, L.C. Hospital for Sick Children, Toronto )

    1994-01-01

    Nitric oxide (NO) is a simple molecule implicated in neuronal transmission, endothelium-dependent vasodilatation, and macrophage immunologic activation. Enzymes responsible for NO synthesis constitute a family with at least three distinct isoforms - neuronal (NOS1), endothelial (NOS3), and inducible tissue. NO synthase enzymatic activity is constitutively expressed but activation of the calcium/calmodulin signaling pathway is required for maximal activity. Constitutive NO synthases contrast with a pathway for NO synthesis evident in macrophages, Kupffer cells, hepatocytes, vascular smooth muscle, and mesangial cells, among others. NO synthase activity is induced in these cell types by cytokines or bacterial wall products over a period of many hours. 14 refs., 1 fig.

  15. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria

    PubMed Central

    Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10–15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  16. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria.

    PubMed

    Peng, Yun-Feng; Chen, Wen-Chao; Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10-15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  17. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    PubMed

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  18. ACC forum looks at 'burning' questions

    SciTech Connect

    Carter, R.

    2005-06-01

    The American Coal Council's (ACC) Spring Coal Forum had as its theme: Coal's renaissance: prospects for regenerating coal generation'. It explored US coal demand, supply, end-user technology and market trends. The article gives an overview of the conference, highlighting several presentations. 2 figs., 1 tab.

  19. Potential for Quantifying Expression of the Geobacteraceae Citrate Synthase Gene To Assess the Activity of Geobacteraceae in the Subsurface and on Current-Harvesting Electrodes

    PubMed Central

    Holmes, Dawn E.; Nevin, Kelly P.; O'Neil, Regina A.; Ward, Joy E.; Adams, Lorrie A.; Woodard, Trevor L.; Vrionis, Helen A.; Lovley, Derek R.

    2005-01-01

    The Geobacteraceae citrate synthase is phylogenetically distinct from those of other prokaryotes and is a key enzyme in the central metabolism of Geobacteraceae. Therefore, the potential for using levels of citrate synthase mRNA to estimate rates of Geobacter metabolism was evaluated in pure culture studies and in four different Geobacteraceae-dominated environments. Quantitative reverse transcription-PCR studies with mRNA extracted from cultures of Geobacter sulfurreducens grown in chemostats with Fe(III) as the electron acceptor or in batch with electrodes as the electron acceptor indicated that transcript levels of the citrate synthase gene, gltA, increased with increased rates of growth/Fe(III) reduction or current production, whereas the expression of the constitutively expressed housekeeping genes recA, rpoD, and proC remained relatively constant. Analysis of mRNA extracted from groundwater collected from a U(VI)-contaminated site undergoing in situ uranium bioremediation revealed a remarkable correspondence between acetate levels in the groundwater and levels of transcripts of gltA. The expression of gltA was also significantly greater in RNA extracted from groundwater beneath a highway runoff recharge pool that was exposed to calcium magnesium acetate in June, when acetate concentrations were high, than in October, when the levels had significantly decreased. It was also possible to detect gltA transcripts on current-harvesting anodes deployed in freshwater sediments. These results suggest that it is possible to monitor the in situ metabolic rate of Geobacteraceae by tracking the expression of the citrate synthase gene. PMID:16269721

  20. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  1. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    PubMed

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  2. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    PubMed Central

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  3. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    PubMed

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure.

  4. A multi-gene phylogeny for Stachybotrys evidences lack of trichodiene synthase (tri5) gene for isolates of one of three intrageneric lineages.

    PubMed

    Koster, Brenda; Wong, Bess; Straus, Neil; Malloch, David

    2009-08-01

    Members of the mitosporic fungal form-genus Stachybotrys, including common indoor contaminants Stachybotrys chartarum, Stachybotrys echinata and Stachybotrys chlorohalonata, are capable of producing potent, protein synthesis-inhibiting, trichothecene mycotoxins. A combined multi-gene approach was used to investigate relationships among species of Stachybotrys against which the presence/absence of the trichothecene biosynthetic pathway gene, trichodiene synthase (tri5), was evaluated. Phylogenetic analyses partitioned species of Stachybotrys into three strongly supported lineages, two of which contained common indoor taxa. No tri5 PCR product was amplified from members of the third clade, which included the only member of the group with a known sexual state, Stachybotrys albipes. Isolates grouped with S. albipes also tested negative for tri5 in Southern analyses. The phylogenetic distribution of tri5 was consistent with known toxin production for the group. For isolates with tri5 product, Bayesian analysis suggested that signal from amino acid determining sites conflicted with the combined phylogeny. Incongruence however, was not supported by either SH-test results or maximum likelihood analyses. Moreover, sites rates analysis showed that tri5 was highly conserved at the amino acid level suggesting that identity at variable sites, among otherwise divergent taxa, might be the result of chance events. PMID:19422915

  5. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia.

    PubMed

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu

    2011-11-01

    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias.

  6. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia.

    PubMed

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu

    2011-11-01

    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias. PMID:21688014

  7. Characterization of ACC deaminase from the biocontrol and plant growth-promoting agent Trichoderma asperellum T203.

    PubMed

    Viterbo, Ada; Landau, Udi; Kim, Sofia; Chernin, Leonid; Chet, Ilan

    2010-04-01

    1-aminocyclopropane-1-carboxylate (ACC) deaminase activity was evaluated in the biocontrol and plant growth-promoting fungus Trichoderma asperellum T203. Fungal cultures grown with ACC as the sole nitrogen source showed high enzymatic activity. The enzyme encoding gene (Tas-acdS) was isolated, and an average 3.5-fold induction of the gene by 3 mM ACC was detected by real-time PCR. Escherichia coli bacteria carrying the intron-free cDNA of Tas-acdS cloned into the vector pAlter-EX1 under the control of the tac promoter revealed specific ACC deaminase (ACCD) activity and the ability to promote canola (Brassica napus) root elongation in pouch assays. RNAi silencing of the ACCD gene in T. asperellum showed decreased ability of the mutants to promote root elongation of canola seedlings. These data suggest a role for ACCD in the plant root growth-promotion effect by T. asperellum.

  8. The female-specific Cs-ACS1G gene of cucumber. A case of gene duplication and recombination between the non-sex-specific 1-aminocyclopropane-1-carboxylate synthase gene and a branched-chain amino acid transaminase gene.

    PubMed

    Knopf, Ronit Rimon; Trebitsh, Tova

    2006-09-01

    Cucumber (Cucumis sativus L.) is a monoecious plant in which female sex expression (gynoecy) is controlled by the Female (F) locus that can be modified by other sex-determining genes as well as by environmental and hormonal factors. As in many other cucurbits, ethylene is the major plant hormone regulating female sex expression. Previously we isolated the Cs-ACS1 (ACS, 1-aminocyclopropane-1-carboxylate synthase) gene that encodes the rate-limiting enzyme in the ethylene biosynthetic pathway. We proposed that Cs-ACS1 is present in a single copy in monoecious (ffMM) plants whereas gynoecious plants (FFMM) contain an additional copy Cs-ACS1G that was mapped to the F locus. To study the origin of Cs-ACS1G, we cloned and analyzed both the gynoecious-specific Cs-ACS1G gene and the non-sex-specific Cs-ACS1 gene. Our results indicate that Cs-ACS1G is the result of a relatively recent gene duplication and recombination, between Cs-ACS1 and a branched-chain amino acid transaminase (BCAT) gene. Taking into consideration that the Cs-ACS1G gene was mapped to the F locus, we propose that this duplication event gave rise to the F locus and to gynoecious cucumber plants. Computer analysis of the 1 kb region upstream of the transcription initiation site revealed several putative cis-acting regulatory elements that can potentially confer the responsiveness of Cs-ACS1G to developmental and hormonal factors and thereby control female sex determination in cucumber. These findings lead us to a model explaining the action of Cs-ACS1 and Cs-ACS1G in cucumber floral sex determination. PMID:16887844

  9. Engineering the robustness of Saccharomyces cerevisiae by introducing bifunctional glutathione synthase gene.

    PubMed

    Qiu, Zhiqi; Deng, Zujun; Tan, Hongming; Zhou, Shining; Cao, Lixiang

    2015-04-01

    Robust, high-yielding Saccharomyces cerevisiae is highly desirable for cost-effective cellulosic ethanol production. In this study, the bifunctional glutathione (GSH) synthetase genes GCSGS at high copy number was integrated into ribosomal DNA of S. cerevisiae by Cre-LoxP system. Threefold higher GSH contents (54.9 μmol/g dry weight) accumulated in the engineered strain BY-G compared to the reference strain. Tolerance of BY-G to H2O2 (3 mM), temperature (40 °C), furfural (10 mM), hydroxymethylfurfural (HMF, 10 mM) and 0.5 mM Cd(2+) increased compared to reference strain. Twofold higher ethanol concentration was obtained by BY-G in simultaneous saccharification and fermentation of corn stover compared to the reference strain. The results showed that intracellular GSH content of S. cerevisiae has an influence on robustness. The strategy is used to engineer S. cerevisiae strains adaptive to a combination of tolerance to inhibitors and raised temperature that may occur in high solid simultaneous saccharification and fermentation of lignocellulosic feedstocks. PMID:25561319

  10. Environment effect on fruit ripening related gene to develop a new post harvest technology

    NASA Astrophysics Data System (ADS)

    Dwivany, Fenny; Esyanti, Rizkita Rahmi; Robertlee, Jekson; Paramaputra, Indra Chandra; Permatadewi, Rinda Kania; Tambun, Dina Hermawaty; Handayani, Resnanti Utami; Pratiwi, Aksarani'Sa; Zaskia, Herafi

    2014-03-01

    Ripening process of fruits is a very complex process, which involves ethylene production, causing alteration on molecular and physiology level. Environmental stress caused by biotic and abiotic stress conditions (such as pathogen, mechanical stress, physical and physiology stress) can stimulate ethylene production. High levels of ethylene in turn can also inhibit growth, cause premature ripening and induce the onset of senescence, which then potentially reduce plant productivity. The ACC Synthase (ACS) and ACC Oxidase (ACO) genes are genes that have role in the ethylene production. By regulating those genes, especially ethylene biosynthesis genes, we might improve the quality of fruit at post harvest condition. Therefore, in this research we studied fruit ripening related genes expression on banana such as MaACS family at different environment condition. The result of study can give contributions in developing of new plants with desired traits or new post harvest technologies.

  11. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    PubMed Central

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-01-01

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley – Cer-c, Cer-q and Cer-u – known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. PMID:26962211

  12. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  13. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    PubMed Central

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  14. Endothelial nitric oxide synthase gene haplotypes and circulating nitric oxide levels significantly associate with risk of essential hypertension.

    PubMed

    Nejatizadeh, Azim; Kumar, Rahul; Stobdan, Tsering; Goyal, A K; Sikdar, Sunandan; Gupta, Mohit; Javed, Saleem; Pasha, M A Qadar

    2008-06-01

    Nitric oxide (NO), a potent vasodilator, plays a pivotal role in blood pressure regulation. Endothelial NO synthase gene (NOS3) polymorphisms influence NO levels. Here, we investigated the role of the -922A/G, -786T/C, 4b/4a, and 894G/T polymorphisms of the NOS3 and NO(x) levels in 800 consecutive unrelated subjects comprising 455 patients of essential hypertension and 345 controls. The polymorphisms were investigated independently and as haplotypes. Plasma NO(x) levels (nitrate and nitrite) were estimated by the Griess method. Genotype frequencies for the -786T/C, 4b/4a, and 894G/T polymorphisms differed significantly (P<0.001) between patients and controls and were associated with an increased risk of hypertension (OR=2.0, OR=3.8, OR=1.6, respectively). The 4-locus haplotypes ATaG (H1), ATaT (H2), and GCaG (H3) were significantly associated with essential hypertension and served as susceptible haplotypes (P

  15. Associations between nitric oxide synthase 3 gene polymorphisms and preeclampsia risk: a meta-analysis.

    PubMed

    Zeng, Fangfang; Zhu, Sui; Wong, Martin Chi-Sang; Yang, Zuyao; Tang, Jinling; Li, Keshen; Su, Xuefen

    2016-01-01

    Previous studies have examined the role of three NOS3 gene polymorphisms [G894T, T-786C, and the variable number of tandem repeats 4b/a (VNTR 4b