Science.gov

Sample records for acc synthase genes

  1. Differential regulation of genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase in etiolated pea seedlings: effects of indole-3-acetic acid, wounding, and ethylene.

    PubMed

    Peck, S C; Kende, H

    1998-12-01

    Treatment of 5- to 6-day-old etiolated pea (Pisum sativum L.) seedlings with indole-3-acetic acid (IAA) induced within 15 min an increase in the transcript levels of two genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase, Ps-ACS1 and Ps-ACS2. Simultaneous treatment with ethylene inhibited this increase and also caused a decrease in ACC synthase enzyme activity as compared to that of seedlings treated with IAA alone. These results indicate that ethylene inhibits its own biosynthesis by decreasing ACC synthase transcript levels via a negative feedback loop. Wounding of pea stems had no effect on the expression of Ps-ACS1, but led within 10 min to an increase in the mRNA levels of Ps-ACS2. This increase was also inhibited by ethylene. The wound signal was transmitted over a distance of at least 4 cm through the stem with no delay in induction or response intensity. The rapid transmission of the wound response is consistent with the possibility that a hydraulic or electric signal is responsible for the spread of the wound response. PMID:9869404

  2. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )

    1993-05-01

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  3. C-terminal phosphorylation is essential for regulation of ethylene synthesizing ACC synthase enzyme.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2013-02-01

    The genetic and molecular biological studies mainly in Arabidopsis and in some other plants have begun to uncover the various components of ripening signaling pathway in plants. Although transcriptional regulation of major ripening genes have been studied in detail, information on role of phosphorylation in regulating the activity and stability of core ripening pathway associated proteins in relation to ethylene biosynthesis during fruit ripening is still limited. Recently we have demonstrated the evidence for post-translational regulation of MA-ACS1 (Musa acuminata ACC synthase 1), the rate limiting step enzyme regulating ripening ethylene production in banana, through phosphorylation at the C-terminal Ser 476 and 479 residues by a 41-kDa Ser/Thr protein kinase. (1) Here we have further discussed role of protein phosphorylation in regulation of stability and activity of ACS enzymes and the mechanistic and evolutionary perspective of phosphorylation pattern of Type I ACC synthase enzymes. PMID:23221778

  4. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana

    PubMed Central

    Chang, Ing-Feng

    2013-01-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis. PMID:23943848

  5. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  6. Effects of bacterial ACC deaminase on Brassica napus gene expression.

    PubMed

    Stearns, Jennifer C; Woody, Owen Z; McConkey, Brendan J; Glick, Bernard R

    2012-05-01

    Plants in association with plant growth-promoting rhizobacteria can benefit from lower plant ethylene levels through the action of the bacterial enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase. This enzyme cleaves the immediate biosynthetic precursor of ethylene, ACC. Ethylene is responsible for many aspects of plant growth and development but, under stressful conditions, it exacerbates stress symptoms. The ACC deaminase-containing bacterium Pseudomonas putida UW4 is a potent plant growth-promoting strain and, as such, was used to elaborate the detailed role of bacterial ACC deaminase in Brassica napus (canola) plant growth promotion. Transcriptional changes in bacterially treated canola plants were investigated with the use of an Arabidopsis thaliana oligonucleotide microarray. A heterologous approach was necessary because there are few tools available at present to measure global expression changes in nonmodel organisms, specifically with the sensitivity of microarrays. The results indicate that the transcription of genes involved in plant hormone regulation, secondary metabolism, and stress response was altered in plants by the presence of the bacterium, whereas the upregulation of genes for auxin response factors and the downregulation of stress response genes was observed only in the presence of bacterial ACC deaminase. These results support the suggestion that there is a direct link between ethylene and the auxin response, which has been suggested from physiological studies, and provide more evidence for the stress-reducing benefits of ACC deaminase-expressing plant growth-promoting bacteria. PMID:22352713

  7. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits.

    PubMed Central

    Olson, D C; White, J A; Edelman, L; Harkins, R N; Kende, H

    1991-01-01

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits [Van Der Straeten, D., Van Wiemeersch, L., Goodman, H. M. & Van Montagu, M. Proc. Natl. Acad. Sci. USA (1990) 87, 4859-4863]. We report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5' and 3' ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes. Images PMID:1711229

  8. Three 1-Aminocyclopropane-1-Carboxylate Synthase Genes Regulated by Primary and Secondary Pollination Signals in Orchid Flowers1

    PubMed Central

    Bui, Anhthu Q.; Neill, Sharman D. O'

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  9. Three 1-aminocyclopropane-1-carboxylate synthase genes regulated by primary and secondary pollination signals in orchid flowers.

    PubMed

    Bui, A Q; O'Neill, S D

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  10. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  11. ACC2 gene polymorphisms, metabolic syndrome, and gene-nutrient interactions with dietary fat

    PubMed Central

    Phillips, Catherine M.; Goumidi, Louisa; Bertrais, Sandrine; Field, Martyn R.; Cupples, L. Adrienne; Ordovas, Jose M.; McMonagle, Jolene; Defoort, Catherine; Lovegrove, Julie A.; Drevon, Christian A.; Blaak, Ellen E.; Kiec-Wilk, Beata; Riserus, Ulf; Lopez-Miranda, Jose; McManus, Ross; Hercberg, Serge; Lairon, Denis; Planells, Richard; Roche, Helen M.

    2010-01-01

    Acetyl-CoA carboxylase β (ACC2) plays a key role in fatty acid synthesis and oxidation pathways. Disturbance of these pathways is associated with impaired insulin responsiveness and metabolic syndrome (MetS). Gene-nutrient interactions may affect MetS risk. This study determined the relationship between ACC2 polymorphisms (rs2075263, rs2268387, rs2284685, rs2284689, rs2300453, rs3742023, rs3742026, rs4766587, and rs6606697) and MetS risk, and whether dietary fatty acids modulate this in the LIPGENE-SU.VI.MAX study of MetS cases and matched controls (n = 1754). Minor A allele carriers of rs4766587 had increased MetS risk (OR 1.29 [CI 1.08, 1.58], P = 0.0064) compared with the GG homozygotes, which may in part be explained by their increased body mass index (BMI), abdominal obesity, and impaired insulin sensitivity (P < 0.05). MetS risk was modulated by dietary fat intake (P = 0.04 for gene-nutrient interaction), where risk conferred by the A allele was exacerbated among individuals with a high-fat intake (>35% energy) (OR 1.62 [CI 1.05, 2.50], P = 0.027), particularly a high intake (>5.5% energy) of n-6 polyunsaturated fat (PUFA) (OR 1.82 [CI 1.14, 2.94], P = 0.01; P = 0.05 for gene-nutrient interaction). Saturated and monounsaturated fat intake did not modulate MetS risk. Importantly, we replicated some of these findings in an independent cohort. In conclusion, the ACC2 rs4766587 polymorphism influences MetS risk, which was modulated by dietary fat, suggesting novel gene-nutrient interactions. PMID:20855566

  12. The tomato terpene synthase gene family.

    PubMed

    Falara, Vasiliki; Akhtar, Tariq A; Nguyen, Thuong T H; Spyropoulou, Eleni A; Bleeker, Petra M; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E; Schilmiller, Anthony L; Last, Robert L; Schuurink, Robert C; Pichersky, Eran

    2011-10-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  13. ACC interleukin-10 gene promoter haplotype as a breast cancer risk factor predictor among Jordanian females

    PubMed Central

    Atoum, Manar Fayiz

    2016-01-01

    Introduction Interleukin-10 (IL-10) is a multifactorial cytokine with a complex biological role in breast cancer. The aims of this study were to investigate any association between IL-10 gene promoter polymorphisms, 1082A>/G, −819T>C, and −592A>C, or haplotypes and breast cancer risk among Jordanian women and to evaluate any association between the most common haplotype with clinicopathological features of breast cancer. Patients and methods A total of 202 breast cancer patients and 210 age-matched healthy control subjects were genotyped for −1082A/G, −819T/C, and −592A/C single nucleotide polymorphisms in the promoter region of the IL-10 gene by polymerase chain reaction-restriction fragment length polymorphism. Study patients and control subjects were recruited from Prince Hamzah Hospital, Amman, Jordan (2012–2013). Ethical approval and signed consent forms were signed by all participants. DNA was extracted, and polymerase chain reaction fragments were amplified and restriction digested by MnII, MaeIII, and RsaI. Results This study showed no statistically significant difference between −1082A/G, −819T/C, and −592A/C IL-10 genotypes or alleles among breast cancer patients or controls. Four different haplotypes ATA, ACC, GTA, and ACA within the IL-10 promoter gene were determined among both breast cancer and control groups. The most frequent haplotype was ACC among breast cancer patients and controls (41.6% and 40.7%, respectively). No statistical differences in these haplotypes among breast cancer patients or controls were determined. Analysis of the most common ACC haplotype showed statistical difference in positive estrogen receptor (P=0.022), positive progesterone receptor (P=0.004), cancer grade (P=0.0001), and cancer stage (P=0.009) among the ACC haplotype compared to non-ACC haplotype. Conclusion To our knowledge, this is the first report studying the association of IL-10 haplotype with breast cancer risk events among Jordanian females. The

  14. Isoprene synthase genes form a monophyletic clade of acyclic terpene synthases in the TPS-B terpene synthase family.

    PubMed

    Sharkey, Thomas D; Gray, Dennis W; Pell, Heather K; Breneman, Steven R; Topper, Lauren

    2013-04-01

    Many plants emit significant amounts of isoprene, which is hypothesized to help leaves tolerate short episodes of high temperature. Isoprene emission is found in all major groups of land plants including mosses, ferns, gymnosperms, and angiosperms; however, within these groups isoprene emission is variable. The patchy distribution of isoprene emission implies an evolutionary pattern characterized by many origins or many losses. To better understand the evolution of isoprene emission, we examine the phylogenetic relationships among isoprene synthase and monoterpene synthase genes in the angiosperms. In this study we identify nine new isoprene synthases within the rosid angiosperms. We also document the capacity of a myrcene synthase in Humulus lupulus to produce isoprene. Isoprene synthases and (E)-β-ocimene synthases form a monophyletic group within the Tps-b clade of terpene synthases. No asterid genes fall within this clade. The chemistry of isoprene synthase and ocimene synthase is similar and likely affects the apparent relationships among Tps-b enzymes. The chronology of rosid evolution suggests a Cretaceous origin followed by many losses of isoprene synthase over the course of evolutionary history. The phylogenetic pattern of Tps-b genes indicates that isoprene emission from non-rosid angiosperms likely arose independently. PMID:23550753

  15. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time. PMID:24849013

  16. Thymidylate synthase gene of herpesvirus ateles.

    PubMed Central

    Richter, J; Puchtler, I; Fleckenstein, B

    1988-01-01

    The putative thymidylate synthase (TS) gene of herpesvirus ateles, a T-lymphotropic tumor virus of New World primates, has a single large open reading frame encoding a polypeptide of 32.9 kilodaltons. The gene is transcribed into an unspliced 2.4-kilobase mRNA that is abundantly expressed late in virus replication. The AT-rich 5' untranslated leader sequence of TS mRNA in herpesvirus ateles-infected cells is remarkable in length (1,184 nucleotides), containing 29 minicistrons; this may indicate a role in translation regulation. Images PMID:3404583

  17. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    PubMed Central

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene structures encompassed 6 exons and 5 introns located in conserved sites. Comparison with the corresponding gene structures of other eukaryotic species revealed lack of common introns that would be shared among selected fungi, nematodes, mammals and plants. The two deduced amino acid sequences were 96% identical. In addition to the thymidylate synthase gene, the intron-less retrocopy, i.e. a processed pseudogene, with sequence identical to the T. spiralis gene coding region, was found to be present within the T. pseudospiralis genome. This pseudogene, instead of the gene, was confirmed by RT-PCR to be expressed in the parasite muscle larvae. Conclusions Intron load, as well as distribution of exon and intron phases in thymidylate synthase genes from various sources, point against the theory of gene assembly by the primordial exon shuffling and support the theory of evolutionary late intron insertion into spliceosomal genes. Thymidylate synthase pseudogene expressed in T. pseudospiralis muscle larvae is designated a retrogene. PMID:24716800

  18. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  19. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  20. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  1. Molecular cloning, expression and antioxidant characterisation of a typical thioredoxin gene (AccTrx2) in Apis cerana cerana.

    PubMed

    Yao, Pengbo; Hao, Lili; Wang, Fang; Chen, Xiaobo; Yan, Yan; Guo, Xingqi; Xu, Baohua

    2013-09-15

    Thioredoxins (Trxs) are a family of small, highly conserved and ubiquitous proteins that are involved in protecting organisms against toxic reactive oxygen species (ROS). In this study, a typical thioredoxin 2 gene was isolated from Apis cerana cerana, AccTrx2. The full-length cDNA sequence of AccTrx2 was composed of 407 bp containing a 318 bp open reading frame (ORF) that encodes a predicted protein of 105 amino acids, 11.974 kDa and an isoelectric point of 4.45. Expression profile of AccTrx2 as determined by a quantitative real-time PCR (qRT-PCR) analysis was higher in brain than in other tissues, with its highest transcript occurring on the 15day post-emergence adult and upregulated by such abiotic stresses as 4 °C, 16 °C, 25 °C, H2O2, cyhalothrin, acaricide, paraquat, phoxime and mercury (HgCl2) treatments. However, AccTrx2 was slightly repressed when exposed to 42 °C treatment. Characterisation of the recombinant protein showed that the purified AccTrx2 had insulin disulfide reductase activity and could protect DNA from ROS damage. These results indicate that AccTrx2 functions as an antioxidant that plays an important role in response to oxidative stress. PMID:23747404

  2. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana.

    PubMed

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses. PMID:26922780

  3. The promoter of LE-ACS7, an early flooding-induced 1-aminocyclopropane-1-carboxylate synthase gene of the tomato, is tagged by a Sol3 transposon

    PubMed Central

    Shiu, Oi Yin; Oetiker, Jürg H.; Yip, Wing Kin; Yang, Shang Fa

    1998-01-01

    Many terrestrial plants respond to flooding with enhanced ethylene production. The roots of flooded plants produce 1-aminocyclopropane-1-carboxylic acid (ACC), which is transported from the root to the shoot, where it is converted to ethylene. In the roots, ACC is synthesized by ACC synthase, which is encoded by a multigene family. Previously, we identified two ACC synthase genes of tomato that are involved in flooding-induced ethylene production. Here, we report the cloning of LE-ACS7, a new tomato ACC synthase with a role early during flooding but also in the early wound response of leaves. The promoter of LE-ACS7 is tagged by a Sol3 transposon. A Sol3 transposon is also present in the tomato polygalacturonase promoter to which it conferred regulatory elements. Thus, Sol3 transposons may affect the regulation of LE-ACS7 and may be involved in the communication between the root and the shoot of waterlogged tomato plants. PMID:9707648

  4. 1-MCP EFFECTS ON ANTIOXIDANT ACTIVITY AND GENE EXPRESSION OF ACC-SYNTHASE AND ACC-OXIDASE IN COTTON FLOWERS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

  5. Characterization of ACC deaminase gene in Pseudomonas entomophila strain PS-PJH isolated from the rhizosphere soil.

    PubMed

    Kamala-Kannan, Seralathan; Lee, Kui-Jae; Park, Seung-Moon; Chae, Jong-Chan; Yun, Bong-Sik; Lee, Yong Hoon; Park, Yool-Jin; Oh, Byung-Taek

    2010-04-01

    The enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase cleaves the ethylene precursor ACC into alpha-ketobutyrate and ammonia. The decreased level of ethylene allows the plant to be more resistant to a wide environmental stress including plant pathogens. In the present study, we characterized the ACC deaminase activity of a Pseudomonas entomophila strain PS-PJH isolated from the red pepper rhizosphere region of red pepper grown at Jinan, Korea. The isolate produced 23.8 +/- 0.4 micromol of alpha-ketobutyrate/mg of protein/h during ACC deamination under in vitro conditions. Polymerase chain reaction for acdS gene showed that the isolated P. entomophila strain PS-PJH carry sequences similar to the known acdS genes. Results of the multiple sequence alignment revealed >99% identity (nucleotide and amino acid) with acdS gene of Pseudomonas putida strains AM15 and UW4. The isolated bacteria promoted 43.3 and 34.1% of growth in Raphanus sativus and Lactuca sativa plants, respectively. Based on the 16S-23S internal transcribed spacer region sequences, the isolate was identified as P. entomophila. To the best of our knowledge this is the first study to report the acdS gene in P. entomophila. PMID:20082369

  6. Heterologous over-expression of ACC SYNTHASE8 (ACS8) in Populus tremula x P. alba clone 717-1B4 results in elevated levels of ethylene and induces stem dwarfism and reduced leaf size through separate genetic pathways.

    PubMed

    Plett, Jonathan M; Williams, Martin; LeClair, Gaetan; Regan, Sharon; Beardmore, Tannis

    2014-01-01

    Plant height is an important agronomic and horticultural trait that impacts plant productivity, durability and esthetic appeal. A number of the plant hormones such as gibberellic acid (GA), auxin and ethylene have been linked to control of plant architecture and size. Reduction in GA synthesis and auxin transport result in dwarfism while ethylene may have a permissive or repressive effect on tissue growth depending upon the age of plant tissues or the environmental conditions considered. We describe here an activation-tagged mutant of Populus tremula x P. alba clone 717-1B4 identified from 2000 independent transgenic lines due to its significantly reduced growth rate and smaller leaf size. Named dwarfy, the phenotype is due to increased expression of PtaACC SYNTHASE8, which codes for an enzyme in the first committed step in the biosynthesis of ethylene. Stems of dwarfy contain fiber and vessel elements that are reduced in length while leaves contain fewer cells. These morphological differences are linked to PtaACS8 inducing different transcriptomic programs in the stem and leaf, with genes related to auxin diffusion and sensing being repressed in the stem and genes related to cell division found to be repressed in the leaves. Altogether, our study gives mechanistic insight into the genetics underpinning ethylene-induced dwarfism in a perennial model organism. PMID:25414707

  7. Heterologous over-expression of ACC SYNTHASE8 (ACS8) in Populus tremula x P. alba clone 717-1B4 results in elevated levels of ethylene and induces stem dwarfism and reduced leaf size through separate genetic pathways

    PubMed Central

    Plett, Jonathan M.; Williams, Martin; LeClair, Gaetan; Regan, Sharon; Beardmore, Tannis

    2014-01-01

    Plant height is an important agronomic and horticultural trait that impacts plant productivity, durability and esthetic appeal. A number of the plant hormones such as gibberellic acid (GA), auxin and ethylene have been linked to control of plant architecture and size. Reduction in GA synthesis and auxin transport result in dwarfism while ethylene may have a permissive or repressive effect on tissue growth depending upon the age of plant tissues or the environmental conditions considered. We describe here an activation-tagged mutant of Populus tremula x P. alba clone 717-1B4 identified from 2000 independent transgenic lines due to its significantly reduced growth rate and smaller leaf size. Named dwarfy, the phenotype is due to increased expression of PtaACC SYNTHASE8, which codes for an enzyme in the first committed step in the biosynthesis of ethylene. Stems of dwarfy contain fiber and vessel elements that are reduced in length while leaves contain fewer cells. These morphological differences are linked to PtaACS8 inducing different transcriptomic programs in the stem and leaf, with genes related to auxin diffusion and sensing being repressed in the stem and genes related to cell division found to be repressed in the leaves. Altogether, our study gives mechanistic insight into the genetics underpinning ethylene-induced dwarfism in a perennial model organism. PMID:25414707

  8. The Tomato Terpene Synthase Gene Family1[W][OA

    PubMed Central

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  9. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  10. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene (AccGSTD) in response to thermal stress.

    PubMed

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee (Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees. PMID:23275971

  11. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  12. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

    PubMed

    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

    2016-06-01

    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts. PMID:26865376

  13. Cloning, expression patterns, and preliminary characterization of AccCPR24, a novel RR-1 type cuticle protein gene from Apis cerana cerana.

    PubMed

    Chu, Xiaoqian; Lu, Wenjing; Zhang, Yuanying; Guo, Xingqi; Sun, Rujiang; Xu, Baohua

    2013-11-01

    Cuticular proteins (CPs) are key components of insect cuticle, a structure that plays a pivotal role in insect development and defense. In this study, we cloned the full-length cDNA of a CP gene from Apis cerana cerana (AccCPR24). An amino acid sequence alignment indicated that AccCPR24 contains the conserved Rebers and Riddiford consensus sequence and shares high similarity with the genes from other hymenopteran insects. We then isolated the genomic DNA and found that the first intron, which is present in other CP genes, is absent in AccCPR24. Real-time quantitative polymerase chain reaction (qPCR) analysis revealed that AccCPR24 is highly expressed in the late pupal stage and midgut. Expression was inhibited by an exogenous ecdysteroid in vitro but was enhanced by this hormone in vivo; environmental stressors, such as heavy metals and pesticides, also influenced gene expression. In addition, a disc diffusion assay showed that AccCPR24 enhanced the ability of bacterial cells to resist multiple stresses. We infer from our results that AccCPR24 acts in honeybee development and in protecting these insects from abiotic stresses. PMID:24115354

  14. Characterization of a Decapentapletic Gene (AccDpp) from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress

    PubMed Central

    Wang, Hongfang; Guo, Xulei; Guo, Xingqi; Sun, Qinghua; Xu, Baohua

    2016-01-01

    To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ) signal pathway. Decapentapletic gene (Dpp) belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana). In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp. PMID:26881804

  15. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  16. A geraniol-synthase gene from Cinnamomum tenuipilum.

    PubMed

    Yang, Tao; Li, Jing; Wang, Hao-Xin; Zeng, Ying

    2005-02-01

    Geraniol may accumulate up to 86-98% of the leaf essential oils in geraniol chemotypes of the evergreen camphor tree Cinnamomum tenuipilum. A similarity-based cloning strategy yielded a cDNA clone that appeared to encode a terpene synthase and which could be phylogenetically grouped within the angiosperm monoterpene synthase/subfamily. After its expression in Escherichia coli and enzyme assay with prenyl diphosphates as substrates, the enzyme encoded by the putative C. tenuipilum monoterpene synthase gene was shown to specifically convert geranyl diphosphate to geraniol as a single product by GC-MS analysis. Biochemical characterization of the partially purified recombinant protein revealed a strong dependency for Mg2+ and Mn2+, and an apparent Michaelis constant of 55.8 microM for geranyl diphosphate. Thus, a new member of the monoterpene synthase family was identified and designated as CtGES. The genome contains a single copy of CtGES gene. Expression of CtGES was exclusively observed in the geraniol chemotype of C. tenuipilum. Furthermore, in situ hybridization analysis demonstrated that CtGES mRNA was localized in the oil cells of the leaves. PMID:15680985

  17. A novel 1-Cys thioredoxin peroxidase gene in Apis cerana cerana: characterization of AccTpx4 and its role in oxidative stresses.

    PubMed

    Huaxia, Yifeng; Wang, Fang; Yan, Yan; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2015-07-01

    Thioredoxin peroxidase (Tpx), also named peroxiredoxin (Prx), is an important peroxidase that can protect organisms against stressful environments. AccTpx4, a 1-Cys thioredoxin peroxidase gene from the Chinese honey bee Apis cerana cerana, was cloned and characterized. The AccTpx4 gene encodes a protein that is predicted to contain the conserved PVCTTE motif from 1-Cys peroxiredoxin. Quantitative real-time PCR (Q-PCR) and Western blotting revealed that AccTpx4 was induced by various oxidative stresses, such as cold, heat, insecticides, H(2)O(2), and HgCl(2). The in vivo peroxidase activity assay showed that recombinant AccTpx4 protein could efficiently degrade H(2)O(2) in the presence of DL-dithiothreitol (DTT). In addition, disc fusion assays revealed that AccTpx4 could function to protect cells against oxidative stresses. These results indicate that AccTpx4 plays an important role in oxidative stress responses and may contribute to the conservation of honeybees. PMID:25971604

  18. Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence.

    PubMed

    Chen, Jen-Chih; Jiang, Cai-Zhong; Gookin, Timothy E; Hunter, Donald A; Clark, David G; Reid, Michael S

    2004-07-01

    Agrobacterium-mediated infection of petunia (Petunia hybrida) plants with tobacco rattle virus (TRV) bearing fragments of Petunia genes resulted in systemic infection and virus-induced gene silencing (VIGS) of the homologous host genes. Infection with TRV containing a phytoene desaturase (PDS) fragment resulted in reduced abundance of PDS transcripts and typical photobleaching of photosynthetic tissues. Infection with TRV containing a chalcone synthase (CHS) fragment resulted in silencing of anthocyanin production in infected flowers. The silencing phenotype ranged from scattered white spots on the normal purple background to entirely white flowers. Symptoms in the V26 cultivar were a diffuse mosaic, but infection of some purple-flowered commercial cultivars resulted in large white sectors and even entirely white flowers. Abundance of CHS transcripts in the white flowers was less than 4% of that in purple flowers on the same plant. Infection with TRV containing a tandem construct of PDS and CHS resulted in leaf photobleaching and white patterns on the flowers. Transcripts of CHS and PDS were reduced both in leaves and in flowers confirming simultaneous silencing of both genes by the tandem construct. We tested the effects of infection with TRV containing CHS and a fragment of a petunia gene encoding for 1-aminocyclopropane-1-carboxylate oxidase (ACO4) Abundance of transcripts encoding ACO4 and ACO1 were reduced (by 5% and 20%, respectively) in infected flowers. Whether the flowers were treated with ACC or pollinated, the white (silenced) flowers or flower sectors produced less ethylene and senesced later than purple (non-silenced) tissues. These results indicate the value of VIGS with tandem constructs containing CHS as reporter and a target gene as a tool for examining the function of floral-associated genes. PMID:15604697

  19. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    PubMed

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  20. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  1. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed Central

    Jin, S; Sonenshein, A L

    1994-01-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ. Images PMID:8045899

  2. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses.

    PubMed

    Schwerdt, Julian G; MacKenzie, Katrin; Wright, Frank; Oehme, Daniel; Wagner, John M; Harvey, Andrew J; Shirley, Neil J; Burton, Rachel A; Schreiber, Miriam; Halpin, Claire; Zimmer, Jochen; Marshall, David F; Waugh, Robbie; Fincher, Geoffrey B

    2015-07-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  3. Characterization of an Apis cerana cerana cytochrome P450 gene (AccCYP336A1) and its roles in oxidative stresses responses.

    PubMed

    Zhu, Ming; Zhang, Weixing; Liu, Feng; Chen, Xiaobo; Li, Han; Xu, Baohua

    2016-06-15

    Cytochrome P450 monooxygenases (P450), widely distributed multifunctional enzymes, that play an important role in the oxidative metabolism of endogenous compounds and xenobiotics. Studies have found that these enzymes show peroxidase-like activity and may thus be involved in protecting organisms against reactive oxygen species (ROS). In this work, Apis cerana cerana was used to investigate the molecular mechanisms of P450 family genes in resisting ROS damage. A cytochrome P450 gene was isolated, AccCYP336A1. The open reading frame (ORF) of AccCYP336A1 is 1491bp in length and encodes a predicted protein of 496 amino acids. The obtained amino acid sequence of AccCYP336A1 shared a high sequence identity with homologous proteins and contained the highly conserved features of this protein family. Quantitative real-time PCR (qRT-PCR) analysis showed that AccCYP336A1 was present in some fast developmental stages and had a higher expression in the epidermis than in other tissues. Additionally, the expression levels of AccCYP336A1 were up-regulated by cold (4°C), heat (42°C), ultraviolet (UV) radiation, H2O2 and pesticide (thiamethoxam, deltamethrin, methomyl and phoxim) treatments. These results were confirmed by the western blot assays. Furthermore, the recombinant AccCYP336A1 protein acted as an antioxidant that resisted paraquat-induced oxidative stress. Taken together, these results suggest that AccCYP336A1 may play a very significant role in antioxidant defense against ROS damage. PMID:26877110

  4. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  7. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  8. Interspecific Variation in the Promoter Region of A Sucrose Synthase Gene in the Genus Saccharum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sucrose synthase is an important enzyme of sucrose metabolism in sugarcane, a polyploid interspecific hybrid of the genus Saccharum. One of the genes for sucrose synthase (Sus2, homologous to maize Sh1) is more highly expressed in sucrose-storing hybrids than in low sucrose S. spontaneum. We amplifi...

  9. MOLECULAR CLONING AND CHARACTERIZATION OF CHROMOSOME-ENCODED CITRATE SYNTHASE GENE FROM SINORHIZOBIUM FREDII USDA257

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrate synthase, a key metabolic enzyme that condenses acetyl-CoA and oxaloacetate to citrate, plays an important role in nodulation and nitrogen fixation. We have isolated a citrate synthase gene by screening a Sinorhizobium fredii USDA257 cosmid library with a heterologous probe from S. meliloti....

  10. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  11. Adaptive Cruise Control (ACC)

    NASA Astrophysics Data System (ADS)

    Reif, Konrad

    Die adaptive Fahrgeschwindigkeitsregelung (ACC, Adaptive Cruise Control) ist eine Weiterentwicklung der konventionellen Fahrgeschwindigkeitsregelung, die eine konstante Fahrgeschwindigkeit einstellt. ACC überwacht mittels eines Radarsensors den Bereich vor dem Fahrzeug und passt die Geschwindigkeit den Gegebenheiten an. ACC reagiert auf langsamer vorausfahrende oder einscherende Fahrzeuge mit einer Reduzierung der Geschwindigkeit, sodass der vorgeschriebene Mindestabstand zum vorausfahrenden Fahrzeug nicht unterschritten wird. Hierzu greift ACC in Antrieb und Bremse ein. Sobald das vorausfahrende Fahrzeug beschleunigt oder die Spur verlässt, regelt ACC die Geschwindigkeit wieder auf die vorgegebene Sollgeschwindigkeit ein (Bild 1). ACC steht somit für eine Geschwindigkeitsregelung, die sich dem vorausfahrenden Verkehr anpasst.

  12. Enhancement of heavy metal accumulation by tissue specific co-expression of iaaM and ACC deaminase genes in plants.

    PubMed

    Zhang, Yong; Zhao, Lihong; Wang, Yao; Yang, Baoyu; Chen, Shiyun

    2008-06-01

    1-Aminocyclopropane deaminase (ACC) and tryptophan monooxygenase are two enzymes involved in plant senescence-inhibiting and growth-promoting regulation, respectively. In this study, two binary vectors were constructed in which the Agrobacterium iaaM gene was under the transcriptional control of a xylem-specific glycine-rich protein promoter alone, or co-expressed with the bacterial ACC deaminase gene, which was driven by the constitutive CaMV 35S promoter. Transgenic petunia shoots co-expressing both genes were able to root on medium supplemented with 7.5 mg l(-1) CoCl2. When T1 transgenic tobacco plants were grown in sand supplemented with Cu2+ and Co2+, tissue specific co-expression of both iaaM and ACC deaminase genes showed faster growth with larger biomass with a more extensive root system, and accumulated a greater amount of heavy metals than the empty vector control plants. When T1 transgenic tobacco plants were grown in soil watered with different concentrations of CuSO4, xylem specific expression of the iaaM gene caused the accumulation of more Cu2+ than the empty vector control at lower CuSO4 concentrations, but showed severe toxic symptoms at concentration of 100 mg l(-1) CuSO4. T1 transgenic plants co-expressing both genes accumulated more heavy metals into the plant shoots and can tolerate CuSO4 at 150 mg l(-1). In addition, plants co-expressing these two genes can grow well in a complex contaminated soil containing both inorganic and organic pollutants, while the growth of the control plants was greatly inhibited. PMID:18471863

  13. Identification and characterization of a novel gene (CTPsH) homologous to murine CTP synthase gene

    SciTech Connect

    Yang, B.Z.; Dng, J.H.; Roe, C.R.

    1994-09-01

    CTP synthase (CTPs) plays an important role in pyrimidine metabolism in eukaryotic cells. Alteration of this enzyme was associated with multidrug resistant phenotype of cancer cells to several cytotoxic pyrimidine ribonucleosides. In order to elucidate the mechanism of this type of drug resistance, a murine CTP synthase cDNA has been previously isolated from a mouse liver cDNA library. Here report the identification of a new gene which is highly similar to mouse CTPs gene. A cDNA clone, designated CTPsH, contained an open reading frame of 1758 nucleotides that predicts a polypeptide of 586 amino acids with an M(r) of 66,002.6. The predicted amino acid sequence shares 79% identity with mouse liver CTPs gene. Both genes are expressed in a wide variety of tissues, as judged by RNA blot analysis, but the relative levels of the two mRNAs differ. So far this is the only gene which shares many features with murine CTPs gene. The availability of the CTPsH would provide an opportunity to characterize the biological function of this gene. The possible role of this new gene (CTPsH) in drug resistance of malignant cells is under investigation.

  14. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  15. Identification of a second cellulose synthase gene (acsAII) in Acetobacter xylinum.

    PubMed Central

    Saxena, I M; Brown, R M

    1995-01-01

    A second cellulose synthase gene (acsAII) coding for a 175-kDa polypeptide that is similar in size and sequence to the acsAB gene product has been identified in Acetobacter xylinum AY201. Evidence for the presence of this gene was obtained during analysis of A. xylinum mutants in which the acsAB gene was disrupted (I.M. Saxena, K. Kudlicka, K. Okuda, and R.M. Brown, Jr., J. Bacteriol. 176:5735-5752, 1994). Although these mutants produced no detectable cellulose, they exhibited significant cellulose synthase activity in vitro. The acsAII gene was isolated by using an acsAB gene fragment as a probe. The acsAII gene coded for cellulose synthase activity as determined from sequence analysis and study of mutants in which this gene was disrupted. A mutant in which only the acsAII gene was disrupted showed no significant differences in either the in vivo cellulose production or the in vitro cellulose synthase activity compared with wild-type cells. Mutants in which both the acsAII and acsAB genes were disrupted produced no cellulose in vivo and exhibited negligible cellulose synthase activity in vitro, thus confirming that the cellulose synthase activity observed in the acsAB mutants was coded by the acsAII gene. These results establish the presence of an additional gene for cellulose synthase expressed in cells of A. xylinum, yet this gene is not required for cellulose production when cells are grown under laboratory conditions. PMID:7665515

  16. Arabidopsis protein phosphatase 2C ABI1 interacts with type I ACC synthases and is involved in the regulation of ozone-induced ethylene biosynthesis.

    PubMed

    Ludwików, Agnieszka; Cieśla, Agata; Kasprowicz-Maluśki, Anna; Mituła, Filip; Tajdel, Małgorzata; Gałgański, Łukasz; Ziółkowski, Piotr A; Kubiak, Piotr; Małecka, Arleta; Piechalak, Aneta; Szabat, Marta; Górska, Alicja; Dąbrowski, Maciej; Ibragimow, Izabela; Sadowski, Jan

    2014-06-01

    Ethylene plays a crucial role in various biological processes and therefore its biosynthesis is strictly regulated by multiple mechanisms. Posttranslational regulation, which is pivotal in controlling ethylene biosynthesis, impacts 1-aminocyclopropane 1-carboxylate synthase (ACS) protein stability via the complex interplay of specific factors. Here, we show that the Arabidopsis thaliana protein phosphatase type 2C, ABI1, a negative regulator of abscisic acid signaling, is involved in the regulation of ethylene biosynthesis under oxidative stress conditions. We found that ABI1 interacts with ACS6 and dephosphorylates its C-terminal fragment, a target of the stress-responsive mitogen-activated protein kinase, MPK6. In addition, ABI1 controls MPK6 activity directly and by this means also affects the ACS6 phosphorylation level. Consistently with this, ozone-induced ethylene production was significantly higher in an ABI1 knockout strain (abi1td) than in wild-type plants. Importantly, an increase in stress-induced ethylene production in the abi1td mutant was compensated by a higher ascorbate redox state and elevated antioxidant activities. Overall, the results of this study provide evidence that ABI1 restricts ethylene synthesis by affecting the activity of ACS6. The ABI1 contribution to stress phenotype underpins its role in the interplay between the abscisic acid (ABA) and ethylene signaling pathways. PMID:24637173

  17. Cellulose synthase gene expression profiling of Physcomitrella patens.

    PubMed

    Tran, M L; Roberts, A W

    2016-05-01

    The cellulose synthase (CESA) gene family of seed plants comprises six clades that encode isoforms with conserved expression patterns and distinct functions in cellulose synthesis complex (CSC) formation and primary and secondary cell wall synthesis. In mosses, which have rosette CSCs like those of seed plants but lack lignified secondary cell walls, the CESA gene family diversified independently and includes no members of the six functionally distinct seed plant clades. There are seven CESA isoforms encoded in the genome of the moss Physcomitrella patens. However, only PpCESA5 has been characterised functionally, and little information is available on the expression of other PpCESA family members. We have profiled PpCESA expression through quantitative RT-PCR, analysis of promoter-reporter lines, and cluster analysis of public microarray data in an effort to identify expression and co-expression patterns that could help reveal the functions of PpCESA isoforms in protein complex formation and development of specific tissues. In contrast to the tissue-specific expression observed for seed plant CESAs, each of the PpCESAs was broadly expressed throughout most developing tissues. Although a few statistically significant differences in expression of PpCESAs were noted when some tissues and hormone treatments were compared, no strong co-expression patterns were observed. Along with CESA phylogenies and lack of single PpCESA mutant phenotypes reported elsewhere, broad overlapping expression of the PpCESAs indicates a high degree of inter-changeability and is consistent with a different pattern of functional specialisation in the evolution of the seed plant and moss CESA families. PMID:26572930

  18. Expression of potato S-adenosyl-L-methionine synthase (SbSAMS) gene altered developmental characteristics and stress responses in transgenic Arabidopsis plants.

    PubMed

    Kim, Sun Hee; Kim, Sang Hyon; Palaniyandi, Sasikumar Arunachalam; Yang, Seung Hwan; Suh, Joo-Won

    2015-02-01

    S-adenosyl-L-methionine (SAM) synthase (SAMS) catalyze the biosynthesis of SAM, which is a precursor for ethylene and polyamines, and a methyl donor for a number of biomolecules. A full-length cDNA of SAMS from Solanum brevidens was expressed in Arabidopsis thaliana to study its physiological function. RT-PCR analysis showed that SbSAMS expression was enhanced significantly in S. brevidens leaves upon treatment with salt, mannitol, ethephon, IAA and ABA. The transgenic SbSAMS overexpression lines accumulated higher levels S-adenosyl homocysteine (SAHC) and ethylene concomitantly with increased SAM level. Expression levels of genes related to ethylene biosynthesis such as ACC synthase, but not polyamine biosynthesis genes were enhanced in SbSAMS overexpressing Arabidopsis lines. In addition, ABA responsive, wound and pathogen-inducible genes were upregulated in SbSAMS transgenic Arabidopsis plants. Transgenic Arabidopsis lines exhibited higher salt and drought stress tolerance compared to those of vector control. Based on these results we conclude that SbSAMS is expressed under abiotic stress to produce SAM as a broad-spectrum signal molecule to upregulate stress-related genes including ethylene and ABA biosynthetic pathway genes responsible for ABA, pathogen and wound responses. PMID:25559387

  19. Molecular and biochemical characterization of benzalacetone synthase and chalcone synthase genes and their proteins from raspberry (Rubus idaeus L.).

    PubMed

    Zheng, Desen; Hrazdina, Geza

    2008-02-15

    Two new members of the polyketide synthase (PKS) gene family (RiPKS4 and RiPKS5) were cloned from raspberry fruits (Rubus idaeus L., cv Royalty) and expressed in Escherichia coli. Characterization of the recombinant enzyme products indicated that RiPKS4 is a bifunctional polyketide synthase producing both 4-hydroxybenzalacetone and naringenin chalcone. The recombinant RiPKS4 protein, like the native protein from raspberry fruits [W. Borejsza-Wysocki, G. Hrazdina, Plant Physiol. 1996;110: 791-799] accepted p-coumaryl-CoA and ferulyl-CoA as starter substrates and catalyzed the formation of both naringenin chalcone, 4-hydroxy-benzalacetone and 3-methoxy-4-hydroxy-benzalacetone. Although activity of RiPKS4 was higher with ferulyl-CoA than with p-coumaryl-CoA, the corresponding product, 3-methoxy-4-hydroxy phenylbutanone could not be detected in raspberries to date. Sequence analysis of the genes and proteins suggested that this feature of RiPKS4 was created by variation in the C-terminus due to DNA recombination at the 3' region of its coding sequence. RiPKS5 is a typical chalcone synthase (CHS) that uses p-coumaryl-CoA only as starter substrate and produces naringenin chalcone exclusively as the reaction product. PMID:18068110

  20. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  1. Arabidopsis thaliana contains a single gene encoding squalene synthase.

    PubMed

    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert

    2008-05-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  2. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  3. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  4. Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

    PubMed Central

    Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.

    2013-01-01

    Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

  5. Cloning and sequence of two different cDNAs encoding 1-aminocyclopropane-1-carboxylate synthase in tomato.

    PubMed

    Van der Straeten, D; Van Wiemeersch, L; Goodman, H M; Van Montagu, M

    1990-06-01

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14), the key enzyme in ethylene biosynthesis, was purified 5000-fold from induced tomato pericarp. ACC synthase activity was unambiguously correlated with a 45-kDa protein by two independent methods. Peptide sequences were obtained both from the N terminus after electroblotting and from tryptic peptides separated by reversed-phase chromatography. Mixed oligonucleotide probes were used to screen a lambda gt11 library prepared from RNA of induced pericarp tissue. Putative ACC synthase clones were isolated with a frequency of 0.01%. One of these contained a 1.9-kilobase insert with a single open reading frame encoding a polypeptide of 55 kDa. A second, partial cDNA clone was found that differed from the first one in 18% of its bases. Genomic Southern blotting suggests possible tandem organization of the two genes in tomato. The entire coding region was expressed in Escherichia coli and the denatured recombinant polypeptide was used to raise polyclonal antibodies. The antibody preparation both immunoinhibits and immunoprecipitates ACC synthase activity from an enriched tomato extract, confirming the identity of the clone. Northern blot analysis demonstrates that the ACC synthase messenger accumulation is coordinated with fruit ripening. PMID:2191304

  6. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  7. Regulation of the cellulose synthase-like gene family by light in the maize mesocotyl.

    PubMed

    van Erp, Harrie; Walton, Jonathan D

    2009-03-01

    The cellulose synthase-like (ZmCSL) gene family of maize was annotated and its expression studied in the maize mesocotyl. A total of 28 full-length CSL genes and another 13 partial sequences were annotated; four are predicted to be pseudogenes. Maize has all of the CSL subfamilies that are present in rice, but the CSLC subfamily is expanded from 6 in rice to 12 in maize, and the CSLH subfamily might be reduced from 3 to 1. Unlike rice, maize has a gene in the CSLG subfamily, based on its sequence similarity to two genes annotated as CSLG in poplar. Light regulation of glycan synthase enzyme activities and CSL gene expression were analyzed in the mesocotyl. A Golgi-localized glucan synthase activity is reduced by ~50% 12 h after exposure to light. beta-1,4-Mannan synthase activity is reduced even more strongly (>85%), whereas beta-1,4-xylan synthase, callose synthase, and latent IDPase activity respond only slightly, if at all, to light. At least 17 of the CSL genes (42%) are expressed in the mesocotyl, of which four are up-regulated at least twofold, seven are down-regulated at least twofold, and six are not affected by light. The results contribute to our understanding of the structure of the CSL gene family in an important food and biofuel plant, show that a large percentage of the CSL genes are expressed in the specialized tissues of the mesocotyl, and demonstrate that members of the CSL gene family are differentially subject to photobiological regulation. PMID:19130077

  8. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae

    PubMed Central

    Gaffoor, Iffa; Trail, Frances

    2006-01-01

    Zearalenone, a mycotoxin produced by several Fusarium spp., is most commonly found as a contaminant in stored grain and has chronic estrogenic effects on mammals. Zearalenone is a polyketide derived from the sequential condensation of multiple acetate units by a polyketide synthase (PKS), but the genetics of its biosynthesis are not understood. We cloned two genes, designated ZEA1 and ZEA2, which encode polyketide synthases that participate in the biosynthesis of zearalenone by Gibberella zeae (anamorph Fusarium graminearum). Disruption of either gene resulted in the loss of zearalenone production under inducing conditions. ZEA1 and ZEA2 are transcribed divergently from a common promoter region. Quantitative PCR analysis of both PKS genes and six flanking genes supports the view that the two polyketide synthases make up the core biosynthetic unit for zearalenone biosynthesis. An appreciation of the genetics of zearalenone biosynthesis is needed to understand how zearalenone is synthesized under field conditions that result in the contamination of grain. PMID:16517624

  10. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  11. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  12. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  13. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    PubMed

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  14. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  15. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  16. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  17. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    PubMed

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  18. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    PubMed Central

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2016-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11), and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  19. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  20. Recent Progress on the Construction and Testing of a Fusion Poly(hydroxyalkanoate) Synthase Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoates) (PHAs) are biodegradable polyesters produced by some bacteria. Two genes in Allochromatium vinosum, phaE and phaC, respectively code for the two subunits of the enzyme complex, PHA synthase, which catalyzes the polymerization of precursors into PHA. We hypothesized that by ...

  1. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  2. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  3. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids

    PubMed Central

    Zavala, Kattina; Opazo, Juan C.

    2015-01-01

    Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas). Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense). We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation. PMID:26181912

  4. Perspectives of bacterial ACC deaminase in phytoremediation.

    PubMed

    Arshad, Muhammad; Saleem, Muhammad; Hussain, Sarfraz

    2007-08-01

    Phytoremediation of contaminated soil and water environments is regulated and coordinated by the plant root system, yet root growth is often inhibited by pollutant-induced stress. Prolific root growth could maximize rates of hyperaccumulation of inorganic contaminants or rhizodegradation of organic pollutants, and thus accelerate phytoremediation. Accelerated ethylene production in response to stress induced by contaminants is known to inhibit root growth and is considered as a major limitation in improving phytoremediation efficiency. Recent work shows that bacterial 1-aminocyclopropane-1-carboxylate (ACC) deaminase regulates ethylene levels in plants by metabolizing its precursor ACC into alpha-ketobutyric acid and ammonia. Plants inoculated with ACC deaminase bacteria or transgenic plants that express bacterial ACC deaminase genes can regulate their ethylene levels and consequently contribute to a more extensive root system. Such proliferation of roots in contaminated soil can lead to enhanced uptake of heavy metals or rhizodegradation of xenobiotics. PMID:17573137

  5. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  6. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  7. Identification of 6-Hydroxymellein Synthase and Accessory Genes in the Lichen Cladonia uncialis.

    PubMed

    Abdel-Hameed, Mona; Bertrand, Robert L; Piercey-Normore, Michele D; Sorensen, John L

    2016-06-24

    A transcribed polyketide synthase (PKS) gene has been identified in the lichen Cladonia uncialis. The complete nucleotide sequence of this PKS was determined from the amplified cDNA, and an assignment of individual domains was accomplished by homology searching using AntiSMASH. A scan of the complete genome sequence of C. uncialis revealed the accessory genes associated with this PKS gene. A homology search has identified that several genes in this cluster are similar to genes responsible for the biosynthesis of terrein in Aspergillus terreus. This permitted assignment of putative function to each of the genes in this new C. uncialis cluster. It is proposed that this gene cluster is responsible for the biosynthesis of a halogenated iscoumarin. This is the first report linking a gene cluster to a halogenated metabolite in lichen. PMID:27264554

  8. Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases

    PubMed Central

    Liepman, Aaron H.; Wilkerson, Curtis G.; Keegstra, Kenneth

    2005-01-01

    Glucuronoarabinoxylan, xyloglucan, and galactomannan are noncellulosic polysaccharides found in plant cell walls. All consist of β-linked glycan backbones substituted with sugar side chains. Although considerable progress has been made in characterizing the structure of these polysaccharides, little is known about the biosynthetic enzymes that produce them. Cellulose synthase-like (Csl) genes are hypothesized to encode Golgi-localized β-glycan synthases that polymerize the backbones of noncellulosic polysaccharides. To investigate this hypothesis, we used heterologous expression in Drosophila Schneider 2 (S2) cells to systematically analyze the functions of the gene products of a group of Csl genes from Arabidopsis and rice (Oryza sativa L.), including members from five Csl gene families (CslA, CslC, CslD, CslE, and CslH). Our analyses indicate that several members of the CslA gene family encode β-mannan synthases. Recombinant CslA proteins produce β-linked mannan polymers when supplied GDP-mannose. The same proteins can produce β-linked glucomannan heteropolymers when supplied both GDP-mannose and GDP-glucose. One CslA protein also produced β-linked glucan polymers when supplied GDP-glucose alone. Heterologous expression studies of additional candidate glycan synthases in insect cells or other systems may help identify other noncellulosic polysaccharide biosynthetic enzymes. PMID:15647349

  9. Pleiotropic Effect of AccD5 and AccE5 Depletion in Acyl-Coenzyme A Carboxylase Activity and in Lipid Biosynthesis in Mycobacteria

    PubMed Central

    Bazet Lyonnet, Bernardo; Diacovich, Lautaro; Cabruja, Matías; Bardou, Fabienne; Quémard, Annaïk; Gago, Gabriela; Gramajo, Hugo

    2014-01-01

    Mycobacteria contain a large variety of fatty acids which are used for the biosynthesis of several complex cell wall lipids that have been implicated in the ability of the organism to resist host defenses. The building blocks for the biosynthesis of all these lipids are provided by a fairly complex set of acyl-CoA carboxylases (ACCases) whose subunit composition and roles within these organisms have not yet been clearly established. Previous biochemical and structural studies provided strong evidences that ACCase 5 from Mycobacterium tuberculosis is formed by the AccA3, AccD5 and AccE5 subunits and that this enzyme complex carboxylates acetyl-CoA and propionyl-CoA with a clear substrate preference for the latest. In this work we used a genetic approach to unambiguously demonstrate that the products of both accD5 and accE5 genes are essential for the viability of Mycobacterium smegmatis. By obtaining a conditional mutant on the accD5-accE5 operon, we also demonstrated that the main physiological role of this enzyme complex was to provide the substrates for fatty acid and mycolic acid biosynthesis. Furthermore, enzymatic and biochemical analysis of the conditional mutant provided strong evidences supporting the notion that AccD5 and/or AccE5 have an additional role in the carboxylation of long chain acyl-CoA prior to mycolic acid condensation. These studies represent a significant step towards a better understanding of the roles of ACCases in mycobacteria and confirm ACCase 5 as an interesting target for the development of new antimycobacterial drugs. PMID:24950047

  10. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  11. Coordinate expression of transcriptionally regulated isocitrate lyase and malate synthase genes in Brassica napus L.

    PubMed Central

    Comai, L; Dietrich, R A; Maslyar, D J; Baden, C S; Harada, J J

    1989-01-01

    We have analyzed the temporal and spatial expression of genes encoding the glycoxylate cycle enzymes isocitrate lyase and malate synthase in Brassica napus L. to determine whether they are coordinately expressed. Both enzymes participate in reactions associated with lipid mobilization in oilseed plant seedlings and are sequestered in a specialized organelle, the glyoxysome. We have identified an isocitrate lyase cDNA clone containing the complete protein coding region. RNA blot and in situ hybridization studies with isocitrate lyase and malate synthase cDNA clones from B. napus showed that the genes exhibit similar expression patterns. The mRNAs begin to accumulate during late embryogeny, reach maximal levels in seedling cotyledons, are not detected at significant amounts in leaves, and are distributed similarly in cotyledons and axes of seedlings. Furthermore, transcription studies with isolated nuclei indicate that the genes are controlled primarily although not exclusively at the transcriptional level. We conclude that glyoxysome biogenesis is regulated in part through the coordinate expression of isocitrate lyase and malate synthase genes. PMID:2535504

  12. Isolation and molecular characterization of 1-aminocyclopropane-1-carboxylic acid synthase genes in Hevea brasiliensis.

    PubMed

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1-7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  13. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  14. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  15. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  16. ACC Study Guide Series.

    ERIC Educational Resources Information Center

    Austin Community Coll., TX. Rio Grande Campus.

    Ten one-page instructional guides designed to assist Austin Community College (ACC) students in using the library and in writing research papers are presented in this series. The titles of the guides are: (1) "The Media Collection (We have more than books in the LRC)"; (2) "Encyclopedias"; (3) "Finding Books"; (4) "Finding a Dictionary or…

  17. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  18. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    PubMed

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  19. Functional Analysis of the Polyketide Synthase Genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum)

    PubMed Central

    Gaffoor, Iffa; Brown, Daren W.; Plattner, Ron; Proctor, Robert H.; Qi, Weihong; Trail, Frances

    2005-01-01

    Polyketides are a class of secondary metabolites that exhibit a vast diversity of form and function. In fungi, these compounds are produced by large, multidomain enzymes classified as type I polyketide synthases (PKSs). In this study we identified and functionally disrupted 15 PKS genes from the genome of the filamentous fungus Gibberella zeae. Five of these genes are responsible for producing the mycotoxins zearalenone, aurofusarin, and fusarin C and the black perithecial pigment. A comprehensive expression analysis of the 15 genes revealed diverse expression patterns during grain colonization, plant colonization, sexual development, and mycelial growth. Expression of one of the PKS genes was not detected under any of 18 conditions tested. This is the first study to genetically characterize a complete set of PKS genes from a single organism. PMID:16278459

  20. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. PMID:26611530

  1. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    PubMed

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  2. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  3. Truncating mutation in the nitric oxide synthase 1 gene is associated with infantile achalasia.

    PubMed

    Shteyer, Eyal; Edvardson, Simon; Wynia-Smith, Sarah L; Pierri, Ciro Leonardo; Zangen, Tzili; Hashavya, Saar; Begin, Michal; Yaacov, Barak; Cinamon, Yuval; Koplewitz, Benjamin Z; Vromen, Amos; Elpeleg, Orly; Smith, Brian C

    2015-03-01

    Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1-deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans. PMID:25479138

  4. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  5. Functional Characterization of the Xanthophyllomyces dendrorhous Farnesyl Pyrophosphate Synthase and Geranylgeranyl Pyrophosphate Synthase Encoding Genes That Are Involved in the Synthesis of Isoprenoid Precursors

    PubMed Central

    Niklitschek, Mauricio; Sepúlveda, Dionisia; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor

    2014-01-01

    The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20) in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5) and dimethylallyl pyrophosphate (DMAPP, C5) was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15) synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10) from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to favor

  6. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  7. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    PubMed

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  8. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  9. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae.

    PubMed

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-09-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  10. Isolation of an Arabidopsis thaliana gene encoding cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol synthase by the use of a chromatographic screen.

    PubMed

    Corey, E J; Matsuda, S P; Bartel, B

    1993-12-15

    Whereas vertebrates and fungi synthesize sterols from epoxysqualene through the intermediate lanosterol, plants cyclize epoxysqualene to cycloartenol as the initial sterol. We report the cloning and characterization of CAS1, an Arabidopsis thaliana gene encoding cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A yeast mutant lacking lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7] was transformed with an A. thaliana cDNA yeast expression library, and colonies were assayed for epoxysqualene mutase activity by thin-layer chromatography. One out of approximately 10,000 transformants produced a homogenate that cyclized 2,3-epoxysqualene to the plant sterol cycloartenol. This activity was shown to be plasmid dependent. The plasmid insert contains a 2277-bp open reading frame capable of encoding an 86-kDa protein with significant homology to lanosterol synthase from Candida albicans and squalene-hopene cyclase (EC 5.4.99.-) from Bacillus acidocalcarius. The method used to clone this gene should be generally applicable to genes responsible for secondary metabolite biosynthesis. PMID:7505443

  11. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    PubMed

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (<100 mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; P<0.05), and the slope of the long-term pressure-natriuresis relationship affected significantly the presence of the lanosterol synthase rs2254524 A variant (AA: 0.71±0.22, AC 0.09±0.13, and CC 0.04±0.11 mEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  12. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.

    PubMed

    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K

    2015-09-01

    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology. PMID:26164855

  13. Cloning, sequencing, and enhanced expression of the dihydropteroate synthase gene of Escherichia coli MC4100.

    PubMed Central

    Dallas, W S; Gowen, J E; Ray, P H; Cox, M J; Dev, I K

    1992-01-01

    The Escherichia coli gene coding for dihydropteroate synthase (DHPS) has been cloned and sequenced. The protein has 282 amino acids and a compositional molecular mass of 30,314 daltons. Increased expression of the enzyme was realized by using a T7 expression system. The enzyme was purified and crystallized. A temperature-sensitive mutant was isolated and found to express a DHPS with a lower specific activity and lower affinities for para-aminobenzoic acid and sulfathiazole. The allele had a point mutation that changed a phenylalanine codon to a leucine codon, and the mutation was in a codon that is conserved among published DHPS sequences. Images PMID:1522070

  14. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  15. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  16. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  17. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  18. Acc homoeoloci and the evolution of wheat genomes

    PubMed Central

    Chalupska, D.; Lee, H. Y.; Faris, J. D.; Evrard, A.; Chalhoub, B.; Haselkorn, R.; Gornicki, P.

    2008-01-01

    The DNA sequences of wheat Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, were analyzed with a view to understanding the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Acc-1 and Acc-2 loci from each of the wheats Triticum urartu (A genome), Aegilops tauschii (D genome), Triticum turgidum (AB genome), and Triticum aestivum (ABD genome), as well as two Acc-2-related pseudogenes from T. urartu were sequenced. The 2.3–2.4 Mya divergence time calculated here for the three homoeologous chromosomes, on the basis of coding and intron sequences of the Acc-1 genes, is at the low end of other estimates. Our clock was calibrated by using 60 Mya for the divergence between wheat and maize. On the same time scale, wheat and barley diverged 11.6 Mya, based on sequences of Acc and other genes. The regions flanking the Acc genes are not conserved among the A, B, and D genomes. They are conserved when comparing homoeologous genomes of diploid, tetraploid, and hexaploid wheats. Substitution rates in intergenic regions consisting primarily of repetitive sequences vary substantially along the loci and on average are 3.5-fold higher than the Acc intron substitution rates. The composition of the Acc homoeoloci suggests haplotype divergence exceeding in some cases 0.5 Mya. Such variation might result in a significant overestimate of the time since tetraploid wheat formation, which occurred no more than 0.5 Mya. PMID:18599450

  19. Acc homoeoloci and the evolution of wheat genomes.

    PubMed

    Chalupska, D; Lee, H Y; Faris, J D; Evrard, A; Chalhoub, B; Haselkorn, R; Gornicki, P

    2008-07-15

    The DNA sequences of wheat Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, were analyzed with a view to understanding the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Acc-1 and Acc-2 loci from each of the wheats Triticum urartu (A genome), Aegilops tauschii (D genome), Triticum turgidum (AB genome), and Triticum aestivum (ABD genome), as well as two Acc-2-related pseudogenes from T. urartu were sequenced. The 2.3-2.4 Mya divergence time calculated here for the three homoeologous chromosomes, on the basis of coding and intron sequences of the Acc-1 genes, is at the low end of other estimates. Our clock was calibrated by using 60 Mya for the divergence between wheat and maize. On the same time scale, wheat and barley diverged 11.6 Mya, based on sequences of Acc and other genes. The regions flanking the Acc genes are not conserved among the A, B, and D genomes. They are conserved when comparing homoeologous genomes of diploid, tetraploid, and hexaploid wheats. Substitution rates in intergenic regions consisting primarily of repetitive sequences vary substantially along the loci and on average are 3.5-fold higher than the Acc intron substitution rates. The composition of the Acc homoeoloci suggests haplotype divergence exceeding in some cases 0.5 Mya. Such variation might result in a significant overestimate of the time since tetraploid wheat formation, which occurred no more than 0.5 Mya. PMID:18599450

  20. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  1. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  2. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  3. Transcriptional regulation of the squalene synthase gene (ERG9) in the yeast Saccharomyces cerevisiae.

    PubMed

    Kennedy, M A; Barbuch, R; Bard, M

    1999-04-14

    The ergosterol biosynthetic pathway is a specific branch of the mevalonate pathway. Since the cells requirement for sterols is greater than for isoprenoids, sterol biosynthesis must be regulated independently of isoprenoid biosynthesis. In this study we explored the transcriptional regulation of squalene synthase (ERG9) in Saccharomyces cerevisiae, the first enzyme dedicated to the synthesis of sterols. A mutant search was performed to identify genes that were involved in the regulation of the expression of an ERG9-lacZ promoter fusion. Mutants with phenotypes consistent with known sterol biosynthetic mutations (ERG3, ERG7, ERG24) increased expression of ERG9. In addition, treatment of wild-type cells with the sterol inhibitors zaragozic acid and ketoconazole, which target squalene synthase and the C-14 sterol demethylase respectively, also caused an increase in ERG9 expression. The data also demonstrate that heme mutants increased ERG9 expression while anaerobic conditions decreased expression. Additionally, the heme activator protein transcription factors HAP1 and HAP2/3/4, the yeast activator protein transcription factor yAP-1, and the phospholipid transcription factor complex INO2/4 regulate ERG9 expression. ERG9 expression is decreased in hap1, hap2/3/4, and yap-1 mutants while ino2/4 mutants showed an increase in ERG9 expression. This study demonstrates that ERG9 transcription is regulated by several diverse factors, consistent with the idea that as the first step dedicated to the synthesis of sterols, squalene synthase gene expression and ultimately sterol biosynthesis is highly regulated. PMID:10209263

  4. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  5. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    PubMed Central

    Su, Yanjing; Zhao, Guoqi; Wei, Zhenwu; Yan, Changjie; Liu, Sujiao

    2012-01-01

    Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase) and its wild type (WT) were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p<0.01) and a lower leaf blade proportion (25.21% vs 32.14%, p<0.01) than WT. Chemical composition analysis showed that BM rice straw was significantly (p<0.01) higher in CP (crude protein), hemicellulose and acid insoluble ash (AIA) contents, but lower in dry matter (DM), acid detergent fiber (ADFom) and cellulose contents when compared to WT. No significant difference (p>0.05) was detected in neutral detergent fiber (NDFom) and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05). The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05), but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants. PMID:25049629

  6. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. PMID:26471689

  7. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  8. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  9. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    PubMed

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way. PMID:21847661

  10. Mutations in the gene encoding starch synthase II profoundly alter amylopectin structure in pea embryos.

    PubMed Central

    Craig, J; Lloyd, J R; Tomlinson, K; Barber, L; Edwards, A; Wang, T L; Martin, C; Hedley, C L; Smith, A M

    1998-01-01

    Mutations at the rug5 (rugosus5) locus have been used to elucidate the role of the major soluble isoform of starch synthase II (SSII) in amylopectin synthesis in the developing pea embryo. The SSII gene maps to the rug5 locus, and the gene in one of three rug5 mutant lines has been shown to carry a base pair substitution that introduces a stop codon into the open reading frame. All three mutant alleles cause a dramatic reduction or loss of the SSII protein. The mutations have pleiotropic effects on the activities of other isoforms of starch synthase but apparently not on those of other enzymes of starch synthesis. These mutations result in abnormal starch granule morphology and amylopectin structure. Amylopectin contains fewer chains of intermediate length (B2 and B3 chains) and more very short and very long chains than does amylopectin from wild-type embryos. The results suggest that SSII may play a specific role in the synthesis of B2 and B3 chains of amylopectin. The extent to which these findings can be extrapolated to other species is discussed. PMID:9501114

  11. Cardiovascular roles of nitric oxide: A review of insights from nitric oxide synthase gene disrupted mice†

    PubMed Central

    Liu, Victor W.T.; Huang, Paul L.

    2009-01-01

    Nitric oxide (NO) is a gaseous molecule that plays many key roles in the cardiovascular system. Each of the enzymes that generate NO—neuronal, inducible and endothelial NO synthase—has been genetically disrupted in mice. This review discusses the cardiovascular phenotypes of each of the NO synthase (NOS) gene knockout mice, and the insights gained into the roles of NO in the cardiovascular system. Mice lacking the endothelial isoform are hypertensive, have endothelial dysfunction and show a more severe outcome in response to vascular injury, to stroke and cerebral ischaemia, and to diet-induced atherosclerosis. Mice lacking the neuronal isoform show a less severe outcome in response to stroke and cerebral ischaemia but have increased diet-induced atherosclerosis. Mice lacking the inducible isoform show reduced hypotension to septic shock. Together, NOS gene knockout mice have been useful tools that complement our other approaches to studying the multiple roles of NO in the cardiovascular system. PMID:17658499

  12. Sulfate metabolism in Tuber borchii: characterization of a putative sulfate transporter and the homocysteine synthase genes.

    PubMed

    Zeppa, Sabrina; Marchionni, C; Saltarelli, R; Guidi, C; Ceccaroli, P; Pierleoni, R; Zambonelli, A; Stocchi, V

    2010-04-01

    The homocysteine synthase (tbhos) and putative sulfate transporter (tbsul1) genes have been characterized in order to understand the sulfate metabolism and regulation in the ectomycorrhizal fungus Tuber borchii. The analyses of tbsul1 and tbhos nucleotide and deduced amino acid sequences led to the identification of the typical domains shown in homologous proteins. Sulfate starvation condition upregulates both genes. The real-time PCR assay of tbsul1 revealed that gene expression was about threefold higher in mycelia grown under sulfate starvation for 2 days than in the mycelial control and in the same starvation condition, the sulfate uptake increased. Real-time PCR and enzymatic assays showed regulation of tbhos when sulfur sources were lacking, suggesting that a transcriptional regulation of this gene rather than a post-transcriptional one occurred. Furthermore, the tbsul1 and tbhos expression patterns were evaluated during the truffle life cycle, revealing an over-expression in the mature ascomata for both genes. In the ectomycorrhizal tissue, only tbhos was upregulated suggesting its substantial role in T. borchii cysteine synthesis. The regulation of tbsul1 and tbhos occurs primarily at the transcriptional level both during vegetative and fruiting phases and these genes could be directly involved in VOCs production. PMID:20039042

  13. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  14. Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi

    PubMed Central

    Larson, Erica M.; Idnurm, Alexander

    2010-01-01

    Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding α-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events. PMID:20657649

  15. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    PubMed Central

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  16. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  17. Evolution of ketosynthase domains of polyketide synthase genes in the Cladonia chlorophaea species complex (Cladoniaceae).

    PubMed

    Timsina, Brinda A; Hausner, Georg; Piercey-Normore, Michele D

    2014-11-01

    Lichen-forming fungi synthesize a diversity of polyketides, but only a few non-reducing polyketide synthase (PKS) genes from a lichen-forming fungus have been linked with a specific polyketide. While it is a challenge to link the large number of PKS paralogs in fungi with specific products, it might be expected that the PKS paralogs from closely related species would be similar because of recent evolutionary divergence. The objectives of this study were to reconstruct a PKS gene phylogeny of the Cladonia chlorophaea species complex based on the ketosynthase domain, a species phylogeny of the complex, and to explore the presence of PKS gene paralogs among members of the species complex. DNA was isolated from 51 individuals of C. chlorophaea and allies to screen for the presence of 13 PKS paralogs. A 128 sequence PKS gene phylogeny using deduced amino acid sequences estimated from the 13 PKS paralogs and sequences subjected to BLASTx comparisons showed losses of each of two PKS domains (reducing and methylation). This research provided insight into the evolution of PKS genes in the C. chlorophaea group, species evolution in the group, and it identified potential directions for further investigation of polyketide synthesis in the C. chlorophaea species complex. PMID:25442293

  18. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  19. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  20. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  1. Common polymorphisms in nitric oxide synthase (NOS) genes influence quality of aging and longevity in humans.

    PubMed

    Montesanto, Alberto; Crocco, Paolina; Tallaro, Federica; Pisani, Francesca; Mazzei, Bruno; Mari, Vincenzo; Corsonello, Andrea; Lattanzio, Fabrizia; Passarino, Giuseppe; Rose, Giuseppina

    2013-04-01

    Nitric oxide (NO) triggers multiple signal transduction pathways and contributes to the control of numerous cellular functions. Previous studies have shown in model organisms that the alteration of NO production has important effects on aging and lifespan. We studied in a large sample (763 subjects, age range 19-107 years) the variability of the three human genes (NOS1, -2, -3) coding for the three isoforms of the NADPH-dependent enzymes named NO synthases (NOS) which are responsible of NO synthesis. We have then verified if the variability of these genes is associated with longevity, and with a number of geriatric parameters. We found that gene variation of NOS1 and NOS2 was associated with longevity. In addition NOS1 rs1879417 was also found to be associated with a lower cognitive performance, while NOS2 rs2297518 polymorphism showed to be associated with physical performance. Moreover, SNPs in the NOS1 and NOS3 genes were respectively associated with the presence of depression symptoms and disability, two of the main factors affecting quality of life in older individuals. On the whole, our study shows that genetic variability of NOS genes has an effect on common age related phenotypes and longevity in humans as well as previously reported for model organisms. PMID:23572278

  2. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  3. Sugar-Dependent Gibberellin-Induced Chalcone Synthase Gene Expression in Petunia Corollas.

    PubMed Central

    Moalem-Beno, D.; Tamari, G.; Leitner-Dagan, Y.; Borochov, A.; Weiss, D.

    1997-01-01

    The induction of anthocyanin synthesis and anthocyanin biosynthetic gene expression in detached petunia (Petunia hybrida) corollas by gibberellic acid (GA3) requires sucrose. Neither sucrose nor GA3 alone can induce these processes. We found that GA3 enhances sucrose uptake by 20 to 30%, and we tested whether this is the mechanism by which the hormone induces gene expression. Changing the intracellular level of sucrose with the inhibitors p-chloromercuribenzenesulfonic acid and vanadate did not inhibit the induction of chalcone synthase gene (chs) expression by GA3. Growing detached corollas in various sucrose concentrations did not affect the induction of the gene but did affect its level of expression and the level of anthocyanin accumulated. Only metabolic sugars promoted GA3-induced anthocyanin accumulation. Mannitol and sorbitol had no effect and 3-O-methylglucose only slightly promoted chs expression and anthocyanin accumulation. Our results do not support the suggestion that sugars act as specific signals in the activation of anthocyanin biosynthetic gene expression during petunia corolla development. We suggest that sugars are essential as general sources of carbohydrates for carbon metabolism, upon which the induction of pigmentation is dependent. PMID:12223616

  4. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. PMID:24440296

  5. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    PubMed

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  6. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  7. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    PubMed Central

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K.

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content. PMID:23755054

  8. Associations between Nitric Oxide Synthase Genes and Exhaled NO-Related Phenotypes according to Asthma Status

    PubMed Central

    Bouzigon, Emmanuelle; Monier, Florent; Boussaha, Mekki; Le Moual, Nicole; Huyvaert, Hélène; Matran, Régis; Letort, Sébastien; Bousquet, Jean; Pin, Isabelle; Lathrop, Mark; Kauffmann, Francine; Demenais, Florence; Nadif, Rachel

    2012-01-01

    Background The nitric oxide (NO) pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs) of NO synthase genes (NOS) and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma) and blood eosinophil counts. Methodology SNPs (N = 121) belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA). Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (FeNO), plasma and exhaled breath condensate (EBC) nitrite-nitrate levels (NO2–NO3) and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. Principal Findings In non-asthmatics, after correction for multiple comparisons, we found significant associations of FeNO levels with three SNPs in NOS3 and NOS2 (P≤0.002), and of EBC NO2–NO3 level with NOS2 (P = 0.002). In asthmatics, a single significant association was detected between FeNO levels and one SNP in NOS3 (P = 0.004). Moreover, there was significant heterogeneity of NOS3 SNP effect on FeNO between asthmatics and non-asthmatics (P = 0.0002 to 0.005). No significant association was found between any SNP and NO2–NO3 plasma levels or blood eosinophil counts. Conclusions Variants in NO synthase genes influence FeNO and EBC NO2–NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid. PMID:22590587

  9. Open reading frame 3, which is adjacent to the mycocerosic acid synthase gene, is expressed as an acyl coenzyme A synthase in Mycobacterium bovis BCG.

    PubMed Central

    Fitzmaurice, A M; Kolattukudy, P E

    1997-01-01

    The aim of this study was to test for expression of a 900-bp open reading frame (ORF), ORF3, located at the 5' end of the mycocerosic acid synthase gene in Mycobacterium bovis BCG and to determine the nature of the ORF3 protein. ORF3 was expressed as a 61-kDa C-terminal fusion protein with glutathione S-transferase in Escherichia coli. Polyclonal rabbit antiserum, prepared against this fusion protein, cross-reacted with a 65-kDa protein in M. bovis BCG crude extracts. Since this protein was larger than that predicted from the nucleotide sequence (32 kDa), ORF3 was resequenced, revealing an ORF of 1,749 bp that encodes a 64.8-kDa protein containing 583 amino acids. Reverse transcription-PCR revealed that ORF3 is expressed in M. bovis BCG. The ORF3 product has a high degree of similarity to the acyladenylate family of enzymes. Immunoaffinity absorption chromatography was used to isolate the 65-kDa cross-reacting protein from M. bovis BCG. This purified protein catalyzed coenzyme A (CoA) ester synthesis of n-C10 to n-C18 fatty acids but not mycocerosic acids. ORF3 antibodies severely inhibited acyl-CoA synthase activities of the purified protein and extracts of M. bovis BCG, Mycobacterium smegmatis, and E. coli. They also showed immunological cross-reactivity with proteins in these extracts. Both the ORF3 protein and the acyl-CoA synthase activity were located in the cell cytosol or were loosely associated with the cell membrane. These results indicate that ORF3 encodes an acyl-CoA synthase-like protein. PMID:9098059

  10. Screen for mitochondrial DNA copy number maintenance genes reveals essential role for ATP synthase

    PubMed Central

    Fukuoh, Atsushi; Cannino, Giuseppe; Gerards, Mike; Buckley, Suzanne; Kazancioglu, Selena; Scialo, Filippo; Lihavainen, Eero; Ribeiro, Andre; Dufour, Eric; Jacobs, Howard T

    2014-01-01

    The machinery of mitochondrial DNA (mtDNA) maintenance is only partially characterized and is of wide interest due to its involvement in disease. To identify novel components of this machinery, plus other cellular pathways required for mtDNA viability, we implemented a genome-wide RNAi screen in Drosophila S2 cells, assaying for loss of fluorescence of mtDNA nucleoids stained with the DNA-intercalating agent PicoGreen. In addition to previously characterized components of the mtDNA replication and transcription machineries, positives included many proteins of the cytosolic proteasome and ribosome (but not the mitoribosome), three proteins involved in vesicle transport, some other factors involved in mitochondrial biogenesis or nuclear gene expression, > 30 mainly uncharacterized proteins and most subunits of ATP synthase (but no other OXPHOS complex). ATP synthase knockdown precipitated a burst of mitochondrial ROS production, followed by copy number depletion involving increased mitochondrial turnover, not dependent on the canonical autophagy machinery. Our findings will inform future studies of the apparatus and regulation of mtDNA maintenance, and the role of mitochondrial bioenergetics and signaling in modulating mtDNA copy number. PMID:24952591

  11. The diversity of polyketide synthase genes from sugarcane-derived fungi.

    PubMed

    Rojas, Juan Diego; Sette, Lara Durães; de Araujo, Welington L; Lopes, Mateus Schreiner Garcez; da Silva, Luiziana Ferreira; Furlan, Renata L A; Padilla, Gabriel

    2012-04-01

    The chemical ecology and biotechnological potential of metabolites from endophytic and rhizosphere fungi are receiving much attention. A collection of 17 sugarcane-derived fungi were identified and assessed by PCR for the presence of polyketide synthase (PKS) genes. The fungi were all various genera of ascomycetes, the genomes of which encoded 36 putative PKS sequences, 26 shared sequence homology with β-ketoacyl synthase domains, while 10 sequences showed homology to known fungal C-methyltransferase domains. A neighbour-joining phylogenetic analysis of the translated sequences could group the domains into previously established chemistry-based clades that represented non-reducing, partially reducing and highly reducing fungal PKSs. We observed that, in many cases, the membership of each clade also reflected the taxonomy of the fungal isolates. The functional assignment of the domains was further confirmed by in silico secondary and tertiary protein structure predictions. This genome mining study reveals, for the first time, the genetic potential of specific taxonomic groups of sugarcane-derived fungi to produce specific types of polyketides. Future work will focus on isolating these compounds with a view to understanding their chemical ecology and likely biotechnological potential. PMID:21938508

  12. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  13. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  14. Analysis of gene expression profiles for cell wall modifying proteins and ACC synthases in soybean cyst nematode colonized roots, adventitious rooting hypocotyls, root tips, flooded roots, and IBA and ACC treatment roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We hypothesized that soybean cyst nematode (SCN) co-opts a part or all of one or more innate developmental process in soybean to establish its feeding structure, syncytium, in soybean roots. The syncytium in soybean roots is formed in a predominantly lateral direction within the vascular bundle by ...

  15. Potential impact of a single nucleotide polymorphism in the hyaluronan synthase 1 gene in Waldenstrom's macroglobulinemia.

    PubMed

    Adamia, Sophia; Treon, Steven P; Reiman, Tony; Tournilhac, Olivier; McQuarrie, Carrie; Mant, Michael J; Belch, Andrew R; Pilarski, Linda M

    2005-03-01

    The hyaluronan synthase 1 (HAS1) gene encodes a plasma membrane protein that synthesizes hyaluronan, an extracellular matrix molecule. Previously, in patients with Waldenstrom's macroglobulinemia (WM), we detected upregulation of HAS1 transcripts and identified aberrant splice variants of this gene. Aberrant splicing of HAS1 results from activation of cryptic splice sites. In turn, activation of cryptic donor and acceptor splice sites can be promoted by mutations occurring upstream of these sites and/or at the branch point of slicing. We measured the frequency of the HAS1 833A/G polymorphism (ie, single-nucleotide polymorphism; SNP) in patients with WM and healthy donors. Additionally, HAS1 gene expression was evaluated in the same group of patients. Our observations so far suggest that HAS1 833A/G SNPs contribute to aberrant splicing of this gene; this idea is supported by the fact that 833A/G SNP is located on an exonic splicing enhancer motif. Based on the results obtained thus far, we speculate that individuals with HAS1 833G/G genotype are predisposed toward aberrant HAS1 splicing and expression of HAS1 variants, resulting in an enhanced risk of developing WM. Study of a larger group of patients and healthy donors is needed to confirm these speculations and to evaluate the prognostic significance of these findings. PMID:15794859

  16. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  17. Endothelial nitric oxide synthase gene transfer enhances dilation of newborn piglet pulmonary arteries.

    PubMed

    Aschner, J L; Kovacs, N; Perciaccante, J V; Figueroa, J P; Thrikawala, N; Robins, G S; Busija, D W

    1999-07-01

    We determined the expression and functional correlate of in vitro transfection with a recombinant adenoviral vector encoding the gene for bovine endothelial nitric oxide synthase (AdCMVeNOS) or Escherichia coli beta-galactosidase (AdCMVLacZ) in pulmonary endothelial cells (EC), vascular smooth muscle cells (VSMC), and pulmonary arteries (PA) from newborn piglets. AdCMVeNOS and AdCMVeLacZ vectors, grown in 293-cell monolayers, were purified by double-cesium gradient ultracentrifugation. Cell cultures and PA were incubated with increasing vector titers for 30 or 60 min, followed by incubation in fresh medium for 18 h at 37 degrees C. LacZ expression was assessed by histochemical staining; eNOS expression was evaluated by Western blot analysis. Functional eNOS expression was determined by measurement of cGMP and quantification of the relaxation response to bradykinin (BK). In PA, LacZ transgene expression was preferentially localized to the adventitia and endothelium. Increased eNOS protein expression was observed in EC and VSMC transfected with AdCMVeNOS. Functional studies revealed increased cGMP abundance in cultured cells and enhanced relaxation to BK in AdCMVeNOS-transfected PA. These studies demonstrate that gene transfer with AdCMVeNOS results in functional expression and altered vasoactive responses in the neonatal pulmonary vasculature. Gene transfer with replication-deficient adenovirus vectors is a useful tool for the study of targeted genes in vascular biology. PMID:10409217

  18. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  19. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment.

    PubMed

    Funk, C D; Funk, L B; Kennedy, M E; Pong, A S; Fitzgerald, G A

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A2, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide-derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human--hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and its gene regulation. PMID:1907252

  20. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  1. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  2. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    PubMed Central

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families were identified. Although three NAS genes have been characterized in maize, there is still no systematic identification of maize NAS family by genomic mining. Results In this study, nine NAS genes in maize were identified and their expression patterns in different organs including developing seeds were determined. According to the evolutionary relationship and tissue specific expression profiles of ZmNAS genes, they can be subgrouped into two classes. Moreover, the expression patterns of ZmNAS genes in response to fluctuating metal status were analysed. The class I ZmNAS genes were induced under Fe deficiency and were suppressed under Fe excessive conditions, while the expression pattern of class II genes were opposite to class I. The complementary expression patterns of class I and class II ZmNAS genes confirmed the classification of this family. Furthermore, the histochemical localization of ZmNAS1;1/1;2 and ZmNAS3 were determined using in situ hybridization. It was revealed that ZmNAS1;1/1;2, representing the class I genes, mainly expressed in cortex and stele of roots with sufficient Fe, and its expression can expanded in epidermis, as well as shoot apices under Fe deficient conditions. On the contrary, ZmNAS3, one of the class II genes, was accumulated in axillary meristems, leaf primordia and mesophyll cells. These results suggest that the two classes of ZmNAS genes may be regulated on transcriptional level when responds to various demands for iron uptake, translocation

  3. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  4. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    PubMed Central

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi. PMID:24036343

  5. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    PubMed

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  6. Expression of Allene Oxide Synthase Determines Defense Gene Activation in Tomato1

    PubMed Central

    Sivasankar, Sobhana; Sheldrick, Bay; Rothstein, Steven J.

    2000-01-01

    Allene oxide synthase (AOS; hydroperoxide dehydratase; EC 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we examined the kinetics of AOS induction in response to wounding and elicitors, in parallel with that of the wound-inducible PIN II (proteinase inhibitor II) gene. AOS was induced in leaves by wounding, systemin, 12-oxophytodienoic acid, and methyl jasmonate. The levels of AOS mRNA started declining by 4 h after induction, whereas the levels of PIN II mRNA continued to increase up to 20 h after induction. Salicylic acid inhibited AOS and PIN II expression, and the addition of 12-oxophytodienoic acid or methyl jasmonate did not prevent the inhibition of PIN II expression in the presence of salicylic acid. Ethylene induced the expression of AOS, but the presence of ethylene alone did not produce an optimal induction of PIN II. The addition of silver thiosulfate, an ethylene action inhibitor, prevented the wound-induced expression of both AOS and PIN II. Products of hydroperoxide lyase affected neither AOS nor PIN II, but induced expression of prosystemin. Based on these results, we propose an updated model for defense gene activation in tomato. PMID:10759530

  7. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  8. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    PubMed Central

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-01-01

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos. PMID:25474088

  9. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  10. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P <0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS (P <0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  11. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  12. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    PubMed Central

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  13. The Evolutionary Fate of the Horizontally Transferred Agrobacterial Mikimopine Synthase Gene in the Genera Nicotiana and Linaria

    PubMed Central

    Talianova, Martina; Vyskot, Boris

    2014-01-01

    Few cases of spontaneously horizontally transferred bacterial genes into plant genomes have been described to date. The occurrence of horizontally transferred genes from the T-DNA of Agrobacterium rhizogenes into the plant genome has been reported in the genus Nicotiana and in the species Linaria vulgaris. Here we compare patterns of evolution in one of these genes (a gene encoding mikimopine synthase, mis) following three different events of horizontal gene transfer (HGT). As this gene plays an important role in Agrobacterium, and there are known cases showing that genes from pathogens can acquire plant protection function, we hypothesised that in at least some of the studied species we will find signs of selective pressures influencing mis sequence. The mikimopine synthase (mis) gene evolved in a different manner in the branch leading to Nicotiana tabacum and N. tomentosiformis, in the branch leading to N. glauca and in the genus Linaria. Our analyses of the genus Linaria suggest that the mis gene began to degenerate soon after the HGT. In contrast, in the case of N. glauca, the mis gene evolved under significant selective pressures. This suggests a possible role of mikimopine synthase in current N. glauca and its ancestor(s). In N. tabacum and N. tomentosiformis, the mis gene has a common frameshift mutation that disrupted its open reading frame. Interestingly, our results suggest that in spite of the frameshift, the mis gene could evolve under selective pressures. This sequence may still have some regulatory role at the RNA level as suggested by coverage of this sequence by small RNAs in N. tabacum. PMID:25420106

  14. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (P<0.0001), whereas the frequency of a wild haplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  15. ACC Synthase Genes are Polymorphic in Watermelon (Citrullus spp.) and Differentially Expressed in Flowers and in Response to Auxin and Gibberellin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The flowering pattern of watermelon species (Citrullus) is either monoecious or andromonoecious. In watermelon (Citrullus lanatus L.), ethylene promotes male flower development while inhibitors of ethylene promote pistillate (pistil-bearing) flower formation. This is opposite to the feminizing effec...

  16. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  17. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    PubMed Central

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  18. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    PubMed

    Catone, Mariela V; Ruiz, Jimena A; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  19. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe

    2012-01-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  20. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  1. Association of thymidylate synthase gene polymorphisms with stavudine triphosphate intracellular levels and lipodystrophy.

    PubMed

    Domingo, Pere; Cabeza, M Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M; Mateo, M Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-04-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/10(6) cells (interquartile range [IQR] = 8.12 to 13.87 fmol/10(6) cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/10(6) cells (IQR = 18.90 to 27.0 fmol/10(6) cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  2. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    PubMed

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  3. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  4. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  5. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  6. Chromosomal organization of the inducible and constitutive prostaglandin synthase/cyclooxygenase genes in mouse

    SciTech Connect

    Ping Zi Wen; Warden C.; Fletcher, B.S.; Kujubu, D.A.; Herschman, H.R.; Lusis, A.J. )

    1993-02-01

    Two distinct prostaglandin synthase/cyclooxygenase (PGS/COS) enzymes have recently been recognized. One (EC 1.14.00.1) is largely constitutive and has been characterized in a variety of species, whereas the other (also known as TIS10) is inducible by mitogens and inhibitable by glucocorticoids. Along with activation of phospholipase A2, the latter PGS/COS is likely to mediate ligand-induced prostaglandin production in a variety of cell types. The two enzymes have similar gene structures and activities. There is accumulating evidence that PGS/COX activity may play a role in inflammatory diseases. For example, PGS/COX expression is upregulated in inflammatory joint diseases and is genetically controlled. As part of an effort to examine genetic factors regulating PGS/COX expression and the possible involvement of the enzymes in mouse models of inflammatory disorders, we report here the chromosomal mapping of the genes for the constitutive and regulated PGS/COX enzymes. We will refer to the constitutive enzyme as Pgs-1 and the inducible enzyme as Pgs-2. 14 refs., 1 tab.

  7. Gene transfer of the neuronal NO synthase isoform to cirrhotic rat liver ameliorates portal hypertension

    PubMed Central

    Yu, Qing; Shao, Rong; Qian, Hu Sheng; George, Samuel E.; Rockey, Don C.

    2000-01-01

    Reduced production of nitric oxide (NO) in the cirrhotic liver results from a defect in hepatic endothelial cell nitric oxide synthase (ecNOS) and appears to contribute to the high intrahepatic resistance and portal hypertension typical of cirrhosis. Therefore, we postulated that targeting a heterologous NOS isoform to sinusoidal endothelial cells or other perisinusoidal cells, such as hepatic stellate cells, would counter the defect in NO production and reduce resistance to blood flow. Recombinant adenovirus (Ad) carrying the neuronal NOS gene (nNOS) targeted liver sinusoidal endothelial cells, stellate cells, and hepatocytes more efficiently than the corresponding cells in cirrhotic livers, but transduction rates were substantial even in cirrhotic animals. Expression of nNOS in each liver cell type, whether from normal or injured liver, caused increased NO production and inhibited endothelin-1–induced contractility of perisinusoidal stellate cells. Finally, in 2 different in vivo models of cirrhosis and portal hypertension, transduction of livers with recombinant Ad.nNOS significantly reduced intrahepatic resistance and portal pressure. The data highlight the feasibility of gene transfer to diseased liver and hepatic cells and demonstrate the potential of a novel therapy for portal hypertension caused by cirrhosis. PMID:10727442

  8. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose. PMID:25381910

  9. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  10. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  11. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  12. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  13. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    PubMed

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  14. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    PubMed

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  15. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  16. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    PubMed

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  17. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed Central

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-01-01

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  18. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  19. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    PubMed

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  20. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-06-15

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  1. Endothelial nitric oxide synthase G894T gene polymorphism and response to skin reactive hyperemia.

    PubMed

    Rasool, Aida Hanum Ghulam; Ghazali, Dzuzaini Mohd; Abdullah, Haswati; Halim, Ahmad Sukari; Wong, Abd Rahim

    2009-09-01

    Post occlusive skin reactive hyperemia (PORH) is a tool used to assess microcirculation. Endothelial nitric oxide synthase (eNOS) mediates nitric oxide (NO) production; polymorphism of the eNOS gene may affect response to the PORH process. This study aims to determine whether eNOS G894T gene polymorphism affects response to skin PORH. 230 normotensive male and females between 18 and 40 years participated in this cross-sectional study. 170 subjects were of the homozygous GG genotype, whereas 60 were of the GT genotype. Skin PORH was performed by occlusion of the upper arm at 200 mm Hg for 3 min. Skin perfusion and temperature were monitored before, during and after occlusion release using the laser Doppler fluximetry. There were no significant differences between genotypes in their baseline blood pressure, serum cholesterol, BMI and age. Maximum change in perfusion after occlusion release (PORHmax) for the GG and GT genotypes were not significantly different at 50.15+/-1.29 vs. 47.92+/-2.17 AU; ANCOVA, p=0.351. Peak perfusion (PORHpeak) were also not significantly different between the two genotypes (61.23+/-1.36 vs. 57.72+/-2.32 AU; p=0.169). Minimum baseline perfusion were however higher in the GG compared to the GT genotype (10.83+/-0.29 vs. 9.61+/-0.50, p=0.029). We conclude that microvascular reactivity, assessed by change in perfusion after temporary ischemia was not significantly different between the GG and GT genotypes of the eNOS G894T gene. eNOS 894T allele carriers however, have lower baseline perfusion compared to the homozygous G894 allele carrier. PMID:19481100

  2. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  3. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  4. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  5. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding. PMID:23612253

  6. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  7. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  8. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  9. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  10. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes. PMID:25543026

  11. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    SciTech Connect

    Peng Guiqing; Zhang Fengmin; Zhang Qi; Wu Kailang; Zhu Fan; Wu Jianguo

    2007-09-30

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-{kappa}B) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes.

  12. Characterization and Biological Function of the ISOCHORISMATE SYNTHASE2 Gene of Arabidopsis1[OA

    PubMed Central

    Garcion, Christophe; Lohmann, Antje; Lamodière, Elisabeth; Catinot, Jérémy; Buchala, Antony; Doermann, Peter; Métraux, Jean-Pierre

    2008-01-01

    Salicylic acid (SA) is an important mediator of plant defense response. In Arabidopsis (Arabidopsis thaliana), this compound was proposed to derive mainly from isochorismate, itself produced from chorismate through the activity of ISOCHORISMATE SYNTHASE1 (ICS1). Null ics1 mutants still accumulate some SA, suggesting the existence of an enzymatic activity redundant with ICS1 or of an alternative ICS-independent SA biosynthetic route. Here, we studied the role of ICS2, a second ICS gene of the Arabidopsis genome, in the production of SA. We have shown that ICS2 encodes a functional ICS enzyme and that, similar to ICS1, ICS2 is targeted to the plastids. Comparison of SA accumulation in the ics1, ics2, and ics1 ics2 mutants indicates that ICS2 participates in the synthesis of SA, but in limited amounts that become clearly detectable only when ICS1 is lacking. This unequal redundancy relationship was also observed for phylloquinone, another isochorismate-derived end product. Furthermore, detection of SA in the double ics1 ics2 double mutant that is completely devoid of phylloquinone provides genetic evidence of the existence of an ICS-independent SA biosynthetic pathway in Arabidopsis. PMID:18451262

  13. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  14. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  15. Chitin synthase 3 from yeast has zymogenic properties that depend on both the CAL1 and the CAL3 genes.

    PubMed Central

    Choi, W J; Sburlati, A; Cabib, E

    1994-01-01

    In previous studies, chitin synthase 3 (Chs3), the enzyme responsible for synthesis of most of the chitin present in the yeast cell, was found to be inactivated by incubation with trypsin, in contrast to other yeast chitin synthases (Chs1 and Chs2), which are stimulated by this treatment (chitin synthase; UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyl-transferase, EC 2.4.1.16). It has now been found that the substrate UDPGlcNAc protects Chs3 against proteolytic inactivation. Treatment of Chs3-containing membranes with detergents drastically reduced the enzymatic activity. Activity could, however, be restored by subsequent incubation with trypsin or other proteases in the presence of UDPGlcNAc. Under such conditions, protease treatment stimulated activity as much as 10-fold. A change in divalent cation specificity after trypsin treatment suggests that the protease directly affects the enzyme molecule. Experiments with mutants in the three genes involved in Chs3 activity--CAL1, CAL2, and CAL3--showed that only CAL1 and CAL3 are required for the protease-elicited (zymogenic) activity. It is concluded that Chs3 is a zymogen and that the CAL2 product functions as its activator. The differences and possible similarities between Chs3 and the other chitin synthases are discussed. PMID:8197125

  16. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  17. Insulin inhibits delta-aminolevulinate synthase gene expression in rat hepatocytes and human hepatoma cells.

    PubMed

    Scassa, M E; Varone, C L; Montero, L; Cánepa, E T

    1998-11-01

    Insulin has been known to regulate intracellular metabolism by modifying the activity or location of many enzymes but it is only in the past few years that the regulation of gene expression is recognized to be a major action of this hormone. The present work provides evidences that insulin inhibits delta-aminolevulinate synthase (ALA-S) gene expression, the enzyme which governs the rate-limiting step in heme biosynthesis. The addition of 5 nM insulin to hepatocytes culture led to a significant decrease of both basal and phenobarbital-induced ALA-S mRNA in a dose-dependent manner, as measured by Northern and slot-blot analysis. Several clues as to how insulin regulates ALA-S transcription were determined. The inhibitory effect is achieved at physiological concentrations but much higher proinsulin doses are needed. Insulin's effect is rapid, quite specific, and protein synthesis is not required. Moreover, ALA-S mRNA half-life is not modified by the presence of the peptidic hormone. Our results demonstrate that the insulin effect is dominant; it overrides 8-CPT-cAMP plus phenobarbital-mediated induction. Also, insulin requires the activation of protein kinase C to exert its full effect. On the other hand, a 870-bp fragment of the ALA-S promoter region is able to sustain the inhibition of CAT expression in plasmid-transfected HepG2 cells. Thus, these results indicate that insulin plays an important role in regulating ALA-S expression by inhibiting its transcription. PMID:9806796

  18. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.

    PubMed

    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L

    2014-01-01

    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  19. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  20. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    PubMed

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  1. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles

    PubMed Central

    Toyomasu, Tomonobu; Usui, Masami; Sugawara, Chizu; Kanno, Yuri; Sakai, Arisa; Takahashi, Hirokazu; Nakazono, Mikio; Kuroda, Masaharu; Miyamoto, Koji; Morimoto, Yu; Mitsuhashi, Wataru; Okada, Kazunori; Yamaguchi, Shinjiro; Yamane, Hisakazu

    2015-01-01

    Gibberellins (GAs) are diterpenoid phytohormones that regulate various aspects of plant growth. Tetracyclic hydrocarbon ent-kaurene is a biosynthetic intermediate of GAs, and is converted from geranylgeranyl diphosphate, a common precursor of diterpenoids, via ent-copalyl diphosphate (ent-CDP) through successive cyclization reactions catalysed by two distinct diterpene synthases, ent-CDP synthase and ent-kaurene synthase. Rice (Oryza sativa L.) has two ent-CDP synthase genes, OsCPS1 and OsCPS2. It has been thought that OsCPS1 participates in GA biosynthesis, while OsCPS2 participates in the biosynthesis of phytoalexins, phytocassanes A–E, and oryzalexins A–F. It has been shown previously that loss-of-function OsCPS1 mutants display a severe dwarf phenotype caused by GA deficiency despite possessing another ent-CDP synthase gene, OsCPS2. Here, experiments were performed to account for the non-redundant biological function of OsCPS1 and OsCPS2. Quantitative reverse transcription–PCR (qRT–PCR) analysis showed that OsCPS2 transcript levels were drastically lower than those of OsCPS1 in the basal parts, including the meristem of the second-leaf sheaths of rice seedlings. qRT–PCR results using tissue samples prepared by laser microdissection suggested that OsCPS1 transcripts mainly localized in vascular bundle tissues, similar to Arabidopsis CPS, which is responsible for GA biosynthesis, whereas OsCPS2 transcripts mainly localized in epidermal cells that address environmental stressors such as pathogen attack. Furthermore, the OsCPS2 transgene under regulation of the OsCPS1 promoter complemented the dwarf phenotype of an OsCPS1 mutant, oscps1-1. The results indicate that transcripts of the two ent-CDP synthase genes differentially localize in rice plants according to their distinct biological roles, OsCPS1 for growth and OsCPS2 for defence. PMID:25336684

  2. Localization of the squalene synthase gene (FDFT1) to human chromosome 8p22-p23. 1

    SciTech Connect

    Shechter, I.; Conrad, D.G.; Hart, I.; Berger, R.C.; McKenzie, T.L.; Bleskan, J.; Patterson, D. )

    1994-03-01

    Recently, the authors reported the isolation of a cDNA encoding the human enzyme squalene synthase, the first step of sterol biosynthesis uniquely committed to synthesis of cholesterol. As such, it is likely that this enzyme occupies a critical regulatory position in the synthesis of cholesterol. As part of continuing studies of the role of this gene in cellular metabolism, they undertook the mapping of this gene on the human chromosomes. To localize the gene, they first isolated a yeast artificial chromosome (YAC) containing the squalene synthase gene. They then used fluorescence in situ hybridization (FISH) with yeast DNA containing the YAC to localize the gene to chromosome 8. Assignment to human chromosome 8 was confirmed by polymerase chain reaction analysis of a somatic cell hybrid containing human chromosome 8. Use of a somatic cell hybrid regional mapping panel dividing chromosome 8 into several fragments localized the gene to 8p21-pter. Fractional length analysis of the FISH mapping placed the signal generated with this YAC at 8p22-p23.1. 13 refs., 2 figs.

  3. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  4. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  5. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    PubMed

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  6. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum.

    PubMed

    Zhang, Ya-Zhou; Chen, Qing; Liu, Cai-Hong; Liu, Yu-Bin; Yi, Pan; Niu, Ke-Xin; Wang, Yan-Qing; Wang, An-Qi; Yu, Hai-Yue; Pu, Zhi-En; Jiang, Qian-Tao; Wei, Yu-Ming; Qi, Peng-Fei; Zheng, You-Liang

    2016-05-01

    Fusarium graminearum is the major causal agent of Fusarium head blight (FHB) of wheat and barley and is considered to be one of the most devastating plant diseases worldwide. Chitin is a critical component of the fungal cell wall and is polymerized from UDP-N-acetyl-alpha-D-glucosamine by chitin synthase. We characterized FgCHS8, a new class of the chitin synthase gene in F. graminearum. Disruption of FgCHS8 resulted in reduced accumulation of chitin, decreased chitin synthase activity, and had no effect on conidia growth when compared with the wild-type isolate. ΔFgCHS8 had a growth rate comparable to that of the wild-type isolate in vitro. However, ΔFgCHS8 had reduced growth when grown on agar supplemented with either 0.025% SDS or 0.9 mM salicylic acid. ΔFgCHS8 produced significantly less deoxynivalenol and exhibited reduced pathogenicity in wheat spikes. Re-introduction of a functional FgCHS8 gene into the ΔFgCHS8 mutant strain restored the wild-type phenotypes. Fluorescence microscopy revealed that FgCHS8 protein was initially expressed in the septa zone, and then gradually distributed over the entire cellular membrane, indicating that FgCHS8 was required for cell wall development. Our results demonstrated that FgCHS8 is important for cell wall sensitivity to environmental stress factors and deoxynivalenol production in F. graminearum. PMID:27109372

  7. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    PubMed

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  8. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs. PMID:25189235

  9. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis. PMID:16307364

  10. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    PubMed

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  11. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  12. Polymorphisms of cystathionine beta-synthase gene are associated with susceptibility to sepsis.

    PubMed

    Sponholz, Christoph; Kramer, Marcel; Schöneweck, Franziska; Menzel, Uwe; Inanloo Rahatloo, Kolsoum; Giamarellos-Bourboulis, Evangelos J; Papavassileiou, Vassileios; Lymberopoulou, Korina; Pavlaki, Maria; Koutelidakis, Ioannis; Perdios, Ioannis; Scherag, André; Bauer, Michael; Platzer, Matthias; Huse, Klaus

    2016-07-01

    Sepsis is the systemic inflammatory host response to infection. Cystathionine beta-synthase (CBS)-dependent homocysteine (Hcy) pathway was demonstrated to affect disease severity and mortality in patients with severe sepsis/septic shock. Independent studies identified a single-nucleotide polymorphism (SNP, rs6586282, hg19 chr21:g.44478497C>T) in intron 14 of the CBS-coding gene (CBS) associated with Hcy plasma levels. We aimed to describe the association of this SNP and variants of a splice donor-affecting variable-number tandem repeat (VNTR, NG_008938.1:g.22763_22793[16_22]) 243 bp downstream of rs6586282 with severe human sepsis. We analyzed the VNTR structure and genotyped variants of rs6586282 and a neighboring SNP (rs34758144, hg19 chr21:g.44478582G>A) in two case-control studies including patients with severe sepsis/septic shock from Germany (n=168) and Greece (n=237). In both studies, we consistently observed an association of CBS VNTR alleles with sepsis susceptibility. Risk linearly increased with number of tandem repeats (per allele odds ratio in the adjusted analysis 1.34; 95% confidence interval (CI)=1.17-1.55; P<0.001). Association had also been shown for rs34758144 whose risk allele is in linkage disequilibrium with one long VNTR allele (19 repeat). In contrast, we observed no evidence for an effect on 28-day survival in patients with severe sepsis/septic shock (per allele hazard ratio in the adjusted analysis for VNTR 1.10; 95% CI=0.95-1.28; P=0.20). In a minigene approach, we demonstrated alternative splicing in distinct VNTR alleles, which, however, was independent of the number of tandem units. In conclusion, there is no ordinary conjunction between human CBS and severe sepsis/septic shock, but CBS genotypes are involved in disease susceptibility. PMID:26508567

  13. Effects of feeding transgenic corn with mCry1Ac or maroACC gene to laying hens for 12 weeks on growth, egg quality and organ health.

    PubMed

    Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F

    2016-08-01

    The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar

  14. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  15. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  16. The Maize Gene terpene synthase 1 Encodes a Sesquiterpene Synthase Catalyzing the Formation of (E)-β-Farnesene, (E)-Nerolidol, and (E,E)-Farnesol after Herbivore Damage1

    PubMed Central

    Schnee, Christiane; Köllner, Tobias G.; Gershenzon, Jonathan; Degenhardt, Jörg

    2002-01-01

    Maize (Zea mays) emits a mixture of volatile compounds upon attack by the Egyptian cotton leafworm (Spodoptera littoralis). These substances, primarily mono- and sesquiterpenes, are used by parasitic wasps to locate the lepidopteran larvae, which are their natural hosts. This interaction among plant, lepidopteran larvae, and hymenopteran parasitoids benefits the plant and has been termed indirect defense. The committed step in the biosynthesis of the different skeletal types of mono- and sesquiterpenes is catalyzed by terpene synthases, a class of enzymes that forms a large variety of mono- and sesquiterpene products from prenyl diphosphate precursors. We isolated a terpene synthase gene, terpene synthase 1 (tps1), from maize that exhibits only a low degree of sequence identity to previously identified terpene synthases. Upon expression in a bacterial system, the encoded enzyme produced the acyclic sesquiterpenes, (E)-β-farnesene, (E,E)-farnesol, and (3R)-(E)-nerolidol, the last an intermediate in the formation of (3E)-4,8-dimethyl-1,3,7-nonatriene. Both (E)-β-farnesene and (3E)-4,8-dimethyl-1,3,7-nonatriene are prominent compounds of the maize volatile blend that is emitted after herbivore damage. The biochemical characteristics of the encoded enzyme are similar to those of terpene synthases from both gymnosperms and dicotyledonous angiosperms, suggesting that catalysis involves a similar electrophilic reaction mechanism. The transcript level of tps1 in the maize cv B73 was elevated after herbivory, mechanical damage, and treatment with elicitors. In contrast, the increase in the transcript level of the tps1 gene or gene homolog in the maize cv Delprim after herbivory was less pronounced, suggesting that the regulation of terpene synthase expression may vary among maize varieties. PMID:12481088

  17. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress.

    PubMed

    Xie, D W; Wang, X N; Fu, L S; Sun, J; Zheng, W; Li, Z F

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat-rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae. PMID:25846877

  18. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  19. The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3-beta-D-glucan synthase.

    PubMed Central

    Douglas, C M; Foor, F; Marrinan, J A; Morin, N; Nielsen, J B; Dahl, A M; Mazur, P; Baginsky, W; Li, W; el-Sherbeini, M

    1994-01-01

    In Saccharomyces cerevisiae, mutations in FKS1 confer hypersensitivity to the immunosuppressants FK506 and cyclosporin A, while mutations in ETG1 confer resistance to the cell-wall-active echinocandins (inhibitors of 1,3-beta-D-glucan synthase) and, in some cases, concomitant hypersensitivity to the chitin synthase inhibitor nikkomycin Z. The FKS1 and ETG1 genes were cloned by complementation of these phenotypes and were found to be identical. Disruption of the gene results in (i) a pronounced slow-growth phenotype, (ii) hypersensitivity to FK506 and cyclosporin A, (iii) a slight increase in sensitivity to echinocandin, and (iv) a significant reduction in 1,3-beta-D-glucan synthase activity in vitro. The nucleotide sequence encodes a 215-kDa polypeptide predicted to be an integral membrane protein with 16 transmembrane helices, consistent with previous observations that the etg1-1 mutation results in echinocandin-resistant glucan synthase activity associated with the nonextractable membrane fraction of the enzyme. These results suggest that FKS1 encodes a subunit of 1,3-beta-D-glucan synthase. The residual activity present in the disruption mutant, the nonessential nature of the gene, and results of Southern blot hybridization analysis point to the existence of a glucan synthase isozyme. Images Fig. 1 Fig. 3 Fig. 5 PMID:7528927

  20. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    PubMed

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  1. Evaluating Performance Portability of OpenACC

    SciTech Connect

    Sabne, Amit J; Sakdhnagool, Putt; Lee, Seyong; Vetter, Jeffrey S

    2015-01-01

    Accelerator-based heterogeneous computing is gaining momentum in High Performance Computing arena. However, the increased complexity of the accelerator architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle the problem. While the abstraction endowed by OpenACC offers productivity, it raises questions on its portability. This paper evaluates the performance portability obtained by OpenACC on twelve OpenACC programs on NVIDIA CUDA, AMD GCN, and Intel MIC architectures. We study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.

  2. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  3. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  4. Roles of ceramide synthase and ceramide clearence genes in nilotinib-induced cell death in chronic myeloid leukemia cells.

    PubMed

    Camgoz, Aylin; Gencer, Emel Basak; Ural, Ali Ugur; Avcu, Ferit; Baran, Yusuf

    2011-08-01

    In this study, we aimed to increase the sensitivity of human K562 and Meg-01 chronic myeloid leukemia (CML) cells to nilotinib by targeting bioactive sphingolipids, in addition to investigating the roles of ceramide metabolizing genes in nilotinib induced apoptosis. Cytotoxic effects of nilotinib, C8:ceramide, glucosyle ceramide synthase (GCS) and sphingosine kinase-1 (SK-1) inhibitors were determined by XTT cell proliferation assay and synergism between the agents was determined by isobologram analysis. Also, quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) results demonstrated that expression levels of longevity assurance (LASS) genes in response to nilotinib were correlated with sensitivity to nilotinib. For the first time, The results of this study showed for the first time that nilotinib induces apoptosis through upregulating ceramide synthase genes and downregulating SK-1 in CML cells in addition to inhibition of BCR/ABL. On the other hand, manipulating bioactive sphingolipids toward generation/accumulation of ceramides increased the apoptotic effects of nilotinib in CML cells. PMID:21756066

  5. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    PubMed

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  6. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    PubMed

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  7. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  8. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  9. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  10. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  11. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    PubMed

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions. PMID:25735638

  12. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    PubMed

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  13. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  14. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants.

    PubMed

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  15. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  16. A novel mechanism of dasatinib-induced apoptosis in chronic myeloid leukemia; ceramide synthase and ceramide clearance genes.

    PubMed

    Gencer, Emel B; Ural, Ali U; Avcu, Ferit; Baran, Yusuf

    2011-11-01

    Sphingolipids are bioeffector molecules that control various aspects of cell growth, proliferation, apoptosis, and drug resistance. Ceramides, the central molecule of sphingolipid metabolism, are inducer of apoptosis and inhibitors of proliferation. Sphingosine-1-phosphate (S1P) and glucosyleceramide, converted from ceramides by sphingosine kinase-1 (SK-1) and glucosyleceramide synthase (GCS) enzymes, respectively, inhibit apoptosis and develop resistance to chemotherapeutic drugs. In this study, we examined the therapeutic potentials of bioactive sphingolipids in chronic myeloid leukemia (CML) alone and in combination with dasatinib in addition to investigate the roles of ceramide-metabolizing genes in dasatinib-induced apoptosis. Cytotoxic effects of dasatinib, C8:ceramide, PDMP, and SK-1 inhibitor were determined by XTT cell proliferation assay. Changes in caspase-3 enzyme activity and mitochondrial membrane potential (MMP) were measured using caspase-3 colorimetric assay and JC-1 MMP detection kit. Expression levels of ceramide-metabolizing genes were examined by qRT-PCR. Application of ceramide analogs and inhibitors of ceramide clearance genes decreased cell proliferation and induced apoptosis. Targeting bioactive sphingolipids towards generation/accumulation of ceramides increased apoptotic effects of dasatinib, synergistically. It was shown for the first time that dasatinib induces apoptosis through downregulating expression levels of antiapoptotic SK-1 but not GCS, and upregulating expression levels of ceramide synthase (CerS) genes, especially CerS1, in K562 cells. On the other hand, dasatinib downregulates expression levels of both GCS and SK-1 and upregulate apoptotic CerS2, -5 and -6 genes in Meg-01 cells. Increasing endogenous ceramide levels and decreasing prosurvival lipids, S1P, and GC, can open the way of more effective treatment of CML. PMID:21455605

  17. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  18. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  19. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  20. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  1. Sterol biosynthesis by a prokaryote: first in vitro identification of the genes encoding squalene epoxidase and lanosterol synthase from Methylococcus capsulatus.

    PubMed

    Nakano, Chiaki; Motegi, Akihiro; Sato, Tsutomu; Onodera, Masayuki; Hoshino, Tsutomu

    2007-10-01

    Sterol biosynthesis by prokaryotic organisms is very rare. Squalene epoxidase and lanosterol synthase are prerequisite to cyclic sterol biosynthesis. These two enzymes, from the methanotrophic bacterium Methylococcus capsulatus, were functionally expressed in Escherichia coli. Structural analyses of the enzymatic products indicated that the reactions proceeded in a complete regio- and stereospecific fashion to afford (3S)-2,3-oxidosqualene from squalene and lanosterol from (3S)-2,3-oxidosqualene, in full accordance with those of eukaryotes. However, our result obtained with the putative lanosterol synthase was inconsistent with a previous report that the prokaryote accepts both (3R)- and (3S)-2,3-oxidosqualenes to afford 3-epi-lanosterol and lanosterol, respectively. This is the first report demonstrating the existence of the genes encoding squalene epoxidase and lanosterol synthase in prokaryotes by establishing the enzyme activities. The evolutionary aspect of prokaryotic squalene epoxidase and lanosterol synthase is discussed. PMID:17928701

  2. Regulation of the expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene. Its role in the control of ketogenesis.

    PubMed Central

    Casals, N; Roca, N; Guerrero, M; Gil-Gómez, G; Ayté, J; Ciudad, C J; Hegardt, F G

    1992-01-01

    We have explored the role of mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase in regulating ketogenesis. We had previously cloned the cDNA for mitochondrial HMG-CoA synthase and have now studied the regulation in vivo of the expression of this gene in rat liver. The amount of processed mitochondrial HMG-CoA synthase mRNA is rapidly changed in response to cyclic AMP, insulin, dexamethasone and refeeding, and is greatly increased by starvation, fat feeding and diabetes. We conclude that one point of ketogenic control is exercised at the level of genetic expression of mitochondrial HMG-CoA synthase. Images Fig. 1. Fig. 4. PMID:1348927

  3. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

    2011-01-01

    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  4. Fructose containing sugars modulate mRNA of lipogenic genes ACC and FAS and protein levels of transcription factors ChREBP and SREBP1c with no effect on body weight or liver fat.

    PubMed

    Janevski, Mile; Ratnayake, Sunil; Siljanovski, Svetlana; McGlynn, Maree A; Cameron-Smith, David; Lewandowski, Paul

    2012-02-01

    The aim of this study was to determine the effects of high-glucose, high-fructose and high-sucrose diets on weight gain, liver lipid metabolism and gene expression of proteins involved with hepatic fat metabolism. Rats were fed a diet containing either 60% glucose, 60% fructose, 60% sucrose, or a standard chow for 28 days. Results indicated that high-fructose and high-sucrose diets were associated with higher mRNA levels of gene transcripts involved with fat synthesis; ACC, FAS and ChREBP, with no change in SREBP-1C mRNA. The protein level of ChREBP and SREBP1c was similar in liver homogenates from all groups, but were higher in nuclear fractions from the liver of high-fructose and high-sucrose fed rats. The mRNA level of gene transcripts involved with fat oxidation was the same in all three diets, whilst a high-fructose diet was associated with greater amount of mRNA of the fat transporter CD36. Despite the changes in mRNA of lipogenic proteins, the body weight of animals from each group was the same and the livers from rats fed high-fructose and high-sucrose diets did not contain more fat than control diet livers. In conclusion, changing the composition of the principal monosaccharide in the diet to a fructose containing sugar elicits changes in the level of hepatic mRNA of lipogenic and fat transport proteins and protein levels of their transcriptional regulators; however this is not associated with any changes in body weight or liver fat content. PMID:22159273

  5. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  6. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    PubMed

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene. PMID:26800264

  7. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    PubMed

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  8. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei

    PubMed Central

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-01-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome. PMID:26612679

  9. [Cloning, expression and functional identification of a type III polyketide synthase gene from Huperzia serrata].

    PubMed

    Ye, Jin-cui; Zhang, Ping; Sun, Jie-yin; Guo, Chao-tan; Chen, Guo-shen; Abe, Ikuro; Noguchi, Hiroshi

    2011-10-01

    A cDNA encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. by RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. serrata PKS2. The terminal sequences of cDNA were obtained by the 3'- and 5'-RACE method. The full-length cDNA of H. serrata PKS2 contained a 1212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1, 3-dihydroxy-N-methylacridone. Interestingly, H. serrata PKS2 lacks most of the consensus active site sequences with acridone synthase from Ruta graveolens (Rutaceae). PMID:22242464

  10. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    PubMed

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  11. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  12. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation

    PubMed Central

    Hespeels, Boris; Li, Xiang; Flot, Jean-François; Pigneur, Lise-Marie; Malaisse, Jeremy; Da Silva, Corinne; Van Doninck, Karine

    2015-01-01

    The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS) and seven putative trehalase (TRE) gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP) gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process. PMID:26161530

  13. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  14. Isolation of the facA (acetyl-coenzyme A synthetase) and acuE (malate synthase) genes of Aspergillus nidulans.

    PubMed

    Sandeman, R A; Hynes, M J

    1989-07-01

    Acetate inducible genes of Aspergillus nidulans were cloned via differential hybridization to cDNA probes. Using transformation of mutant strains the genes were identified as facA (acetyl-Coenzyme A synthetase) and acuE (malate synthase). The levels of RNA encoded by these genes were shown to be acetate inducible and subject to carbon catabolite repression. Induction is abolished in a facB mutant and carbon catabolite repression is relieved in a creA mutant. PMID:2571070

  15. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.

    2014-01-01

    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  16. Variants of gene for microsomal prostaglandin E2 synthase show association with disease and severe inflammation in rheumatoid arthritis

    PubMed Central

    Korotkova, Marina; Daha, Nina A; Seddighzadeh, Maria; Ding, Bo; Catrina, Anca I; Lindblad, Staffan; Huizinga, Tom W J; Toes, Rene E M; Alfredsson, Lars; Klareskog, Lars; Jakobsson, Per-Johan; Padyukov, Leonid

    2011-01-01

    Microsomal PGE synthase 1 (mPGES-1) is the terminal enzyme in the induced state of prostaglandin E2 (PGE2) synthesis and constitutes a therapeutic target for rheumatoid arthritis (RA) treatment. We examined the role of the prostaglandin E synthase (PTGES) gene polymorphism in susceptibility to and severity of RA and related variations in the gene to its function. The PTGES gene polymorphism was analyzed in 3081 RA patients and 1900 controls from two study populations: Swedish Epidemiological Investigation of Rheumatoid Arthritis (EIRA) and the Leiden Early Arthritis Clinic (Leiden EAC). Baseline disease activity score (DAS28) was employed as a disease severity measure. mPGES-1 expression was analyzed in synovial tissue from RA patients with known genotypes using immunohistochemistry. In the Swedish study population, among women a significant association with risk for RA was observed for PTGES single-nucleotide polymorphisms (SNPs) in univariate analysis and for the distinct haplotype. These results were substantiated by meta-analysis of data from EIRA and Leiden EAC studies with overall OR 1.31 (95% confidence interval 1.11–1.56). Several PTGES SNPs were associated with earlier onset of disease or with higher DAS28 in women with RA. Patients with the genotype associated with higher DAS28 exhibited significantly higher mPGES-1 expression in synovial tissue. Our data reveal a possible influence of PTGES polymorphism on the pathogenesis of RA and on disease severity through upregulation of mPGES-1 at the sites of inflammation. Genetically predisposed individuals may develop earlier and more active disease owing to this mechanism. PMID:21448233

  17. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  18. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  19. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  20. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    PubMed

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  1. Identification, characterization and functional analysis of a chitin synthase gene in the brown citrus aphid, Toxoptera citricida (Hemiptera, Aphididae).

    PubMed

    Shang, F; Xiong, Y; Xia, W-K; Wei, D-D; Wei, D; Wang, J-J

    2016-08-01

    Chitin synthase (CHS) is a crucial enzyme involved in the final step of the insect chitin biosynthetic pathway. In this study, we cloned the full-length cDNA sequence of a chitin synthase gene (TCiCHS) from the brown citrus aphid, Toxoptera citricida, an important citrus pest and the main vector of citrus tristeza virus worldwide. TCiCHS was expressed during the entire lifecycle and in all insect tissues examined. Expression was highest in first-second-instar nymphs, nymph-adult transitions and in the abdomen (6.7-fold higher than head). Embryos had a higher expression level than the integument. Fourth-instar nymphs were exposed to 5 and 500 mg/l concentrations of the chitin synthesis inhibitor diflubenzuron (DFB) for 48 h and had the highest mortality at the 500 mg/l concentration. The mRNA expression levels of TCiCHS were significantly enhanced upon the exposure of nymphs to both low and high DFB concentrations. Silencing of TCiCHS occurred through plant-mediated double-stranded RNA (dsRNA) feeding. Most dsRNA-fed nymphs were unable to moult to the next stage, and the expression of TCiCHS decreased 48% compared with controls. These results demonstrate that TCiCHS plays an important role in nymph to adult development, is possibly help identify molecular targets for To. citricida control. PMID:26991909

  2. Thymidylate synthase and methylenetetrahy-drofolate reductase gene polymorphisms and gastric cancer susceptibility in a population of Northern Brazil.

    PubMed

    Araújo, M D; Borges, B N; Rodrigues-Antunes, S; Burbano, R M R; Harada, M L

    2015-01-01

    The folate metabolic pathway, which is involved in DNA synthesis and methylation, is associated with individual susceptibility to several diseases, including gastric tumors. In this study, we investigated four polymorphisms [thymidylate synthase enhancer region, single nucleotide polymorphism thymidylate synthase 5' (TS5'), TS3' untranslated region, and methylenetetrahydrofolate reductase (MTHFR) 677C> T] in 2 genes related to the folate pathway, TS and MTHFR, and their possible association with the risk gastric cancer development in a population from Pará state, Brazil. For the TS enhancer region, TS3' untranslated region, and single nucleotide polymorphism TS5' polymorphisms, no significant results were obtained. For the MTHFR 677C>T polymorphism, TT genotype carriers had a higher risk of developing tumors in the antrum (P = 0.19 vs CC and P = 0.02 vs CT) and intestine (odds ratio = 4.18, 95% confidence interval = 0.66-26.41; P = 0.252 vs CC and odds ratio = 2.25, 95% confidence interval = 0.32-15.75; P = 0.725 vs CT). Those carrying at least 1 T allele had an increased risk of lymph node metastasis (odds ratio = 3.00, 95% confidence interval = 0.88-10.12; P = 0.133). Our results suggest that polymorphisms in MTHFR affect the susceptibility to gastric tumors in the Brazilian population and may be a factor causing poor prognosis in such patients. PMID:26345936

  3. Wound-induced terpene synthase gene expression in Sitka spruce that exhibit resistance or susceptibility to attack by the white pine weevil.

    PubMed

    Byun-McKay, Ashley; Godard, Kimberley-Ann; Toudefallah, Morteza; Martin, Diane M; Alfaro, Rene; King, John; Bohlmann, Joerg; Plant, Aine L

    2006-03-01

    We analyzed the expression pattern of various terpene synthase (TPS) genes in response to a wounding injury applied to the apical leader of Sitka spruce (Picea sitchensis Bong. Carr.) genotypes known to be resistant (R) or susceptible (S) to white pine weevil (Pissodes strobi Peck.) attack. The purpose was to test if differences in constitutive or wound-induced TPS expression can be associated with established weevil resistance. All wounding treatments were conducted on 9-year-old R and S trees growing under natural field conditions within the range of variation for weevil R and S genotypes. Representative cDNAs of the monoterpene synthase (mono-TPS), sesquiterpene synthase (sesqui-TPS), and diterpene synthase (di-TPS) classes were isolated from Sitka spruce to assess TPS transcript levels. Based on amino acid sequence similarity, the cDNAs resemble Norway spruce (Picea abies) (-)-linalool synthase (mono-TPS; PsTPS-Linl) and levopimaradiene/abietadiene synthase (di-TPS; PsTPS-LASl), and grand fir (Abies grandis) delta-selinene synthase (sesqui-TPS; PsTPS-Sell). One other mono-TPS was functionally identified as (-)-limonene synthase (PsTPS-Lim). No significant difference in constitutive expression levels for these TPSs was detected between R and S trees. However, over a postwounding period of 16 d, only R trees exhibited significant transcript accumulation for the mono- and sesqui-TPS tested. Both R and S trees exhibited a significant accumulation of PsTPS-LASl transcripts. An assessment of traumatic resin duct formation in wounded leaders showed that both R and S trees responded by forming traumatic resin ducts; however, the magnitude of this response was significantly greater in R trees. Collectively, our data imply that the induced resinosis response is an important aspect of defense in weevil R Sitka spruce trees growing under natural conditions. PMID:16415217

  4. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  5. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    PubMed Central

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  6. Saccharomyces cerevisiae has a single glutamate synthase gene coding for a plant-like high-molecular-weight polypeptide.

    PubMed Central

    Cogoni, C; Valenzuela, L; González-Halphen, D; Olivera, H; Macino, G; Ballario, P; González, A

    1995-01-01

    Purification of the glutamate synthase (GOGAT) enzyme from Saccharomyces cerevisiae showed that it is an oligomeric enzyme composed of three identical 199-kDa subunits. The GOGAT structural gene was isolated by screening a yeast genomic library with a yeast PCR probe. This probe was obtained by amplification with degenerate oligonucleotides designed from conserved regions of known GOGAT genes. The derived amino-terminal sequence of the GOGAT gene was confirmed by direct amino-terminal sequence analysis of the purified protein of 199 kDa. Northern (RNA) analysis allowed the identification of an mRNA of about 7 or 8 kb. An internal fragment of the GOGAT gene was used to obtain null GOGAT mutants completely devoid of GOGAT activity. The results show that S. cerevisiae has a single NADH-GOGAT enzyme, consisting of three 199-kDa monomers, that differs from the one found in prokaryotic microorganisms but is similar to those found in other eukaryotic organisms such as alfalfa. PMID:7836314

  7. Effective treatment of vascular endothelial growth factor refractory hindlimb ischemia by a mutant endothelial nitric oxide synthase gene.

    PubMed

    Qian, H S; Liu, P; Huw, L-Y; Orme, A; Halks-Miller, M; Hill, S M; Jin, F; Kretschmer, P; Blasko, E; Cashion, L; Szymanski, P; Vergona, R; Harkins, R; Yu, J; Sessa, W C; Dole, W P; Rubanyi, G M; Kauser, K

    2006-09-01

    Gene delivery of angiogenic growth factors is a promising approach for the treatment of ischemic cardiovascular diseases. However, success of this new therapeutic principle is hindered by the lack of critical understanding as to how disease pathology affects the efficiency of gene delivery and/or the downstream signaling pathways of angiogenesis. Critical limb ischemia occurs in patients with advanced atherosclerosis often exhibiting deficiency in endothelial nitric oxide production. Similar to these patients, segmental femoral artery resection progresses into severe ischemic necrosis in mice deficient in endothelial nitric oxide synthase (ecNOS-KO) as well as in balb/c mice. We used these models to evaluate the influence of severe ischemia on transfection efficiency and duration of transgene expression in the skeletal muscle following plasmid injection in combination with electroporation. Subsequently, we also explored the potential therapeutic effect of the phosphomimetic mutant of ecNOS gene (NOS1177D) using optimized delivery parameters, and found significant benefit both in ecNOS-KO and balb/c mice. Our results indicate that NOS1177D gene delivery to the ischemic skeletal muscle can be efficient to reverse critical limb ischemia in pathological settings, which are refractory to treatments with a single growth factor, such as vascular endothelial growth factor. PMID:16642030

  8. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    PubMed Central

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  9. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance.

    PubMed

    Miki, B L; Labbé, H; Hattori, J; Ouellet, T; Gabard, J; Sunohara, G; Charest, P J; Iyer, V N

    1990-10-01

    A survey of selected crop species and weeds was conducted to evaluate the inhibition of the enzyme acetohydroxyacid synthase (AHAS) and seedling growth in vitro by the sulfonylurea herbicides chlorsulfuron, DPX A7881, DPX L5300, DPX M6316 and the imidazolinone herbicides AC243,997, AC263,499, AC252,214. Particular attention was given to the Brassica species including canola cultivars and cruciferous weeds such as B. kaber (wild mustard) and Thlaspi arvense (stinkweed). Transgenic lines of B. napus cultivars Westar and Profit, which express the Arabidopsis thaliana wild-type AHAS gene or the mutant gene csr1-1 at levels similar to the resident AHAS genes, were generated and compared. The mutant gene was essential for resistance to the sulfonylurea chlorsulfuron but not to DPX A7881, which appeared to be tolerated by certain Brassica species. Cross-resistance to the imidazolinones did not occur. The level of resistance to chlorsulfuron in transgenic canola greatly exceeded the levels that were toxic to the Brassica species or cruciferous weeds. Direct selection of transgenic lines with chlorsulfuron sprayed at field levels under greenhouse conditions was achieved. PMID:24221001

  10. Cloning and functional analysis of the promoter of a maize starch synthase III gene (ZmDULL1).

    PubMed

    Wu, J D; Jiang, C P; Zhu, H S; Jiang, H Y; Cheng, B J; Zhu, S W

    2015-01-01

    The ZmDULL1 gene encodes a starch synthase and is a determinant of the structure of endosperm starch in maize (Zea mays L.). However, little is known regarding the regulatory mechanism of the ZmDULL1 gene. In this study, we isolated and characterized the ZmDULL1 promoter (PDULL1), which is the 5' flanking region of ZmDULL1 in maize. Sequence analysis showed that several cis-acting elements important for endosperm expression (GCN4_motif and AACA-element) were located within the promoter. A series of PDULL1 deletion derivatives, PDULL1-1-PDULL1-4, from the translation start code (-1676, -1216, -740, and -343) were fused to the β-glucuronidase (GUS) reporter gene. Each deletion construct was transformed into rice using the Agrobacterium-mediated method, and then GUS activity was measured in transgenic plants. The results showed that PDULL1 was an endosperm-specific promoter. Further analysis showed that the promoter sequence (-343 to -1 base pairs) was sufficient for mediating GUS gene expression in endosperm. These results indicate that the region from -343 to -1 base pairs of PDULL1 is valuable for transgenic rice breeding and genetic engineering studies. PMID:26125743

  11. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    PubMed

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  12. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    PubMed

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves. PMID:17582515

  13. Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

    PubMed Central

    Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

    1989-01-01

    We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

  14. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  15. The significance and effect of tandem repeats within the Mycobacterium tuberculosis leuA gene on alpha-isopropylmalate synthase.

    PubMed

    Chanchaem, Wimon; Palittapongarnpim, Prasit

    2008-09-01

    The 57-bp tandem repeats located in the Mycobacterium tuberculosis leuA gene code for the alpha-isopropylmalate synthase (alpha-IPMS). It is unique to this pathogen. It was previously demonstrated that the leuA-coding sequence Rv3710, containing the tandem repeats, can be translated to an active alpha-IPMS. The objective of the present study was to investigate the significance and effect of the two 57-bp tandem repeats upon gene expression and the general properties of alpha-IPMS. The putative M. tuberculosis H37Rv leuA gene with and without the tandem repeats was cloned by PCR and expressed in an Escherichia coli host. The enzyme product was studied for general properties, comparing that from a native leuA gene containing two repeats and that from the 57-bp tandem repeats deletion mutant. Upon deletion of the two 57-bp tandem repeats, the expression level of leuA from M. tuberculosis H37Rv was comparable with that of the native form. The general properties of the two types of enzymes were similar. They were both functional with the same range of optimal temperature and optimal pH for activity and with similar enzyme stability. Deletion of the repeats had no detectable effect on leuA expression level or the general properties of the enzyme product. PMID:18647358

  16. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    PubMed

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  17. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum.

    PubMed

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-08-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  18. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    PubMed

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  19. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  20. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  1. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    PubMed

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. PMID:26839981

  2. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L.) as examples

    PubMed Central

    2010-01-01

    Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx) genes and four genome-specific primer sets for the starch synthase II (SSII) genes were developed mainly from single nucleotide polymorphisms (SNPs) and/or insertions or deletions (Indels) in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D) could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx and SSII genes in natural

  3. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.

    2002-01-01

    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills Attached Labs"; (5)…

  4. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    PubMed Central

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes. PMID:25784918

  5. Longiborneol Synthase Gene from Fusarium Graminearum is Required for Culmorin Biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A sesquiterpene cyclase gene, fg10397, was found in a Fusarium graminearum cDNA library that was previously used to identify trichothecene and butenolide biosynthetic genes. Gene disruption and add-back experiments showed that fg10397 was required for culmorin biosynthesis. Expression of fg10397 in...

  6. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla

    2016-01-01

    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  7. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  8. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life

    PubMed Central

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  9. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed Central

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  10. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  11. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

    2015-01-01

    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  12. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae.

    PubMed

    Müller, Christian; Hansen, Kim; Szabo, Peter; Nielsen, Jens

    2003-03-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3.4-22.5 g kg(-1) biomass) and the power-law model adequately described the rheological properties. In the cultivations there were pellets, clumps, and freely dispersed hyphal elements. The different morphological fractions were quantified using image analysis. The apparent viscosity of the fermentation broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. PMID:12514801

  13. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    PubMed

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  14. Analysis of 6-pyruvyl tetrahydropterin synthase, a target gene product of su(s) suppressor in Drosophila

    SciTech Connect

    Yim, J.J.; Park, Y.S.; Kim, J.H.; Jacobson, K.B. . Dept. of Microbiology; Oak Ridge National Lab., TN )

    1989-01-01

    Of the 20 suppressor mutants listed in Drosophila, su(s){sup 2} has been studied for the biochemical characterization of the suppression. In su(s){sup 2} suppression, some mutants at vermilion (v, 1-33.0), sable (s, 1-43.0), speck (sp, 2-107.0), and purple (pr, 2-54.5) are suppressible by mutants at the suppressor of sable (su(s)) locus. There have been many reports of suppression mechanism studies in purple led to purple loci. The biochemical studies in purple led to in vitro demonstration of a su(s){sup +} gene product as a negative effector against suppressed purple PPH{sub 4} synthase, which has been also demonstrated in the gene product of vermilion more recently. Both studies led to a proposal for a posttranslational mechanism in which the su(s){sup +} gene produces a substance that interferes with the function of the target enzymes from the purple and vermilion mutant. In contrast to the transcriptional regulation of the su(s) locus the posttranslational mechanism is based on qualitative differences between wild and suppressed enzyme. Therefore this investigation was to determine if any quantitative or qualitative differences exist between the mutant and wild type target enzymes. 7 refs., 4 figs.

  15. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  16. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  17. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    PubMed Central

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  18. The Tomato E8 Gene Influences Ethylene Biosynthesis in Fruit but Not in Flowers.

    PubMed Central

    Kneissl, M. L.; Deikman, J.

    1996-01-01

    We investigated the function of the tomato (Lycopersicon esculentum) E8 gene. Previous experiments in which antisense suppression of E8 was used suggested that the E8 protein has a negative effect on ethylene evolution in fruit. E8 is expressed in flowers as well as in fruit, and its expression is high in anthers. We introduced a cauliflower mosaic virus 35S-E8 gene into tomato plants and obtained plants with overexpression of E8 and plants in which E8 expression was suppressed due to co-suppression. Overexpression of E8 in unripe fruit did not affect the level of ethylene evolution during fruit ripening; however, reduction of E8 protein by cosuppression did lead to elevated levels during ripening. Levels for ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), and ACC oxidase mRNA were increased approximately 7-fold in fruit of plants with reduced E8 protein. Levels of ACC synthase 2 mRNA were increased 2.5-fold, and ACC synthase 4 mRNA was not affected. Reduction of E8 protein in anthers did not affect the accumulation of ACC or of mRNAs encoding enzymes involved in ethylene biosynthesis. Our results suggest that the product of the E8 reaction participates in feedback regulation of ethylene biosynthesis during fruit ripening. PMID:12226407

  19. Inadvertent gene silencing of argininosuccinate synthase (bcass1) in Botrytis cinerea by the pLOB1 vector system.

    PubMed

    Patel, Risha M; Van Kan, Jan A L; Bailey, Andy M; Foster, Gary D

    2010-09-01

    For several years, researchers working on the plant pathogen Botrytis cinerea and a number of other related fungi have routinely used the pLOB1 vector system, based on hygromycin resistance, under the control of the Aspergillus nidulans oliC promoter and what was reported to be the beta-tubulin (tubA) terminator. Recently, it has been demonstrated that this vector contains a 446-bp portion of the B. cinerea argininosuccinate synthase gene (bcass1) rather than the tubA terminator. As argininosuccinate synthase is essential for the production of L-arginine, inadvertent gene silencing of bcass1 may result in partial L-arginine auxotrophy and, indeed, may lead to altered phenotypes in planta. In this article, we report our findings relating to possible problems arising from this incorrect plasmid construction. As an absolute baseline, gene disruption of bcass1 was carried out and generated a strict auxotroph, unable to grow without exogenous arginine supplementation. The knockout displayed an alteration in host range in planta, showing a reduction in pathogenicity on strawberries, French bean leaves and tomatoes, but maintained wild-type growth on grape, which is in accordance with the reported arginine availability in such tissues. Deliberate gene silencing of bcass1 mirrored these effects, with strongly silenced lines showing reduced virulence. The degree of silencing as seen by partial auxotrophy was correlated with an observed reduction in virulence. We also showed that inadvertent silencing of bcass1 is possible when using the pLOB1 vector or derivatives thereof. Partial arginine auxotrophy and concomitant reductions in virulence were triggered in approximately 6% of transformants obtained when expressing enhanced green fluorescent protein, luciferase, monomeric red fluorescent protein or beta-glucuronidase using the pLOB1-based expression system, which inadvertently contains 446 bp of the bcass1 coding sequence. We recommend the testing of transformants obtained

  20. Functional Genomic Analysis Supports Conservation of Function Among Cellulose Synthase-Like A Gene Family Members and Suggests Diverse Roles of Mannans in Plants1[W][OA

    PubMed Central

    Liepman, Aaron H.; Nairn, C. Joseph; Willats, William G.T.; Sørensen, Iben; Roberts, Alison W.; Keegstra, Kenneth

    2007-01-01

    Mannan polysaccharides are widespread among plants, where they serve as structural elements in cell walls, as carbohydrate reserves, and potentially perform other important functions. Previous work has demonstrated that members of the cellulose synthase-like A (CslA) family of glycosyltransferases from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze β-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced in insect cells, and each CslA protein catalyzed mannan and glucomannan synthase reactions in vitro. Microarray mining and quantitative real-time reverse transcription-polymerase chain reaction analysis demonstrated that transcripts of Arabidopsis and loblolly pine (Pinus taeda) CslA genes display tissue-specific expression patterns in vegetative and floral tissues. Glycan microarray analysis of Arabidopsis indicated that mannans are present throughout the plant and are especially abundant in flowers, siliques, and stems. Mannans are also present in chloronemal and caulonemal filaments of Physcomitrella patens, where they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall structure and carbohydrate storage. PMID:17307900

  1. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  2. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    SciTech Connect

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  3. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel That Evolved by Gene Duplication

    PubMed Central

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα)8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys)3Zn site in the related enzymes, MetH and betaine–homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E·Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer. PMID:15630480

  4. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  5. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs. PMID:24211386

  6. Development of a gene delivery system in Streptococcus gordonii using thymidylate synthase as a selection marker.

    PubMed

    Lee, Song F; Hulbah, Maram; Halperin, Scott A

    2016-06-01

    Streptococcus gordonii, a commensal bacterium of the human oral cavity, is a potential live vaccine vector. In this study, we have developed a system that delivers a vaccine antigen gene onto the chromosome of S. gordonii. The system consisted of a recipient strain, that is a thymidine auxotroph constructed by deletion of a portion of thyA gene, and a linear gene delivery construct, composed of the functional thyA gene, the vaccine antigen gene, and a DNA fragment immediately downstream of thyA. The construct is assembled by a ligation and polymerase chain reaction strategy. Upon introduction into the thyA mutant, the vaccine antigen gene integrated into the chromosome via a double crossing-over event. Using the above strategy, a test vaccine antigen gene coding for a fusion protein composed of the Bordetella pertussis filamentous hemagglutinin type I domain and the single chain antibody against complement receptor 1 was successfully delivered to S. gordonii. The resulting S. gordonii expressed the fusion protein and the delivered gene was stable in the bacterium in vitro and in a mouse colonization experiment. Mice colonized by the fusion protein-expressing S. gordonii developed antibodies that recognized the native filamentous hemagglutinin protein suggesting that an immune response was elicited. PMID:27062990

  7. Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer

    SciTech Connect

    Hur, Hyuk; Kang, Jeonghyun; Kim, Nam Kyu; Min, Byung Soh; Lee, Kang Young; Shin, Sang Joon; Keum, Ki Chang; Choi, Junjeong; Kim, Hoguen; Choi, Sung Ho; Lee, Mi-Young

    2011-11-01

    Purpose: This study aims to correlate thymidylate synthase (TS) gene polymorphisms with the tumor response to preoperative 5-fluorouracil (5-FU)-based chemoradiation therapy (CRT) in patients with rectal cancer. Methods and Materials: Forty-four patients with rectal cancer treated with 5-FU-based preoperative CRT were prospectively enrolled in this study. Thymidylate synthase expression and TS gene polymorphisms were evaluated in tumor obtained before preoperative CRT and were correlated with the pathologic response, as assessed by histopathologic staging (pTNM) and tumor regression grade. Results: Patients exhibited 2R/3R and 3R/3R tandem repeat polymorphisms in the TS gene. With regard to TS expression in these genotypes, 2R/3RC and 3RC/3RC were defined as the low-expression group and 2R/3RG, 3RC/3RG, and 3RG/3RG as the high-expression group. There was no significant correlation between TS expression and tumor response. There was no significant difference in the tumor response between patients homozygous for 3R/3R and patients heterozygous for 2R/3R. However, 13 of 14 patients in the low-expression group with a G>C single-nucleotide polymorphism (SNP) (2R/3RC [n = 5] or 3RC/3RC [n = 9]) exhibited a significantly greater tumor downstaging rate, as compared with only 12 of 30 patients in the high-expression group without the SNP (2R/3RG [n = 10], 3RC/3RG [n = 9], or 3RG/3RG [n = 11]) (p = 0.001). The nodal downstaging rate was also significantly greater in this low-expression group, as compared with the high-expression group (12 of 14 vs. 14 of 30, p = 0.014). However, there was no significant difference in the tumor regression grade between these groups. Conclusions: This study suggests that SNPs within the TS enhancer region affect the tumor response to preoperative 5-FU-based CRT in rectal cancer.

  8. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  9. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    SciTech Connect

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  10. Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1

    PubMed Central

    Wang, Liuqing; Wang, Yan; Wang, Qi; Liu, Fei; Selvaraj, Jonathan Nimal; Liu, Lingna; Xing, Fuguo; Zhao, Yueju; Zhou, Lu; Liu, Yang

    2015-01-01

    Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the β-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production. PMID:26213966

  11. Analysis of human hyaluronan synthase gene transcriptional regulation and downstream hyaluronan cell surface receptor mobility in myofibroblast differentiation.

    PubMed

    Midgley, Adam C; Bowen, Timothy

    2015-01-01

    The ubiquitous extracellular glycosaminoglycan hyaluronan (HA) is a polymer composed of repeated disaccharide units of alternating D-glucuronic acid and D-N-acetylglucosamine residues linked via alternating β-1,4 and β-1,3 glycosidic bonds. Emerging data continue to reveal functions attributable to HA in a variety of physiological and pathological contexts. Defining the mechanisms regulating expression of the human hyaluronan synthase (HAS) genes that encode the corresponding HA-synthesizing HAS enzymes is therefore important in the context of HA biology in health and disease. We describe here methods to analyze transcriptional regulation of the HAS and HAS2-antisense RNA 1 genes. Elucidation of mechanisms of HA interaction with receptors such as the cell surface molecule CD44 is also key to understanding HA function. To this end, we provide protocols for fluorescent recovery after photobleaching analysis of CD44 membrane dynamics in the process of fibroblast to myofibroblast differentiation, a phenotypic transition that is common to the pathology of fibrosis of large organs such as the liver and kidney. PMID:25325984

  12. Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

    PubMed

    Zhu, L

    2015-01-01

    We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion. PMID:26345779

  13. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  14. Polyketide Synthase Gene Diversity within the Microbiome of the Sponge Arenosclera brasiliensis, Endemic to the Southern Atlantic Ocean

    PubMed Central

    Trindade-Silva, Amaro E.; Rua, Cintia P. J.; Andrade, Bruno G. N.; Vicente, Ana Carolina Paulo; Silva, Genivaldo G. Z.

    2013-01-01

    Microbes associated with marine sponges are considered important producers of bioactive, structurally unique polyketides. The synthesis of such secondary metabolites involves type I polyketide synthases (PKSs), which are enzymes that reach a maximum complexity degree in bacteria. The Haplosclerida sponge Arenosclera brasiliensis hosts a complex microbiota and is the source of arenosclerins, alkaloids with cytotoxic and antibacterial activity. In the present investigation, we performed high-throughput sequencing of the ketosynthase (KS) amplicon to investigate the diversity of PKS genes present in the metagenome of A. brasiliensis. Almost 4,000 ketosynthase reads were recovered, with about 90% annotated automatically as bacterial. A total of 235 bacterial KS contigs was rigorously assembled from this sequence pool and submitted to phylogenetic analysis. A great diversity of six type I PKS groups has been consistently detected in our phylogenetic reconstructions, including a novel and A. brasiliensis-exclusive group. Our study is the first to reveal the diversity of type I PKS genes in A. brasiliensis as well as the potential of its microbiome to serve as a source of new polyketides. PMID:23275501

  15. Normal responses to restraint stress in mice lacking the gene for neuronal nitric oxide synthase.

    PubMed

    Weissman, Ben A; Sottas, Chantal M; Holmes, Michael; Zhou, Ping; Iadecola, Costantino; Hardy, Dianne O; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in this suppression, but the evidence has not been conclusive. We used adult wild-type (WT) and nNOS knockout male mice (nNOS-/-) to assess the respective roles of CORT and nNOS-derived NO in stress mediated inhibition of T production. Animals were assigned to either basal control or 3-hour IMO groups. No difference in basal plasma and testicular T levels were observed between WT and nNOS-/-, although testicular weights of mutant mice were slightly lower compared to WT animals. The plasma contents of luteinizing hormone (LH) and CORT in unstressed mice of both genotypes were similar. Exposure to 3 hours of IMO increased plasma CORT and decreased T concentrations in mice of both genotypes. However, comparable levels of plasma LH and testicular nitrite and nitrate (NOx), NO stable metabolites, were detected in control and stressed WT and nNOS-/- mice. Adrenal concentrations of NOx declined after IMO, but the reduction was not statistically significant. These findings implicate CORT rather than NO generated by nNOS in the rapid stress-induced suppression of circulating T. PMID:19304728

  16. Inducible nitric oxide synthase gene expression in brain following cerebral ischemia

    SciTech Connect

    Iadecola, C.; Zhang, Fangyi; Xu, S.

    1995-05-01

    Cerebral ischemia is followed by a local inflammatory response that is thought to participate in the extension of the tissue damage occurring in the postischemic period. However, the mechanisms whereby the inflammation contributes to the progression of the damage have not been fully elucidated. In models of inflammation, expression of the inducible isoform of nitric oxide synthase (iNOS) is responsible for cytotoxicity through the production of large amounts of nitric oxide (NO). In this study, therefore, we sought to establish whether iNOS is expressed in the ischemic brain. Rats were killed 6 h to 7 days after occlusion of the middle cerebral artery. iNOS expression in the ischemic area was determined by reverse-transcription polymerase chain reaction. Porphobilinogen deaminase mRNA was detected in the same sample and used for normalization. In the ischemic brain, there was expression of iNOS mRNA that began at 12 h, peaked at 48 h, and returned to baseline at 7 days (n = 3/time point). iNOS mRNA expression paralleled the time course of induction of iNOS catalytic activity, determined by the citrulline assay (17.4 {+-} 4.4 pmol citrulline/{mu}g protein/min at 48 h; mean {+-} SD; n = 5 per time point). iNOS immunoreactivity was seen in neutrophils at 48-96 h after ischemia. The data provide molecular, biochemical, and immunocytochemical evidence of iNOS induction following focal cerebral ischemia. These findings, in concert with our recent demonstration that inhibition of iNOS reduces infarct volume in the same stroke model, indicate that NO production may play an important pathogenic role in the progression of the tissue damage that follows cerebral ischemia. 35 refs., 3 figs.

  17. Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.

    PubMed Central

    Richter, G; Volk, R; Krieger, C; Lahm, H W; Röthlisberger, U; Bacher, A

    1992-01-01

    3,4-Dihydroxy-2-butanone 4-phosphate is biosynthesized from ribulose 5-phosphate and serves as the biosynthetic precursor for the xylene ring of riboflavin. The gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli has been cloned and sequenced. The gene codes for a protein of 217 amino acid residues with a calculated molecular mass of 23,349.6 Da. The enzyme was purified to near homogeneity from a recombinant E. coli strain and had a specific activity of 1,700 nmol mg-1 h-1. The N-terminal amino acid sequence and the amino acid composition of the protein were in agreement with the deduced sequence. The molecular mass as determined by ion spray mass spectrometry was 23,351 +/- 2 Da, which is in agreement with the predicted mass. The previously reported loci htrP, "luxH-like," and ribB at 66 min of the E. coli chromosome are all identical to the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase, but their role had not been hitherto determined. Sequence homology indicates that gene luxH of Vibrio harveyi and the central open reading frame of the Bacillus subtilis riboflavin operon code for 3,4-dihydroxy-2-butanone 4-phosphate synthase. Images PMID:1597419

  18. Analysis of the mitochondrial ATP synthase beta-subunit gene in Drosophilidae: structure, transcriptional regulatory features and developmental pattern of expression in Drosophila melanogaster.

    PubMed Central

    Peña, P; Ugalde, C; Calleja, M; Garesse, R

    1995-01-01

    We have cloned and determined the structure of the gene encoding the H(+)-ATP synthase beta subunit in two distantly related Drosophila species, D. melanogaster and D. virilis. The gene contains three exons that are extremely well conserved at the amino acid level, not only in the region encoding the mature protein but also in that encoding the leader peptide. Primer extension analysis indicates that the 5' untranslated region is extremely short, and reveals the presence of multiple initiation sites of transcription in both Drosophila species. The promoters of D. melanogaster and D. virilis H(+)-ATP synthase beta-subunit genes contain a conserved region surrounding the initiation transcription sites. Nucleotide sequence analysis has revealed the absence of canonical TATA and CCAAT boxes and the presence of several putative regulatory elements in both promoter regions, including GAGA, GATA and Ets binding sites. We have analysed the pattern of gene expression during D. melanogaster development. The mRNA is stored in oocytes, and activation of transcription takes place after 10 h of development. The expression of the nuclear-encoded H(+)-ATP synthase beta subunit is strictly coordinated with the expression of subunits 6 and 8 of the same complex that are encoded in the mitochondrial genome. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:8554535

  19. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  20. GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.).

    PubMed

    Cai, Caiping; Zhang, Xueying; Niu, Erli; Zhao, Liang; Li, Nina; Wang, Liman; Ding, Linyun; Guo, Wangzhen

    2014-08-01

    Carotenoids are important accessory pigments in plants that are essential for photosynthesis. Phytoene synthase (PSY), a rate-controlling enzyme in the carotenoid biosynthesis pathway, has been widely characterized in rice, maize, and sorghum, but at present there are no reports describing this enzyme in cotton. In this study, GhPSY was identified as a candidate gene for the red plant phenotype via a combined strategy using: (1) molecular marker data for loci closely linked to R1; (2) the whole-genome scaffold sequence from Gossypium raimondii; (3) gene expression patterns in cotton accessions expressing the red plant and green plant phenotypes; and (4) the significant correlation between a single nucleotide polymorphisms (SNP) in GhPSY and leaf phenotypes of progeny in the (Sub16 × T586) F2 segregating population. GhPSY was relatively highly expressed in leaves, and the protein was localized to the plastid where it appeared to be mostly attached to the surface of thylakoid membranes. GhPSY mRNA was expressed at a significantly higher level in T586 and SL1-7-1 red plants than TM-1 and Hai7124 green plants. SNP analysis in the GhPSY locus showed co-segregation with the red and green plant phenotypes in the (Sub16 × T586) F2 segregating population. A phylogenetic analysis showed that GhPSY belongs to the PSY2 subfamily, which is related to photosynthesis in photosynthetic tissues. Using a reverse genetics approach based on Tobacco rattle virus-induced gene silencing, we showed that the knockdown of GhPSY caused a highly uniform bleaching of the red color in newly-emerged leaves in both T586 and SL1-7-1 plants with a red plant phenotype. These findings indicate that GhPSY is important for engineering the carotenoid metabolic pathway in pigment production. PMID:24718783

  1. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    PubMed

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  2. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    PubMed

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  3. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    PubMed

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited < 50% by a 48-h treatment with 100 microM Al in calcium chloride solution. Roots of P. falcataria and A. mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  4. Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development.

    PubMed

    Arakane, Yasuyuki; Hogenkamp, David G; Zhu, Yu Cheng; Kramer, Karl J; Specht, Charles A; Beeman, Richard W; Kanost, Michael R; Muthukrishnan, Subbaratnam

    2004-03-01

    Two chitin synthase (CHS) genes of the red flour beetle, Tribolium castaneum, were sequenced and their transcription patterns during development examined. By screening a BAC library of genomic DNA from T. castaneum (Tc) with a DNA probe encoding the catalytic domain of a putative Tribolium CHS, several clones that contained CHS genes were identified. Two distinct PCR products were amplified from these BAC clones and confirmed to be highly similar to CHS genes from other insects, nematodes and fungi. The DNA sequences of these genes, TcCHS1 and TcCHS2, were determined by amplification of overlapping PCR fragments from two of the BAC DNAs and mapped to different linkage groups. Each ORF was identified and full-length cDNAs were also amplified, cloned and sequenced. TcCHS1 and TcCHS2 encode transmembrane proteins of 1558 and 1464 amino acids, respectively. The TcCHS1 gene was found to use alternate exons, each encoding 59 amino acids, a feature not found in the TcCHS2 gene. During development, Tribolium expressed TcCHS1 predominantly in the embryonic and pupal stages, whereas TcCHS2 was prevalent in the late larval and adult stages. The alternate exon 8a of TcCHS1 was utilized over a much broader range of development than exon 8b. We propose that the two isoforms of the TcCHS1 enzyme are used predominantly for the formation of chitin in embryonic and pupal cuticles, whereas TcCHS2 is utilized primarily for the synthesis of peritrophic membrane-associated chitin in the midgut. PMID:14871625

  5. Association of endothelial nitric oxide synthase gene T-786C promoter polymorphism with gastric cancer

    PubMed Central

    Krishnaveni, Devulapalli; Amar Chand, Bhayal; Shravan Kumar, Porika; Uma Devi, Malladi; Ramanna, Macherla; Jyothy, Akka; Pratibha, Nallari; Balakrishna, N; Venkateshwari, Ananthapur

    2015-01-01

    AIM: To investigate the role of endothelial nitric oxide synthase -786T > C promoter polymorphism in the etiology of gastric cancer (GC). METHODS: A total of 150 GC patients and 150 control subjects were included in the study. The information on demographic features was elicited with an informed consent from all the patients and control subjects using a structured questionnaire. Helicobacter pylori (H. pylori) infectivity status was tested in antral biopsies from all the subjects by rapid urease test following the method of Vaira et al. Genomic DNA was isolated from whole blood samples following the salting out method of Lahiri et al. Genotype analysis of the rs2070744 polymorphism was carried out by allele-specific polymerase chain reaction method. The genotypes were determined based on the appearance of bands on an agarose gel stained with ethidium bromide under ultraviolet gel documentation with the help of 100 bp ladder. Odds ratios and corresponding 95%CIs were determined using java stat online software. RESULTS: There was a significant difference in the distribution of C allele (C vs T; P = 0.000, OR = 5.038) in patient group compared to the control subjects exhibiting a fivefold increased risk for GC. When the T/T and C/C genotypes were compared, there was an enhanced GC risk for individuals with C/C genotype (T/T vs C/C; P = 0.000). Among the demographic factors, smoking and alcoholism were the common risk factors in patients compared to the control subjects (P < 0.05). Patients with smoking and alcoholism developed cancer even in heterozygous T/C condition (smoking: P = 0.020 and alcoholism: P = 0.005). Individuals with H. pylori infection showed seven fold increased risk for cancer. All the patients with C/C genotype revealed a significant association between H. pylori infection and GC. Among the patients 2.4% of them revealed familial incidence of GC. No significant difference was noticed between cases and controls with regard to consanguinity (P = 0

  6. The Sesquiterpene Synthase from the Botrydial Biosynthetic Gene Cluster of the Phytopathogen Botrytis cinerea

    PubMed Central

    Pinedo, Cristina; Wang, Chieh-Mei; Pradier, Jean-Marc; Dalmais, Bérengère; Choquer, Mathias; Pêcheur, Pascal Le; Morgant, Guillaume; Collado, Isidro G.; Cane, David E.; Viaud, Muriel

    2009-01-01

    The fungus Botrytis cinerea is the causal agent of the economically important gray mold disease that affects more than 200 ornamental and agriculturally important plant species. B. cinerea is a necrotrophic plant pathogen that secretes nonspecific phytotoxins, including the sesquiterpene botrydial and the polyketide botcinic acid. The region surrounding the previously characterized BcBOT1 gene has now been identified as the botrydial biosynthetic gene cluster. Five genes including BcBOT1 and BcBOT2 were shown by quantitative Reverse Transcription-PCR to be co-regulated through the calcineurin signaling pathway. Inactivation of the BcBOT2 gene, encoding a putative sesquiterpene cyclase, abolished botrydial biosynthesis, which could be restored by in trans complementation. Inactivation of BcBOT2 also resulted in over-production of botcinic acid that was observed to be strain-dependent. Recombinant BcBOT2 protein converted farnesyl diphosphate to the parent sesquiterpene of the botrydial biosynthetic pathway, the tricyclic alcohol presilphiperfolan-8β-ol. PMID:19035644

  7. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    PubMed Central

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  8. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  9. Annotation of the Modular Polyketide Synthase and Nonribosomal Peptide Synthetase Gene Clusters in the Genome of Streptomyces tsukubaensis NRRL18488

    PubMed Central

    Blažič, Marko; Starcevic, Antonio; Lisfi, Mohamed; Baranasic, Damir; Goranovič, Dušan; Fujs, Štefan; Kuščer, Enej; Kosec, Gregor; Petković, Hrvoje; Cullum, John; Hranueli, Daslav

    2012-01-01

    The high G+C content and large genome size make the sequencing and assembly of Streptomyces genomes more difficult than for other bacteria. Many pharmaceutically important natural products are synthesized by modular polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs). The analysis of such gene clusters is difficult if the genome sequence is not of the highest quality, because clusters can be distributed over several contigs, and sequencing errors can introduce apparent frameshifts into the large PKS and NRPS proteins. An additional problem is that the modular nature of the clusters results in the presence of imperfect repeats, which may cause assembly errors. The genome sequence of Streptomyces tsukubaensis NRRL18488 was scanned for potential PKS and NRPS modular clusters. A phylogenetic approach was used to identify multiple contigs belonging to the same cluster. Four PKS clusters and six NRPS clusters were identified. Contigs containing cluster sequences were analyzed in detail by using the ClustScan program, which suggested the order and orientation of the contigs. The sequencing of the appropriate PCR products confirmed the ordering and allowed the correction of apparent frameshifts resulting from sequencing errors. The product chemistry of such correctly assembled clusters could also be predicted. The analysis of one PKS cluster showed that it should produce a bafilomycin-like compound, and reverse transcription (RT)-PCR was used to show that the cluster was transcribed. PMID:22983969

  10. 844ins68 in the cystathionine beta-synthase gene in Israel and review of its distribution in the world.

    PubMed

    Zoossmann-Diskin, Avshalom; Gazit, Efraim; Peleg, Leah; Shohat, Mordechai; Turner, David

    2004-06-01

    The 844ins68 allele in the cystathionine beta-synthase gene is always found in cis with the T833C mutation further indicating that its origin is monophyletic and that it might be a useful anthropogenetic marker. Its frequency was examined in 1087 randomly chosen subjects from Israel (twelve Jewish communities and Palestinians), and found to range from 0.034 to 0.125. The heterogeneity among the Jewish communities spans most of the range encountered among Caucasoid populations and is in accordance both with other genetic markers examined in the Jewish communities and with genetic distance and discriminant analyses. 844ins68 cannot distinguish between various European regions, because of the marked heterogeneity of the allele frequency distribution in Europe. This distribution of the insertion does not follow a recognised pattern of any known colonisation process. Its use as a reliable anthropogenetic marker discriminating between the major human groups may also be problematic until more populations are sampled. PMID:15228193

  11. The innervation of rainbow trout (Oncorhynchus mykiss) liver: protein gene product 9.5 and neuronal nitric oxide synthase immunoreactivities

    PubMed Central

    ESTEBAN, F. J.; JIMÉNEZ, A.; BARROSO, J. B.; PEDROSA, J. A.; DEL MORAL, M. L.; RODRIGO, J.; PEINADO, M. A.

    1998-01-01

    We have explored the innervation of the rainbow trout (O. mykiss) liver using immunohistochemical procedures and light microscopy to detect in situ protein gene product 9.5 and neuronal nitric oxide synthase immunoreactivities (PGP-IR and NOS-IR). The results showed PGP-IR nerve fibres running with the extralobular biliary duct (EBD), hepatic artery (EHA) and portal vein (EPV) that form the hepatic hilum, as well as following the spatial distribution of the intrahepatic blood vessel and biliary channels. These nerve fibres appear as single varicose processes, thin bundles, or thick bundles depending on their diameter and location in the wall of the blood vessel or biliary duct. No PGP-IR fibres were detected in the liver parenchyma. NOS-IR nerve fibres were located only in the vessels and ducts that form the hepatic hilum (EBD, EHA, EPV); in addition, NOS-IR nerve cell bodies were found isolated or forming ganglionated plexuses in the peribiliary fibromuscular tissue of the EBD. No PGP-IR ganglionated plexuses were detected in the EBD. The location of the general (PGP-IR) and nitrergic (nNOS-IR) intrinsic nerves of the trout liver suggest a conserved evolutionary role of the nervous control of hepatic blood flow and hepatobiliary activity. PMID:9827640

  12. Ceramides promote apoptosis for virus-infected lymphoma cells through induction of ceramide synthases and viral lytic gene expression

    PubMed Central

    Dai, Lu; Trillo-Tinoco, Jimena; Bai, Aiping; Chen, Yihan; Bielawski, Jacek; Del Valle, Luis; Smith, Charles D.; Ochoa, Augusto C.; Qin, Zhiqiang; Parsons, Chris

    2015-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent for several human cancers including primary effusion lymphoma (PEL), a rapidly progressive malignancy arising preferentially in immunocompromised patients. With conventional chemotherapy, PEL continues to portend high mortality, dictating the development of novel therapeutic strategies. Sphingosine kinase 2 (SphK2) represents a key gatekeeper for sphingolipid metabolism, responsible for conversion of ceramides to sphingosine-1-phosphate (S1P). We have previously demonstrated that targeting SphK2 using a novel selective inhibitor, ABC294640, leads to intracellular accumulation of ceramides and induces apoptosis for KSHV-infected PEL cells, while suppressing tumor progression in vivo. In the current study, we sought to determine whether specific ceramide/dh-ceramide species and related ceramide synthases (CerS) impact viability for KSHV-infected PEL cells during targeting of SphK2. We found that several specific ceramide and dihydro(dh)-ceramide species and their associated CerS reduce PEL survival and tumor expansion in vitro and in vivo. Moreover, we found that dhC16-Cer induces PEL apoptosis in part through activation of KSHV lytic gene expression. These data further implicate bioactive sphingolipids in regulation of PEL survival, and provide justification for future studies evaluating clinically relevant ceramide analogs or mimetics for their potential as therapeutic agents for PEL. PMID:26327294

  13. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    PubMed Central

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  14. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity.

    PubMed

    Zaragoza, O; Blazquez, M A; Gancedo, C

    1998-08-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30 degreesC was indistinguishable from that of the wild type. However, at 42 degreesC it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37 degreesC, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42 degreesC, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 10(6) CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  15. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    PubMed

    Chen, Wei; He, Shaozhen; Liu, Degao; Patil, Gunvant B; Zhai, Hong; Wang, Feibing; Stephenson, Troy J; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  16. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana

    PubMed Central

    Liu, Degao; Patil, Gunvant B.; Zhai, Hong; Wang, Feibing; Stephenson, Troy J.; Wang, Yannan; Wang, Bing; Valliyodan, Babu; Nguyen, Henry T.; Liu, Qingchang

    2015-01-01

    Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS), named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP) was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC) analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG). Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD) in transgenic seedlings. In addition, the level of malondialdehyde (MDA) was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress. PMID:26376432

  17. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars.

    PubMed

    Chizzali, Cornelia; Swiddan, Asya K; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in 'Harrow Sweet', while only PcBIS2 transcripts were detected in 'Alexander Lucas' and 'Conference'. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of 'Harrow Sweet', whereas the concentrations were ten times lower in 'Conference' and not even detectable in 'Alexander Lucas'. In 'Harrow Sweet', the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of 'Alexander Lucas' and 'Conference' advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  18. Atypical expression of mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase in subcutaneous adipose tissue of male rats.

    PubMed

    Thumelin, S; Kohl, C; Girard, J; Pégorier, J P

    1999-06-01

    The mRNAs encoding mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase (mtHMG-CoA synthase), the rate limiting enzyme in ketone body production, are highly expressed in subcutaneous (SC) and, to a lesser extent, in peri-epididymal (PE) rat adipose tissues. This atypical mtHMG-CoA synthase gene expression is dependent on the age (from 9 weeks of age) and sex (higher in male than in female) of the rats. In contrast, the expression of mtHMG-CoA synthase in SC adipose deposit is independent of the nutritional state (fed versus starved) or of the thermic environment (24 degrees C versus 4 degrees C). The expression of mtHMG-CoA synthase is suppressed in SC fat pads of castrated male rats whereas treatment of castrated rats with testosterone restores a normal level of expression. Moreover, testosterone injection induces the expression mtHMG-CoA synthase in SC adipose tissue of age-matched females. The presence of the mtHMG-CoA synthase immunoreactive protein confers to mitochondria isolated from SC adipose deposits, the capacity to produce ketone bodies at a rate similar to that found in liver mitochondria (SC = 13.7 +/- 0.7, liver = 16.4 +/- 1.4 nmol/min/mg prot). mtHMG-CoA synthase is expressed in the stromal vascular fraction (SVF) whatever the adipose deposit considered. While acetyl-CoA carboxylase (ACC) is only expressed in mature adipocytes, the other lipogenic enzymes, fatty acid synthase (FAS) and citrate cleavage enzyme (CCE), are expressed both in SVF cells and mature adipocytes. The expression of lipogenic enzyme genes is markedly reduced in adipocytes but not in SVF cells isolated from 48-h starved male rats. When SVF is subfractionated, mtHMG-CoA synthase mRNAs are mainly recovered in two fractions containing poorly digested structures such as microcapillaries whereas the lowest expression is found in the pre-adipocyte fraction. Interestingly, FAS and CCE mRNAs co-segregate with mtHMG-CoA synthase mRNA. The possible physiological relevance of such

  19. Endothelial nitric oxide synthase gene polymorphisms and the risk of hypertension in an Indian population.

    PubMed

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2014-01-01

    Genetic variants of eNOS gene play a significant role in the pathogenesis of hypertension. Many environmental factors have, also, been implicated in the aetiology of hypertension. We carried out an age-matched case-control study among adults. Hypertension was defined according to JNC-VII criteria and eNOS gene polymorphisms were determined by PCR and PCR followed by PCR-RFLP. eNOS intron 4 aa genotype (adjusted OR 6.81; 95% CI 2.29-20.25) and eNOS 894TT genotype (adjusted OR 7.84; 95% CI 2.57-23.96) were associated with the risk of hypertension. Tobacco users (either smoking/chewing or both) with eNOS intron 4 aa genotype (OR 14.00: 95% CI 1.20-163.37), eNOS 894GG genotype (OR 5.56: 95% CI 3.72-8.31), and eNOS T-786C CC genotype (OR 9.00: 95% CI 1.14-71.04) were at an increased risk of hypertension. Similarly a significant gene-environment interaction was observed between individuals consuming alcohol with eNOS intron 4 aa genotype (OR 12.00: 95% CI 1.20-143.73) and eNOS 894GG genotype (OR 1.95: 95% CI 1.35-2.81). The present study identified few susceptible genotypes of the eNOS gene with the risk of hypertension. Moreover, the interactive effects between the environmental factors and the risk of hypertension were dependent on the eNOS genotypes. PMID:25165716

  20. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    PubMed Central

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  1. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    PubMed

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  2. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  3. Large-Scale Phylogenetic Classification of Fungal Chitin Synthases and Identification of a Putative Cell-Wall Metabolism Gene Cluster in Aspergillus Genomes

    PubMed Central

    Pacheco-Arjona, Jose Ramon; Ramirez-Prado, Jorge Humberto

    2014-01-01

    The cell wall is a protective and versatile structure distributed in all fungi. The component responsible for its rigidity is chitin, a product of chitin synthase (Chsp) enzymes. There are seven classes of chitin synthase genes (CHS) and the amount and type encoded in fungal genomes varies considerably from one species to another. Previous Chsp sequence analyses focused on their study as individual units, regardless of genomic context. The identification of blocks of conserved genes between genomes can provide important clues about the interactions and localization of chitin synthases. On the present study, we carried out an in silico search of all putative Chsp encoded in 54 full fungal genomes, encompassing 21 orders from five phyla. Phylogenetic studies of these Chsp were able to confidently classify 347 out of the 369 Chsp identified (94%). Patterns in the distribution of Chsp related to taxonomy were identified, the most prominent being related to the type of fungal growth. More importantly, a synteny analysis for genomic blocks centered on class IV Chsp (the most abundant and widely distributed Chsp class) identified a putative cell wall metabolism gene cluster in members of the genus Aspergillus, the first such association reported for any fungal genome. PMID:25148134

  4. Divergent properties and phylogeny of cyanobacterial 5-enol-pyruvyl-shikimate-3-phosphate synthases: evidence for horizontal gene transfer in the Nostocales.

    PubMed

    Forlani, Giuseppe; Bertazzini, Michele; Barillaro, Donatella; Rippka, Rosmarie

    2015-01-01

    As it represents the target of the successful herbicide glyphosate, great attention has been paid to the shikimate pathway enzyme 5-enol-pyruvyl-shikimate-3-phosphate (EPSP) synthase. However, inconsistent results have been reported concerning the sensitivity of the enzyme from cyanobacteria, and consequent inhibitory effects on cyanobacterial growth. The properties of EPSP synthase were investigated in a set of 42 strains representative of the large morphological diversity of these prokaryotes. Publicly available protein sequences were analyzed, and related to enzymatic features. In most cases, the native protein showed an unusual homodimeric composition and a general sensitivity to micromolar doses of glyphosate. By contrast, eight out of 15 Nostocales strains were found to possess a monomeric EPSP synthase, whose activity was inhibited only at concentrations exceeding 1 mM. Sequence analysis showed that these two forms are only distantly related, the latter clustering separately in a clade composed of diverse bacterial phyla. The results are consistent with the occurrence of a horizontal gene transfer event involving an evolutionarily distant organism. Moreover, data suggest that the existence of class I (glyphosate-sensitive) and class II (glyphosate-tolerant) EPSP synthases representing two distinct phylogenetic clades is an oversimplification because of the limited number of analyzed samples. PMID:25229999

  5. Diversity of benzylsuccinate synthase-like (bssA) genes in hydrocarbon-polluted marine sediments suggests substrate-dependent clustering.

    PubMed

    Acosta-González, Alejandro; Rosselló-Móra, Ramon; Marqués, Silvia

    2013-06-01

    The potential of hydrocarbon biodegradation in marine sediments was determined through the detection of a functional biomarker, the bssA gene, coding for benzylsuccinate synthase, the key enzyme of anaerobic toluene degradation. Eight bssA clone libraries (409 sequences) were constructed from polluted sediments affected by the Prestige oil spill in the Atlantic Islands National Park and from hydrocarbon-amended sediment microcosms in Mallorca. The amplified products and database-derived bssA-like sequences grouped into four major clusters, as determined by phylogenetic reconstruction, principal coordinate analysis (PCoA), and a subfamily prediction tool. In addition to the classical bssA sequences that were targeted, we were able to detect sequences homologous to the naphthylmethylsuccinate synthase gene (nmsA) and the alkylsuccinate synthase gene (assA), the bssA homologues for anaerobic 2-methylnaphthalene and alkane degradation, respectively. The detection of bssA-like variants was determined by the persistence and level of pollution in the marine samples. The observed level of gene diversity was lower in the Mallorca sediments, which were dominated by assA-like sequences. In contrast, the Atlantic Islands samples, which were highly contaminated with methylnaphthalene-rich crude oil, showed a high proportion of nmsA-like sequences. Some of the detected genes were phylogenetically related to Deltaproteobacteria communities, previously described as the predominant hydrocarbon degraders at these sites. Differences between all detected bssA-like genes described to date indicate separation between marine and terrestrial sequences and further subgrouping according to taxonomic affiliation. Global analysis suggested that bssA homologues appeared to cluster according to substrate specificity. We observed undetected divergent gene lineages of bssA homologues, which evidence the existence of new degrader groups in these environments. PMID:23563947

  6. Diversity of Benzylsuccinate Synthase-Like (bssA) Genes in Hydrocarbon-Polluted Marine Sediments Suggests Substrate-Dependent Clustering

    PubMed Central

    Acosta-González, Alejandro; Rosselló-Móra, Ramon

    2013-01-01

    The potential of hydrocarbon biodegradation in marine sediments was determined through the detection of a functional biomarker, the bssA gene, coding for benzylsuccinate synthase, the key enzyme of anaerobic toluene degradation. Eight bssA clone libraries (409 sequences) were constructed from polluted sediments affected by the Prestige oil spill in the Atlantic Islands National Park and from hydrocarbon-amended sediment microcosms in Mallorca. The amplified products and database-derived bssA-like sequences grouped into four major clusters, as determined by phylogenetic reconstruction, principal coordinate analysis (PCoA), and a subfamily prediction tool. In addition to the classical bssA sequences that were targeted, we were able to detect sequences homologous to the naphthylmethylsuccinate synthase gene (nmsA) and the alkylsuccinate synthase gene (assA), the bssA homologues for anaerobic 2-methylnaphthalene and alkane degradation, respectively. The detection of bssA-like variants was determined by the persistence and level of pollution in the marine samples. The observed level of gene diversity was lower in the Mallorca sediments, which were dominated by assA-like sequences. In contrast, the Atlantic Islands samples, which were highly contaminated with methylnaphthalene-rich crude oil, showed a high proportion of nmsA-like sequences. Some of the detected genes were phylogenetically related to Deltaproteobacteria communities, previously described as the predominant hydrocarbon degraders at these sites. Differences between all detected bssA-like genes described to date indicate separation between marine and terrestrial sequences and further subgrouping according to taxonomic affiliation. Global analysis suggested that bssA homologues appeared to cluster according to substrate specificity. We observed undetected divergent gene lineages of bssA homologues, which evidence the existence of new degrader groups in these environments. PMID:23563947

  7. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    PubMed

    Rai, Himanshu; Parveen, Farah; Kumar, Sudeep; Kapoor, Aditya; Sinha, Nakul

    2014-01-01

    Several association studies of endothelial nitric oxide synthase (NOS3) gene polymorphisms with respect to coronary artery disease (CAD) have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235), examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a) with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons), followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons) and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons) in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons) and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons) have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons). PMID:25409023

  8. A new quantitative PCR method for the detection of Anaplasma platys in dogs based on the citrate synthase gene.

    PubMed

    da Silva, Claudia B; Pires, Marcus S; Vilela, Joice A R; Peckle, Maristela; da Costa, Renata L; Vitari, Gabriela L V; Santos, Leandro A; Santos, Huarrisson A; Massard, Carlos L

    2016-09-01

    Anaplasma platys is an obligate intracellular bacterium that primarily affects dogs, but it can also infect humans. Our study aimed to standardize a quantitative real-time (q)PCR method using the citrate synthase gene (gltA) as a specific target for A. platys detection in naturally infected dogs. Primers (gltA84F and gltA84R) and probe (PLATYSp) were designed to amplify an 84-bp fragment based on the gltA gene sequences of A. platys available in GenBank. A total of 186 dog blood samples originating from the Brazilian state of Rio de Janeiro were tested by qPCR. Additionally, the same samples were tested by cytology and a nested (n)PCR that targeted the 16S ribosomal DNA to determine the performance of our qPCR method compared to these existing techniques. Among the samples tested with qPCR, 17.2% were considered positive, significantly more than detected by nPCR (14.0%). Under optical microscopy, inclusions were observed in platelets of 25.3% of the samples, and among these samples, only 33.9% were identified as positive for A. platys using qPCR. The qPCR technique proved to be more specific than cytology and to have superior sensitivity to nPCR for detecting A. platys in dogs. The development of this new qPCR method contributes to the advancement of research involving A. platys Furthermore, it can be used to quantify the presence of this bacterium to evaluate the treatment of infected animals, or even as a more sensitive and specific tool for situations indicating possible clinical disease but with negative cytology. PMID:27423737

  9. Methylenetetrahydrofolate reductase and methionine synthase reductase gene polymorphisms and protection from microvascular complications in adolescents with type 1 diabetes.

    PubMed

    Wiltshire, Esko J; Mohsin, Fauzia; Chan, Albert; Donaghue, Kim C

    2008-08-01

    Folate status has been associated with endothelial dysfunction in adolescents with type 1 diabetes, and elevated total plasma homoocyst(e)ine (tHcy) is a risk for vascular disease in the non-diabetic population. Polymorphisms in genes involved in folate and homocysteine metabolism are implicated in vascular disease. We aimed to determine whether polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes are risk factors for early microvascular disease in a large group of adolescents with type 1 diabetes. Four hundred and eighty adolescents were screened annually for retinopathy and microalbuminuria for a median of 4 yr. Molecular analysis for the polymorphisms 677C-->T, 1298A-->C in MTHFR, and 66A-->G in MTRR was performed. The MTRR 66GG genotype reduced the risk for elevated albumin excretion rate (AER) (OR 0.47, CI 0.25, 0.88, p = 0.018) and showed a trend to reduced risk for microalbuminuria (OR 0.27, CI 0.06-1.21, p = 0.09). Survival without elevated AER was increased with the MTRR 66GG genotype (12.4 vs. 9.7 yr, p = 0.04) and with the MTHFR 1298CC genotype (15.2 vs. 10.2 yr, p = 0.007). Conversely, survival without retinopathy was reduced with the MTHFR 677TT and MTRR 66GG combined genotype (6.2 vs. 10.2 yr, p = 0.015). The MTRR 66GG and MTHFR 1298 CC genotypes may confer protection against early nephropathy, possibly because they are associated with lower tHcy. The MTHFR 677 TT was only related to earlier onset retinopathy in combination with MTRR 66GG. PMID:18774994

  10. Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

    PubMed Central

    Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

    2006-01-01

    Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

  11. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328.

    PubMed

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr_8_2: 2978617-2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni(2+)-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. PMID:27060547

  12. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    PubMed

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  13. [Cloning of flavone synthase (FNSII) gene and expression in three cell lines of Saussurea medusa].

    PubMed

    Wang, Bingjie; Li, Houhua; Wang, Yajie; Gaol, Yan; Fu, Wany; Weil, Xincui

    2015-12-01

    Saussurea medusa is a rare traditional Chinese medicinal herb, of which luteolin is the niain active medicinal compound for cancer prevention and treatment. A full-length FNSII gene, namely SmFNSII (GenBank Accession No. KF170286), was obtained from green cell line of Saussurea medusa by RT-PCR and RACE-PCR. Sequence analysis indicated that SmFNSII is 1 710 bp in full length, containing a 34 bp 5'-untranslated region (5'-UTR), a 125 bp 3'-UTR, and a 1 551 bp open reading frame (ORF) encoding 516 amino acid residues. Amino acid sequence analysis indicated that SmFNSII belonged to subfamily CYP93B of plant cytochrome P450. Sequence alignment and phylogenetic analysis revealed that amino acid sequences of SmFNSII shared 87% homology with the protein in Hieracium pilosella. Quantitative real-time PCR analysis indicated that SmFNSII expression is the highest in red cell line and the lowest in white cell line, corresponding to quantitative analysis of luteolin concentration. pET-SmFNSII, a prokaryotic expression recombinant plasmid, was constructed and transferred into Escherichia coli, and the expressed protein band was the same size with predicted protein. Saussurea medusa cultivars with high anti-inflammatory, anti-cancer activities and health care function would be cultivated through filtering cell lines and plants with high expression level of FNSII gene and luteolin accumulation. PMID:27093835

  14. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  15. Potential for Quantifying Expression of the Geobacteraceae Citrate Synthase Gene To Assess the Activity of Geobacteraceae in the Subsurface and on Current-Harvesting Electrodes

    PubMed Central

    Holmes, Dawn E.; Nevin, Kelly P.; O'Neil, Regina A.; Ward, Joy E.; Adams, Lorrie A.; Woodard, Trevor L.; Vrionis, Helen A.; Lovley, Derek R.

    2005-01-01

    The Geobacteraceae citrate synthase is phylogenetically distinct from those of other prokaryotes and is a key enzyme in the central metabolism of Geobacteraceae. Therefore, the potential for using levels of citrate synthase mRNA to estimate rates of Geobacter metabolism was evaluated in pure culture studies and in four different Geobacteraceae-dominated environments. Quantitative reverse transcription-PCR studies with mRNA extracted from cultures of Geobacter sulfurreducens grown in chemostats with Fe(III) as the electron acceptor or in batch with electrodes as the electron acceptor indicated that transcript levels of the citrate synthase gene, gltA, increased with increased rates of growth/Fe(III) reduction or current production, whereas the expression of the constitutively expressed housekeeping genes recA, rpoD, and proC remained relatively constant. Analysis of mRNA extracted from groundwater collected from a U(VI)-contaminated site undergoing in situ uranium bioremediation revealed a remarkable correspondence between acetate levels in the groundwater and levels of transcripts of gltA. The expression of gltA was also significantly greater in RNA extracted from groundwater beneath a highway runoff recharge pool that was exposed to calcium magnesium acetate in June, when acetate concentrations were high, than in October, when the levels had significantly decreased. It was also possible to detect gltA transcripts on current-harvesting anodes deployed in freshwater sediments. These results suggest that it is possible to monitor the in situ metabolic rate of Geobacteraceae by tracking the expression of the citrate synthase gene. PMID:16269721

  16. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    PubMed

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  17. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    PubMed Central

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  18. Engineering the robustness of Saccharomyces cerevisiae by introducing bifunctional glutathione synthase gene.

    PubMed

    Qiu, Zhiqi; Deng, Zujun; Tan, Hongming; Zhou, Shining; Cao, Lixiang

    2015-04-01

    Robust, high-yielding Saccharomyces cerevisiae is highly desirable for cost-effective cellulosic ethanol production. In this study, the bifunctional glutathione (GSH) synthetase genes GCSGS at high copy number was integrated into ribosomal DNA of S. cerevisiae by Cre-LoxP system. Threefold higher GSH contents (54.9 μmol/g dry weight) accumulated in the engineered strain BY-G compared to the reference strain. Tolerance of BY-G to H2O2 (3 mM), temperature (40 °C), furfural (10 mM), hydroxymethylfurfural (HMF, 10 mM) and 0.5 mM Cd(2+) increased compared to reference strain. Twofold higher ethanol concentration was obtained by BY-G in simultaneous saccharification and fermentation of corn stover compared to the reference strain. The results showed that intracellular GSH content of S. cerevisiae has an influence on robustness. The strategy is used to engineer S. cerevisiae strains adaptive to a combination of tolerance to inhibitors and raised temperature that may occur in high solid simultaneous saccharification and fermentation of lignocellulosic feedstocks. PMID:25561319

  19. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    PubMed Central

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-01-01

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley – Cer-c, Cer-q and Cer-u – known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. PMID:26962211

  20. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  1. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    PubMed Central

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  2. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels

    PubMed Central

    Akerman, S; Williamson, D J; Kaube, H; Goadsby, P J

    2002-01-01

    The detailed pathophysiology of migraine is beginning to be understood and is likely to involve activation of trigeminovascular afferents. Clinically effective anti-migraine compounds are believed to have actions that include peripheral inhibition of calcitonin gene-related peptide (CGRP) release from trigeminal neurones, or preventing dural vessel dilation, or both. CGRP antagonists can block both neurogenic and CGRP-induced dural vessel dilation. Nitric oxide (NO) can induce headache in migraine patients and often triggers a delayed migraine. The initial headache is thought to be caused via a direct action of the NO–cGMP pathway that causes vasodilation by vascular smooth muscle relaxation, while the delayed headache is likely to be a result of triggering trigeminovascular activation. Nitric oxide synthase (NOS) inhibitors are effective in the treatment of acute migraine. The present studies used intravital microscopy to examine the effects of specific NOS inhibitors on neurogenic dural vasodilation (NDV) and CGRP-induced dilation. The non-specific and neuronal NOS (nNOS) inhibitors were able to partially inhibit NDV, while the non-specific and endothelial NOS (eNOS) inhibitors were able to partially inhibit the CGRP induced dilation. There was no effect of the inducible NOS (iNOS) inhibitor. The data suggest that the delayed headache response triggered by NO donors in humans may be due, in part, to increased nNOS activity in the trigeminal system that causes CGRP release and dural vessel dilation. Further, eNOS activity in the endothelium causes NO production and smooth muscle relaxation by direct activation of the NO–cGMP pathway, and may be involved in the initial headache response. PMID:12183331

  3. In vivo gene transfer of endothelial nitric oxide synthase decreases portal pressure in anaesthetised carbon tetrachloride cirrhotic rats

    PubMed Central

    Van de Casteele, M; Omasta, A; Janssens, S; Roskams, T; Desmet, V; Nevens, F; Fevery, J

    2002-01-01

    Background: Portal hypertension in cirrhosis results from enhanced intrahepatic resistance to an augmented inflow. The former is partly due to an imbalance between intrahepatic vasoconstriction and vasodilatation. Enhanced endothelin-1 and decreased activity of hepatic constitutive endothelial nitric oxide synthase (NOS 3) was reported in carbon tetrachloride (CCl4) cirrhotic rat liver. Aims: To study whether an increase in hepatic NOS 3 could be obtained in the CCl4 cirrhotic rat liver by in vivo cDNA transfer and to investigate a possible effect on portal pressure. Methods: Hepatic NOS 3 immunohistochemistry and western blotting were used to measure the amount of NOS 3 protein. Recombinant adenovirus, carrying cDNA encoding human NOS 3, was injected into the portal vein of CCl4 cirrhotic rats. Cirrhotic controls received carrier buffer, naked adenovirus, or adenovirus carrying the lac Z gene. Results: NOS 3 immunoreactivity and amount of protein (western blotting) were significantly decreased in CCl4 cirrhotic livers. Following cDNA transfer, NOS 3 expression and the amount of protein were partially restored. Portal pressure was 11.4 (1.6) mm Hg in untreated cirrhotic (n=9) and 11.8 (0.6) in lac Z transfected (n=4) cirrhotic rats but was reduced to 7.8 (1.0) mm Hg (n=9) five days after NOS 3 cDNA transfer. No changes were observed in systemic haemodynamics, in liver tests or urinary nitrates, or in NOS 3 expression in lung or kidney, indicating a highly selective transfer. Conclusions: NOS 3 cDNA transfer to cirrhotic rat liver is feasible and the increase in hepatic NOS 3 leads to a marked decrease in portal hypertension without systemic effects. These data indicate a major haemodynamic role of intrahepatic NOS 3 in the pathogenesis of portal hypertension in CCl4 cirrhosis. PMID:12171971

  4. Inhibition of the expression of the starch synthase II gene leads to lower pasting temperature in sweetpotato starch.

    PubMed

    Takahata, Yasuhiro; Tanaka, Masaru; Otani, Motoyasu; Katayama, Kenji; Kitahara, Kanefumi; Nakayachi, Osamu; Nakayama, Hiroki; Yoshinaga, Masaru

    2010-06-01

    The sweetpotato cultivar Quick Sweet (QS) with a lower pasting temperature of starch is a unique breeding material, but the biochemical background of this property has been unknown. To assess the physiological impact of the reduced isoform II activity of starch synthase (SSII) on the starch properties in sweetpotato storage root, transgenic sweetpotato plants with reduced expressions of the SSII gene were generated and evaluated. All of the starches from transgenic plants showed lower pasting temperatures and breakdown measured by a Rapid Visco Analyzer. The pasting temperatures in transgenic plants were approximately 10-15 degrees C lower than in wild-type plants. Distribution of the amylopectin chain length of the transgenic lines showed marked differences compared to that in wild-type plants: more chains with degree of polymerization (DP) 6-11 and fewer chains with DP 13-25. The starch granules from the storage root of transgenic plants showed cracking on the hilum, while those from wild-type plants appeared to be typical sweetpotato starch. In accordance with these observations, the expression of SSII in the storage roots of the sweetpotato cultivar with low pasting temperature starch (QS) was notably lower than in cultivars with normal starch. Moreover, nucleotide sequence analysis suggested that most of the SSII transcripts in the cultivar with low pasting temperature starch were inactive alleles. These results clearly indicate that the activity of SSII in sweetpotato storage roots, like those in other plants, affects the pasting properties of starch through alteration of the amylopectin structure. PMID:20306051

  5. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    PubMed

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  6. Associations between nitric oxide synthase 3 gene polymorphisms and preeclampsia risk: a meta-analysis

    PubMed Central

    Zeng, Fangfang; Zhu, Sui; Wong, Martin Chi-Sang; Yang, Zuyao; Tang, Jinling; Li, Keshen; Su, Xuefen

    2016-01-01

    Previous studies have examined the role of three NOS3 gene polymorphisms [G894T, T-786C, and the variable number of tandem repeats 4b/a (VNTR 4b/a)] in the susceptibility to preeclampsia with inconclusive findings. We therefore conducted an updated meta-analysis by including more studies. The most appropriate genetic model was chosen for each polymorphism by using a well-established method. Pooled results indicated that, compared with the GT + GG genotype, the TT genotype of G894T was associated with an increased risk of preeclampsia (odds ratio (OR) = 1.46; 95% confidence interval (CI) = 1.21–1.77, P < 0.001; I2 = 40.2%). The CC genotype of T-786C was also associated with a higher risk of preeclampsia (OR = 1.30; 95% CI = 1.07–1.58, P = 0.034; I2 = 46.9%) than the CT + TT genotype. No association was found for VNTR 4b/a. Stratified analysis indicated that the increased risk was evident for high-quality studies both for G894T and T-786C, and for studies conducted among Caucasians and Africans for T-786C. However, the increased risk for T-786C among Africans needs further confirmation due to the high probability of false-positive reports. Our results suggested that G894T and T-786C polymorphisms, but not VNTR 4b/a, were associated with an increased risk of preeclampsia. PMID:26997284

  7. Environment effect on fruit ripening related gene to develop a new post harvest technology

    NASA Astrophysics Data System (ADS)

    Dwivany, Fenny; Esyanti, Rizkita Rahmi; Robertlee, Jekson; Paramaputra, Indra Chandra; Permatadewi, Rinda Kania; Tambun, Dina Hermawaty; Handayani, Resnanti Utami; Pratiwi, Aksarani'Sa; Zaskia, Herafi

    2014-03-01

    Ripening process of fruits is a very complex process, which involves ethylene production, causing alteration on molecular and physiology level. Environmental stress caused by biotic and abiotic stress conditions (such as pathogen, mechanical stress, physical and physiology stress) can stimulate ethylene production. High levels of ethylene in turn can also inhibit growth, cause premature ripening and induce the onset of senescence, which then potentially reduce plant productivity. The ACC Synthase (ACS) and ACC Oxidase (ACO) genes are genes that have role in the ethylene production. By regulating those genes, especially ethylene biosynthesis genes, we might improve the quality of fruit at post harvest condition. Therefore, in this research we studied fruit ripening related genes expression on banana such as MaACS family at different environment condition. The result of study can give contributions in developing of new plants with desired traits or new post harvest technologies.

  8. Identification and characteristics of the structural gene for the Drosophila eye colour mutant sepia, encoding PDA synthase, a member of the omega class glutathione S-transferases.

    PubMed

    Kim, Jaekwang; Suh, Hyunsuk; Kim, Songhee; Kim, Kiyoung; Ahn, Chiyoung; Yim, Jeongbin

    2006-09-15

    The eye colour mutant sepia (se1) is defective in PDA {6-acetyl-2-amino-3,7,8,9-tetrahydro-4H-pyrimido[4,5-b]-[1,4]diazepin-4-one or pyrimidodiazepine} synthase involved in the conversion of 6-PTP (2-amino-4-oxo-6-pyruvoyl-5,6,7,8-tetrahydropteridine; also known as 6-pyruvoyltetrahydropterin) into PDA, a key intermediate in drosopterin biosynthesis. However, the identity of the gene encoding this enzyme, as well as its molecular properties, have not yet been established. Here, we identify and characterize the gene encoding PDA synthase and show that it is the structural gene for sepia. Based on previously reported information [Wiederrecht, Paton and Brown (1984) J. Biol. Chem. 259, 2195-2200; Wiederrecht and Brown (1984) J. Biol. Chem. 259, 14121-14127; Andres (1945) Drosoph. Inf. Serv. 19, 45; Ingham, Pinchin, Howard and Ish-Horowicz (1985) Genetics 111, 463-486; Howard, Ingham and Rushlow (1988) Genes Dev. 2, 1037-1046], we isolated five candidate genes predicted to encode GSTs (glutathione S-transferases) from the presumed sepia locus (region 66D5 on chromosome 3L). All cloned and expressed candidates exhibited relatively high thiol transferase and dehydroascorbate reductase activities and low activity towards 1-chloro-2,4-dinitrobenzene, characteristic of Omega class GSTs, whereas only CG6781 catalysed the synthesis of PDA in vitro. The molecular mass of recombinant CG6781 was estimated to be 28 kDa by SDS/PAGE and 56 kDa by gel filtration, indicating that it is a homodimer under native conditions. Sequencing of the genomic region spanning CG6781 revealed that the se1 allele has a frameshift mutation from 'AAGAA' to 'GTG' at nt 190-194, and that this generates a premature stop codon. Expression of the CG6781 open reading frame in an se1 background rescued the eye colour defect as well as PDA synthase activity and drosopterins content. The extent of rescue was dependent on the dosage of transgenic CG6781. In conclusion, we have discovered a new catalytic

  9. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    PubMed Central

    Zhou, Tao; Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Sato, Seizo; Igarashi, Yasuhiro

    2015-01-01

    The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS) domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides. PMID:25603349

  10. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms with Coronary Artery Disease: An Updated Meta-Analysis and Systematic Review

    PubMed Central

    Parveen, Farah; Kapoor, Aditya; Sinha, Nakul

    2014-01-01

    Several association studies of endothelial nitric oxide synthase (NOS3) gene polymorphisms with respect to coronary artery disease (CAD) have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235), examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27bp VNTR b/a) with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28–1.52, and P<0.00001 for all comparisons), followed by T786-C (OR range = 1.34–1.42, and P<0.00001 for all comparisons) and 4b/a, (OR range = 1.19–1.41, and P≤0.002 for all comparisons) in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54–1.87, and P<0.004 for all comparisons) and 4b/a (OR range = 1.71–3.02, and P<0.00001 for all comparisons) have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61–1.90, and P≤0.01 for all comparisons). PMID:25409023

  11. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase

    PubMed Central

    Sellem, Carole H.; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H.; Sainsard-Chanet, Annie

    2016-01-01

    Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8–15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before. PMID:27442014

  12. Sensitivity of Aspergillus nidulans to the cellulose synthase inhibitor dichlobenil: insights from wall-related genes' expression and ultrastructural hyphal morphologies.

    PubMed

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Salerno, Marco; Pum, Dietmar; Strauss, Joseph

    2013-01-01

    The fungal cell wall constitutes an important target for the development of antifungal drugs, because of its central role in morphogenesis, development and determination of fungal-specific molecular features. Fungal walls are characterized by a network of interconnected glycoproteins and polysaccharides, namely α-, β-glucans and chitin. Cell walls promptly and dynamically respond to environmental stimuli by a signaling mechanism, which triggers, among other responses, modulations in wall biosynthetic genes' expression. Despite the absence of cellulose in the wall of the model filamentous fungus Aspergillus nidulans, we found in this study that fungal growth, spore germination and morphology are affected by the addition of the cellulose synthase inhibitor dichlobenil. Expression analysis of selected genes putatively involved in cell wall biosynthesis, carried out at different time points of drug exposure (i.e. 0, 1, 3, 6 and 24 h), revealed increased expression for the putative mixed linkage β-1,3;1,4 glucan synthase celA together with the β-1,3-glucan synthase fksA and the Rho-related GTPase rhoA. We also compared these data with the response to Congo Red, a known plant/fungal drug affecting both chitin and cellulose biosynthesis. The two drugs exerted different effects at the cell wall level, as shown by gene expression analysis and the ultrastructural features observed through atomic force microscopy and scanning electron microscopy. Although the concentration of dichlobenil required to affect growth of A. nidulans is approximately 10-fold higher than that required to inhibit plant cellulose biosynthesis, our work for the first time demonstrates that a cellulose biosynthesis inhibitor affects fungal growth, changes fungal morphology and expression of genes connected to fungal cell wall biosynthesis. PMID:24312197

  13. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    PubMed

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  14. ACC Study Guide Series (Revised Edition).

    ERIC Educational Resources Information Center

    Staples, Katherine; And Others

    Designed for the beginning college student who needs to search for information, prepare written assignments, or take tests, the ACC (Austin Community College) Study Guide Series comprises 17 one-page study guides. Printed on card stock with colored headings, the guides are highlighted with cartoon illustrations and are intended to provide…

  15. A novel family of integrases associated with prophages and genomic islands integrated within the tRNA-dihydrouridine synthase A (dusA) gene.

    PubMed

    Farrugia, Daniel N; Elbourne, Liam D H; Mabbutt, Bridget C; Paulsen, Ian T

    2015-05-19

    Genomic islands play a key role in prokaryotic genome plasticity. Genomic islands integrate into chromosomal loci such as transfer RNA genes and protein coding genes, whilst retaining various cargo genes that potentially bestow novel functions on the host organism. A gene encoding a putative integrase was identified at a single site within the 5' end of the dusA gene in the genomes of over 200 bacteria. This integrase was discovered to be a component of numerous genomic islands, which appear to share a target site within the dusA gene. dusA encodes the tRNA-dihydrouridine synthase A enzyme, which catalyses the post-transcriptional reduction of uridine to dihydrouridine in tRNA. Genomic islands encoding homologous dusA-associated integrases were found at a much lower frequency within the related dusB and dusC genes, and non-dus genes. Excision of these dusA-associated islands from the chromosome as circularized intermediates was confirmed by polymerase chain reaction. Analysis of the dusA-associated islands indicated that they were highly diverse, with the integrase gene representing the only universal common feature. PMID:25883135

  16. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    SciTech Connect

    Lee, G.L.; Astrin, K.H.; Desnick, R.J.

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  17. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers

    PubMed Central

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K.; Müller, Carsten T.; Rosati, Carlo; Rogers, Hilary J.

    2012-01-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar ‘Sweet Laura’ is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. ‘Sweet Laura’ with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. ‘Sweet Laura’ and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. ‘Sweet Laura’ placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R28(R)X8W and D321DXXD are the putative Mg2+-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. ‘Sweet Laura’ flowers. PMID:22268153

  18. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    NASA Astrophysics Data System (ADS)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  19. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    PubMed

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. PMID:27405007

  20. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  1. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton specie...

  2. Genetic polymorphisms in nitric oxide synthase genes modify the relationship between vegetable and fruit intake and risk of non-Hodgkin lymphoma

    PubMed Central

    Han, Xuesong; Zheng, Tongzhang; Lan, Qing; Zhang, Yaqun; Kilfoy, Briseis A.; Qin, Qin; Rothman, Nathaniel; Zahm, Shelia H.; Holford, Theodore R.; Leaderer, Brian; Zhang, Yawei

    2010-01-01

    Oxidative damage caused by reactive oxygen species (ROS) and other free radicals is involved in carcinogenesis. It has been suggested that high vegetable and fruit intake may reduce the risk of non-Hodgkin lymphoma (NHL) as vegetables and fruit are rich in antioxidants. The aim of this study is to evaluate the interaction of vegetable and fruit intake with genetic polymorphisms in oxidative stress pathway genes and NHL risk. This hypothesis was investigated in a population-based case-control study of NHL and NHL histological subtype in Connecticut women including 513 histologically confirmed incident cases and 591 randomly selected controls. Gene-vegetable/fruit joint effects were estimated using unconditional logistic regression model. The false discovery rate method was applied to adjust for multiple comparisons. Significant interactions with vegetable and fruit intake were mainly found for genetic polymorphisms on nitric oxide synthase (NOS) genes among those with diffuse large B-cell lymphoma (DLBCL) and Follicular lymphoma (FL). Two single nucleotide polymorphisms (SNPs) in the NOS1 gene were found to significantly modify the association between total vegetable and fruit intake and risk of NHL overall, as well as the risk of follicular lymphoma (FL). When vegetables, bean vegetables, cruciferous vegetables, green leafy vegetables, red vegetables, yellow/orange vegetables, fruit, and citrus fruit were examined separately, strong interaction effects were narrowed to vegetable intake among DLBCL patients. Our results suggest that genetic polymorphisms in oxidative stress pathway genes, especially in the nitric oxide synthase genes, modify the association between vegetable and fruit intake and risk of NHL. PMID:19423521

  3. An Arabidopsis callose synthase.

    PubMed

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole; Mundy, John

    2002-08-01

    Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially complements a yeast beta-1,3-glucan synthase mutant. AtGsl5 is developmentally expressed at highest levels in flowers, consistent with flowers having high beta-1,3-glucan synthase activities for deposition of callose in pollen. A role for AtGsl5 in callose synthesis is also indicated by AtGsl5 expression in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant. PMID:12081364

  4. Biochemistry and genetics of ACC deaminase: a weapon to “stress ethylene” produced in plants

    PubMed Central

    Singh, Rajnish P.; Shelke, Ganesh M.; Kumar, Anil; Jha, Prabhat N.

    2015-01-01

    1-aminocyclopropane-1-carboxylate deaminase (ACCD), a pyridoxal phosphate-dependent enzyme, is widespread in diverse bacterial and fungal species. Owing to ACCD activity, certain plant associated bacteria help plant to grow under biotic and abiotic stresses by decreasing the level of “stress ethylene” which is inhibitory to plant growth. ACCD breaks down ACC, an immediate precursor of ethylene, to ammonia and α-ketobutyrate, which can be further metabolized by bacteria for their growth. ACC deaminase is an inducible enzyme whose synthesis is induced in the presence of its substrate ACC. This enzyme encoded by gene AcdS is under tight regulation and regulated differentially under different environmental conditions. Regulatory elements of gene AcdS are comprised of the regulatory gene encoding LRP protein and other regulatory elements which are activated differentially under aerobic and anaerobic conditions. The role of some additional regulatory genes such as AcdB or LysR may also be required for expression of AcdS. Phylogenetic analysis of AcdS has revealed that distribution of this gene among different bacteria might have resulted from vertical gene transfer with occasional horizontal gene transfer (HGT). Application of bacterial AcdS gene has been extended by developing transgenic plants with ACCD gene which showed increased tolerance to biotic and abiotic stresses in plants. Moreover, distribution of ACCD gene or its homolog's in a wide range of species belonging to all three domains indicate an alternative role of ACCD in the physiology of an organism. Therefore, this review is an attempt to explore current knowledge of bacterial ACC deaminase mediated physiological effects in plants, mode of enzyme action, genetics, distribution among different species, ecological role of ACCD and, future research avenues to develop transgenic plants expressing foreign AcdS gene to cope with biotic and abiotic stressors. Systemic identification of regulatory circuits

  5. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

    PubMed

    Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

    2009-05-13

    One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates. PMID:19326953

  6. The Variability of Sesquiterpenes Emitted from Two Zea mays Cultivars Is Controlled by Allelic Variation of Two Terpene Synthase Genes Encoding Stereoselective Multiple Product Enzymes

    PubMed Central

    Köllner, Tobias G.; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-01-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes. PMID:15075399

  7. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    PubMed

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. PMID:24932969

  8. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid.

    PubMed

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2013-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of cellulose in higher plants. The hybrid Acacia auriculiformis x Acacia mangium represents an important source of tree cellulose for forest-based product manufacturing, with enormous economic potential. In this work, we isolate the first cellulose synthase gene, designated AaxmCesA1, from this species. The isolated full-length AaxmCesA1 cDNA encodes a polypeptide of 1,064 amino acids. Sequence analyses revealed that AaxmCesA1 cDNA possesses the key motif characteristics of a CesA protein. AaxmCesA1 shares more than 75 % amino acid sequence identity with CesA proteins from other plant species. Subsequently, the full-length AaxmCesA1 gene of 7,389 bp with partial regulatory and 13 intron regions was also isolated. Relative gene expression analysis by quantitative PCR in different tissues of the Acacia hybrid, suggests the involvement of the AaxmCesA1 gene in primary cell wall synthesis of rapidly dividing young root cells. Similarity analyses using Blast algorithms also suggests a role in primary cell wall deposition in the Acacia hybrid. Southern analysis predicts that AaxmCesA1 is a member of a multigene family with at least two isoforms in the genome of the Acacia hybrid. PMID:24415841

  9. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    SciTech Connect

    Paez, David; Salazar, Juliana; Pare, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  10. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    PubMed

    Cheng, Jun; Khan, Muhammad Awais; Qiu, Wen-Ming; Li, Jing; Zhou, Hui; Zhang, Qiong; Guo, Wenwu; Zhu, Tingting; Peng, Junhua; Sun, Fengjie; Li, Shaohua; Korban, Schuyler S; Han, Yuepeng

    2012-01-01

    Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS), which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA) to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots. PMID:22291904

  11. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    PubMed Central

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  12. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    PubMed

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  13. Copy-number analysis of topoisomerase and thymidylate synthase genes in frozen and FFPE DNAs of colorectal cancers

    PubMed Central

    Yu, Jinsheng; Miller, Ryan; Zhang, Wanghai; Sharma, Mala; Holtschlag, Vicky; Watson, Mark A; McLeod, Howard L

    2008-01-01

    Background Archived formalin-fixed, paraffin-embedded specimens represent an important resource for pharmacogenomic analysis in retrospective clinical studies but the quality of results from formalin-fixed, paraffin-embedded samples is of concern due to the fact of the degradation of DNAs and RNAs from formalin-fixed, paraffin-embedded tissues. Methods In the present study, we used DNA from fresh frozen as well as formalin-fixed, paraffin-embedded tumor to detect copy-number changes in colorectal cancer, and our data shows that formalin-fixed, paraffin-embedded DNAs were able to deliver reliable copy-number data, and that quantitative PCR had the ability to detect copy-number changes from deletion to amplification, with high concordance of copy-number calls among formalin-fixed, paraffin-embedded and frozen DNAs. Results The amplification of topoisomerase I and deletion of thymidylate synthase were found in 23% (12/52) and 27% (14/52) of colorectal cancers, but EGF receptor amplification was not common (5/52, < 10%). Among 52 colorectal cancers, 31 tumors were both topoisomerase I and thymidylate synthase diploid, which may have a worse outcome for tumor chemotherapy; and there were five tumors with favorable genomics (topoisomerase I amplification and thymidylate synthase deletion). Furthermore, topoisomerase I-amplified tumors had a two-times higher RNA level and a nearly twofold higher protein expression level than did the diploid tumors (p < 0.001 and 0.01, respectively), but there were no correlations between copy-number status and RNA or protein level for thymidylate synthase. Conclusions Our study suggests a potential pharmacogenomic influence of topoisomerase I copy-number alteration on its RNA/protein expressions, which could be reflected on tumor response to chemotherapy in human colorectal cancer. PMID:18855534

  14. The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix.

    PubMed

    Arakane, Y; Muthukrishnan, S; Kramer, K J; Specht, C A; Tomoyasu, Y; Lorenzen, M D; Kanost, M; Beeman, R W

    2005-10-01

    Functional analysis of the two chitin synthase genes, TcCHS1 and TcCHS2, in the red flour beetle, Tribolium castaneum, revealed unique and complementary roles for each gene. TcCHS1-specific RNA interference (RNAi) disrupted all three types of moult (larval-larval, larval-pupal and pupal-adult) and greatly reduced whole-body chitin content. Exon-specific RNAi showed that splice variant 8a of TcCHS1 was required for both the larval-pupal and pupal-adult moults, whereas splice variant 8b was required only for the latter. TcCHS2-specific RNAi had no effect on metamorphosis or on total body chitin content. However, RNAi-mediated down-regulation of TcCHS2, but not TcCHS1, led to cessation of feeding, a dramatic shrinkage in larval size and reduced chitin content in the midgut. PMID:16164601

  15. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    PubMed Central

    Ishida, Hiroshi; Ray, Radharaman; Amnuaysirikul, Jack; Ishida, Keiko; Ray, Prabhati

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of NO on wound healing inhibited by SM in NHEKs. The effect of the iNOS gene transfer on iNOS protein expression and NO generation were monitored by Western blot and flow cytometry, respectively. Wound healing with or without the iNOS gene transfer after SM exposure was assessed by light and confocal microscopy. The iNOS gene transfer via adenovirus resulted in overexpression of the iNOS and an increase in NO production regardless of SM exposure in the NHEK model. The gene transfer was also effective in overcoming the inhibition of wound healing due to SM exposure leading to the promotion of wound closure. The findings in this study suggest that the iNOS gene transfer is a promising therapeutic strategy for SM-induced skin injury. PMID:23762631

  16. Loss of the gene for the alpha subunit of ATP synthase (ATP5A1) from the W chromosome in the African grey parrot (Psittacus erithacus).

    PubMed

    de Kloet, S R

    2001-08-01

    This study describes the results of an analysis using Southern blotting, the polymerase chain reaction, and sequencing which shows that the African grey parrot (Psittacus erithacus) lacks the W-chromosomal gene for the alpha subunit of mitochondrial ATP synthase (ATP5A1W). Additional evidence shows that in other psittacines a fragment of the ATP5A1W gene contains five times as many nonsynonymous nucleotide replacements as the homologous fragment of the Z gene. Therefore, whereas in these other psittacines the corresponding ATP5A1Z protein fragment is highly conserved and varies by only a few, moderately conservative amino acid substitutions, the homologous ATP5A1W fragments contain a considerable number of, sometimes highly nonconservative, amino acid replacements. In one of these species, the ringneck parakeet (Psittacula krameri), the ATP5A1W gene is present in an inactive form because of the presence of a nonsense codon. Other changes, possibly leading to an inactive ATP5A1W gene product, involve the substitution of arginine residues by cysteine in the ATP5A1W protein of the mitred conure (Aratinga mitrata) and the blue and gold macaw (Ara ararauna). The data suggest also that although the divergence of the psittacine ATP5A1W and ATP5A1Z genes preceded the origin of the psittacidae, this divergence occurred independently of a similar process in the myna (Gracula religiosa), the outgroup used in this study. PMID:11479684

  17. Functional Analysis of the α-1,3-Glucan Synthase Genes agsA and agsB in Aspergillus nidulans: AgsB Is the Major α-1,3-Glucan Synthase in This Fungus

    PubMed Central

    Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu

    2013-01-01

    Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and 13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species. PMID:23365684

  18. ATP synthase.

    PubMed

    Junge, Wolfgang; Nelson, Nathan

    2015-01-01

    Oxygenic photosynthesis is the principal converter of sunlight into chemical energy. Cyanobacteria and plants provide aerobic life with oxygen, food, fuel, fibers, and platform chemicals. Four multisubunit membrane proteins are involved: photosystem I (PSI), photosystem II (PSII), cytochrome b6f (cyt b6f), and ATP synthase (FOF1). ATP synthase is likewise a key enzyme of cell respiration. Over three billion years, the basic machinery of oxygenic photosynthesis and respiration has been perfected to minimize wasteful reactions. The proton-driven ATP synthase is embedded in a proton tight-coupling membrane. It is composed of two rotary motors/generators, FO and F1, which do not slip against each other. The proton-driven FO and the ATP-synthesizing F1 are coupled via elastic torque transmission. Elastic transmission decouples the two motors in kinetic detail but keeps them perfectly coupled in thermodynamic equilibrium and (time-averaged) under steady turnover. Elastic transmission enables operation with different gear ratios in different organisms. PMID:25839341

  19. Assignment of the human prostaglandin-endoperoxide synthase 2 (PTGS2) gene to 1q25 by fluorescence in situ hybridization

    SciTech Connect

    Tay, A.; Squire, J.A.; Goldberg, H.; Skorecki, K.

    1994-10-01

    A major mechanism for the regulation of prostaglandin synthesis occurs at the level of cyclooxygenase, also known as prostaglandin-endoperoxide synthase (PTGS). Two isoforms of PTGS have been identified: PTGS1, encoded by a 2.8-kb mRNA and a mitogen-inducible form, PTGS2, encoded by a 4.5-kb mRNA. We report here the assignment of the human PTGS2 gene to chromosome 1q25 by fluorescence in situ hybridization (FISH). We note with interest the physical proximity of the PTGS2 gene to that of cytosolic phospholipase A2 (cPLA2), which we have previously mapped to chromosome 1q24-q25. In contrast, the PTGS1 gene has been mapped to chromosome 9. Since cPLA2 and PTGS2 are key enzymes in the synthesis of prostaglandins and thromboxane, the possible implication of this proximity could mean that polymorphic markers already determined for the cPLA2 gene may also prove to be useful as markers for the PTGS2 gene as well. 10 refs., 1 fig.

  20. Chicken ovalbumin upstream-promoter transcription factor (COUP-TF) could act as a transcriptional activator or repressor of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene.

    PubMed Central

    Rodríguez, J C; Ortiz, J A; Hegardt, F G; Haro, D

    1997-01-01

    The chicken ovalbumin upstream-promoter transcription factor (COUP-TF) has a dual effect on the regulation of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene. COUP-TF could act as a transcriptional activator or repressor of this gene through different DNA sequences. COUP-TF induces expression of a reporter gene linked to the mitochondrial HMG-CoA synthase gene promoter in human hepatoma HepG2 cells, but represses it in a Leydig tumour cell line (R2C); in both these cell lines the expression of the mitochondrial HMG-CoA synthase gene mimics that of liver and testis. The activation is promoted by a fragment of the gene from coordinates -62 to +28, which contains a GC box and a TATA box, and where no COUP-TF binding site was observed by in vitro DNA binding studies. On the other hand, the COUP-TF inhibitory effect is mainly due to repression of peroxisome-proliferator-activated receptor-dependent activation of the gene, interacting with the region from -104 to -92. To our knowledge this work represents the second example of a target gene for COUP-TF I that could be either activated or repressed by the action of this receptor through different DNA sequences of the same gene. PMID:9291136

  1. Starch phosphorylation in potato tubers is influenced by allelic variation in the genes encoding glucan water dikinase, starch branching enzymes I and II, and starch synthase III

    PubMed Central

    Carpenter, Margaret A.; Joyce, Nigel I.; Genet, Russell A.; Cooper, Rebecca D.; Murray, Sarah R.; Noble, Alasdair D.; Butler, Ruth C.; Timmerman-Vaughan, Gail M.

    2015-01-01

    Starch phosphorylation is an important aspect of plant metabolism due to its role in starch degradation. Moreover, the degree of phosphorylation of starch determines its physicochemical properties and is therefore relevant for industrial uses of starch. Currently, starch is chemically phosphorylated to increase viscosity and paste stability. Potato cultivars with elevated starch phosphorylation would make this process unnecessary, thereby bestowing economic and environmental benefits. Starch phosphorylation is a complex trait which has been previously shown by antisense gene repression to be influenced by a number of genes including those involved in starch synthesis and degradation. We have used an association mapping approach to discover genetic markers associated with the degree of starch phosphorylation. A diverse collection of 193 potato lines was grown in replicated field trials, and the levels of starch phosphorylation at the C6 and C3 positions of the glucosyl residues were determined by mass spectrometry of hydrolyzed starch from tubers. In addition, the potato lines were genotyped by amplicon sequencing and microsatellite analysis, focusing on candidate genes known to be involved in starch synthesis. As potato is an autotetraploid, genotyping included determination of allele dosage. Significant associations (p < 0.001) were found with SNPs in the glucan water dikinase (GWD), starch branching enzyme I (SBEI) and the starch synthase III (SSIII) genes, and with a SSR allele in the SBEII gene. SNPs in the GWD gene were associated with C6 phosphorylation, whereas polymorphisms in the SBEI and SBEII genes were associated with both C6 and C3 phosphorylation and the SNP in the SSIII gene was associated with C3 phosphorylation. These allelic variants have potential as genetic markers for starch phosphorylation in potato. PMID:25806042

  2. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  3. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    PubMed Central

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  4. Exposure to diflubenzuron results in an up-regulation of a chitin synthase 1 gene in citrus red mite, Panonychus citri (Acari: Tetranychidae).

    PubMed

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  5. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera) Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    PubMed Central

    2010-01-01

    Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS) were predicted by in silico analysis of the grapevine (Vitis vinifera) genome assembly [1]. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information about gene structure and

  6. 5th International ACC Symposium: Hereditary Predisposition to Childhood ACC and the Associated Molecular Phenotype: 5th International ACC Symposium Session: Not Just for Kids!

    PubMed

    Else, Tobias; Rodriguez-Galindo, Carlos

    2016-02-01

    Adrenocortical carcinoma (ACC) affects children and adults. Roughly 50% of very early onset ACCs occur in children with germline TP53 mutations. Several recent studies have extended our understanding in basic, clinical, and translational genetics with regard to TP53 germline predisposition in ACC patients. The recent description of the molecular landscape of pediatric ACCs provided insight into differences of tumors arising in patients with and without TP53 germline mutation. Another recent important finding is that not all TP53 mutations are equal in their tumor suppressing potential. It has now been shown that family histories as well as molecular characteristics of preserved TP53 functions vary greatly between mutations. It also has become clear that adult patients with ACC often harbor germline mutations causing hereditary syndromes, including Li-Fraumeni syndrome (LFS), Lynch syndrome, and multiple endocrine neoplasia type 1 (MEN1). PMID:26660147

  7. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  8. Silencing of the chalcone synthase gene in Casuarina glauca highlights the important role of flavonoids during nodulation.

    PubMed

    Abdel-Lateif, Khalid; Vaissayre, Virginie; Gherbi, Hassen; Verries, Clotilde; Meudec, Emmanuelle; Perrine-Walker, Francine; Cheynier, Véronique; Svistoonoff, Sergio; Franche, Claudine; Bogusz, Didier; Hocher, Valérie

    2013-09-01

    Nitrogen-fixing root nodulation is confined to four plant orders, including > 14,000 Leguminosae, one nonlegume genus Parasponia and c. 200 actinorhizal species that form symbioses with rhizobia and Frankia bacterial species, respectively. Flavonoids have been identified as plant signals and developmental regulators for nodulation in legumes and have long been hypothesized to play a critical role during actinorhizal nodulation. However, direct evidence of their involvement in actinorhizal symbiosis is lacking. Here, we used RNA interference to silence chalcone synthase, which is involved in the first committed step of the flavonoid biosynthetic pathway, in the actinorhizal tropical tree Casuarina glauca. Transformed flavonoid-deficient hairy roots were generated and used to study flavonoid accumulation and further nodulation. Knockdown of chalcone synthase expression reduced the level of specific flavonoids and resulted in severely impaired nodulation. Nodule formation was rescued by supplementing the plants with naringenin, which is an upstream intermediate in flavonoid biosynthesis. Our results provide, for the first time, direct evidence of an important role for flavonoids during the early stages of actinorhizal nodulation. PMID:23692063

  9. Endothelial Nitric Oxide Synthase (-786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia.

    PubMed

    Vilas-Boas, Wendell; Figueiredo, Camylla V B; Pitanga, Thassila N; Carvalho, Magda O S; Santiago, Rayra P; Santana, Sânzio S; Guarda, Caroline C; Zanette, Angela M D; Cerqueira, Bruno A V; Gonçalves, Marilda S

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS -786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  10. Endothelial Nitric Oxide Synthase (−786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia

    PubMed Central

    Vilas-Boas, Wendell; Figueiredo, Camylla V. B.; Pitanga, Thassila N.; Carvalho, Magda O. S.; Santiago, Rayra P.; Santana, Sânzio S.; Guarda, Caroline C.; Zanette, Angela M. D.; Cerqueira, Bruno A. V.; Gonçalves, Marilda S.

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS −786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  11. Ketide Synthase (KS) Domain Prediction and Analysis of Iterative Type II PKS Gene in Marine Sponge-Associated Actinobacteria Producing Biosurfactants and Antimicrobial Agents

    PubMed Central

    Selvin, Joseph; Sathiyanarayanan, Ganesan; Lipton, Anuj N.; Al-Dhabi, Naif Abdullah; Valan Arasu, Mariadhas; Kiran, George S.

    2016-01-01

    The important biological macromolecules, such as lipopeptide and glycolipid biosurfactant producing marine actinobacteria were analyzed and their potential linkage between type II polyketide synthase (PKS) genes was explored. A unique feature of type II PKS genes is their high amino acid (AA) sequence homology and conserved gene organization. These enzymes mediate the biosynthesis of polyketide natural products with enormous structural complexity and chemical nature by combinatorial use of various domains. Therefore, deciphering the order of AA sequence encoded by PKS domains tailored the chemical structure of polyketide analogs still remains a great challenge. The present work deals with an in vitro and in silico analysis of PKS type II genes from five actinobacterial species to correlate KS domain architecture and structural features. Our present analysis reveals the unique protein domain organization of iterative type II PKS and KS domain of marine actinobacteria. The findings of this study would have implications in metabolic pathway reconstruction and design of semi-synthetic genomes to achieve rational design of novel natural products. PMID:26903957

  12. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    SciTech Connect

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-11-07

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml{sup -1}), CdCl{sub 2} (4 mM), CuCl{sub 2} (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses.

  13. Phylogeny of type I polyketide synthases (PKSs) in fungal entomopathogens and expression analysis of PKS genes in Beauveria bassiana BCC 2660.

    PubMed

    Punya, Juntira; Swangmaneecharern, Pratchya; Pinsupa, Suparat; Nitistaporn, Pornpen; Phonghanpot, Suranat; Kunathigan, Viyada; Cheevadhanarak, Supapon; Tanticharoen, Morakot; Amnuaykanjanasin, Alongkorn

    2015-06-01

    Entomopathogenic fungi are able to invade and kill insects. Various secondary metabolites can mediate the interaction of a fungal pathogen with an insect host and also help the fungus compete with other microbes. Here we screened 23 isolates of entomopathogenic fungi for polyketide synthase (PKS) genes and amplified 72 PKS gene fragments using degenerate PCR. We performed a phylogenetic analysis of conserved ketosynthase and acyltransferase regions in these 72 sequences and 72 PKSs identified from four insect fungal genome sequences. The resulting genealogy indicated 47 orthologous groups with 99-100 % bootstrap support, suggesting shared biosynthesis of identical or closely related compounds from different fungi. Three insect-specific groups were identified among the PKSs in reducing clades IIa, IIb, and III, which comprised PKSs from 12, 9, and 30 fungal isolates, respectively. A IIa-IIb pair could be found in seven fungi. Expression analyses revealed that eleven out of twelve PKS genes identified in Beauveria bassiana BCC 2660 were expressed in culture. PKS genes from insect-specific clades IIa and IIb were expressed only in insect-containing medium, while others were expressed only in PDB or in CYB, PDB and SDY. The data suggest the potential production of several polyketides in culture. PMID:25986551

  14. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  15. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.

    PubMed

    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G

    1996-03-11

    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  16. Rice SLENDER LEAF 1 gene encodes cellulose synthase-like D4 and is specifically expressed in M-phase cells to regulate cell proliferation

    PubMed Central

    Yoshikawa, Takanori; Eiguchi, Mitsugu; Hibara, Ken-Ichiro; Ito, Jun-Ichi; Nagato, Yasuo

    2013-01-01

    Cellulose synthase-like (CSL) genes are predicted to catalyse the biosynthesis of non-cellulosic polysaccharides such as the β-d-glycan backbone of hemicelluloses and are classified into nine subfamilies (CSLA–CSLH and CSLJ). The CSLD subfamily is conserved in all land plants, and among the nine CSL subfamilies, it shows the highest sequence similarity to the cellulose synthase genes, suggesting that it plays fundamental roles in plant development. This study presents a detailed analysis of slender leaf 1 (sle1) mutants of rice that showed rolled and narrow leaf blades and a reduction in plant height. The narrow leaf blade of sle1 was caused by reduced cell proliferation beginning at the P3 primordial stage. In addition to the size reduction of organs, sle1 mutants exhibited serious developmental defects in pollen formation, anther dehiscence, stomata formation, and cell arrangement in various tissues. Map-based cloning revealed that SLE1 encodes the OsCSLD4 protein, which was identified previously from a narrow leaf and dwarf 1 mutant. In situ hybridization experiments showed that OsCSLD4 was expressed in a patchy pattern in developing organs. Double-target in situ hybridization and quantitative RT-PCR analyses revealed that SLE1 was expressed specifically during the M-phase of the cell cycle, and suggested that the cell-cycle regulation was altered in sle1 mutants. These results suggest that the OsCSLD4 protein plays a pivotal role in the M phase to regulate cell proliferation. Further study of OsCSLD4 is expected to yield new insight into the role of hemicelluloses in plant development. PMID:23519729

  17. Functional Analysis of the Cellulose Synthase-Like Genes CSLD1, CSLD2, and CSLD4 in Tip-Growing Arabidopsis Cells1[W

    PubMed Central

    Bernal, Adriana J.; Yoo, Cheol-Min; Mutwil, Marek; Jensen, Jakob Krüger; Hou, Guichuan; Blaukopf, Claudia; Sørensen, Iben; Blancaflor, Elison B.; Scheller, Henrik Vibe; Willats, William G.T.

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that previously described for CSLD3 (KOJAK). CSLD2 is required during a later stage of hair development than CSLD3, and CSLD2 mutants produce root hairs with a range of abnormalities, with many root hairs rupturing late in development. Remarkably, though, it was often the case that in CSLD2 mutants, tip growth would resume after rupturing of root hairs. In silico, semiquantitative reverse transcription-polymerase chain reaction, and promoter-reporter construct analyses indicated that the expression of both CSLD2 and CSLD3 is elevated at reduced temperatures, and the phenotypes of mutants homozygous for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect in male transmission, and plants heterozygous for insertions in CSLD1 or CSLD4 were defective in their ability to produce pollen tubes, although the number and morphology of pollen grains was normal. We propose that the CSLD family of putative glycosyltransferases synthesize a polysaccharide that has a specialized structural role in the cell walls of tip-growing cells. PMID:18768911

  18. Orphan nuclear receptor HNF4G promotes bladder cancer growth and invasion through the regulation of the hyaluronan synthase 2 gene

    PubMed Central

    Okegawa, T; Ushio, K; Imai, M; Morimoto, M; Hara, T

    2013-01-01

    Nuclear receptors (NRs) are a class of transcription factors that are closely involved in the progression of certain types of cancer. We aimed to study the relation between bladder cancer and NRs, with special focus on orphan NRs whose ligands and functions have not been identified. First, we examined the expression levels of 22 genes encoding orphan NRs in clinical bladder cancer and found that hepatocyte nuclear factor 4γ (HNF4G; NR2A2) and NR2F6 were the genes that were upregulated most frequently in cancer tissues compared with their paired normal tissues. Knockdown and overexpression of each of these orphan NRs suppressed and stimulated the growth of bladder cancer cells in vitro, respectively. HNF4G also promoted tumor growth in bladder cancer xenograft models in vivo. Furthermore, HNF4G was both necessary and sufficient for the invasion of bladder cancer cells in vitro. Moreover, using microarray analyses, we identified hyaluronan synthase 2 (HAS2) as one of the genes induced by HNF4G in bladder cancer cells. Transcription was activated by HNF4G in reporter assays using the promoter/enhancer region of the HAS2 gene. The endogenous expression of the HAS2 gene was suppressed by knockdown of HNF4G. In turn, knockdown of HAS2 inhibited the growth and invasion of bladder cancer cells. Taken together, our data suggest that some orphan NRs are involved in bladder cancer progression and that, among them, HNF4G promotes the growth and invasion of bladder cancer, at least in part, via the regulation of the HAS2 gene. PMID:23896584

  19. RNA Interference of Soybean Isoflavone Synthase Genes Leads to Silencing in Tissues Distal to the Transformation Site and to Enhanced Susceptibility to Phytophthora sojae1

    PubMed Central

    Subramanian, Senthil; Graham, Madge Y.; Yu, Oliver; Graham, Terrence L.

    2005-01-01

    Isoflavones are thought to play diverse roles in plant-microbe interactions and are also potentially important to human nutrition and medicine. Isoflavone synthase (IFS) is a key enzyme for the formation of the isoflavones. Here, we examined the consequences of RNAi silencing of genes for this enzyme in soybean (Glycine max). Soybean cotyledon tissues were transformed with Agrobacterium rhizogenes carrying an RNAi silencing construct designed to silence expression of both copies of IFS genes. Approximately 50% of emerging roots were transformed with the RNAi construct, and most transformed roots exhibited >95% silencing of isoflavone accumulation. Silencing of IFS was also demonstrated throughout the entire cotyledon (in tissues distal to the transformation site) both by high-performance liquid chromatography analysis of isoflavones and by real-time reverse transcription-PCR. This distal silencing led to a nearly complete suppression of mRNA accumulation for both the IFS1 and IFS2 genes and of isoflavone accumulations induced by wounding or treatment with the cell wall glucan elicitor from Phytophthora sojae. Preformed isoflavone conjugates were not reduced in distal tissues, suggesting little turnover of these stored isoflavone pools. Distal silencing was established within just 5 d of transformation and was highly efficient for a 3- to 4-d period, after which it was no longer apparent in most experiments. Silencing of IFS was effective in at least two genotypes and led to enhanced susceptibility to P. sojae, disrupting both R gene-mediated resistance in roots and nonrace-specific resistance in cotyledon tissues. The soybean cotyledon system, already a model system for defense signal-response and cell-to-cell signaling, may provide a convenient and effective system for functional analysis of plant genes through gene silencing. PMID:15778457

  20. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  1. Induction of fatty acid synthase and S14 gene expression by glucose, xylitol and dihydroxyacetone in cultured rat hepatocytes is closely correlated with glucose 6-phosphate concentrations.

    PubMed Central

    Mourrieras, F; Foufelle, F; Foretz, M; Morin, J; Bouche, S; Ferre, P

    1997-01-01

    It is now well established that the transcription of several genes belonging to the glycolytic and lipogenic pathway is stimulated in the presence of a high glucose concentration in adipocytes and hepatocytes. We have previously proposed that glucose 6-phosphate could be the signal metabolite that transduces the glucose effect. This proposal has recently been challenged and both an intermediate of the pentose phosphate pathway, xylulose 5-phosphate, and metabolites of the later part of glycolysis (3-phosphoglycerate and phosphoenolpyruvate) have been proposed. To discriminate between these possibilities, we have measured concomitantly, in primary cultures of adult rat hepatocytes, the expression of the fatty acid synthase (FAS) and S14 genes and the concentration of glucose metabolites. We have used various substrates entering at different steps of the glycolytic pathway (glucose, dihydroxyacetone) and the pentose phosphate pathway (xylitol). When compared with 5 mM glucose, 25 mM glucose induces a marked increase in both S14 and FAS gene expression, detectable as early as 2 h and peaking at 6 h. Increasing concentrations (1-5 mM) of xylitol and dihydroxyacetone in the presence of 5 mM glucose are also able to induce S14 and FAS gene expression progressively. Among the various glucose metabolites measured, glucose 6-phosphate, in contrast with xylulose 5-phosphate and metabolites of the lower part of glycolysis, is the only one that shows a clear-cut parallelism between its concentration and the degree of S14 and FAS gene expression. We conclude that glucose 6-phosphate is the most likely signal metabolite for the glucose-induced transcription of this group of genes. PMID:9291103

  2. A functional cellulose synthase from ascidian epidermis

    PubMed Central

    Matthysse, Ann G.; Deschet, Karine; Williams, Melanie; Marry, Mazz; White, Alan R.; Smith, William C.

    2004-01-01

    Among animals, urochordates (e.g., ascidians) are unique in their ability to biosynthesize cellulose. In ascidians cellulose is synthesized in the epidermis and incorporated into a protective coat know as the tunic. A putative cellulose synthase-like gene was first identified in the genome sequences of the ascidian Ciona intestinalis. We describe here a cellulose synthase gene from the ascidian Ciona savignyi that is expressed in the epidermis. The predicted C. savignyi cellulose synthase amino acid sequence showed conserved features found in all cellulose synthases, including plants, but was most similar to cellulose synthases from bacteria, fungi, and Dictyostelium discoidium. However, unlike other known cellulose synthases, the predicted C. savignyi polypeptide has a degenerate cellulase-like region near the carboxyl-terminal end. An expression construct carrying the C. savignyi cDNA was found to restore cellulose biosynthesis to a cellulose synthase (CelA) minus mutant of Agrobacterium tumefaciens, showing that the predicted protein has cellulose synthase activity. The lack of cellulose biosynthesis in all other groups of metazoans and the similarity of the C. savignyi cellulose synthase to enzymes from cellulose-producing organisms support the hypothesis that the urochordates acquired the cellulose biosynthetic pathway by horizontal transfer. PMID:14722352

  3. Tumor suppressor p53 inhibits transcriptional activation of invasion gene thromboxane synthase mediated by the proto-oncogenic factor ets-1.

    PubMed

    Kim, Ella; Günther, Willy; Yoshizato, Kimio; Meissner, Hildegard; Zapf, Srenja; Nüsing, Rolf M; Yamamoto, Hirotaka; Van Meir, Erwin G; Deppert, Wolfgang; Giese, Alf

    2003-10-30

    Cancer formation and progression is a complex process determined by several mechanisms that promote cell growth, invasiveness, neo-angiogenesis, and render neoplastic cells resistant to apoptosis. The tumor suppressor p53 and the proto-oncogenic factor ets-1 are important regulators of such mechanisms. While it is well established that p53 and ets-1 influence various aspects of cell behavior by regulating the transcription of specific genes, little is known about the functional relationship between these transcription factors. We found that the gene encoding thromboxane synthase (TXSA), which we recently identified as a factor promoting invasion and resistance to apoptosis in gliomas, is a novel target gene for both p53 and ets-1. We demonstrate that p53 and ets-1 coregulate TXSA in an antagonistic and inter-related manner, with ets-1 being a potent transcriptional activator and p53 inhibiting ets-1-dependent transcription. Negative interference with ets-1 transcription requires functional p53 and is lost in mutant p53 proteins. We show that ets-1 and p53 associate physically in vitro and in vivo and that their interaction, rather than a direct binding of p53 to the TXSA promoter, is required for transcriptional repression of TXSA by wild-type p53. An important implication of our findings is that the loss of p53-mediated negative control over ets-1-dependent transcription may lead to the acquisition of an invasive phenotype in tumor cells. PMID:14586398

  4. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    PubMed

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed. PMID:27072286

  5. Production of dammarane-type sapogenins in rice by expressing the dammarenediol-II synthase gene from Panax ginseng C.A. Mey.

    PubMed

    Huang, Zhiwei; Lin, Juncheng; Cheng, Zuxin; Xu, Ming; Huang, Xinying; Yang, Zhijian; Zheng, Jingui

    2015-10-01

    Ginsenosides are the main active ingredients in Chinese medicinal ginseng; 2,3-oxidosqualene is a precursor metabolite to ginsenosides that is present in rice. Because rice lacks a key rate-limiting enzyme (dammarenediol-II synthase, DS), rice cannot synthesize dammarane-type ginsenosides. In this study, the ginseng (Panax ginseng CA Mey.) DS gene (GenBank: AB265170.1) was transformed into rice using agrobacterium, and 64 rice transgenic plants were produced. The Transfer-DNA (T-DNA) insertion sites in homozygous lines of the T2 generation were determined by using high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR) and differed in all tested lines. One to two copies of the T-DNA were present in each transformant, and real-time PCR and Western blotting showed that the transformed DS gene could be transcribed and highly expressed. High performance liquid chromatography (HPLC) analysis showed that the dammarane-type sapogenin 20(S)-protopanaxadiol (PPD) content was 0.35-0.59 mg/g dw and the dammarane-type sapogenin 20(S)-protopanaxatriol (PPT) content was 0.23-0.43 mg/g dw in the transgenic rice. LC/MS analysis confirmed production of PPD and PPT. These results indicate that a new "ginseng rice" germplasm containing dammarane-type sapogenins has been successfully developed by transforming the ginseng DS gene into rice. PMID:26398795

  6. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    PubMed

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  7. Organophosphate Pesticide Exposures, Nitric Oxide Synthase Gene Variants, and Gene–Pesticide Interactions in a Case–Control Study of Parkinson’s Disease, California (USA)

    PubMed Central

    Paul, Kimberly C.; Sinsheimer, Janet S.; Rhodes, Shannon L.; Cockburn, Myles; Bronstein, Jeff; Ritz, Beate

    2015-01-01

    Background: Nitric oxide synthase (NOS) genes are candidates for Parkinson’s disease (PD) because NOS enzymes produce nitric oxide (NO), a pro-oxidant that can damage neurons. Widely used organophosphate (OP) pesticides can induce oxidative stress and are reported to increase PD risk. Additionally, two single nucleotide polymorphisms (SNPs) from the PON1 (paraoxonase 1) gene influence the ability to metabolize OPs. Objective: Here, we investigated contributions of NOS genes and OP pesticides to PD risk, controlling for PON1 status. Methods: In 357 incident PD cases and 495 population controls, we investigated eight NOS SNPs and interactions with both household and ambient agricultural OP exposures assessed with geographic information system (GIS). Results: In comparing PD in homozygous variant carriers of NOS2A rs1060826 versus homozygous wild-type or heterozygotes, we estimate an adjusted odds ratio (OR) of 1.51 (95% CI: 0.95, 2.41). When considering interactions between NOS1 rs2682826 and OP exposure from household use, the OR for frequent OP use alone was 1.30 (95% CI: 0.72, 2.34) and for the CT+TT genotype alone was 0.89 (95% CI: 0.58, 1.39), and for frequent OP use combined with the CT+TT genotype the OR was 2.84 (95% CI: 1.49, 5.40) (interaction p-value 0.04). Similar results were seen for ambient OP exposure. Interactions between OP exposure and three other NOS1 SNPs and a genetic risk score combining all NOS1 SNPs reached statistical significance. Conclusions: We found that OP pesticides were more strongly associated with PD among participants with variant genotypes in NOS1, consistent with the importance of oxidative stress-inducing mechanisms. Our data provide evidence for NOS1 modifying PD risk in OP exposed populations. Citation: Paul KC, Sinsheimer JS, Rhodes SL, Cockburn M, Bronstein J, Ritz B. 2016. Organophosphate pesticide exposures, nitric oxide synthase gene variants, and gene–pesticide interactions in a case–control study of Parkinson

  8. Ambient pH Controls Glycogen Levels by Regulating Glycogen Synthase Gene Expression in Neurospora crassa. New Insights into the pH Signaling Pathway

    PubMed Central

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia

    2012-01-01

    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacCKO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa. PMID:22952943

  9. Development of a human mitochondrial oligonucleotide microarray (h-MitoArray) and gene expression analysis of fibroblast cell lines from 13 patients with isolated F1Fo ATP synthase deficiency

    PubMed Central

    Čížková, Alena; Stránecký, Viktor; Ivánek, Robert; Hartmannová, Hana; Nosková, Lenka; Piherová, Lenka; Tesařová, Markéta; Hansíková, Hana; Honzík, Tomáš; Zeman, Jiří; Divina, Petr; Potocká, Andrea; Paul, Jan; Sperl, Wolfgang; Mayr, Johannes A; Seneca, Sara; Houštĕk, Josef; Kmoch, Stanislav

    2008-01-01

    Background To strengthen research and differential diagnostics of mitochondrial disorders, we constructed and validated an oligonucleotide microarray (h-MitoArray) allowing expression analysis of 1632 human genes involved in mitochondrial biology, cell cycle regulation, signal transduction and apoptosis. Using h-MitoArray we analyzed gene expression profiles in 9 control and 13 fibroblast cell lines from patients with F1Fo ATP synthase deficiency consisting of 2 patients with mt9205ΔTA microdeletion and a genetically heterogeneous group of 11 patients with not yet characterized nuclear defects. Analysing gene expression profiles, we attempted to classify patients into expected defect specific subgroups, and subsequently reveal group specific compensatory changes, identify potential phenotype causing pathways and define candidate disease causing genes. Results Molecular studies, in combination with unsupervised clustering methods, defined three subgroups of patient cell lines – M group with mtDNA mutation and N1 and N2 groups with nuclear defect. Comparison of expression profiles and functional annotation, gene enrichment and pathway analyses of differentially expressed genes revealed in the M group a transcription profile suggestive of synchronized suppression of mitochondrial biogenesis and G1/S arrest. The N1 group showed elevated expression of complex I and reduced expression of complexes III, V, and V-type ATP synthase subunit genes, reduced expression of genes involved in phosphorylation dependent signaling along MAPK, Jak-STAT, JNK, and p38 MAP kinase pathways, signs of activated apoptosis and oxidative stress resembling phenotype of premature senescent fibroblasts. No specific functionally meaningful changes, except of signs of activated apoptosis, were detected in the N2 group. Evaluation of individual gene expression profiles confirmed already known ATP6/ATP8 defect in patients from the M group and indicated several candidate disease causing genes for

  10. Mini- and full-length dystrophin gene transfer induces the recovery of nitric oxide synthase at the sarcolemma of mdx4cv skeletal muscle fibers.

    PubMed

    Decrouy, A; Renaud, J M; Lunde, J A; Dickson, G; Jasmin, B J

    1998-01-01

    In normal skeletal muscle fibers, dystrophin accumulates at the cytoplasmic face of the sarcolemma where it associates with dystrophin-associated proteins (DAPs). Several studies have recently shown that the neuronal isoform of nitric oxide synthase (nNOS) is also located at the sarcolemma, and that this membrane localization is mediated through interactions of nNOS with one of the DAPs, namely alpha 1-syntrophin. Since the lack of dystrophin in muscle fi