Science.gov

Sample records for acc synthase genes

  1. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  2. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    PubMed

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  3. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    PubMed

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  4. Ozone stress induces the expression of ACC synthase in potato plants

    SciTech Connect

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J. )

    1993-05-01

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACC synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.

  5. A functional tomato ACC synthase expressed in Escherichia coli demonstrates suicidal inactivation by its substrate S-adenosylmethionine.

    PubMed

    Li, N; Wiesman, Z; Liu, D; Mattoo, A K

    1992-07-20

    1-Aminocyclopropane-1-carboxylate (ACC) synthase is a key enzyme in the biosynthesis of the plant hormone, ethylene. We have isolated, sequenced and expressed a functional tomato (cv Pik-Red) ACC synthase gene in Escherichia coli. ACC synthase expressed in E. coli was inactivated by incubation with S-adenosylmethionine (SAM), the half-time of which was concentration dependent. Mixing the tomato fruit protein extract with the cell-free extract from transformed E. coli did not affect SAM-dependent inactivation of ACC synthase activity. Thus, single isoforms of the ACC synthase enzyme, which demonstrate the biochemical features expected of the tomato fruit enzyme, can be expressed in E. coli and their structure-function relationships investigated.

  6. Isoelectric focusing of wound-induced tomato ACC synthase

    SciTech Connect

    White, J.A.; Kende, H. )

    1990-05-01

    Several techniques of electrofocusing have been used to determine whether 1-aminocyclopropane-1-carboxylate (ACC) synthase isolated from wounded tomato pericarp tissue exists in different isoforms, each with its characteristic isoelectric point (pI). The pI of the native enzyme was found to be 6.0 {plus minus} 0.2. When radiolabeled, denatured ACC synthase was electrofocused by non-equilibrium pH gradient electrophoresis (NEpHGE), the enzyme separated into four discernible spots which, upon reaching equilibrium, ranged in pI from 6.6 to 6.9. Immunopurified ACC synthase from four tomato cultivars (Duke, Cornell, Mountain Pride and Pik Red) migrated in each case as a 50-kDa protein on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE). We propose that native ACC synthase in extracts of tomato pericarp tissue exists in one single form and that the charge heterogeneities observed upon electrofocusing of denatured enzyme result from modifications of preexisting protein.

  7. Accumulation of wound-inducible ACC synthase transcript in tomato fruit is inhibited by salicylic acid and polyamines.

    PubMed

    Li, N; Parsons, B L; Liu, D R; Mattoo, A K

    1992-02-01

    Regulation of wound-inducible 1-aminocyclopropane-1-carboxylic acid (ACC) synthase expression was studied in tomato fruit (Lycopersicon esculentum cv. Pik-Red). A 70 base oligonucleotide probe homologous to published ACC synthase cDNA sequences was successfully used to identify and analyze regulation of a wound-inducible transcript. The 1.8 kb ACC synthase transcript increased upon wounding the fruit as well as during fruit ripening. Salicylic acid, an inhibitor of wound-responsive genes in tomato, inhibited the wound-induced accumulation of the ACC synthase transcript. Further, polyamines (putrescine, spermidine and spermine) that have anti-senescence properties and have been shown to inhibit the development of ACC synthase activity, inhibited the accumulation of the wound-inducible ACC synthase transcript. The inhibition by spermine was greater than that caused by putrescine or spermidine. The transcript level of a wound-repressible glycine-rich protein gene and that of the constitutively expressed rRNA were not affected as markedly by either salicylic acid or polyamines. These data suggest that salicylic acid and polyamines may specifically regulate ethylene biosynthesis at the level of ACC synthase transcript accumulation.

  8. A type III ACC synthase, ACS7, is involved in root gravitropism in Arabidopsis thaliana.

    PubMed

    Huang, Shih-Jhe; Chang, Chia-Lun; Wang, Po-Hsun; Tsai, Min-Chieh; Hsu, Pang-Hung; Chang, Ing-Feng

    2013-11-01

    Ethylene is an important plant hormone that regulates developmental processes in plants. The ethylene biosynthesis pathway is a highly regulated process at both the transcriptional and post-translational level. The transcriptional regulation of these ethylene biosynthesis genes is well known. However, post-translational modifications of the key ethylene biosynthesis enzyme 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) are little understood. In vitro kinase assays were conducted on the type III ACS, AtACS7, fusion protein and peptides to determine whether the AtACS7 protein can be phosphorylated by calcium-dependent protein kinase (CDPK). AtACS7 was phosphorylated at Ser216, Thr296, and Ser299 by AtCDPK16 in vitro. To investigate further the function of the ACS7 gene in Arabidopsis, an acs7-1 loss-of-function mutant was isolated. The acs7-1 mutant exhibited less sensitivity to the inhibition of root gravitropism by treatment with the calcium chelator ethylene glycol tetraacetic acid (EGTA). Seedlings were treated with gradient concentrations of ACC. The results showed that a certain concentration of ethylene enhanced the gravity response. Moreover, the acs7-1 mutant was less sensitive to inhibition of the gravity response by treatment with the auxin polar transport inhibitor 1-naphthylphthalamic acid, but exogenous ACC application recovered root gravitropism. Altogether, the results indicate that AtACS7 is involved in root gravitropism in a calcium-dependent manner in Arabidopsis.

  9. 1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

    PubMed

    Tucker, Mark L; Xue, Ping; Yang, Ronghui

    2010-01-01

    Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

  10. The formation of ACC and competition between polyamines and ethylene for SAM

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethylene biosynthesis involves the conversion of S-adenosylmethionine (SAM) to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is then converted to ethylene. The genes that encode enzymes in this pathway all belong to a family of genes. Differential transcriptional regulation ...

  11. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    PubMed

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  12. Rapid identification of 1-aminocyclopropane-1-carboxylate (ACC) synthase genotypes in cultivars of Japanese pear (Pyrus pyrifolia Nakai) using CAPS markers.

    PubMed

    Itai, A; Kotaki, T; Tanabe, K; Tamura, F; Kawaguchi, D; Fukuda, M

    2003-05-01

    In Japanese pear (Pyrus pyrifolia Nakai), fruit storage potential is closely related to the amount of ethylene produced. We have developed a rapid and accurate method for analyzing genes involved in high ethylene production during fruit ripening in Japanese pear. This involves cleaved-amplified polymorphic sequences (CAPS) of two 1-aminocyclopropane-1-carboxylate (ACC) synthase genes (PPACS1 and PPACS2). Two CAPS markers (A for PPACS1 and B for PPACS2), associated with the amount of ethylene produced, were identified. Marker A was associated with high ethylene producers and marker B with moderate ethylene producers. The absence of these two markers enabled the identification of low ethylene producers. Using these markers, we have identified ethylene genotypes for 40 Japanese pear cultivars and two Chinese pear (P. bretschneideri) cultivars that are commercially important and used in breeding programs. Furthermore, we performed linkage analysis of these two genes in the F(2) population, which revealed that the recombination frequency between the two markers was 20.8 +/- 3.6%. This information is critical to the selection of parents and in breeding strategies to improve storage ability of Japanese pears.

  13. Involvement of ethylene and 1-aminocyclopropane-1-carboxylate synthase gene in regulation of programmed cell death during rose (Rosa x hybrida) flower development.

    PubMed

    Pan, Hai-Chun; Li, Ji-Hong; Wang, Xian-Ze

    2005-08-01

    Programmed cell death (PCD) is an integral part of plant development. Flower petal usually has the shortest lifetime among all plant organs. There must be a sensitive, tightly controlled PCD in the life cycle of the flower. To understand its mechanism, the ethylene production rate of petals and its correlation with degree of senescence, 1-aminocyclopropane-1-carboxylate (ACC) synthase gene expression, ACC synthase activity and ACC content were determined through the whole flower development period which was arbitrarily divided into five stages depending on appearance of the flower. The results showed that ethylene was not detectable at stages 1 and 2, appeared at stage 3 and increased at stage 5. Transcript of ACC synthase gene did not accumulate at stages 1 and 2, but did so at stages 3-5, and increased gradually at stage 5. ACC synthase activity and ACC content changed in similar way to ethylene production. Ethylene plays a critical role in initiation of rose flower senescence through regulating petal PCD.

  14. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  15. Molecular cloning, expression, and stress response of the estrogen-related receptor gene (AccERR) from Apis cerana cerana

    NASA Astrophysics Data System (ADS)

    Zhang, Weixing; Zhu, Ming; Zhang, Ge; Liu, Feng; Wang, Hongfang; Guo, Xingqi; Xu, Baohua

    2016-04-01

    Estrogen-related receptor (ERR), which belongs to the nuclear receptor superfamily, has been implicated in diverse physiological processes involving the estrogen signaling pathway. However, little information is available on ERR in Apis cerana cerana. In this report, we isolated the ERR gene and investigated its involvement in antioxidant defense. Quantitative real-time polymerase chain reaction (qPCR) revealed that the highest mRNA expression occurred in eggs during different developmental stages. The expression levels of AccERR were highest in the muscle, followed by the rectum. The predicted transcription factor binding sites in the promoter of AccERR suggested that AccERR potentially functions in early development and in environmental stress responses. The expression of AccERR was induced by cold (4 °C), heat (42 °C), ultraviolet light (UV), HgCl2, and various types of pesticides (phoxim, deltamethrin, triadimefon, and cyhalothrin). Western blot was used to measure the expression levels of AccERR protein. These data suggested that AccERR might play a vital role in abiotic stress responses.

  16. 1-MCP EFFECTS ON ANTIOXIDANT ACTIVITY AND GENE EXPRESSION OF ACC-SYNTHASE AND ACC-OXIDASE IN COTTON FLOWERS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton remains an important cash crop for farmers in the southern United States. When temperatures rise above 32oC the in vivo fertilization efficiency of cotton is reduced resulting in decreased seed production and potentially decreased yields. Under stress, the plant hormone ethylene is manufact...

  17. Characterization of ACC deaminase gene in Pseudomonas entomophila strain PS-PJH isolated from the rhizosphere soil.

    PubMed

    Kamala-Kannan, Seralathan; Lee, Kui-Jae; Park, Seung-Moon; Chae, Jong-Chan; Yun, Bong-Sik; Lee, Yong Hoon; Park, Yool-Jin; Oh, Byung-Taek

    2010-04-01

    The enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase cleaves the ethylene precursor ACC into alpha-ketobutyrate and ammonia. The decreased level of ethylene allows the plant to be more resistant to a wide environmental stress including plant pathogens. In the present study, we characterized the ACC deaminase activity of a Pseudomonas entomophila strain PS-PJH isolated from the red pepper rhizosphere region of red pepper grown at Jinan, Korea. The isolate produced 23.8 +/- 0.4 micromol of alpha-ketobutyrate/mg of protein/h during ACC deamination under in vitro conditions. Polymerase chain reaction for acdS gene showed that the isolated P. entomophila strain PS-PJH carry sequences similar to the known acdS genes. Results of the multiple sequence alignment revealed >99% identity (nucleotide and amino acid) with acdS gene of Pseudomonas putida strains AM15 and UW4. The isolated bacteria promoted 43.3 and 34.1% of growth in Raphanus sativus and Lactuca sativa plants, respectively. Based on the 16S-23S internal transcribed spacer region sequences, the isolate was identified as P. entomophila. To the best of our knowledge this is the first study to report the acdS gene in P. entomophila.

  18. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  19. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana.

    PubMed

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-09-26

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were 'catalytic activity' (1327, 56.4%), 'heme binding' (65, 2.76%), 'tetrapyrrole binding' (66, 2.81%), and 'oxidoreductase activity' (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis.

  20. The cloned 1-aminocyclopropane-1-carboxylate (ACC) deaminase gene from Sinorhizobium sp. strain BL3 in Rhizobium sp. strain TAL1145 promotes nodulation and growth of Leucaena leucocephala.

    PubMed

    Tittabutr, Panlada; Awaya, Jonathan D; Li, Qing X; Borthakur, Dulal

    2008-06-01

    The objective of this study was to determine the role of 1-aminocyclopropane-1-carboxylate (ACC) deaminase of symbionts in nodulation and growth of Leucaena leucocephala. The acdS genes encoding ACC deaminase were cloned from Rhizobium sp. strain TAL1145 and Sinorhizobium sp. BL3 in multicopy plasmids, and transferred to TAL1145. The BL3-acdS gene greatly enhanced ACC deaminase activity in TAL1145 compared to the native acdS gene. The transconjugants of TAL1145 containing the native or BL3 acdS gene could grow in minimal media containing 1.5mM ACC, whereas BL3 could tolerate up to 3mM ACC. The TAL1145 acdS gene was inducible by mimosine and not by ACC, while the BL3 acdS gene was highly inducible by ACC and not by mimosine. The transconjugants of TAL1145 containing the native- and BL3-acdS genes formed nodules with greater number and sizes, and produced higher root mass on L. leucocephala than by TAL1145. This study shows that the introduction of multiple copies of the acdS gene increased ACC deaminase activities of TAL1145 and enhanced its symbiotic efficiency on L. leucocephala.

  1. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  2. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  3. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  4. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene (AccGSTD) in response to thermal stress.

    PubMed

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee (Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  5. Identification and characterization of an Apis cerana cerana Delta class glutathione S-transferase gene ( AccGSTD) in response to thermal stress

    NASA Astrophysics Data System (ADS)

    Yan, Huiru; Jia, Haihong; Wang, Xiuling; Gao, Hongru; Guo, Xingqi; Xu, Baohua

    2013-02-01

    Glutathione S-transferases (GSTs) are members of a multifunctional enzyme super family that plays a pivotal role in both insecticide resistance and protection against oxidative stress. In this study, we identified a single-copy gene, AccGSTD, as being a Delta class GST in the Chinese honey bee ( Apis cerana cerana). A predicted antioxidant response element, CREB, was found in the 1,492-bp 5'-flanking region, suggesting that AccGSTD may be involved in oxidative stress response pathways. Real-time PCR and immunolocalization studies demonstrated that AccGSTD exhibited both developmental- and tissue-specific expression patterns. During development, AccGSTD transcript was increased in adults. The AccGSTD expression level was the highest in the honey bee brain. Thermal stress experiments demonstrated that AccGSTD could be significantly upregulated by temperature changes in a time-dependent manner. It is hypothesized that high expression levels might be due to the increased levels of oxidative stress caused by the temperature challenges. Additionally, functional assays of the recombinant AccGSTD protein revealed that AccGSTD has the capability to protect DNA from oxidative damage. Taken together, these data suggest that AccGSTD may be responsible for antioxidant defense in adult honey bees.

  6. Molecular cloning of an 1-aminocyclopropane-1-carboxylate synthase from senescing carnation flower petals.

    PubMed

    Park, K Y; Drory, A; Woodson, W R

    1992-01-01

    Synthetic oligonucleotides based on the sequence of 1-aminocyclopropane-1-carboxylate (ACC) synthase from tomato were used to prime the synthesis and amplification of a 337 bp tomato ACC synthase cDNA by polymerase chain reaction (PCR). This PCR product was used to screen a cDNA library prepared from mRNA isolated from senescing carnation flower petals. Two cDNA clones were isolated which represented the same mRNA. The longer of the two clones (CARACC3) contained a 1950 bp insert with a single open reading frame of 516 amino acids encoding a protein of 58 kDa. The predicted protein from the carnation ACC synthase cDNA was 61%, 61%, 64%, and 51% identical to the deduced proteins from zucchini squash, winter squash, tomato, and apple, respectively. Genomic DNA gel blot analysis indicated the presence of at least a second gene in carnation which hybridized to CARACC3 under conditions of low stringency. ACC synthase mRNA accumulates during senescence of carnation flower petals concomitant with the increase in ethylene production and ACC synthase enzyme activity. Ethylene induced the accumulation of ACC synthase mRNA in presenescent petals. Wound-induced ethylene production in leaves was not associated with an increase in ACC synthase mRNA represented by CARACC3. These results indicate that CARACC3 represents an ACC synthase transcript involved in autocatalytic ethylene production in senescing flower petals.

  7. Precise spatio-temporal modulation of ACC synthase by MPK6 cascade mediates the response of rose flowers to rehydration.

    PubMed

    Meng, Yonglu; Ma, Nan; Zhang, Qian; You, Qi; Li, Na; Ali Khan, Muhammad; Liu, Xiaojing; Wu, Lin; Su, Zhen; Gao, Junping

    2014-09-01

    Drought is a major abiotic stress that affects the development and growth of most plants, and limits crop yield worldwide. Although the response of plants to drought has been well documented, much less is known about how plants respond to the water recovery process, namely rehydration. Here, we describe the spatio-temporal response of plant reproductive organs to rehydration using rose flowers as an experimental system. We found that rehydration triggered rapid and transient ethylene production in the gynoecia. This ethylene burst serves as a signal to ensure water recovery in flowers, and promotes flower opening by influencing the expression of a set of rehydration-responsive genes. An in-gel kinase assay suggested that the rehydration-induced ethylene burst resulted from transient accumulation of RhACS1/2 proteins in gynoecia. Meanwhile, RhMPK6, a rose homolog of Arabidopsis thaliana MPK6, is rapidly activated by rehydration within 0.5 h. Furthermore, RhMPK6 was able to phosphorylate RhACS1 but not RhACS2 in vitro. Application of the kinase inhibitor K252a suppressed RhACS1 accumulation and rehydration-induced ethylene production in gynoecia, and the protein phosphatase inhibitor okadaic acid had the opposite effect, confirming that accumulation of RhACS1 was phosphorylation-dependent. Finally, silencing of RhMPK6 significantly reduced ethylene production in gynoecia when flowers were subjected to rehydration. Taken together, our results suggest that temporal- and spatial-specific activation of an RhMPK6-RhACS1 cascade is responsible for rehydration-induced ethylene production in gynoecia, and that the resulting ethylene-mediated signaling pathway is a key factor in flower rehydration.

  8. Role and Regulation of ACC Deaminase Gene in Sinorhizobium meliloti: Is It a Symbiotic, Rhizospheric or Endophytic Gene?

    PubMed Central

    Checcucci, Alice; Azzarello, Elisa; Bazzicalupo, Marco; De Carlo, Anna; Emiliani, Giovanni; Mancuso, Stefano; Spini, Giulia; Viti, Carlo; Mengoni, Alessio

    2017-01-01

    Plant-associated bacteria exhibit a number of different strategies and specific genes allow bacteria to communicate and metabolically interact with plant tissues. Among the genes found in the genomes of plant-associated bacteria, the gene encoding the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase (acdS) is one of the most diffused. This gene is supposed to be involved in the cleaving of plant-produced ACC, the precursor of the plant stress-hormone ethylene toning down the plant response to infection. However, few reports are present on the actual role in rhizobia, one of the most investigated groups of plant-associated bacteria. In particular, still unclear is the origin and the role of acdS in symbiotic competitiveness and on the selective benefit it may confer to plant symbiotic rhizobia. Here we present a phylogenetic and functional analysis of acdS orthologs in the rhizobium model-species Sinorhizobium meliloti. Results showed that acdS orthologs present in S. meliloti pangenome have polyphyletic origin and likely spread through horizontal gene transfer, mediated by mobile genetic elements. When acdS ortholog from AK83 strain was cloned and assayed in S. meliloti 1021 (lacking acdS), no modulation of plant ethylene levels was detected, as well as no increase in fitness for nodule occupancy was found in the acdS-derivative strain compared to the parental one. Surprisingly, AcdS was shown to confer the ability to utilize formamide and some dipeptides as sole nitrogen source. Finally, acdS was shown to be negatively regulated by a putative leucine-responsive regulator (LrpL) located upstream to acdS sequence (acdR). acdS expression was induced by root exudates of both legumes and non-leguminous plants. We conclude that acdS in S. meliloti is not directly related to symbiotic interaction, but it could likely be involved in the rhizospheric colonization or in the endophytic behavior. PMID:28194158

  9. Role and Regulation of ACC Deaminase Gene in Sinorhizobium meliloti: Is It a Symbiotic, Rhizospheric or Endophytic Gene?

    PubMed

    Checcucci, Alice; Azzarello, Elisa; Bazzicalupo, Marco; De Carlo, Anna; Emiliani, Giovanni; Mancuso, Stefano; Spini, Giulia; Viti, Carlo; Mengoni, Alessio

    2017-01-01

    Plant-associated bacteria exhibit a number of different strategies and specific genes allow bacteria to communicate and metabolically interact with plant tissues. Among the genes found in the genomes of plant-associated bacteria, the gene encoding the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase (acdS) is one of the most diffused. This gene is supposed to be involved in the cleaving of plant-produced ACC, the precursor of the plant stress-hormone ethylene toning down the plant response to infection. However, few reports are present on the actual role in rhizobia, one of the most investigated groups of plant-associated bacteria. In particular, still unclear is the origin and the role of acdS in symbiotic competitiveness and on the selective benefit it may confer to plant symbiotic rhizobia. Here we present a phylogenetic and functional analysis of acdS orthologs in the rhizobium model-species Sinorhizobium meliloti. Results showed that acdS orthologs present in S. meliloti pangenome have polyphyletic origin and likely spread through horizontal gene transfer, mediated by mobile genetic elements. When acdS ortholog from AK83 strain was cloned and assayed in S. meliloti 1021 (lacking acdS), no modulation of plant ethylene levels was detected, as well as no increase in fitness for nodule occupancy was found in the acdS-derivative strain compared to the parental one. Surprisingly, AcdS was shown to confer the ability to utilize formamide and some dipeptides as sole nitrogen source. Finally, acdS was shown to be negatively regulated by a putative leucine-responsive regulator (LrpL) located upstream to acdS sequence (acdR). acdS expression was induced by root exudates of both legumes and non-leguminous plants. We conclude that acdS in S. meliloti is not directly related to symbiotic interaction, but it could likely be involved in the rhizospheric colonization or in the endophytic behavior.

  10. Overexpression of ACC gene from oleaginous yeast Lipomyces starkeyi enhanced the lipid accumulation in Saccharomyces cerevisiae with increased levels of glycerol 3-phosphate substrates.

    PubMed

    Wang, Jiancai; Xu, Ronghua; Wang, Ruling; Haque, Mohammad Enamul; Liu, Aizhong

    2016-06-01

    The conversion of acetyl-CoA to malonyl-CoA by acetyl-CoA carboxylase (ACC) is the rate-limiting step in fatty acid biosynthesis. In this study, a gene coding for ACC was isolated and characterized from an oleaginous yeast, Lipomyces starkeyi. Real-time quantitative PCR (qPCR) analysis of L. starkeyi acetyl-CoA carboxylase gene (LsACC1) showed that the expression levels were upregulated with the fast accumulation of lipids. The LsACC1 was co-overexpressed with the glycerol 3-phosphate dehydrogenase gene (GPD1), which regulates lipids biosynthesis by supplying another substrates glycerol 3-phosphate for storage lipid assembly, in the non-oleaginous yeast Saccharomyces cerevisiae. Further, the S. cerevisiae acetyl-CoA carboxylase (ScACC1) was transferred with GPD1 and its function was analyzed in comparison with LsACC1. The results showed that overexpressed LsACC1 and GPD1 resulted in a 63% increase in S. cerevisiae. This study gives new data in understanding of the molecular mechanisms underlying the regulation of fatty acids and lipid biosynthesis in yeasts.

  11. Identification of two distinct Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    Two distinct Bacillus subtilis genes (citA and citZ) were found to encode citrate synthase isozymes that catalyze the first step of the Krebs cycle. The citA gene was cloned by genetic complementation of an Escherichia coli citrate synthase mutant strain (W620) and was in a monocistronic transcriptional unit. A divergently transcribed gene, citR, could encode a protein with strong similarity to the bacterial LysR family of regulatory proteins. A null mutation in citA had little effect on citrate synthase enzyme activity or sporulation. The residual citrate synthase activity was purified from a citA null mutant strain, and the partial amino acid sequence for the purified protein (CitZ) was determined. The citZ gene was cloned from B. subtilis chromosomal DNA by using a PCR-generated probe synthesized with oligonucleotide primers derived from the partial amino acid sequence of purified CitZ. The citZ gene proved to be the first gene in a tricistronic cluster that also included citC (coding for isocitrate dehydrogenase) and citH (coding for malate dehydrogenase). A mutation in citZ caused a substantial loss of citrate synthase enzyme activity, glutamate auxotrophy, and a defect in sporulation.

  12. Dynamic 1-Aminocyclopropane-1-Carboxylate-Synthase and -Oxidase Transcript Accumulation Patterns during Pollen Tube Growth in Tobacco Styles1

    PubMed Central

    Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

    2002-01-01

    In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes. PMID:12427986

  13. Characterization of a Decapentapletic Gene (AccDpp) from Apis cerana cerana and Its Possible Involvement in Development and Response to Oxidative Stress

    PubMed Central

    Wang, Hongfang; Guo, Xulei; Guo, Xingqi; Sun, Qinghua; Xu, Baohua

    2016-01-01

    To tolerate many acute and chronic oxidative stress-producing agents that exist in the environment, organisms have evolved many classes of signal transduction pathways, including the transforming growth factor β (TGFβ) signal pathway. Decapentapletic gene (Dpp) belongs to the TGFβ superfamily, and studies on Dpp have mainly focused on its role in the regulation of development. No study has investigated the response of Dpp to oxidative pressure in any organism, including Apis cerana cerana (A. cerana cerana). In this study, we identified a Dpp gene from A. cerana cerana named AccDpp. The 5΄ flanking region of AccDpp had many transcription factor binding sites that relevant to development and stress response. AccDpp was expressed at all stages of A. cerana cerana, with its highest expression in 15-day worker bees. The mRNA level of AccDpp was higher in the poison gland and midgut than other tissues. Furthermore, the transcription of AccDpp could be repressed by 4°C and UV, but induced by other treatments, according to our qRT-PCR analysis. It is worth noting that the expression level of AccDpp protein was increased after a certain time when A. cerana cerana was subjected to all simulative oxidative stresses, a finding that was not completely consistent with the result from qRT-PCR. It is interesting that recombinant AccDpp restrained the growth of Escherichia coli, a function that might account for the role of the antimicrobial peptides of AccDpp. In conclusion, these results provide evidence that AccDpp might be implicated in the regulation of development and the response of oxidative pressure. The findings may lay a theoretical foundation for further genetic studies of Dpp. PMID:26881804

  14. Silencing the NR2B gene in rat ACC neurons by lentivirus-delivered shRNA alleviates pain-related aversion.

    PubMed

    Guo, Shou-Gang; Lv, Xiu-Hua; Guan, Shan-Hui; Li, Hui-Lu; Qiao, Yong; Feng, Hao; Cong, Lin; Wang, Gong-Ming

    2015-01-01

    The N-methyl-D-aspartate (NMDA) receptor NR2B subunit on neurons in the anterior cingulate cortex (ACC) is implicated in the affective response to noxious stimuli. Selectively silencing this NR2B subunit in ACC neurons could therefore alleviate pain-related aversion. However, to date, there is no optimal approach to selectively silence the NR2B gene in ACC neurons. In the present study, we constructed lentiviral vectors and delivered shRNA (NR2B-RNAi-LV) to effectively silence the NR2B gene in ACC neurons. The use of lentivirus resulted in 95% transfection efficiency and 83% silencing of the NR2B gene in ACC neurons. Electrophysiological experiments showed that the total INMDA was similarly reduced by 48% in lentivirus-transfected ACC neurons. The biochemical and functional data demonstrated that lentiviral shRNA delivery produced a high transfection and silencing efficiency in the ACC neurons. SNI rats weighting 220-250 g were randomly divided into three groups: normal saline group (NS), lenti-siRNA/NC (LV-NC) group, and lenti-siRNA/NR2B (LV-NR2B) group, and conditioned place avoidance was conducted. The results indicated that NR2B-RNAi-LV decreased greatly the conditioning scores of F-CPA while NC-GFP-LV has no effects. NR2B mRNA expression in the NR2B-RNAi-LV group was significantly lower than that in the control group and NC-GFP-LV group. This novel approach of silencing the NR2B gene in ACC neuron could potentially be used to alleviate pain-related aversion.

  15. AccERK2, a map kinase gene from Apis cerana cerana, plays roles in stress responses, developmental processes, and the nervous system.

    PubMed

    Li, Yuzhen; Zhang, Liang; Kang, Mingjiang; Guo, Xingqi; Baohua Xu

    2012-03-01

    Extracellular signal-regulated kinase (ERK), a mitogen-activated protein kinase (MAPK), plays roles in a variety of cellular responses. However, limited information is available on the relationship between ERKs and environmental stresses. In this report, an ERK gene, AccERK2, was cloned and characterized from Apis cerana cerana. Polypeptide sequence alignment revealed that the single-copied AccERK2 shares high identity with other known ERKs and contains the typical conserved Thr-Glu-Tyr (TEY) motif in its activation loop. Genomic sequence analysis revealed that the seven exons of AccERK2 are interrupted by six introns, and the seventh intron is located in the 3' untranslated region. Semi-quantitative reverse transcription (RT-PCR) indicated that AccERK2 was expressed at higher levels in the larval and pupal stages than in the adult stage. AccERK2 was also most highly expressed in the brain. The expression of AccERK2 was induced by abiotic stresses, including heat, ion irradiation, oxidative stress, and heavy metal ions. Based on these results, it appears that AccERK2 in A. cerana cerana participates in developmental processes, the nervous system, and responses to environmental stressors.

  16. ACC oxidase genes expressed in the wood-forming tissues of loblolly pine (Pinus taeda L.) include a pair of nearly identical paralogs (NIPs).

    PubMed

    Yuan, S; Wang, Y; Dean, J F D

    2010-03-15

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final reaction of the ethylene biosynthetic pathway, converting the unusual cyclic amino acid, ACC, into ethylene. Past studies have shown a possible link between ethylene and compression wood formation in conifers, but the relationship has received no more than modest study at the gene expression level. In this study, a cDNA clone encoding a putative ACC oxidase, PtACO1, was isolated from a cDNA library produced using mRNA from lignifying xylem of loblolly pine (Pinus taeda) trunk wood. The cDNA clone comprised an open reading frame of 1461 bp encoding a protein of 333 amino acids. Using PCR amplification techniques, a genomic clone corresponding to PtACO1 was isolated and shown to contain three introns with typical GT/AG boundaries defining the splice junctions. The PtACO1 gene product shared 70% identity with an ACC oxidase from European white birch (Betula pendula), and phylogenetic analyses clearly placed the gene product in the ACC oxidase cluster of the Arabidopsis thaliana 2-oxoglutarate-dependent dioxygenase superfamily tree. The PtACO1 sequence was used to identify additional ACC oxidase clones from loblolly pine root cDNA libraries characterized as part of an expressed sequence tag (EST) discovery project. The PtACO1 sequence was also used to recover additional paralogous sequences from genomic DNA, one of which (PtACO2) turned out to be >98% identical to PtACO1 in the nucleotide coding sequence, leading to its classification as a "nearly identical paralog" (NIP). Quantitative PCR analyses showed that the expression level of PtACO1-like transcripts varied in different tissues, as well as in response to hormonal treatments and bending. Possible roles for PtACO1 in compression wood formation in loblolly pine and the discovery of its NIP are discussed in light of these results.

  17. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  18. Phytochelatin synthase genes from Arabidopsis and the yeast Schizosaccharomyces pombe.

    PubMed Central

    Ha, S B; Smith, A P; Howden, R; Dietrich, W M; Bugg, S; O'Connell, M J; Goldsbrough, P B; Cobbett, C S

    1999-01-01

    Phytochelatins (PCs), a family of heavy metal-inducible peptides important in the detoxification of heavy metals, have been identified in plants and some microorganisms, including Schizosaccharomyces pombe, but not in animals. PCs are synthesized enzymatically from glutathione (GSH) by PC synthase in the presence of heavy metal ions. In Arabidopsis, the CAD1 gene, identified by using Cd-sensitive, PC-deficient cad1 mutants, has been proposed to encode PC synthase. Using a positional cloning strategy, we have isolated the CAD1 gene. Database searches identified a homologous gene in S. pombe, and a mutant with a targeted deletion of this gene was also Cd sensitive and PC deficient. Extracts of Escherichia coli cells expressing a CAD1 cDNA or the S. pombe gene catalyzing GSH-dependent, heavy metal-activated synthesis of PCs in vitro demonstrated that both genes encode PC synthase activity. Both enzymes were activated by a range of metal ions. In contrast, reverse transcription-polymerase chain reaction experiments showed that expression of the CAD1 mRNA is not influenced by the presence of Cd. A comparison of the two predicted amino acid sequences revealed a highly conserved N-terminal region, which is presumed to be the catalytic domain, and a variable C-terminal region containing multiple Cys residues, which is proposed to be involved in activation of the enzyme by metal ions. Interestingly, a similar gene was identified in the nematode, Caenorhabditis elegans, suggesting that PCs may also be expressed in some animal species. PMID:10368185

  19. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    PubMed

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  20. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  1. Cloning, identification and expression analysis of ACC oxidase gene involved in ethylene production pathway.

    PubMed

    Jafari, Zohreh; Haddad, Raheem; Hosseini, Ramin; Garoosi, Ghasemali

    2013-02-01

    1-aminocyclopropane-1-carboxylic acid oxidase (ACO) enzyme is a member of the Fe II-dependent family of oxidases/oxygenases which require Fe(2+) as a cofactor, ascorbate as a cosubstrate and CO(2) as an activator. This enzyme catalyses the terminal step in the plant signaling of ethylene biosynthetic pathway. A 948 bp fragment of the ACO1 gene cDNA sequence was cloned from tomato (Lycopersicon esculentum) fruit tissues by using reverse transcriptase-polymerase chain reaction (RT-PCR) with two PCR primers designed according to the sequence of a tomato cDNA clone (X58273). The BLAST search showed a high level of similarity (77-98 %) between ACO1 and ACO genes of other plants. The calculated molecular mass and predicted isoelectric point of LeACO1 were 35.8 kDa and 5.13, respectively. The three-dimensional structure studies illustrated that the LeACO1 protein folds into a compact jelly-roll motif comprised of 8 α-helices, 12 β-strands and several long loops. The cosubstrate was located in a cofactor-binding pocket referred to as a 2-His-1-carboxylate facial triad. Semi-quantitative RT-PCR analysis of gene expression revealed that the LeACO1 was expressed in fruit tissues at different ripening stages.

  2. Fine structure analysis of Salmonella typhimurium glutamate synthase genes.

    PubMed Central

    Madonna, M J; Fuchs, R L; Brenchley, J E

    1985-01-01

    Glutamate synthase activity is required for the growth of Salmonella typhimurium on media containing a growth-rate-limiting nitrogen source. Mutations that alter glutamate synthase activity had been identified in the gltB gene, but it was not known which of the two nonidentical subunits of the enzyme was altered. To examine the gene-protein relationship of the glt region, two nonsense mutations were identified and used to demonstrate that gltB encodes the large subunit of the enzyme. Six strains with independent Mu cts d1 (lac bla) insertions were isolated, from which a collection of deletion mutations was obtained. The deletions were transduced with the nonsense mutations and 38 other glt point mutations to construct a fine-structure genetic map. Chromosome mobilization studies, mediated by Hfr derivatives of Mu cts d1 lysogens, showed that gltB is transcribed in a clockwise direction, as shown in the S. typhimurium linkage map. Studies of the polar effects of three Mu cts d1 insertions indicated that the gene for the small subunit maps clockwise to gltB and that the two genes are cotranscribed to form a glt operon. Images PMID:3881392

  3. Methionine synthase and thymidylate synthase gene polymorphisms and colorectal adenoma risk: the self defense forces study.

    PubMed

    Yoshimitsu, Shinichiro; Morita, Makiko; Hamachi, Tadamichi; Tabata, Shinji; Abe, Hiroshi; Tajima, Osamu; Uezono, Kousaku; Ohnaka, Keizo; Kono, Suminori

    2012-10-01

    Folate-mediated one-carbon metabolism has been implicated in colorectal carcinogenesis. We investigated associations of functional genetic polymorphisms of methionine synthase (MTR), MTR reductase (MTRR), and thymidylate synthase (TS) with colorectal adenomas. The study subjects were 455 cases of colorectal adenomas and 1052 controls with no polyp at colonoscopy. Genotypes were determined for MTR A2756G, MTRR A66G and two polymorphisms in the TS gene, 28-bp tandem repeat polymorphism in the promoter enhancer region (TSER) and 6-bp deletion polymorphism at position 1494 in the 3' untranslated region (TS 1494del6). We also examined the alcohol-genotype and gene-gene interactions on adenoma risk. The GG genotype of MTR A2756G was associated with an increased risk of colorectal adenomas; odds ratios for AG and GG versus AA genotype were 0.99 (95% confidence interval 0.78-1.26) and 1.72 (1.04-2.82), respectively. The increase in the risk associated with MTR 2756GG genotype was evident in men with high alcohol consumption (≥30 mL/d), but not in those with low alcohol consumption (interaction P = 0.03). Men who were homozygous for the TSER double-repeat allele had a slightly decreased risk of colorectal adenomas as compared with those homozygous for the TSER triple-repeat allele. Neither MTRR A66G nor TS 1494del6 was associated with colorectal adenomas. There was no measurable interaction either between MTR A2756G and MTRR A66G or between TSER and TS 1494del6. MTR A2756G appears to be associated with colorectal adenoma risk differently according to alcohol consumption. The MTR-catalyzed reaction may play an important role in the development of colorectal adenomas.

  4. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    PubMed

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato.

  5. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  6. Adaptive Cruise Control (ACC)

    NASA Astrophysics Data System (ADS)

    Reif, Konrad

    Die adaptive Fahrgeschwindigkeitsregelung (ACC, Adaptive Cruise Control) ist eine Weiterentwicklung der konventionellen Fahrgeschwindigkeitsregelung, die eine konstante Fahrgeschwindigkeit einstellt. ACC überwacht mittels eines Radarsensors den Bereich vor dem Fahrzeug und passt die Geschwindigkeit den Gegebenheiten an. ACC reagiert auf langsamer vorausfahrende oder einscherende Fahrzeuge mit einer Reduzierung der Geschwindigkeit, sodass der vorgeschriebene Mindestabstand zum vorausfahrenden Fahrzeug nicht unterschritten wird. Hierzu greift ACC in Antrieb und Bremse ein. Sobald das vorausfahrende Fahrzeug beschleunigt oder die Spur verlässt, regelt ACC die Geschwindigkeit wieder auf die vorgegebene Sollgeschwindigkeit ein (Bild 1). ACC steht somit für eine Geschwindigkeitsregelung, die sich dem vorausfahrenden Verkehr anpasst.

  7. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  8. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  9. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene.

    PubMed

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_000366.1, NM_000375.2]) in evolution by studying the phylogenetic relationship and divergence of this gene using computational methods. The UROS protein sequences from various taxa were retrieved from GenBank database and were compared using Clustal-W (multiple sequence alignment) with defaults and a first-pass phylogenetic tree was built using neighbor-joining method as in DELTA BLAST 2.2.27+ version. A total of 163 BLAST hits were found for the uroporphyrinogen III synthase query sequence and these hits showed putative conserved domain, HemD superfamily (as on 14(th) Nov 2012). We then narrowed down the search by manually deleting the proteins which were not UROS sequences and sequences belonging to phyla other than Chordata were deleted. A repeat phylogenetic analysis of 39 taxa was performed using PhyML and TreeDyn software to confirm that UROS is a highly conserved protein with approximately 85% conserved sequences in almost all chordate taxons emphasizing its importance in heme synthesis.

  10. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  11. Identification of Unique Type II Polyketide Synthase Genes in Soil

    PubMed Central

    Wawrik, Boris; Kerkhof, Lee; Zylstra, Gerben J.; Kukor, Jerome J.

    2005-01-01

    Many bacteria, particularly actinomycetes, are known to produce secondary metabolites synthesized by polyketide synthases (PKS). Bacterial polyketides are a particularly rich source of bioactive molecules, many of which are of potential pharmaceutical relevance. To directly access PKS gene diversity from soil, we developed degenerate PCR primers for actinomycete type II KSα (ketosynthase) genes. Twenty-one soil samples were collected from diverse sources in New Jersey, and their bacterial communities were compared by terminal restriction fragment length polymorphism (TRFLP) analysis of PCR products generated using bacterial 16S rRNA gene primers (27F and 1525R) as well as an actinomycete-specific forward primer. The distribution of actinomycetes was highly variable but correlated with the overall bacterial species composition as determined by TRFLP. Two samples were identified to contain a particularly rich and unique actinomycete community based on their TRFLP patterns. The same samples also contained the greatest diversity of KSα genes as determined by TRFLP analysis of KSα PCR products. KSα PCR products from these and three additional samples with interesting TRFLP pattern were cloned, and seven novel clades of KSα genes were identified. Greatest sequence diversity was observed in a sample containing a moderate number of peaks in its KSα TRFLP. The nucleotide sequences were between 74 and 81% identical to known sequences in GenBank. One cluster of sequences was most similar to the KSα involved in ardacin (glycopeptide antibiotic) production by Kibdelosporangium aridum. The remaining sequences showed greatest similarity to the KSα genes in pathways producing the angucycline-derived antibiotics simocyclinone, pradimicin, and jasomycin. PMID:15870305

  12. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases.

    PubMed

    Shibuya, M; Zhang, H; Endo, A; Shishikura, K; Kushiro, T; Ebizuka, Y

    1999-11-01

    Two new triterpene synthase cDNAs, named as OEW and TRW, were cloned from olive leaves (Olea europaea) and from dandelion roots (Taraxacum officinale), respectively, by the PCR method with primers designed from the conserved sequences found in the known oxidosqualene cyclases. Their ORFs consisted of 2274 bp nucleotides and coded for 758 amino acid long polypeptides. They shared high sequence identity (78%) to each other, while they showed only about 60% identities to the known triterpene synthases LUPI (lupeol synthase clone from Arabidopsis thaliana) and PNY (beta-amyrin synthase clone from Panax ginseng) at amino acid level. To determine the enzyme functions of the translates, they were expressed in an ERG7 deficient yeast mutant. Accumulation of lupeol in the cells of yeast transformants proved both of these clones code for lupeol synthase proteins. An EST (expression sequence tag) clone isolated from Medicago truncatula roots as a homologue of cycloartenol synthase gene, exhibits high sequence identity (75-77%) to these two lupeol synthase cDNAs, suggesting it to be another lupeol synthase clone. Comparatively low identity (approximately 57%) of LUP1 from Arabidopsis thaliana to either one of these clones leaves LUP1 as a distinct clone among lupeol synthases. From these sequence comparisons, now we propose that two branches of lupeol synthase gene have been generated in higher plants during the course of evolution.

  13. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  14. Characterization of a chitin synthase encoding gene and effect of diflubenzuron in soybean aphid, Aphis glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chitin synthases are critical enzymes for synthesis of chitin and thus for subsequent growth and development in insects. We have identified and characterized a chitin synthase gene (CHS) from cDNA of Aphis glycines, the soybean aphid, a serious pest of soybean. The full-length cDNA of CHS in A. glyc...

  15. Potential Functional Replacement of the Plastidic Acetyl-CoA Carboxylase Subunit (accD) Gene by Recent Transfers to the Nucleus in Some Angiosperm Lineages1[W][OA

    PubMed Central

    Rousseau-Gueutin, Mathieu; Huang, Xun; Higginson, Emily; Ayliffe, Michael; Day, Anil; Timmis, Jeremy N.

    2013-01-01

    Eukaryotic cells originated when an ancestor of the nucleated cell engulfed bacterial endosymbionts that gradually evolved into the mitochondrion and the chloroplast. Soon after these endosymbiotic events, thousands of ancestral prokaryotic genes were functionally transferred from the endosymbionts to the nucleus. This process of functional gene relocation, now rare in eukaryotes, continues in angiosperms. In this article, we show that the chloroplastic acetyl-CoA carboxylase subunit (accD) gene that is present in the plastome of most angiosperms has been functionally relocated to the nucleus in the Campanulaceae. Surprisingly, the nucleus-encoded accD transcript is considerably smaller than the plastidic version, consisting of little more than the carboxylase domain of the plastidic accD gene fused to a coding region encoding a plastid targeting peptide. We verified experimentally the presence of a chloroplastic transit peptide by showing that the product of the nuclear accD fused to green fluorescent protein was imported in the chloroplasts. The nuclear gene regulatory elements that enabled the erstwhile plastidic gene to become functional in the nuclear genome were identified, and the evolution of the intronic and exonic sequences in the nucleus is described. Relocation and truncation of the accD gene is a remarkable example of the processes underpinning endosymbiotic evolution. PMID:23435694

  16. Evolution and Expression of Tandem Duplicated Maize Flavonol Synthase Genes

    PubMed Central

    Falcone Ferreyra, María Lorena; Casas, María Isabel; Questa, Julia Irene; Herrera, Andrea Lorena; DeBlasio, Stacy; Wang, Jing; Jackson, David; Grotewold, Erich; Casati, Paula

    2012-01-01

    Flavonoids are specialized compounds widely distributed and with diverse functions throughout the plant kingdom and with several benefits for human health. In particular, flavonols, synthesized by flavonol synthase (FLS), protect plants against UV-B radiation and are essential for male fertility in maize and other plants. We have recently characterized a UV-B inducible ZmFLS1, corresponding to the first to be described in monocot plants. Interestingly, the new assembly of the B73 maize genome revealed the presence of a second putative FLS gene (ZmFLS2), with very high identity with ZmFLS1. ZmFLSs expression was analyzed in different maize tissues, and by combining electrophoretic mobility shift assays and transient expression experiments, we show that both genes are direct targets of anthocyanin (C1/PL1 + R/B) and 3-deoxy flavonoid (P1) transcriptional regulators. ZmFLS expression analyses show higher levels of both transcripts in high altitude landraces than inbred lines, and both genes are regulated by UV-B radiation in all lines analyzed. Moreover, the high sequence conservation of the ZmFLS promoters between maize lines suggests that the differences observed in ZmFLS expression are due to allelic variations in the transcription factors that regulate their activities. Finally, we generated pFLS1::FLS1-RFP transgenic plants and analyzed ZmFLS1 expression in different maize tissues; we found that this enzyme is localized in the ER and the perinuclear region. PMID:22654889

  17. Characterization of the cDNA and gene coding for the biotin synthase of Arabidopsis thaliana.

    PubMed Central

    Weaver, L M; Yu, F; Wurtele, E S; Nikolau, B J

    1996-01-01

    Biotin, an essential cofactor, is synthesized de novo only by plants and some microbes. An Arabidopsis thaliana expressed sequence tag that shows sequence similarity to the carboxyl end of biotin synthase from Escherichia coli was used to isolate a near-full-length cDNA. This cDNA was shown to code for the Arabidopsis biotin synthase by its ability to complement a bioB mutant of E. coli. Site-specific mutagenesis indicates that residue threonine-173, which is highly conserved in biotin synthases, is important for catalytic competence of the enzyme. The primary sequence of the Arabidopsis biotin synthase is most similar to biotin synthases from E. coli, Serratia marcescens, and Saccharomyces cerevisiae (about 50% sequence identity) and more distantly related to the Bacillus sphaericus enzyme (33% sequence identity). The primary sequence of the amino terminus of the Arabidopsis biotin synthase may represent an organelle-targeting transit peptide. The single Arabidopsis gene coding for biotin synthase, BIO2, was isolated and sequenced. The biotin synthase coding sequence is interrupted by five introns. The gene sequence upstream of the translation start site has several unusual features, including imperfect palindromes and polypyrimidine sequences, which may function in the transcriptional regulation of the BIO2 gene. PMID:8819873

  18. Sequence of the indoleglycerol phosphate synthase (trpC) gene from Rhodobacter capsulatus.

    PubMed Central

    Becker-Rudzik, M; Young, D A; Marrs, B L

    1992-01-01

    We have isolated, cloned, and sequenced the indoleglycerol phosphate synthase gene (trpC) from Rhodobacter capsulatus. Normalized alignment scores comparing the trpC gene of R. capsulatus with the trpC genes of other bacterial species are reported. An unexpected degree of similarity to the trpC gene of Bacillus subtilis was found. PMID:1644778

  19. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  20. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  1. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    PubMed

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  2. Citrate synthase encoded by the CIT2 gene of Saccharomyces cerevisiae is peroxisomal.

    PubMed Central

    Lewin, A S; Hines, V; Small, G M

    1990-01-01

    The product of the CIT2 gene has the tripeptide SKL at its carboxyl terminus. This amino acid sequence has been shown to act as a peroxisomal targeting signal in mammalian cells. We examined the subcellular site of this extramitochondrial citrate synthase. Cells of Saccharomyces cerevisiae were grown on oleate medium to induce peroxisome proliferation. A fraction containing membrane-enclosed vesicles and organelles was analyzed by sedimentation on density gradients. In wild-type cells, the major peak of citrate synthase activity was recovered in the mitochondrial fraction, but a second peak of activity cosedimented with peroxisomes. The peroxisomal activity, but not the mitochondrial activity, was inhibited by incubation at pH 8.1, a characteristic of the extramitochondrial citrate synthase encoded by the CIT2 gene. In a strain in which the CIT1 gene encoding mitochondrial citrate synthase had been disrupted, the major peak of citrate synthase activity was peroxisomal, and all of the activity was sensitive to incubation at pH 8.1. Yeast cells bearing a cit2 disruption were unable to mobilize stored lipids and did not form stable peroxisomes in oleate. We conclude that citrate synthase encoded by CIT2 is peroxisomal and participates in the glyoxylate cycle. Images PMID:2181273

  3. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  4. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  5. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  6. Deletion of the carboxyl-terminal region of 1-aminocyclopropane-1-carboxylic acid synthase, a key protein in the biosynthesis of ethylene, results in catalytically hyperactive, monomeric enzyme.

    PubMed

    Li, N; Mattoo, A K

    1994-03-04

    1-Aminocyclopropane-1-carboxylic acid (ACC) synthase is a key enzyme regulating biosynthesis of the plant hormone ethylene. The expression of an enzymatically active, wound-inducible tomato (Lycopersicon esculentum L. cv Pik-Red) ACC synthase (485 amino acids long) in a heterologous Escherichia coli system allowed us to study the importance of hypervariable COOH terminus in enzymatic activity and protein conformation. We constructed several deletion mutants of the gene, expressed these in E. coli, purified the protein products to apparent homogeneity, and analyzed both conformation and enzyme kinetic parameters of the wild-type and truncated ACC syntheses. Deletion of the COOH terminus through Arg429 results in complete inactivation of the enzyme. Deletion of 46-52 amino acids from the COOH terminus results in an enzyme that has nine times higher affinity for the substrate S-adenosylmethionine than the wild-type enzyme. The highly efficient, truncated ACC synthase was found to be a monomer of 52 +/- 1.8 kDa as determined by gel filtration, whereas the wild-type ACC synthase, analyzed under similar conditions, is a dimer. These results demonstrate that the non-conserved COOH terminus of ACC synthase affects its enzymatic function as well as dimerization.

  7. Phylogenomic analysis of polyketide synthase genes in actinomycetes: structural analysis of KS domains and modules of polyketide synthases.

    PubMed

    Sarwar, Samreen; Ahmed, Mehboob; Hasnain, Shahida

    2012-01-01

    Polyketides are complex and diverse secondary metabolites, synthesised by large multifunctional enzymes, Polyketide Synthases (PKS). The phylogenomic analysis of β-ketosynthase (KS) domains and PKSs within actinomycetes suggests the contribution of point mutations, gene duplications, horizontal gene transfer and homologous recombination in the evolution of PKSs. PKS genealogy suggested the ancestral module structure with KS-AT-ACP domain composition. KS domains showed similar core and highly variable loop regions at the dimer interface, which seems to affect the selectivity of the primer unit. In PKS modules, the linker regions comprise a significant fraction of the module. The reducing domains (ketoreductase and dehydrogenase) protrude out from the central axis of the module and also responsible for extreme variability in the final products. Thus, phylogenomic and structural analysis of PKSs can assist in the artificial reprogramming of PKSs.

  8. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  9. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  10. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering.

  11. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.

    1995-02-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  12. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    PubMed

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  13. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    PubMed

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported.

  14. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    PubMed

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  15. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  16. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  17. Differentiation of 1-aminocyclopropane-1-carboxylate (ACC) deaminase from its homologs is the key for identifying bacteria containing ACC deaminase.

    PubMed

    Li, Zhengyi; Chang, Siping; Ye, Shuting; Chen, Mingyue; Lin, Li; Li, Yuanyuan; Li, Shuying; An, Qianli

    2015-10-01

    1-Aminocyclopropane-1-carboxylate (ACC) deaminase-mediated reduction of ethylene generation in plants under abiotic stresses is a key mechanism by which bacteria can promote plant growth. Misidentification of ACC deaminase and the ACC deaminase structure gene (acdS) can lead to overestimation of the number of bacteria containing ACC deaminase and their function in ecosystems. Previous non-specific amplification of acdS homologs has led to an overestimation of the horizontal transfer of acdS genes. Here, we designed consensus-degenerate hybrid oligonucleotide primers (acdSf3, acdSr3 and acdSr4) based on differentiating the key residues in ACC deaminases from those of homologs for specific amplification of partial acdS genes. PCR amplification, sequencing and phylogenetic analysis identified acdS genes from a wide range of proteobacteria and actinobacteria. PCR amplification and a genomic search did not find the acdS gene in bacteria belonging to Pseudomonas stutzeri or in the genera Enterobacter, Klebsiella or Bacillus. We showed that differentiating the acdS gene and ACC deaminase from their homologs was crucial for the molecular identification of bacteria containing ACC deaminase and for understanding the evolution of the acdS gene. We provide an effective method for screening and identifying bacteria containing ACC deaminase.

  18. Recent Progress on the Construction and Testing of a Fusion Poly(hydroxyalkanoate) Synthase Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoates) (PHAs) are biodegradable polyesters produced by some bacteria. Two genes in Allochromatium vinosum, phaE and phaC, respectively code for the two subunits of the enzyme complex, PHA synthase, which catalyzes the polymerization of precursors into PHA. We hypothesized that by ...

  19. Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway.

    PubMed Central

    Niyogi, K K; Fink, G R

    1992-01-01

    Arabidopsis thaliana has two genes, ASA1 and ASA2, encoding the alpha subunit of anthranilate synthase, the enzyme catalyzing the first reaction in the tryptophan biosynthetic pathway. As a branchpoint enzyme in aromatic amino acid biosynthesis, anthranilate synthase has an important regulatory role. The sequences of the plant genes are homologous to their microbial counterparts. Both predicted proteins have putative chloroplast transit peptides at their amino termini and conserved amino acids involved in feedback inhibition by tryptophan. ASA1 and ASA2 cDNAs complement anthranilate synthase alpha subunit mutations in the yeast Saccharomyces cerevisiae and in Escherichia coli, confirming that both genes encode functional anthranilate synthase proteins. The distributions of ASA1 and ASA2 mRNAs in various parts of Arabidopsis plants are overlapping but nonidentical, and ASA1 mRNA is approximately 10 times more abundant in whole plants. Whereas ASA2 is expressed at a constitutive basal level, ASA1 is induced by wounding and bacterial pathogen infiltration, suggesting a novel role for ASA1 in the production of tryptophan pathway metabolites as part of an Arabidopsis defense response. Regulation of key steps in aromatic amino acid biosynthesis in Arabidopsis appears to involve differential expression of duplicated genes. PMID:1392592

  20. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  1. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells.

    PubMed

    Yang, Yan; Ge, Feng; Sun, Ying; Liu, Diqiu; Chen, Chaoyin

    2017-04-05

    To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS) was transformed into Panax notoginseng (P. notoginseng) cells in which RNA interference (RNAi) of the cycloartenol synthase (CAS) gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT) cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  2. Molecular Cloning and Co-Expression of Phytoene Synthase Gene from Kocuria gwangalliensis in Escherichia coli.

    PubMed

    Seo, Yong Bae; Choi, Seong-Seok; Lee, Jong Kyu; Kim, Nan-Hee; Choi, Mi Jin; Kim, Jong-Myoung; Jeong, Tae Hyug; Nam, Soo-Wan; Lim, Han Kyu; Kim, Gun-Do

    2015-11-01

    A phytoene synthase gene, crtB, was isolated from Kocuria gwangalliensis. The crtB with 1,092 bp full-length has a coding sequence of 948 bp and encodes a 316-amino-acids protein. The deduced amino acid sequence showed a 70.9% identity with a putative phytoene synthase from K. rhizophila. An expression plasmid, pCcrtB, containing the crtB gene was constructed, and E. coli cells containing this plasmid produced the recombinant protein of approximately 34 kDa , corresponding to the molecular mass of phytoene synthase. Biosynthesis of lycopene was confirmed when the plasmid pCcrtB was co-transformed into E. coli containing pRScrtEI carrying the crtE and crtI genes encoding lycopene biosynthetic pathway enzymes. The results obtained from this study will provide a base of knowledge about the phytoene synthase of K. gwangalliensis and can be applied to the production of carotenoids in a non-carotenoidproducing host.

  3. Morphology engineering of Penicillium chrysogenum by RNA silencing of chitin synthase gene.

    PubMed

    Liu, Hui; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai; Zheng, Zhiming

    2013-03-01

    Chitin synthases, that catalyze the formation of chitin the major component of cell walls in most filamentous fungi, play crucial roles in the growth and morphogenesis. To investigate the roles of chitin synthase in Penicillium chrysogenum, we developed an RNAi system to silence the class III chitin synthase gene chs4. After transformation, mutants had a slow growth rate and shorter but highly branched hyphae. All transformants either were unable to form conidia or could form only a few. Changes in chs4 expression could lead to a completely different morphology and eventually cause distinct penicillin yields. In particular, the yield of one transformant was 41 % higher than that of the original strain.

  4. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    PubMed

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  5. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed Central

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-01-01

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  6. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua.

    PubMed

    Kumar, N Senthil; Tang, Bin; Chen, Xiaofei; Tian, Honggang; Zhang, Wenqing

    2008-03-01

    The chitin synthase (CHS) gene B (4781 bp) of Spodoptera exigua (SeCHSB) was cloned by reverse-transcription PCR (RT-PCR) and 3'/5' RACE from the midgut. SeCHSB contains an open reading frame of 4572 nucleotides, encoding a protein of 1523 amino acids with a predicted molecular mass of approximately 174.6 kDa. Alignment of SeCHSB with class B CHSs of other insects showed a high degree of conservation in the putative catalytic domain region. The structure of the SeCHSB gene was analyzed and was found to be the same as that of Manduca sexta CHSB (MsCHSB), including 23 exons and 22 introns but without alternative exons. Southern blot analysis revealed that SeCHSB was a single copy gene and the presence of only two chitin synthase genes in S. exigua. Further investigation indicated that SeCHSB was specifically expressed in the midgut, and its transcript existed constitutively in the midgut from the 3rd instar larval stage to prepupae and reached highest expression on the 1st day of the fifth instar larval stage. These data suggest that SeCHSB is very important in midgut formation and development. Chitin synthase gene comparisons between different classes of insects using software tools revealed some interesting aspects of the similarity and divergence of the gene in the Class Insecta.

  7. Identification and expression of mutations in the hydroxymethylbilane synthase gene causing acute intermittent porphyria (AIP).

    PubMed Central

    Solis, C.; Lopez-Echaniz, I.; Sefarty-Graneda, D.; Astrin, K. H.; Desnick, R. J.

    1999-01-01

    BACKGROUND: Acute intermittent porphyria (AIP), an autosomal dominant inborn error, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (EC 4.3.1.8; HMB-synthase). This disease is characterized by acute, life-threatening neurologic attacks that are precipitated by various drugs, hormones, and other factors. The enzymatic and/or biochemical diagnosis of AIP heterozygotes is problematic; therefore, efforts have focused on the identification of HMB-synthase mutations so that heterozygotes can be identified and educated to avoid the precipitating factors. In Spain, the occurrence of AIP has been reported, but the nature of the HMB-synthase mutations causing AIP in Spanish families has not been investigated. Molecular analysis was therefore undertaken in nine unrelated Spanish AIP patients. MATERIALS AND METHODS: Genomic DNA was isolated from affected probands and family members of nine unrelated Spanish families with AIP. The HMB-synthase gene was amplified by long-range PCR and the nucleotide sequence of each exon was determined by cycle sequencing. RESULTS: Three new mutations, a missense, M212V; a single base insertion, g4715insT; and a deletion/insertion, g7902ACT-->G, as well as five previously reported mutations (G111R, R116W, R149X R167W, and R173W) were detected in the Spanish probands. Expression of the novel missense mutation M212V in E. coli revealed that the mutation was causative, having <2% residual activity. CONCLUSIONS: These studies identified the first mutations in the HMB-synthase gene causing AIP in Spanish patients. Three of the mutations were novel, while five previously reported lesions were found in six Spanish families. These findings enable accurate identification and counseling of presymptomatic carriers in these nine unrelated Spanish AIP families and further demonstrate the genetic heterogeneity of mutations causing AIP. Images Fig. 1 PMID:10602775

  8. Regulation of an anthranilate synthase gene in Streptomyces venezuelae by a trp attenuator.

    PubMed

    Lin, C; Paradkar, A S; Vining, L C

    1998-07-01

    The nucleotide sequence of a 2-4 kb BamHI-SalI fragment of Streptomyces venezuelae ISP5230 DNA that complements trpE and trpG mutations in Escherichia coli contains two ORFs. The larger of these (ORF2) encodes a 624 amino acid sequence similar to the overall sequence of the two subunits of anthranilate synthase. The two-thirds nearest the amino terminus resembles the aminase subunit; the remaining one-third resembles the glutamine amidotransferase subunit. Upstream of ORF2 is a small ORF encoding 18 amino acids that include three adjacent Trp residues; in addition the ORF contains inverted repeats with sequence and positional similarity to the products of attenuator (trpL) regions that regulate tryptophan biosynthesis in other bacteria. In cultures of a trpC mutant of S. venezuelae, increasing the concentration of exogenous tryptophan decreased the formation of anthranilate synthase; similar evidence of endproduct repression was obtained in a trpCER mutant of E. coli transformed with a vector containing the cloned DNA fragment from S. venezuelae. The anthranilate synthase activity in S. venezuelae cell extracts was inhibited by tryptophan, although only at high concentrations of the amino acid. A two-base deletion introduced into the cloned S. venezuelae DNA fragment prevented complementation of a trpE mutation in E. coli. However, S. venezuelae transformants in which the two-base deletion had been introduced by replacement of homologous chromosomal DNA did not exhibit a Trp- phenotype. The result implies that S. venezuelae has one or more additional genes for anthranilate synthase. In alignments with anthranilate synthase genes from other organisms, ORF2 from S. venezuelae most closely resembled genes for phenazine biosynthesis in Pseudomonas. The results bear on the function of the gene in S. venezuelae.

  9. Acc homoeoloci and the evolution of wheat genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We analyzed the DNA sequences of BACs from many wheat libraries containing the Acc-1 and Acc-2 loci, encoding the plastid and cytosolic forms of the enzyme acetyl-CoA carboxylase, to gain understanding of the evolution of these genes and the origin of the three genomes in modern hexaploid wheat. Mor...

  10. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  11. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene.

    PubMed

    Cha, Mijeong; Shim, Sang Hee; Kim, Sung Hong; Kim, Ok Tae; Lee, Se-Weon; Kwon, Suk-Yoon; Baek, Kwang-Hyun

    2012-10-01

    Paclitaxel is produced by various species of yew trees and has been extensively used to treat tumors. In our research, a taxadiene synthase (TS) gene from Taxus brevifolia was used to transform the roots of cultured ginseng (Panax ginseng C.A. Meyer) to produce taxadiene, the unique skeletal precursor to taxol. The TS gene was successfully introduced into the ginseng genome, and the de novo formation of taxadiene was identified by mass spectroscopy profiling. Without any change in phenotypes or growth difference in a TS-transgenic ginseng line, the transgenic TSS3-2 line accumulated 9.1 μg taxadiene per gram of dry weight. In response to the treatment of methyl jasmonate for 3 or 6 days, the accumulation was 14.6 and 15.9 μg per g of dry weight, respectively. This is the first report of the production of taxadiene by engineering ginseng roots with a taxadiene synthase gene.

  12. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  13. chsZ, a gene for a novel class of chitin synthase from Aspergillus oryzae.

    PubMed

    Chigira, Yuko; Abe, Keietsu; Gomi, Katsuya; Nakajima, Tasuku

    2002-07-01

    We cloned and characterized a novel Aspergillus oryzae chitin synthase gene, chsZ, encoding a polypeptide containing a new myosin motor-like domain in its N-terminal half. Alignment analysis revealed that ChsZ was less homologous to known class V enzymes, except for its probable chitin synthase conserved region in the C-terminal half. We also found a chsY gene and found that ChsY showed higher similarity to the class V enzymes than did ChsZ. Phylogenetic analysis clearly demonstrated that the A. oryzae ChsZ, together with Chs4 of Paracoccidioides brasiliensis and Chs6 of Ustilago maydis, formed a new subclass distinct from A. oryzae ChsY and known class V chitin synthases, including A. nidulans CsmA (ChsD) and A. fumigatus ChsE. In conclusion, we propose a new class, class VI chitin synthases, represented by A. oryzae ChsZ, P. brasiliensis Chs4 and U. maydis Chs6. Expression analysis suggested that the regulation of chsZ expression is distinct from that of chsY expression.

  14. Molecular cloning and expression profile analysis of three sunflower (Helianthus annuus) diterpene synthase genes.

    PubMed

    Pugliesi, Claudio; Fambrini, Marco; Salvini, Mariangela

    2011-02-01

    ent-Kaurene, a key precursor of gibberellins, is formed by the action of two diterpene synthases (diTPSs), ent-copalyl diphosphate synthase (CPS), and ent-kaurene synthase (KS). The full-length cDNAs of CPS- (HaCPS1L) and KS-like (HaKS2L and HaKS3L) genes were isolated from sunflower. The amino acid sequences of HaCPS1L, HaKS2L, and HaKS3L exhibit structural features and homology to diTPSs of several plant species involved in gibberellin biosynthesis. RT-PCR analysis indicates that the expression of all genes (HaCPS1L, HaKS2L, and HaKS3L) is highly regulated during growth and development. All three diTPSs are preferentially expressed in rapidly growing tissues. HaKS2L is expressed at a much lower level than the other two diTPS genes. During seed development, the high level of both HaCPS1L and HaKS3L transcripts correlated with the period of rapid growth of the embryo. The three diTPS genes are not subjected to feedback regulation by gibberellin activity.

  15. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    NASA Astrophysics Data System (ADS)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  16. Horizontal Gene Transfer of Phytochelatin Synthases from Bacteria to Extremophilic Green Algae.

    PubMed

    Olsson, Sanna; Penacho, Vanessa; Puente-Sánchez, Fernando; Díaz, Silvia; Gonzalez-Pastor, José Eduardo; Aguilera, Angeles

    2017-01-01

    Transcriptomic sequencing together with bioinformatic analyses and an automated annotation process led us to identify novel phytochelatin synthase (PCS) genes from two extremophilic green algae (Chlamydomonas acidophila and Dunaliella acidophila). These genes are of intermediate length compared to known PCS genes from eukaryotes and PCS-like genes from prokaryotes. A detailed phylogenetic analysis gives new insight into the complicated evolutionary history of PCS genes and provides evidence for multiple horizontal gene transfer events from bacteria to eukaryotes within the gene family. A separate subgroup containing PCS-like genes within the PCS gene family is not supported since the PCS genes are monophyletic only when the PCS-like genes are included. The presence and functionality of the novel genes in the organisms were verified by genomic sequencing and qRT-PCR. Furthermore, the novel PCS gene in Chlamydomonas acidophila showed very strong induction by cadmium. Cloning and expression of the gene in Escherichia coli clearly improves its cadmium resistance. The gene in Dunaliella was not induced, most likely due to gene duplication.

  17. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    PubMed

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity.

  18. Studies on Plant Growth Promoting Properties of Fruit-Associated Bacteria from Elettaria cardamomum and Molecular Analysis of ACC Deaminase Gene.

    PubMed

    Jasim, B; Anish, Mathew Chacko; Shimil, Vellakudiyan; Jyothis, Mathew; Radhakrishnan, E K

    2015-09-01

    Endophytic microorganisms have been reported to have diverse plant growth promoting mechanisms including phosphate solubilization, N2 fixation, production of phyto-hormones and ACC (1-aminocyclopropane-1-carboxylate) deaminase and antiphyto-pathogenic properties. Among these, ACC deaminase production is very important because of its regulatory effect on ethylene which is a stress hormone with precise role in the control of fruit development and ripening. However, distribution of these properties among various endophytic bacteria associated with fruit tissue and its genetic basis is least investigated. In the current study, 11 endophytic bacteria were isolated and identified from the fruit tissue of Elettaria cardamomum and were studied in detail for various plant growth promoting properties especially ACC deaminase activity using both culture-based and PCR-based methods. PCR-based screening identified the isolates EcB 2 (Pantoea sp.), EcB 7 (Polaromonas sp.), EcB 9 (Pseudomonas sp.), EcB 10 (Pseudomonas sp.) and EcB 11 (Ralstonia sp.) as positive for ACC deaminase. The PCR products were further subjected to sequence analysis which proved the similarity of the sequences identified in the study with ACC deaminase sequences reported from other sources. The detailed bioinformatic analysis of the sequence including homology-based modelling and molecular docking confirmed the sequences to have ACC deaminase activity. The docking of the modelled proteins was done using patch dock, and the detailed scrutiny of the protein ligand interaction revealed conservation of key amino acids like Lys51, Ser78, Tyr268 and Tyr294 which play important role in the enzyme activity. These suggest the possible regulatory effect of these isolates on fruit physiology.

  19. Construction of gene expression system in hop (Humulus lupulus) lupulin gland using valerophenone synthase promoter.

    PubMed

    Okada, Yukio; Saeki, Kazuo; Inaba, Akira; Suda, Narushi; Kaneko, Takafumi; Ito, Kazutoshi

    2003-09-01

    The promoter region of the valerophenone synthase (VPS) gene was isolated from hop (Humulus lupulus). VPS, a member of the chalcone synthase (CHS) super-family, catalyzes the biosynthesis reaction of the hop resin that significantly accumulates in the cone's secretory gland called the "lupulin gland". The typical H-box and G-box sequences, which exist in many plants' CHS promoters and act as cis-elements for tissue specificity, UV-light induction, etc., were not found in the isolated VPS promoter, although the H-box-like sequence (CCTTACC, CCTAACC) and the core sequence (ACGT) of the G-box were observed. The transformation experiment using the VPS promoter-UIDA gene fusion revealed that the promoter acts not only in the lupulin gland but also in the glands of leaf and stem. On the other hand, the VPS promoter activity was not induced by UV-irradiation.

  20. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    PubMed

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  1. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  2. The human ATP synthase beta subunit gene: sequence analysis, chromosome assignment, and differential expression.

    PubMed

    Neckelmann, N; Warner, C K; Chung, A; Kudoh, J; Minoshima, S; Fukuyama, R; Maekawa, M; Shimizu, Y; Shimizu, N; Liu, J D

    1989-11-01

    In humans, the functional F0F1-ATP synthase beta subunit gene is located on chromosome 12 in the p13----qter region. Other partially homologous sequences have been detected on chromosomes 2 and 17. The bona fide beta subunit gene has 10 exons encoding a leader peptide of 49 amino acids and a mature protein of 480 amino acids. Thirteen Alu family DNA repeats are found upstream from the gene and in four introns. The gene has four "CCAAT" sequences upstream and in close proximity to the transcriptional initiation site. A 13-bp motif is found in the 5' nontranscribed region of both the beta subunit gene and an ADP/ATP translocator gene that is expressed in high levels in cardiac and skeletal muscle. Analysis of the beta subunit mRNA levels reveals marked differences among tissues. The highest levels are found in heart, lower levels in skeletal muscle, and the lowest levels in liver and kidney. These findings suggest that the tissue-specific levels of ATP synthase beta subunit mRNA may be generated through transcriptional control.

  3. Identification and characterization of the niddamycin polyketide synthase genes from Streptomyces caelestis.

    PubMed Central

    Kakavas, S J; Katz, L; Stassi, D

    1997-01-01

    The genes encoding the polyketide synthase (PKS) portion of the niddamycin biosynthetic pathway were isolated from a library of Streptomyces caelestis NRRL-2821 chromosomal DNA. Analysis of 40 kb of DNA revealed the presence of five large open reading frames (ORFs) encoding the seven modular sets of enzymatic activities required for the synthesis of a 16-membered lactone ring. The enzymatic motifs identified within each module were consistent with those predicted from the structure of niddamycin. Disruption of the second ORF of the PKS coding region eliminated niddamycin production, demonstrating that the cloned genes are involved in the biosynthesis of this compound. PMID:9393718

  4. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  5. Truncating mutation in the nitric oxide synthase 1 gene is associated with infantile achalasia.

    PubMed

    Shteyer, Eyal; Edvardson, Simon; Wynia-Smith, Sarah L; Pierri, Ciro Leonardo; Zangen, Tzili; Hashavya, Saar; Begin, Michal; Yaacov, Barak; Cinamon, Yuval; Koplewitz, Benjamin Z; Vromen, Amos; Elpeleg, Orly; Smith, Brian C

    2015-03-01

    Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1-deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans.

  6. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  7. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  8. In silico structural and functional analysis of Mesorhizobium ACC deaminase.

    PubMed

    Pramanik, Krishnendu; Soren, Tithi; Mitra, Soumik; Maiti, Tushar Kanti

    2017-02-11

    Nodulation is one of the very important processes of legume plants as it is the initiating event of fixing nitrogen. Although ethylene has essential role in normal plant metabolism but it has also negative impact on plants particularly in nodule formation in legume plants. It is also produced due to a variety of biotic or abiotic stresses. 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase is a rhizobial enzyme which cleaves ACC (immediate precursor of ethylene) into α-ketobutyrate and ammonia. As a result, the level of ethylene from the plant cells is decreased and the negative impact of ethylene on nodule formation is reduced. ACC deaminase is widely studied in several plant growth promoting rhizobacterial (PGPR) strains including many legume nodulating bacteria like Mesorhizobium sp. It is an important symbiotic nitrogen fixer belonging to the class - alphaproteobacteria under the order Rhizobiales. ACC deaminase has positive role in Legume-rhizobium symbiosis. Rhizobial ACC deaminase has the potentiality to reduce the adverse effects of ethylene, thereby triggering the nodulation process. The present study describes an in silico comparative structural (secondary structure prediction, homology modeling) and functional analysis of ACC deaminase from Mesorhizobium spp. to explore physico-chemical properties using a number of bio-computational tools. M. loti was selected as a representative species of Mesorhizobium genera for 3D modelling of ACC deaminase protein. Correlation by the phylogenetic relatedness on the basis of both ACC deaminase enzymes and respective acdS genes of different strains of Mesorhizobium has also studied.

  9. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  10. Human gene encoding prostacyclin synthase (PTGIS): Genomic organization, chromosomal localization, and promoter activity

    SciTech Connect

    Yokoyama, Chieko; Yabuki, Tomoko; Inoue, Hiroyasu

    1996-09-01

    The prostacyclin synthase gene isolated from human genomic libraries (PTGIS) consists of 10 exons spanning approximately 60 kb. All the splice donor and acceptor sites conform to the GT/AG rule. Genomic Southern blot and fluorescence in situ hybridization analyses revealed that the human prostacyclin synthase gene is present as a single copy per haploid genome and is localized on chromosome 20q13.11-q13.13. The 1.5-kb sequence of the 5{prime} of the translational initiation site contained both GC-rich and pyrimidine-rich regions and consensus sequences of the transcription factor recognition sites such as Sp1, AP-2, the interferon-{gamma} response element, GATA, NF-{kappa}B, the CACCC box, and the glucocorticoid response element. The core binding sequence (GAGACC) of the shear stress responsive element was also found in the 5{prime}-flanking region of the gene. The major product of the primer extension analysis suggested that the transcription of the gene started from the positions around 49 bp upstream of the translational initiation codon. Transient transfection experiments using human aortic and bovine arterial endothelial cells demonstrated that the GC-rich region (positions -145 to -10) possessed a significant promoter activity. The 6-kb downstream sequence of the translational termination codon contained multiple polyadenylation signals, Alu repeat sequences, and the consensus sequence of the primate-repetitive DNA element, MER1. Two sizes of the prostacyclin synthase mRNAs (approximately 6 and 3.3 kb) were detected with the human aorta and lung. RNA blot hybridization analysis using the 3{prime}-untranslated region as probe indicated that the sizes of the 3{prime}-flanking regions were different in the major 6-kb and minor 3.3-kb mRNAs. 54 refs., 7 figs.

  11. Primary structure of the Escherichia coli thyA gene and its thymidylate synthase product.

    PubMed Central

    Belfort, M; Maley, G; Pedersen-Lane, J; Maley, F

    1983-01-01

    The nucleotide sequence of a 1,163-base-pair fragment that encodes the entire thyA gene of Escherichia coli K-12 was determined. The strategy involved sequence determination of both DNA strands by using overlapping deletions that had been generated in vitro from the two ends of the fragment with BAL-31 nuclease. The amino-terminal sequence of thymidylate synthase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase, EC 2.1.1.45), the product of the thyA gene, located the 792-base-pair open reading frame, which codes for the 264 amino acid residues of this enzyme. The amino acid sequence deduced from the nucleotide data was confirmed to the extent of 40% by partial sequence analysis of the enzyme purified from extracts of the amplified cloned gene. Transcriptional and translational control areas were apparent in the regions flanking the structural gene. The 5-fluorodeoxyuridylate-binding residue of the active site was identified as cysteine-146. Comparison of the E. coli and Lactobacillus casei synthase sequences reveals consistent homology (62%) over extensive regions. This homology is particularly striking in a very hydrophobic region bordering cysteine-146. In the two enzymes, this region, which probably defines the active site, is 82% homologous. However, a dramatic difference between the two sequences is reflected by the surprising finding that a 51-amino-acid stretch, present midway through the L. casei sequence, is completely absent from the E. coli enzyme. PMID:6308660

  12. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  13. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  14. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes.

    PubMed

    Kroken, Scott; Glass, N Louise; Taylor, John W; Yoder, O C; Turgeon, B Gillian

    2003-12-23

    Fungal type I polyketides (PKs) are synthesized by PK synthases (PKSs) and include well known secondary metabolites such as the anticholesterol drug lovastatin and the potent natural carcinogen aflatoxin. Other type I PKs are known to be virulence factors for some plant pathogens and pigments such as melanin. In this study, a phylogenomic approach was used to investigate the origin and diversity of fungal genes encoding putative PKSs that are predicted to synthesize type I PKs. The resulting genealogy, constructed by using the highly conserved PKS ketosynthase (KS) domain, indicated that: (i). Species within subphylum Pezizomycotina (phylum Ascomycota) but not early diverging ascomycetes, like Saccharomyces cerevisiae (Saccharomycotina) or Schizosaccharomyces pombe (Taphrinomycotina), had large numbers (7-25) of PKS genes. (ii). Bacteria and fungi had separate groups of PKS genes; the few exceptions are the likely result of horizontal gene transfer from bacteria to various sublineages of fungi. (iii). The bulk of genes encoding fungal PKSs fell into eight groups. Four groups were predicted to synthesize variously reduced PKs, and four groups were predicted to make unreduced PKs. (iv). Species within different classes of Pezizomycotina shared the same groups of PKS genes. (v). Different fungal genomes shared few putative orthologous PKS genes, even between closely related genomes in the same class or genus. (vi) The discontinuous distributions of orthologous PKSs among fungal species can be explained by gene duplication, divergence, and gene loss; horizontal gene transfer among fungi does not need to be invoked.

  15. Cloning and truncation modification of trehalose-6-phosphate synthase gene from Selaginella pulvinata.

    PubMed

    Zhao, Sheng-Mei; Fu, Feng-Ling; Gou, Lin; Wang, Han-Guang; He, Gang; Li, Wan-Chen

    2013-01-10

    A homologous sequence was amplified from resurrection plant Selaginella pulvinta by RACE technique, proved to be the full-length cDNA of trehalose-6-phosphate synthase gene by homologous alignment and yeast complementation assay, and nominated as SpTPS1 gene. The open reading frame of this gene was truncated 225bp at the 5'-end, resulting the N-terminal truncation modification of 75 amino acids for its encoding protein. The TPS1 deletion mutant strain YSH290 of the brewer's yeast transformed by the truncated gene SpTPS1Δ and its original full-length version restored growth on the medium with glucose as a sole carbon source and displayed growth curves with no significant difference, indicating their encoding proteins functioning as TPS enzyme. The TPS activity of the mutant strain transformed by the truncated gene SpTPS1Δ was about six fold higher than that transformed by its original version, reasoning that the extra N-terminal extension of the full-length amino acid sequence acts as an inhibitory domain to trehalose synthesis. However, the trehalose accumulation of the mutant strain transformed by the truncated gene SpTPS1Δ was only 8% higher than that transformed by its original version. This result is explained by the feedback balance of trehalose content coordinated by the comparative activities between trehalose synthase and trehalase. The truncated gene SpTPS1Δ is suggested to be used in transgenic operation, together with the inhibition of trehalase activity by the application of validamycin A or genetic deficiency of the endogenous trehalase gene, for the enhancement of trehalose accumulation and improvement of abiotic tolerance in transgenic plants.

  16. A trehalose-6-phosphate synthase gene from Saccharina japonica (Laminariales, Phaeophyceae).

    PubMed

    Deng, Yunyan; Wang, Xiuliang; Guo, Hui; Duan, Delin

    2014-01-01

    The full-length cDNA sequence of a trehalose-6-phosphate synthase gene from Saccharina japonica (designated as SjaTPS) (Accession: KC578568) was isolated based on homologous cloning and RACE-PCR. It was 4,127 bp, with 320 bp 5'-UTR, 21 bp 3'-UTR, and open reading frame (ORF) of 3,786 bp. The deduced 1,261 amino acids characterized with predicted molecular weight of 137.84 kDa and theoretical isoelectric point of 7.12. The SjaTPS had one N-terminal CBM20 (family 20 carbohydrate-binding module) domain, one TPS domain (trehalose-6-phosphate synthase) in the middle region and a single TPP (trehalose-6-phosphate phosphatase) domain near the C-terminus. Structural analysis suggested that the SjaTPS putatively functioned as trehalose-6-phosphate synthase, and might be related to laminaran metabolism in S. japonica. Homology analysis indicated that the SjaTPS shared 49-70 % similarities with the 13 known TPS sequences of other algae; only 55 % amino acid similarities were detected between SjaTPS and the previously reported TPS sequence of S. japonica (Accession: DQ666325). Phylogenetic analysis revealed close affinity between SjaTPS and TPS of brown alga Ectocarpus siliculosus (Accession: CBJ29609). Transcriptional analysis showed that desiccation greatly enhanced SjaTPS expression and the maximum appeared at 3 h, which was about 300-fold compared to that of the start, implied that SjaTPS was involved with drought adaption in kelp. In vitro expression of SjaTPS showed that one distinct band existed at ~115 kDa, and western blot detection proved that it was positive to the anti-His antibody with high specificity. Our results increased the knowledge of trehalose-6-phosphate synthase properties in S. japonica and also important for better understanding the role trehalose plays in kelp abiotic tolerance for adaption to the sublittoral habitats.

  17. Characterization and functional analysis of the human inducible nitric oxide synthase gene promoter.

    PubMed Central

    Spitsin, S. V.; Koprowski, H.; Michaels, F. H.

    1996-01-01

    BACKGROUND: Nitric oxide has a wide variety of homeostatic and pathological effects. Control of the production of nitric oxide by the inducible form of the enzyme resides in the 5' promoter region of the gene. Although control of the murine isoform has been investigated, little is known about the functional aspects of the human analog. MATERIALS AND METHODS: A 3.9-kb 5' nontranslated region of the human gene was cloned, sequenced, and several reporter constructs prepared. The promoter-reporter constructs were transfected into human or murine monocytoid cells and reporter expression quantified following cytokine activation of the cells. The production of nitric oxide was also monitored. RESULTS: Although a murine promoter-reporter functioned efficiently in both human and mouse cells, the human constructs functioned only in human cells. The activity of the mouse construct increased progressively with the addition of activating cytokines, but the human promoter-reporter did not. Although interleukin 1 beta drove expression of the human inducible nitric oxide synthase reporter, actual expression of nitric oxide required both interleukin 1 beta and interferon-gamma. CONCLUSIONS: The data indicate that despite the significant homology between the human and mouse inducible nitric oxide synthase promoter sequence, control of the two genes is quite different. In addition to being more efficient in promoter activity, the murine promoter responds increasingly to cytokines that are not effective for the human analog. It is also apparent that human inducible nitric oxide synthase is controlled at both the level of transcription and post-translationally. PMID:8726465

  18. Functional characterization of the rice kaurene synthase-like gene family.

    PubMed

    Xu, Meimei; Wilderman, P Ross; Morrone, Dana; Xu, Jianjun; Roy, Arnab; Margis-Pinheiro, Marcia; Upadhyaya, Narayana M; Coates, Robert M; Peters, Reuben J

    2007-02-01

    The rice (Oryza sativa) genome contains a family of kaurene synthase-like genes (OsKSL) presumably involved in diterpenoid biosynthesis. While a number of OsKSL enzymes have been functionally characterized, several have not been previously investigated, and the gene family has not been broadly analyzed. Here we report cloning of several OsKSL genes and functional characterization of the encoded enzymes. In particular, we have verified the expected production of ent-kaur-16-ene by the gibberellin phytohormone biosynthesis associated OsKS1 and demonstrated that OsKSL3 is a pseudo-gene, while OsKSL5 and OsKSL6 produce ent-(iso)kaur-15-ene. Similar to previous reports, we found that our sub-species variant of OsKSL7 produces ent-cassa-12,15-diene, OsKSL10 produces ent-(sandaraco)pimar-8(14),15-diene, and OsKSL8 largely syn-stemar-13-ene, although we also identified syn-stemod-12-ene as an alternative product formed in approximately 20% of the reactions catalyzed by OsKSL8. Along with our previous reports identifying OsKSL4 as a syn-pimara-7,15-diene synthase and OsKSL11 as a syn-stemod-13(17)-ene synthase, this essentially completes biochemical characterization of the OsKSL gene family, enabling broader analyses. For example, because several OsKSL enzymes are involved in phytoalexin biosynthesis and their gene transcription is inducible, promoter analysis was used to identify a pair of specifically conserved motifs that may be involved in transcriptional up-regulation during the rice plant defense response. Also examined is the continuing process of gene evolution in the OsKSL gene family, which is particularly interesting in the context of very recently reported data indicating that a japonica sub-species variant of OsKSL5 produces ent-pimara-8(14),15-diene, rather than the ent-(iso)kaur-15-ene produced by the indica sub-species variant analyzed here.

  19. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles.

    PubMed

    Piel, Jörn

    2002-10-29

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were cloned from total DNA of Paederus fuscipes beetles, which use this compound for chemical defense. Sequence analysis of the gene cluster and adjacent regions revealed the presence of ORFs with typical bacterial architecture and homologies. The ped cluster, which is present only in beetle specimens with high pederin content, is located on a 54-kb region bordered by transposase pseudogenes and encodes a mixed modular polyketide synthase/nonribosomal peptide synthetase. Notably, none of the modules contains regions with homology to acyltransferase domains, but two copies of isolated monodomain acyltransferase genes were found at the upstream end of the cluster. In line with an involvement in pederin biosynthesis, the upstream cluster region perfectly mirrors pederin structure. The unexpected presence of additional polyketide synthase/nonribosomal peptide synthetase modules reveals surprising insights into the evolutionary relationship between pederin-type pathways in beetles and sponges.

  20. Prospects for Lentiviral Vector Mediated Prostaglandin F Synthase Gene Delivery in Monkey Eyes In vivo

    PubMed Central

    Lee, Eun Suk; Rasmussen, Carol A.; Filla, Mark S.; Slauson, Sarah R.; Kolb, Aaron W.; Peters, Donna M.; Kaufman, Paul L.; Gabelt, B’Ann True; Brandt, Curtis R.

    2014-01-01

    Currently, the most effective outflow drugs approved for clinical use are prostaglandin F2α analogues, but these require daily topical self-dosing and have various intraocular, ocular surface and extraocular side effects. Lentiviral vector-mediated delivery of the prostaglandin F synthase (PGFS) gene, resulting in long-term reduction of IOP, may eliminate off-target tissue effects and the need for daily topical PGF2α self-administration. Lentiviral vector-mediated delivery of the PGFS gene to the anterior segment has been achieved in cats and non-human primates. Although these results are encouraging, our studies have identified a number of challenges that need to be overcome for prostaglandin gene therapy to be translated into the clinic. Using examples from our work in non-human primates, where we were able to achieve a significant reduction in IOP (2 mm Hg) for 5 months after delivery of the cDNA for bovine PGF synthase, we identify and discuss these issues and consider several possible solutions. PMID:24559478

  1. Efficient transformation of wheat by using a mutated rice acetolactate synthase gene as a selectable marker.

    PubMed

    Ogawa, Taiichi; Kawahigashi, Hiroyuki; Toki, Seiichi; Handa, Hirokazu

    2008-08-01

    Acetolactate synthase (ALS) is a target enzyme for many herbicides, including sulfonylurea and imidazolinone. We investigated the usefulness of a mutated ALS gene of rice, which had double point mutations and encoded an herbicide-resistant form of the enzyme, as a selectable marker for wheat transformation. After the genomic DNA fragment from rice containing the mutated ALS gene was introduced into immature embryos by means of particle bombardment, transgenic plants were efficiently selected with the herbicide bispyribac sodium (BS). Southern blot analysis confirmed that transgenic plants had one to more than ten copies of the transgene in their chromosomes. Adjustment of the BS concentration combined with repeated selection effectively prevented nontransgenic plants from escaping herbicide selection. Measurement of ALS activity indicated that transgenic plants produced an herbicide-resistant form of ALS and therefore had acquired the resistance to BS. This report is the first to describe a selection system for wheat transformation that uses a selectable marker gene of plant origin.

  2. Exploration of geosmin synthase from Streptomyces peucetius ATCC 27952 by deletion of doxorubicin biosynthetic gene cluster.

    PubMed

    Singh, Bijay; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-10-01

    Thorough investigation of Streptomyces peucetius ATCC 27952 genome revealed a sesquiterpene synthase, named spterp13, which encodes a putative protein of 732 amino acids with significant similarity to S. avermitilis MA-4680 (SAV2163, GeoA) and S. coelicolor A3(2) (SCO6073). The proteins encoded by SAV2163 and SCO6073 produce geosmin in the respective strains. However, the spterp13 gene seemed to be silent in S. peucetius. Deletion of the doxorubicin gene cluster from S. peucetius resulted in increased cell growth rate along with detectable production of geosmin. When we over expressed the spterp13 gene in S. peucetius DM07 under the control of an ermE* promoter, 2.4 +/- 0.4-fold enhanced production of geosmin was observed.

  3. A comparative analysis of the plant cellulose synthase (CesA) gene family.

    PubMed

    Holland, N; Holland, D; Helentjaris, T; Dhugga, K S; Xoconostle-Cazares, B; Delmer, D P

    2000-08-01

    CesA genes are believed to encode the catalytic subunit of cellulose synthase. Identification of nine distinct CesA cDNAs from maize (Zea mays) has allowed us to initiate comparative studies with homologs from Arabidopsis and other plant species. Mapping studies show that closely related CesA genes are not clustered but are found at different chromosomal locations in both Arabidopsis and maize. Furthermore, sequence comparisons among the CesA-deduced proteins show that these cluster in groups wherein orthologs are often more similar than paralogs, indicating that different subclasses evolved prior to the divergence of the monocot and dicot lineages. Studies using reverse transcriptase polymerase chain reaction with gene-specific primers for six of the nine maize genes indicate that all genes are expressed to at least some level in all of the organs examined. However, when expression patterns for a few selected genes from maize and Arabidopsis were analyzed in more detail, they were found to be expressed in unique cell types engaged in either primary or secondary wall synthesis. These studies also indicate that amino acid sequence comparisons, at least in some cases, may have value for prediction of such patterns of gene expression. Such analyses begin to provide insights useful for future genetic engineering of cellulose deposition, in that identification of close orthologs across species may prove useful for prediction of patterns of gene expression and may also aid in prediction of mutant combinations that may be necessary to generate severe phenotypes.

  4. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  5. Nicotianamine synthase gene family as central components in heavy metal and phytohormone response in maize.

    PubMed

    Zhou, Mei-Liang; Qi, Lei-Peng; Pang, Jun-Feng; Zhang, Qian; Lei, Zhi; Tang, Yi-Xiong; Zhu, Xue-Mei; Shao, Ji-Rong; Wu, Yan-Min

    2013-06-01

    Nicotianamine (NA) is an important divalent metal chelator and the main precursor of phytosiderophores. NA is synthesized from S-adenosylmethionine in a process catalyzed by nicotianamine synthase (NAS). In this study, a set of structural and phylogenetic analyses have been applied to identify the maize NAS genes based on the maize genome sequence release. Ten maize NAS genes have been mapped; seven of them have not been reported to date. Phylogenetic analysis and expression pattern from microarray data led to their classification into two different orthologous groups. C-terminal fusion of ZmNAS3 with GFP was found in the cytoplasm of Arabidopsis leaf protoplast. Expression analysis by reverse transcription polymerase chain reaction revealed ZmNAS genes are responsive to heavy metal ions (Ni, Fe, Cu, Mn, Zn, and Cd), and all 10 ZmNAS genes were only observed in the root tissue except of ZmNAS6. The promoter of ZmNAS genes was analyzed for the presence of different cis-element response to all kinds of phytohormones and environment stresses. We found that the ZmNAS gene expression of maize seedlings was regulated by jasmonic acid, abscisic acid, and salicylic acid. Microarray data demonstrated that the ZmNAS genes show differential, organ-specific expression patterns in the maize developmental steps. The integrated comparative analysis can improve our current view of ZmNAS genes and facilitate the functional characterization of individual members.

  6. The maize brown midrib4 (bm4) gene encodes a functional folylpolyglutamate synthase

    PubMed Central

    Li, Li; Hill-Skinner, Sarah; Liu, Sanzhen; Beuchle, Danielle; Tang, Ho Man; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

    2015-01-01

    Mutations in the brown midrib4 (bm4) gene affect the accumulation and composition of lignin in maize. Fine-mapping analysis of bm4 narrowed the candidate region to an approximately 105 kb interval on chromosome 9 containing six genes. Only one of these six genes, GRMZM2G393334, showed decreased expression in mutants. At least four of 10 Mu-induced bm4 mutant alleles contain a Mu insertion in the GRMZM2G393334 gene. Based on these results, we concluded that GRMZM2G393334 is the bm4 gene. GRMZM2G393334 encodes a putative folylpolyglutamate synthase (FPGS), which functions in one-carbon (C1) metabolism to polyglutamylate substrates of folate-dependent enzymes. Yeast complementation experiments demonstrated that expression of the maize bm4 gene in FPGS-deficient met7 yeast is able to rescue the yeast mutant phenotype, thus demonstrating that bm4 encodes a functional FPGS. Consistent with earlier studies, bm4 mutants exhibit a modest decrease in lignin concentration and an overall increase in the S:G lignin ratio relative to wild-type. Orthologs of bm4 include at least one paralogous gene in maize and various homologs in other grasses and dicots. Discovery of the gene underlying the bm4 maize phenotype illustrates a role for FPGS in lignin biosynthesis. PMID:25495051

  7. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  8. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  9. Modular synthase-encoding gene involved in α-olefin biosynthesis in Synechococcus sp. strain PCC 7002.

    PubMed

    Mendez-Perez, Daniel; Begemann, Matthew B; Pfleger, Brian F

    2011-06-01

    A gene involved in the production of medium-chain α-olefins was identified in the cyanobacterium Synechococcus sp. strain PCC 7002. The gene encodes a large multidomain protein with homology to type I polyketide synthases, suggesting a route for hydrocarbon biosynthesis from fatty acids via an elongation decarboxylation mechanism.

  10. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  11. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  12. Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants.

    PubMed

    Song, Jian; Liu, Jing; Weng, Manli; Huang, Yanyan; Luo, Lei; Cao, Pengxiu; Sun, Haiwei; Liu, Jie; Zhao, Jinhong; Feng, Dianqi; Wang, Bin

    2013-01-15

    A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants.

  13. Characterization of a pine multigene family containing elicitor-responsive stilbene synthase genes.

    PubMed

    Preisig-Müller, R; Schwekendiek, A; Brehm, I; Reif, H J; Kindl, H

    1999-01-01

    Young pine seedlings respond to environmental stress by induced synthesis of pinosylvin, a stilbene phytoalexin. Heartwood of pine trees is characterized by a high content of pinosylvin. The formation of pinosylvin from cinnamoyl-CoA and three molecules malonyl-CoA catalysed by pinosylvin synthase is typical of the genus Pinus. Its enzyme activity not detectable in unstressed seedlings is substantially increased upon application of stimuli like UV-light or infection with the phytopathogenic fungus Botrytis cinerea. A genomic DNA library was screened with pinosylvin synthase cDNA pSP-54 as a probe. Ten clones were isolated and grouped into five subclasses according to the size of their introns. After subcloning into plasmid T7T3, four different members of the five gene subclasses were characterized by sequencing. Emphasis was put on isolating various promoters and analyzing and comparing their responsiveness. The amino acid sequences deduced from genes PST-1, PST-2, PST-3 and PST-5 shared an overall identity of more than 95%. In gene PST-5, the putative translation start site ATG was replaced by CTG. While promoter regions near the TATAA box were almost identical PST-1, PST-2 and PST-3, further upstream sequences differed substantially. Differences in promoter strength were analysed both in transgenic tobacco plants and by transient expression in tobacco protoplasts. Constructs used contained the bacterial beta-glucuronidase under the control of the promoters of pine genes PST-1, PST-2 and PST-3. Upon treatment with UV light or fungal elicitor, the promoter of PST-1 showed highest responsiveness and led to tissue-specific expression in vascular bundles. The data suggest that in pine the gene product of PST-1 is responsible for both the stress response in seedlings and pinosylvin formation in the heartwood.

  14. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  15. Tissue-specific gene silencing mediated by a naturally occurring chalcone synthase gene cluster in Glycine max.

    PubMed

    Tuteja, Jigyasa H; Clough, Steven J; Chan, Wan-Ching; Vodkin, Lila O

    2004-04-01

    Chalcone synthase, a key regulatory enzyme in the flavonoid pathway, constitutes an eight-member gene family in Glycine max (soybean). Three of the chalcone synthase (CHS) gene family members are arranged as inverted repeats in a 10-kb region, corresponding to the I locus (inhibitor). Spontaneous mutations of a dominant allele (I or i(i)) to a recessive allele (i) have been shown to delete promoter sequences, paradoxically increasing total CHS transcript levels and resulting in black seed coats. However, it is not known which of the gene family members contribute toward pigmentation and how this locus affects CHS expression in other tissues. We investigated the unusual nature of the I locus using four pairs of isogenic lines differing with respect to alleles of the I locus. RNA gel blots using a generic open reading frame CHS probe detected similar CHS transcript levels in stems, roots, leaves, young pods, and cotyledons of the yellow and black isolines but not in the seed coats, which is consistent with the dominant I and i(i) alleles mediating CHS gene silencing in a tissue-specific manner. Using real-time RT-PCR, a variable pattern of expression of CHS genes in different tissues was demonstrated. However, increase in pigmentation in the black seed coats was associated with release of the silencing effect specifically on CHS7/CHS8, which occurred at all stages of seed coat development. These expression changes were linked to structural changes taking place at the I locus, shown to encompass a much wider region of at least 27 kb, comprising two identical 10.91-kb stretches of CHS gene duplications. The suppressive effect of this 27-kb I locus in a specific tissue of the G. max plant represents a unique endogenous gene silencing mechanism.

  16. Tissue-Specific Gene Silencing Mediated by a Naturally Occurring Chalcone Synthase Gene Cluster in Glycine maxW⃞

    PubMed Central

    Tuteja, Jigyasa H.; Clough, Steven J.; Chan, Wan-Ching; Vodkin, Lila O.

    2004-01-01

    Chalcone synthase, a key regulatory enzyme in the flavonoid pathway, constitutes an eight-member gene family in Glycine max (soybean). Three of the chalcone synthase (CHS) gene family members are arranged as inverted repeats in a 10-kb region, corresponding to the I locus (inhibitor). Spontaneous mutations of a dominant allele (I or ii) to a recessive allele (i) have been shown to delete promoter sequences, paradoxically increasing total CHS transcript levels and resulting in black seed coats. However, it is not known which of the gene family members contribute toward pigmentation and how this locus affects CHS expression in other tissues. We investigated the unusual nature of the I locus using four pairs of isogenic lines differing with respect to alleles of the I locus. RNA gel blots using a generic open reading frame CHS probe detected similar CHS transcript levels in stems, roots, leaves, young pods, and cotyledons of the yellow and black isolines but not in the seed coats, which is consistent with the dominant I and ii alleles mediating CHS gene silencing in a tissue-specific manner. Using real-time RT-PCR, a variable pattern of expression of CHS genes in different tissues was demonstrated. However, increase in pigmentation in the black seed coats was associated with release of the silencing effect specifically on CHS7/CHS8, which occurred at all stages of seed coat development. These expression changes were linked to structural changes taking place at the I locus, shown to encompass a much wider region of at least 27 kb, comprising two identical 10.91-kb stretches of CHS gene duplications. The suppressive effect of this 27-kb I locus in a specific tissue of the G. max plant represents a unique endogenous gene silencing mechanism. PMID:15064367

  17. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    PubMed

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  18. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis.

  19. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    PubMed

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  20. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    PubMed

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  1. Cloning and Characterization of a Squalene Synthase Gene from the Chaga Medicinal Mushroom, Inonotus obliquus (Agaricomycetes).

    PubMed

    Zhang, Panpan; Cao, Xiaoying; Li, Changgen; Zheng, Zhujun; Yong, Sun; Jiang, Ji-Hong

    2016-01-01

    Squalene synthase catalyzes the condensation of 2 molecules of farnesyl diphosphate to produce squalene, the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. A squalene synthase gene, designated IoSQS, was isolated from Inonotus obliquus, a medicinal mushroom that produces a plethora of bioactive triterpenes. IoSQS complementary DNA was found to contain an open reading frame of 1476 bp, encoding a protein of 491 amino acids with a calculated molecular mass of 55.85 kDa. The IoSQS genomic DNA sequence consisted of 1813 bp and contained 4 exons and 3 introns. The restriction fragment polymorphisms revealed by Southern blot analysis suggested that IoSQS was a single-copy gene. Promoter analysis indicated that the 5' upstream region of IoSQS possessed various potential elements associated with physiological and environmental factors. The expression pattern of IoSQS in different stages and under methyl jasmonate treatment correlated with the accumulation of total triterpenoids and was consistent with the predicted results of the IoSQS promoter region. The N-terminal 466 residues of the hydrophilic sequence were expressed as a His-tagged protein in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. Squalene was detected in vitro in reaction mixture by high-performance liquid chromatography analysis. These results suggest that the IoSQS enzyme is involved in squalene production in I. obliquus.

  2. Altered ceramide acyl chain length and ceramide synthase gene expression in Parkinson’s disease.

    PubMed

    Abbott, Sarah K; Li, Hongyun; Muñoz, Sonia Sanz; Knoch, Bianca; Batterham, Marijka; Murphy, Karen E; Halliday, Glenda M; Garner, Brett

    2014-04-01

    Genetic studies have provided increasing evidence that ceramide homeostasis plays a role in neurodegenerative diseases including Parkinson’s disease (PD). It is known that the relative amounts of different ceramide molecular species, as defined by their fatty acyl chain length, regulate ceramide function in lipid membranes and in signaling pathways. In the present study we used a comprehensive sphingolipidomic case-control approach to determine the effects of PD on ceramide composition in postmortem brain tissue from the anterior cingulate cortex (a region with significant PD pathology) and the occipital cortex (spared in PD), also assessing mRNA expression of the major ceramide synthase genes that regulate ceramide acyl chain composition in the same tissue using quantitative PCR. In PD anterior cingulate cortex but not occipital cortex, total ceramide and sphingomyelin levels were reduced from control levels by 53% (P < 0.001) and 42% (P < 0.001), respectively. Of the 13 ceramide and 15 sphingomyelin molecular lipid species identified and quantified, there was a significant shift in the ceramide acyl chain composition toward shorter acyl chain length in the PD anterior cingulate cortex. This PD-associated change in ceramide acyl chain composition was accompanied by an upregulation of ceramide synthase-1 gene expression, which we consider may represent a response to reduced ceramide levels. These data suggest a significant shift in ceramide function in lipid membranes and signaling pathways occurs in regions with PD pathology. Identifying the regulatory mechanisms precipitating this change may provide novel targets for future therapeutics.

  3. Morphological changes induced by class III chitin synthase gene silencing could enhance penicillin production of Penicillium chrysogenum.

    PubMed

    Liu, Hui; Zheng, Zhiming; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai

    2013-04-01

    Chitin synthases catalyze the formation of β-(1,4)-glycosidic bonds between N-acetylglucosamine residues to form the unbranched polysaccharide chitin, which is the major component of cell walls in most filamentous fungi. Several studies have shown that chitin synthases are structurally and functionally divergent and play crucial roles in the growth and morphogenesis of the genus Aspergillus although little research on this topic has been done in Penicillium chrysogenum. We used BLAST to find the genes encoding chitin synthases in P. chrysogenum related to chitin synthase genes in Aspergillus nidulans. Three homologous sequences coding for a class III chitin synthase CHS4 and two hypothetical proteins in P. chrysogenum were found. The gene which product showed the highest identity and encoded the class III chitin synthase CHS4 was studied in detail. To investigate the role of CHS4 in P. chrysogenum morphogenesis, we developed an RNA interference system to silence the class III chitin synthase gene chs4. After transformation, mutants exhibited a slow growth rate and shorter and more branched hyphae, which were distinct from those of the original strain. The results also showed that the conidiation efficiency of all transformants was reduced sharply and indicated that chs4 is essential in conidia development. The morphologies of all transformants and the original strain in penicillin production were investigated by light microscopy, which showed that changes in chs4 expression led to a completely different morphology during fermentation and eventually caused distinct penicillin yields, especially in the transformants PcRNAi1-17 and PcRNAi2-1 where penicillin production rose by 27 % and 41 %, respectively.

  4. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  5. [Mechanism of genuineness of Glycyrrhiza uralensis based on SNP of β-Amyrin synthase gene].

    PubMed

    Zang, Yi-mei; Li, Yan-peng; Qiao, Jing; Chen, Hong-hao; Liu, Chun-sheng

    2015-07-01

    β-Amyrin synthase (β-AS) genes of Glycyrrhiza uralensis from 6 different regions were analyzed by PCR-SSCP and sequenced, then the correlationship between β-AS SNP and regions of Glycyrrhiza uralensis were determined. According to the 1 coding single nucleotide polymorphism on the first exon of β-AS gene at 94 bp site, Glycyrrhiza uralensis could be divided into 3 genotypes. In these genotypes, the percentage of 94A type in genuine regions was much higher, and it had significant differences with the percentage in non-genuine regions (P < 0.001). The results of the experiment proved that different β-AS genotypes at 94 bp site from different regions may be one of the important reasons to result in the genuineness of Glycyrrhiza uralensis.

  6. Identification and characterization of chitin synthase genes in the postharvest citrus fruit pathogen Penicillium digitatum.

    PubMed

    Gandía, Mónica; Harries, Eleonora; Marcos, Jose F

    2012-06-01

    In this study, we carried out the isolation and characterization of chitin synthase genes (CHS) of the main citrus fruit postharvest pathogen Penicillium digitatum. Using distinct sets of degenerate primers designed from conserved regions of CHS genes of yeast and filamentous fungi, PCR methods, and a DNA genomic library, five putative CHS genes (PdigCHSI, PdigCHSII, PdigCHSIII, PdigCHSV, and PdigCHSVII) were identified, isolated, sequenced, and characterized. Phylogenetic analyses, sequence identity, and domain conservation support the annotation as CHS. A very high sequence identity and strong synteny were found with corresponding regions from the genome of Penicillium chrysogenum. Gene expression of P. digitatum CHS genes during mycelium axenic growth, under oxidative and osmotic stress conditions, and during infection of citrus fruits was confirmed and quantified using quantitative RT-PCR (qRT-PCR). PdigCHSIII had the highest expression among the five genes by one order of magnitude, while PdigCHSII had the lowest. However, PdigCHSII was strongly induced coincident with conidial production, suggesting a role in conidiogenesis. The expression of PdigCHSI, PdigCHSIII, PdigCHSV, and PdigCHSVII was upregulated during infection of citrus fruit. PdigCHSV and PdigCHSVII coexpressed in most of the experiments carried out, and they are separated by a 1.77 kb intergenic region and arranged in opposite directions.

  7. Transcriptional regulation of pig GYS1 gene by glycogen synthase kinase 3β (GSK3β).

    PubMed

    Wang, Yilin; Wang, Yan; Zhong, Tao; Guo, Jiazhong; Li, Li; Zhang, Hongping; Wang, Linjie

    2017-01-01

    Glycogen synthase kinase 3β (GSK3β) is a ubiquitous serine/threonine kinase and has important roles in glycogen metabolism biosynthesis. Studies have revealed that GSK3β can directly regulate the glycogen synthase activity, yet little is known about the regulation of GSK3β on GYS1 gene transcription. Here, we show that overexpression of GSK3β decreased the mRNA expression level of GYS1. Then we cloned approximately 1.5 kb of pig GYS1 gene promoter region, generated sequential deletion constructs, and evaluated their activity. A gradual increase of the promoter activity was seen with increasing length of the promoter sequence, reaching its highest activity to the sequence corresponding to nt -350 to +224, and then decreased. However, the activities of constructed promoter fragments show different responses to GSK3β co-transfection. By analyzing a series of GYS1 promoter reporter constructs, we have defined two crucial regions (-1488 to -539, -350 to -147) that are responsible for GSK3β-induced transcriptional repression. Furthermore, the ChIP results revealed that only the first and second NF-κB sites of GYS1 promoter could bind to p65, and overexpression of GSK3β induced a significant decrease in p65 binding to the second NF-κB binding site, suggesting that GSK3β may regulate expression of GYS1 gene through binding to the second rather than the first NF-κB site. These data suggest that the NF-κB plays important roles in the transcriptional activity of pig GYS1 gene regulated by GSK3β.

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  9. The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium

    PubMed Central

    Pawelczyk, Jakub; Viljoen, Albertus; Kremer, Laurent; Dziadek, Jaroslaw

    2017-01-01

    Malonyl-coenzyme A (CoA) is a crucial extender unit for the synthesis of mycolic and other fatty acids in mycobacteria, generated in a reaction catalyzed by acetyl-CoA carboxylase. We previously reported on the essentiality of accD6Mtb encoding the functional acetyl-CoA carboxylase subunit in Mycobacterium tuberculosis. Strikingly, the homologous gene in the fast-growing, non-pathogenic Mycobacterium smegmatis - (accD6Msm) appeared to be dispensable, and its deletion did not influence the cell lipid content. Herein, we demonstrate that, despite the difference in essentiality, accD6Msm and accD6Mtb encode proteins of convergent catalytic activity in vivo. To identify an alternative, AccD6-independent, malonyl-CoA synthesis pathway in M. smegmatis, a complex genetic approach combined with lipid analysis was applied to screen all five remaining carboxyltransferase genes (accD1-accD5) with respect to their involvement in mycolic acid biosynthesis and ability to utilize acetyl-CoA as the substrate for carboxylation. This approach revealed that AccD1Msm, AccD2Msm and AccD3Msm are not essential for mycolic acid biosynthesis. Furthermore, we confirmed in vivo the function of AccD4Msm as an essential, long-chain acyl-CoA carboxyltransferase, unable to carboxylate short-chain substrate. Finally, our comparative studies unambiguously demonstrated between-species difference in in vivo ability of AccD5 carboxyltransferase to utilize acetyl-CoA that influences AccD6 essentiality in pathogenic and non-pathogenic mycobacteria. PMID:28205597

  10. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    PubMed

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  11. Evolution of Homospermidine Synthase in the Convolvulaceae: A Story of Gene Duplication, Gene Loss, and Periods of Various Selection Pressures[C][W][OA

    PubMed Central

    Kaltenegger, Elisabeth; Eich, Eckart; Ober, Dietrich

    2013-01-01

    Homospermidine synthase (HSS), the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, is known to have its origin in the duplication of a gene encoding deoxyhypusine synthase. To study the processes that followed this gene duplication event and gave rise to HSS, we identified sequences encoding HSS and deoxyhypusine synthase from various species of the Convolvulaceae. We show that HSS evolved only once in this lineage. This duplication event was followed by several losses of a functional gene copy attributable to gene loss or pseudogenization. Statistical analyses of sequence data suggest that, in those lineages in which the gene copy was successfully recruited as HSS, the gene duplication event was followed by phases of various selection pressures, including purifying selection, relaxed functional constraints, and possibly positive Darwinian selection. Site-specific mutagenesis experiments have confirmed that the substitution of sites predicted to be under positive Darwinian selection is sufficient to convert a deoxyhypusine synthase into a HSS. In addition, analyses of transcript levels have shown that HSS and deoxyhypusine synthase have also diverged with respect to their regulation. The impact of protein–protein interaction on the evolution of HSS is discussed with respect to current models of enzyme evolution. PMID:23572540

  12. [Diversity of polyketide synthase genes (PKS) in metagenomic community of the freshwater sponge].

    PubMed

    Kaliuzhnaia, O V; Kulakova, N V; Itskovich, B V

    2012-01-01

    Screening of metagenomic DNA of microbial community, associated with Baikalian sponge Lubomirskia baicalensis, was made to show the presence of polyketide synthase genes (PKS). PKS enzymatic systems take part in synthesis of a great number of biologically-active substances. Cloning and sequencing of amplified products of the ketosynthase domain section of PKS gene cluster has revealed 15 fragments of PKS genes differing from each other's on 35-65% by aminoacid sequences. BLASTX analysis has shown that all these sequences belong to the KS-domains identified in various groups of microorganisms: alpha-, beta-, delta-Proteobacteria, Verrucomicrobia, Cyanobacteria, Chlorophyta. Some sequences were related to the genes which are taking part in biosynthesis of curacin A (CurI, CurJ), stigmatellin (StiC, StiG), nostophycin (NpnB), and cryptophycins (CrpB). The homology of the found sequences with those of the EMBL database varies within 50-82% confirming the presence in fresh-water sponge community the genes for synthesis of the new, yet not studied polyketide substances, possessing the biotechnological potential.

  13. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    PubMed

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  14. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    PubMed

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  15. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5.

  16. Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit.

    PubMed

    Aluru, Maneesha R; Mazourek, Michael; Landry, Laurie G; Curry, Jeanne; Jahn, Molly; O'Connell, Mary A

    2003-07-01

    The biosynthesis of capsaicinoids in the placenta of chilli fruit is modelled to require components of the fatty acid synthase (FAS) complex. Three candidate genes for subunits in this complex, Kas, Acl, and Fat, isolated based on differential expression, were characterized. Transcription of these three genes was placental-specific and RNA abundance was positively correlated with degree of pungency. Kas and Acl were mapped to linkage group 1 and Fat to linkage group 6. None of the genes is linked to the pungency locus, C, on linkage group 2. KAS accumulation was positively correlated with pungency. Western blots of placental extracts and histological sections both demonstrated that the accumulation of this enzyme was correlated with fruit pungency and KAS was immunolocalized to the expected cell layer, the placental epidermis. Enzyme activity of the recombinant form of the placental-specific KAS was confirmed using crude cell extracts. These FAS components are fruit-specific members of their respective gene families. These genes are predicted to be associated with Capsicum fruit traits, for example, capsaicinoid biosynthesis or fatty acid biosynthesis necessary for placental development.

  17. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  18. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    PubMed

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  19. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    PubMed Central

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K.

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content. PMID:23755054

  20. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    PubMed

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  1. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  2. Nitric oxide production and NO synthase gene expression contribute to vascular regulation during exercise.

    PubMed

    Shen, W; Zhang, X; Zhao, G; Wolin, M S; Sessa, W; Hintze, T H

    1995-08-01

    Nitric oxide (NO) is a vasodilator produced under normal physiologic conditions primarily by the vascular endothelium lining all blood vessels. The primary stimulus for the production of nitric oxide by the constitutive endothelial nitric oxide synthase (ECNOS, Type II) found in blood vessels is most likely the shear stress, the frictional force, caused by blood flowing through blood vessels. During exercise there is an increase in cardiac output and redistribution of blood flow to increase blood flow in skeletal muscle and in the coronary circulation. These adjustments provide increased oxygen delivery to support aerobic energy production and to sustain the exercise response. NO may be involved in the regulation of vascular tone in exercising skeletal and cardiac muscle by promoting, enhancing the metabolic vasodilation. In addition, the production of NO by capillary endothelium may regulate oxygen consumption by mitochondria through chemical interactions between NO and the iron-sulfur center of these enzymes. Finally, brief exercise training may alter the gene expression for the enzyme, the constitutive endothelial NO synthase, which forms NO and may be part of the vascular adaptation seen after aerobic exercise training. Furthermore, if there is a genetic predisposition to produce NO, as in world class athletes or animals bred to race, NO may contribute to spectacular exercise performance. These three potential roles of NO will be discussed and data presented to support each of these in our review.

  3. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  4. Endothelial Nitric Oxide Synthase and Angiotensin Converting Enzyme Gene Polymorphisms in Migraine Patients

    PubMed Central

    SİPAHİ, Tammam; GÜLDİKEN, Babürhan; KABAYEL, Levent; PALABIYIK, Orkide; ÖZKAN, Hülya; KILIÇ, Tülay Okman; SÜT, Necdet; TURGUT, Nilda

    2013-01-01

    Introduction In this study, we investigated the association of migraine with the Variable Number of Tandem Repeats (VNTR), repeated as 27 base pair, gene polymorphism in intron 4 of the endothelial nitric oxide synthase (eNOS) and the insertion/deletion of angiotensin converting enzyme (ACE) gene polymorphisms. Methods One hundred and five migraine and ninety seven healthy female control subjects were enrolled in the study. The patients were subdivided as migraine with aura and without aura, and the frequency and severity of migraine headaches were recorded. The eNOS VNTR (eNOS 4 a/b) and ACE insertion/deletion gene polymorphisms (ACE I/D) were assessed by polymerase chain reactions. Result The allele and genotype frequencies of eNOS 4 a/b gene polymorphism showed no difference between the migraine and control groups. The genotypic distribution of the ACE I/D gene polymorphism in the migraine group significantly differed from that in the control group. The DD and ID genotype increased the risk of migraine as much as 2.571 (95% CI-1.138–5.811) and 4.453 (95% CI-2.006–9.883) compared to the II genotype. The same increased risk sustained for both genotypes in the migraine with aura subgroup, but only the ID genotype remained as the risk factor in the migraine without aura subgroup (OR-3.750, 95% CI-1.493–9.420). No association of gene polymorphisms with migraine frequency and severity was observed. Conclusion Our findings support the relationship between migraine and the ACE I/D gene polymorphism. However, no association was found between migraine and the eNOS 4 a/b gene polymorphism.

  5. Updating carbamoylphosphate synthase (CPS) phylogenies: occurrence and phylogenetic identity of archaeal CPS genes.

    PubMed

    Cammarano, Piero; Gribaldo, Simonetta; Johann, Andre

    2002-08-01

    Among Bacteria the carA and carB genes encoding the small (CarA) and large (CarB) subunits of carbamoylphosphate synthase (CPS) have been lost in certain symbionts (Haemophylus influenzae) and in most obligate intracellular parasites (Chlamydiae, Spirochaetes, Mycoplasmatales, Rickettsiae) having genome sizes in the 0.7- to 1.1-Mb range. Compared to Bacteria, Archaea exhibit a more varied pattern of CPS gene losses and an unusual propensity to incorporate CPS genes derived from both Bacteria and other Archaea. Schematically they fall into three groups. Group 1 taxa (the crenarchaeon Aeropyrum pernix and the euryarchaea Pyrococcus horikoshi and Pyrococcus abyssii) lack CPS genes altogether. Group 2 taxa (comprising Halobacteriales, Thermoplasmales, Methanococcales, Methanomicrobiales, Archaeoglobales) harbor CPS genes whose encoded CarB and CarA subunit proteins are ostensibly bacterial in origin; that is, they are intermixed with bacterial homologues on a phylogeny of concatenated CarA and CarB sequences and are not distinguishable from bacterial sequences after searching for domain-specific amino acid residue positions. Group 3 taxa (the crenarchaea Pyrobaculum aerophilum, Sulfolobus solfataricus, and Sulfolobus tokodaii and the euryarchaeon Pyrococcus furiosus) harbor CPS genes whose encoded proteins appear to be archaeal: consistent with an archaeal origin, the CarA and CarB sequences in this group possess both unique signatures and signatures affiliating them to Eukarya. Based on the topology of the clade comprising the four Group 3 taxa, we argue that CPS genes of P. furiosus (a euryarchaeon) and those of the crenarchaea P. aerophilum, S. solfataricus, and S. tokodaii are of a single type, resulting from the two genes being laterally transferred from a crenarchaeon to P. furiosus.

  6. Effects of methionine synthase and methylenetetrahydrofolate reductase gene polymorphisms on markers of one-carbon metabolism.

    PubMed

    Ho, Vikki; Massey, Thomas E; King, Will D

    2013-11-01

    Genetic and nutritional factors play a role in determining the functionality of the one-carbon (1C) metabolism cycle, a network of biochemical reactions critical to intracellular processes. Genes encoding enzymes for methylenetetrahydrofolate reductase (MTHFR) and methionine synthase (MTR) may determine biomarkers of the cycle including homocysteine (HCY), S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH). MTHFR C677T is an established genetic determinant of HCY but less is known of its effect on SAM and SAH. Conversely, the relationship between MTR A2756G and HCY remains inconclusive, and its effect on SAM and SAH has only been previously investigated in a female-specific population. Folate and vitamin B12 are essential substrate and cofactor of 1C metabolism; thus, consideration of gene-nutrient interactions may clarify the role of genetic determinants of HCY, SAM and SAH. This cross-sectional study included 570 healthy volunteers from Kingston, Ontario, Ottawa, Ontario and Halifax, Nova Scotia, Canada. Least squares regression was used to examine the effects of MTR and MTHFR polymorphisms on plasma HCY, SAM and SAH concentrations; gene-gene and gene-nutrient interactions were considered with the inclusion of cross-products in the model. Main effects of MTR and MTHFR polymorphisms on HCY concentrations were observed; however, no gene-gene or gene-nutrient interactions were found. No association was observed for SAM. For SAH, interactions between MTR and MTHFR polymorphisms, and MTHFR polymorphism and serum folate were found. The findings of this research provide evidence that HCY and SAH, biomarkers of 1C metabolism, are influenced by genetic and nutritional factors and their interactions.

  7. [An intron-free methyl jasmonate inducible geranylgeranyl diphosphate synthase gene from Taxus media and its functional identification in yeast].

    PubMed

    Liao, Zhihua; Gong, Yifu; Kai, Guoyin; Zuo, Kaijing; Chen, Min; Tan, Qiumin; Wei, Yamin; Guo, Liang; Tan, Feng; Sun, Xiaofen; Tang, Kexuan

    2005-01-01

    Geranylgeranyl diphosphate synthase (GGPPS, EC: 2.5.1.29) catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes including Taxol, one of the most potent antitumor drugs. In order to investigate the role of GGPP synthase in taxol biosynthesis, we cloned, characterized and functionally expressed the GGPP synthase gene from Taxus media. A 3743-bp genomic sequence of T. media was isolated by genome walking strategy which contained an 1182-bp open reading frame (ORF) encoding a 393-amino acid polypeptide that showed high similarity to other plant GGPPSs. Subsequently the full-length cDNA of the GGPPS gene of T. media (designated TmGGPPS) was amplified by RACE. Bioinformatic analysis showed that TmGGPPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the prenyltransferases. By constructing the phylogenetic tree of plant GGPPSs, it was found that plant-derived GGPPSs could be divided into two classes, angiosperm and gymnosperm classes, which might have evolved in parallel from the same ancestor. To our knowledge this was the first report that the geranylgeranyl diphosphate synthase genes were free of intron and evolved in parallel between angiosperms and gymnosperms. The coding sequence of TmGGPPS was expressed in yeast mutant (SFNY368) lacking of GGPP synthase activity through functional complementation, and the transgenic yeast showed to have activity of GGPP synthase. This was also the first time to use SFNY368 to identify the function of plant-derived GGPPSs. Furthermore, investigation of the impact of methyl jasmonate (MeJA) on the expression of TmGGPPS revealed that MeJA-treated T. media cultured cells had much higher expression of TmGGPPS than untreated cells.

  8. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase.

    PubMed

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida

    2011-07-01

    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  9. Rat mitochondrial and cytosolic 3-hydroxy-3-methylglutaryl-CoA synthases are encoded by two different genes.

    PubMed Central

    Ayté, J; Gil-Gómez, G; Haro, D; Marrero, P F; Hegardt, F G

    1990-01-01

    We report the isolation and characterization of a 1994-base-pair cDNA that encompasses the entire transcription unit of the mitochondrial 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase (EC 4.1.3.5.) gene from rat. Analysis of the nucleotide sequence reveals that the cDNA encodes a polypeptide of 508 residues and 56,918-Da molecular mass. Identify of the cDNA clone isolated as mitochondrial HMG-CoA synthase was confirmed by the following criteria: (i) Amino acid residues are 65% homologous with hamster cytosolic HMG-CoA synthase. (ii) A 19-amino acid sequence probably corresponding to the catalytic site is highly homologous (90%) to that reported for chicken liver mitochondrial HMG-CoA synthase. (iii) The expression product of the cDNA in Escherichia coli has HMG-CoA synthase activity. (iv) The protein includes a sequence of 37 amino acid residues at the N terminus that is not present in the cytosolic enzyme. The predominantly basic, hydrophobic, and hydroxylated nature of the residues of this sequence suggests that it is a leader peptide to target HMG-CoA synthase inside mitochondria. These data plus the hybridization pattern in genomic Southern blot analysis, the different transcript size (2.0 kilobases versus 3.4 kilobases for the cytosolic enzyme), and the different expression pattern shown in RNA blot experiments suggest the presence of two HMG-CoA synthase genes, one for the cytosolic and another for the mitochondrial enzyme. Images PMID:1971108

  10. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    PubMed

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds.

  11. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Pereira, M; Felipe, M S; Brígido, M M; Soares, C M; Azevedo, M O

    2000-03-30

    1,3-beta-D-glucan is a fungal cell wall polymer synthesized by the multi-subunit enzyme 1,3-beta-D-glucan synthase. A subunit of this integral membrane protein was first described as the product of the FKS1 gene from Saccharomyces cerevisiae using echinocandin mutants. Other FKS1 genes were also reported for Candida albicans, Aspergillus nidulans and Cryptococcus neoformans. Here, we report the nucleotide sequence of the first homologous FKS gene cloned from the pathogenic fungus Paracoccidioides brasiliensis. An open reading frame of 5942 bp was identified in the complete sequence, interrupted by two putative introns, the first close to the 5' end and the second close to the 3' end of the gene. A promoter region is also described containing consensus sequences such as canonical TATA and CAAT boxes and, possibly, multiple sites for glucose regulation by creA protein. The deduced sequence of 1926 amino acid show more than 85% similarity to FksAp from A. nidulans, and 71% to Fks1p and Fks2p from S. cerevisiae. Computational analysis of P. brasiliensis Fks1p suggests a similar structure to transmembrane proteins, such as FksAp, with the presence of two domains composed by hydrophobic helices that limit the putative highly hydrophilic catalytic domain within the cytoplasm.

  12. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88.

  13. Potential impact of a single nucleotide polymorphism in the hyaluronan synthase 1 gene in Waldenstrom's macroglobulinemia.

    PubMed

    Adamia, Sophia; Treon, Steven P; Reiman, Tony; Tournilhac, Olivier; McQuarrie, Carrie; Mant, Michael J; Belch, Andrew R; Pilarski, Linda M

    2005-03-01

    The hyaluronan synthase 1 (HAS1) gene encodes a plasma membrane protein that synthesizes hyaluronan, an extracellular matrix molecule. Previously, in patients with Waldenstrom's macroglobulinemia (WM), we detected upregulation of HAS1 transcripts and identified aberrant splice variants of this gene. Aberrant splicing of HAS1 results from activation of cryptic splice sites. In turn, activation of cryptic donor and acceptor splice sites can be promoted by mutations occurring upstream of these sites and/or at the branch point of slicing. We measured the frequency of the HAS1 833A/G polymorphism (ie, single-nucleotide polymorphism; SNP) in patients with WM and healthy donors. Additionally, HAS1 gene expression was evaluated in the same group of patients. Our observations so far suggest that HAS1 833A/G SNPs contribute to aberrant splicing of this gene; this idea is supported by the fact that 833A/G SNP is located on an exonic splicing enhancer motif. Based on the results obtained thus far, we speculate that individuals with HAS1 833G/G genotype are predisposed toward aberrant HAS1 splicing and expression of HAS1 variants, resulting in an enhanced risk of developing WM. Study of a larger group of patients and healthy donors is needed to confirm these speculations and to evaluate the prognostic significance of these findings.

  14. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  15. Effects of homoeologous wheat starch synthase IIa genes on starch properties.

    PubMed

    Shimbata, Tomoya; Ai, Yongfeng; Fujita, Masaya; Inokuma, Takayuki; Vrinten, Patricia; Sunohara, Ai; Saito, Mika; Takiya, Toshiyuki; Jane, Jay-lin; Nakamura, Toshiki

    2012-12-05

    Near-isogenic lines (NILs) of the eight haplotypes of starch synthase IIa (SSIIa) were used to analyze the effects of SSIIa gene dosage on branch chain length, gelatinization, pasting, retrogradation, and enzymatic hydrolysis of starches. Compared to wild-type, the amylopectin of lines missing one or more active SSIIa enzymes had increases in the proportion of short branch chains (DP6-10) and decreases in midlength chains (DP11-24), and the size of these differences depended on the dosage of active SSIIa enzymes. Of the three loci, SSIIa-A1 had the smallest contribution to amylopectin structure and SSIIa-B1 the largest. The different effects of the three SSIIa enzymes on starch properties were also seen in gelatinization, retrogradation, pasting, and enzymatic hydrolysis properties. Such differences in starch properties might be useful in influencing the texture and shelf life of food products.

  16. DNA polymorphisms in the tetrahydrocannabinolic acid (THCA) synthase gene in "drug-type" and "fiber-type" Cannabis sativa L.

    PubMed

    Kojoma, Mareshige; Seki, Hikaru; Yoshida, Shigeo; Muranaka, Toshiya

    2006-06-02

    The cannabinoid content of 13 different strains of cannabis plant (Cannabis sativa L.) was analyzed. Six strains fell into the "drug-type" class, with high Delta-9-tetrahydrocannabinolic acid (THCA) content, and seven strains into the "fiber-type" class, with low THCA using HPLC analysis. Genomic DNA sequence polymorphisms in the THCA synthase gene from each strain were studied. A single PCR fragment of the THCA synthase gene was detected from six strains of "drug-type" plants. We could also detect the fragment from seven strains of "fiber-type" plants, although no or very low content of THCA were detected in these samples. These were 1638 bp from all 13 strains and no intron among the sequences obtained. There were two variants of the THCA synthase gene in the "drug-type" and "fiber-type" cannabis plants, respectively. Thirty-seven major substitutions were detected in the alignment of the deduced amino acid sequences from these variants. Furthermore, we identified a specific PCR marker for the THCA synthase gene for the "drug-type" strains. This PCR marker was not detected in the "fiber-type" strains.

  17. Cystathionine beta synthase gene dose dependent vascular remodeling in murine model of hyperhomocysteinemia.

    PubMed

    Tyagi, Neetu; Qipshidze, Natia; Sen, Utpal; Rodriguez, Walter; Ovechkin, Alexander; Tyagi, Suresh C

    2011-09-30

    Although children born with severe homocystinurea (i.e. cystathionine beta synthase homozygote knockout, CBS-/-) develop deleterious vascular complications with structural malformation and do not live past teenage, the heterozygote (CBS-/+) lives with apparently normal phenotype. Interestingly, this differential role of CBS expression in vascular remodeling is unclear. Peroxisome proliferator activated receptor gamma (PPARγ) is nuclear transcription factor that mitigates vascular complications. The hypothesis was that homocysteine (Hcy) decreased thioredoxin (Trx), peroxiredoxin (Prx), increased NADPH oxidase (NOX1), mitochondrial nitric oxide synthase (mtNOS) activity and reactive oxygen species (ROS) in mitochondria in a CBS gene dose-dependent manner. ROS transduced matrix metalloproteinase (MMP) activation causing thickening (fibrosis) of the basement membrane, rendering ineffective endothelial nitric oxide synthase (eNOS) and promoted endothelial-smooth muscle disconnection/uncoupling by antagonizing PPARγ. Wild type (WT-CBS+/+), CBS-/+ and CBS -/- mice were treated with or without ciglitazone (CZ, a PPARγ agonist) in food at birth. Aortic nuclear PPARγ expression was measured by EMSA. Aortic mtNOS activity and ROS production was measured using NO- and H(2)O(2)-electrodes, respectively. Aorta was analyzed for Trx, Prx, by Western blot, and PCR. MMP activity was by in situ zymography. Aortic function was measured in tissue myobath. The results suggested 90% morbidity in CBS-/- allele at 12 wks. However, treatment with the PPARγ agonist, CZ significantly reduced the morbidity to 20%. In addition, CZ restored the PPARγ activity in CBS-/+ and -/- mice to normal levels. The oxidative stress was alleviated by CZ treatment. In situ labeling with mito-tracker suggests co-localization of ROS with mitochondrial mitophagy. The mtNOS activity was increased in HHcy compared to WT. The data support the notion that Hcy decreases redoxins, increases mtNOS activity and

  18. Promoters of Human Cosmc and T-synthase Genes Are Similar in Structure, Yet Different in Epigenetic Regulation*

    PubMed Central

    Zeng, Junwei; Mi, Rongjuan; Wang, Yingchun; Li, Yujing; Lin, Li; Yao, Bing; Song, Lina; van Die, Irma; Chapman, Arlene B.; Cummings, Richard D.; Jin, Peng; Ju, Tongzhong

    2015-01-01

    The T-synthase (core 1 β3-galactosyltransferase) and its molecular chaperone Cosmc regulate the biosynthesis of mucin type O-glycans on glycoproteins, and evidence suggests that both T-synthase and Cosmc are transcriptionally suppressed in several human diseases, although the transcriptional regulation of these two genes is not understood. Here, we characterized the promoters essential for human Cosmc and T-synthase transcription. The upstream regions of the genes lack a conventional TATA box but contain CpG islands, cCpG-I and cCpG-II for Cosmc and tCpG for T-synthase. Using luciferase reporter assays, site-directed mutagenesis, ChIP assays, and mithramycin A treatment, we identified the core promoters within cCpG-II and tCpG, which contain two binding sites for Krüppel-like transcription factors, including SP1/SP3, respectively. Methylome analysis of Tn4 B cells, which harbor a silenced Cosmc, confirmed the hypermethylation of the Cosmc core promoter but not for T-synthase. These results demonstrate that Cosmc and T-synthase are transcriptionally regulated at a basal level by the specificity protein/Krüppel-like transcription factor family of members, which explains their ubiquitous and coordinated expression, and also indicate that they are differentially epigenetically regulated beyond X chromosome imprinting. These results are important in understanding the regulation of these genes that have roles in human diseases, such as IgA nephropathy and cancer. PMID:26063800

  19. Promoters of Human Cosmc and T-synthase Genes Are Similar in Structure, Yet Different in Epigenetic Regulation.

    PubMed

    Zeng, Junwei; Mi, Rongjuan; Wang, Yingchun; Li, Yujing; Lin, Li; Yao, Bing; Song, Lina; van Die, Irma; Chapman, Arlene B; Cummings, Richard D; Jin, Peng; Ju, Tongzhong

    2015-07-31

    The T-synthase (core 1 β3-galactosyltransferase) and its molecular chaperone Cosmc regulate the biosynthesis of mucin type O-glycans on glycoproteins, and evidence suggests that both T-synthase and Cosmc are transcriptionally suppressed in several human diseases, although the transcriptional regulation of these two genes is not understood. Here, we characterized the promoters essential for human Cosmc and T-synthase transcription. The upstream regions of the genes lack a conventional TATA box but contain CpG islands, cCpG-I and cCpG-II for Cosmc and tCpG for T-synthase. Using luciferase reporter assays, site-directed mutagenesis, ChIP assays, and mithramycin A treatment, we identified the core promoters within cCpG-II and tCpG, which contain two binding sites for Krüppel-like transcription factors, including SP1/SP3, respectively. Methylome analysis of Tn4 B cells, which harbor a silenced Cosmc, confirmed the hypermethylation of the Cosmc core promoter but not for T-synthase. These results demonstrate that Cosmc and T-synthase are transcriptionally regulated at a basal level by the specificity protein/Krüppel-like transcription factor family of members, which explains their ubiquitous and coordinated expression, and also indicate that they are differentially epigenetically regulated beyond X chromosome imprinting. These results are important in understanding the regulation of these genes that have roles in human diseases, such as IgA nephropathy and cancer.

  20. Partial deletion of both the spermine synthase gene and the Pex gene in the X-linked hypophosphatemic, gyro (Gy) mouse.

    PubMed

    Meyer, R A; Henley, C M; Meyer, M H; Morgan, P L; McDonald, A G; Mills, C; Price, D K

    1998-03-15

    Gy, along with Hyp, is a dominant mutation of the normal gene Pex causing X-linked hypophosphatemia in the mouse. Hemizygous Gy male mice, however, have greater defects in survival, bodily growth, skeletal mineralization, and neurological function than those found in heterozygous Gy females or in Hyp mice. Since the gene for spermine synthase is immediately upstream of the homologous human gene PEX, we compared the effects of the Gy and Hyp mutations on both the spermine synthase gene and the Pex gene. Barely detectable levels of spermine (< 5% of normal) with elevated levels of its precursor, spermidine, were found in organs of Gy male mice compared to normal male littermates. Neither Gy females nor Hyp male mice were significantly affected. Four missing introns of the spermine synthase gene were identified in Gy male mice, suggesting extensive gene disruption. A pseudogene for spermine synthase was also identified in the mouse genome. Pex mRNA was found in several but not all tissues studied in adult normal mice. Pex mRNA was altered in both Gy and Hyp mice. All male Hyp mice were lacking the 3' end of the Pex message, whereas all male Gy mice were deficient at the 5' end. In summary, the Gy mutation is associated with a recessively expressed mutation of the spermine synthase gene, leading to spermine deficiency, and a dominantly expressed mutation of the Pex gene, leading to hypophosphatemia. Alterations in two contiguous genes in Gy may explain the additional phenotypic abnormalities present in the Gy male mouse.

  1. Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans.

    PubMed

    Sagane, Yoshimasa; Zech, Karin; Bouquet, Jean-Marie; Schmid, Martina; Bal, Ugur; Thompson, Eric M

    2010-05-01

    Extracellular matrices play important, but poorly investigated, roles in morphogenesis. Extracellular cellulose is central to regulation of pattern formation in plants, but among metazoans only tunicates are capable of cellulose biosynthesis. Cellulose synthase (CesA) gene products are present in filter-feeding structures of all tunicates and also regulate metamorphosis in the ascidian Ciona. Ciona CesA is proposed to have been acquired by lateral gene transfer from a prokaryote. We identified two CesA genes in the sister-class larvacean Oikopleura dioica. Each has a mosaic structure of a glycoslyltransferase 2 domain upstream of a glycosyl hydrolase family 6 cellulase-like domain, a signature thus far unique to tunicates. Spatial-temporal expression analysis revealed that Od-CesA1 produces long cellulose fibrils along the larval tail, whereas Od-CesA2 is responsible for the cellulose scaffold of the post-metamorphic filter-feeding house. Knockdown of Od-CesA1 inhibited cellulose production in the extracellular matrix of the larval tail. Notochord cells either failed to align or were misaligned, the tail did not elongate properly and tailbud embryos also exhibited a failure to hatch. Knockdown of Od-CesA2 did not elicit any of these phenotypes and instead caused a mild delay in pre-house formation. Phylogenetic analyses including Od-CesAs indicate that a single lateral gene transfer event from a prokaryote at the base of the lineage conferred biosynthetic capacity in all tunicates. Ascidians possess one CesA gene, whereas duplicated larvacean genes have evolved distinct temporal and functional specializations. Extracellular cellulose microfibrils produced by the pre-metamorphic Od-CesA1 duplicate have a role in notochord and tail morphogenesis.

  2. Genetic association analyses of nitric oxide synthase genes and neural tube defects vary by phenotype.

    PubMed

    Soldano, Karen L; Garrett, Melanie E; Cope, Heidi L; Rusnak, J Michael; Ellis, Nathen J; Dunlap, Kaitlyn L; Speer, Marcy C; Gregory, Simon G; Ashley-Koch, Allison E

    2013-10-01

    Neural tube defects (NTDs) are caused by improper neural tube closure during the early stages of embryonic development. NTDs are hypothesized to have a complex genetic origin and numerous candidate genes have been proposed. The nitric oxide synthase 3 (NOS3) G594T polymorphism has been implicated in risk for spina bifida, and interactions between that single nucleotide polymorphism (SNP) and the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism have also been observed. To evaluate other genetic variation in the NO pathway in the development of NTDs, we examined all three NOS genes: NOS1, NOS2, and NOS3. Using 3109 Caucasian samples in 745 families, we evaluated association in the overall dataset and within specific phenotypic subsets. Haplotype tagging SNPs in the NOS genes were tested for genetic association with NTD subtypes, both for main effects as well as for the presence of interactions with the MTHFR C677T polymorphism. Nominal main effect associations were found with all subtypes, across all three NOS genes, and interactions were observed between SNPs in all three NOS genes and MTHFR C677T. Unlike the previous report, the most significant associations in our dataset were with cranial subtypes and the AG genotype of rs4795067 in NOS2 (p = 0.0014) and the interaction between the rs9658490 G allele in NOS1 and MTHFR 677TT genotype (p = 0.0014). Our data extend the previous findings by implicating a role for all three NOS genes, independently and through interactions with MTHFR, in risk not only for spina bifida, but all NTD subtypes.

  3. Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate.

    PubMed

    Wang, Jian-Rong; Lin, Jun-Fang; Guo, Li-Qiong; You, Lin-Feng; Zeng, Xian-Lu; Wen, Jia-Ming

    2014-02-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate to give presqualene diphosphate and the subsequent rearrangement to form squalene. The gene encoding squalene synthase was cloned from Poria cocos by degenerate PCR and inverse PCR. The open reading frame of the gene is 1,497 bp, which encodes 499 amino acid residues. A phylogenetic analysis revealed that P. cocos SQS belonged to the fungus group, and was more closely related to the SQS of Ganoderma lucidum than other fungi. The treatment of P. cocos with methyl jasmonate (MeJA) significantly enhanced the transcriptional level of P. cocos sqs gene and the content of squalene in P. cocos. The transcriptional level of sqs gene was approximately fourfold higher than the control sample and the squalene content reached 128.62 μg/g, when the concentration of MeJA was 300 μM after 72 h induction.

  4. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  5. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.)

    PubMed Central

    Rafique, Muhammad Z.; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (“Anne”). A 5 bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes. PMID:28066458

  6. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  7. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    PubMed

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  8. Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat.

    PubMed

    Blake, W L; Clarke, S D

    1990-12-01

    The objective of this research was to determine whether dietary polyunsaturated fatty acids suppress hepatic fatty acid synthase (FAS) mRNA levels by altering FAS gene transcription. Male Sprague-Dawley rats were meal-fed for 10 d a high glucose diet supplemented with 20% digestible energy as menhaden oil or tripalmitin. The transcription rate for FAS was determined by nuclear run-on analysis in hepatic nuclei isolated from rats 2 h postmeal. The values for transcription rates of FAS and S14 (a putative lipogenic protein) in rats fed menhaden oil were only 6 and 21%, respectively, of the rates in rats fed the tripalmitin diet (p less than 0.02). Gene transcription for beta-actin and phosphoenolpyruvate carboxykinase did not differ between treatments. The reduction in hepatic FAS mRNA levels caused by dietary polyunsaturated fats appears to be caused primarily by an inhibition of FAS transcription. The control of transcription by polyunsaturated fats appears not to be mediated by cAMP because the transcription rate for phosphoenolpyruvate carboxykinase (whose gene is very sensitive to cAMP stimulation) was unaffected by the source of dietary fat.

  9. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    PubMed Central

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi. PMID:24036343

  10. A Single Arabidopsis Gene Encodes Two Differentially Targeted Geranylgeranyl Diphosphate Synthase Isoforms1[OPEN

    PubMed Central

    Schipper, Bert; Beekwilder, Jules

    2016-01-01

    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis thaliana), five genes appear to encode GGPPS isoforms localized in plastids (two), the endoplasmic reticulum (two), and mitochondria (one). However, the loss of function of the plastid-targeted GGPPS11 isoform (referred to as G11) is sufficient to cause lethality. Here, we show that the absence of a strong transcription initiation site in the G11 gene results in the production of transcripts of different lengths. The longer transcripts encode an isoform with a functional plastid import sequence that produces GGPP for the major groups of photosynthesis-related plastidial isoprenoids. However, shorter transcripts are also produced that lack the first translation initiation codon and rely on a second in-frame ATG codon to produce an enzymatically active isoform lacking this N-terminal domain. This short enzyme localizes in the cytosol and is essential for embryo development. Our results confirm that the production of differentially targeted enzyme isoforms from the same gene is a central mechanism to control the biosynthesis of isoprenoid precursors in different plant cell compartments. PMID:27707890

  11. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  12. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    PubMed Central

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-01-01

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos. PMID:25474088

  13. Molecular cloning, structure, and chromosomal localization of the human inducible nitric oxide synthase gene.

    PubMed

    Chartrain, N A; Geller, D A; Koty, P P; Sitrin, N F; Nussler, A K; Hoffman, E P; Billiar, T R; Hutchinson, N I; Mudgett, J S

    1994-03-04

    Nitric oxide, a multifunctional effector molecule synthesized by nitric oxide synthase (NOS) from L-arginine, conveys signals for vasorelaxation, neurotransmission, and cytotoxicity. Three different NOS isoforms have been identified which fall into two distinct types, constitutive and inducible. The inducible NOS (iNOS) isoform is expressed in a variety of cell types and tissues in response to inflammatory agents and cytokines. The human iNOS (NOS2) gene was isolated on overlapping cosmid clones from a human genomic library using both the murine macrophage and the human hepatocyte iNOS cDNAs as probes. All isolated cosmids were part of a single genomic locus and no other genomic loci were identified or isolated. Analysis of this locus indicated that the human iNOS gene is approximately 37 kilobases in length and consists of 26 exons and 25 introns. Primer extension analysis of lipopolysaccharide and cytokine-stimulated human hepatocyte RNA mapped the transcriptional initiation site 30 base pairs downstream of a TATA sequence, and a 400-base pair 5'-flanking region was found to be structurally similar to the recently described murine iNOS promoter. Polymerase chain reaction analysis of a human/rodent genomic DNA somatic cell hybrid panel and fluorescent in situ hybridization indicated that the human iNOS gene is located on chromosome 17 at position 17cen-q11.2.

  14. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance.

    PubMed

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E

    2013-11-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  15. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    PubMed

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans(+5). The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans(+5) and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  16. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  17. Evidence that the multifunctional polypeptides of vertebrate and fungal fatty acid synthases have arisen by independent gene fusion events.

    PubMed

    McCarthy, A D; Goldring, J P; Hardie, D G

    1983-10-17

    The enoyl reductase (NADPH binding site) of rabbit mammary fatty acid synthase has been radioactively labelled using pyridoxal phosphate and sodium [3H]borohydride. Using this method we have been able to add this site to the four sites whose location has already been mapped within the multifunctional polypeptide chain of the protein. The results show that the enoyl reductase lies between the 3-oxoacylsynthase and the acyl carrier. This confirms that the active sites occur in a different order on the single multifunctional polypeptide of vertebrate fatty acid synthase and the two multifunctional polypeptides of fungal fatty acid synthase, and suggests that these two systems have arisen by independent gene fusion events.

  18. Cloning and characterization of the citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans.

    PubMed

    Park, B W; Han, K H; Lee, C Y; Lee, C H; Maeng, P J

    1997-04-30

    We isolated a citrate synthase gene (citA) from Aspergillus nidulans. By analysis of the protein coding region, citA was shown to encode a citrate synthase (CitA) of 52.2 kDa consisting of 474 amino acid residues that were interrupted by seven introns. Also, the precursor CitA protein was revealed to have an N-terminal mitochondrial targeting signal of 35 amino acid residues containing an R-3 cleavage motif, R(32)-C-Y decreases S(35), which supports the fact that citA encodes the mitochondrial form of citrate synthase of A. nidulans. Southern blot analysis showed that citA is present as a single copy in the genome.

  19. Association of methionine synthase gene polymorphisms with wool production and quality traits in Chinese Merino population.

    PubMed

    Rong, E G; Yang, H; Zhang, Z W; Wang, Z P; Yan, X H; Li, H; Wang, N

    2015-10-01

    Methionine synthase (MTR) plays a crucial role in maintaining homeostasis of intracellular methionine, folate, and homocysteine, and its activity correlates with DNA methylation in many mammalian tissues. Our previous genomewide association study identified that 1 SNP located in the gene was associated with several wool production and quality traits in Chinese Merino. To confirm the potential involvement of the gene in sheep wool production and quality traits, we performed sheep tissue expression profiling, SNP detection, and association analysis with sheep wool production and quality traits. The semiquantitative reverse transcription PCR analysis showed that the gene was differentially expressed in skin from Merino and Kazak sheep. The sequencing analysis identified a total of 13 SNP in the gene from Chinese Merino sheep. Comparison of the allele frequencies revealed that these 13 identified SNP were significantly different among the 6 tested Chinese Merino strains ( < 0.001). Linkage disequilibrium analysis showed that SNP 3 to 11 were strongly linked in a single haplotype block in the tested population. Association analysis showed that SNP 2 to 11 were significantly associated with the average wool fiber diameter and the fineness SD and that SNP 4 to 11 were significantly associated with the CV of fiber diameter trait ( < 0.05). Single nucleotide polymorphism 2 and SNP 5 to 12 were weakly associated with wool crimp. Similarly, the haplotypes derived from these 13 identified SNP were also significantly associated with the average wool fiber diameter, fineness SD, and the CV of fiber diameter ( < 0.05). Our results suggest that is a candidate gene for sheep wool production and quality traits, and the identified SNP might be used in sheep breeding.

  20. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (P<0.0001), whereas the frequency of a wild haplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients.

  1. The Evolutionary Fate of the Horizontally Transferred Agrobacterial Mikimopine Synthase Gene in the Genera Nicotiana and Linaria

    PubMed Central

    Talianova, Martina; Vyskot, Boris

    2014-01-01

    Few cases of spontaneously horizontally transferred bacterial genes into plant genomes have been described to date. The occurrence of horizontally transferred genes from the T-DNA of Agrobacterium rhizogenes into the plant genome has been reported in the genus Nicotiana and in the species Linaria vulgaris. Here we compare patterns of evolution in one of these genes (a gene encoding mikimopine synthase, mis) following three different events of horizontal gene transfer (HGT). As this gene plays an important role in Agrobacterium, and there are known cases showing that genes from pathogens can acquire plant protection function, we hypothesised that in at least some of the studied species we will find signs of selective pressures influencing mis sequence. The mikimopine synthase (mis) gene evolved in a different manner in the branch leading to Nicotiana tabacum and N. tomentosiformis, in the branch leading to N. glauca and in the genus Linaria. Our analyses of the genus Linaria suggest that the mis gene began to degenerate soon after the HGT. In contrast, in the case of N. glauca, the mis gene evolved under significant selective pressures. This suggests a possible role of mikimopine synthase in current N. glauca and its ancestor(s). In N. tabacum and N. tomentosiformis, the mis gene has a common frameshift mutation that disrupted its open reading frame. Interestingly, our results suggest that in spite of the frameshift, the mis gene could evolve under selective pressures. This sequence may still have some regulatory role at the RNA level as suggested by coverage of this sequence by small RNAs in N. tabacum. PMID:25420106

  2. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  3. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    PubMed Central

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  4. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  5. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe

    2012-01-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  6. Genome mining unearths a hybrid nonribosomal peptide synthetase-like-pteridine synthase biosynthetic gene cluster

    PubMed Central

    Park, Hyun Bong; Perez, Corey E; Barber, Karl W; Rinehart, Jesse; Crawford, Jason M

    2017-01-01

    Nonribosomal peptides represent a large class of metabolites with pharmaceutical relevance. Pteridines, such as pterins, folates, and flavins, are heterocyclic metabolites that often serve as redox-active cofactors. The biosynthetic machineries for construction of these distinct classes of small molecules operate independently in the cell. Here, we discovered an unprecedented nonribosomal peptide synthetase-like-pteridine synthase hybrid biosynthetic gene cluster in Photorhabdus luminescens using genome synteny analysis. P. luminescens is a Gammaproteobacterium that undergoes phenotypic variation and can have both pathogenic and mutualistic roles. Through extensive gene deletion, pathway-targeted molecular networking, quantitative proteomic analysis, and NMR, we show that the genetic locus affects the regulation of quorum sensing and secondary metabolic enzymes and encodes new pteridine metabolites functionalized with cis-amide acyl-side chains, termed pepteridine A (1) and B (2). The pepteridines are produced in the pathogenic phenotypic variant and represent the first reported metabolites to be synthesized by a hybrid NRPS-pteridine pathway. These studies expand our view of the combinatorial biosynthetic potential available in bacteria. DOI: http://dx.doi.org/10.7554/eLife.25229.001

  7. Spermine deficiency in Gy mice caused by deletion of the spermine synthase gene.

    PubMed

    Lorenz, B; Francis, F; Gempel, K; Böddrich, A; Josten, M; Schmahl, W; Schmidt, J; Lehrach, H; Meitinger, T; Strom, T M

    1998-03-01

    Two mouse mutations gyro (Gy) and hypophosphatemia (Hyp) are mouse models for X-linked hypophosphatemic rickets and have been shown to be deleted for the 5' and 3' end of the mouse homolog of PHEX (phosphate regulating gene with homologies to endopeptidases on the X chromosome; formerly called PEX), respectively. In addition to the metabolic disorder observed in Hyp mice, male Gy mice are sterile and show circling behavior and reduced viability. The human SMS (spermine synthase) gene maps approximately 39 kb upstream of PHEX and is transcribed in the same direction. To elucidate the complex phenotype of Gy mice, we characterized the genomic region upstream of Phex. By establishing the genomic structure of mouse Sms, a 160-190 kb deletion was shown in Gy mice, which includes both Phex and Sms. There are several pseudogenes of SMS / Sms in man and mouse. Northern analysis revealed three different Sms transcripts which are absent in Gy mice. Measurement of polyamine levels revealed a marked decrease in spermine in liver and pancreas of affected male Gy mice. Analysis of brain tissue revealed no gross or histological abnormalities. Gy provides a mouse model for a defect in the polyamine pathway, which is known to play a key role in cell proliferation.

  8. Endothelial Nitric Oxide Synthase Gene Single Nucleotide Polymorphism Predicts Cerebral Vasospasm following Aneurysmal Subarachnoid Hemorrhage

    PubMed Central

    Starke, Robert M.; Kim, Grace H.; Komotar, Ricardo J.; Hickman, Zachary L.; Black, Eric M.; Rosales, Maritza B.; Kellner, Christopher P.; Hahn, David K.; Otten, Marc L.; Edwards, John; Wang, Tao; Russo, James J.; Mayer, Stephan A.; Connolly, E. Sander

    2009-01-01

    Summary Vasospasm is a major cause of morbidity and mortality following aneurysmal subarachnoid hemorrhage (aSAH). Studies have demonstrated a link between single nucleotide polymorphisms (SNP) in the endothelial nitric oxide synthase (eNOS) gene and the incidence of coronary spasm and aneurysms. Alterations in the eNOS T-786 SNP may lead to an increased risk of post-aSAH cerebral vasospasm. In this prospective clinical study, 77 aSAH patients provided genetic material and were followed for the occurrence of vasospasm. In multivariate logistic regression analysis, genotype was the only factor predictive of vasospasm. The odds ratio for symptomatic vasospasm in patients with one T allele was 3.3 (95% CI 1.1–10.0, p=0.034) and 10.9 for TT. Patients with angiographic spasm were 3.6 times more likely to have a T allele (95% CI 1.3–9.6, p=0.013, TT OR 12.6). Patients with severe vasospasm requiring endovascular therapy were more likely to have a T allele (OR 3.5, 95% CI 1.3–9.5, p=0.016, TT OR 12.0). Patients with the T allele of the eNOS gene are more likely have severe vasospasm. Presence of this genotype may allow the identification of individuals at high risk for post-aSAH vasospasm and lead to early treatment and improved outcome. PMID:18319732

  9. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma.

    PubMed

    González, Raúl; De la Rosa, Ángel J; Romero-Brufau, Santiago; Barrera-Pulido, Lydia; Gallardo-Chamizo, Francisco; Pereira, Sheila; Marín, Luís M; Álamo, José M; Rodríguez-Hernández, Ángeles; Padillo, Francisco J; Muntané, Jordi

    2015-08-01

    Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO) synthase type III (NOS-3) overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP) and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP) and Rous Sarcoma Virus (RSV) promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  10. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  11. Cis-regulatory analysis of the sea urchin pigment cell gene polyketide synthase.

    PubMed

    Calestani, Cristina; Rogers, David J

    2010-04-15

    The Strongylocentrotus purpuratus polyketide synthase gene (SpPks) encodes an enzyme required for the biosynthesis of the larval pigment echinochrome. SpPks is expressed exclusively in pigment cells and their precursors starting at blastula stage. The 7th-9th cleavage Delta-Notch signaling, required for pigment cell development, positively regulates SpPks. In previous studies, the transcription factors glial cell missing (SpGcm), SpGatae and kruppel-like (SpKrl/z13) have been shown to positively regulate SpPks. To uncover the structure of the Gene Regulatory Network (GRN) regulating the specification and differentiation processes of pigment cells, we experimentally analyzed the putative SpPks cis-regulatory region. We established that the -1.5kb region is sufficient to recapitulate the correct spatial and temporal expression of SpPks. Predicted DNA-binding sites for SpGcm, SpGataE and SpKrl are located within this region. The mutagenesis of these DNA-binding sites indicated that SpGcm, SpGataE and SpKrl are direct positive regulators of SpPks. These results demonstrate that the sea urchin GRN for pigment cell development is quite shallow, which is typical of type I embryo development.

  12. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  13. Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae

    PubMed Central

    Li, Jing; Lee, Eun-Jeong; Chang, Limei; Facchini, Peter J.

    2016-01-01

    Norcoclaurine synthase (NCS) catalyzes the enantioselective Pictet-Spengler condensation of dopamine and 4-hydroxyphenylacetaldehyde as the first step in benzylisoquinoline alkaloid (BIA) biosynthesis. NCS orthologs in available transcriptome databases were screened for variants that might improve the low yield of BIAs in engineered microorganisms. Databases for 21 BIA-producing species from four plant families yielded 33 assembled contigs with homology to characterized NCS genes. Predicted translation products generated from nine contigs consisted of two to five sequential repeats, each containing most of the sequence found in single-domain enzymes. Assembled contigs containing tandem domain repeats were detected only in members of the Papaveraceae family, including opium poppy (Papaver somniferum). Fourteen cDNAs were generated from 10 species, five of which encoded NCS orthologs with repeated domains. Functional analysis of corresponding recombinant proteins yielded six active NCS enzymes, including four containing either two, three or four repeated catalytic domains. Truncation of the first 25 N-terminal amino acids from the remaining polypeptides revealed two additional enzymes. Multiple catalytic domains correlated with a proportional increase in catalytic efficiency. Expression of NCS genes in Saccharomyces cereviseae also produced active enzymes. The metabolic conversion capacity of engineered yeast positively correlated with the number of repeated domains. PMID:27991536

  14. An Evolutionary Analysis of Lateral Gene Transfer in Thymidylate Synthase Enzymes

    PubMed Central

    Stern, Adi; Mayrose, Itay; Penn, Osnat; Shaul, Shaul; Gophna, Uri; Pupko, Tal

    2010-01-01

    Thymidylate synthases (Thy) are key enzymes in the synthesis of deoxythymidylate, 1 of the 4 building blocks of DNA. As such, they are essential for all DNA-based forms of life and therefore implicated in the hypothesized transition from RNA genomes to DNA genomes. Two evolutionally unrelated Thy enzymes, ThyA and ThyX, are known to catalyze the same biochemical reaction. Both enzymes are sporadically distributed within each of the 3 domains of life in a pattern that suggests multiple nonhomologous lateral gene transfer (LGT) events. We present a phylogenetic analysis of the evolution of the 2 enzymes, aimed at unraveling their entangled evolutionary history and tracing their origin back to early life. A novel probabilistic evolutionary model was developed, which allowed us to compute the posterior probabilities and the posterior expectation of the number of LGT events. Simulation studies were performed to validate the model's ability to accurately detect LGT events, which have occurred throughout a large phylogeny. Applying the model to the Thy data revealed widespread nonhomologous LGT between and within all 3 domains of life. By reconstructing the ThyA and ThyX gene trees, the most likely donor of each LGT event was inferred. The role of viruses in LGT of Thy is finally discussed. PMID:20525631

  15. Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae.

    PubMed

    Li, Jing; Lee, Eun-Jeong; Chang, Limei; Facchini, Peter J

    2016-12-19

    Norcoclaurine synthase (NCS) catalyzes the enantioselective Pictet-Spengler condensation of dopamine and 4-hydroxyphenylacetaldehyde as the first step in benzylisoquinoline alkaloid (BIA) biosynthesis. NCS orthologs in available transcriptome databases were screened for variants that might improve the low yield of BIAs in engineered microorganisms. Databases for 21 BIA-producing species from four plant families yielded 33 assembled contigs with homology to characterized NCS genes. Predicted translation products generated from nine contigs consisted of two to five sequential repeats, each containing most of the sequence found in single-domain enzymes. Assembled contigs containing tandem domain repeats were detected only in members of the Papaveraceae family, including opium poppy (Papaver somniferum). Fourteen cDNAs were generated from 10 species, five of which encoded NCS orthologs with repeated domains. Functional analysis of corresponding recombinant proteins yielded six active NCS enzymes, including four containing either two, three or four repeated catalytic domains. Truncation of the first 25 N-terminal amino acids from the remaining polypeptides revealed two additional enzymes. Multiple catalytic domains correlated with a proportional increase in catalytic efficiency. Expression of NCS genes in Saccharomyces cereviseae also produced active enzymes. The metabolic conversion capacity of engineered yeast positively correlated with the number of repeated domains.

  16. Amelioration of osteoarthritis by intra-articular hyaluronan synthase 2 gene therapy.

    PubMed

    Zhang, Da-Wei; Yang, Quan-Sheng; Zhu, Jin-Yu; Cao, Xiao-Rui; Li, Li-Wen; Zhu, Qing-Sheng

    2007-01-01

    Osteoarthritis (OA) is a chronic, degenerative disorder of multifactorial aetiology, characterized by loss of articular cartilage and periarticular bone remodelling. Goals of managing OA include controlling pain, maintaining and improving function and health-related quality of life, and limiting functional impairment. Although several managements had been proved to ameliorate the symptoms of osteoarthritis, no methods could cure it thoroughly. High-molecular-weight hyaluronan (HMW-HA) is a major component of synovial joint fluids which physically acts as a viscous lubricant for slow joint movements and as an elastic shock absorber during rapid movements. It also has a variety of biologic effects in vivo, such as inhibiting the release of inflammatory factors and suppressing the degradation of cartilage matrix. Intra-articular injection of synthetic HMW-HA has been used as viscosupplement for knee OA and its therapeutic efficacy has been verified. However, repeated injections of HMW-HA which is needed to control symptoms increase the probability of infection and sometimes there will have acute joint pain with effusion, which requires aspiration to exclude sepsis. In order to overcome the disadvantages of repeated injections of HMW-HA, novel strategies should be developed. As HMW-HA is synthesized by hyaluronan synthase-2 (HAS2), we postulate that HAS2 gene could be delivered into intra-articular cells by methods of gene therapy to achieve long-lasting synthesis of HMW-HA. In our opinion, this strategy seems to hold interesting future prospects for the treatment of OA.

  17. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.

  18. Cloning and Characterization of the Autoinducer Synthase Gene from Lipid-Degrading Bacterium Cedecea neteri

    PubMed Central

    Tan, Kian-Hin; How, Kah-Yan; Tan, Jia-Yi; Yin, Wai-Fong; Chan, Kok-Gan

    2017-01-01

    The process of intercellular communication among bacteria, termed quorum sensing (QS), is mediated by small diffusible molecules known as the autoinducers. QS allows the population to react to the change of cell density in unison, in processes such as biofilm formation, plasmid conjugation, virulence, motility and root nodulation. In Gram-negative proteobacteria, N-acyl homoserine lactone (AHL) is the common “language” to coordinate gene expression. This signaling molecule is usually synthesized by LuxI-type proteins. We have previously discovered that a rare bacterium, Cedecea neteri, exhibits AHL-type QS activity. With information generated from genome sequencing, we have identified the luxIR gene pair responsible for AHL-type QS and named it cneIR. In this study, we have cloned and expressed the 636 bp luxI homolog in an Escherichia coli host for further characterization. Our findings show that E. coli harboring cneI produced the same AHL profile as the wild type C. neteri, with the synthesis of AHL known as N-butyryl-homoserine lactone. This 25 kDa LuxI homolog shares high similarity with other AHL synthases from closely related species. This work is the first documentation of molecular cloning and characterization of luxI homolog from C. neteri. PMID:28197135

  19. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-10-15

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS.

  20. A Novel Transcriptional Regulator Related to Thiamine Phosphate Synthase Controls Thiamine Metabolism Genes in Archaea.

    PubMed

    Rodionov, Dmitry A; Leyn, Semen A; Li, Xiaoqing; Rodionova, Irina A

    2017-02-15

    Thiamine (vitamin B1) is a precursor of thiamine pyrophosphate (TPP), an essential coenzyme in the central metabolism of all living organisms. Bacterial thiamine biosynthesis and salvage genes are controlled at the RNA level by TPP-responsive riboswitches. In Archaea, TPP riboswitches are restricted to the Thermoplasmatales order. Mechanisms of transcriptional control of thiamine genes in other archaeal lineages remain unknown. Using the comparative genomics approach, we identified a novel family of transcriptional regulators (named ThiR) controlling thiamine biosynthesis and transport genes in diverse lineages in the Crenarchaeota phylum as well as in the Halobacteria and Thermococci classes of the Euryarchaeota ThiR regulators are composed of an N-terminal DNA-binding domain and a C-terminal ligand-binding domain, which is similar to the archaeal thiamine phosphate synthase ThiN. By using comparative genomics, we predicted ThiR-binding DNA motifs and reconstructed ThiR regulons in 67 genomes representing all above-mentioned lineages. The predicted ThiR-binding motifs are characterized by palindromic symmetry with several distinct lineage-specific consensus sequences. In addition to thiamine biosynthesis genes, the reconstructed ThiR regulons include various transporters for thiamine and its precursors. Bioinformatics predictions were experimentally validated by in vitro DNA-binding assays with the recombinant ThiR protein from the hyperthermophilic archaeon Metallosphaera yellowstonensis MK1. Thiamine phosphate and, to some extent, TPP and hydroxyethylthiazole phosphate were required for the binding of ThiR to its DNA targets, suggesting that ThiR is derepressed by limitation of thiamine phosphates. The thiamine phosphate-binding residues previously identified in ThiN are highly conserved in ThiR regulators, suggesting a conserved mechanism for effector recognition.

  1. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata.

  2. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  3. In vitro isolation, elicitation of psoralen in callus cultures of Psoralea corylifolia and cloning of psoralen synthase gene.

    PubMed

    Parast, Behrooz M; Chetri, Siva K; Sharma, Kuldeep; Agrawal, Veena

    2011-10-01

    Psoralen, an important furanocoumarin occurring abundantly in seeds of Psoralea corylifolia is used as an anticancerous compound against leukemia and other cancer cell lines. Evaluation and isolation of psoralen from the calluses derived from different plant parts, viz. cotyledons, nodes, leaves and roots have been done in the present case for the first time. Amongst all, a maximum of 1934.75 μg/g f.w. of psoralen was recorded in callus derived from cotyledons, followed by 1875.50 and 1465.75 μg/g f.w. of psoralen in node and leaf derived calluses, respectively. Amount of psoralen enhanced further when cotyledonary calluses were exposed to different concentrations of organic elicitors (yeast extract, proline, inositol, casein hydrolyzate (CH), glycine, glutamine and sucrose) and precursors of psoralen (umbelliferone, cinnamic acid and NADPH). Isolation of psoralen was done using methanol as solvent through column chromatography and TLC. FT-IR and NMR further characterized and confirmed the structure of psoralen. In addition, the putative gene, psoralen synthase involved in psoralen synthesis pathway has been isolated, cloned and sequenced which comprised 1237 bp length. BLAST analysis of the gene sequence of psoralen synthase revealed that its nucleotide sequence showed 93% homology with psoralen synthase isolated from Ammi majus. This is the first report of isolation, cloning and characterization of psoralen synthase from Psoralea corylifolia.

  4. Recombination and horizontal transfer of nodulation and ACC deaminase (acdS) genes within Alpha- and Betaproteobacteria nodulating legumes of the Cape Fynbos biome.

    PubMed

    Lemaire, Benny; Van Cauwenberghe, Jannick; Chimphango, Samson; Stirton, Charles; Honnay, Olivier; Smets, Erik; Muasya, A Muthama

    2015-11-01

    The goal of this work is to study the evolution and the degree of horizontal gene transfer (HGT) within rhizobial genera of both Alphaproteobacteria (Mesorhizobium, Rhizobium) and Betaproteobacteria (Burkholderia), originating from South African Fynbos legumes. By using a phylogenetic approach and comparing multiple chromosomal and symbiosis genes, we revealed conclusive evidence of high degrees of horizontal transfer of nodulation genes among closely related species of both groups of rhizobia, but also among species with distant genetic backgrounds (Rhizobium and Mesorhizobium), underscoring the importance of lateral transfer of symbiosis traits as an important evolutionary force among rhizobia of the Cape Fynbos biome. The extensive exchange of symbiosis genes in the Fynbos is in contrast with a lack of significant events of HGT among Burkholderia symbionts from the South American Cerrado and Caatinga biome. Furthermore, homologous recombination among selected housekeeping genes had a substantial impact on sequence evolution within Burkholderia and Mesorhizobium. Finally, phylogenetic analyses of the non-symbiosis acdS gene in Mesorhizobium, a gene often located on symbiosis islands, revealed distinct relationships compared to the chromosomal and symbiosis genes, suggesting a different evolutionary history and independent events of gene transfer. The observed events of HGT and incongruence between different genes necessitate caution in interpreting topologies from individual data types.

  5. Evaluating Performance Portability of OpenACC

    SciTech Connect

    Sabne, Amit J; Sakdhnagool, Putt; Lee, Seyong; Vetter, Jeffrey S

    2015-01-01

    Accelerator-based heterogeneous computing is gaining momentum in High Performance Computing arena. However, the increased complexity of the accelerator architectures demands more generic, high-level programming models. OpenACC is one such attempt to tackle the problem. While the abstraction endowed by OpenACC offers productivity, it raises questions on its portability. This paper evaluates the performance portability obtained by OpenACC on twelve OpenACC programs on NVIDIA CUDA, AMD GCN, and Intel MIC architectures. We study the effects of various compiler optimizations and OpenACC program settings on these architectures to provide insights into the achieved performance portability.

  6. Alternative splicing and gene duplication differentially shaped the regulation of isochorismate synthase in Populus and Arabidopsis

    PubMed Central

    Yuan, Yinan; Chung, Jeng-Der; Fu, Xueyan; Johnson, Virgil E.; Ranjan, Priya; Booth, Sarah L.; Harding, Scott A.; Tsai, Chung-Jui

    2009-01-01

    Isochorismate synthase (ICS) converts chorismate to isochorismate for the biosynthesis of phylloquinone, an essential cofactor for photosynthetic electron transport. ICS is also required for salicylic acid (SA) synthesis during Arabidopsis defense. In several other species, including Populus, SA is derived primarily from the phenylpropanoid pathway. We therefore sought to investigate ICS regulation in Populus to learn the extent of ICS involvement in SA synthesis and defense. Arabidopsis harbors duplicated AtICS genes that differ in their exon-intron structure, basal expression, and stress inducibility. In contrast, we found a single ICS gene in Populus and six other sequenced plant genomes, pointing to the AtICS duplication as a lineage-specific event. The Populus ICS encodes a functional plastidic enzyme, and was not responsive to stresses that stimulated phenylpropanoid accumulation. Populus ICS underwent extensive alternative splicing that was rare for the duplicated AtICSs. Sequencing of 184 RT-PCR Populus clones revealed 37 alternative splice variants, with normal transcripts representing ≈50% of the population. When expressed in Arabidopsis, Populus ICS again underwent alternative splicing, but did not produce normal transcripts to complement AtICS1 function. The splice-site sequences of Populus ICS are unusual, suggesting a causal link between junction sequence, alternative splicing, and ICS function. We propose that gene duplication and alternative splicing of ICS evolved independently in Arabidopsis and Populus in accordance with their distinct defense strategies. AtICS1 represents a divergent isoform for inducible SA synthesis during defense. Populus ICS primarily functions in phylloquinone biosynthesis, a process that can be sustained at low ICS transcript levels. PMID:19996170

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase.

    PubMed

    Tan, Fui-Ching; Cheng, Qi; Saha, Kaushik; Heinemann, Ilka U; Jahn, Martina; Jahn, Dieter; Smith, Alison G

    2008-03-01

    UROS (uroporphyrinogen III synthase; EC 4.2.1.75) is the enzyme responsible for the formation of uroporphyrinogen III, the precursor of all cellular tetrapyrroles including haem, chlorophyll and bilins. Although UROS genes have been cloned from many organisms, the level of sequence conservation between them is low, making sequence similarity searches difficult. As an alternative approach to identify the UROS gene from plants, we used functional complementation, since this does not require conservation of primary sequence. A mutant of Saccharomyces cerevisiae was constructed in which the HEM4 gene encoding UROS was deleted. This mutant was transformed with an Arabidopsis thaliana cDNA library in a yeast expression vector and two colonies were obtained that could grow in the absence of haem. The rescuing plasmids encoded an ORF (open reading frame) of 321 amino acids which, when subcloned into an Escherichia coli expression vector, was able to complement an E. coli hemD mutant defective in UROS. Final proof that the ORF encoded UROS came from the fact that the recombinant protein expressed with an N-terminal histidine-tag was found to have UROS activity. Comparison of the sequence of AtUROS (A. thaliana UROS) with the human enzyme found that the seven invariant residues previously identified were conserved, including three shown to be important for enzyme activity. Furthermore, a structure-based homology search of the protein database with AtUROS identified the human crystal structure. AtUROS has an N-terminal extension compared with orthologues from other organisms, suggesting that this might act as a targeting sequence. The precursor protein of 34 kDa translated in vitro was imported into isolated chloroplasts and processed to the mature size of 29 kDa. Confocal microscopy of plant cells transiently expressing a fusion protein of AtUROS with GFP (green fluorescent protein) confirmed that AtUROS was targeted exclusively to chloroplasts in vivo.

  9. Analysis of methionine synthase (rs1805087) gene polymorphism in autism patients in Northern Iran.

    PubMed

    Haghiri, Rosa; Mashayekhi, Farhad; Bidabadi, Elham; Salehi, Zivar

    2016-01-01

    Autism is characterized by impairment in reciprocal communication and speech, repetitive behaviors, and social communication. The genetic and environmental factors play roles in the pathogenesis of autism. It was recently shown that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. One of the genes that may be the risk factor for autism is Methionine synthase (MTR). MTR is responsible for the regeneration of methionine from homocysteine. The aim of this study was to analyze the association of MTR A2756G gene polymorphism (rs1805087) and the risk of autism in a population in northern Iran. The prevalence of MTR A2756G polymorphism was determined in 108 children with autism and 130 controls in northern Iran. Genotypes and allele frequencies were determined in patients and controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The prevalence of genotype frequencies of AA, AG and GG in autistic children were 57.41%, 22.22% and 20.37%, respectively, while in controls were 61.54%, 32.31% and 6.15%, respectively. There was significant difference between the MTR polymorphism distribution in control and patient groups. The prevalence of allele frequencies of A and G in autistic children were 0.69 and 0.31, respectively and in controls were 0.78 and 0.22, respectively (P=0.03). The MTR G allele conferred a 1.6-fold increased risk to autism relative to the A allele (95% CI=1.06-2.41, P=0.02). The present study suggests that the G allele of MTR A2756G polymorphism is associated with an increased risk of autism.

  10. Effects of feeding transgenic corn with mCry1Ac or maroACC gene to laying hens for 12 weeks on growth, egg quality and organ health.

    PubMed

    Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F

    2016-08-01

    The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar

  11. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    PubMed

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  12. Methionine synthase: high-resolution mapping of the human gene and evaluation as a candidate locus for neural tube defects.

    PubMed

    Brody, L C; Baker, P J; Chines, P S; Musick, A; Molloy, A M; Swanson, D A; Kirke, P N; Ghosh, S; Scott, J M; Mills, J L

    1999-08-01

    Periconceptual folate supplementation has been found to prevent the occurrence of many neural tube defects (NTDs). Consequently, genetic variation in folate metabolism genes is expected to contribute to the risk for neural tube defects. Methionine synthase catalyzes the vitamin B(12)-dependent conversion of homocysteine and 5-methyltetrahydrofolate to methionine and tetrahydrofolate. The observation that homocysteine and vitamin B(12) levels are independent predictors of NTD risk suggested that methionine synthase could be a candidate gene for NTDs. To assess the role of the MS gene in NTDs, we performed high-resolution physical mapping of the MS locus, isolated highly polymorphic markers linked to the MS gene, and tested for an association between specific MS alleles and NTDs. We mapped the MS gene to a position between 909 and 913 cR(10000) on chromosome 1 by radiation hybrid mapping. Polymorphic markers D1S1567 and D1S1568 map to locations no more than 900 and 194 kb from the MS gene, respectively. The segregation of these polymorphic markers was measured in 85 Irish NTD families. No allele of either marker showed a significant association with NTDs using the transmission disequilibrium test. A lack of association was also observed for the D1919G missense mutation within the gene. Our results suggest that inherited variation in the MS gene does not contribute to NTD risk in this population.

  13. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  14. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    PubMed Central

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T

    1994-01-01

    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  15. Development of an analysis program of type I polyketide synthase gene clusters using homology search and profile hidden Markov model.

    PubMed

    Tae, Hongseok; Sohng, Jae Kyung; Park, Kiejung

    2009-02-01

    MAPSI (Management and Analysis for Polyketide Synthase Type I) has been developed to offer computational analysis methods to detect type I PKS (polyketide synthase) gene clusters in genome sequences. MAPSI provides a genome analysis component, which detects PKS gene clusters by identifying domains in proteins of a genome. MAPSI also contains databases on polyketides and genome annotation data, as well as analytic components such as new PKS assembly and domain analysis. The polyketide data and analysis component are accessible through Web interfaces and are displayed with diverse information. MAPSI, which was developed to aid researchers studying type I polyketides, provides diverse components to access and analyze polyketide information and should become a very powerful computational tool for polyketide research. The system can be extended through further studies of factors related to the biological activities of polyketides.

  16. Enhanced citric acid biosynthesis in Pseudomonas fluorescens ATCC 13525 by overexpression of the Escherichia coli citrate synthase gene.

    PubMed

    Buch, Aditi D; Archana, G; Kumar, G Naresh

    2009-08-01

    Citric acid secretion by fluorescent pseudomonads has a distinct significance in microbial phosphate solubilization. The role of citrate synthase in citric acid biosynthesis and glucose catabolism in pseudomonads was investigated by overexpressing the Escherichia coli citrate synthase (gltA) gene in Pseudomonas fluorescens ATCC 13525. The resultant approximately 2-fold increase in citrate synthase activity in the gltA-overexpressing strain Pf(pAB7) enhanced the intracellular and extracellular citric acid yields during the stationary phase, by about 2- and 26-fold, respectively, as compared to the control, without affecting the growth rate, glucose depletion rate or biomass yield. Decreased glucose consumption was paralleled by increased gluconic acid production due to an increase in glucose dehydrogenase activity. While the extracellular acetic acid yield increased in Pf(pAB7), pyruvic acid secretion decreased, correlating with an increase in pyruvate carboxylase activity and suggesting an increased demand for the anabolic precursor oxaloacetate. Activities of two other key enzymes, glucose-6-phosphate dehydrogenase and isocitrate dehydrogenase, remained unaltered, and the contribution of phosphoenolpyruvate carboxylase and isocitrate lyase to glucose catabolism was negligible. Strain Pf(pAB7) demonstrated an enhanced phosphate-solubilizing ability compared to the control. Co-expression of the Synechococcus elongatus PCC 6301 phosphoenolpyruvate carboxylase and E. coli gltA genes in P. fluorescens ATCC 13525, so as to supplement oxaloacetate for citrate biosynthesis, neither significantly affected citrate biosynthesis nor caused any change in the other physiological and biochemical parameters measured, despite approximately 1.3- and 5-fold increases in citrate synthase and phosphoenolpyruvate carboxylase activities, respectively. Thus, our results demonstrate that citrate synthase is rate-limiting in enhancing citrate biosynthesis in P. fluorescens ATCC 13525

  17. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families.

    PubMed Central

    Suchi, M; Mizuno, H; Kawai, Y; Tsuboi, T; Sumi, S; Okajima, K; Hodgson, M E; Ogawa, H; Wada, Y

    1997-01-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5'-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a lambdaEMBL-3 human genomic library and report a single-copy gene spanning approximately 15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5' flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A-to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A (v = .26) and 440Gpoly (v = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. Images Figure 1 Figure 4 Figure 5 PMID:9042911

  18. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    PubMed

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins.

  19. Transformation of apple ( Malus domestica Borkh.) with the stilbene synthase gene from grapevine ( Vitis vinifera L.) and a PGIP gene from kiwi ( Actinidia deliciosa).

    PubMed

    Szankowski, I; Briviba, K; Fleschhut, J; Schönherr, J; Jacobsen, H-J; Kiesecker, H

    2003-09-01

    The objective of the present research was to introduce genes with antifungal potential into the commercially important apple cvs. Elstar and Holsteiner Cox in order to establish resistance against fungal diseases. The gene encoding the stilbene synthase (Vst1) from Vitis vinifera L., responsible for the synthesis of the phytoalexin resveratrol in grapevine, and the gene for a polygalacturonase-inhibiting protein (PGIP) from kiwi ( Actinidia deliciosa) were transferred into Holsteiner Cox and Elstar via Agrobacterium tumefaciens-mediated transformation. A total of nine transgenic Holsteiner Cox clones and one transgenic E clone carrying the stilbene-synthase gene as well as three transgenic Holsteiner Cox lines harbouring the polygalacturonase-inhibiting protein from Kiwi were identified via polymerase chain reaction and Southern blot analysis. High performance liquid chromatography analysis revealed the accumulation of a resveratrol-derivate, a glycoside, in transgenic Vst1 plants.

  20. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  1. A CELLULOSE SYNTHASE (CESA) gene essential for gametophore morphogenesis in the moss Physcomitrella patens.

    PubMed

    Goss, Chessa A; Brockmann, Derek J; Bushoven, John T; Roberts, Alison W

    2012-06-01

    In seed plants, different groups of orthologous genes encode the CELLULOSE SYNTHASE (CESA) proteins that are responsible for cellulose biosynthesis in primary and secondary cell walls. The seven CESA sequences of the moss Physcomitrella patens (Hedw.) B. S. G. form a monophyletic sister group to seed plant CESAs, consistent with independent CESA diversification and specialization in moss and seed plant lines. The role of PpCESA5 in the development of P. patens was investigated by targeted mutagenesis. The cesa5 knockout lines were tested for cellulose deficiency using carbohydrate-binding module affinity cytochemistry and the morphology of the leafy gametophores was analyzed by 3D reconstruction of confocal images. No defects were identified in the development of the filamentous protonema or in production of bud initials that normally give rise to the leafy gametophores. However, the gametophore buds were cellulose deficient and defects in subsequent cell expansion, cytokinesis, and leaf initiation resulted in the formation of irregular cell clumps instead of leafy shoots. Analysis of the cesa5 knockout phenotype indicates that a biophysical model of organogenesis can be extended to the moss gametophore shoot apical meristem.

  2. Endothelial nitric oxide synthase gene polymorphism and elite endurance athlete status: the Genathlete study.

    PubMed

    Wolfarth, B; Rankinen, T; Mühlbauer, S; Ducke, M; Rauramaa, R; Boulay, M R; Pérusse, L; Bouchard, C

    2008-08-01

    In the Genathlete study, we examined the contribution of three polymorphisms in the endothelial nitric oxide synthase (NOS3) gene to discriminate elite endurance athletes (EEA) from sedentary controls (SC). The EEA group included a total of 316 Caucasian males with a VO2max >75 mL/kg. The SC group comprised 299 unrelated sedentary Caucasian males who had VO2max values below 50 mL/kg. The polymerase chain reaction technique was used to amplify a microsatellite (CA)(n) repeat in intron 13, a 27 bp repeat in intron 4 and a third fragment in exon 7 containing the Glu298Asp SNP. No difference was found between the EEA and SC groups for the 27 bp repeat and the Glu298Asp polymorphism. Chi-square analysis of the overall allelic distribution of the (CA)(n) repeat revealed no significant difference between the two groups (P=0.135). However, comparing carriers and non-carriers for the most common (CA)(n) repeat alleles, we found significant differences between SC and EEA, with more EEA subjects carrying the 164 bp allele (P=0.007). In summary, we found suggestive evidence that the 164 bp allele of the (CA)(n) repeat in intron 13 is associated with EEA status and may account for some of the differences between EEA and SC.

  3. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    PubMed

    Jiang, Ling; Lin, Ming; Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+) and Hg(2+). Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m ) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  4. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  5. Isomaltulose synthase from Klebsiella sp. strain LX3: gene cloning and characterization and engineering of thermostability.

    PubMed

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-06-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an alpha-amylase domain and (beta/alpha)(8)-barrel structures, suggesting that it belongs to the alpha-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in alpha-amylases and glucosyltransferases (Asp(241), Glu(295), Asp(369), His(145), and His(368)) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 +/- 1.7 mM for sucrose, and maximum activity (approximately 328.0 +/- 2.5 U/mg) at pH 6.0 and 35 degrees C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50 degrees C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu(498) and Arg(310) with proline resulted in an 11-fold increase in the half-life of PalI at 50 degrees C.

  6. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment.

  7. Expression of Monoamine Transporters, Nitric Oxide Synthase 3, and Neurotrophin Genes in Antidepressant-Stimulated Astrocytes

    PubMed Central

    Kittel-Schneider, Sarah; Kenis, Gunter; Schek, Julia; van den Hove, Daniel; Prickaerts, Jos; Lesch, Klaus-Peter; Steinbusch, Harry; Reif, Andreas

    2012-01-01

    Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the RNA expression of brain-derived neurotrophic factor (Bdnf), serotonin transporter (5Htt), dopamine transporter (Dat), and endothelial nitric oxide synthase (Nos3) was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, led to a significant increase of the Bdnf RNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 RNA expression was detected in cultured astrocytes. Conclusion: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants. PMID:22529824

  8. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  9. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  10. [Cloning and bioinformatics analysis of ent-kaurene oxidase synthase gene in Salvia miltiorrhiza].

    PubMed

    Hu, Ya-ting; Gao, Wei; Liu, Yu-jia; Cheng, Qi-qing; Su, Ping; Liu, Yu-zhong; Chen, Min

    2014-11-01

    Based on the transcriptome database of Salvia miltiorrhiza, specific primers were designed to clone a full-length cDNA of ent-kaurene oxidase synthase (SmKOL) using the RACE strategy. ORF Finder was used to find the open reading frame of SmKOL cDNA, and ClustalW has been performed to analysis the multiple amino acid sequence alignment. Phylogenetic tree has been constructed using MEGA 5.1. The transcription level of SmKOL from the hairy roots induced by elicitor methyl jasmonate (MeJA) was qualifiedby real-time quantitative PCR. The full length of SmKOL cDNA was of 1 884 bp nucleotides encoding 519 amino acids. The molecular weight of the SmKOL protein was about 58.88 kDa with isoelectric point (pI) of 7.62. Results of real-time quantitative PCR analyses indicated that the level of SmKOL mRNA expression in hairy roots was increased by elicitor oMeJA, and reached maximum in 36 h. The full-length cDNA of SmKOL was cloned from S. miltiorrhiza hairy root, which provides a target gene for further studies of its function, gibberellin biosynthesis and regulation of secondary metabolites.

  11. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    PubMed

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  12. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  13. Cloning and Functional Analysis of a beta-amyrin synthase gene associated with oleanolic acid biosynthesis in Gentiana straminea MAXIM.

    PubMed

    Liu, Yanling; Cai, Yunfei; Zhao, Zhongjuan; Wang, Junfeng; Li, Jing; Xin, Wei; Xia, Guangmin; Xiang, Fengning

    2009-05-01

    Phytosterols and triterpenes are synthesized by oxidosqualene cyclases (OSCs) via the isoprenoid pathway. Here, GsAS1--a full-length beta-amyrin synthase cDNA isolated from Gentiana straminea MAXIM.--was characterized. Its open reading frame consists of 2268 bp, predicted to encode a 756 residue protein containing four QW and one Asp-Cys-Thr-Ala-Glu (DCTAE) motifs, which are both well conserved among known triterpene synthases. The deduced GsAS1 peptide sequence shares 76.2% homology with that of Panax ginseng beta-amyrin synthase. A phylogenetic analysis showed that GsAS1 is closely related to other plant OSCs, and particularly to the beta-amyrin synthases. When the GsAS1 sequence was heterologously expressed in Escherichia coli, an 88 kDa gene product was produced, and this reacted with the appropriate antibody. The sequence was also heterologously expressed in the Pichia pastoris yeast. GsAS1 is expressed in a tissue-specific manner, with its expression in the leaf being ca. 4.5-fold than that in the root, and nearly three-fold than that in the stem. GsAS1 expression was up-regulated by treatment with methyl jasmonate (MeJA) over a period from 6 h to 10 d post treatment. The accumulation oleanolic acid increased after induction by MeJA.

  14. Airborne Cloud Computing Environment (ACCE)

    NASA Technical Reports Server (NTRS)

    Hardman, Sean; Freeborn, Dana; Crichton, Dan; Law, Emily; Kay-Im, Liz

    2011-01-01

    Airborne Cloud Computing Environment (ACCE) is JPL's internal investment to improve the return on airborne missions. Improve development performance of the data system. Improve return on the captured science data. The investment is to develop a common science data system capability for airborne instruments that encompasses the end-to-end lifecycle covering planning, provisioning of data system capabilities, and support for scientific analysis in order to improve the quality, cost effectiveness, and capabilities to enable new scientific discovery and research in earth observation.

  15. Paradoxical performance of tryptophan synthase gene trp1 (+) in transformations of the basidiomycete Coprinopsis cinerea.

    PubMed

    Dörnte, Bastian; Kües, Ursula

    2016-10-01

    Several transformation strains of Coprinopsis cinerea carry the defective tryptophan synthase allele trp1-1,1-6 which can be complemented by introduction of the trp1 (+) wild-type gene. Regularly in C. cinerea, single-trp1 (+)-vector transformations yield about half the numbers of clones than cotransformations with a non-trp1 (+)-plasmid done in parallel. The effect is also observed with the orthologous Schizophyllum commune trpB (+) gene shown here to function as a selection marker in C. cinerea. Parts of single-trp1 (+) - or single-trpB (+) -vector transformants are apparently lost. This paradoxical phenomenon relates to de-regulation of aromatic amino acid biosynthesis pathways. Adding tryptophan precursors to protoplast regeneration agar or feeding with other aromatic amino acids increases loss of single-trp1 (+)-vector transformants and also sets off loss of clones in cotransformation with a non-trp1 (+)-plasmid. Feedback control by tryptophan and cross-pathway control by tyrosine and phenylalanine are both active in the process. We deduce from the observations that more cotransformants than single-vector transformants are obtained by in average less disturbance of the tryptophan biosynthesis pathway. DNA in C. cinerea transformation usually integrates into the genome at multiple ectopic places. Integration events for a single vector per nucleus should statistically be 2-fold higher in single-vector transformations than in cotransformations in which the two different molecules compete for the same potential integration sites. Integration of more trp1 (+) copies into the genome might more likely lead to sudden tryptophan overproduction with subsequent rigid shut-down of the pathway. Blocking ectopic DNA integration in a Δku70 mutant abolished the effect of doubling clone numbers in cotransformations due to preferred single trp1 (+) integration by homologous recombination at its native genomic site.

  16. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    PubMed

    Tai, Deqiang; Tian, Ji; Zhang, Jie; Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  17. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  18. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  19. Late-onset cutaneous porphyria in a patient heterozygous for a uroporphyrinogen III synthase gene mutation.

    PubMed

    Aguilera, P; Badenas, C; Whatley, S D; To-Figueras, J

    2016-12-01

    Deficiency of uroporphyrinogen III synthase (UROS) causes congenital erythropoietic porphyria (CEP). The disease, originating from the inheritance of mutations within the UROS gene, presents a recessive form of transmission. In a few patients, a late-onset CEP-like phenotype without UROS mutations appears to be associated with a myelodysplastic syndrome. We report a 60-year-old man with late-onset signs of cutaneous porphyria and accumulation in urine, plasma and faeces of type I porphyrin isomers characteristic of CEP. Analysis of DNA from peripheral leucocytes, skin and bone marrow aspirate showed that he was a heterozygous carrier of a Cys73Arg (c.217 T>C) mutation within UROS. Sequencing of cDNA from peripheral blood confirmed heterozygosity and expression of the normal allele. Measurement of UROS enzymatic activity in erythrocytes showed values ~70% of normal, indirectly indicating expression of the normal allele. Differently from other cases of late-onset uroporphyria, the patient did not present thrombocytopenia or any evidence of a myelodysplastic syndrome. Five years of clinical follow-up showed persistence of skin signs and increased excretion of porphyrins, independently of lifestyle factors or changes in medication regimes. We hypothesize acquired mosaicism (in the bone marrow) affecting the UROS gene. Thus, unstable cellular clones initiated overproduction of isomer I porphyrins leading to a CEP phenotype. This could be explained either by a clonal expansion of the porphyric (Cys73Arg) allele or by loss of function of the normal allele. Cellular turnover would facilitate release of uroporphyrins into circulation and subsequent skin lesions. This is the first case of a CEP heterozygous carrier presenting clinical manifestations.

  20. TALEN mediated targeted editing of GM2/GD2-synthase gene modulates anchorage independent growth by reducing anoikis resistance in mouse tumor cells.

    PubMed

    Mahata, Barun; Banerjee, Avisek; Kundu, Manjari; Bandyopadhyay, Uday; Biswas, Kaushik

    2015-03-12

    Complex ganglioside expression is highly deregulated in several tumors which is further dependent on specific ganglioside synthase genes. Here, we designed and constructed a pair of highly specific transcription-activator like effector endonuclease (TALENs) to disrupt a particular genomic locus of mouse GM2-synthase, a region conserved in coding sequence of all four transcript variants of mouse GM2-synthase. Our designed TALENs effectively work in different mouse cell lines and TALEN induced mutation rate is over 45%. Clonal selection strategy is undertaken to generate stable GM2-synthase knockout cell line. We have also demonstrated non-homologous end joining (NHEJ) mediated integration of neomycin cassette into the TALEN targeted GM2-synthase locus. Functionally, clonally selected GM2-synthase knockout clones show reduced anchorage-independent growth (AIG), reduction in tumor growth and higher cellular adhesion as compared to wild type Renca-v cells. Insight into the mechanism shows that, reduced AIG is due to loss in anoikis resistance, as both knockout clones show increased sensitivity to detachment induced apoptosis. Therefore, TALEN mediated precise genome editing at GM2-synthase locus not only helps us in understanding the function of GM2-synthase gene and complex gangliosides in tumorigenicity but also holds tremendous potential to use TALENs in translational cancer research and therapeutics.

  1. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles

    PubMed Central

    Toyomasu, Tomonobu; Usui, Masami; Sugawara, Chizu; Kanno, Yuri; Sakai, Arisa; Takahashi, Hirokazu; Nakazono, Mikio; Kuroda, Masaharu; Miyamoto, Koji; Morimoto, Yu; Mitsuhashi, Wataru; Okada, Kazunori; Yamaguchi, Shinjiro; Yamane, Hisakazu

    2015-01-01

    Gibberellins (GAs) are diterpenoid phytohormones that regulate various aspects of plant growth. Tetracyclic hydrocarbon ent-kaurene is a biosynthetic intermediate of GAs, and is converted from geranylgeranyl diphosphate, a common precursor of diterpenoids, via ent-copalyl diphosphate (ent-CDP) through successive cyclization reactions catalysed by two distinct diterpene synthases, ent-CDP synthase and ent-kaurene synthase. Rice (Oryza sativa L.) has two ent-CDP synthase genes, OsCPS1 and OsCPS2. It has been thought that OsCPS1 participates in GA biosynthesis, while OsCPS2 participates in the biosynthesis of phytoalexins, phytocassanes A–E, and oryzalexins A–F. It has been shown previously that loss-of-function OsCPS1 mutants display a severe dwarf phenotype caused by GA deficiency despite possessing another ent-CDP synthase gene, OsCPS2. Here, experiments were performed to account for the non-redundant biological function of OsCPS1 and OsCPS2. Quantitative reverse transcription–PCR (qRT–PCR) analysis showed that OsCPS2 transcript levels were drastically lower than those of OsCPS1 in the basal parts, including the meristem of the second-leaf sheaths of rice seedlings. qRT–PCR results using tissue samples prepared by laser microdissection suggested that OsCPS1 transcripts mainly localized in vascular bundle tissues, similar to Arabidopsis CPS, which is responsible for GA biosynthesis, whereas OsCPS2 transcripts mainly localized in epidermal cells that address environmental stressors such as pathogen attack. Furthermore, the OsCPS2 transgene under regulation of the OsCPS1 promoter complemented the dwarf phenotype of an OsCPS1 mutant, oscps1-1. The results indicate that transcripts of the two ent-CDP synthase genes differentially localize in rice plants according to their distinct biological roles, OsCPS1 for growth and OsCPS2 for defence. PMID:25336684

  2. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles.

    PubMed

    Toyomasu, Tomonobu; Usui, Masami; Sugawara, Chizu; Kanno, Yuri; Sakai, Arisa; Takahashi, Hirokazu; Nakazono, Mikio; Kuroda, Masaharu; Miyamoto, Koji; Morimoto, Yu; Mitsuhashi, Wataru; Okada, Kazunori; Yamaguchi, Shinjiro; Yamane, Hisakazu

    2015-01-01

    Gibberellins (GAs) are diterpenoid phytohormones that regulate various aspects of plant growth. Tetracyclic hydrocarbon ent-kaurene is a biosynthetic intermediate of GAs, and is converted from geranylgeranyl diphosphate, a common precursor of diterpenoids, via ent-copalyl diphosphate (ent-CDP) through successive cyclization reactions catalysed by two distinct diterpene synthases, ent-CDP synthase and ent-kaurene synthase. Rice (Oryza sativa L.) has two ent-CDP synthase genes, OsCPS1 and OsCPS2. It has been thought that OsCPS1 participates in GA biosynthesis, while OsCPS2 participates in the biosynthesis of phytoalexins, phytocassanes A-E, and oryzalexins A-F. It has been shown previously that loss-of-function OsCPS1 mutants display a severe dwarf phenotype caused by GA deficiency despite possessing another ent-CDP synthase gene, OsCPS2. Here, experiments were performed to account for the non-redundant biological function of OsCPS1 and OsCPS2. Quantitative reverse transcription-PCR (qRT-PCR) analysis showed that OsCPS2 transcript levels were drastically lower than those of OsCPS1 in the basal parts, including the meristem of the second-leaf sheaths of rice seedlings. qRT-PCR results using tissue samples prepared by laser microdissection suggested that OsCPS1 transcripts mainly localized in vascular bundle tissues, similar to Arabidopsis CPS, which is responsible for GA biosynthesis, whereas OsCPS2 transcripts mainly localized in epidermal cells that address environmental stressors such as pathogen attack. Furthermore, the OsCPS2 transgene under regulation of the OsCPS1 promoter complemented the dwarf phenotype of an OsCPS1 mutant, oscps1-1. The results indicate that transcripts of the two ent-CDP synthase genes differentially localize in rice plants according to their distinct biological roles, OsCPS1 for growth and OsCPS2 for defence.

  3. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  4. Circular RNA of the human sphingomyelin synthase 1 gene: Multiple splice variants, evolutionary conservatism and expression in different tissues

    PubMed Central

    Filippenkov, Ivan B; Sudarkina, Olga Yu; Limborska, Svetlana A; Dergunova, Lyudmila V

    2015-01-01

    The human sphingomyelin synthase 1 gene (SGMS1) encodes an essential enzyme that is involved in the synthesis of sphingomyelin and diacylglycerol from phosphatidylcholine and ceramide. Among the products of SGMS1, we found new transcripts, circular RNAs (circRNAs), that contain sequences of the gene's 5′ untranslated region (5′UTR). Some of them include the gene's coding region and fragments of introns. An analysis of the abundance of circRNAs in human tissues showed that the largest transcripts were predominantly found in different parts of the brain. circRNAs of rat and mouse sphingomyelin synthase 1 orthologous genes were detected and are highly similar to the human SGMS1 gene transcripts. A quantitative analysis of the abundance of such transcripts also revealed their elevated amount in the brain. A computational analysis of sequences of human circRNAs showed their high potential of binding microRNAs (miRNAs), including the miRNAs that form complexes with Ago proteins and the mRNA of SGMS1. We assume that the circRNAs identified here participate in the regulation of the function of the SGMS1 gene in the brain. PMID:26274505

  5. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    PubMed

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  6. Absence of mutations associated with sulfa resistance in Pneumocystis carinii dihydropteroate synthase gene from non-human primates.

    PubMed

    Demanche, C; Guillot, J; Berthelemy, M; Petitt, T; Roux, P; Wakefield, A E

    2002-06-01

    The dihydropteroate synthase (DHPS) gene from Pneumocystis carinii isolated from non-human primates was amplified using a polymerase chain reaction (PCR) and sequenced to analyse point mutations associated with sulfa resistance. P. carinii DHPS gene amplification was obtained from eight lung samples from five New World primate species and one Old World primate species. None of the animals had been exposed to sulfa drugs and only the wild-type P. carinii DHPS sequence at codons 55 and 57 was observed. These data support the hypothesis that high rates of DHPS mutants in P. carinii f. sp. hominis have arisen with increased use of sulfa drugs for P. carinii pneumonia prophylaxis.

  7. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  8. Analysis of THCA synthase gene expression in cannabis: a preliminary study by real-time quantitative PCR.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Boschi, Ilaria

    2013-09-10

    In this paper we describe analyses performed by Real-Time Reverse-Transcriptase Polymerase Chain Reaction (real-time RT-PCR) on RNA of 12 samples, carried out for forensic purposes to investigate a correlation between tetrahydrocannabinol (THC) concentration in Cannabis and the tetrahydrocannabinol acid synthase (THCAS) gene expression. Samples were obtained from an experimental cultivation of declared potency Cannabis variety seeds and from seizures. The Rubisco gene and the 26S ribosomal RNA gene were used as internal control genes for their constant expression and stability. As results we found minor gene expression in samples from leaves of young plants. Further, grouping results for cannabis samples with similar characteristics, we have found an increased relative expression in samples with the highest percentage of THC coming from seized sample and adult plants.

  9. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese.

  10. Gene Deletion of 7,8-Linoleate Diol Synthase of the Rice Blast Fungus

    PubMed Central

    Jernerén, Fredrik; Sesma, Ane; Francheschetti, Marina; Hamberg, Mats; Oliw, Ernst H.

    2010-01-01

    Linoleate diol synthases (LDS) are heme enzymes, which oxygenate 18:2n-6 sequentially to (8R)-hydroperoxylinoleic acid ((8R)-HPODE) and to (5S,8R)-dihydroxy-, (7S,8S)-dihydroxy-, or (8R,11S)-dihydroxylinoleic acids (DiHODE). The genome of the rice blast fungus, Magnaporthe oryzae, contains two genes with homology to LDS. M. oryzae oxidized 18:2n-6 to (8R)-HPODE and to (7S,8S)-DiHODE, (6S,8R)-DiHODE, and (8R,11S)-HODE. Small amounts of 10-hydroxy-(8E,12Z)-octadecadienoic acid and traces of 5,8-DiHODE were also detected by liquid chromatography-mass spectrometry. The contribution of the 7,8-LDS gene to M. oryzae pathogenicity was evaluated by replacement of the catalytic domain with hygromycin and green fluorescent protein variant (SGFP) cassettes. This genetically modified strain Δ7,8-LDS infected rice leaves and roots and formed appressoria and conidia as the native fungus. The Δ7,8-LDS mutant had lost the capacity to biosynthesize all the metabolites except small amounts of 8-hydroxylinoleic acid. Studies with stereospecifically deuterated linoleic acids showed that (8R)-HPODE was formed by abstraction of the pro-S hydrogen at C-8 and antarafacial oxygenation, whereas (7S,8S)-DiHODE and (8R,11S)-DiHODE were formed from (8R)-HPODE by suprafacial hydrogen abstraction and oxygenation at C-7 and C-11, respectively. A mac1 suppressor mutant (Δmac1 sum1–99) of M. oryzae, which shows cAMP-independent protein kinase A activity, oxygenated 18:2n-6 to increased amounts of (10R)-HPODE and (5S,8R)-DiHODE. Expression of the 7,8-LDS gene but not of the second homologue was detected in the suppressor mutant. This suggests that PKA-mediated signaling pathway regulates the dioxygenase and hydroperoxide isomerase activities of M. oryzae. PMID:20023302

  11. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  12. Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

    PubMed

    Mizuno, Daichi; Higuchi, Kyoko; Sakamoto, Tatsuya; Nakanishi, Hiromi; Mori, Satoshi; Nishizawa, Naoko K

    2003-08-01

    Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

  13. LANOSTEROL SYNTHASE GENE POLYMORPHISMS AND CHANGES IN ENDOGENOUS OUABAIN IN THE RESPONSE TO LOW SODIUM INTAKE

    PubMed Central

    LANZANI, Chiara; GATTI, Guido; CITTERIO, Lorena; MESSAGGIO, Elisabetta; DELLI CARPINI, Simona; SIMONINI, Marco; CASAMASSIMA, Nunzia; ZAGATO, Laura; BRIONI, Elena; HAMLYN, John M.; MANUNTA, Paolo

    2015-01-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Further, lanosterol synthase (LSS), an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here we investigated the hypothesis that LSS rs2254524 alleles in vivo impact the BP and EO responses evoked by a low dietary Na intake (<100 mEq/day, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic (−8.7±1.7 vs −3.0±1.5 p= 0.013), and diastolic (−5.1±0.98 vs −1.4±0,.94 mmHg, p<0.05) BP and the slope of the long-term pressure-natriuresis relationship were affected significantly by the presence of the LSS rs2254524 A variant (AA: 0.71±0,22, AC 0.09±0.13, CC 0.04±0.11 mEq/mmHg/24h, p=0.028). In addition, BP rose in ~25% of the patients in response to the low salt diet and this was associated with increased circulating EO. LSS gene polymorphisms influence both the salt-sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects i.e., increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  14. Hereditary sideroblastic anaemia due to a mutation in exon 10 of the erythroid 5-aminolaevulinate synthase gene.

    PubMed

    Edgar, A J; Wickramasinghe, S N

    1998-02-01

    DNA sequencing of the coding region of the erythroid 5-aminolaevulinate synthase (ALAS2) cDNA from a male with pyridoxine-responsive sideroblastic anaemia revealed a missense mutation C1622G and a closely linked polymorphism C1612A in exon 10 of the gene. Sequence analysis of the genomic DNA from other family members revealed that the proband's mother and daughter were heterozygous carriers of the mutation, consistent with the X-linked inheritance. The C1622G mutation results in a histidine to aspartic acid substitution at amino acid residue 524. The histidine residue is conserved in both the erythroid and housekeeping ALAS proteins in vertebrates, all other known ALAS proteins and other oxamine synthases that have pyridoxal 5'-phosphate as a co-factor. This histidine is located in a predicted loop, preceding a long alpha-helix region near the carboxy-terminus.

  15. Impact of methionine synthase gene and methylenetetrahydrofolate reductase gene polymorphisms on the risk of sudden sensorineural hearing loss.

    PubMed

    Gross, Menachem; Friedman, Gideon; Eliashar, Ron; Koren-Morag, Nira; Goldschmidt, Neta; Atta, Iman Abou; Ben-Yehuda, Arie

    2006-01-01

    Idiopathic sudden sensorineural hearing loss (SSNHL) represents a frequently encountered otological disease of unknown etiology. In recent years, several inherited risk factors have been found in the pathogenesis of vascular diseases. In the present study, we determined whether specific polymorphism or the combination of polymorphisms in folate-dependent homocysteine metabolism genes can act as predisposing inherited vascular risk factors in the development of SSNHL. We conducted a prospective case-control study using DNA samples extracted from 81 patients diagnosed as suffering from SSNHL and 264 healthy control subjects. Three functional polymorphisms were analyzed by polymerase chain reaction amplification, restriction enzyme digestion, and DNA fragment separation by electrophoresis: methylenetetrahydrofolate reductase (MTHFR) C677T, MTHFR A1298C, and methionine synthase (MTR) A2756G polymorphisms. The prevalence of the homozygous genotype of MTR 2756GG in the SSNHL patients (9%) was significantly higher than in the control group (4%) (p = 0.011). The allelic frequency of the G allele of the MTR A2756G polymorphism among SSNHL patients (12.5%) was also significantly higher than in the control group (5%) (p = 0.033). The prevalence of patients possessing two polymorphisms (31%) and three polymorphisms (17%) in the SSNHL group was significantly higher than in the control group (23 and 9%, respectively; p = 0.019). The frequency of patients with a very high rank risk (double homozygous) was significantly higher in the SSNHL group, MTHFR 677TT/MTR 2675GG--7%, than the frequency of patients in the control group, MTHFR 677TT/MTR 2675GG--3% (p = 0.030). Certain polymorphisms in genes encoding enzymes in the folate-dependent homocysteine metabolism are associated with SSNHL. In our case-control study, a significant association between MTR 2756GG genotype and SSNHL was found which may represent an inherited vascular risk factor in the pathogenesis of SSNHL.

  16. Lentivirus-mediated gene transfer of uroporphyrinogen III synthase fully corrects the porphyric phenotype in human cells.

    PubMed

    Géronimi, F; Richard, E; Lamrissi-Garcia, I; Lalanne, M; Ged, C; Redonnet-Vernhet, I; Moreau-Gaudry, F; de Verneuil, H

    2003-05-01

    Congenital erythropoietic porphyria (CEP) is an inherited disease due to a deficiency in the uroporphyrinogen III synthase, the fourth enzyme of the heme biosynthesis pathway. It is characterized by accumulation of uroporphyrin I in the bone marrow, peripheral blood and other organs. The prognosis of CEP is poor, with death often occurring early in adult life. For severe transfusion-dependent cases, when allogeneic cell transplantation cannot be performed, the autografting of genetically modified primitive/stem cells may be the only alternative. In vitro gene transfer experiments have documented the feasibility of gene therapy via hematopoietic cells to treat this disease. In the present study lentiviral transduction of porphyric cell lines and primary CD34(+) cells with the therapeutic human uroporphyrinogen III synthase (UROS) cDNA resulted in both enzymatic and metabolic correction, as demonstrated by the increase in UROS activity and the suppression of porphyrin accumulation in transduced cells. Very high gene transfer efficiency (up to 90%) was achieved in both cell lines and CD34(+) cells without any selection. Expression of the transgene remained stable over long-term liquid culture. Furthermore, gene expression was maintained during in vitro erythroid differentiation of CD34(+) cells. Therefore the use of lentiviral vectors is promising for the future treatment of CEP patients by gene therapy.

  17. Genomic organization and expression analysis of a farnesyl diphosphate synthase gene (FPPS2) in apples (Malus domestica Borkh.).

    PubMed

    Yuan, Kejun; Wang, Changjun; Xin, Li; Zhang, Anning; Ai, Chengxiang

    2013-07-25

    A farnesyl diphosphate synthase gene (FPPS2), which contains 11 introns and 12 exons, was isolated from the apple cultivar "White Winter Pearmain". When it was compared to our previously reported FPPS1, its each intron size was different, its each exon size was the same as that of FPPS1 gene, 30 nucleotide differences were found in its coding sequence. Based on these nucleotide differences, specific primers were designed to perform expression analysis; the results showed that it expressed in both fruit and leaf, its expression level was obviously lower than that of FPPS1 gene in fruit which was stored at 4°C for 5 weeks. This is the first report concerning two FPPS genes and their expression comparison in apples.

  18. Expression of the Saccharomyces cerevisiae inositol-1-phosphate synthase (INO1) gene is regulated by factors that affect phospholipid synthesis.

    PubMed Central

    Hirsch, J P; Henry, S A

    1986-01-01

    The INO1 gene of Saccharomyces cerevisiae encodes the regulated enzyme inositol-1-phosphate synthase, which catalyzes the first committed step in the synthesis of inositol-containing phospholipids. The expression of this gene was analyzed under conditions known to regulate phospholipid synthesis. RNA blot hybridization with a genomic clone for INO1 detected two RNA species of 1.8 and 0.6 kb. The abundance of the 1.8-kb RNA was greatly decreased when the cells were grown in the presence of the phospholipid precursor inositol, as was the enzyme activity of the synthase. Complementation analysis showed that this transcript encoded the INO1 gene product. The level of INO1 RNA was repressed 12-fold when the cells were grown in medium containing inositol, and it was repressed 33-fold when the cells were grown in the presence of inositol and choline together. The INO1 transcript was present at a very low level in cells containing mutations (ino2 and ino4) in regulatory genes unlinked to INO1 that result in inositol auxotrophy. The transcript was constitutively overproduced in cells containing a mutation (opi1) that causes constitutive expression of inositol-1-phosphate synthase and results in excretion of inositol. The expression of INO1 RNA was also examined in cells containing a mutation (cho2) affecting the synthesis of phosphatidylcholine. In contrast to what was observed in wild-type cells, growth of cho2 cells in medium containing inositol did not result in a significant decrease in INO1 RNA abundance. Inositol and choline together were required for repression of the INO1 transcript in these cells, providing evidence for a regulatory link between the synthesis of inositol- and choline-containing lipids. The level of the 0.6-kb RNA was affected, although to a lesser degree, by many of the same factors that influence INO1 expression. Images PMID:3025587

  19. Duplicate isochorismate synthase genes of Bacillus subtilis: regulation and involvement in the biosyntheses of menaquinone and 2,3-dihydroxybenzoate.

    PubMed Central

    Rowland, B M; Taber, H W

    1996-01-01

    Bacillus subtilis has duplicate isochorismate synthase genes, menF and dhbC. Isochorismate synthase is involved in the biosynthesis of both the respiratory chain component menaquinone (MK) and the siderophore 2,3-dihydroxybenzoate (DHB). Several menF and dhbC deletion mutants were constructed to identify the contribution made by each gene product to MK and DHB biosynthesis. menF deletion mutants were able to produce wild-type levels of MK and DHB, suggesting that the dhbC gene product is able to compensate for the lack of MenF. However, a dhbC deletion mutant produced wild-type levels of MK but was DHB deficient, indicating that MenF is unable to compensate for the lack of DhbC. A menF dhbC double-deletion mutant was both MK and DHB deficient. Transcription analysis showed that expression of dhbC, but not of menF, is regulated by iron concentration. A dhbA'::lacZ fusion strain was constructed to examine the effects of mutations to the iron box sequence within the dhb promoter region. These mutations abolished the iron-regulated transcription of the dhb genes, suggesting that a Fur-like repressor protein exists in B. subtilis. PMID:8550523

  20. New Insights into 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Phylogeny, Evolution and Ecological Significance

    PubMed Central

    Nascimento, Francisco X.; Rossi, Márcio J.; Soares, Cláudio R. F. S.; McConkey, Brendan J.; Glick, Bernard R.

    2014-01-01

    The main objective of this work is the study of the phylogeny, evolution and ecological importance of the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase, the activity of which represents one of the most important and studied mechanisms used by plant growth–promoting microorganisms. The ACC deaminase gene and its regulatory elements presence in completely sequenced organisms was verified by multiple searches in diverse databases, and based on the data obtained a comprehensive analysis was conducted. Strain habitat, origin and ACC deaminase activity were taken into account when analyzing the results. In order to unveil ACC deaminase origin, evolution and relationships with other closely related pyridoxal phosphate (PLP) dependent enzymes a phylogenetic analysis was also performed. The data obtained show that ACC deaminase is mostly prevalent in some Bacteria, Fungi and members of Stramenopiles. Contrary to previous reports, we show that ACC deaminase genes are predominantly vertically inherited in various bacterial and fungal classes. Still, results suggest a considerable degree of horizontal gene transfer events, including interkingdom transfer events. A model for ACC deaminase origin and evolution is also proposed. This study also confirms the previous reports suggesting that the Lrp-like regulatory protein AcdR is a common mechanism regulating ACC deaminase expression in Proteobacteria, however, we also show that other regulatory mechanisms may be present in some Proteobacteria and other bacterial phyla. In this study we provide a more complete view of the role for ACC deaminase than was previously available. The results show that ACC deaminase may not only be related to plant growth promotion abilities, but may also play multiple roles in microorganism's developmental processes. Hence, exploring the origin and functioning of this enzyme may be the key in a variety of important agricultural and biotechnological applications. PMID:24905353

  1. A Sorangium cellulosum (myxobacterium) gene cluster for the biosynthesis of the macrolide antibiotic soraphen A: cloning, characterization, and homology to polyketide synthase genes from actinomycetes.

    PubMed Central

    Schupp, T; Toupet, C; Cluzel, B; Neff, S; Hill, S; Beck, J J; Ligon, J M

    1995-01-01

    A 40-kb region of DNA from Sorangium cellulosum So ce26, which contains polyketide synthase (PKS) genes for synthesis of the antifungal macrolide antibiotic soraphen A, was cloned. These genes were detected by homology to Streptomyces violaceoruber genes encoding components of granaticin PKS, thus extending this powerful technique for the identification of bacterial PKS genes, which has so far been applied only to actinomycetes, to the gram-negative myxobacteria. Functional analysis by gene disruption has indicated that about 32 kb of contiguous DNA of the cloned region contains genes involved in soraphen A biosynthesis. The nucleotide sequence of a 6.4-kb DNA fragment, derived from the region with homology to granaticin PKS genes, was determined. Analysis of this sequence has revealed the presence of a single large open reading frame beginning and ending outside the 6.4-kb fragment. The deduced amino acid sequence indicates the presence of a domain with a high level of similarity to beta-ketoacyl synthases that are involved in polyketide synthesis. Other domains with high levels of similarity to regions of known polyketide biosynthetic functions were identified, including those for acyl transferase, acyl carrier protein, ketoreductase, and dehydratase. We present data which indicate that soraphen A biosynthesis is catalyzed by large, multifunctional enzymes analogous to other bacterial PKSs of type I. PMID:7601830

  2. The CTB1 gene encoding a fungal polyketide synthase is required for cercosporin biosynthesis and fungal virulence of Cercospora nicotianae.

    PubMed

    Choquer, Mathias; Dekkers, Katherine L; Chen, Hui-Qin; Cao, Lihua; Ueng, Peter P; Daub, Margaret E; Chung, Kuang-Ren

    2005-05-01

    Cercosporin is a light-activated, non-host-selective toxin produced by many Cercospora fungal species. In this study, a polyketide synthase gene (CTB1) was functionally identified and molecularly characterized to play a key role in cercosporin biosynthesis by Cercospora nicotianae. We also provide conclusive evidence to confirm the crucial role of cercosporin in fungal pathogenesis. CTB1 encoded a polypeptide with a deduced length of 2,196 amino acids containing a keto synthase (KS), an acyltransferase (AT), a thioesterase/claisen cyclase (TE/CYC), and two acyl carrier protein (ACP) domains, and had high levels of similarity to many fungal type I polyketide synthases. Expression of a 6.8-kb CTB1 transcript was highly regulated by light and medium composition, consistent with the conditions required for cercosporin biosynthesis in cultures. Targeted disruption of CTB1 resulted in the loss of both CTB1 transcript and cercosporin biosynthesis in C. nicotianae. The ctb1-null mutants incited fewer necrotic lesions on inoculated tobacco leaves compared with the wild type. Complementation of ctb1-null mutants with a full-length CTB1 clone restored wild-type levels of cercosporin production as well as the ability to induce lesions on tobacco. Thus, we have demonstrated conclusively that cercosporin is synthesized via a polyketide pathway, and cercosporin is an important virulence factor in C. nicotianae. The results also suggest that strategies that avoid the toxicity of cercosporin will be useful in reduction of disease incidence caused by Cercospora spp.

  3. ACC Effectiveness Review, 1999-2002.

    ERIC Educational Resources Information Center

    Wallace, Roslyn, Ed.

    2002-01-01

    These newsletters on Institutional Effectiveness (IE) at Austin Community College (ACC) in Texas include the following articles: (1) "The 'Fast Track'...Students Say It Works!" (2) "Are Students Successfully Completing Distance Learning Courses at ACC?" (3) "Tracking Transfers"; (4) "Math Pilot: Study Skills…

  4. Metabolic and developmental effects resulting from deletion of the citA gene encoding citrate synthase in Aspergillus nidulans.

    PubMed

    Murray, Sandra L; Hynes, Michael J

    2010-04-01

    Citrate synthase is a central activity in carbon metabolism. It is required for the tricarboxylic acid (TCA) cycle, respiration, and the glyoxylate cycle. In Saccharomyces cerevisiae and Arabidopsis thaliana, there are mitochondrial and peroxisomal isoforms encoded by separate genes, while in Aspergillus nidulans, a single gene, citA, encodes a protein with predicted mitochondrial and peroxisomal targeting sequences (PTS). Deletion of citA results in poor growth on glucose but not on derepressing carbon sources, including those requiring the glyoxylate cycle. Growth on glucose is restored by a mutation in the creA carbon catabolite repressor gene. Methylcitrate synthase, required for propionyl-coenzyme A (CoA) metabolism, has previously been shown to have citrate synthase activity. We have been unable to construct the mcsADelta citADelta double mutant, and the expression of mcsA is subject to CreA-mediated carbon repression. Therefore, McsA can substitute for the loss of CitA activity. Deletion of citA does not affect conidiation or sexual development but results in delayed conidial germination as well as a complete loss of ascospores in fruiting bodies, which can be attributed to loss of meiosis. These defects are suppressed by the creA204 mutation, indicating that McsA activity can substitute for the loss of CitA. A mutation of the putative PTS1-encoding sequence in citA had no effect on carbon source utilization or development but did result in slower colony extension arising from single conidia or ascospores. CitA-green fluorescent protein (GFP) studies showed mitochondrial localization in conidia, ascospores, and hyphae. Peroxisomal localization was not detected. However, a very low and variable detection of punctate GFP fluorescence was sometimes observed in conidia germinated for 5 h when the mitochondrial targeting sequence was deleted.

  5. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested.

  6. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes.

  7. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    PubMed

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  8. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  9. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    PubMed

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications.

  10. Patterning of Virus-Infected Glycine max Seed Coat Is Associated with Suppression of Endogenous Silencing of Chalcone Synthase Genes

    PubMed Central

    Senda, Mineo; Masuta, Chikara; Ohnishi, Shizen; Goto, Kazunori; Kasai, Atsushi; Sano, Teruo; Hong, Jin-Sung; MacFarlane, Stuart

    2004-01-01

    Most commercial Glycine max (soybean) varieties have yellow seeds because of loss of pigmentation in the seed coat. It has been suggested that inhibition of seed coat pigmentation in yellow G. max may be controlled by homology-dependent silencing of chalcone synthase (CHS) genes. Our analysis of CHS mRNA and short-interfering RNAs provide clear evidence that the inhibition of seed coat pigmentation in yellow G. max results from posttranscriptional rather than transcriptional silencing of the CHS genes. Furthermore, we show that mottling symptoms present on the seed coat of G. max plants infected with some viruses can be caused by suppression of CHS posttranscriptional gene silencing (PTGS) by a viral silencing suppressor protein. These results demonstrate that naturally occurring PTGS plays a key role in expression of a distinctive phenotype in plants and present a simple clear example of the elucidation of the molecular mechanism for viral symptom induction. PMID:15037735

  11. Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes.

    PubMed

    Senda, Mineo; Masuta, Chikara; Ohnishi, Shizen; Goto, Kazunori; Kasai, Atsushi; Sano, Teruo; Hong, Jin-Sung; MacFarlane, Stuart

    2004-04-01

    Most commercial Glycine max (soybean) varieties have yellow seeds because of loss of pigmentation in the seed coat. It has been suggested that inhibition of seed coat pigmentation in yellow G. max may be controlled by homology-dependent silencing of chalcone synthase (CHS) genes. Our analysis of CHS mRNA and short-interfering RNAs provide clear evidence that the inhibition of seed coat pigmentation in yellow G. max results from posttranscriptional rather than transcriptional silencing of the CHS genes. Furthermore, we show that mottling symptoms present on the seed coat of G. max plants infected with some viruses can be caused by suppression of CHS posttranscriptional gene silencing (PTGS) by a viral silencing suppressor protein. These results demonstrate that naturally occurring PTGS plays a key role in expression of a distinctive phenotype in plants and present a simple clear example of the elucidation of the molecular mechanism for viral symptom induction.

  12. Structural organization of the human neuronal nitric oxide synthase gene (NOS1).

    PubMed

    Hall, A V; Antoniou, H; Wang, Y; Cheung, A H; Arbus, A M; Olson, S L; Lu, W C; Kau, C L; Marsden, P A

    1994-12-30

    Neuronal nitric oxide (NO) synthase, localized to human chromosome 12, uniquely participates in diverse biologic processes; neurotransmission, the regulation of body fluid homeostasis, neuroendocrine physiology, control of smooth muscle motility, sexual function, and myocyte/myoblast biology, among others. Restriction enzyme mapping, subcloning, and DNA sequence analysis of bacteriophage- and yeast artificial chromosome-derived human genomic DNA indicated that the mRNA for neuronal NO synthase is dispersed over a minimum of 160 kilobases of human genomic DNA. Analysis of intron-exon splice junctions predicted that the open reading frame is encoded by 28 exons, with translation initiation and termination in exon 2 and exon 29, respectively. Determination of transcription initiation sites in brain poly(A) RNA with primer extension analysis and RNase protection revealed a major start site 28 nucleotides downstream from a TATA box. Sequence inspection of 5'-flanking regions revealed potential cis-acting DNA elements: AP-2, TEF-1/MCBF, CREB/ATF/c-Fos, NRF-1, Ets, NF-1, and NF-kappa B-like sequences. Diversity appears to represent a major theme apparent upon analysis of human neuronal NO synthase mRNA transcripts. A microsatellite of the dinucleotide variety was detected within the 3'-untranslated region of exon 29. Multiple alleles were evident in normal individuals indicating the existence of allelic mRNA sequence variation. Characterization of variant human neuronal NO synthase cDNAs indicated the existence of casette exon 9/10 and exon 10 deletions as examples of structural mRNA diversity due to alternative splicing. The latter deletion of a 175-nucleotide exon introduces a frame-shift and premature stop codon indicating the potential existence of a novel NH2 terminus protein. In summary, analysis of the human neuronal NO synthase locus reveals a complex genomic organization and mRNA diversity that is both allelic and structural.

  13. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  14. Gene therapy techniques for the delivery of endothelial nitric oxide synthase to the lung for pulmonary hypertension.

    PubMed

    Deng, W; Bivalacqua, T J; Champion, H C; Hellstrom, W J; Murthy, Subramanyam N; Kadowitz, Philip J

    2010-01-01

    Pulmonary hypertension (PH) is a serious, often fatal disease characterized by remodeling of the pulmonary vascular bed, increased pulmonary arterial pressure, and right heart failure. The increased vascular resistance in the pulmonary circulation is due to structural changes and increased vasoconstrictor tone. Although current therapies have prolonged survival, the long-term outcome is not favorable. Nitric oxide (NO) is synthesized by endothelial nitric oxide synthase (eNOS) and is important in regulating vascular resistance and in vascular remodeling in the lung. NO deficiency due to endothelial dysfunction plays an important role in the pathogenesis of PH. Therefore, local eNOS gene delivery to the lung is a promising approach for the treatment of PH. Adenoviral-mediated in vivo gene therapy and adult stem cell-based ex vivo gene therapy are two attractive current gene therapies for the treatment of cardiovascular and pulmonary diseases. In this chapter we describe the use of two gene transfer techniques, i.e., adenoviral gene transfer of eNOS and eNOS gene-modified rat marrow stromal cells, for eNOS gene delivery to the lung of laboratory animals for the treatment of PH.

  15. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  16. 1-Aminocyclopropane-1-carboxylate (ACC) deaminases from Methylobacterium radiotolerans and Methylobacterium nodulans with higher specificity for ACC.

    PubMed

    Fedorov, Dmitry N; Ekimova, Galina A; Doronina, Nina V; Trotsenko, Yuri A

    2013-06-01

    The 1-aminocyclopropane-1-carboxylate (ACC) deaminases (EC 3.4.99.7), the key enzymes of degradation of the precursor of the phytohormone ethylene, have not been well studied despite their great importance for plant-bacterial interactions. Using blast, the open reading frames encoding ACC deaminases were found in the genomes of epiphytic methylotroph Methylobacterium radiotolerans JCM2831 and nodule-forming endosymbiont Methylobacterium nodulans ORS2060. These genes were named acdS and cloned; recombinant proteins were expressed and purified from Escherichia coli. The enzyme from M. nodulans displayed the highest substrate specificity among all of the characterized ACC deaminases (Km 0.80 ± 0.04 mM), whereas the enzyme from M. radiotolerans had Km 1.8 ± 0.3 mM. The kcat values were 111.8 ± 0.2 and 65.8 ± 2.8 min(-1) for the enzymes of M. nodulans and M. radiotolerans, respectively. Both enzymes are homotetramers with a molecular mass of 144 kDa, as was demonstrated by size exclusion chromatography and native PAGE. The purified enzymes displayed the maximum activity at 45-50 °C and pH 8.0. Thus, the priority data have been obtained, extending the knowledge of biochemical properties of bacterial ACC deaminases.

  17. Genome-Wide Analysis of the Sucrose Synthase Gene Family in Grape (Vitis vinifera): Structure, Evolution, and Expression Profiles.

    PubMed

    Zhu, Xudong; Wang, Mengqi; Li, Xiaopeng; Jiu, Songtao; Wang, Chen; Fang, Jinggui

    2017-03-28

    Sucrose synthase (SS) is widely considered as the key enzyme involved in the plant sugar metabolism that is critical to plant growth and development, especially quality of the fruit. The members of SS gene family have been identified and characterized in multiple plant genomes. However, detailed information about this gene family is lacking in grapevine (Vitis vinifera L.). In this study, we performed a systematic analysis of the grape (V. vinifera) genome and reported that there are five SS genes (VvSS1-5) in the grape genome. Comparison of the structures of grape SS genes showed high structural conservation of grape SS genes, resulting from the selection pressures during the evolutionary process. The segmental duplication of grape SS genes contributed to this gene family expansion. The syntenic analyses between grape and soybean (Glycine max) demonstrated that these genes located in corresponding syntenic blocks arose before the divergence of grape and soybean. Phylogenetic analysis revealed distinct evolutionary paths for the grape SS genes. VvSS1/VvSS5, VvSS2/VvSS3 and VvSS4 originated from three ancient SS genes, which were generated by duplication events before the split of monocots and eudicots. Bioinformatics analysis of publicly available microarray data, which was validated by quantitative real-time reverse transcription PCR (qRT-PCR), revealed distinct temporal and spatial expression patterns of VvSS genes in various tissues, organs and developmental stages, as well as in response to biotic and abiotic stresses. Taken together, our results will be beneficial for further investigations into the functions of SS gene in the processes of grape resistance to environmental stresses.

  18. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    PubMed

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions.

  19. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  20. In vitro effect of nanosilver on gene expression of superoxide dismutases and nitric oxide synthases in chicken Sertoli cells.

    PubMed

    Hassanpour, H; Mirshokraei, P; Sadrabad, E Khalili; Dehkordi, A Esmailian; Layeghi, S; Afzali, A; Mohebbi, A

    2015-02-01

    To evaluate effects of different concentrations of nanosilver colloid on the cell culture of Sertoli cells, the proportion of lipid peroxidation, antioxidant capacity, nitric oxide (NO) production and genes expression of superoxide dismutases (SOD1 and SOD2) and nitric oxide synthases (eNOS and iNOS) were measured. Sertoli cells were incubated at concentrations of 25, 75 and 125 ppm nanosilver for 48 h. There was progressive lipid peroxidation in treatments according to increasing of nanosilver. Lipid peroxidation, as indicated by malondialdehyde levels, was significantly elevated by the highest concentration of silver colloid (125 ppm), although antioxidant capacity, as measured by ferric ion reduction, was unaffected. Nitrite, as an index of NO production was reduced only in 125 ppm of nanosilver. Expression of SOD1 gene was reduced in nanosilver-treated cells at all concentrations, whereas expression of SOD2 gene was reduced only in cells treated with 125 ppm nanosilver. Expression of iNOS gene was progressively increased with higher concentrations of nanosilver. Expression of eNOS gene was also increased in 125 ppm of nanosilver. In conclusion, toxic effects of nanosilver could be due to high lipid peroxidation and suppression of antioxidant mechanisms via reduced expression of SOD genes and increased expression of NOS genes.

  1. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies.

  2. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  3. A study of iterative type II polyketide synthases, using bacterial genes cloned from soil DNA: a means to access and use genes from uncultured microorganisms.

    PubMed Central

    Seow, K T; Meurer, G; Gerlitz, M; Wendt-Pienkowski, E; Hutchinson, C R; Davies, J

    1997-01-01

    To examine as randomly as possible the role of the beta-ketoacyl and acyl carrier protein (ACP) components of bacterial type II polyketide synthases (PKSs), homologs of the chain-length-factor (CLF) genes were cloned from the environmental community of microorganisms. With PCR primers derived from conserved regions of known ketosynthase (KSalpha) and ACP genes specifying the formation of 16- to 24-carbon polyketides, two CLF (KSbeta) genes were cloned from unclassified streptomycetes isolated from the soil, and two were cloned from soil DNA without the prior isolation of the parent microorganism. The sequence and deduced product of each gene were distinct from those of known KSbeta genes and, by phylogenetic analysis, belonged to antibiotic-producing PKS gene clusters. Hybrid PKS gene cassettes were constructed with each novel KSbeta gene substituted for the actI-ORF2 or tcmL KSbeta subunit genes, along with the respective actI-ORF1 or tcmK KSalpha, tcmM ACP, and tcmN cyclase genes, and were found to produce an octaketide or decaketide product characteristic of the ones known to be made by the heterologous KSalpha gene partner. Since substantially less than 1% of the microorganisms present in soil are thought to be cultivatable by standard methods, this work demonstrates a potential way to gain access to a more extensive range of microbial molecular diversity and to biosynthetic pathways whose products can be tested for biological applications. PMID:9393700

  4. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  5. [Identification and characterization of intraspecific variability of the sucrose synthase gene Sus4 of potato (Solanum tuberosum)].

    PubMed

    Boris, K V; Ryzhova, N N; Kochieva, E Z

    2011-02-01

    Nucleotide and amino acid variability of fragments of the Sus4 gene encoding the sucrose synthase enzyme was studied in 24 potato cultivars selected in Russia and other countries and differing in starch content in tubers. Both SNPs and indels were detected in a chosen Sus4 gene fragment including the sequence from exon 3 to exon 6 and corresponding to the main part of the sucrose synthase domain. Four types of Sus4 sequences were revealed depending on the presence of an insertion in introns 4 and 5 and of the mononucleotide octamer (T)8 in intron 5. Differentiation of these sequences was confirmed by statistical methods. Sixteen amino acid substitutions were identified in the translated sequence, of which eleven were nonsynonymous. Specific varietal nucleotide and amino acid substitutions were also revealed, which can be used in future for marking potato cultivars/genotypes. No direct associations between the mutational changes and the starch content were found in the potato cultivars studied by us.

  6. Molecular cloning and functional expression analysis of a new gene encoding geranylgeranyl diphosphate synthase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Miao, Zhiqi; Tang, Kexuan

    2010-10-01

    Geranylgeranyl diphosphate synthase (GGPPS) [EC 2.5.1.29] catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes such as taxol. Herein, a full-length cDNA encoding GGPPS (designated as CgGGPPS) was cloned and characterized from hazel (Corylus avellana L. Gasaway), a taxol-producing angiosperms. The full-length cDNA of CgGGPPS was 1515 bp with a 1122 bp open reading frame (ORF) encoding a 373 amino acid polypeptide. The CgGGPPS genomic DNA sequence was also obtained, revealing CgGGPPS gene was not interrupted by an intron. Southern blot analysis indicated that CgGGPPS belonged to a small gene family. Tissue expression pattern analysis indicated that CgGGPPS expressed the highest in leaves. RT-PCR analysis indicated that CgGGPPS expression could be induced by exogenous methyl jasmonate acid. Furthermore, carotenoid accumulation was observed in Escherichia coli carrying pACCAR25ΔcrtE plasmid carrying CgGGPPS. The result revealed that cDNA encoded a functional GGPP synthase.

  7. [Cloning, expression and functional identification of a type III polyketide synthase gene from Huperzia serrata].

    PubMed

    Ye, Jin-cui; Zhang, Ping; Sun, Jie-yin; Guo, Chao-tan; Chen, Guo-shen; Abe, Ikuro; Noguchi, Hiroshi

    2011-10-01

    A cDNA encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. by RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. serrata PKS2. The terminal sequences of cDNA were obtained by the 3'- and 5'-RACE method. The full-length cDNA of H. serrata PKS2 contained a 1212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1, 3-dihydroxy-N-methylacridone. Interestingly, H. serrata PKS2 lacks most of the consensus active site sequences with acridone synthase from Ruta graveolens (Rutaceae).

  8. Rapid detection of mutations in the human-derived Pneumocystis carinii dihydropteroate synthase gene associated with sulfa resistance.

    PubMed

    Ma, L; Kovacs, J A

    2001-03-01

    Recent studies have shown that point mutations in the dihydropteroate synthase (DHPS) gene of human-derived Pneumocystis carinii are related to exposure to sulfa drugs and possibly represent the emergence of sulfa resistance. We developed a simple single-strand conformation polymorphism (SSCP) method to permit rapid detection of these mutations. With plasmid constructs, SSCP was able to detect as little as 10% of a minority population. The SSCP assay was compared to direct sequencing for typing the DHPS gene by examining 37 clinical isolates with known DHPS sequences and 41 clinical isolates with unknown DHPS sequences. The typing results were consistent between these two methods for all isolates except 11 in which mutations were detected by SSCP but not by direct sequencing. Sequencing of individual clones after subcloning confirmed the presence of mutations in a minority population as determined by SSCP. SSCP is a very simple and sensitive method for rapid identification of P. camii DHPS mutations.

  9. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids.

  10. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    PubMed

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene.

  11. One type of chalcone synthase gene expressed during embryogenesis regulates the flavonoid accumulation in citrus cell cultures.

    PubMed

    Moriguchi, T; Kita, M; Tomono, Y; EndoInagaki, T; Omura, M

    1999-06-01

    To elucidate the relationship between the expression of chalcone synthase (CHS) genes and the production of flavonoid in citrus cell cultures, two cDNA clones encoding CHS were isolated (CitCHS1 and CitCHS2) from the citrus. The accumulation of CitCHS2 mRNA was notably induced by embryogenesis but CitCHS1 mRNA was not. There was no detectable accumulation of flavonoid in the undifferentiated calli, but flavonoid accumulated after the morphological changes to embryoids. These results indicate that two CHS genes differentially expressed during citrus somatic embryogenesis and CitCHS2 may regulate the accumulation of flavonoid in citrus cell cultures.

  12. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met).

    PubMed

    Gucev, Zoran; Slavevska, Nevenka; Tasic, Velibor; Laban, Nevenka; Pop-Jordanova, Nada; Danilovski, Dragan; Woolf, Jacqueline; Cole, Duncan

    2011-05-01

    Congenital erythropoietic porphyria (CEP) is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS). We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met). The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  13. Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus.

    PubMed

    Dillon, Andrew; Varanasi, Vijay K; Danilova, Tatiana V; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E; Tranel, Patrick J; Friebe, Bernd; Gill, Bikram S; Jugulam, Mithila

    2017-02-01

    Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A tuberculatus In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A tuberculatus.

  14. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    PubMed

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  15. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei

    PubMed Central

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-01-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome. PMID:26612679

  16. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens').

    PubMed

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H

    2012-11-01

    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  17. Identification and characterization of a class III chitin synthase gene of Moniliophthora perniciosa, the fungus that causes witches' broom disease of cacao.

    PubMed

    Souza, Catiane S; Oliveira, Bruno M; Costa, Gustavo G L; Schriefer, Albert; Selbach-Schnadelbach, Alessandra; Uetanabaro, Ana Paula T; Pirovani, Carlos P; Pereira, Gonçalo A G; Taranto, Alex G; Cascardo, Júlio Cézar de M; Góes-Neto, Aristóteles

    2009-08-01

    Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches' broom disease of cacao.

  18. WdCHS3, a Gene That Encodes a Class III Chitin Synthase in Wangiella (Exophiala) dermatitidis, Is Expressed Differentially under Stress Conditions

    PubMed Central

    Wang, Zheng; Szaniszlo, Paul J.

    2000-01-01

    Class III chitin synthases are important for hyphal growth in some filamentous fungi but are not found in yeasts. Using a specific PCR product that encodes a portion of the class III chitin synthase of W. dermatitidis as a probe, we isolated the chitin synthase gene, WdCHS3, from this polymorphic melanized pathogen of humans. Northern blotting showed that WdCHS3 was highly expressed under stress conditions, such as the shift of cells to temperatures commensurate with infection, or to conditions that induce cellular morphogenesis in this fungus. Analysis of the 5′ upstream sequence of WdCHS3 provided evidence for a negative regulatory element at between −780 and −1600 bp. Western blotting indicated that the production of the WdChs3p was temperature dependent and temporally regulated. Disruption of WdCHS3 in a wild-type strain and in two temperature-sensitive morphological mutants resulted in significantly reduced chitin synthase activities but did not obviously affect their morphologies, growth rates, chitin contents, or virulence. This paradox suggested that the contributions of the high levels of WdCHS3 gene expression and WdChs3p production in strains subjected to stress reside in unknown or unexamined parts of the life cycle of this ecologically poorly known member of the Fungi Imperfecti. Nonetheless, this report presents the first evidence that transcription of a chitin synthase gene is regulated by a negative regulatory element in its 5′ upstream sequence. PMID:10648509

  19. Genome-Wide Identification and Evolution Analysis of Trehalose-6-Phosphate Synthase Gene Family in Nelumbo nucifera

    PubMed Central

    Jin, Qijiang; Hu, Xin; Li, Xin; Wang, Bei; Wang, Yanjie; Jiang, Hongwei; Mattson, Neil; Xu, Yingchun

    2016-01-01

    Trehalose-6-phosphate synthase (TPS) plays a key role in plant carbohydrate metabolism and the perception of carbohydrate availability. In the present work, the publicly available Nelumbo nucifera (lotus) genome sequence database was analyzed which led to identification of nine lotus TPS genes (NnTPS). It was found that at least two introns are included in the coding sequences of NnTPS genes. When the motif compositions were analyzed we found that NnTPS generally shared the similar motifs, implying that they have similar functions. The dN/dS ratios were always less than 1 for different domains and regions outside domains, suggesting purifying selection on the lotus TPS gene family. The regions outside TPS domain evolved relatively faster than NnTPS domains. A phylogenetic tree was constructed using all predicted coding sequences of lotus TPS genes, together with those from Arabidopsis, poplar, soybean, and rice. The result indicated that those TPS genes could be clearly divided into two main subfamilies (I-II), where each subfamily could be further divided into 2 (I) and 5 (II) subgroups. Analyses of divergence and adaptive evolution show that purifying selection may have been the main force driving evolution of plant TPS genes. Some of the critical sites that contributed to divergence may have been under positive selection. Transcriptome data analysis revealed that most NnTPS genes were predominantly expressed in sink tissues. Expression pattern of NnTPS genes under copper and submergence stress indicated that NNU_014679 and NNU_022788 might play important roles in lotus energy metabolism and participate in stress response. Our results can facilitate further functional studies of TPS genes in lotus. PMID:27746792

  20. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins.

  1. Characterization of Stilbene Synthase Genes in Mulberry (Morus atropurpurea) and Metabolic Engineering for the Production of Resveratrol in Escherichia coli.

    PubMed

    Wang, Chuanhong; Zhi, Shuang; Liu, Changying; Xu, Fengxiang; Zhao, Aichun; Wang, Xiling; Ren, Yanhong; Li, Zhengang; Yu, Maode

    2017-03-01

    Stilbenes have been recognized for their beneficial physiological effects on human health. Stilbene synthase (STS) is the key enzyme of resveratrol biosynthesis and has been studied in numerous plants. Here, four MaSTS genes were isolated and identified in mulberry (Morus atropurpurea Roxb.). The expression levels of MaSTS genes and the accumulation of trans-resveratrol, trans-oxyresveratrol, and trans-mulberroside A were investigated in different plant organs. A novel coexpression system that harbored 4-coumarate:CoA ligase gene (Ma4CL) and MaSTS was established. Stress tests suggested that MaSTS genes participate in responses to salicylic acid, abscisic acid, wounding, and NaCl stresses. Additionally, overexpressed MaSTS in transgenic tobacco elevated the trans-resveratrol level and increased tolerance to drought and salinity stresses. These results revealed the major MaSTS gene, and we evaluated its function in mulberry, laying the foundation for future research on stilbene metabolic pathways in mulberry.

  2. Effect of thymidylate synthase (TYMS) gene polymorphisms with methotrexate treatment outcome in south Indian Tamil patients with rheumatoid arthritis.

    PubMed

    Muralidharan, Niveditha; Misra, Durga P; Jain, Vikramraj K; Negi, Vir Singh

    2017-03-27

    Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease causing joint damage and significant functional impairment. Methotrexate (MTX) remains the mainstay for the treatment of RA. MTX inhibits several enzymes of the folate and nucleotide pathways. Thymidylate synthase (TYMS) is an important enzyme in the de novo pyrimidine pathway responsible for DNA replication. The two common gene polymorphisms analyzed in TYMS are 28-bp tandem repeat polymorphism and a 6-bp insertion/deletion polymorphism. The present study was carried out to find the role of these TYMS gene polymorphisms with clinical phenotype, treatment response, and MTX adverse events in 254 patients with RA of south Indian Tamil ethnicity. TYMS gene polymorphisms were analyzed by PCR. The allele frequencies of TYMS gene polymorphisms did not differ between good and non-responders. However, the TYMS 28-bp tandem repeat 3R allele was higher in non-responders than in patients undergoing remission [64 vs 51.11%, p = 0.06, OR 0.58, 95% CI (0.34-1.00)]. The TYMS 6-bp deletion allele was higher in non-responders than good responders [78.20 vs 64.92%, p = 0.06, OR 0.51 95% CI (0.27-0.98)]. TYMS 3R allele and TYMS 6-bp deletion allele may favor non-response to MTX in south Indian Tamils. TYMS gene polymorphisms did not influence MTX adverse events.

  3. Suppression of the barley uroporphyrinogen III synthase gene by a Ds activation tagging element generates developmental photosensitivity.

    PubMed

    Ayliffe, Michael A; Agostino, Anthony; Clarke, Bryan C; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J

    2009-03-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen.

  4. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  5. Expression of the naphthoate synthase gene in Mycobacterium tuberculosis in a self-generated oxygen depleted liquid culture system.

    PubMed

    Ramchandra, Prathna; Sturm, A Willem

    2010-12-01

    Mycobacterium tuberculosis has been classified for decades as a strict aerobic species. Whole genome sequencing of the type culture strain H37Rv has revealed the presence of a full set of genes allowing for anaerobic metabolism. Naphthoate synthase (menB) is a key enzyme required for the synthesis of menaquinone, which plays a crucial role in anaerobic electron transport, ultimately resulting in the formation of energy generating intermediates. Interrupting the synthesis of this enzyme will interfere with the production of menaquinone and therefore this enzyme is a potential drug target. This study serves to investigate the role of naphtoate synthase in the survival of M. tuberculosis H37Rv when incubated under oxygen limiting conditions of unagitated liquid culture over 15 weeks. M. tuberculosis H37Rv was grown in Middlebrook 7H9 media. The tubes were kept undisturbed at 37 °C for up to 15 weeks. At selected time points, aliquots of cells were removed and frozen. RNA was simultaneously extracted from all aliquots. The RNA was converted to cDNA for Real-Time PCR on the ABI 7000 SDS. Gene expression was normalized against 16S RNA quantities at each time point. A systematic increase in the expression of the menB gene product was observed over the incubation period with a 4.3-fold increase seen at week 6 (P < 0.001) relative to day 0 and an 85.8-fold increase at week 15 (P < 0.001) relative to day 0. Cells of M. tuberculosis increase menaquinone production during prolonged incubation in broth culture as a mechanism of survival. This study substantiates the menB enzyme to be a putative drug target.

  6. A Stilbene Synthase Gene (SbSTS1) Is Involved in Host and Nonhost Defense Responses in Sorghum1

    PubMed Central

    Yu, Christine K.Y.; Springob, Karin; Schmidt, Jürgen; Nicholson, Ralph L.; Chu, Ivan K.; Yip, Wing Kin; Lo, Clive

    2005-01-01

    A chalcone synthase (CHS)-like gene, SbCHS8, with high expressed sequence tag abundance in a pathogen-induced cDNA library, was identified previously in sorghum (Sorghum bicolor). Genomic Southern analysis revealed that SbCHS8 represents a single-copy gene. SbCHS8 expression was induced in sorghum mesocotyls following inoculation with Cochliobolus heterotrophus and Colletotrichum sublineolum, corresponding to nonhost and host defense responses, respectively. However, the induction was delayed by approximately 24 h when compared to the expression of at least one of the other SbCHS genes. In addition, SbCHS8 expression was not induced by light and did not occur in a tissue-specific manner. SbCHS8, together with SbCHS2, was overexpressed in transgenic Arabidopsis (Arabidopsis thaliana) tt4 (transparent testa) mutants defective in CHS activities. SbCHS2 rescued the ability of these mutants to accumulate flavonoids in seed coats and seedlings. In contrast, SbCHS8 failed to complement the mutation, suggesting that the encoded enzyme does not function as a CHS. To elucidate their biochemical functions, recombinant proteins were assayed with different phenylpropanoid-Coenzyme A esters. Flavanones and stilbenes were detected in the reaction products of SbCHS2 and SbCHS8, respectively. Taken together, our data demonstrated that SbCHS2 encodes a typical CHS that synthesizes naringenin chalcone, which is necessary for the formation of different flavonoid metabolites. On the other hand, SbCHS8, now retermed SbSTS1, encodes an enzyme with stilbene synthase activity, suggesting that sorghum accumulates stilbene-derived defense metabolites in addition to the well-characterized 3-deoxyanthocyanidin phytoalexins. PMID:15821144

  7. Ketogenic mitochondrial 3-hydroxy 3-methylglutaryl-CoA synthase gene expression in intestine and liver of suckling rats.

    PubMed

    Serra, D; Asins, G; Hegardt, F G

    1993-03-01

    The ketogenic mitochondrial 3-hydroxy 3-methylglutaryl-coenzyme A (HMG-CoA) synthase gene is expressed in intestine of suckling rats, its mRNA levels changing with age. Intestine mitochondrial mRNA values reach maximum levels on the 12th postnatal day and then decrease smoothly. Mother's milk may influence the intestine expression, since mRNA levels at birth are very low, increasing after the first lactation. Moreover, rats weaned at either Day 18 or 21 decrease their mRNA levels dramatically and there is no expression in adult rats. Mitochondrial HMG-CoA synthase is also expressed in liver of suckling rats but the developmental pattern of mRNAs is different from that in intestine, showing the highest values at Day 3 of life. mRNA levels in liver are lower than in intestine for most of the suckling period, suggesting the physiological relevance of the intestine for the ketogenic process of the whole body. Liver mRNA levels on weaning and in adult rats are high enough to sustain hepatic ketogenesis.

  8. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    NASA Astrophysics Data System (ADS)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  9. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    PubMed Central

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  10. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  11. Evolution and Function of the Sucrose-Phosphate Synthase Gene Families in Wheat and Other Grasses[w

    PubMed Central

    Castleden, C. Kate; Aoki, Naohiro; Gillespie, Vanessa J.; MacRae, Elspeth A.; Quick, W. Paul; Buchner, Peter; Foyer, Christine H.; Furbank, Robert T.; Lunn, John E.

    2004-01-01

    Suc-phosphate synthase (SPS) is a key regulatory enzyme in the pathway of Suc biosynthesis and has been linked to quantitative trait loci controlling plant growth and yield. In dicotyledonous plants there are three SPS gene families: A, B, and C. Here we report the finding of five families of SPS genes in wheat (Triticum aestivum) and other monocotyledonous plants from the family Poaceae (grasses). Three of these form separate subfamilies within the previously described A, B, and C gene families, but the other two form a novel and distinctive D family, which on present evidence is only found in the Poaceae. The D-type SPS proteins lack the phosphorylation sites associated with 14-3-3 protein binding and osmotic stress activation, and the linker region between the N-terminal catalytic glucosyltransferase domain and the C-terminal Suc-phosphatase-like domain is 80 to 90 amino acid residues shorter than in the A, B, or C types. The D family appears to have arisen after the divergence of mono- and dicotyledonous plants, with a later duplication event resulting in the two D-type subfamilies. Each of the SPS gene families in wheat showed different, but overlapping, spatial and temporal expression patterns, and in most organs at least two different SPS genes are expressed. Analysis of expressed sequence tags indicated similar expression patterns to wheat for each SPS gene family in barley (Hordeum vulgare) but not in more distantly related grasses. We identified an expressed sequence tag from rice (Oryza sativa) that appears to be derived from an endogenous antisense SPS gene, and this might account for the apparently low level of expression of the related OsSPS11 sense gene, adding to the already extensive list of mechanisms for regulating the activity of SPS in plants. PMID:15247374

  12. Differential expression of three eucalyptus secondary cell wall-related cellulose synthase genes in response to tension stress.

    PubMed

    Lu, Shanfa; Li, Laigeng; Yi, Xiaoping; Joshi, Chandrashekhar P; Chiang, Vincent L

    2008-01-01

    Trees constitute the majority of lignocellulosic biomass existing on our planet. Trees also serve as important feedstock materials for various industrial products. However, little is known about the regulatory mechanisms of cellulose synthase (CesA) genes of trees. Here, the cloning and characterization of three CesA genes (EgraCesA1, EgraCesA2, and EgraCesA3) from an economically important tree species, Eucalyptus grandis, are reported. All three genes were specifically expressed in xylem cells of eucalyptus undergoing secondary cell wall biosynthesis. The GUS gene, expressed under the control of the EgraCesA2 or EgraCesA3 promoter, was also localized in the secondary xylem in transgenic tobacco stems. However, the EgraCesA1 promoter alone or along with its 5'-UTR introns was insufficient to direct appropriate GUS expression. EgraCesA2 and EgraCesA3 gene expression was up-regulated in tension-stressed eucalyptus xylem cells. Accordingly, GUS expression directed by the EgraCesA2 or EgraCesA3 promoter was also up-regulated. EgraCesA1 had no such response. Thus, it is most unlikely that EgraCesA1 is a subunit of the EgraCesA2-EgraCesA3 complex. The presence of at least two types of cellulose biosynthesis machinery in wood formation is an important clue in deciphering the underpinnings of the perennial growth of trees in various environmental conditions. By analysing GUS gene expression directed by the EgraCesA3 promoter or its deletions, several negative and positive regulatory regions controlling gene expression in xylem or phloem were identified. Also a region which is likely to contain mechanical stress-responsive elements was deduced. These results will guide further studies on identifying cis-regulatory elements directing CesA gene transcription and wood formation regulatory networks.

  13. 1-Deoxy-d-Xylulose 5-Phosphate Synthase, the Gene Product of Open Reading Frame (ORF) 2816 and ORF 2895 in Rhodobacter capsulatus

    PubMed Central

    Hahn, Frederick M.; Eubanks, Lisa M.; Testa, Charles A.; Blagg, Brian S. J.; Baker, Jonathan A.; Poulter, C. Dale

    2001-01-01

    In eubacteria, green algae, and plant chloroplasts, isopentenyl diphosphate, a key intermediate in the biosynthesis of isoprenoids, is synthesized by the methylerythritol phosphate pathway. The five carbons of the basic isoprenoid unit are assembled by joining pyruvate and d-glyceraldehyde 3-phosphate. The reaction is catalyzed by the thiamine diphosphate-dependent enzyme 1-deoxy-d-xylulose 5-phosphate synthase. In Rhodobacter capsulatus, two open reading frames (ORFs) carry the genes that encode 1-deoxy-d-xylulose 5-phosphate synthase. ORF 2816 is located in the photosynthesis-related gene cluster, along with most of the genes required for synthesis of the photosynthetic machinery of the bacterium, whereas ORF 2895 is located elsewhere in the genome. The proteins encoded by ORF 2816 and ORF 2895, 1-deoxy-d-xylulose 5-phosphate synthase A and B, containing a His6 tag, were synthesized in Escherichia coli and purified to greater than 95% homogeneity in two steps. 1-Deoxy-d-xylulose 5-phosphate synthase A appears to be a homodimer with 68 kDa subunits. A new assay was developed, and the following steady-state kinetic constants were determined for 1-deoxy-d-xylulose 5-phosphate synthase A and B: Kmpyruvate = 0.61 and 3.0 mM, Kmd-glyceraldehyde 3-phosphate = 150 and 120 μM, and Vmax = 1.9 and 1.4 μmol/min/mg in 200 mM sodium citrate (pH 7.4). The ORF encoding 1-deoxy-d-xylulose 5-phosphate synthase B complemented the disrupted essential dxs gene in E. coli strain FH11. PMID:11114895

  14. Cloning and Characterization of a Flavonol Synthase Gene from Scutellaria baicalensis

    PubMed Central

    Kim, Yeon Bok; Kim, KwangSoo; Kim, YeJi; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  15. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium.

    PubMed

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-07-01

    The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  16. Transcriptional basis for hyporesponsiveness of the human inducible nitric oxide synthase gene to lipopolysaccharide/interferon-gamma.

    PubMed

    Zhang, X; Laubach, V E; Alley, E W; Edwards, K A; Sherman, P A; Russell, S W; Murphy, W J

    1996-04-01

    The work reported here resolves, at the level of gene regulation, the controversy as to whether or not human monocytes/macrophages can produce nitric oxide (NO) when stimulated with lipopolysaccharide (LPS), with or without co-stimulation by interferon-gamma (IFN-gamma). Studies included structural comparison of the promoters for human and mouse inducible NO synthase (iNOS) genes, transfection and assay of human and mouse iNOS promoter regions in response to LPS +/- IFN-gamma, and electrophoretic mobility shift assays of kappa B response elements. Two explanations for hyporesponsiveness of the human iNOS promoter to LPS +/- IFN-gamma were found: (1) multiple inactivating nucleotide substitutions in the human counterpart of the enhancer element that has been shown to regulate LPS/IFN-gamma induced expression of the mouse iNOS gene; and (2) and absence of one or more nuclear factors in human macrophages (e.g., an LPS-inducible nuclear factor-kappa B/Rel complex), that is (are) required for maximal expression of the gene. The importance of resolution of this controversy is that future research in this area should be directed toward the understanding of alternative mechanisms that can result in the successful production of NO.

  17. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    PubMed Central

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  18. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    PubMed

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves.

  19. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    PubMed Central

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  20. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.).

    PubMed

    Prasad, B C Narasimha; Kumar, Vinod; Gururaj, H B; Parimalan, R; Giridhar, P; Ravishankar, G A

    2006-09-05

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS ( approximately 35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes.

  1. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  2. Mutations in cystathionine beta-synthase or methylenetetrahydrofolate reductase gene increase N-homocysteinylated protein levels in humans.

    PubMed

    Jakubowski, Hieronim; Boers, Godfried H J; Strauss, Kevin A

    2008-12-01

    Severely elevated plasma homocysteine (Hcy) levels observed in genetic disorders of Hcy metabolism are associated with pathologies in multiple organs and lead to premature death due to vascular complications. In addition to elevating plasma Hcy, mutations in cystathionine beta-synthase (CBS) or methylenetetrahydrofolate reductase (MTHFR) gene lead to markedly elevated levels of circulating Hcy-thiolactone. The thiooester chemistry of Hcy-thiolactone underlies its ability to form isopeptide bonds with protein lysine residues (N-Hcy-protein), which may impair or alter the protein's function. However, it was not known whether genetic deficiencies in Hcy metabolism affect N-Hcy-protein levels in humans. Here we show that plasma N-Hcy-protein levels are significantly elevated in CBS- and MTHFR-deficient patients. We also show that CBS-deficient patients have significantly elevated plasma levels of prothrombotic N-Hcy-fibrinogen. These results provide a possible explanation for increased atherothrombosis observed in CBS-deficient patients.

  3. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    PubMed

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-03-27

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  4. Novel point mutation in the uroporphyrinogen III synthase gene causes congenital erythropoietic porphyria of a Japanese family.

    PubMed

    Takamura, N; Hombrados, I; Tanigawa, K; Namba, H; Nagayama, Y; de Verneuil, H; Yamashita, S

    1997-06-13

    The molecular basis of the uroporphyrinogen III synthase (UROIIIS) deficiency was investigated in a member of a Japanese family. This defect in heme biosynthesis is responsible for a rare autosomal recessive disease: congenital erythropoietic porphyria (CEP) or Günther's disease. The patient was homozygous for a novel missense mutation: a G to T transition of nucleotide 7 that predicted a valine to phenylalanine substitution at residue 3 (V3F). The parents were heterozygous for the same mutation. The loss of UROIIIS activity was verified by an in vitro assay system. The corresponding mutated protein was expressed in Escherichia coli and no residual activity was observed. Further studies are needed to determine whether the mutations of the UROIIIS gene (UROS) have a specific profile in Japan compared to European or American countries.

  5. Production of a freeze-thaw-stable potato starch by antisense inhibition of three starch synthase genes.

    PubMed

    Jobling, Stephen A; Westcott, Roger J; Tayal, Akash; Jeffcoat, Roger; Schwall, Gerhard P

    2002-03-01

    The use of unmodified starches in frozen foods is severely limited by the undesirable textural changes that occur after freezing and thawing. Retrogradation of glucan chains leads to syneresis, a separation of the starch gel and water phases. Stabilization of the starch structure is normally achieved by chemical modification to prevent these changes from occurring. We have now created a freeze-thaw-stable potato starch by alteration of starch composition and structure by genetic modification. An amylose-free starch with short-chain amylopectin was produced by simultaneous antisense downregulation of three starch synthase genes. This starch is extremely freeze-thaw-stable and shows no syneresis even after five freeze-thaw cycles. The use of this starch has potential for environmental and consumer benefits because its production requires no chemical modification.

  6. Overexpression of erg20 gene encoding farnesyl pyrophosphate synthase has contrasting effects on activity of enzymes of the dolichyl and sterol branches of mevalonate pathway in Trichoderma reesei.

    PubMed

    Piłsyk, Sebastian; Perlińska-Lenart, Urszula; Górka-Nieć, Wioletta; Graczyk, Sebastian; Antosiewicz, Beata; Zembek, Patrycja; Palamarczyk, Grażyna; Kruszewska, Joanna S

    2014-07-10

    The mevalonate pathway is the most diverse metabolic route resulting in the biosynthesis of at least 30,000 isoprenoid compounds, many of which, such as sterols or dolichols, are indispensable for living cells. In the filamentous fungus Trichoderma of major biotechnological interest isoprenoid metabolites are also involved in the biocontrol processes giving the mevalonate pathway an additional significance. On the other hand, little is known about genes coding for enzymes of the mevalonate pathway in Trichoderma. Here, we present cloning and functional analysis of the erg20 gene from Trichoderma reesei coding for farnesyl pyrophosphate (FPP) synthase (EC 2.5.1.10), an enzyme located at the branching point of the mevalonate pathway. Expression of the gene in a thermosensitive erg20-2 mutant of Saccharomyces cerevisiae impaired in the FPP synthase activity suppressed the thermosensitive phenotype. The same gene overexpressed in T. reesei significantly enhanced the FPP synthase activity and also stimulated the activity of cis-prenyltransferase, an enzyme of the dolichyl branch of the mevalonate pathway. Unexpectedly, the activity of squalene synthase from the other, sterol branch, was significantly decreased without, however, affecting ergosterol level.

  7. Differential induction of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack.

    PubMed Central

    Keith, B; Dong, X N; Ausubel, F M; Fink, G R

    1991-01-01

    We have isolated cDNAs from two distinct genes encoding 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase (EC 4.1.2.15) in Arabidopsis thaliana. Predicted protein sequences from both genes, DHS1 and DHS2, and a potato DAHP synthase gene are highly related, but none shows significant sequence similarity to conserved microbial DAHP synthase proteins. Despite this structural difference, the DHS1 cDNA complements mutations in a yeast strain lacking DAHP synthase activity. DHS1 RNA levels increase in Arabidopsis leaves subjected either to physical wounding or to infiltration with pathogenic Pseudomonas syringae strains. DHS2 RNA levels are not increased by these treatments, suggesting that the DHS1 and DHS2 proteins fulfill different physiological functions. Other enzymes in the Arabidopsis aromatic pathway are also encoded by duplicated genes, an arrangement that may allow independent regulation of aromatic amino acid biosynthesis by distinct physiological requirements such as protein synthesis and secondary metabolism. The presence of amino-terminal extensions characteristic of chloroplast transit peptides on DHS1 and DHS2 suggests that both proteins may be targeted to the chloroplast. Images PMID:1681544

  8. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    PubMed

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  9. GENERAL: The effect of ACC vehicles to mixed traffic flow consisting of manual and ACC vehicles

    NASA Astrophysics Data System (ADS)

    Xie, Dong-Fan; Gao, Zi-You; Zhao, Xiao-Mei

    2008-12-01

    This paper studies the effect of adaptive cruise control (ACC) system on traffic flow by using simulations. The multiple headway and velocity direrence (MHVD) model is used to depict the motion of ACC vehicles, and the simulation results are compared with the optimal velocity (OV) model which is used to depict the motion of manual vehicles. Compared the cases between the manual and the ACC vehicle flow, the fundamental diagram can be classified into four regions: I, II, III, IV. In low and high density the flux of the two models is the same; in region II the free flow region of the MHVD model is enlarged, and the flux of the MHVD model is larger than that of the OV model; in region III serious jams occur in the OV model while the ACC system suppresses the jams in the MHVD model and the traffic flow is in order, but the flux of the OV model is larger than that of the MHVD model. Similar phenomena also appeared in mixed traffic flow which consists of manual and ACC vehicles. The results indicate that ACC vehicles have significant effect on traffic flow. The improvement induced by ACC vehicles decreases with the increasing proportion of ACC vehicles.

  10. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  11. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  12. Structure Conservation and Differential Expression of Farnesyl Diphosphate Synthase Genes in Euphorbiaceous Plants

    PubMed Central

    Guo, Dong; Li, Hui-Liang; Peng, Shi-Qing

    2015-01-01

    Farnesyl diphosphate synthase (FPS) is a key enzyme of isoprenoids biosynthesis. However, knowledge of the FPSs of euphorbiaceous species is limited. In this study, ten FPSs were identified in four euphorbiaceous plants. These FPSs exhibited similar exon/intron structure. The deduced FPS proteins showed close identities and exhibited the typical structure of plant FPS. The members of the FPS family exhibit tissue expression patterns that vary among several euphorbiaceous plant species under normal growth conditions. The expression profiles reveal spatial and temporal variations in the expression of FPSs of different tissues from Euphorbiaceous plants. Our results revealed wide conservation of FPSs and diverse expression in euphorbiaceous plants during growth and development. PMID:26389894

  13. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    PubMed Central

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes. PMID:25784918

  14. Gene expression of mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase in a poorly ketogenic mammal: effect of starvation during the neonatal period of the piglet.

    PubMed

    Adams, S H; Alho, C S; Asins, G; Hegardt, F G; Marrero, P F

    1997-05-15

    The low ketogenic capacity of pigs correlates with a low activity of mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase. To identify the molecular mechanism controlling such activity, we isolated the pig cDNA encoding this enzyme and analysed changes in mRNA levels and mitochondrial specific activity induced during development and starvation. Pig mitochondrial synthase showed a tissue-specific expression pattern. As with rat and human, the gene is expressed in liver and large intestine; however, the pig differs in that mRNA was not detected in testis, kidney or small intestine. During development, pig mitochondrial HMG-CoA synthase gene expression showed interesting differences from that in the rat: (1) there was a 2-3 week lag in the postnatal induction; (2) the mRNA levels remained relatively abundant through the suckling-weaning transition and at maturity, in contrast with the fall observed in rats at similar stages of development; and (3) the gene expression was highly induced by fasting during the suckling, whereas no such change in mitochondrial HMG-CoA synthase mRNA levels has been observed in rat. The enzyme activity of mitochondrial HMG-CoA synthase increased 27-fold during starvation in piglets, but remained one order of magnitude lower than rats. These results indicate that post-transcriptional mechanism(s) and/or intrinsic differences in the encoded enzyme are responsible for the low activity of pig HMG-CoA synthase observed throughout development or after fasting.

  15. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis.

    PubMed

    Pazouki, Leila; Memari, Hamid R; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS) that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS). The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3), functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP), while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP) and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP). Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  16. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  17. Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L.).

    PubMed

    Qin, Xiaoqiong; Coku, Ardian; Inoue, Kentaro; Tian, Li

    2011-10-01

    Carotenoids perform many critical functions in plants, animals, and humans. It is therefore important to understand carotenoid biosynthesis and its regulation in plants. Phytoene synthase (PSY) catalyzes the first committed and rate-limiting step in carotenoid biosynthesis. While PSY is present as a single copy gene in Arabidopsis, duplicated PSY genes have been identified in many economically important monocot and dicot crops. CmPSY1 was previously identified from melon (Cucumis melo L.), but was not functionally characterized. We isolated a second PSY gene, CmPSY2, from melon in this work. CmPSY2 possesses a unique intron/exon structure that has not been observed in other plant PSYs. Both CmPSY1 and CmPSY2 are functional in vitro, but exhibit distinct expression patterns in different melon tissues and during fruit development, suggesting differential regulation of the duplicated melon PSY genes. In vitro chloroplast import assays verified the plastidic localization of CmPSY1 and CmPSY2 despite the lack of an obvious plastid target peptide in CmPSY2. Promoter motif analysis of the duplicated melon and tomato PSY genes and the Arabidopsis PSY revealed distinctive cis-regulatory structures of melon PSYs and identified gibberellin-responsive motifs in all PSYs except for SlPSY1, which has not been reported previously. Overall, these data provide new insights into the evolutionary history of plant PSY genes and the regulation of PSY expression by developmental and environmental signals that may involve different regulatory networks.

  18. Copy Number Variation in Acetolactate Synthase Genes of Thifensulfuron-Methyl Resistant Alopecurus aequalis (Shortawn Foxtail) Accessions in Japan

    PubMed Central

    Iwakami, Satoshi; Shimono, Yoshiko; Manabe, Yohei; Endo, Masaki; Shibaike, Hiroyuki; Uchino, Akira; Tominaga, Tohru

    2017-01-01

    Severe infestations of Alopecurus aequalis (shortawn foxtail), a noxious weed in wheat and barley cropping systems in Japan, can occur even after application of thifensulfuron-methyl, a sulfonylurea (SU) herbicide. In the present study, nine accessions of A. aequalis growing in a single wheat field were tested for sensitivity to thifensulfuron-methyl. Seven of the nine accessions survived application of standard field rates of thifensulfuron-methyl, indicating that severe infestations likely result from herbicide resistance. Acetolactate synthase (ALS) is the target enzyme of SU herbicides. Full-length genes encoding ALS were therefore isolated to determine the mechanism of SU resistance. As a result, differences in ALS gene copy numbers among accessions were revealed. Two copies, ALS1 and ALS2, were conserved in all accessions, while some carried two additional copies, ALS3 and ALS4. A single-base deletion in ALS3 and ALS4 further indicated that they represent pseudogenes. No differences in ploidy level were observed between accessions with two or four copies of the ALS gene, suggesting that copy number varies. Resistant plants were found to carry a mutation in either the ALS1 or ALS2 gene, with all mutations causing an amino acid substitution at the Pro197 residue, which is known to confer SU resistance. Transcription of each ALS gene copy was confirmed by reverse transcription PCR, supporting involvement of these mutations in SU resistance. The information on the copy number and full-length sequences of ALS genes in A. aequalis will aid future analysis of the mechanism of resistance. PMID:28303143

  19. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life.

    PubMed

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  20. Evolution and Functional Insights of Different Ancestral Orthologous Clades of Chitin Synthase Genes in the Fungal Tree of Life

    PubMed Central

    Li, Mu; Jiang, Cong; Wang, Qinhu; Zhao, Zhongtao; Jin, Qiaojun; Xu, Jin-Rong; Liu, Huiquan

    2016-01-01

    Chitin synthases (CHSs) are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III) was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc) identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene family in the fungal

  1. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI) gene detected in Acinetobacter baumannii

    PubMed Central

    Modarresi, Farzan; Azizi, Omid; Shakibaie, Mohammad Reza; Motamedifar, Mohammad; Mansouri, Shahla

    2016-01-01

    Background and Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants. Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned into pTG19 and transformed to E. coli DH5α. The gene was then recovered from agarose gel and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. pET28a + luxI was transformed into E. coli BL21 (DE3). The luxI putative gene was further detected in the transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR) and the presence of N-acylhomoserine lactone (AHL) was checked by colorimetric assay and Fourier Transform Infra-Red (FT-IR) spectroscopy. Results: We successfully cloned AHL gene from A. baumannii strain 23 to pET28a expression vector. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05). It was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524). The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H) at 1764.69 cm−1 and 1659.23 cm−1 respectively. Conclusion: From above results we concluded that, luxI in A. baumannii is indeed responsible for AHL production and not regulation and pET28a vector allows efficient AHL expression in E. coli BL21 transformants. PMID:27307980

  2. Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture.

    PubMed

    Saleem, Muhammad; Arshad, Muhammad; Hussain, Sarfraz; Bhatti, Ahmad Saeed

    2007-10-01

    Ethylene is a gaseous plant growth hormone produced endogenously by almost all plants. It is also produced in soil through a variety of biotic and abiotic mechanisms, and plays a key role in inducing multifarious physiological changes in plants at molecular level. Apart from being a plant growth regulator, ethylene has also been established as a stress hormone. Under stress conditions like those generated by salinity, drought, waterlogging, heavy metals and pathogenicity, the endogenous production of ethylene is accelerated substantially which adversely affects the root growth and consequently the growth of the plant as a whole. Certain plant growth promoting rhizobacteria (PGPR) contain a vital enzyme, 1-aminocyclopropane-1-carboxylate (ACC) deaminase, which regulates ethylene production by metabolizing ACC (an immediate precursor of ethylene biosynthesis in higher plants) into alpha-ketobutyrate and ammonia. Inoculation with PGPR containing ACC deaminase activity could be helpful in sustaining plant growth and development under stress conditions by reducing stress-induced ethylene production. Lately, efforts have been made to introduce ACC deaminase genes into plants to regulate ethylene level in the plants for optimum growth, particularly under stressed conditions. In this review, the primary focus is on giving account of all aspects of PGPR containing ACC deaminase regarding alleviation of impact of both biotic and abiotic stresses onto plants and of recent trends in terms of introduction of ACC deaminase genes into plant and microbial species.

  3. Bioinformatic comparisons and tissue expression of the neuronal nitric oxide synthase (nNOS) gene from the red drum (Sciaenops ocellatus).

    PubMed

    Zhou, Libin; Bai, Ru; Tian, Jianxiao; Liu, Xiaochun; Lu, Danqi; Zhu, Pei; Liu, Yun; Zeng, Lujiao; Luo, Wenna; Zhang, Yong; Wang, Anli

    2009-10-01

    The full length cDNA sequence for neuronal nitric oxide synthase (nNOS) gene from red drum (Sciaenops ocellatus) has been cloned, subjected to bioinformatic analysis, and examined for expression in different tissues. Red drum nNOS showed high identity to nNOS of mammals and other fish species. Notably, a unique 7-aa insertion was found in the important catalytic sites of the NO synthase domain, possibly affecting the function of red drum nNOS. Furthermore, this nNOS was expressed not only in brain but also in most of the internal organs including liver, intestine, spleen, head kidney and thymus.

  4. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    PubMed

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori.

  5. Functional polymorphism of the promoter region of the prostacyclin synthase gene and severity of RSV infection in hospitalized children.

    PubMed

    Hashimoto, Koichi; Ishibashi, Kei; Gebretsadik, Tebeb; Hartert, Tina V; Yamamoto, Akihiro; Nakayama, Tomohiro; Ohashi, Kazutaka; Sakata, Hiroshi; Kawasaki, Yukihiko; Katayose, Masahiko; Sakuma, Hiroko; Suzuki, Hitoshi; Hosoya, Mitsuaki; Peebles, Ray Stokes; Suzutani, Tatsuo

    2008-11-01

    Prostaglandin I(2) (PGI(2)) protects against RSV-induced illness in mice. A variable-number tandem repeat (VNTR) polymorphism has been detected in the promoter region of the PGI(2) synthase (PGIS) gene. We sought to determine if PGI(2) concentrations or polymorphisms of the PGIS gene correlate with severity of RSV lower respiratory tract infections (LRTI) in human infants. VNTR polymorphisms were studied in 81 previously healthy children between birth and 12 months of age who were hospitalized for LRTI due to RSV and 98 healthy adult control subjects. The severity of RSV infection was quantified using a clinical scoring system, and infant urine samples were collected during the acute illness for measurement of the urinary metabolite of PGI(2). There were no significant differences in the overall distribution of alleles and genotypes between infants with RSV LRTI and the control subjects. The severity of RSV infection significantly inversely correlated with urinary PGI(2) metabolite concentrations. The urinary PGI(2) metabolite concentration correlated with the number of VNTR. The presence of a genotype with a low number VNTR repeats significantly correlated with the most severe RSV LRTI, and genotypes with the highest number of VNTR correlated with the least severe RSV LRTI. A functional polymorphism in the promoter region of the PGIS gene is associated with both significant differences in urinary PGI(2) concentrations during RSV LRTI, and severity of RSV infection in previously healthy infants.

  6. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    PubMed

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  7. Increase in the astaxanthin synthase gene (crtS) dose by in vivo DNA fragment assembly in Xanthophyllomyces dendrorhous

    PubMed Central

    2013-01-01

    Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that is relevant to biotechnology, as it can synthesize the carotenoid astaxanthin. However, the astaxanthin levels produced by wild-type strains are low. Although different approaches for promoting increased astaxanthin production have been attempted, no commercially competitive results have been obtained thus far. A promising alternative to facilitate the production of carotenoids in this yeast involves the use of genetic modification. However, a major limitation is the few available molecular tools to manipulate X. dendrorhous. Results In this work, the DNA assembler methodology that was previously described in Saccharomyces cerevisiae was successfully applied to assemble DNA fragments in vivo and integrate these fragments into the genome of X. dendrorhous by homologous recombination in only one transformation event. Using this method, the gene encoding astaxanthin synthase (crtS) was overexpressed in X. dendrorhous and a higher level of astaxanthin was produced. Conclusions This methodology could be used to easily and rapidly overexpress individual genes or combinations of genes simultaneously in X. dendrorhous, eliminating numerous steps involved in conventional cloning methods. PMID:24103677

  8. Expression of ripening-related genes in prickly pear (Opuntia sp.) fruits.

    PubMed

    Collazo-Siqués, P; Valverde, M E; Paredes-López, O; Guevara-Lara, F

    2003-01-01

    To throw light on the expression of ripening-related genes in prickly pear (Opuntia sp.) fruits and on the possible role of the gaseous hormone ethylene in nonclimacteric fruit ripening, cDNA fragments that showed high homologies with 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase cDNAs from other plants were cloned and partially characterized. Thus, the corresponding genes were accordingly named opaccs-1 and opacco-1, after Opuntia ACC synthase-1 and Opuntia ACC oxidase-1, respectively. Southern analysis suggests the presence of at least one copy of both genes, as well as other related homologous sequences in the Opuntia genome. Northern analysis of the opaccs-1 gene shows an enhanced expression in ripening fruit tissues, whereas opacco-1 expression is highly induced in ripe tissues with respect to the green fruits and mature cladodes. These results are in agreement with an active metabolic role of ethylene during nonclimacteric prickly pear fruit ripening. This is the first report on the analysis at the molecular level of ripening-related genes of the Opuntia genus.

  9. Mutations in the liver glycogen synthase gene in children with hypoglycemia due to glycogen storage disease type 0.

    PubMed Central

    Orho, M; Bosshard, N U; Buist, N R; Gitzelmann, R; Aynsley-Green, A; Blümel, P; Gannon, M C; Nuttall, F Q; Groop, L C

    1998-01-01

    Glycogen storage disease type 0 (GSD-0) is a rare form of fasting hypoglycemia presenting in infancy or early childhood and accompanied by high blood ketones and low alanine and lactate concentrations. Although feeding relieves symptoms, it often results in postprandial hyperglycemia and hyperlactatemia. The glycogen synthase (GS) activity has been low or immeasurable in liver biopsies, whereas the liver glycogen content has been only moderately decreased. To investigate whether mutations in the liver GS gene (GYS2) on chromosome 12p12.2 were involved in GSD-0, we determined the exon-intron structure of the GYS2 gene and examined nine affected children from five families for linkage of GSD-0 to the GYS2 gene. Mutation screening of the 16 GYS2 exons was done by single-strand conformational polymorphism (SSCP) and direct sequencing. Liver GS deficiency was diagnosed from liver biopsies (GS activity and glycogen content). GS activity in the liver of the affected children was extremely low or nil, resulting in subnormal glycogen content. After suggestive linkage to the GYS2 gene had been established (LOD score = 2.9; P < 0.01), mutation screening revealed several different mutations in these families, including a premature stop codon in exon 5 (Arg246X), a 5'-donor splice site mutation in intron 6 (G+1T--> CT), and missense mutations Asn39Ser, Ala339Pro, His446Asp, Pro479Gln, Ser483Pro, and Met491Arg. Seven of the affected children carried mutations on both alleles. The mutations could not be found in 200 healthy persons. Expression of the mutated enzymes in COS7 cells indicated severely impaired GS activity. In conclusion, the results demonstrate that GSD-0 is caused by different mutations in the GYS2 gene. PMID:9691087

  10. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    PubMed

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  11. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    PubMed

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-12-29

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain.

  12. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    SciTech Connect

    Pejcha, Robert; Ludwig, Martha L.

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  13. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  14. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea

    PubMed Central

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  15. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  16. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  17. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  18. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  19. Dynamic Modulation of Thymidylate Synthase Gene Expression and Fluorouracil Sensitivity in Human Colorectal Cancer Cells

    PubMed Central

    Wakasa, Kentaro; Kawabata, Rumi; Nakao, Seiki; Hattori, Hiroyoshi; Taguchi, Kenichi; Uchida, Junji; Yamanaka, Takeharu; Maehara, Yoshihiko; Fukushima, Masakazu; Oda, Shinya

    2015-01-01

    Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS) expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU) treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy. PMID:25881233

  20. In silico identification and analysis of phytoene synthase genes in plants.

    PubMed

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  1. Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer

    SciTech Connect

    Hur, Hyuk; Kang, Jeonghyun; Kim, Nam Kyu; Min, Byung Soh; Lee, Kang Young; Shin, Sang Joon; Keum, Ki Chang; Choi, Junjeong; Kim, Hoguen; Choi, Sung Ho; Lee, Mi-Young

    2011-11-01

    Purpose: This study aims to correlate thymidylate synthase (TS) gene polymorphisms with the tumor response to preoperative 5-fluorouracil (5-FU)-based chemoradiation therapy (CRT) in patients with rectal cancer. Methods and Materials: Forty-four patients with rectal cancer treated with 5-FU-based preoperative CRT were prospectively enrolled in this study. Thymidylate synthase expression and TS gene polymorphisms were evaluated in tumor obtained before preoperative CRT and were correlated with the pathologic response, as assessed by histopathologic staging (pTNM) and tumor regression grade. Results: Patients exhibited 2R/3R and 3R/3R tandem repeat polymorphisms in the TS gene. With regard to TS expression in these genotypes, 2R/3RC and 3RC/3RC were defined as the low-expression group and 2R/3RG, 3RC/3RG, and 3RG/3RG as the high-expression group. There was no significant correlation between TS expression and tumor response. There was no significant difference in the tumor response between patients homozygous for 3R/3R and patients heterozygous for 2R/3R. However, 13 of 14 patients in the low-expression group with a G>C single-nucleotide polymorphism (SNP) (2R/3RC [n = 5] or 3RC/3RC [n = 9]) exhibited a significantly greater tumor downstaging rate, as compared with only 12 of 30 patients in the high-expression group without the SNP (2R/3RG [n = 10], 3RC/3RG [n = 9], or 3RG/3RG [n = 11]) (p = 0.001). The nodal downstaging rate was also significantly greater in this low-expression group, as compared with the high-expression group (12 of 14 vs. 14 of 30, p = 0.014). However, there was no significant difference in the tumor regression grade between these groups. Conclusions: This study suggests that SNPs within the TS enhancer region affect the tumor response to preoperative 5-FU-based CRT in rectal cancer.

  2. Isolation and chromosomal localization of the human endothelial nitric oxide synthase (NOS3) gene

    SciTech Connect

    Robinson, L.J.; Michel, T.; Weremowicz, S.; Morton, C.C. )

    1994-01-15

    Endothelial NOS activity is a major determinant of vascular tone and blood pressure, and in several important (and sometimes hereditary) disease states, such as hypertension, diabetes, and atherosclerosis, the endothelial NO signaling system appears to be abnormal. To explore the relationship of the endothelial NOS activity, the authors isolated the human gene encoding the endothelial NOS. Genomic clones containing the 5[prime] end of this gene were identified in a human genomic library by applying a polymerase chain reaction (PCR)-based approach. Identification of the human gene for endothelial NOS (NOS3) was confirmed by nucleotide sequence analysis of the first coding exon, which was found to be identical to its cognate cDNA. The NOS3 gene spans at least 20 kb and appears to contain multiple introns. The transcription start site and promoter region of the NOS3 gene were identified by primer extension and ribonuclease protection assays. Sequencing of the putative promoter revealed consensus sequences for the shear stress-response element, as well as cytokine-responsive cis regulatory sequences, both possible important to the roles played by NOS3 in the normal and the diseased cardiovascular system. The authors also mapped the chromosomal location of the NOS3 gene. First, a chromosomal panel of human-rodent somatic cell hybrids was screened using PCR with oligonucleotide primers derived from the NOS3 genomic clone. The specificity of the amplified PCR product was confirmed by human and hamster genomic DNA controls, as well as by Southern blot analysis, using the NOS3 cDNA as probe. Definitive chromosomal assignment of the NOS3 gene to human chromosome 7 was based upon 0% discordancy; fluorescence in situ hybridization sublocalized the NOS3 gene to 7q36. The identification and characterization of the NOS3 gene may lead to further insights into heritable disease states associated with this gene product. 41 refs., 3 figs., 1 tab.

  3. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    PubMed

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  4. Polyketide Synthase Gene Diversity within the Microbiome of the Sponge Arenosclera brasiliensis, Endemic to the Southern Atlantic Ocean

    PubMed Central

    Trindade-Silva, Amaro E.; Rua, Cintia P. J.; Andrade, Bruno G. N.; Vicente, Ana Carolina Paulo; Silva, Genivaldo G. Z.

    2013-01-01

    Microbes associated with marine sponges are considered important producers of bioactive, structurally unique polyketides. The synthesis of such secondary metabolites involves type I polyketide synthases (PKSs), which are enzymes that reach a maximum complexity degree in bacteria. The Haplosclerida sponge Arenosclera brasiliensis hosts a complex microbiota and is the source of arenosclerins, alkaloids with cytotoxic and antibacterial activity. In the present investigation, we performed high-throughput sequencing of the ketosynthase (KS) amplicon to investigate the diversity of PKS genes present in the metagenome of A. brasiliensis. Almost 4,000 ketosynthase reads were recovered, with about 90% annotated automatically as bacterial. A total of 235 bacterial KS contigs was rigorously assembled from this sequence pool and submitted to phylogenetic analysis. A great diversity of six type I PKS groups has been consistently detected in our phylogenetic reconstructions, including a novel and A. brasiliensis-exclusive group. Our study is the first to reveal the diversity of type I PKS genes in A. brasiliensis as well as the potential of its microbiome to serve as a source of new polyketides. PMID:23275501

  5. The Class II Trehalose 6-phosphate Synthase Gene PvTPS9 Modulates Trehalose Metabolism in Phaseolus vulgaris Nodules

    PubMed Central

    Barraza, Aarón; Contreras-Cubas, Cecilia; Estrada-Navarrete, Georgina; Reyes, José L.; Juárez-Verdayes, Marco A.; Avonce, Nelson; Quinto, Carmen; Díaz-Camino, Claudia; Sanchez, Federico

    2016-01-01

    Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS) of common bean (Phaseolus vulgaris), was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1%) of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant. PMID:27847509

  6. Fatty acid synthase 2 contributes to diapause preparation in a beetle by regulating lipid accumulation and stress tolerance genes expression

    PubMed Central

    Tan, Qian-Qian; Liu, Wen; Zhu, Fen; Lei, Chao-Liang; Wang, Xiao-Ping

    2017-01-01

    Diapause, also known as dormancy, is a state of arrested development that allows insects to survive unfavorable environmental conditions. Diapause-destined insects store large amounts of fat when preparing for diapause. However, the extent to which these accumulated fat reserves influence diapause remains unclear. To address this question, we investigated the function of fatty acid synthase (FAS), which plays a central role in lipid synthesis, in stress tolerance, the duration of diapause preparation, and whether insects enter diapause or not. In diapause-destined adult female cabbage beetles, Colaphellus bowringi, FAS2 was more highly expressed than FAS1 at the peak stage of diapause preparation. FAS2 knockdown suppressed lipid accumulation and subsequently affected stress tolerance genes expression and water content. However, silencing FAS2 had no significant effects on the duration of diapause preparation or the incidence of diapause. FAS2 transcription was suppressed by juvenile hormone (JH) and the JH receptor methoprene-tolerant (Met). These results suggest that the absence of JH-Met induces FAS2 expression, thereby promoting lipid storage in diapause-destined female beetles. These results demonstrate that fat reserves regulate stress tolerance genes expression and water content, but have no significant effect on the duration of diapause preparation or the incidence of diapause. PMID:28071706

  7. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  8. Gene therapy via inducible nitric oxide synthase: a tool for the treatment of a diverse range of pathological conditions.

    PubMed

    McCarthy, Helen O; Coulter, Jonathan A; Robson, Tracy; Hirst, David G

    2008-08-01

    Nitric oxide (NO(.)) is a reactive nitrogen radical produced by the NO synthase (NOS) enzymes; it affects a plethora of downstream physiological and pathological processes. The past two decades have seen an explosion in the understanding of the role of NO(.) biology, highlighting various protective and damaging modes of action. Much of the controversy surrounding the role of NO(.) relates to the differing concentrations generated by the three isoforms of NOS. Both calcium-dependent isoforms of the enzyme (endothelial and neuronal NOS) generate low-nanomolar/picomolar concentrations of NO(.). By contrast, the calcium-independent isoform (inducible NOS (iNOS)) generates high concentrations of NO(.), 2-3 orders of magnitude greater. This review summarizes the current literature in relation to iNOS gene therapy for the therapeutic benefit of various pathological conditions, including various states of vascular disease, wound healing, erectile dysfunction, renal dysfunction and oncology. The available data provide convincing evidence that manipulation of endogenous NO(.) using iNOS gene therapy can provide the basis for future clinical trials.

  9. Cloning and functional analysis of farnesyl diphosphate synthase (FPPS) gene from Mylabris cichorii Cloning, functional analysis of McFPPS.

    PubMed

    Zha, Shenfang; Yin, Youping; Wang, Yu; Huang, Yi; Li, Yan; Wang, Zhongkang

    2016-03-14

    Cantharidin, a defensive terpene compound synthesized by the meloid beetle (Coleoptera, Meloidae), is an important anti-cancer agent. However, there has been little study done on how this compound synthesized by the beetle. In this paper, a farnesyl-diphosphate synthase gene, designated McFPPS, was isolated from Mylabris cichorii by RT-PCR based on conserved domains in other organisms. Multiple alignment analysis showed that the deduced amino acids shared >70% homology with FPPSs from other species and contained typically seven conservative regions. Expression profile analysis revealed that McFPPS was expressed throughout the tested growth stages of M. cichorii adults; whereas the transcripts accumulated to the highest level at 20 d male adults while the highest expression level appeared at 15 d females. Tissue expression pattern analysis showed McFPPS was expressed constitutively in all tested tissues and a relatively higher expression level in the alimentary canal of males, but no significant tissue difference in the females. For the first time, a RNA interference strategy was employed to induce a greater suppression of McFPPS mRNA, and thus, a sharp decrease in the expression levels of downstream genes and the concentration of product. All these results indicated McFPPS may be directly involved or play an essential role in the biosynthesis of cantharidin. This article is protected by copyright. All rights reserved.

  10. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    PubMed

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  11. Inducible nitric oxide synthase expression in chronic viral hepatitis. Evidence for a virus-induced gene upregulation.

    PubMed Central

    Majano, P L; García-Monzón, C; López-Cabrera, M; Lara-Pezzi, E; Fernández-Ruiz, E; García-Iglesias, C; Borque, M J; Moreno-Otero, R

    1998-01-01

    Increased nitric oxide (NO) production may contribute to the pathological changes featuring in some inflammatory diseases, but the role of NO in chronic viral hepatitis is still unknown. We compared the inducible NO synthase (NOS2) expression in the liver of patients with chronic viral hepatitis with that of both nonviral liver disease and histologically normal liver. NOS2 expression was assessed by immunohistochemical and in situ hybridization studies of liver biopsy sections. An intense hepatocellular NOS2 reactivity was detected in chronic viral hepatitis, whereas it was weakly or not observed in nonviral liver disease or normal liver, respectively. In addition, we determined whether the hepatitis B virus (HBV) might regulate the synthesis of this enzyme. NOS2 mRNA and protein levels as well as enzyme activity were assessed in cytokine-stimulated HBV-transfected and untransfected hepatoma cells. Transfection with either HBV genome or HBV X gene resulted in induction of NOS2 mRNA expression, and the maximal induction of this transcript and NO production was observed in cytokine-stimulated HBV-transfected cells. These results indicate that hepatotropic viral infections are able to upregulate the NOS2 gene expression in human hepatocytes, suggesting that NO may mediate important pathogenic events in the course of chronic viral hepatitis. PMID:9525976

  12. Bioinformatic and molecular analysis of hydroxymethylbutenyl diphosphate synthase (GCPE) gene expression during carotenoid accumulation in ripening tomato fruit.

    PubMed

    Rodríguez-Concepción, Manuel; Querol, Jordi; Lois, Luisa María; Imperial, Santiago; Boronat, Albert

    2003-07-01

    Carotenoids are plastidic isoprenoid pigments of great biological and biotechnological interest. The precursors for carotenoid production are synthesized through the recently elucidated methylerythritol phosphate (MEP) pathway. Here we have identified a tomato ( Lycopersicon esculentum Mill.) cDNA sequence encoding a full-length protein with homology to the MEP pathway enzyme hydroxymethylbutenyl 4-diphosphate synthase (HDS, also called GCPE). Comparison with other plant and bacterial HDS sequences showed that the plant enzymes contain a plastid-targeting N-terminal sequence and two highly conserved plant-specific domains in the mature protein with no homology to any other sequence in the databases. The ubiquitous distribution of HDS-encoding expressed sequence tags (ESTs) in the tomato collections suggests that the corresponding gene is likely expressed throughout the plant. The role of HDS in controlling the supply of precursors for carotenoid biosynthesis was estimated from the bioinformatic and molecular analysis of transcript abundance in different stages of fruit development. No significant changes in HDS gene expression were deduced from the statistical analysis of EST distribution during fruit ripening, when an active MEP pathway is required to support a massive accumulation of carotenoids. RNA blot experiments confirmed that similar transcript levels were present in both the wild-type and carotenoid-depleted yellow ripe ( r) mutant fruit independent of the stage of development and the carotenoid composition of the fruit. Together, our results are consistent with a non-limiting role for HDS in carotenoid biosynthesis during tomato fruit ripening.

  13. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    PubMed

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  14. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  15. Nitric oxide regulates nitric oxide synthase-2 gene expression by inhibiting NF-kappaB binding to DNA.

    PubMed Central

    Park, S K; Lin, H L; Murphy, S

    1997-01-01

    Treatment of astroglial cells with interleukin 1beta and interferon gamma transcriptionally activates the nitric oxide synthase (NOS)-2 gene. The duration of mRNA expression is brief because of transcript instability. In addition, NO donors reduce the expression of NOS-2 mRNA dramatically by reducing the rate of transcription. In this study we observed that the NO donor, spermine NONOate did not inhibit the activation and translocation of NF-kappaB, a key transcription factor in the induction of NOS-2, but inhibited formation of the NF-kappaB-DNA complex. This effect was reversed by methaemoglobin (acting as an NO trap) and by the reducing agent dithiothreitol. Formation of the interferon-regulatory factor-DNA complex was unaffected by NO. These results suggest that NO can modulate its own production by interfering with NF-kappaB interaction with the promoter region of the NOS gene, a negative feedback effect that may be important for limiting NO production in vivo. PMID:9065784

  16. The Class II Trehalose 6-phosphate Synthase Gene PvTPS9 Modulates Trehalose Metabolism in Phaseolus vulgaris Nodules.

    PubMed

    Barraza, Aarón; Contreras-Cubas, Cecilia; Estrada-Navarrete, Georgina; Reyes, José L; Juárez-Verdayes, Marco A; Avonce, Nelson; Quinto, Carmen; Díaz-Camino, Claudia; Sanchez, Federico

    2016-01-01

    Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS) of common bean (Phaseolus vulgaris), was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1%) of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  17. The comparative analysis of the potential relationship between resveratrol and stilbene synthase gene family in the development stages of grapes (Vitis quinquangularis and Vitis vinifera).

    PubMed

    Shi, Jiangli; He, Mingyang; Cao, Jiangling; Wang, Huan; Ding, Jiahua; Jiao, Yuntong; Li, Ruimin; He, Jing; Wang, Dan; Wang, Yuejin

    2014-01-01

    Resveratrol is positively correlated with grapevine disease resistance and its consumption is also highly beneficial to human health. HPLC analyses showed that resveratrol content was significantly higher in most wild Chinese grapevines than in most European Vitis vinifera grapevine cvs. Fruit of the wild Chinese genotype Vitis quinquangularis Danfeng-2 contains much higher levels of resveratrol than some others. Because stilbene synthase is responsible for resveratrol biosynthesis, 41 full-length stilbene synthase genes were isolated from Danfeng-2 using the RACE method. A neighbor-joining tree of the STS family displayed high similarity between Danfeng-2 and V. vinifera cv. Pinot Noir. The content of the endogenous stilbene synthase family in tissues and the expression levels induced by powdery mildew were both higher in Danfeng-2 than in Pinot Noir. Moreover, expression in the berry was significantly higher than in the leaves. Our results demonstrated that resveratrol accumulation was consistent with endogenous STS gene expressions, and that both were higher in Danfeng-2 than in Pinot Noir. Therefore, STS genes and producing resveratrol from V. quinquangularis played more important role in Vitis resistance. Otherwise, the gene VqSTS6 was markedly higher than the other VqSTS genes in the six tissues/organs assayed by Real-time PCR, which will offer a useful basis for commercial application of resveratrol from Chinese wild grapes.

  18. The glu298asp polymorphism in the nitric oxide synthase 3 gene is associated with the risk of ischemic stroke in two large independent case-control studies.

    PubMed

    Berger, Klaus; Stögbauer, Florian; Stoll, Monika; Wellmann, Juergen; Huge, Andreas; Cheng, Suzanne; Kessler, Christof; John, Ulrich; Assmann, Gerd; Ringelstein, E Bernd; Funke, Harald

    2007-04-01

    The search for genes involved in the pathogenesis of stroke has been highlighted as a field of needs. We followed the concept, that stroke represents a complex genetic disorder, and analyzed the contribution of 106 informative single nucleotide polymorphisms (SNPs) from 63 candidate genes for cardiovascular diseases for the risk of stroke. We conducted two independent case-control studies in two different German regions and recruited a total of 1,901 hospitalized stroke cases and 1,747 regional population controls. The smaller of both studies was used as the replication study. Multiplex PCR in combination with allele-specific hybridization was used for genotype determination. Descriptive statistics, permutations and multivariable logistic regression were used in the analyses. After permutation testing 5 SNPs, located in the nitric oxide synthase 3, the alpha 2 integrin, the interleukin 13, the selectin P and the chemokine receptor 2 genes, had a significant allele difference between cases and controls in the larger study. For one of these SNPs, the glu298asp polymorphism in the nitric oxide synthase 3 gene, an association with ischemic stroke was replicated in the second study and also in a combined analysis of both studies. This association was independent of age, gender, hypertension, diabetes and hypercholesterolemia in both studies. Using large sample sizes and a replication study approach, we found evidence for a role of a polymorphism in the nitric oxide synthase 3 gene in stroke onset.

  19. Induction of isoprenyl diphosphate synthases, plant hormones and defense signalling genes correlates with traumatic resin duct formation in Norway spruce (Picea abies).

    PubMed

    Schmidt, Axel; Nagel, Raimund; Krekling, Trygve; Christiansen, Erik; Gershenzon, Jonathan; Krokene, Paal

    2011-12-01

    Norway spruce (Picea abies) defends itself against herbivores and pathogens by formation of traumatic resin ducts filled with terpenoid-based oleoresin. An important group of enzymes in terpenoid biosynthesis are the short-chain isoprenyl diphosphate synthases which produce geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)) as precursors of monoterpenes, sesquiterpenes, and diterpene resin acids, respectively. After treatment with methyl jasmonate (MJ) we investigated the expression of all isoprenyl diphosphate synthase genes characterized to date from Norway spruce and correlated this with formation of traumatic resin ducts and terpene accumulation. Formation of traumatic resin ducts correlated with higher amounts of monoterpenes, sesquiterpenes and diterpene resin acids and an upregulation of isoprenyl diphosphate synthase genes producing geranyl diphosphate or geranylgeranyl diphosphate. Among defense hormones, jasmonate and jasmonate-isoleucine conjugate accumulated to higher levels in trees with extensive traumatic resin duct formation, whereas salicylate did not. Jasmonate and ethylene are likely to both be involved in formation of traumatic resin ducts based on elevated transcripts of genes encoding lipoxygenase and 1-aminocyclopropane-1-carboxylic acid oxidase associated with resin duct formation. Other genes involved in defense signalling in other systems, mitogen-activated protein kinase3 and nonexpressor of pathogenesis-related gene1, were also associated with traumatic resin duct formation. These responses were detected not only at the site of MJ treatment, but also systemically up to 60 cm above the site of treatment on the trunk.

  20. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis.

    PubMed

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-02-11

    BACKGROUND Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. MATERIAL AND METHODS PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. RESULTS Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (p<0.05, OR=1.69, 95% CI: 1.53-1.86 for T vs. C; p<0.05, OR=2.76, 95% CI: 2.03-3.75 for TT vs. CC; p<0.05, OR=1.74, 95% CI 1.56-1.95 for TT vs. (CT + CC); p<0.05, OR=2.43, 95% CI: 1.79-3.30 for (CT + TT) vs. CC). In addition, a significant association between 4b4a VNTR polymorphism and MI risk was observed. On sub-group analyses by ethnicity, a significant increase in MI risk was observed separately for Asian and Caucasian populations for T-786C polymorphism, but not for the 4b4a polymorphism. CONCLUSIONS In this meta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations.

  1. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis

    PubMed Central

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-01-01

    Background Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. Material/Methods PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. Results Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (p<0.05, OR=1.69, 95% CI: 1.53–1.86 for T vs. C; p<0.05, OR=2.76, 95% CI: 2.03–3.75 for TT vs. CC; p<0.05, OR=1.74, 95% CI 1.56–1.95 for TT vs. (CT + CC); p<0.05, OR=2.43, 95% CI: 1.79–3.30 for (CT + TT) vs. CC). In addition, a significant association between 4b4a VNTR polymorphism and MI risk was observed. On sub-group analyses by ethnicity, a significant increase in MI risk was observed separately for Asian and Caucasian populations for T-786C polymorphism, but not for the 4b4a polymorphism. Conclusions In this meta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations. PMID:28188309

  2. Biogeography of Actinomycete Communities and Type II Polyketide Synthase Genes in Soils Collected in New Jersey and Central Asia▿

    PubMed Central

    Wawrik, Boris; Kutliev, Djumaniyaz; Abdivasievna, Urinova A.; Kukor, Jerome J.; Zylstra, Gerben J.; Kerkhof, Lee

    2007-01-01

    Soil microbial communities are believed to be comprised of thousands of different bacterial species. One prevailing idea is that “everything is everywhere, and the environment selects,” implying that all types of bacteria are present in all environments where their growth requirements are met. We tested this hypothesis using actinomycete communities and type II polyketide synthase (PKS) genes found in soils collected from New Jersey and Uzbekistan (n = 91). Terminal restriction fragment length polymorphism analysis using actinomycete 16S rRNA and type II PKS genes was employed to determine community profiles. The terminal fragment frequencies in soil samples had a lognormal distribution, indicating that the majority of actinomycete phylotypes and PKS pathways are present infrequently in the environment. Less than 1% of peaks were detected in more than 50% of samples, and as many as 18% of the fragments were unique and detected in only one sample. Actinomycete 16S rRNA fingerprints clustered by country of origin, indicating that unique populations are present in North America and Central Asia. Sequence analysis of type II PKS gene fragments cloned from Uzbek soil revealed 35 novel sequence clades whose levels of identity to genes in the GenBank database ranged from 68 to 92%. The data indicate that actinomycetes are patchily distributed but that distinct populations are present in North American and Central Asia. These results have implications for microbial bioprospecting and indicate that the cosmopolitan actinomycete species and PKS pathways may account for only a small proportion of the total diversity in soil. PMID:17337547

  3. ACC forum looks at 'burning' questions

    SciTech Connect

    Carter, R.

    2005-06-01

    The American Coal Council's (ACC) Spring Coal Forum had as its theme: Coal's renaissance: prospects for regenerating coal generation'. It explored US coal demand, supply, end-user technology and market trends. The article gives an overview of the conference, highlighting several presentations. 2 figs., 1 tab.

  4. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    PubMed

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  5. Three genes encoding citrate synthases in Saccharopolyspora erythraea are regulated by the global nutrient-sensing regulators GlnR, DasR, and CRP.

    PubMed

    Liao, Cheng-Heng; Yao, Li-Li; Ye, Bang-Ce

    2014-10-08

    Saccharopolyspora erythraea has three citrate synthases encoded by gltA-2, citA, and citA4. Here, we characterized and identified the expression and regulatory properties of these synthases. Three pleiotropic global regulatory proteins of S. erythraea - CRP, GlnR, and DasR - are involved in carbon metabolism, nitrogen metabolism, and amino-sugar (chitin and GlcNAc) metabolism. Using electrophoretic mobility shift assays (EMSAs), we identified these regulators as proteins that bind directly to the promoter regions of all citrate synthase genes (gltA-2, citA, and citA4). Footprinting assays indicated the exact protect sequences of CRP, GlnR, and DasR on the promoter region of gltA-2, revealing binding competition between GlnR and DasR. Moreover, by comparing the transcription levels of citrate synthase genes between parental and glnR mutant or dasR mutant strains, or by comparing the transcription response of citrate synthases under various nutrient conditions, we found that GlnR and DasR negatively regulated citA and citA4 transcription but had no regulatory effects on the gltA-2 gene. Although no CRP mutant was available, the results indicated that CRP was a cAMP-binding receptor affecting gltA-2 transcription when the intracellular cAMP concentration increased. Thus, an overall model of CS regulation by C and/or N metabolism regulators and cAMP receptor protein was proposed.

  6. Malate synthase gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Williams).

    PubMed

    Pua, Eng-Chong; Chandramouli, Sumana; Han, Ping; Liu, Pei

    2003-01-01

    Malate synthase (MS) is a key enzyme responsible for malic acid synthesis in the glyoxylate cycle, which functions to convert stored lipids to carbohydrates, by catalysing the glyoxylate condensation reaction with acetyl-CoA in the peroxisome. In this study, the cloning of an MS cDNA, designated MaMS-1, from the banana fruit is reported. MaMS-1 was 1801 bp in length encoding a single polypeptide of 556 amino acid residues. Sequence analysis revealed that MaMS-1 possessed the conserved catalytic domain and a putative peroxisomal targeting signal SK(I/L) at the carboxyl terminal. MaMS-1 also shared an extensive sequence homology (79-81.3%) with other plant MS homologues. Southern analysis indicated that MS might be present as multiple members in the banana genome. In Northern analysis, MaMS-1 was expressed specifically in ripening fruit tissue and transcripts were not detected in other organs such as roots, pseudostem, leaves, ovary, male flower, and in fruit at different stages of development. However, the transcript abundance in fruit was affected by stage of ripening, during which transcript was barely detectable at the early stage of ripening (FG and TY), but the level increased markedly in MG and in other fruits at advanced ripening stages. Furthermore, MaMS-1 expression in FG fruit could be stimulated by treatment with 1 microl l(-1) exogenous ethylene, but the stimulatory effect was abolished by the application of an ethylene inhibitor, norbornadiene. Results of this study clearly show that MS expression in banana fruit is temporally regulated during ripening and is ethylene-inducible.

  7. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips.

    PubMed

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A

    2013-09-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound.

  8. Regulation of expression of GLT1, the gene encoding glutamate synthase in Saccharomyces cerevisiae.

    PubMed

    Valenzuela, L; Ballario, P; Aranda, C; Filetici, P; González, A

    1998-07-01

    Saccharomyces cerevisiae glutamate synthase (GOGAT) is an oligomeric enzyme composed of three 199-kDa identical subunits encoded by GLT1. In this work, we analyzed GLT1 transcriptional regulation. GLT1-lacZ fusions were prepared and GLT1 expression was determined in a GDH1 wild-type strain and in a gdh1 mutant derivative grown in the presence of various nitrogen sources. Null mutants impaired in GCN4, GLN3, GAT1/NIL1, or UGA43/DAL80 were transformed with a GLT1-lacZ fusion to determine whether the above-mentioned transcriptional factors had a role in GLT1 expression. A collection of increasingly larger 5' deletion derivatives of the GLT1 promoter was constructed to identify DNA sequences that could be involved in GLT1 transcriptional regulation. The effect of the lack of GCN4, GLN3, or GAT1/NIL1 was also tested in the pertinent 5' deletion derivatives. Our results indicate that (i) GLT1 expression is negatively modulated by glutamate-mediated repression and positively regulated by Gln3p- and Gcn4p-dependent transcriptional activation; (ii) two cis-acting elements, a CGGN15CCG palindrome and an imperfect poly(dA-dT), are present and could play a role in GLT1 transcriptional activation; and (iii) GLT1 expression is moderately regulated by GCN4 under amino acid deprivation. Our results suggest that in a wild-type strain grown on ammonium, GOGAT constitutes an ancillary pathway for glutamate biosynthesis.

  9. Adrenocortical carcinoma (ACC): diagnosis, prognosis, and treatment

    PubMed Central

    Libé, Rossella

    2015-01-01

    Adrenocortical carticnoma (ACC) is a rare malignancy with an incidence of 0.7–2.0 cases/million habitants/year. The diagnosis of malignancy relies on careful investigations of clinical, biological, and imaging features before surgery and pathological examination after tumor removal. Most patients present with steroid hormone excess or abdominal mass effects, but 15% of patients with ACC is initially diagnosed incidentally. After the diagnosis, in order to assess the ACC prognosis and establish an adequate basis for treatment decisions different tools are proposed. The stage classification proposed by the European Network for the Study of Adrenal Tumors (ENSAT) is recommended. Pathology reports define the Weiss score, the resection status and the proliferative index, including the mitotic count and the Ki67 index. As far as the treatment is concerned, in case of tumor limited to the adrenal gland, the complete resection of the tumor is the first option. Most patients benefit from adjuvant mitotane treatment. In metastatic disease, mitotane is the cornerstone of initial treatment, and cytotoxic drugs should be added in case of progression. Recently, the First International Randomized (FIRM-ACT) Trial in metastatic ACC reported the association between mitotane and etoposide/doxorubicin/cisplatin (EDP) as the new standard in first line treatment of ACC. In last years, new targeted therapies, including the IGF-1 receptor inhibitors, have been investigated, but their efficacy remains limited. Thus, new treatment concepts are urgently needed. The ongoing “omic approaches” and next-generation sequencing will improve our understanding of the pathogenesis and hopefully will lead to better therapies. PMID:26191527

  10. The barley amo1 locus is tightly linked to the starch synthase IIIa gene and negatively regulates expression of granule-bound starch synthetic genes

    PubMed Central

    Li, Zhongyi; Li, Dehong; Du, Xihua; Wang, Hong; Larroque, Oscar; Jenkins, Colin L. D.; Jobling, Stephen A.; Morell, Matthew K.

    2011-01-01

    In this study of barley starch synthesis, the interaction between mutations at the sex6 locus and the amo1 locus has been characterized. Four barley genotypes, the wild type, sex6, amo1, and the amo1sex6 double mutant, were generated by backcrossing the sex6 mutation present in Himalaya292 into the amo1 ‘high amylose Glacier’. The wild type, amo1, and sex6 genotypes gave starch phenotypes consistent with previous studies. However, the amo1sex6 double mutant yielded an unexpected phenotype, a significant increase in starch content relative to the sex6 phenotype. Amylose content (as a percentage of starch) was not increased above the level observed for the sex6 mutation alone; however, on a per seed basis, grain from lines containing the amo1 mutation (amo1 mutants and amo1sex6 double mutants) synthesize significantly more amylose than the wild-type lines and sex6 mutants. The level of granule-bound starch synthase I (GBSSI) protein in starch granules is increased in lines containing the amo1 mutation (amo1 and amo1sex6). In the amo1 genotype, starch synthase I (SSI), SSIIa, starch branching enzyme IIa (SBEIIa), and SBEIIb also markedly increased in the starch granules. Genetic mapping studies indicate that the ssIIIa gene is tightly linked to the amo1 locus, and the SSIIIa protein from the amo1 mutant has a leucine to arginine residue substitution in a conserved domain. Zymogram analysis indicates that the amo1 phenotype is not a consequence of total loss of enzymatic activity although it remains possible that the amo1 phenotype is underpinned by a more subtle change. It is therefore proposed that amo1 may be a negative regulator of other genes of starch synthesis. PMID:21813797

  11. Analysis of the mitochondrial ATP synthase beta-subunit gene in Drosophilidae: structure, transcriptional regulatory features and developmental pattern of expression in Drosophila melanogaster.

    PubMed Central

    Peña, P; Ugalde, C; Calleja, M; Garesse, R

    1995-01-01

    We have cloned and determined the structure of the gene encoding the H(+)-ATP synthase beta subunit in two distantly related Drosophila species, D. melanogaster and D. virilis. The gene contains three exons that are extremely well conserved at the amino acid level, not only in the region encoding the mature protein but also in that encoding the leader peptide. Primer extension analysis indicates that the 5' untranslated region is extremely short, and reveals the presence of multiple initiation sites of transcription in both Drosophila species. The promoters of D. melanogaster and D. virilis H(+)-ATP synthase beta-subunit genes contain a conserved region surrounding the initiation transcription sites. Nucleotide sequence analysis has revealed the absence of canonical TATA and CCAAT boxes and the presence of several putative regulatory elements in both promoter regions, including GAGA, GATA and Ets binding sites. We have analysed the pattern of gene expression during D. melanogaster development. The mRNA is stored in oocytes, and activation of transcription takes place after 10 h of development. The expression of the nuclear-encoded H(+)-ATP synthase beta subunit is strictly coordinated with the expression of subunits 6 and 8 of the same complex that are encoded in the mitochondrial genome. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:8554535

  12. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarity with FLSs from other plant species. Using quantitative real-time PCR and high-performance liquid chromatography (HPLC), the expression of FtFLS1/2 and the production of 3 main flavonols (kaempferol, myricetin and quercetin) was detected in roots, leaves, stems, flowers and different stages of developing seeds. The relationship between the expression of the 2 FLS genes and the accumulation of the 3 basic flavonols was analyzed in 2 tartary buckwheat cultivars. FtFLS1 and FtFLS2 exhibited differential transcriptional levels between the tartary buckwheat cultivars 'Hokkai T10' and 'Hokkai T8'. Generally, higher transcript levels of FtFLS1 and FtFLS2 and a higher amount of flavonols were observed in the 'Hokkai T10' cultivar than 'Hokkai T8'. The content of flavonols showed tissue-specific accumulation between the 2 cultivars. The transcription of FtFLS1 was inhibited by the exogenous application of abscisic acid (ABA), salicylic acid (SA) and sodium chloride (NaCl), while FtFLS2 was not affected by ABA but up-regulated by SA and NaCl. These data indicate that the 2 FtFLS isoforms of buckwheat have different functions in the response of buckwheat to environmental stress.

  13. RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say)

    PubMed Central

    Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing

    2016-01-01

    Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata. Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences (LdChSAa, LdChSAb and LdChSB) were cloned. LdChSAa and LdChSAb, two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed dsChSA (derived from a common fragment of LdChSAa and LdChSAb), dsChSAa, dsChSAb and dsChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa+LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChSs are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata. PMID:27877084

  14. GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.).

    PubMed

    Cai, Caiping; Zhang, Xueying; Niu, Erli; Zhao, Liang; Li, Nina; Wang, Liman; Ding, Linyun; Guo, Wangzhen

    2014-08-01

    Carotenoids are important accessory pigments in plants that are essential for photosynthesis. Phytoene synthase (PSY), a rate-controlling enzyme in the carotenoid biosynthesis pathway, has been widely characterized in rice, maize, and sorghum, but at present there are no reports describing this enzyme in cotton. In this study, GhPSY was identified as a candidate gene for the red plant phenotype via a combined strategy using: (1) molecular marker data for loci closely linked to R1; (2) the whole-genome scaffold sequence from Gossypium raimondii; (3) gene expression patterns in cotton accessions expressing the red plant and green plant phenotypes; and (4) the significant correlation between a single nucleotide polymorphisms (SNP) in GhPSY and leaf phenotypes of progeny in the (Sub16 × T586) F2 segregating population. GhPSY was relatively highly expressed in leaves, and the protein was localized to the plastid where it appeared to be mostly attached to the surface of thylakoid membranes. GhPSY mRNA was expressed at a significantly higher level in T586 and SL1-7-1 red plants than TM-1 and Hai7124 green plants. SNP analysis in the GhPSY locus showed co-segregation with the red and green plant phenotypes in the (Sub16 × T586) F2 segregating population. A phylogenetic analysis showed that GhPSY belongs to the PSY2 subfamily, which is related to photosynthesis in photosynthetic tissues. Using a reverse genetics approach based on Tobacco rattle virus-induced gene silencing, we showed that the knockdown of GhPSY caused a highly uniform bleaching of the red color in newly-emerged leaves in both T586 and SL1-7-1 plants with a red plant phenotype. These findings indicate that GhPSY is important for engineering the carotenoid metabolic pathway in pigment production.

  15. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    PubMed

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  16. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers.

    PubMed

    Wen, Xiao-Peng; Pang, Xiao-Ming; Matsuda, Narumi; Kita, Masayuki; Inoue, Hiromichi; Hao, Yu-Jin; Honda, Chikako; Moriguchi, Takaya

    2008-04-01

    An apple spermidine synthase (SPDS) gene (MdSPDS1) was verified to encode a functional protein by the complementation of the spe3 yeast mutant, which lacks the SPDS gene. To justify our hypothesis that apple SPDS is involved in abiotic stress responses and to obtain transgenic fruit trees tolerant to abiotic stresses as well, MdSPDS1-over-expressing transgenic European pear (Pyrus communis L. 'Ballad') plants were created by Agrobacterium-mediated transformation. A total of 21 transgenic lines showing various spermidine (Spd) titers and MdSPDS1 expression levels were obtained. Selected lines were exposed to salt (150 mM NaCl), osmosis (300 mM mannitol), and heavy metal (500 microM CuSO4) stresses for evaluating their stress tolerances. Transgenic line no. 32, which was revealed to have the highest Spd accumulation and expression level of MdSPDS1, showed the strongest tolerance to these stresses. When growth increments, electrolyte leakage (EL), and values of thiobarbituric acid reactive substances (TBARS) were monitored, line no. 32 showed the lowest growth inhibition and the least increase in EL or TBARS under stress conditions. Spd titers in wild-type and transgenic lines showed diverse changes upon stresses, and these changes were not consistent with the changes in MdSPDS1 expressions. Moreover, there were no differences in the sodium concentration in the shoots between the wild type and line no. 32, whereas the copper concentration was higher in the wild type than in line no. 32. Although the mechanism(s) underlying the involvement of polyamines in stress responses is not known, these results suggest that the over-expression of the SPDS gene substantially increased the tolerance to multiple stresses by altering the polyamine titers in pear. Thus, MdSPDS1-over-expressing transgenic pear plants could be used to improve desert land and/or to repair polluted environments.

  17. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  18. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    PubMed

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae.

  19. Construction and characterization of two Citrus BAC libraries and identification of clones containing the phytoene synthase gene.

    PubMed

    Baig, M N R; Yu, An; Guo, Wenwu; Deng, Xiuxin

    2009-05-01

    Two deep-coverage Bacterial Artificial Chromosome (BAC) libraries of Citrus sinensis (L.) Osbeck 'Cara Cara' navel orange and Citrus reticulata (L.) Blanco 'Egan No. 1' Ponkan mandarin, which belong to the two most important species of the Citrus genus, have been constructed and characterized to facilitate gene cloning and to analyze variety-specific genome composition. The C. sinensis BAC library consists of 36 000 clones with negligible false-positive clones and an estimated average insert size of 126 kb covering ~4.5 x 109 bp and thus providing an 11.8-fold coverage of haploid genome equivalents, whereas the C. reticulata library consists of 21 000 clones also with negligible false-positive clones and an estimated average of 120 kb covering ~2.5 x 109 bp representing a 6.6-fold coverage of haploid genome equivalents. Both libraries were evaluated for contamination with high-copy vector, empty pIndigoBAC536 vector, and organellar DNA sequences. Screening has been performed by Southern hybridization of BAC filters, which results in <0.5% chloroplast DNA contamination and no mitochondrial DNA contamination in both libraries. Eight and five positive clones harboring the gene encoding Phytoene synthase (Psy (EC 2.5.1.32)) were identified from the C. sinensis and C. reticulata libraries, respectively, using the filter hybridization procedure. These results suggest that the two BAC libraries are useful tools for the isolation of functional genes and advanced genomics research in the two important species C. sinensis and C. reticulata. Resources, high-density filters, individual clones, and whole libraries are available for public distribution and are accessible at the National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University.

  20. Association of endothelial nitric oxide synthase gene T-786C promoter polymorphism with gastric cancer

    PubMed Central

    Krishnaveni, Devulapalli; Amar Chand, Bhayal; Shravan Kumar, Porika; Uma Devi, Malladi; Ramanna, Macherla; Jyothy, Akka; Pratibha, Nallari; Balakrishna, N; Venkateshwari, Ananthapur

    2015-01-01

    AIM: To investigate the role of endothelial nitric oxide synthase -786T > C promoter polymorphism in the etiology of gastric cancer (GC). METHODS: A total of 150 GC patients and 150 control subjects were included in the study. The information on demographic features was elicited with an informed consent from all the patients and control subjects using a structured questionnaire. Helicobacter pylori (H. pylori) infectivity status was tested in antral biopsies from all the subjects by rapid urease test following the method of Vaira et al. Genomic DNA was isolated from whole blood samples following the salting out method of Lahiri et al. Genotype analysis of the rs2070744 polymorphism was carried out by allele-specific polymerase chain reaction method. The genotypes were determined based on the appearance of bands on an agarose gel stained with ethidium bromide under ultraviolet gel documentation with the help of 100 bp ladder. Odds ratios and corresponding 95%CIs were determined using java stat online software. RESULTS: There was a significant difference in the distribution of C allele (C vs T; P = 0.000, OR = 5.038) in patient group compared to the control subjects exhibiting a fivefold increased risk for GC. When the T/T and C/C genotypes were compared, there was an enhanced GC risk for individuals with C/C genotype (T/T vs C/C; P = 0.000). Among the demographic factors, smoking and alcoholism were the common risk factors in patients compared to the control subjects (P < 0.05). Patients with smoking and alcoholism developed cancer even in heterozygous T/C condition (smoking: P = 0.020 and alcoholism: P = 0.005). Individuals with H. pylori infection showed seven fold increased risk for cancer. All the patients with C/C genotype revealed a significant association between H. pylori infection and GC. Among the patients 2.4% of them revealed familial incidence of GC. No significant difference was noticed between cases and controls with regard to consanguinity (P = 0

  1. Surveillance of Dihydropteroate Synthase Genes in Stenotrophomonas maltophilia by LAMP: Implications for Infection Control and Initial Therapy

    PubMed Central

    Zhao, Jin; Xing, Yubin; Liu, Wei; Ni, Wentao; Wei, Chuanqi; Wang, Rui; Liu, Yunxi; Liu, Youning

    2016-01-01

    Stenotrophomonas maltophilia is a common nosocomial pathogen that causes high morbidity and mortality. Because of its inherent extended antibiotic resistance, therapeutic options for S. maltophilia are limited, and sulfamethoxazole/trimethoprim (SXT) is the only first-line antimicrobial recommended. However, with the spread of dihydropteroate synthase (sul1 and sul2) genes, global emergence of SXT resistance has been reported. There is an urgent need to develop a rapid and sensitive but cost-efficient method to monitor the dissemination of sul genes. In this study, we developed loop-mediated isothermal amplification (LAMP) assays for sul1 and sul2 using real-time turbidity and hydroxy naphthol blue coloration methods. The assays could quickly detect sul genes with high sensitivity and specificity. The LAMP detection limit was 0.74 pg/reaction of extracted genomic DNA for sul1 and 2.6 pg/reaction for sul2, which were both 10-fold more sensitive than the corresponding traditional PCR assays. Additionally, the LAMP assays could positively amplify DNA from sul1-producing strains, but not from the negative controls. We then used the LAMP assays to investigate the dissemination of sul genes among S. maltophilia isolates from patients in three hospitals in Beijing, China. Among 450 non-duplicated samples collected during 2012–2014, 56 (12.4%) strains were SXT-resistant. All these SXT-resistant strains were positive for sul genes, with 35 (62.5%) carrying sul1, 17 (30.4%) carrying sul2, and 4 (7.1%) carrying both sul1 and sul2, which indicated that sul genes were the predominant resistance mechanism. Of 394 SXT-susceptible strains, 16 were also sul-positive. To provide epidemiological data for the appropriate choice of antimicrobials for treatment of sul-positive S. maltophilia, we further tested the susceptibility to 18 antimicrobials. Among these, sul-positive strains showed the highest susceptibility to tetracycline derivatives, especially minocycline (MIC50/MIC90, 0

  2. The Sesquiterpene Synthase from the Botrydial Biosynthetic Gene Cluster of the Phytopathogen Botrytis cinerea

    PubMed Central

    Pinedo, Cristina; Wang, Chieh-Mei; Pradier, Jean-Marc; Dalmais, Bérengère; Choquer, Mathias; Pêcheur, Pascal Le; Morgant, Guillaume; Collado, Isidro G.; Cane, David E.; Viaud, Muriel

    2009-01-01

    The fungus Botrytis cinerea is the causal agent of the economically important gray mold disease that affects more than 200 ornamental and agriculturally important plant species. B. cinerea is a necrotrophic plant pathogen that secretes nonspecific phytotoxins, including the sesquiterpene botrydial and the polyketide botcinic acid. The region surrounding the previously characterized BcBOT1 gene has now been identified as the botrydial biosynthetic gene cluster. Five genes including BcBOT1 and BcBOT2 were shown by quantitative Reverse Transcription-PCR to be co-regulated through the calcineurin signaling pathway. Inactivation of the BcBOT2 gene, encoding a putative sesquiterpene cyclase, abolished botrydial biosynthesis, which could be restored by in trans complementation. Inactivation of BcBOT2 also resulted in over-production of botcinic acid that was observed to be strain-dependent. Recombinant BcBOT2 protein converted farnesyl diphosphate to the parent sesquiterpene of the botrydial biosynthetic pathway, the tricyclic alcohol presilphiperfolan-8β-ol. PMID:19035644

  3. Ceramides promote apoptosis for virus-infected lymphoma cells through induction of ceramide synthases and viral lytic gene expression

    PubMed Central

    Dai, Lu; Trillo-Tinoco, Jimena; Bai, Aiping; Chen, Yihan; Bielawski, Jacek; Del Valle, Luis; Smith, Charles D.; Ochoa, Augusto C.; Qin, Zhiqiang; Parsons, Chris

    2015-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent for several human cancers including primary effusion lymphoma (PEL), a rapidly progressive malignancy arising preferentially in immunocompromised patients. With conventional chemotherapy, PEL continues to portend high mortality, dictating the development of novel therapeutic strategies. Sphingosine kinase 2 (SphK2) represents a key gatekeeper for sphingolipid metabolism, responsible for conversion of ceramides to sphingosine-1-phosphate (S1P). We have previously demonstrated that targeting SphK2 using a novel selective inhibitor, ABC294640, leads to intracellular accumulation of ceramides and induces apoptosis for KSHV-infected PEL cells, while suppressing tumor progression in vivo. In the current study, we sought to determine whether specific ceramide/dh-ceramide species and related ceramide synthases (CerS) impact viability for KSHV-infected PEL cells during targeting of SphK2. We found that several specific ceramide and dihydro(dh)-ceramide species and their associated CerS reduce PEL survival and tumor expansion in vitro and in vivo. Moreover, we found that dhC16-Cer induces PEL apoptosis in part through activation of KSHV lytic gene expression. These data further implicate bioactive sphingolipids in regulation of PEL survival, and provide justification for future studies evaluating clinically relevant ceramide analogs or mimetics for their potential as therapeutic agents for PEL. PMID:26327294

  4. [Cloning, prokaryotic expression, and functional identification of a sesquiterpene synthase gene (AsSS4) from Aquilaria sinensis].

    PubMed

    Liang, Liang; Guo, Qing-Mei; Zhang, Zheng; Xu, Yan-Hong; Han, Xiao-Min; Liu, Juan

    2014-12-01

    A sesquiterpene synthase (AsSS4) full-length open reading frame (ORF) cDNA was cloned from wounded stems of Aquilaria sinensis by RT-PCR method. The result showed that the ORF of AsSS4 was 1,698 bp encoding 565 amino acids. Prokaryotic expression vector pET28a-AsSS4 was constructed and transformed into E. coli BL21 (DE3) pLysS. Recombinant AsSS4 protein was obtained after induction by IPTG and SDS-PAGE analysis with a MW of 64 kD. Enzymatic reactions using farnesyl pyrophosphate showed that recombinant AsSS4 protein purified by Ni-agarose gel yielded five sesquiterpene compounds, cyclohexane, 1-ethenyl-1-methyl-2, 4-bis(1-methylethenyl)-, β-elemene, α-guaiene, α-caryophyllene and δ-guaiene. This paper reported the first cloning and functional characterization of AsSS4 gene from A. sinensis, which will establish a foundation for future studies on the molecular mechanisms of wound-induce agarwood formation in A. sinensis

  5. Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum.

    PubMed

    Tijerino, Anamariela; Cardoza, R Elena; Moraga, Javier; Malmierca, Mónica G; Vicente, Francisca; Aleu, Josefina; Collado, Isidro G; Gutiérrez, Santiago; Monte, Enrique; Hermosa, Rosa

    2011-03-01

    Trichoderma brevicompactum produces trichodermin, a simple trichothecene-type toxin that shares the first steps of the sesquiterpene biosynthetic pathway with other phytotoxic trichothecenes from Fusarium spp. Trichodiene synthase catalyses the conversion of farnesyl pyrophosphate to trichodiene and it is encoded by the tri5 gene that was cloned and analysed functionally by homologous overexpression in T. brevicompactum. tri5 expression was up-regulated in media with glucose, H(2)O(2) or glycerol. tri5 repression was observed in cultures supplemented with the antioxidants ferulic acid and tyrosol. Acetone extracts of tri5-overexpressing transformants displayed higher antifungal activity than those from the wild-type. Chromatographic and spectroscopic analyses revealed that tri5 overexpression led to an increased production of trichodermin and tyrosol. Agar diffusion assays with these two purified metabolites from the tri5-overexpressing transformant T. brevicompactum Tb41tri5 showed that only trichodermin had antifungal activity against Saccharomyces cerevisiae, Kluyveromyces marxianus, Candida albicans, Candida glabrata, Candida tropicalis and Aspergillus fumigatus, in most cases such activity being higher than that observed for amphotericin B and hygromycin. Our results point to the significant role of tri5 in the production of trichodermin and in the antifungal activity of T. brevicompactum.

  6. The sensitivity of light-evoked responses of retinal ganglion cells is decreased in nitric oxide synthase gene knockout mice.

    PubMed

    Wang, Guo-Yong; van der List, Deborah A; Nemargut, Joseph P; Coombs, Julie L; Chalupa, Leo M

    2007-11-30

    We have shown previously that increasing the production of nitric oxide (NO) results in a dampening of visual responses of retinal ganglion cells (G. Y. Wang, L. C. Liets, & L. M. Chalupa, 2003). To gain further insights into the role of NO in retinal function, we made whole-cell patch clamp recordings from ganglion cells of neural type nitric oxide synthase (nNOS) gene knockout mice. Here we show that in the dark-adapted state, the sensitivity of retinal ganglion cell to light stimulation is decreased in nNOS knockout animals. The lowest light intensities required to evoke optimal responses and the average intensities that evoked half-maximal responses were significantly higher in nNOS knockouts than in normal mice. Retinal histology and other features of light-evoked responses of ganglion cells in nNOS mice appeared to be indistinguishable from those of normal mice. Collectively, these results, in conjunction with our previous work, provide evidence that increasing levels of NO dampen visual responses of ganglion cells, while a lack of nNOS decreases the sensitivity of these neurons to light. Thus, NO levels in the retina are capable of modulating the information that ganglion cells convey to the visual centers of the brain.

  7. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    PubMed

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest.

  8. Identification and regulation of fusA, the polyketide synthase gene responsible for fusarin production in Fusarium fujikuroi.

    PubMed

    Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen

    2012-10-01

    Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.

  9. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  10. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  11. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS) gene expression patterns

    PubMed Central

    2011-01-01

    Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan) walls and septae (callose plugs) of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS). Of 12 CalS gene family members in Arabidopsis, only one (CalS5) has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms) and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5) (Nymphaeales). Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression and pollen

  12. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers.

  13. Large-Scale Phylogenetic Classification of Fungal Chitin Synthases and Identification of a Putative Cell-Wall Metabolism Gene Cluster in Aspergillus Genomes

    PubMed Central

    Pacheco-Arjona, Jose Ramon; Ramirez-Prado, Jorge Humberto

    2014-01-01

    The cell wall is a protective and versatile structure distributed in all fungi. The component responsible for its rigidity is chitin, a product of chitin synthase (Chsp) enzymes. There are seven classes of chitin synthase genes (CHS) and the amount and type encoded in fungal genomes varies considerably from one species to another. Previous Chsp sequence analyses focused on their study as individual units, regardless of genomic context. The identification of blocks of conserved genes between genomes can provide important clues about the interactions and localization of chitin synthases. On the present study, we carried out an in silico search of all putative Chsp encoded in 54 full fungal genomes, encompassing 21 orders from five phyla. Phylogenetic studies of these Chsp were able to confidently classify 347 out of the 369 Chsp identified (94%). Patterns in the distribution of Chsp related to taxonomy were identified, the most prominent being related to the type of fungal growth. More importantly, a synteny analysis for genomic blocks centered on class IV Chsp (the most abundant and widely distributed Chsp class) identified a putative cell wall metabolism gene cluster in members of the genus Aspergillus, the first such association reported for any fungal genome. PMID:25148134

  14. Induction of aminolevulinic acid synthase gene expression and enhancement of metabolite, protoporphyrin IX, excretion by organic germanium.

    PubMed

    Nakamura, Takashi; Saito, Miki; Shimada, Yasuhiro; Fukaya, Haruhiko; Shida, Yasuo; Tokuji, Yoshihiko

    2011-02-25

    Poly-trans-[(2-carboxyethyl) germasesquioxane], Ge-132 is a water-soluble organic germanium compound. Oral intake of dietary Ge-132 changes fecal color and we attempted to identify the fecal red pigment, which increased by the intake of dietary Ge-132. Sprague Dawley rats were given diets containing Ge-132 from 0 to 0.5% concentration. Fecal red pigment was extracted and purified for optical and structural studies. We examined the fecal red pigment content by high performance liquid chromatography (HPLC), and hepatic gene expressions relating to heme synthesis by reverse transcription polymerase chain reaction (RT-PCR). The purified red pigment had particular optical characteristics on the ultraviolet (UV)-visible spectrum (Soret band absorbance at 400 nm) and fluorescence emission at 600 nm by 400 nm excitation, and was identified as protoporphyrin IX by LC-MS analysis. Protoporphyrin IX significantly (P<0.05) increased 2.4-fold in the feces by the intake of a 0.5% Ge-132 diet. Gene expression analysis of the liver explained the increase of protoporphyrin IX by dietary Ge-132 as it enhanced (P<0.05) aminolevulinic acid synthase 1 (Alas1), a rate-limiting enzyme of heme synthesis, expression 1.8-fold, but decreased ferrochelatase (Fech) expression 0.6-fold (P<0.05). The results show that the intake of dietary Ge-132 is related to heme metabolism. Because protoporphyrin IX is used to treat chronic hepatitis, Ge-132 may be a beneficial substance to increase protoporphyrin IX in the liver.

  15. Diversity of Benzylsuccinate Synthase-Like (bssA) Genes in Hydrocarbon-Polluted Marine Sediments Suggests Substrate-Dependent Clustering

    PubMed Central

    Acosta-González, Alejandro; Rosselló-Móra, Ramon

    2013-01-01

    The potential of hydrocarbon biodegradation in marine sediments was determined through the detection of a functional biomarker, the bssA gene, coding for benzylsuccinate synthase, the key enzyme of anaerobic toluene degradation. Eight bssA clone libraries (409 sequences) were constructed from polluted sediments affected by the Prestige oil spill in the Atlantic Islands National Park and from hydrocarbon-amended sediment microcosms in Mallorca. The amplified products and database-derived bssA-like sequences grouped into four major clusters, as determined by phylogenetic reconstruction, principal coordinate analysis (PCoA), and a subfamily prediction tool. In addition to the classical bssA sequences that were targeted, we were able to detect sequences homologous to the naphthylmethylsuccinate synthase gene (nmsA) and the alkylsuccinate synthase gene (assA), the bssA homologues for anaerobic 2-methylnaphthalene and alkane degradation, respectively. The detection of bssA-like variants was determined by the persistence and level of pollution in the marine samples. The observed level of gene diversity was lower in the Mallorca sediments, which were dominated by assA-like sequences. In contrast, the Atlantic Islands samples, which were highly contaminated with methylnaphthalene-rich crude oil, showed a high proportion of nmsA-like sequences. Some of the detected genes were phylogenetically related to Deltaproteobacteria communities, previously described as the predominant hydrocarbon degraders at these sites. Differences between all detected bssA-like genes described to date indicate separation between marine and terrestrial sequences and further subgrouping according to taxonomic affiliation. Global analysis suggested that bssA homologues appeared to cluster according to substrate specificity. We observed undetected divergent gene lineages of bssA homologues, which evidence the existence of new degrader groups in these environments. PMID:23563947

  16. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria

    PubMed Central

    Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of