Development of an accelerated reliability test schedule for terrestrial solar cells
NASA Technical Reports Server (NTRS)
Lathrop, J. W.; Prince, J. L.
1981-01-01
An accelerated test schedule using a minimum amount of tests and a minimum number of cells has been developed on the basis of stress test results obtained from more than 1500 cells of seven different cell types. The proposed tests, which include bias-temperature, bias-temperature-humidity, power cycle, thermal cycle, and thermal shock tests, use as little as 10 and up to 25 cells, depending on the test type.
Investigation of reliability attributes and accelerated stress factors on terrestrial solar cells
NASA Technical Reports Server (NTRS)
Prince, J. L.; Lathrop, J. W.
1979-01-01
The results of accelerated stress testing of four different types of silicon terrestrial solar cells are discussed. The accelerated stress tests used included bias-temperature tests, bias-temperature-humidity tests, thermal cycle and thermal shock tests, and power cycle tests. Characterization of the cells was performed before stress testing and at periodic down-times, using electrical measurement, visual inspection, and metal adherence pull tests. Electrical parameters measured included short-circuit current, open circuit voltage, and output power, voltage, and current at the maximum power point. Incorporated in the report are the distributions of the prestress electrical data for all cell types. Data were also obtained on cell series and shunt resistance.
NASA Astrophysics Data System (ADS)
Hellqvist Kjell, Maria; Malmgren, Sara; Ciosek, Katarzyna; Behm, Mårten; Edström, Kristina; Lindbergh, Göran
2013-12-01
Accelerated aging at elevated temperature is commonly used to test lithium-ion battery lifetime, but the effect of an elevated temperature is still not well understood. If aging at elevated temperature would only be faster, but in all other respects equivalent to aging at ambient temperature, cells aged to end-of-life (EOL) at different temperatures would be very similar. The present study compares graphite/LiFePO4-based cells either cycle- or calendar-aged to EOL at 22 °C and 55 °C. Cells cycled at the two temperatures show differences in electrochemical impedance spectra as well as in X-ray photoelectron spectroscopy (XPS) spectra. These results show that lithium-ion cell aging is a complex set of processes. At elevated temperature, the aging is accelerated in process-specific ways. Furthermore, the XPS results of cycle-aged samples indicate increased deposition of oxygenated LiPF6 decomposition products in both the negative and positive electrode/electrolyte interfaces. The decomposition seems more pronounced at elevated temperature, and largely accelerated by cycling, which could contribute to the observed cell impedance increase.
Some practical observations on the accelerated testing of Nickel-Cadmium Cells
NASA Technical Reports Server (NTRS)
Mcdermott, P. P.
1979-01-01
A large scale test of 6.0 Ah Nickel-Cadmium Cells conducted at the Naval Weapons Support Center, Crane, Indiana has demonstrated a methodology for predicting battery life based on failure data from cells cycled in an accelerated mode. After examining eight variables used to accelerate failure, it was determined that temperature and depth of discharge were the most reliable and efficient parameters for use in accelerating failure and for predicting life.
Accelerated cycle life performance for ovonic nickel-metal hydride cells
NASA Technical Reports Server (NTRS)
Otzinger, Burton M.
1991-01-01
Nickel-Metal Hydride (Ni-MH) rechargeable batteries have emerged as the leading candidate for commercial replacement of nickel-cadmium (Ni-Cd) batteries. An important incentive is that the Ni-MH cell provides approximately twice the capacity of a Ni-Cd cell for a given size. A six-cell battery was committed to an accelerated cycle life test to determine the effect of separation type on performance. Results of the test may also show the Ni-MH battery to be a replacement candidate for the aerospace Ni-Cd battery.
EOS-AM1 Nickel Hydrogen Cell Interim Life Test Report
NASA Technical Reports Server (NTRS)
Bennett, C. W.; Keys, D. J.; Rao, G. M.; Wannemacher, H. E.; Vaidyanathan, H.
1997-01-01
This paper reports the interim results of the Earth Observing System AM-1 project (EOS-AM-1) nickel hydrogen cell life test being conducted under contract to National Aeronautics and Space Administration (NASA) Goddard Space Flight Center (GSFC) at the Lockheed Martin Missiles and Space (LMMS) facility in East Windsor, NJ; and at COMSAT Labs., Clarksburg, MD. The purpose of the tests is to verify that the EOS-AM-l cell design can meet five years of real-time Low Earth Orbit (LEO) cycling. The tests include both real-time LEO and accelerated stress tests. At LMMS, the first real-time LEO simulated 99 minute orbital cycle started on February 7, 1994 and the test has been running continuously since that time, with 13000 LEO cycles completed as of September 2, 1996. Each cycle consists of a 64 minute charge (VT at 1.507 volts per cell, 1.06 C/D ratio, followed by 0.6 ampere trickle charge) and a 35 minute constant power discharge at 177 watts (22.5% DOD). At COMSAT, the accelerated stress test consists of 90 minute orbital cycles at 60% DOD with a 30 minute discharge at 60 amperes and a 60 minute charge at 40 ampercs (VT at 1.54 volts per cell to 1.09 C/D ratio, followed by 0.6 ampere trickle charge). The real-time LEO life test battery consists of seven, 50AH (nameplate rating) Eagle-Picher, Inc. (EPI) Mantech cells manufactured into three, 3-cell pack assemblies (there are two place holder cells that are not part of the life test electrical circuit). The test pack is configured to simulate the conductive thermal design of the spacecraft battely, including: conductive aluminum sleeves, 3-cell pack aluminum baseplate, and honeycomb panel all mounted to a liquid (-5 C) cold plate. The entire assembly is located in a thermal chamber operating at +3 C. The accelerated stress test unit consists of five cells mounted in machined aluminum test sleeves and is operating at +10 C. The real-time LEO life test battery has met all performance requirements through the first 13,000 cycles, including: end of charge and discharge cell voltages and voltage gradients; end of chalge and discharge cell pressures; within cell and between cell temperature gradients; discharge capacity; current and power levels; and all chalge parameters. The accelerated stress test battely has completed over 5900 cycles as of 9/11/96. This paper reports both battery performances as a function of cycle life, with individual cell performance comparisons repolted for selected cycles in both tests.
NASA Technical Reports Server (NTRS)
Bennett, Charles W.; Keys, Denney J.; Rao, Gopalakrishna M.; Wannemacher, Hari E.; Vaidyanathan, Harry
1997-01-01
This paper reports the interim results of the Earth Observing System AM-1 project (EOS-AM-1) nickel hydrogen cell life test being conducted under contract to National Aeronautics and Space Administration (NASA) Goddard Space Flight Center (GSFC) at the Lockheed Martin Missile and Space (LMMS) facility in East Windsor, NJ; and at COMSAT Labs., Clarksburg, MD. The purpose of die tests is to verify that the EOS-AM-1 cell design can meet five years of real-time Low Earth Orbit (LEO) cycling. The tests include both real-time LEO and accelerated stress tests. At LMMS, the first real-time LEO simulated 99 minute orbital cycle started on February 7, 1994 and the test has been running continuously since that time, with 18,202 LEO cycles completed as of September 1, 1997. Each cycle consists of a 64 minute charge (VT at 1.507 volts per cell, 1.06 C/D ratio, followed by 0.6 ampere trickle charge) and a 35 minute constant power discharge at 177 watts (22.5% DOD). At COMSAT, the accelerated stress test consists of 90 minute orbital cycles at 60% DOD with a 30 minute discharge at 60 amperes and a 60 minute charge at 40 amperes (VT at 1.54 volts per cell to 1.09 C/D ratio, followed by 0.6 ampere trickle charge). The real-time LEO life test battery consists of seven, 50AH (nameplate rating) Eagle-Picher, Inc. (EPI) Mantech cells manufactured into three, 3-cell pack assemblies (there are two place holder cells that are not part of the life test electrical circuit). The test pack is configured to simulate the conductive thermal design of the spacecraft battery, including: conductive aluminum sleeves, 3-cell pack aluminum baseplate, and honeycomb panel all mounted to a liquid (-5 C) cold plate. The entire assembly is located in a thermal chamber operating at +30 C. The accelerated stress test unit consists of five cells mounted in machined aluminum test sleeves and is operating at +10 C. The real-time LEO life test battery has met all performance requirements through the first 18,202 cycles, including: end of charge mid discharge cell voltages and voltage gradients; end of charge and discharge cell pressures; within cell and between cell temperature gradients; discharge capacity; current and power levels; and all charge parameters. The accelerated stress test battery has completed 11,998 cycles when the test was terminated. The stress test unit met all test parameters. This paper reports battery perfortnances as a funcfion of cycle life for both the real-time LEO and the accelerated life test regimes.
EOS--AM1 Nickel Hydrogen Cell Interim Life Test Report
NASA Technical Reports Server (NTRS)
Bennett, C. W.; Keys, D. J.; Rao, G. M.; Wannemacher, H. E.; Vaidyanathan H.
1999-01-01
This paper reports the interim results of the Earth Observing System AM-1 project (EOS-AM-1) nickel hydrogen cell life test being conducted under contract to National Aeronautics and Space Administration (NASA) Goddard Space Flight Center (GSFC) at the Lockheed Martin Missiles and Space (LMMS) facility in East Windsor, NJ; and at COMSAT Labs., Clarksburg, MD. The purpose of the tests is to verify that the EOS-AM-1 cell design can meet five years of real-time Low Earth Orbit (LEO) cycling. The tests include both real-time LEO and accelerated stress tests. At LMMS, the first real-time LEO simulated 99 minute orbital cycle started on February 7, 1994 and the test has been running continuously since that time, with 18202 LEO cycles completed as of September 1, 1997. Each cycle consists of a 64 minute charge (VT at 1.507 volts per cell. 1.06 C/D ratio, followed by 0.6 ampere trickle charge) and a 35 minute constant power discharge at 177 watts (22.5% DOD). At COMSAT, the accelerated stress test consists of 90 minute orbital cycles at 60% DOD with a 30 minute discharge at 60 amperes and a 60 minute charge at 40 amperes (VT at 1.54 volts per cell to 1.09 C/D ratio, followed by 0.6 ampere trickle charge). The real-time LEO life test battery consists of seven, 50AH (nameplate rating) Eagle-Picher, Inc. (EPI) Mantech cells manufactured into three. 3-cell pack assemblies (there are two place holder cells that are not part of the life test electrical circuit). The test pack is configured to simulate the conductive thermal design of the spacecraft battery, including: conductive aluminum sleeves, 3-cell pack aluminum baseplate, and honeycomb panel all mounted to a liquid (-5 C) cold plate. The entire assembly is located in a thermal chamber operatina at +30 C. The accelerated stress test unit consists of five cells mounted in machined aluminum test sleeves and is operating at +10 C. The real-time LEO life test battery has met all performance requirements throuch the first 18,202 cycles, including: end of chargee and discharge cell voltages and voltace -radients; end of charge and discharge cell pressures; within cell and between cell temperature gradients; discharge capacity; current and power levels; and all charge parameters. The accelerated stress test battery has completed 11,998 cycles when the test was terminated. The stress test unit met all test parameters. This paper reports battery performances as a function of cycle life for both the real time LEO and the accelerated life test regimes.
EOS-AM1 Nickel Hydrogen Cell Interim Life Test Report
NASA Technical Reports Server (NTRS)
Bennett, Charles W.; Keys, D. J.; Rao, G. M.; Wannemacher, H. E.; Vaidyanathan, Hari
1998-01-01
This paper reports the interim results Earth Observing System AM-1 project (EOS-AM-1) nickel hydrogen cell life test being conducted under contract to National Aeronautics and Space Administration (NASA) Goddard Space Flight Center (GSFC) at the Lockheed Martin Missiles and Space (LMMS) facility in East Windsor, NJ; and at COMSAT Labs., Clarksburg, MD. The purpose of the tests is to verify that the EOS-AM-1 cell design can meet five years of real-time Low Earth Orbit (LEO) cycling. The tests include both real-time LEO and accelerated stress tests. At LMMS, the first real-time LEO simulated 99 minute orbital cycle started on February 7, 1994 and the test has been running continuously since that time, with 18202 LEO cycles completed as of September 1, 1997. Each cycle consists of a 64-minute charge (VT at 1,507 volts per cell, 1.06 C/D ratio, followed by 0.6 ampere trickle charge) and a 35 minute constant power discharge at 177 watts (22.5 percent DOD). At COMSAT, the accelerated stress test consists of 90 minute orbital cycles at 60 percent DOD with a 30 minute discharge at 60 amperes and a 60 minute charge at 40 amperes (VT at 1.54 volts per cell to 1.90 C/D ratio, followed by 0.6 ampere trickle charge). The real-time LEO life test battery consists of seven, 50AH (nameplate rating) Eagle-Picher, Inc. (EPI) Mantech cells manufactured into three, 3-cell pack assemblies (there are two place holder cells that are not part of the life test electrical circuit). The test pack is configured to simulate the conductive thermal design of the spacecraft battery, including: conductive aluminum sleeves, 3-cell pack aluminum baseplate, and honeycomb panel all mounted to a liquid (minus 5 deg) cold plate. The entire assembly is located in a thermal chamber operating at plus 3 deg. The accelerated stress test unit consists of five cells mounted in machined aluminum test sleeves and is operating at plus 10 deg. The real-time LEO life test battery has met all performance requirements through the first 18,202 cycles, including: end of charge and discharge cell voltages and voltage gradients; end of charge and discharge cells pressures; within cell and between cell temperature gradients dischare capacity; current and power levels; and all charge parameters. The accelerated stress test battery has completed 11998 cycles when the test was terminated. The stress test unit met all test parameters. This paper reports battery performances as a function of cycle life for both the real-time LEO and the accelerated life test regimes.
Contact integrity testing of stress-tested silicon terrestrial solar cells
NASA Technical Reports Server (NTRS)
Prince, J. L.; Lathrop, J. W.; Witter, G. W.
1980-01-01
A test procedure was developed and applied to terrestrial silicon solar cells in order to determine the effect of accelerated environmental and time-temperature aging on metal contact integrity. Quantities of cells of four different manufacturers were given the contact integrity test after being subjected to accelerated stress tests that included forward bias-temperature, thermal cycle and thermal shock, power cycle, and bias-temperature humidity tests at two temperature-humidity levels. Significant effects due to certain stress tests were found for some cell types. It is concluded that cells fabricated using plated nickel/solder metallization showed significantly more serious contact integrity degradation than silver-metallized cells.
An accelerated calendar and cycle life study of Li-ion cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bloom, I.; Cole, B. W.; Sohn, J. J.
2001-10-15
The accelerated calendar and cycle life of lithium-ion cells was studied. Useful cell life was strongly affected by temperature, time, state-of-charge (SOC) and change in state-of-charge ({Delta}SOC). In calendar life experiments, useful cell life was strongly affected by temperature and time. Temperature accelerated cell performance degradation. The rates of area specific impedance (ASI) increase and power fade followed simple laws based on a power of time and Arrhenius kinetics. The data have been modeled using these two concepts and the calculated data agree well with the experimental values. The calendar life ASI increase and power fade data follow (time){sup 1/2}more » kinetics. This behavior may be due to solid electrolyte interface layer growth. From the cycle life experiments, the ASI increase data follow (time){sup 1/2} kinetics also, but there is an apparent change in overall power fade mechanism when going from 3 to 6% {Delta}SOC. Here, the power of time drops to below 1/2, which indicates that the power fade mechanism is more complex than layer growth.« less
Analysis of lead-acid battery accelerated testing data
NASA Astrophysics Data System (ADS)
Clifford, J. E.; Thomas, R. E.
1983-06-01
Battelle conducted an independent review and analysis of the accelerated test procedures and test data obtained by Exide in the 3 year Phase 1 program to develop advanced lead acid batteries for utility load leveling. Of special importance is the extensive data obtained in deep discharge cycling tests on 60 cells at elevated temperatures over a 2-1/2 year period. The principal uncertainty in estimating cell life relates to projecting cycle life data at elevated temperature to the lower operating temperatures. The accelerated positive grid corrosion test involving continuous overcharge at 500C provided some indication of the degree of grid corrosion that might be tolerable before failure. The accelerated positive material shedding test was not examined in any detail. Recommendations are made for additional studies.
Accelerated test plan for nickel cadmium spacecraft batteries
NASA Technical Reports Server (NTRS)
Hennigan, T. J.
1973-01-01
An accelerated test matrix is outlined that includes acceptance, baseline and post-cycling tests, chemical and physical analyses, and the data analysis procedures to be used in determining the feasibility of an accelerated test for sealed, nickel cadmium cells.
Zheng, Dong; Chen, Ziang; Chen, Jingfu; Zhuang, Xiaomin; Feng, Jianqiang; Li, Juan
2016-10-01
Hydrogen sulfide (H2S), regarded as the third gaseous transmitter, mediates and induces various biological effects. The present study investigated the effects of H2S on multiple myeloma cell progression via amplifying the activation of Akt pathway in multiple myeloma cells. The level of H2S produced in multiple myeloma (MM) patients and healthy subjects was measured using enzyme-linked immunosorbent assay (ELISA). MM cells were treated with 500 µmol/l NaHS (a donor of H2S) for 24 h. The expression levels of phosphorylated-Akt (p-Akt), Bcl-2 and caspase-3 were measured by western blot assay. Cell viability was detected by Cell Counting Kit 8 (CCK-8). The cell cycle was analyzed by flow cytometry. Our results show that the concentration of H2S was higher in MM patients and that it increased in parallel with disease progression. Treating MM cells with 500 µmol/l NaHS for 24 h markedly increased the expression level of Bcl-2 and the activation of p-Akt, however, the expression level of caspase-3 was decreased, cell viability was increased, and cell cycle progression was accelerated in MM cells. NaHS also induced migration in MM cells in transwell migration assay. Furthermore, co-treatment of MM cells with 500 µmol/l NaHS and 50 µmol/l LY294002 for 24 h significantly overset these effects. In conclusion, our findings demonstrate that the Akt pathway contributes to NaHS-induced cell proliferation, migration and acceleration of cell cycle progression in MM cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prince, J.L.; Lathrop, J.W.
1979-05-01
The results of accelerated stress testing of four different types of silicon terrestrial solar cells are discussed. The accelerated stress tests used included bias-temperature tests, bias-temperature-humidity tests, thermal cycle and thermal shock tests, and power cycle tests. Characterization of the cells was performed before stress testing and at periodic down-times, using electrical measurement, visual inspection, and metal adherence pull tests. Electrical parameters measured included short-circuit current, I/sub sc/, open circuit voltage, V/sub oc/, and output power, voltage, and current at the maximum power point, P/sub m/, V/sub m/, and I/sub m/ respectively. Incorporated in the report are the distributions ofmore » the prestress electrical data for all cell types. Data was also obtained on cell series and shunt resistance. Significant differences in the response to the various stress tests was observed between cell types. On the basis of the experience gained in this research work, a suggested Reliability Qualification Test Schedule was developed.« less
Traynard, Pauline; Feillet, Céline; Soliman, Sylvain; Delaunay, Franck; Fages, François
2016-11-01
Experimental observations have put in evidence autonomous self-sustained circadian oscillators in most mammalian cells, and proved the existence of molecular links between the circadian clock and the cell cycle. Some mathematical models have also been built to assess conditions of control of the cell cycle by the circadian clock. However, recent studies in individual NIH3T3 fibroblasts have shown an unexpected acceleration of the circadian clock together with the cell cycle when the culture medium is enriched with growth factors, and the absence of such acceleration in confluent cells. In order to explain these observations, we study a possible entrainment of the circadian clock by the cell cycle through a regulation of clock genes around the mitosis phase. We develop a computational model and a formal specification of the observed behavior to investigate the conditions of entrainment in period and phase. We show that either the selective activation of RevErb-α or the selective inhibition of Bmal1 transcription during the mitosis phase, allow us to fit the experimental data on both period and phase, while a uniform inhibition of transcription during mitosis seems incompatible with the phase data. We conclude on the arguments favoring the RevErb-α up-regulation hypothesis and on some further predictions of the model. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
KOH concentration effect on the cycle life of nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Lim, H. S.; Verzwyvelt, S. A.
1985-01-01
Effects of KOH concentration on the cycle life of a sintered-type nickel electrode were studied in a boiler plate nickel-hydrogen cell at 23 C using an accelerated 45-min cycle regime at 80 percent depth of discharge. The cycle life improved greatly as the KOH concentration decreased, although the initial capacity of the cell decreased slightly. The cycle life improved by a factor of two or more when the KOH concentration was reduced from 36 to 31 percent and by a similar factor from reductions of 31 to 26 percent. For many applications, this life improvement may outweigh the initial capacity decrease.
Proseus, Timothy E; Boyer, John S
2012-06-01
Pectin is a normal constituent of cell walls of green plants. When supplied externally to live cells or walls isolated from the large-celled green alga Chara corallina, pectin removes calcium from load-bearing cross-links in the wall, loosening the structure and allowing it to deform more rapidly under the action of turgor pressure. New Ca(2+) enters the vacated positions in the wall and the externally supplied pectin binds to the wall, depositing new wall material that strengthens the wall. A calcium pectate cycle has been proposed for these sub-reactions. In the present work, the cycle was tested in C. corallina by depriving the wall of external Ca(2+) while allowing the cycle to run. The prediction is that growth would eventually be disrupted by a lack of adequate deposition of new wall. The test involved adding pectate or the calcium chelator EGTA to the Ca(2+)-containing culture medium to bind the calcium while the cycle ran in live cells. After growth accelerated, turgor and growth eventually decreased, followed by an abrupt turgor loss and growth cessation. The same experiment with isolated walls suggested the walls of live cells became unable to support the plasma membrane. If instead the pectate or EGTA was replaced with fresh Ca(2+)-containing culture medium during the initial acceleration in live cells, growth was not disrupted and returned to the original rates. The operation of the cycle was thus confirmed, providing further evidence that growth rates and wall biosynthesis are controlled by these sub-reactions in plant cell walls.
Chen, Chun-Fa; Dou, Xiao-Wei; Liang, Yuan-Ke; Lin, Hao-Yu; Bai, Jing-Wen; Zhang, Xi-Xun; Wei, Xiao-Long; Li, Yao-Chen; Zhang, Guo-Jun
2016-01-01
Uncontrolled cell proliferation, genomic instability and cancer are closely related to the abnormal activation of the cell cycle. Therefore, blocking the cell cycle of cancer cells has become one of the key goals for treating malignancies. Unfortunately, the factors affecting cell cycle progression remain largely unknown. In this study, we have explored the effects of Notch3 on the cell cycle in breast cancer cell lines by 3 methods: overexpressing the intra-cellular domain of Notch3 (N3ICD), knocking-down Notch3 by RNA interference, and using X-ray radiation exposure. The results revealed that overexpression of Notch3 arrested the cell cycle at the G0/G1 phase, and inhibited the proliferation and colony-formation rate in the breast cancer cell line, MDA-MB-231. Furthermore, overexpressing N3ICD upregulated Cdh1 expression and resulted in p27(Kip) accumulation by accelerating Skp2 degradation. Conversely, silencing of Notch3 in the breast cancer cell line, MCF-7, caused a decrease in expression levels of Cdh1 and p27(Kip) at both the protein and mRNA levels, while the expression of Skp2 only increased at the protein level. Correspondingly, there was an increase in the percentage of cells in the G0/G1 phase and an elevated proliferative ability and colony-formation rate, which may be caused by alterations of the Cdh1/Skp2/p27 axis. These results were also supported by exposing MDA-MB-231 cells or MCF-7 treated with siN3 to X-irradiation at various doses. Overall, our data showed that overexpression of N3ICD upregulated the expression of Cdh1 and caused p27(Kip) accumulation by accelerating Skp2 degradation, which in turn led to cell cycle arrest at the G0/G1 phase, in the context of proliferating breast cancer cell lines. These findings help to illuminate the precision therapy targeted to cell cycle progression, required for cancer treatment.
Monfredi, Oliver; Maltseva, Larissa A.; Spurgeon, Harold A.; Boyett, Mark R.; Lakatta, Edward G.; Maltsev, Victor A.
2013-01-01
Spontaneous, submembrane local Ca2+ releases (LCRs) generated by the sarcoplasmic reticulum in sinoatrial nodal cells, the cells of the primary cardiac pacemaker, activate inward Na+/Ca2+-exchange current to accelerate the diastolic depolarization rate, and therefore to impact on cycle length. Since LCRs are generated by Ca2+ release channel (i.e. ryanodine receptor) openings, they exhibit a degree of stochastic behavior, manifested as notable cycle-to-cycle variations in the time of their occurrence. Aim The present study tested whether variation in LCR periodicity contributes to intrinsic (beat-to-beat) cycle length variability in single sinoatrial nodal cells. Methods We imaged single rabbit sinoatrial nodal cells using a 2D-camera to capture LCRs over the entire cell, and, in selected cells, simultaneously measured action potentials by perforated patch clamp. Results LCRs begin to occur on the descending part of the action potential-induced whole-cell Ca2+ transient, at about the time of the maximum diastolic potential. Shortly after the maximum diastolic potential (mean 54±7.7 ms, n = 14), the ensemble of waxing LCR activity converts the decay of the global Ca2+ transient into a rise, resulting in a late, whole-cell diastolic Ca2+ elevation, accompanied by a notable acceleration in diastolic depolarization rate. On average, cells (n = 9) generate 13.2±3.7 LCRs per cycle (mean±SEM), varying in size (7.1±4.2 µm) and duration (44.2±27.1 ms), with both size and duration being greater for later-occurring LCRs. While the timing of each LCR occurrence also varies, the LCR period (i.e. the time from the preceding Ca2+ transient peak to an LCR’s subsequent occurrence) averaged for all LCRs in a given cycle closely predicts the time of occurrence of the next action potential, i.e. the cycle length. Conclusion Intrinsic cycle length variability in single sinoatrial nodal cells is linked to beat-to-beat variations in the average period of individual LCRs each cycle. PMID:23826247
Cell Cycle Regulates Nuclear Stability of AID and Determines the Cellular Response to AID
Le, Quy; Maizels, Nancy
2015-01-01
AID (Activation Induced Deaminase) deaminates cytosines in DNA to initiate immunoglobulin gene diversification and to reprogram CpG methylation in early development. AID is potentially highly mutagenic, and it causes genomic instability evident as translocations in B cell malignancies. Here we show that AID is cell cycle regulated. By high content screening microscopy, we demonstrate that AID undergoes nuclear degradation more slowly in G1 phase than in S or G2-M phase, and that mutations that affect regulatory phosphorylation or catalytic activity can alter AID stability and abundance. We directly test the role of cell cycle regulation by fusing AID to tags that destabilize nuclear protein outside of G1 or S-G2/M phases. We show that enforced nuclear localization of AID in G1 phase accelerates somatic hypermutation and class switch recombination, and is well-tolerated; while nuclear AID compromises viability in S-G2/M phase cells. We identify AID derivatives that accelerate somatic hypermutation with minimal impact on viability, which will be useful tools for engineering genes and proteins by iterative mutagenesis and selection. Our results further suggest that use of cell cycle tags to regulate nuclear stability may be generally applicable to studying DNA repair and to engineering the genome. PMID:26355458
Design and Performance Data for 81 Ah FNC Cells
NASA Technical Reports Server (NTRS)
Cohen, F.; Anderman, Menahem
1997-01-01
Design and performance data for 81 Ah FNC cells are given. The conclusions are: that a sealed Ni-Cd cells are not limited to 50 Ah with the FNC design; energy densities of 40 Wh/kg in a conservative high Cd, high electrolyte design have been demonstrated; uniform ATP data and LEO cycling performance is being demonstrated; internal cell pressures remain low under all conditions; and no conditioning is necessary under any LEO profile; accelerated LEO cycling exhibits performance well beyond traditional space Ni-Cd cells.
Accelerated stress testing of terrestrial solar cells
NASA Technical Reports Server (NTRS)
Lathrop, J. W.; Hawkins, D. C.; Prince, J. L.; Walker, H. A.
1982-01-01
The development of an accelerated test schedule for terrestrial solar cells is described. This schedule, based on anticipated failure modes deduced from a consideration of IC failure mechanisms, involves bias-temperature testing, humidity testing (including both 85-85 and pressure cooker stress), and thermal-cycle thermal-shock testing. Results are described for 12 different unencapsulated cell types. Both gradual electrical degradation and sudden catastrophic mechanical change were observed. These effects can be used to discriminate between cell types and technologies relative to their reliability attributes. Consideration is given to identifying laboratory failure modes which might lead to severe degradation in the field through second quadrant operation. Test results indicate that the ability of most cell types to withstand accelerated stress testing depends more on the manufacturer's design, processing, and worksmanship than on the particular metallization system. Preliminary tests comparing accelerated test results on encapsulated and unencapsulated cells are described.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cell - Update II
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1992-01-01
An update of validation test results confirming the breakthrough in LEO cycle life of nickel-hydrogen cells containing 26 percent KOH electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel (IPV) nickel-hydrogen cells has been previously reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles, compared to 3500 cycles for cells containing 31 percent KOH. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min discharge (2X normal rate). The depth-of-discharge was 80 percent. Six 48-Ah Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells), and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The three 31 percent KOH cells failed (cycles 3729, 4165, and 11355). One of the 26 percent KOH cells failed at cycle 15314. The other two 26 percent KOH cells were cycled for over 16,000 cycles during the continuing test.
Centriole maturation requires regulated Plk1 activity during two consecutive cell cycles.
Kong, Dong; Farmer, Veronica; Shukla, Anil; James, Jana; Gruskin, Richard; Kiriyama, Shigeo; Loncarek, Jadranka
2014-09-29
Newly formed centrioles in cycling cells undergo a maturation process that is almost two cell cycles long before they become competent to function as microtubule-organizing centers and basal bodies. As a result, each cell contains three generations of centrioles, only one of which is able to form cilia. It is not known how this long and complex process is regulated. We show that controlled Plk1 activity is required for gradual biochemical and structural maturation of the centrioles and timely appendage assembly. Inhibition of Plk1 impeded accumulation of appendage proteins and appendage formation. Unscheduled Plk1 activity, either in cycling or interphase-arrested cells, accelerated centriole maturation and appendage and cilia formation on the nascent centrioles, erasing the age difference between centrioles in one cell. These findings provide a new understanding of how the centriole cycle is regulated and how proper cilia and centrosome numbers are maintained in the cells.
Centriole maturation requires regulated Plk1 activity during two consecutive cell cycles
Kong, Dong; Farmer, Veronica; Shukla, Anil; James, Jana; Gruskin, Richard; Kiriyama, Shigeo
2014-01-01
Newly formed centrioles in cycling cells undergo a maturation process that is almost two cell cycles long before they become competent to function as microtubule-organizing centers and basal bodies. As a result, each cell contains three generations of centrioles, only one of which is able to form cilia. It is not known how this long and complex process is regulated. We show that controlled Plk1 activity is required for gradual biochemical and structural maturation of the centrioles and timely appendage assembly. Inhibition of Plk1 impeded accumulation of appendage proteins and appendage formation. Unscheduled Plk1 activity, either in cycling or interphase-arrested cells, accelerated centriole maturation and appendage and cilia formation on the nascent centrioles, erasing the age difference between centrioles in one cell. These findings provide a new understanding of how the centriole cycle is regulated and how proper cilia and centrosome numbers are maintained in the cells. PMID:25246616
Landscape and flux reveal a new global view and physical quantification of mammalian cell cycle
Li, Chunhe; Wang, Jin
2014-01-01
Cell cycles, essential for biological function, have been investigated extensively. However, enabling a global understanding and defining a physical quantification of the stability and function of the cell cycle remains challenging. Based upon a mammalian cell cycle gene network, we uncovered the underlying Mexican hat landscape of the cell cycle. We found the emergence of three local basins of attraction and two major potential barriers along the cell cycle trajectory. The three local basins of attraction characterize the G1, S/G2, and M phases. The barriers characterize the G1 and S/G2 checkpoints, respectively, of the cell cycle, thus providing an explanation of the checkpoint mechanism for the cell cycle from the physical perspective. We found that the progression of a cell cycle is determined by two driving forces: curl flux for acceleration and potential barriers for deceleration along the cycle path. Therefore, the cell cycle can be promoted (suppressed), either by enhancing (suppressing) the flux (representing the energy input) or by lowering (increasing) the barrier along the cell cycle path. We found that both the entropy production rate and energy per cell cycle increase as the growth factor increases. This reflects that cell growth and division are driven by energy or nutrition supply. More energy input increases flux and decreases barrier along the cell cycle path, leading to faster oscillations. We also identified certain key genes and regulations for stability and progression of the cell cycle. Some of these findings were evidenced from experiments whereas others lead to predictions and potential anticancer strategies. PMID:25228772
Racetrack-shape fixed field induction accelerator for giant cluster ions
NASA Astrophysics Data System (ADS)
Takayama, Ken; Adachi, Toshikazu; Wake, Masayoshi; Okamura, Katsuya
2015-05-01
A novel scheme for a racetrack-shape fixed field induction accelerator (RAFFIA) capable of accelerating extremely heavy cluster ions (giant cluster ions) is described. The key feature of this scheme is rapid induction acceleration by localized induction cells. Triggering the induction voltages provided by the signals from the circulating bunch allows repeated acceleration of extremely heavy cluster ions. The given RAFFIA example is capable of realizing the integrated acceleration voltage of 50 MV per acceleration cycle. Using 90° bending magnets with a reversed field strip and field gradient is crucial for assuring orbit stability in the RAFFIA.
KOH concentration effect on cycle life of nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Lim, Hong S.; Verzwyvelt, S. A.
1987-01-01
A cycle life test of Ni/H2 cells containing electrolytes of various KOH concentrations and a sintered type nickel electrode was carried out at 23 C using a 45 min accelerated low Earth orbit (LEO) cycle regime at 80 percent depth of discharge. One of three cells containing 26 percent KOH has achieved over 28,000 cycles, and the other two 19,000 cycles, without a sign of failure. Two other cells containing 31 percent KOH electrolyte, which is the concentration presently used in aerospace cells, failed after 2,979 and 3,620 cycles. This result indicates that the cycle life of the present type of Ni/H2 cells may be extended by a factor of 5 to 10 simply by lowering the KOH concentration. Long cycle life of a Ni/H2 battery at high depth-of-discharge operation is desired, particularly for an LEO spacecraft application. Typically, battery life of about 30,000 cycles is required for a five year mission in an LEO. Such a cycle life with presently available cells can be assured only at a very low depth-of-discharge operation. Results of testing already show that the cycle life of an Ni/H2 cell is tremendously improved by simply using an electrolyte of low KOH concentration.
Zugaza, J L; Casabiell, X A; Bokser, L; Eiras, A; Beiras, A; Casanueva, F F
1995-07-01
We have previously demonstrated that pretreatment of several cell lines with cis-unsaturated fatty acids, like oleic acid, blocks epidermal growth factor (EGF)-induced early ionic signals, and in particular the [Ca2+]i rise. In the present work we show that this blockade does not alter EGF-stimulated cellular proliferation evaluated by direct cell counting, but induces a powerful enhancement in the pulsed thymidine incorporation assay. The lack of effect of oleic acid on EGF-stimulated cellular proliferation was confirmed by repeated cell counts, cumulative thymidine incorporation, and protein synthesis, but a clear synergistic effect between oleic acid and EGF was again obtained by means of time course experiments with pulsed thymidine. Combined flow cytometry analysis and cell counts at earlier times in EGF-stimulated cells showed that oleic acids accelerates the entrance of cells into the replicative cycle leading to an earlier cell division. Afterward, these oleic acid-pretreated cells became delayed by an unknown compensatory mechanism in such a way that at 48 h post-EGF, the cell count in control and oleic acid-pretreated cells was equal. In conclusion (a) oleic acid accelerates or enhances the EGF mitogenic action and (b) in the long term cells compensate the initial perturbation with respect to untreated cells. As a side observation, the widely employed pulsed thymidine incorporation method as a measure of cell division could be extremely misleading unless experimental conditions are well controlled.
Growth cycle of Helicobacter pylori in gastric mucous layer.
Nakazawa, Teruko
2002-12-01
Helicobacter pylori bacterium is characterized by its strong urease activity. Our studies on the role of H. pylori urease revealed; (i) it is essential for colonization, (ii) exogenous urea is required for acid resistance, (iii) the bacteria have the ability to move toward urea and sodium bicarbonate, (iv) urea hydrolysis accelerates chemotactic locomotion, and (v) decay of urease mRNA to accomplish the active center is pH-regulated; i.e., the mRNA is stabilized and destabilized under acidic and neutral conditions, respectively. Based on the above results, I propose the growth cycle of H. pylori in gastric mucous layer. H. pylori bacteria proliferate on the epithelial cell surface by utilizing nutrients derived from degraded cells. Proliferated bacteria leave the cell surface to pH-variable region where they encounter strong acid. Urease is activated with simultaneous opening of UreI channel so that urea is hydrolyzed to neutralize acid. Chemotaxis of H. pylori toward urea and sodium bicarbonate that are abundant on the cell surface is accelerated by urea hydrolysis so that the bacteria go back to the cell surface for the next round of proliferation. This growth cycle may allow the bacteria to infect persistently in the stomach.
Mir Cooperative Solar Array Project Accelerated Life Thermal Cycling Test
NASA Technical Reports Server (NTRS)
Hoffman, David J.; Scheiman, David A.
1996-01-01
The Mir Cooperative Solar Array (MCSA) project was a joint U.S./Russian effort to build a photovoltaic (PV) solar array and deliver it to the Russian space station Mir. The MCSA will be used to increase the electrical power on Mir and provide PV array performance data in support of Phase 1 of the International Space Station. The MCSA was brought to Mir by space shuttle Atlantis in November 1995. This report describes an accelerated thermal life cycle test which was performed on two samples of the MCSA. In eight months time, two MCSA solar array 'mini' panel test articles were simultaneously put through 24,000 thermal cycles. There was no significant degradation in the structural integrity of the test articles and no electrical degradation, not including one cell damaged early and removed from consideration. The nature of the performance degradation caused by this one cell is briefly discussed. As a result of this test, changes were made to improve some aspects of the solar cell coupon-to-support frame interface on the flight unit. It was concluded from the results that the integration of the U.S. solar cell modules with the Russian support structure would be able to withstand at least 24,000 thermal cycles (4 years on-orbit). This was considered a successful development test.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Silverman, T. J.; Bosco, N.; Kurtz, S.
2012-03-01
Concentrating photovoltaic (CPV) cell assemblies can fail due to thermomechanical fatigue in the die-attach layer. In this presentation, we show the latest results from our computational model of thermomechanical fatigue. The model is used to estimate the relative lifetime of cell assemblies exposed to various temperature histories consistent with service and with accelerated testing. We also present early results from thermal cycling experiments designed to help validate the computational model.
Mende, Nicole; Kuchen, Erika E.; Lesche, Mathias; Grinenko, Tatyana; Kokkaliaris, Konstantinos D.; Hanenberg, Helmut; Lindemann, Dirk; Dahl, Andreas; Platz, Alexander; Höfer, Thomas; Calegari, Federico
2015-01-01
Maintenance of stem cell properties is associated with reduced proliferation. However, in mouse hematopoietic stem cells (HSCs), loss of quiescence results in a wide range of phenotypes, ranging from functional failure to extensive self-renewal. It remains unknown whether the function of human HSCs is controlled by the kinetics of cell cycle progression. Using human HSCs and human progenitor cells (HSPCs), we report here that elevated levels of CCND1–CDK4 complexes promoted the transit from G0 to G1 and shortened the G1 cell cycle phase, resulting in protection from differentiation-inducing signals in vitro and increasing human leukocyte engraftment in vivo. Further, CCND1–CDK4 overexpression conferred a competitive advantage without impacting HSPC numbers. In contrast, accelerated cell cycle progression mediated by elevated levels of CCNE1–CDK2 led to the loss of functional HSPCs in vivo. Collectively, these data suggest that the transition kinetics through the early cell cycle phases are key regulators of human HSPC function and important for lifelong hematopoiesis. PMID:26150472
Mende, Nicole; Kuchen, Erika E; Lesche, Mathias; Grinenko, Tatyana; Kokkaliaris, Konstantinos D; Hanenberg, Helmut; Lindemann, Dirk; Dahl, Andreas; Platz, Alexander; Höfer, Thomas; Calegari, Federico; Waskow, Claudia
2015-07-27
Maintenance of stem cell properties is associated with reduced proliferation. However, in mouse hematopoietic stem cells (HSCs), loss of quiescence results in a wide range of phenotypes, ranging from functional failure to extensive self-renewal. It remains unknown whether the function of human HSCs is controlled by the kinetics of cell cycle progression. Using human HSCs and human progenitor cells (HSPCs), we report here that elevated levels of CCND1-CDK4 complexes promoted the transit from G0 to G1 and shortened the G1 cell cycle phase, resulting in protection from differentiation-inducing signals in vitro and increasing human leukocyte engraftment in vivo. Further, CCND1-CDK4 overexpression conferred a competitive advantage without impacting HSPC numbers. In contrast, accelerated cell cycle progression mediated by elevated levels of CCNE1-CDK2 led to the loss of functional HSPCs in vivo. Collectively, these data suggest that the transition kinetics through the early cell cycle phases are key regulators of human HSPC function and important for lifelong hematopoiesis. © 2015 Mende et al.
Cycle life test of secondary spacecraft cells
NASA Technical Reports Server (NTRS)
Harkness, J. D.
1980-01-01
The results of the life cycling program on rechargeable calls are reported. Information on required data, the use of which the data will be put, application details, including orbital description, charge control methods, load rquirements, etc., are given. Cycle tests were performed on 660 sealed, nickel cadmium cells. The cells consisted of seven sample classifications ranging form 3.0 to 20 amp. hours. Nickel cadmium, silver cadmium, and silver zinc sealed cells, excluding synchronous orbit and accelerated test packs were added. The capacities of the nickel cadmium cells, the silver cadmium and the silver zinc cells differed in range of amp hrs. The cells were cylced under different load, charge control, and temperature conditions. All cell packs are recharged by use of a pack voltage limit. All charging is constant current until the voltage limit is reached.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight battery cells
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1990-01-01
A breakthrough in low earth orbit (LEO) cycle life of individual pressure vessel (IPV) nickel hydrogen battery cells was reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. The effect of KOH concentration on cycle life was studied. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min charge (2 x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The next step is to validate these results using flight hardware and a real time LEO test. NASA Lewis has a contract with the Naval Weapons Support Center (NWSC), Crane, Indiana, to validate the boiler plate test results. Six 48 A-hr Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells) and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The cells were cycled for over 8000 cycles in the continuing test. There were no failures for the cells containing 26 percent KOH. There was two failures, however, for the cells containing 31 percent KOH.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight battery cells
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1990-01-01
A breakthrough in the low-earth-orbit (LEO) cycle life of individual pressure vessel (IPV) nickel hydrogen battery cells is reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40,000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. The effect of KOH concentration on cycle life was studied. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min charge (2 x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The next step is to validate these results using flight hardware and real time LEO test. NASA Lewis has a contract with the Naval Weapons Support Center (NWSC), Crane, Indiana to validate the boiler plate test results. Six 48 A-hr Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells) and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The cells were cycled for over 8000 cycles in the continuing test. There were no failures for the cells containing 26 percent KOH. There were two failures, however, for the cells containing 31 percent KOH.
Non-stochastic reprogramming from a privileged somatic cell state
Guo, Shangqin; Zi, Xiaoyuan; Schulz, Vincent P.; Cheng, Jijun; Zhong, Mei; Koochaki, Sebastian H.J.; Megyola, Cynthia M.; Pan, Xinghua; Heydari, Kartoosh; Weissman, Sherman M.; Gallagher, Patrick G.; Krause, Diane S.; Fan, Rong; Lu, Jun
2014-01-01
SUMMARY Reprogramming somatic cells to induced pluripotency by Yamanaka factors is usually slow and inefficient, and is thought to be a stochastic process. We identified a privileged somatic cell state, from which acquisition of pluripotency could occur in a non-stochastic manner. Subsets of murine hematopoietic progenitors are privileged, whose progeny cells predominantly adopt the pluripotent fate with activation of endogenous Oct4 locus after 4–5 divisions in reprogramming conditions. Privileged cells display an ultrafast cell cycle of ~8 hours. In fibroblasts, a subpopulation cycling at a similar ultrafast speed is observed after 6 days of factor expression, and is increased by p53-knockdown. This ultrafast-cycling population accounts for >99% of the bulk reprogramming activity in wildtype or p53-knockdown fibroblasts. Our data demonstrate that the stochastic nature of reprogramming can be overcome in a privileged somatic cell state, and suggest that cell cycle acceleration toward a critical threshold is an important bottleneck for reprogramming. PMID:24486105
Mukundan, Rangachary; Baker, Andrew M.; Kusoglu, Ahmet; ...
2018-03-01
A combined chemical/mechanical accelerated stress test (AST) was developed for proton exchange membrane (PEM) fuel cells based on relative humidity cycling (RHC) between dry and saturated gases at open circuit voltage (OCV). Membrane degradation and failure were investigated using scanning electron microscopy and small- and wide-angle X-ray scattering. Changes to membrane thickness, hydrophilic domain spacing, and crystallinity were observed to be most similar between field-operated cells and OCV RHC ASTs, where local thinning and divot-type defects are the primary failure modes. While RHC in air also reproduces these failure modes, it is not aggressive enough to differentiate between different membranemore » types in >1,333 hours (55 days) of testing. Conversely, steady-state OCV tests result in significant ionomer morphology changes and global thinning, which do not replicate field degradation and failure modes. It is inferred that during the OCV RHC AST, the decay of the membrane's mechanical properties is accelerated such that materials can be evaluated in hundreds, instead of thousands, of hours, while replicating the degradation and failure modes of field operation; associated AST protocols are recommended as OCV RHC at 90°C for 500 hours with wet/dry cycle durations of 30s/45s and 2m/2m for automotive and bus operation, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukundan, Rangachary; Baker, Andrew M.; Kusoglu, Ahmet
A combined chemical/mechanical accelerated stress test (AST) was developed for proton exchange membrane (PEM) fuel cells based on relative humidity cycling (RHC) between dry and saturated gases at open circuit voltage (OCV). Membrane degradation and failure were investigated using scanning electron microscopy and small- and wide-angle X-ray scattering. Changes to membrane thickness, hydrophilic domain spacing, and crystallinity were observed to be most similar between field-operated cells and OCV RHC ASTs, where local thinning and divot-type defects are the primary failure modes. While RHC in air also reproduces these failure modes, it is not aggressive enough to differentiate between different membranemore » types in >1,333 hours (55 days) of testing. Conversely, steady-state OCV tests result in significant ionomer morphology changes and global thinning, which do not replicate field degradation and failure modes. It is inferred that during the OCV RHC AST, the decay of the membrane's mechanical properties is accelerated such that materials can be evaluated in hundreds, instead of thousands, of hours, while replicating the degradation and failure modes of field operation; associated AST protocols are recommended as OCV RHC at 90°C for 500 hours with wet/dry cycle durations of 30s/45s and 2m/2m for automotive and bus operation, respectively.« less
Sequential replication-coupled destruction at G1/S ensures genome stability
Coleman, Kate E.; Grant, Gavin D.; Haggerty, Rachel A.; Brantley, Kristen; Shibata, Etsuko; Workman, Benjamin D.; Dutta, Anindya; Varma, Dileep; Purvis, Jeremy E.; Cook, Jeanette Gowen
2015-01-01
Timely ubiquitin-mediated protein degradation is fundamental to cell cycle control, but the precise degradation order at each cell cycle phase transition is still unclear. We investigated the degradation order among substrates of a single human E3 ubiquitin ligase, CRL4Cdt2, which mediates the S-phase degradation of key cell cycle proteins, including Cdt1, PR-Set7, and p21. Our analysis of synchronized cells and asynchronously proliferating live single cells revealed a consistent order of replication-coupled destruction during both S-phase entry and DNA repair; Cdt1 is destroyed first, whereas p21 destruction is always substantially later than that of Cdt1. These differences are attributable to the CRL4Cdt2 targeting motif known as the PIP degron, which binds DNA-loaded proliferating cell nuclear antigen (PCNADNA) and recruits CRL4Cdt2. Fusing Cdt1's PIP degron to p21 causes p21 to be destroyed nearly concurrently with Cdt1 rather than consecutively. This accelerated degradation conferred by the Cdt1 PIP degron is accompanied by more effective Cdt2 recruitment by Cdt1 even though p21 has higher affinity for PCNADNA. Importantly, cells with artificially accelerated p21 degradation display evidence of stalled replication in mid-S phase and sensitivity to replication arrest. We therefore propose that sequential degradation ensures orderly S-phase progression to avoid replication stress and genome instability. PMID:26272819
KOH concentration effect on the cycle life of nickel-hydrogen cells. 4: Results of failure analyse
NASA Technical Reports Server (NTRS)
Lim, H. S.; Verzwyvelt, S. A.
1989-01-01
Effects of KOH concentrations on failure modes and mechanisms of nickel-hydrogen cells were studied using long cycled boiler plate cells containing electrolytes of various KOH concentrations ranging 21 to 36 percent. Life of these cells were up to 40,000 cycles in an accelerated low earth orbit (LEO) cycle regime at 80 percent depth of discharge. An interim life test results were reported earlier in J. Power Sources, 22, 213-220, 1988. The results of final life test, end-of-life cell performance, and teardown analyses are discussed. These teardown analyses included visual observations, measurements of nickel electrode capacity in an electrolyte-flooded cell, dimensional changes of cell components, SEM studies on cell cross section, BET surface area and pore volume distribution in cycled nickel electrodes, and chemical analyses. Cycle life of a nickel-hydrogen cell was improved tremendously as KOH concentration was decreased from 36 to 31 percent and from 31 to 26 percent while effect of further concentration decrease was complicated as described in our earlier report. Failure mode of high concentration (31 to 36 percent) cells was gradual capacity decrease, while that of low concentration (21 to 26 percent) cells was mainly formation of a soft short. Long cycled (25,000 to 40,000 cycles) nickel electrodes were expanded more than 50 percent of the initial value, but no correlation was found between this expansion and measured capacity. All electrodes cycled in low concentration (21 to 26 percent) cells had higher capacity than those cycled in high concentration (31 to 36 percent) cells.
Advanced nickel-hydrogen spacecraft battery development
NASA Technical Reports Server (NTRS)
Coates, Dwaine K.; Fox, Chris L.; Standlee, D. J.; Grindstaff, B. K.
1994-01-01
Eagle-Picher currently has several advanced nickel-hydrogen (NiH2) cell component and battery designs under development including common pressure vessel (CPV), single pressure vessel (SPV), and dependent pressure vessel (DPV) designs. A CPV NiH2 battery, utilizing low-cost 64 mm (2.5 in.) cell diameter technology, has been designed and built for multiple smallsat programs, including the TUBSAT B spacecraft which is currently scheduled (24 Nov. 93) for launch aboard a Russian Proton rocket. An advanced 90 mm (3.5 in.) NiH2 cell design is currently being manufactured for the Space Station Freedom program. Prototype 254 mm (10 in.) diameter SPV batteries are currently under construction and initial boilerplate testing has shown excellent results. NiH2 cycle life testing is being continued at Eagle-Picher and IPV cells have currently completed more than 89,000 accelerated LEO cycles at 15% DOD, 49,000 real-time LEO cycles at 30 percent DOD, 37,800 cycles under a real-time LEO profile, 30 eclipse seasons in accelerated GEO, and 6 eclipse seasons in real-time GEO testing at 75 percent DOD maximum. Nickel-metal hydride battery development is continuing for both aerospace and electric vehicle applications. Eagle-Picher has also developed an extensive range of battery evaluation, test, and analysis (BETA) measurement and control equipment and software, based on Hewlett-Packard computerized data acquisition/control hardware.
Thermal and Cycle-Life Behavior of Commercial Li-ion and Li-Polymer Cells
NASA Technical Reports Server (NTRS)
Zimmerman, Albert H.; Quinzio, M. V.
2001-01-01
Accelerated and real-time LEO cycle-life test data will be presented for a range of commercial Li-ion and Li-polymer (gel type) cells indicating the ranges of performance that can be obtained, and the performance screening tests that must be done to assure long life. The data show large performance variability between cells, as well as a highly variable degradation signature during non-cycling periods within the life tests. High-resolution Dynamic Calorimetry data will be presented showing the complex series of reactions occurring within these Li cells as they are cycled. Data will also be presented for cells being tested using an Adaptive Charge Control Algorithm (ACCA) that continuously adapts itself to changes in cell performance, operation, or environment to both find and maintain the optimum recharge over life. The ACCA has been used to prevent all unneeded overcharge for Li cells, NiCd cells and NiH2 cells. While this is important for all these cell types, it is most critical for Li-ion cells, which are not designed with electrochemical tolerance for overcharge.
Investigation of reliability attributes and accelerated stress factors on terrestrial solar cells
NASA Technical Reports Server (NTRS)
Lathrop, J. W.; Prince, J. L.
1980-01-01
Three tasks were undertaken to investigate reliability attributes of terrestrial solar cells: (1) a study of the electrical behavior of cells in the second (reverse) quadrant; (2) the accelerated stress testing of three new state-of-the-art cells; and (3) the continued bias-temperature testing of four block 2 type silicon cells at 78 C and 135 C. Electrical characteristics measured in the second quadrant were determined to be a function of the cell's thermal behavior with breakdown depending on the initiation of localized heating. This implied that high breakdown cells may be more fault tolerant when forced to operate in the second quadrant, a result contrary to conventional thinking. The accelerated stress tests used in the first (power) quadrant were bias-temperature, bias-temperature-humidity, temperature-humidity, thermal shock, and thermal cycle. The new type cells measured included an EFG cell, a polycrystalline cell, and a Czochralski cell. Significant differences in the response to the various tests were observed between cell types. A microprocessed controlled, short interval solar cell tester was designed and construction initiated on a prototype.
A nontranscriptional role for Oct4 in the regulation of mitotic entry
Zhao, Rui; Deibler, Richard W.; Lerou, Paul H.; Ballabeni, Andrea; Heffner, Garrett C.; Cahan, Patrick; Unternaehrer, Juli J.; Kirschner, Marc W.; Daley, George Q.
2014-01-01
Rapid progression through the cell cycle and a very short G1 phase are defining characteristics of embryonic stem cells. This distinct cell cycle is driven by a positive feedback loop involving Rb inactivation and reduced oscillations of cyclins and cyclin-dependent kinase (Cdk) activity. In this setting, we inquired how ES cells avoid the potentially deleterious consequences of premature mitotic entry. We found that the pluripotency transcription factor Oct4 (octamer-binding transcription factor 4) plays an unappreciated role in the ES cell cycle by forming a complex with cyclin–Cdk1 and inhibiting Cdk1 activation. Ectopic expression of Oct4 or a mutant lacking transcriptional activity recapitulated delayed mitotic entry in HeLa cells. Reduction of Oct4 levels in ES cells accelerated G2 progression, which led to increased chromosomal missegregation and apoptosis. Our data demonstrate an unexpected nontranscriptional function of Oct4 in the regulation of mitotic entry. PMID:25324523
NASA Astrophysics Data System (ADS)
Kilic, Cevahir; Raible, Christoph C.; Stocker, Thomas F.; Kirk, Edilbert
2017-01-01
Fundamental to the redistribution of energy in a planetary atmosphere is the general circulation and its meridional structure. We use a general circulation model of the atmosphere in an aquaplanet configuration with prescribed sea surface temperature and investigate the influence of the gravitational acceleration g on the structure of the circulation. For g =g0 = 9.81 ms-2 , three meridional cells exist in each hemisphere. Up to about g /g0 = 1.4 all cells increase in strength. Further increasing this ratio results in a weakening of the thermally indirect cell, such that a two- and finally a one-cell structure of the meridional circulation develops in each hemisphere. This transition is explained by the primary driver of the thermally direct Hadley cell: the diabatic heating at the equator which is proportional to g. The analysis of the energetics of the atmospheric circulation based on the Lorenz energy cycle supports this finding. For Earth-like gravitational accelerations transient eddies are primarily responsible for the meridional heat flux. For large gravitational accelerations, the direct zonal mean conversion of energy dominates the meridional heat flux.
Effect of KOH concentration on LEO cycle life of IPV nickel-hydrogen flight cells-update 2
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Hall, Stephen W.
1991-01-01
An update of validation test results confirming the breakthrough in low earth orbit (LEO) cycle life of nickel-hydrogen cells containing 26 percent KOH electrolyte is presented. A breakthrough in the LEO cycle life of individual pressure vessel (IPV nickel-hydrogen cells has been previously reported. The cycle life of boiler plate cells containing 26 percent potassium hydroxide (KOH) electrolyte was about 40 000 LEO cycles compared to 3500 cycles for cells containing 31 percent KOH. This test was conducted at Hughes Aircraft Company under a NASA Lewis contract. The purpose was to investigate the effect of KOH concentration on cycle life. The cycle regime was a stressful accelerated LEO, which consisted of a 27.5 min charge followed by a 17.5 min discharge (2x normal rate). The depth of discharge (DOD) was 80 percent. The cell temperature was maintained at 23 C. The boiler plate test results are in the process of being validated using flight hardware and real time LEO test at the Naval Weapons Support Center (NWSC), Crane, Indiana under a NASA Lewis Contract. Six 48 Ah Hughes recirculation design IPV nickel-hydrogen flight battery cells are being evaluated. Three of the cells contain 26 percent KOH (test cells), and three contain 31 percent KOH (control cells). They are undergoing real time LEO cycle life testing. The cycle regime is a 90-min LEO orbit consisting of a 54-min charge followed by a 36-min discharge. The depth-of-discharge is 80 percent. The cell temperature is maintained at 10 C. The three 31 percent KOH cells failed (cycles 3729, 4165, and 11355). One of the 26 percent KOH cells failed at cycle 15314. The other two 26 percent KOH cells were cycled for over 16600 cycles during the continuing test.
JavanMoghadam, Sonia; Weihua, Zhang; Hunt, Kelly K.; Keyomarsi, Khandan
2016-01-01
ABSTRACT Estrogen receptor alpha (ERα) has been implicated in several cell cycle regulatory events and is an important predictive marker of disease outcome in breast cancer patients. Here, we aimed to elucidate the mechanism through which ERα influences proliferation in breast cancer cells. Our results show that ERα protein is cell cycle-regulated in human breast cancer cells and that the presence of 17-β-estradiol (E2) in the culture medium shortened the cell cycle significantly (by 4.5 hours, P < 0.05) compared with unliganded conditions. The alterations in cell cycle duration were observed in the S and G2/M phases, whereas the G1 phase was indistinguishable under liganded and unliganded conditions. In addition, ERα knockdown in MCF-7 cells accelerated mitotic exit, whereas transfection of ERα-negative MDA-MB-231 cells with exogenous ERα significantly shortened the S and G2/M phases (by 9.1 hours, P < 0.05) compared with parental cells. Finally, treatment of MCF-7 cells with antiestrogens revealed that tamoxifen yields a slower cell cycle progression through the S and G2/M phases than fulvestrant does, presumably because of the destabilizing effect of fulvestrant on ERα protein. Together, these results show that ERα modulates breast cancer cell proliferation by regulating events during the S and G2/M phases of the cell cycle in a ligand-dependent fashion. These results provide the rationale for an effective treatment strategy that includes a cell cycle inhibitor in combination with a drug that lowers estrogen levels, such as an aromatase inhibitor, and an antiestrogen that does not result in the degradation of ERα, such as tamoxifen. PMID:27049344
JavanMoghadam, Sonia; Weihua, Zhang; Hunt, Kelly K; Keyomarsi, Khandan
2016-06-17
Estrogen receptor alpha (ERα) has been implicated in several cell cycle regulatory events and is an important predictive marker of disease outcome in breast cancer patients. Here, we aimed to elucidate the mechanism through which ERα influences proliferation in breast cancer cells. Our results show that ERα protein is cell cycle-regulated in human breast cancer cells and that the presence of 17-β-estradiol (E2) in the culture medium shortened the cell cycle significantly (by 4.5 hours, P < 0.05) compared with unliganded conditions. The alterations in cell cycle duration were observed in the S and G2/M phases, whereas the G1 phase was indistinguishable under liganded and unliganded conditions. In addition, ERα knockdown in MCF-7 cells accelerated mitotic exit, whereas transfection of ERα-negative MDA-MB-231 cells with exogenous ERα significantly shortened the S and G2/M phases (by 9.1 hours, P < 0.05) compared with parental cells. Finally, treatment of MCF-7 cells with antiestrogens revealed that tamoxifen yields a slower cell cycle progression through the S and G2/M phases than fulvestrant does, presumably because of the destabilizing effect of fulvestrant on ERα protein. Together, these results show that ERα modulates breast cancer cell proliferation by regulating events during the S and G2/M phases of the cell cycle in a ligand-dependent fashion. These results provide the rationale for an effective treatment strategy that includes a cell cycle inhibitor in combination with a drug that lowers estrogen levels, such as an aromatase inhibitor, and an antiestrogen that does not result in the degradation of ERα, such as tamoxifen.
Xia, Xi; Yu, Yang; Zhang, Li; Ma, Yang; Wang, Hong
2016-01-01
Endothelial injury is a risk factor for atherosclerosis. Endothelial progenitor cell (EPC) proliferation contributes to vascular injury repair. Overexpression of inhibitor of DNA binding 1 (Id1) significantly promotes EPC proliferation; however, the underlying molecular mechanism remains to be fully elucidated. The present study investigated the role of Id1 in cell cycle regulation of EPCs, which is closely associated with proliferation. Overexpression of Id1 increased the proportion of EPCs in the S/G2M phase and significantly increased cyclin D1 expression levels, while knockdown of Id1 arrested the cell cycle progression of EPCs in the G1 phase and inhibited cyclin D1 expression levels. In addition, it was demonstrated that Id1 upregulated wingless-type mouse mammary tumor virus integration site family member 2 (Wnt2) expression levels and promoted β-catenin accumulation and nuclear translocation. Furthermore, Wnt2 knockdown counteracted the effects of Id1 on cell cycle progression of EPCs. In conclusion, the results of the present study indicate that Id1 promoted Wnt2 expression, which accelerated cell cycle progression from G1 to S phase. This suggests that Id1 may promote cell cycle progression of EPCs, and that Wnt2 may be important in Id1 regulation of the cell cycle of EPCs. PMID:27432753
Bektik, Emre; Dennis, Adrienne; Pawlowski, Gary; Zhou, Chen; Maleski, Danielle; Takahashi, Satoru; Laurita, Kenneth R; Deschênes, Isabelle; Fu, Ji-Dong
2018-05-04
Direct reprogramming of fibroblasts into induced cardiomyocytes (iCMs) holds a great promise for regenerative medicine and has been studied in several major directions. However, cell-cycle regulation, a fundamental biological process, has not been investigated during iCM-reprogramming. Here, our time-lapse imaging on iCMs, reprogrammed by Gata4, Mef2c, and Tbx5 (GMT) monocistronic retroviruses, revealed that iCM-reprogramming was majorly initiated at late-G1- or S-phase and nearly half of GMT-reprogrammed iCMs divided soon after reprogramming. iCMs exited cell cycle along the process of reprogramming with decreased percentage of 5-ethynyl-20-deoxyuridine (EdU)⁺/α-myosin heavy chain (αMHC)-GFP⁺ cells. S-phase synchronization post-GMT-infection could enhance cell-cycle exit of reprogrammed iCMs and yield more GFP high iCMs, which achieved an advanced reprogramming with more expression of cardiac genes than GFP low cells. However, S-phase synchronization did not enhance the reprogramming with a polycistronic-viral vector, in which cell-cycle exit had been accelerated. In conclusion, post-infection synchronization of S-phase facilitated the early progression of GMT-reprogramming through a mechanism of enhanced cell-cycle exit.
Carbon Corrosion in PEM Fuel Cells and the Development of Accelerated Stress Tests
Macauley, Natalia; Papadias, Dennis D.; Fairweather, Joseph; ...
2018-03-15
Here, carbon corrosion is an important degradation mechanism that can impair PEMFC performance through the destruction of catalyst connectivity, collapse of the electrode pore structure, loss of hydrophobic character, and an increase of the catalyst particle size. In this study, carbon corrosion was quantified in situ by measurement of carbon dioxide in the fuel cell exhaust gases through non-dispersive infrared spectroscopy during simulated drive cycle operations consisting of potential cycling with varying upper and lower potential limits. These studies were conducted for three different types of carbon supports. A reduction in the catalyst layer thickness was observed during a simulatedmore » drive cycle operation with a concomitant decrease in catalyst layer porosity, which led to performance losses due to increased mass transport limitations. The observed thickness reduction was primarily due to compaction of the catalyst layer, with the actual mass of carbon oxidation (loss) contributing only a small fraction (< 20%). The dynamics of carbon corrosion are presented along with a model that simulates the transient and dynamic corrosion rates observed in our experiments. Accelerated carbon corrosion stress tests are presented and their effects are compared to those observed for the drive cycle test.« less
Carbon Corrosion in PEM Fuel Cells and the Development of Accelerated Stress Tests
DOE Office of Scientific and Technical Information (OSTI.GOV)
Macauley, Natalia; Papadias, Dennis D.; Fairweather, Joseph
Here, carbon corrosion is an important degradation mechanism that can impair PEMFC performance through the destruction of catalyst connectivity, collapse of the electrode pore structure, loss of hydrophobic character, and an increase of the catalyst particle size. In this study, carbon corrosion was quantified in situ by measurement of carbon dioxide in the fuel cell exhaust gases through non-dispersive infrared spectroscopy during simulated drive cycle operations consisting of potential cycling with varying upper and lower potential limits. These studies were conducted for three different types of carbon supports. A reduction in the catalyst layer thickness was observed during a simulatedmore » drive cycle operation with a concomitant decrease in catalyst layer porosity, which led to performance losses due to increased mass transport limitations. The observed thickness reduction was primarily due to compaction of the catalyst layer, with the actual mass of carbon oxidation (loss) contributing only a small fraction (< 20%). The dynamics of carbon corrosion are presented along with a model that simulates the transient and dynamic corrosion rates observed in our experiments. Accelerated carbon corrosion stress tests are presented and their effects are compared to those observed for the drive cycle test.« less
NASA Lewis advanced IPV nickel-hydrogen technology
NASA Technical Reports Server (NTRS)
Smithrick, John J.; Britton, Doris L.
1993-01-01
Individual pressure vessel (IPV) nickel-hydrogen technology was advanced at NASA Lewis and under Lewis contracts. Some of the advancements are as follows: to use 26 percent potassium hydroxide electrolyte to improve cycle life and performance, to modify the state of the art cell design to eliminate identified failure modes and further improve cycle life, and to develop a lightweight nickel electrode to reduce battery mass, hence reduce launch and/or increase satellite payload. A breakthrough in the LEO cycle life of individual pressure vessel nickel-hydrogen battery cells was reported. The cycle life of boiler plate cells containing 26 percent KOH electrolyte was about 40,000 accelerated LEO cycles at 80 percent DOD compared to 3,500 cycles for cells containing 31 percent KOH. Results of the boiler plate cell tests have been validated at NWSC, Crane, Indiana. Forty-eight ampere-hour flight cells containing 26 and 31 percent KOH have undergone real time LEO cycle life testing at an 80 percent DOD, 10 C. The three cells containing 26 percent KOH failed on the average at cycle 19,500. The three cells containing 31 percent KOH failed on the average at cycle 6,400. Validation testing of NASA Lewis 125 Ah advanced design IPV nickel-hydrogen flight cells is also being conducted at NWSC, Crane, Indiana under a NASA Lewis contract. This consists of characterization, storage, and cycle life testing. There was no capacity degradation after 52 days of storage with the cells in the discharged state, on open circuit, 0 C, and a hydrogen pressure of 14.5 psia. The catalyzed wall wick cells have been cycled for over 22,694 cycles with no cell failures in the continuing test. All three of the non-catalyzed wall wick cells failed (cycles 9,588; 13,900; and 20,575). Cycle life test results of the Fibrex nickel electrode has demonstrated the feasibility of an improved nickel electrode giving a higher specific energy nickel-hydrogen cell. A nickel-hydrogen boiler plate cell using an 80 mil thick, 90 percent porous Fibrex nickel electrode has been cycled for 10,000 cycles at 40 percent DOD.
Effects of HRAS oncogene on cell cycle progression in a cervical cancer-derived cell line.
Córdova-Alarcón, Emilio; Centeno, Federico; Reyes-Esparza, Jorge; García-Carrancá, Alejandro; Garrido, Efraín
2005-01-01
Human papillomavirus (HPV) infection is the most prevalent factor in anogenital cancers. However, epidemiological surveys and molecular data indicate that viral presence is not enough to induce cervical cancer, suggesting that cellular factors could play a key role. One of the most important genes involved in cancer development is the RAS oncogene, and activating mutations in this gene have been associated with HPV infection and cervical neoplasia. Thus, we determined the effect of HRAS oncogene expression on cell proliferation in a cell line immortalized by E6 and E7 oncogenes. HPV positive human cervical carcinoma-derived cell lines (HeLa), previously transfected with the HRAS oncogene or the empty vector, were used. We first determined the proliferation rate and cell cycle profile of these cells by using flow cytometry and BrdU incorporation assays. In order to determine the signaling pathway regulated by HRAS and implicated in the alteration of proliferation of these cells, we used specific chemical inhibitors to inactivate the Raf and PI3K pathways. We observed that HeLa cells stably transfected with oncogenic HRAS progressed faster than control cells on the cell cycle by reducing their G1 phase. Additionally, HRAS overexpression accelerated the G1/S transition. Specific chemical inhibitors for PI3K and MEK activities indicated that both PI3K/AKT and RAF/MEK/ERK pathways are involved in the HRAS oncogene-induced reduction of the G1 phase. Our results suggest that the HRAS oncogene could play an important role in the development of cervical cancer, in addition to the presence of HPV, by reducing the G1 phase and accelerating the G1/S transition of infected cells.
NASA Astrophysics Data System (ADS)
Tsanakas, John A.; Jaffre, Damien; Sicre, Mathieu; Elouamari, Rachid; Vossier, Alexis; de Salins, Jean-Edouard; Bechou, Laurent; Levrier, Bruno; Perona, Arnaud; Dollet, Alain
2014-09-01
This paper presents a preliminary study upon a novel approach proposed for highly accelerated ageing and reliability optimization of high concentrating photovoltaic (HCPV) cells and assemblies. The intended approach aims to overcome several limitations of some current accelerated ageing tests (AAT) adopted up today, proposing the use of an alternative experimental set-up for performing faster and more realistic thermal cycles, under real sun, without the involvement of environmental chamber. The study also includes specific characterization techniques, before and after each AAT sequence, which respectively provide the initial and final diagnosis on the condition of the tested sample. The acquired data from these diagnostic/characterization methods are then used as indices to determine both quantitatively and qualitatively the severity of degradation and, thus, the ageing level for each tested HCPV assembly or cell sample. Ultimate goal of such "initial diagnosis - AAT - final diagnosis" sequences is to provide the basis for a future work on the reliability analysis of the main degradation mechanisms and confident prediction of failure propagation in HCPV cells, by means of acceleration factor (AF) and mean-time-to-failure (MTTF) estimations.
Thermal Characterization Study of Lithium-Ion Cells
NASA Technical Reports Server (NTRS)
Britton, Doris L.; Miller, Thomas B.; Bennett, William R.
2007-01-01
The primary challenge in designing a full scale lithium-ion (Li-ion) battery system is safety under both normal operating as well as abusive conditions. The normal conditions involve expected charge/discharge cycles and it is known that heat evolves in batteries during those cycles. This is a major concern in the design for high power applications and careful thermal management is necessary to alleviate this concern. An emerging thermal measurement technology, such as the electrochemical calorimetric of batteries, will aid in the development of advanced, safe battery system. To support this technology, several "commercial-off-the-shelf" (COTS) Li-ion cells with different chemistries and designs are being evaluated for different cycling regimes at a given operating temperature. The Accelerated Rate Calorimeter (ARC)-Arbin cycler setup is used to measure the temperature, voltage, and current of the cells at different charge/discharge rates. Initial results demonstrated good cell cyclability. During the cycle testing, the cell exhibited an endothermic cooling in the initial part of the charge cycle. The discharge portion of the cycle is exothermic during the entire discharge period. The presence of an endothermic reaction indicates a significant entropy effect during the beginning of charge cycle. Further studies will be performed to understand the thermal characteristics of the Li-ion cells at the different operating conditions. The effects on the thermal response on cell aging and states-of-charge will also be identified.
Fox, Raymond G; Magness, Scott; Kujoth, Gregory C; Prolla, Tomas A; Maeda, Nobuyo
2012-05-01
Changes in intestinal absorption of nutrients are important aspects of the aging process. To address this issue, we investigated the impact of accelerated mitochondrial DNA mutations on the stem/progenitor cells in the crypts of Lieberkühn in mice homozygous for a mitochondrial DNA polymerase gamma mutation, Polg(D257A), that exhibit accelerated aging phenotype. As early as 3-7 mo of age, the small intestine was significantly enlarged in the PolgD257A mice. The crypts of the PolgD257A mice contained 20% more cells than those of their wild-type littermates and exhibited a 10-fold increase in cellular apoptosis primarily in the stem/progenitor cell zones. Actively dividing cells were proportionally increased, yet a significantly smaller proportion of cells was in the S phase of the cell cycle. Stem cell-derived organoids from PolgD257A mice failed to develop fully in culture and exhibited fewer crypt units, indicating an impact of the mutation on the intestinal epithelial stem/progenitor cell maintenance. In addition, epithelial cell migration along the crypt-villus axis was slowed and less organized, and the ATP content in the villi was significantly reduced. On a high-fat, high-carbohydrate diet, PolgD257A mice showed significantly restricted absorption of excess lipids accompanied by an increase in fecal steatocrits. We conclude that the PolgD257A mutation causes cell cycle dysregulation in the crypts leading to the age-associated changes in the morphology of the small intestine and contributes to the restricted absorption of dietary lipids.
Particle-in-cell simulation of x-ray wakefield acceleration and betatron radiation in nanotubes
Zhang, Xiaomei; Tajima, Toshiki; Farinella, Deano; ...
2016-10-18
Though wakefield acceleration in crystal channels has been previously proposed, x-ray wakefield acceleration has only recently become a realistic possibility since the invention of the single-cycled optical laser compression technique. We investigate the acceleration due to a wakefield induced by a coherent, ultrashort x-ray pulse guided by a nanoscale channel inside a solid material. By two-dimensional particle-in-cell computer simulations, we show that an acceleration gradient of TeV/cm is attainable. This is about 3 orders of magnitude stronger than that of the conventional plasma-based wakefield accelerations, which implies the possibility of an extremely compact scheme to attain ultrahigh energies. In additionmore » to particle acceleration, this scheme can also induce the emission of high energy photons at ~O(10–100) MeV. Here, our simulations confirm such high energy photon emissions, which is in contrast with that induced by the optical laser driven wakefield scheme. In addition to this, the significantly improved emittance of the energetic electrons has been discussed.« less
Hassani, Saeed; Khaleghian, Ali; Ahmadian, Shahin; Alizadeh, Shaban; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir; Ghaffari, Seyed H
2018-01-01
PML-RARα perturbs the normal epigenetic setting, which is essential to oncogenic transformation in acute promyelocytic leukemia (APL). Transcription induction and recruitment of DNA methyltransferases (DNMTs) by PML-RARα and subsequent hypermethylation are components of this perturbation. Arsenic trioxide (ATO), an important drug in APL therapy, concurrent with degradation of PML-RARα induces cell cycle change and apoptosis. How ATO causes cell cycle alteration has remained largely unexplained. Here, we investigated DNA methylation patterns of cell cycle regulatory genes promoters, the effects of ATO on the methylated genes and cell cycle distribution in an APL cell line, NB4. Analysis of promoter methylation status of 22 cell cycle related genes in NB4 revealed that CCND1, CCNE1, CCNF, CDKN1A, GADD45α, and RBL1 genes were methylated 60.7, 84.6, 58.6, 8.7, 33.4, and 73.7%, respectively, that after treatment with 2 μM ATO for 48 h, turn into 0.6, 13.8, 0.1, 6.6, 10.7, and 54.5% methylated. ATO significantly reduced the expression of DNMT1, 3A, and 3B. ATO induced the expression of CCND1, CCNE1, and GADD45α genes, suppressed the expression of CCNF and CDKN1A genes, which were consistent with decreased number of cells in G1 and S phases and increased number of cells in G2/M phase. In conclusion, demethylation and alteration in the expression level of the cell cycle related genes may be possible mechanisms in ATO-induced cell cycle arrest in APL cells. It may suggest that ATO by demethylation of CCND1 and CCNE1 and their transcriptional activation accelerates G1 and S transition into the G2/M cell cycle arrest.
Rapid Prototyping of Microbial Cell Factories via Genome-scale Engineering
Si, Tong; Xiao, Han; Zhao, Huimin
2014-01-01
Advances in reading, writing and editing genetic materials have greatly expanded our ability to reprogram biological systems at the resolution of a single nucleotide and on the scale of a whole genome. Such capacity has greatly accelerated the cycles of design, build and test to engineer microbes for efficient synthesis of fuels, chemicals and drugs. In this review, we summarize the emerging technologies that have been applied, or are potentially useful for genome-scale engineering in microbial systems. We will focus on the development of high-throughput methodologies, which may accelerate the prototyping of microbial cell factories. PMID:25450192
An essential cell cycle regulation gene causes hybrid inviability in Drosophila
Phadnis, Nitin; Baker, EmilyClare P.; Cooper, Jacob C.; Frizzell, Kimberly A.; Hsieh, Emily; de la Cruz, Aida Flor A.; Shendure, Jay; Kitzman, Jacob O.; Malik, Harmit S.
2015-01-01
Speciation, the process by which new biological species arise, involves the evolution of reproductive barriers such as hybrid sterility or inviability between populations. However, identifying hybrid incompatibility genes remains a key obstacle in understanding the molecular basis of reproductive isolation. We devised a genomic screen, which identified a cell cycle regulation gene as the cause of male inviability in hybrids between Drosophila melanogaster and D. simulans. Ablation of the D. simulans allele of this gene is sufficient to rescue the adult viability of hybrid males. This dominantly acting cell cycle regulator causes mitotic arrest and, thereby, inviability of male hybrid larvae. Our genomic method provides a facile means to accelerate the identification of hybrid incompatibility genes in other model and non-model systems. PMID:26680200
Alao, John P; Sjölander, Johanna J; Baar, Juliane; Özbaki-Yagan, Nejla; Kakoschky, Bianca; Sunnerhagen, Per
2014-01-01
Cdc25 is required for Cdc2 dephosphorylation and is thus essential for cell cycle progression. Checkpoint activation requires dual inhibition of Cdc25 and Cdc2 in a Rad3-dependent manner. Caffeine is believed to override activation of the replication and DNA damage checkpoints by inhibiting Rad3-related proteins in both S chizosaccharomyces pombe and mammalian cells. In this study, we have investigated the impact of caffeine on Cdc25 stability, cell cycle progression and checkpoint override. Caffeine induced Cdc25 accumulation in S . pombe independently of Rad3. Caffeine delayed cell cycle progression under normal conditions but advanced mitosis in cells treated with replication inhibitors and DNA-damaging agents. In the absence of Cdc25, caffeine inhibited cell cycle progression even in the presence of hydroxyurea or phleomycin. Caffeine induces Cdc25 accumulation in S . pombe by suppressing its degradation independently of Rad3. The induction of Cdc25 accumulation was not associated with accelerated progression through mitosis, but rather with delayed progression through cytokinesis. Caffeine-induced Cdc25 accumulation appears to underlie its ability to override cell cycle checkpoints. The impact of Cdc25 accumulation on cell cycle progression is attenuated by Srk1 and Mad2. Together our findings suggest that caffeine overrides checkpoint enforcement by inducing the inappropriate nuclear localization of Cdc25. PMID:24666325
Ma, Kai-Li; Song, Lian-Kun; Yuan, Yu-He; Zhang, Ying; Han, Ning; Gao, Kai; Chen, Nai-Hong
2014-07-01
α-Synuclein (α-syn), a 14 kDa pre-synaptic protein, is widely involved in the Parkinson's disease (PD) pathogenesis. Recent studies have shown that the nuclear accumulation of α-syn might have a toxic effect. The main purpose of the present study was to explore which amino acid residues in α-syn are associated with its nuclear accumulation, the molecule(s) mediated the nuclear import of α-syn, and the role of α-syn accumulated in the nucleus. It has been noted that the nuclear import of α-syn may be mediated by importin α and that both the amino acid residues 1-60 and 103-140 of α-syn were indispensable for its nuclear import. After imported into the nucleus, the accumulated α-syn played a toxic role in both the PC12 cells and the C57 mice. Furthermore, α-syn-nuclear localization signal-injected mice showed behavioral symptoms associated with PD. Further studies performed in vitro showed that the toxicity of α-syn in the nucleus might be due to an interference of the cell cycle. Thus, it can be concluded that α-syn can accumulate in nucleus, which is mediated by importin α, and promote neurotoxicity by accelerating the cell cycle. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhan, Ming; Riordon, Daniel R.; Yan, Bin; Tarasova, Yelena S.; Bruweleit, Sarah; Tarasov, Kirill V.; Li, Ronald A.; Wersto, Robert P.; Boheler, Kenneth R.
2012-01-01
Embryonic stem cells (ESCs) are pluripotent and have unlimited self-renewal capacity. Although pluripotency and differentiation have been examined extensively, the mechanisms responsible for self-renewal are poorly understood and are believed to involve an unusual cell cycle, epigenetic regulators and pluripotency-promoting transcription factors. Here we show that B-MYB, a cell cycle regulated phosphoprotein and transcription factor critical to the formation of inner cell mass, is central to the transcriptional and co-regulatory networks that sustain normal cell cycle progression and self-renewal properties of ESCs. Phenotypically, B-MYB is robustly expressed in ESCs and induced pluripotent stem cells (iPSCs), and it is present predominantly in a hypo-phosphorylated state. Knockdown of B-MYB results in functional cell cycle abnormalities that involve S, G2 and M phases, and reduced expression of critical cell cycle regulators like ccnb1 and plk1. By conducting gene expression profiling on control and B-MYB deficient cells, ChIP-chip experiments, and integrative computational analyses, we unraveled a highly complex B-MYB-mediated transcriptional network that guides ESC self-renewal. The network encompasses critical regulators of all cell cycle phases and epigenetic regulators, pluripotency transcription factors, and differentiation determinants. B-MYB along with E2F1 and c-MYC preferentially co-regulate cell cycle target genes. B-MYB also co-targets genes regulated by OCT4, SOX2 and NANOG that are significantly associated with stem cell differentiation, embryonic development, and epigenetic control. Moreover, loss of B-MYB leads to a breakdown of the transcriptional hierarchy present in ESCs. These results coupled with functional studies demonstrate that B-MYB not only controls and accelerates cell cycle progression in ESCs it contributes to fate decisions and maintenance of pluripotent stem cell identity. PMID:22936984
Zhan, Ming; Riordon, Daniel R; Yan, Bin; Tarasova, Yelena S; Bruweleit, Sarah; Tarasov, Kirill V; Li, Ronald A; Wersto, Robert P; Boheler, Kenneth R
2012-01-01
Embryonic stem cells (ESCs) are pluripotent and have unlimited self-renewal capacity. Although pluripotency and differentiation have been examined extensively, the mechanisms responsible for self-renewal are poorly understood and are believed to involve an unusual cell cycle, epigenetic regulators and pluripotency-promoting transcription factors. Here we show that B-MYB, a cell cycle regulated phosphoprotein and transcription factor critical to the formation of inner cell mass, is central to the transcriptional and co-regulatory networks that sustain normal cell cycle progression and self-renewal properties of ESCs. Phenotypically, B-MYB is robustly expressed in ESCs and induced pluripotent stem cells (iPSCs), and it is present predominantly in a hypo-phosphorylated state. Knockdown of B-MYB results in functional cell cycle abnormalities that involve S, G2 and M phases, and reduced expression of critical cell cycle regulators like ccnb1 and plk1. By conducting gene expression profiling on control and B-MYB deficient cells, ChIP-chip experiments, and integrative computational analyses, we unraveled a highly complex B-MYB-mediated transcriptional network that guides ESC self-renewal. The network encompasses critical regulators of all cell cycle phases and epigenetic regulators, pluripotency transcription factors, and differentiation determinants. B-MYB along with E2F1 and c-MYC preferentially co-regulate cell cycle target genes. B-MYB also co-targets genes regulated by OCT4, SOX2 and NANOG that are significantly associated with stem cell differentiation, embryonic development, and epigenetic control. Moreover, loss of B-MYB leads to a breakdown of the transcriptional hierarchy present in ESCs. These results coupled with functional studies demonstrate that B-MYB not only controls and accelerates cell cycle progression in ESCs it contributes to fate decisions and maintenance of pluripotent stem cell identity.
Su, Jingjing; Zhou, Houguang; Tao, Yinghong; Guo, Zhuangli; Zhang, Shuo; Zhang, Yu; Huang, Yanyan; Tang, Yuping; Hu, Renming; Dong, Qiang
2015-01-01
Cell cycle processes play a vital role in vascular endothelial proliferation and dysfunction. Cell division cycle protein 14 (Cdc14) is an important cell cycle regulatory phosphatase. Previous studies in budding yeast demonstrated that Cdc14 could trigger the inactivation of mitotic cyclin-dependent kinases (Cdks), which are required for mitotic exit and cytokinesis. However, the exact function of human Cdc14 (hCdc14) in cell cycle regulation during vascular diseases is yet to be elucidated. There are two HCdc14 homologs: hCdc14A and hCdc14B. In the current study, we investigated the potential role of hCdc14A in high glucose-, free fatty acids (FFAs)-, and hypoxia-induced injury in cultured human brain vascular endothelial cells (HBVECs). Data revealed that high glucose, FFA, and hypoxia down-regulated hCdc14A expression remarkably, and also affected the expression of other cell cycle-related proteins such as cyclin B, cyclin D, cyclin E, and p53. Furthermore, the combined addition of the three stimuli largely blocked cell cycle progression, decreased cell proliferation, and increased apoptosis. We also determined that hCdc14A was localized mainly to centrosomes during interphase and spindles during mitosis using confocal microscopy, and that it could affect the expression of other cycle-related proteins. More importantly, the overexpression of hCdc14A accelerated cell cycle progression, enhanced cell proliferation, and promoted neoplastic transformation, whereas the knockdown of hCdc14A using small interfering RNA produced the opposite effects. Therefore, these findings provide novel evidence that hCdc14A might be involved in cell cycle regulation in cultured HBVECs during high glucose-, FFA-, and hypoxia-induced injury. Copyright © 2014 Elsevier Inc. All rights reserved.
Efthymiou, George S.; Shuler, Michael L.
1989-08-29
An improved multilayer continuous biological membrane reactor and a process to eliminate diffusional limitations in membrane reactors in achieved by causing a convective flux of nutrient to move into and out of an immobilized biocatalyst cell layer. In a pressure cycled mode, by increasing and decreasing the pressure in the respective layers, the differential pressure between the gaseous layer and the nutrient layer is alternately changed from positive to negative. The intermittent change in pressure differential accelerates the transfer of nutrient from the nutrient layers to the biocatalyst cell layer, the transfer of product from the cell layer to the nutrient layer and the transfer of byproduct gas from the cell layer to the gaseous layer. Such intermittent cycling substantially eliminates mass transfer gradients in diffusion inhibited systems and greatly increases product yield and throughput in both inhibited and noninhibited systems.
Effects of adenosine 5'-monophosphate on epidermal turnover.
Furukawa, Fukumi; Kanehara, Shoko; Harano, Fumiki; Shinohara, Shigeo; Kamimura, Junko; Kawabata, Shigekatsu; Igarashi, Sachiyo; Kawamura, Mitsuaki; Yamamoto, Yuki; Miyachi, Yoshiki
2008-10-01
The structure and function of the epidermis is maintained by cell renewal based on epidermal turnover. Epidermal turnover is delayed by aging, and it is thought that the delay of the epidermal turnover is a cause of aging alternation of skin. The epidermal turnover is related to the energy metabolism of epidermal basal cells. Adenosine 5'-triphosphate (ATP) is needed for cell renewal: cell division, and adenosine 5'-monophosphate (AMP) increases the amount of intracellular ATP. These findings suggest that AMP accelerates the epidermal turnover delayed by aging. This study investigated whether AMP and adenosine 5'-monophosphate disodium salt (AMP2Na) accelerates the epidermal turnover. An effect of AMP2Na on cell proliferation was examined by our counting of keratinocytes. An effect of AMP2Na on cell cycle was examined by our counting of basal cells in DNA synthetic period of hairless rats. The effects of AMP2Na (or AMP) on the epidermal turnover were examined by our measuring stratum corneum transit time by use of guinea pigs, and by our measuring stratum corneum surface area by use of hairless rats and in a clinical pharmacological study. The AMP2Na showed two different profiles on the proliferation of primary cultured keratinocytes. At a low concentration it induced cell growth, whereas at a high concentration it inhibited cell growth. The number of basal cells in the DNA synthetic period of AMP2Na was significantly higher than that of the vehicle in hairless rats. The stratum corneum transit time of AMP2Na was significantly shorter than that of the vehicle in guinea pigs. The corneocyte surface area of emulsion containing AMP2Na was significantly smaller than that of the vehicle in volunteers. We conclude that AMP promotes the cell proliferation and the cell cycle progression of epidermal basal cells and accelerates epidermal turnover safely. In addition, AMP is useful for skin rejuvenation in dermatology and aesthetic dermatology.
An essential cell cycle regulation gene causes hybrid inviability in Drosophila.
Phadnis, Nitin; Baker, EmilyClare P; Cooper, Jacob C; Frizzell, Kimberly A; Hsieh, Emily; de la Cruz, Aida Flor A; Shendure, Jay; Kitzman, Jacob O; Malik, Harmit S
2015-12-18
Speciation, the process by which new biological species arise, involves the evolution of reproductive barriers, such as hybrid sterility or inviability between populations. However, identifying hybrid incompatibility genes remains a key obstacle in understanding the molecular basis of reproductive isolation. We devised a genomic screen, which identified a cell cycle-regulation gene as the cause of male inviability in hybrids resulting from a cross between Drosophila melanogaster and D. simulans. Ablation of the D. simulans allele of this gene is sufficient to rescue the adult viability of hybrid males. This dominantly acting cell cycle regulator causes mitotic arrest and, thereby, inviability of male hybrid larvae. Our genomic method provides a facile means to accelerate the identification of hybrid incompatibility genes in other model and nonmodel systems. Copyright © 2015, American Association for the Advancement of Science.
NASA Astrophysics Data System (ADS)
Sharma, A.; Tibai, Z.; Hebling, J.; Fülöp, J. A.
2018-03-01
Laser-driven proton acceleration from a micron-sized cryogenic hydrogen microjet target is investigated using multi-dimensional particle-in-cell simulations. With few-cycle (20-fs) ultraintense (2-PW) laser pulses, high-energy quasi-monoenergetic proton acceleration is predicted in a new regime. A collisionless shock-wave acceleration mechanism influenced by Weibel instability results in a maximum proton energy as high as 160 MeV and a quasi-monoenergetic peak at 80 MeV for 1022 W/cm2 laser intensity with controlled prepulses. A self-generated strong quasi-static magnetic field is also observed in the plasma, which modifies the spatial distribution of the proton beam.
2012-01-01
Background Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina’s stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. Results The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. Conclusions These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins. PMID:23111152
Luo, Jing; Uribe, Rosa A; Hayton, Sarah; Calinescu, Anda-Alexandra; Gross, Jeffrey M; Hitchcock, Peter F
2012-10-30
Midkine is a small heparin binding growth factor expressed in numerous tissues during development. The unique midkine gene in mammals has two paralogs in zebrafish: midkine-a (mdka) and midkine-b (mdkb). In the zebrafish retina, during both larval development and adult photoreceptor regeneration, mdka is expressed in retinal stem and progenitor cells and functions as a molecular component of the retina's stem cell niche. In this study, loss-of-function and conditional overexpression were used to investigate the function of Mdka in the retina of the embryonic zebrafish. The results show that during early retinal development Mdka functions to regulate cell cycle kinetics. Following targeted knockdown of Mdka synthesis, retinal progenitors cycle more slowly, and this results in microphthalmia, a diminished rate of cell cycle exit and a temporal delay of cell cycle exit and neuronal differentiation. In contrast, Mdka overexpression results in acceleration of the cell cycle and retinal overgrowth. Mdka gain-of-function, however, does not temporally advance cell cycle exit. Experiments to identify a potential Mdka signaling pathway show that Mdka functions upstream of the HLH regulatory protein, Id2a. Gene expression analysis shows Mdka regulates id2a expression, and co-injection of Mdka morpholinos and id2a mRNA rescues the Mdka loss-of-function phenotype. These data show that in zebrafish, Mdka resides in a shared Id2a pathway to regulate cell cycle kinetics in retinal progenitors. This is the first study to demonstrate the function of Midkine during retinal development and adds Midkine to the list of growth factors that transcriptionally regulate Id proteins.
Rapid prototyping of microbial cell factories via genome-scale engineering.
Si, Tong; Xiao, Han; Zhao, Huimin
2015-11-15
Advances in reading, writing and editing genetic materials have greatly expanded our ability to reprogram biological systems at the resolution of a single nucleotide and on the scale of a whole genome. Such capacity has greatly accelerated the cycles of design, build and test to engineer microbes for efficient synthesis of fuels, chemicals and drugs. In this review, we summarize the emerging technologies that have been applied, or are potentially useful for genome-scale engineering in microbial systems. We will focus on the development of high-throughput methodologies, which may accelerate the prototyping of microbial cell factories. Copyright © 2014 Elsevier Inc. All rights reserved.
RCA SATCOM Battery in Orbit Performance Update and Accelerated Life Test Results
NASA Technical Reports Server (NTRS)
Gaston, S. J.; Schiffer, S. F.
1984-01-01
No significant degradation of nickel cadmium battery performance in SATCOM F1 and F2 after almost 8 and 7-3/4 years in orbit was shown. Battery minimum discharge voltage data are presented for these spacecraft. In addition, 2 groups of nickel cadmium cells which are representative of those in orbit are undergoing real time eclipse-reduced suntime cycling in the laboratory. These groups of cells, which are being cycled at a maximum of 53% and 62% depth of discharge (based on actual capacity), have completed 14 and 15 eclipse seasons, respectively. Data for these groups of cells are presented and are compared with the in-orbit battery data.
Environmental stress speeds up DNA replication in Pseudomonas putida in chemostat cultivations.
Lieder, Sarah; Jahn, Michael; Koepff, Joachim; Müller, Susann; Takors, Ralf
2016-01-01
Cellular response to different types of stress is the hallmark of the cell's strategy for survival. How organisms adjust their cell cycle dynamics to compensate for changes in environmental conditions is an important unanswered question in bacterial physiology. A cell using binary fission for reproduction passes through three stages during its cell cycle: a stage from cell birth to initiation of replication, a DNA replication phase and a period of cell division. We present a detailed analysis of durations of cell cycle phases, investigating their dynamics under environmental stress conditions. Applying continuous steady state cultivations (chemostats), the DNA content of a Pseudomonas putida KT2440 population was quantified with flow cytometry at distinct growth rates. Data-driven modeling revealed that under stress conditions, such as oxygen deprivation, solvent exposure and decreased iron availability, DNA replication was accelerated correlated to the severity of the imposed stress (up to 1.9-fold). Cells maintained constant growth rates by balancing the shortened replication phase with extended cell cycle phases before and after replication. Transcriptome data underpin the transcriptional upregulation of crucial genes of the replication machinery. Hence adaption of DNA replication speed appears to be an important strategy to withstand environmental stress. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Generating clock signals for a cycle accurate, cycle reproducible FPGA based hardware accelerator
Asaad, Sameth W.; Kapur, Mohit
2016-01-05
A method, system and computer program product are disclosed for generating clock signals for a cycle accurate FPGA based hardware accelerator used to simulate operations of a device-under-test (DUT). In one embodiment, the DUT includes multiple device clocks generating multiple device clock signals at multiple frequencies and at a defined frequency ratio; and the FPG hardware accelerator includes multiple accelerator clocks generating multiple accelerator clock signals to operate the FPGA hardware accelerator to simulate the operations of the DUT. In one embodiment, operations of the DUT are mapped to the FPGA hardware accelerator, and the accelerator clock signals are generated at multiple frequencies and at the defined frequency ratio of the frequencies of the multiple device clocks, to maintain cycle accuracy between the DUT and the FPGA hardware accelerator. In an embodiment, the FPGA hardware accelerator may be used to control the frequencies of the multiple device clocks.
Xi, Z; Yao, M; Li, Y; Xie, C; Holst, J; Liu, T; Cai, S; Lao, Y; Tan, H; Xu, H-X; Dong, Q
2016-06-02
Cell cycle re-entry by quiescent cancer cells is an important mechanism for cancer progression. While high levels of c-MYC expression are sufficient for cell cycle re-entry, the modality to block c-MYC expression, and subsequent cell cycle re-entry, is limited. Using reversible quiescence rendered by serum withdrawal or contact inhibition in PTEN(null)/p53(WT) (LNCaP) or PTEN(null)/p53(mut) (PC-3) prostate cancer cells, we have identified a compound that is able to impede cell cycle re-entry through c-MYC. Guttiferone K (GUTK) blocked resumption of DNA synthesis and preserved the cell cycle phase characteristics of quiescent cells after release from the quiescence. In vehicle-treated cells, there was a rapid increase in c-MYC protein levels upon release from the quiescence. However, this increase was inhibited in the presence of GUTK with an associated acceleration in c-MYC protein degradation. The inhibitory effect of GUTK on cell cycle re-entry was significantly reduced in cells overexpressing c-MYC. The protein level of FBXW7, a subunit of E3 ubiquitin ligase responsible for degradation of c-MYC, was reduced upon the release from the quiescence. In contrast, GUTK stabilized FBXW7 protein levels during release from the quiescence. The critical role of FBXW7 was confirmed using siRNA knockdown, which impaired the inhibitory effect of GUTK on c-MYC protein levels and cell cycle re-entry. Administration of GUTK, either in vitro prior to transplantation or in vivo, suppressed the growth of quiescent prostate cancer cell xenografts. Furthermore, elevation of FBXW7 protein levels and reduction of c-MYC protein levels were found in the xenografts of GUTK-treated compared with vehicle-treated mice. Hence, we have identified a compound that is capable of impeding cell cycle re-entry by quiescent PTEN(null)/p53(WT) and PTEN(null)/p53(mut) prostate cancer cells likely by promoting c-MYC protein degradation through stabilization of FBXW7. Its usage as a clinical modality to prevent prostate cancer progression should be further evaluated.
Camara, Johanna Eltz; Skarstad, Kirsten; Crooke, Elliott
2003-05-01
Regulatory inactivation of DnaA helps ensure that the Escherichia coli chromosome is replicated only once per cell cycle, through accelerated hydrolysis of active replication initiator ATP-DnaA to inactive ADP-DnaA. Analysis of deltahda strains revealed that the regulatory inactivation of DnaA component Hda is necessary for maintaining controlled initiation but not for cell growth or viability.
Zeng, Yuanyuan; Zhu, Jianjie; Shen, Dan; Qin, Hualong; Lei, Zhe; Li, Wei; Liu, Zeyi; Huang, Jian-An
2017-05-09
Despite advances in diagnosis and treatment, the survival of non-small cell lung cancer (NSCLC) patients remains poor; therefore, improved understanding of the disease mechanism and novel treatment strategies are needed. Downregulation of SMAD4 and dysregulated expression of miR-205 have been reported. However, the relationship between them remains unclear. We investigated the effect of microRNA (miR)-205 on the expression of SMAD4 in NSCLC. Knockdown and overexpression of SMAD4 promoted or suppressed cellular viability and proliferation, and accelerated or inhibited the cell cycle in NSCLC cells, respectively. The 3'-untranslated region (3'-UTR) of SMAD4 was predicted as a target of miR-205. Luciferase assays validated that miR-205 binds directly to the SMAD4 3'-UTR. Protein and mRNA expression analyses confirmed that miR-205 overexpression in NSCLC cells inhibited the expression of SMAD4 mRNA and protein. In human NSCLC tissues, increased miR-205 expression was observed frequently and was inversely correlated with decreased SMAD4 expression. Ectopic expression of miR-205 in NSCLC cells suppressed cellular viability and proliferation, accelerated the cell cycle, and promoted tumor growth of lung carcinoma xenografts in nude mice. Our study showed that miR-205 decreased SMAD4 expression, thus promoting NSCLC cell growth. Our findings highlighted the therapeutic potential of targeting miR-205 in NSCLC treatment.
Qin, Hualong; Lei, Zhe; Li, Wei; Liu, Zeyi; Huang, Jian-an
2017-01-01
Despite advances in diagnosis and treatment, the survival of non-small cell lung cancer (NSCLC) patients remains poor; therefore, improved understanding of the disease mechanism and novel treatment strategies are needed. Downregulation of SMAD4 and dysregulated expression of miR-205 have been reported. However, the relationship between them remains unclear. We investigated the effect of microRNA (miR)-205 on the expression of SMAD4 in NSCLC. Knockdown and overexpression of SMAD4 promoted or suppressed cellular viability and proliferation, and accelerated or inhibited the cell cycle in NSCLC cells, respectively. The 3′-untranslated region (3′-UTR) of SMAD4 was predicted as a target of miR-205. Luciferase assays validated that miR-205 binds directly to the SMAD4 3′-UTR. Protein and mRNA expression analyses confirmed that miR-205 overexpression in NSCLC cells inhibited the expression of SMAD4 mRNA and protein. In human NSCLC tissues, increased miR-205 expression was observed frequently and was inversely correlated with decreased SMAD4 expression. Ectopic expression of miR-205 in NSCLC cells suppressed cellular viability and proliferation, accelerated the cell cycle, and promoted tumor growth of lung carcinoma xenografts in nude mice. Our study showed that miR-205 decreased SMAD4 expression, thus promoting NSCLC cell growth. Our findings highlighted the therapeutic potential of targeting miR-205 in NSCLC treatment. PMID:28199217
Wang, Wei Jie; Chen, Di; Jiang, Ming Zuo; Xu, Bing; Li, Xiao Wei; Chu, Yi; Zhang, Yu Jie; Mao, Ren; Liang, Jie; Fan, Dai Ming
2018-02-01
To explore the relationship between gasdermin D (GSDMD) and gastric cancer (GC) cell proliferation, and to determine whether the downregulated expression of GSDMD contributed to the tumorigenesis and proliferation of GC cells. GSDMD expressions in GC tissues and matched adjacent non-cancerous tissues were assessed by quantitative real-time polymerase chain reaction, Western blot and immunohistochemistry. The effect of GSDMD on cell proliferation in vitro was assessed by the colony formation assay and cell viability assays. In vivo, xenografted tumors in nude mice were evaluated. The cell cycle was analyzed by flow cytometry. In addition, the alterations of several cell cycle-related and cell signaling pathway proteins were analyzed by Western blot. GSDMD expression was decreased in GC, and the decreased expression of GSDMD could markedly promote the proliferation of tumors in vivo and in vitro. The downregulation of GSDMD accelerated S/G 2 cell transition by activating extracellular signal regulated kinase, signal transducer and activator of transcription 3 and phosphatidylinositol 3 kinase/protein kinase B signaling pathways and regulating cell cycle-related proteins in GC. GSDMD may protect against cell proliferation of GC, and it may be used as a diagnostic and treatment strategy for GC. © 2018 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.
Raman spectral observation of a new phase observed in nickel electrodes cycled to failure
NASA Technical Reports Server (NTRS)
Loyselle, Patricia L.; Shan, X.; Cornilsen, B. C.; Reid, Margaret A.
1991-01-01
A new phase is reported in nickel electrodes from Ni/H2 boilerplate cells which were cycled to failure in electrolyte of variable KOH concentration (21 to 36 percent). Raman spectra clearly show the presence of this phase, and these spectra have been used to estimate the amounts present on these electrodes. Ten of 12 electrodes examined contain this new phase. The cycle life at higher KOH concentrations (31 and 36 percent) was greatly reduced, and nickel electrodes from these cells exhibited extensive amounts of this new phase. The presence of this new phase correlates with cell failure defined by low end of discharge voltages. It is proposed that the lowered capacity and failure of these electrodes was caused by loss of active mass and formation of a phase with reduced electrochemical activity. These results indicate that formation of the new phase is accelerated at higher KOH concentrations.
Lactate dehydrogenase activity drives hair follicle stem cell activation
Aimee, Flores; John, Schell; Abby, Krall; David, Jelinek; Matilde, Miranda; Melina, Grigorian; Daniel, Braas; White Andrew, C; Jessica, Zhou; Nick, Graham; Thomas, Graeber; Pankaj, Seth; Denis, Evseenko; Hilary, Coller; Jared, Rutter; Heather, Christofk; Lowry William, E
2017-01-01
Summary While normally dormant, Hair Follicle Stem Cells (HFSCs) quickly become activated to divide during a new hair cycle. The quiescence of HFSCs is known to be regulated by a number of intrinsic and extrinsic mechanisms. Here we provide several lines of evidence to demonstrate that HFSCs utilize glycolytic metabolism and produce significantly more lactate than other cells in the epidermis. Furthermore, lactate generation appears to be critical for the activation of HFSCs as deletion of lactate dehydrogenase (Ldha) prevented their activation. Conversely, genetically promoting lactate production in HFSCs through mitochondrial pyruvate carrier (Mpc1) deletion accelerated their activation and the hair cycle. Finally, we identify small molecules that increase lactate production by stimulating Myc levels or inhibiting Mpc1 carrier activity and can topically induce the hair cycle. These data suggest that HFSCs maintain a metabolic state that allow them to remain dormant and yet quickly respond to appropriate proliferative stimuli. PMID:28812580
Parkin New Cargos: a New ROS Independent Role for Parkin in Regulating Cell Division.
Stieg, David C; Cooper, Katrina F
2016-01-01
Cell cycle progression requires the destruction of key cell cycle regulators by the multi-subunit E3 ligase called the anaphase promoting complex (APC/C). As the cell progresses through the cell cycle, the APC/C is sequentially activated by two highly conserved co-activators called Cdc20 and Cdh1. Importantly, APC/C Cdc20 is required to degrade substrates in G2/M whereas APC Cdh1 drives the cells into G1. Recently, Parkin, a monomeric E3 ligase that is required for ubiquitin-mediated mitophagy following mitochondrial stress, was shown to both bind and be activated by Cdc20 or Cdh1 during the cell cycle. This mitotic role for Parkin does not require an activating phosphorylation by its usual kinase partner PINK. Rather, mitotic Parkin activity requires phosphorylation on a different serine by the polo-like kinase Plk1. Interestingly, although Parkin Cdc20 and Parkin Cdh1 activity is independent of the APC/C, it mediates degradation of an overlapping subset of substrates. However, unlike the APC/C, Parkin is not necessary for cell cycle progression. Despite this, loss of Parkin activity accelerates genome instability and tumor growth in xenograft models. These findings provide a mechanism behind the previously described, but poorly understood, tumor suppressor role for Parkin. Taken together, studies suggest that the APC/C and Parkin have similar and unique roles to play in cell division, possibly being dependent upon the different subcellular address of these two ligases.
Azad, Arun; Bukczynska, Patricia; Jackson, Susan; Haupt, Ygal; Haput, Ygal; Cullinane, Carleen; McArthur, Grant A; Solomon, Benjamin
2014-02-01
To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs, and accelerated senescence after radiation. Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination. Copyright © 2014. Published by Elsevier Inc.
Cell cycle arrest and the evolution of chronic kidney disease from acute kidney injury.
Canaud, Guillaume; Bonventre, Joseph V
2015-04-01
For several decades, acute kidney injury (AKI) was generally considered a reversible process leading to complete kidney recovery if the individual survived the acute illness. Recent evidence from epidemiologic studies and animal models, however, have highlighted that AKI can lead to the development of fibrosis and facilitate the progression of chronic renal failure. When kidney injury is mild and baseline function is normal, the repair process can be adaptive with few long-term consequences. When the injury is more severe, repeated, or to a kidney with underlying disease, the repair can be maladaptive and epithelial cell cycle arrest may play an important role in the development of fibrosis. Indeed, during the maladaptive repair after a renal insult, many tubular cells that are undergoing cell division spend a prolonged period in the G2/M phase of the cell cycle. These tubular cells recruit intracellular pathways leading to the synthesis and the secretion of profibrotic factors, which then act in a paracrine fashion on interstitial pericytes/fibroblasts to accelerate proliferation of these cells and production of interstitial matrix. Thus, the tubule cells assume a senescent secretory phenotype. Characteristic features of these cells may represent new biomarkers of fibrosis progression and the G2/M-arrested cells may represent a new therapeutic target to prevent, delay or arrest progression of chronic kidney disease. Here, we summarize recent advances in our understanding of the biology of the cell cycle and how cell cycle arrest links AKI to chronic kidney disease. © The Author 2014. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.
A review of polymer electrolyte membrane fuel cell durability test protocols
NASA Astrophysics Data System (ADS)
Yuan, Xiao-Zi; Li, Hui; Zhang, Shengsheng; Martin, Jonathan; Wang, Haijiang
Durability is one of the major barriers to polymer electrolyte membrane fuel cells (PEMFCs) being accepted as a commercially viable product. It is therefore important to understand their degradation phenomena and analyze degradation mechanisms from the component level to the cell and stack level so that novel component materials can be developed and novel designs for cells/stacks can be achieved to mitigate insufficient fuel cell durability. It is generally impractical and costly to operate a fuel cell under its normal conditions for several thousand hours, so accelerated test methods are preferred to facilitate rapid learning about key durability issues. Based on the US Department of Energy (DOE) and US Fuel Cell Council (USFCC) accelerated test protocols, as well as degradation tests performed by researchers and published in the literature, we review degradation test protocols at both component and cell/stack levels (driving cycles), aiming to gather the available information on accelerated test methods and degradation test protocols for PEMFCs, and thereby provide practitioners with a useful toolbox to study durability issues. These protocols help prevent the prolonged test periods and high costs associated with real lifetime tests, assess the performance and durability of PEMFC components, and ensure that the generated data can be compared.
Gap junctions favor normal rat kidney epithelial cell adaptation to chronic hypertonicity.
Desforges, Bénédicte; Savarin, Philippe; Bounedjah, Ouissame; Delga, Stéphanie; Hamon, Loïc; Curmi, Patrick A; Pastré, David
2011-09-01
Upon hypertonic stress most often resulting from high salinity, cells need to balance their osmotic pressure by accumulating neutral osmolytes called compatible osmolytes like betaine, myo-inositol, and taurine. However, the massive uptake of compatible osmolytes is a slow process compared with other defense mechanisms related to oxidative or heat stress. This is especially critical for cycling cells as they have to double their volume while keeping a hospitable intracellular environment for the molecular machineries. Here we propose that clustered cells can accelerate the supply of compatible osmolytes to cycling cells via the transit, mediated by gap junctions, of compatible osmolytes from arrested to cycling cells. Both experimental results in epithelial normal rat kidney cells and theoretical estimations show that gap junctions indeed play a key role in cell adaptation to chronic hypertonicity. These results can provide basis for a better understanding of the functions of gap junctions in osmoregulation not only for the kidney but also for many other epithelia. In addition to this, we suggest that cancer cells that do not communicate via gap junctions poorly cope with hypertonic environments thus explaining the rare occurrence of cancer coming from the kidney medulla.
Hsiao, Yung-Hsuan; Lin, Ching-I; Liao, Hsiang; Chen, Yue-Hua; Lin, Shyh-Hsiang
2014-11-13
Obesity-related neurodegenerative diseases are associated with elevated saturated fatty acids (SFAs) in the brain. An increase in SFAs, especially palmitic acid (PA), triggers neuron cell apoptosis, causing cognitive function to deteriorate. In the present study, we focused on the specific mechanism by which PA triggers SH-SY5Y neuron cell apoptosis. We found that PA induces significant neuron cell cycle arrest in the G2/M phase in SH-SY5Y cells. Our data further showed that G2/M arrest is involved in elevation of endoplasmic reticular (ER) stress according to an increase in p-eukaryotic translation inhibition factor 2α, an ER stress marker. Chronic exposure to PA also accelerates beta-amyloid accumulation, a pathological characteristic of Alzheimer's disease. Interestingly, SFA-induced ER stress, G2/M arrest and cell apoptosis were reversed by treatment with 2-bromopalmitate, a protein palmitoylation inhibitor. These findings suggest that protein palmitoylation plays a crucial role in SFA-induced neuron cell cycle G2/M arrest, ER stress and apoptosis; this provides a novel strategy for preventing SFA-induced neuron cell dysfunction.
Thermal modelling of Li-ion polymer battery for electric vehicle drive cycles
NASA Astrophysics Data System (ADS)
Chacko, Salvio; Chung, Yongmann M.
2012-09-01
Time-dependent, thermal behaviour of a lithium-ion (Li-ion) polymer cell has been modelled for electric vehicle (EV) drive cycles with a view to developing an effective battery thermal management system. The fully coupled, three-dimensional transient electro-thermal model has been implemented based on a finite volume method. To support the numerical study, a high energy density Li-ion polymer pouch cell was tested in a climatic chamber for electric load cycles consisting of various charge and discharge rates, and a good agreement was found between the model predictions and the experimental data. The cell-level thermal behaviour under stressful conditions such as high power draw and high ambient temperature was predicted with the model. A significant temperature increase was observed in the stressful condition, corresponding to a repeated acceleration and deceleration, indicating that an effective battery thermal management system would be required to maintain the optimal cell performance and also to achieve a full battery lifesapn.
Greenberg, Edward F; Vatolin, Sergei
2018-06-01
Normally aging cells are characterized by an unbalanced mitochondrial dynamic skewed toward punctate mitochondria. Genetic and pharmacological manipulation of mitochondrial fission/fusion cycles can contribute to both accelerated and decelerated cellular or organismal aging. In this work, we connect these experimental data with the symbiotic theory of mitochondrial origin to generate new insight into the evolutionary origin of aging. Mitochondria originated from autotrophic α-proteobacteria during an ancient endosymbiotic event early in eukaryote evolution. To expand beyond individual host cells, dividing α-proteobacteria initiated host cell lysis; apoptosis is a product of this original symbiont cell lytic exit program. Over the course of evolution, the host eukaryotic cell attenuated the harmful effect of symbiotic proto-mitochondria, and modern mitochondria are now functionally interdependent with eukaryotic cells; they retain their own circular genomes and independent replication timing. In nondividing differentiated or multipotent eukaryotic cells, intracellular mitochondria undergo repeated fission/fusion cycles, favoring fission as organisms age. The discordance between cellular quiescence and mitochondrial proliferation generates intracellular stress, eventually leading to a gradual decline in host cell performance and age-related pathology. Hence, aging evolved from a conflict between maintenance of a quiescent, nonproliferative state and the evolutionarily conserved propagation program driving the life cycle of former symbiotic organisms: mitochondria.
Cerium migration during PEM fuel cell accelerated stress testing
Baker, Andrew M.; Mukundan, Rangachary; Borup, Rodney L.; ...
2016-01-01
Cerium is a radical scavenger which improves polymer electrolyte membrane (PEM) fuel cell durability. During operation, however, cerium rapidly migrates in the PEM and into the catalyst layers (CLs). In this work, membrane electrode assemblies (MEAs) were subjected to accelerated stress tests (ASTs) under different humidity conditions. Cerium migration was characterized in the MEAs after ASTs using X-ray fluorescence. During fully humidified operation, water flux from cell inlet to outlet generated in-plane cerium gradients. Conversely, cerium profiles were flat during low humidity operation, where in-plane water flux was negligible, however, migration from the PEM into the CLs was enhanced. Humiditymore » cycling resulted in both in-plane cerium gradients due to water flux during the hydration component of the cycle, and significant migration into the CLs. Fluoride and cerium emissions into effluent cell waters were measured during ASTs and correlated, which signifies that ionomer degradation products serve as possible counter-ions for cerium emissions. Fluoride emission rates were also correlated to final PEM cerium contents, which indicates that PEM degradation and cerium migration are coupled. Lastly, it is proposed that cerium migrates from the PEM due to humidification conditions and degradation, and is subsequently stabilized in the CLs by carbon catalyst supports.« less
Applications of the pulsed gas stripper technique at the GSI UNILAC
NASA Astrophysics Data System (ADS)
Scharrer, P.; Barth, W.; Bevcic, M.; Düllmann, Ch. E.; Gerhard, P.; Groening, L.; Horn, K. P.; Jäger, E.; Khuyagbaatar, J.; Krier, J.; Vormann, H.; Yakushev, A.
2017-08-01
In the frame of an upgrade program for the GSI UNILAC, preparing it for the use as an injector system for FAIR, a pulsed gas stripper cell was developed. It utilizes the required low duty cycle by applying a pulsed gas injection instead of a continuous gas inlet. The resulting lower gas consumption rate enables the use of low-Z gas targets over a wide range of stripper target thicknesses. The setup enables an increased flexibility for the accelerator by allowing the gas stripper to be used in time-sharing beam operation matching the capabilities of the GSI UNILAC like the acceleration of different ion beams in quasi-parallel operation. Measured charge state distributions of 238U, 50Ti, and CH3 beams on H2 and N2 gas highlight the benefits of the pulsed gas stripper cell for the accelerator operation and performance.
Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin
2012-01-01
Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner.
Thermal Fatigue Evaluation of Pb-Free Solder Joints: Results, Lessons Learned, and Future Trends
NASA Astrophysics Data System (ADS)
Coyle, Richard J.; Sweatman, Keith; Arfaei, Babak
2015-09-01
Thermal fatigue is a major source of failure of solder joints in surface mount electronic components and it is critically important in high reliability applications such as telecommunication, military, and aeronautics. The electronic packaging industry has seen an increase in the number of Pb-free solder alloy choices beyond the common near-eutectic Sn-Ag-Cu alloys first established as replacements for eutectic SnPb. This paper discusses the results from Pb-free solder joint reliability programs sponsored by two industry consortia. The characteristic life in accelerated thermal cycling is reported for 12 different Pb-free solder alloys and a SnPb control in 9 different accelerated thermal cycling test profiles in terms of the effects of component type, accelerated thermal cycling profile and dwell time. Microstructural analysis on assembled and failed samples was performed to investigate the effect of initial microstructure and its evolution during accelerated thermal cycling test. A significant finding from the study is that the beneficial effect of Ag on accelerated thermal cycling reliability (measured by characteristic lifetime) diminishes as the severity of the accelerated thermal cycling, defined by greater ΔT, higher peak temperature, and longer dwell time increases. The results also indicate that all the Pb-free solders are more reliable in accelerated thermal cycling than the SnPb alloy they have replaced. Suggestions are made for future work, particularly with respect to the continued evolution of alloy development for emerging application requirements and the value of using advanced analytical methods to provide a better understanding of the effect of microstructure and its evolution on accelerated thermal cycling performance.
Bao, Yan; Mukai, Kuniaki; Hishiki, Takako; Kubo, Akiko; Ohmura, Mitsuyo; Sugiura, Yuki; Matsuura, Tomomi; Nagahata, Yoshiko; Hayakawa, Noriyo; Yamamoto, Takehiro; Fukuda, Ryo; Saya, Hideyuki; Suematsu, Makoto; Minamishima, Yoji Andrew
2013-09-01
Activation of aerobic glycolysis in cancer cells is well known as the Warburg effect, although its relation to cell- cycle progression remains unknown. In this study, human colon cancer cells were labeled with a cell-cycle phase-dependent fluorescent marker Fucci to distinguish cells in G1-phase and those in S + G2/M phases. Fucci-labeled cells served as splenic xenograft transplants in super-immunodeficient NOG mice and exhibited multiple metastases in the livers, frozen sections of which were analyzed by semiquantitative microscopic imaging mass spectrometry. Results showed that cells in G1-phase exhibited higher concentrations of ATP, NADH, and UDP-N-acetylglucosamine than those in S and G2-M phases, suggesting accelerated glycolysis in G1-phase cells in vivo. Quantitative determination of metabolites in cells synchronized in S, G2-M, and G1 phases suggested that efflux of lactate was elevated significantly in G1-phase. By contrast, ATP production in G2-M was highly dependent on mitochondrial respiration, whereas cells in S-phase mostly exhibited an intermediary energy metabolism between G1 and G2-M phases. Isogenic cells carrying a p53-null mutation appeared more active in glycolysis throughout the cell cycle than wild-type cells. Thus, as the cell cycle progressed from G2-M to G1 phases, the dependency of energy production on glycolysis was increased while the mitochondrial energy production was reciprocally decreased. These results shed light on distinct features of the phase-specific phenotypes of metabolic systems in cancer cells. ©2013 AACR.
NASA Astrophysics Data System (ADS)
Ariyoshi, Kingo; Yamamoto, Satoshi; Ohzuku, Tsutomu
A 3 V lithium-ion cell with Li[Ni 1/2Mn 3/2]O 4 ( Fd 3¯m ; a=8.17 Å) and the zero-strain insertion material of Li[Li 1/3Ti 5/3]O 4 ( Fd 3¯m ; a=8.36 Å) was examined with an emphasis on rate-capability and cycle life. This cell showed a quite flat operating voltage of 3.2 V with excellent cycleability. Accelerated cycle tests indicated that 83% of the initial capacity was delivered and stored even after 1100 cycles. Although the calculated energy density of a Li[Li 1/3Ti 5/3]O 4/Li[Ni 1/2Mn 3/2]O 4 cell was about 250 Wh kg -1 or 1000 Wh dm -3 based on the active material weight or volume, the 3 V lithium-ion battery exhibited positive characteristic features, such as flatness in operating voltage, high rate capability, and cycle life.
Pasternak, Taras; Asard, Han; Potters, Geert; Jansen, Marcel A K
2014-01-01
Glutathione (GSH) is an important scavenger of Reactive Oxygen Species (ROS), precursor of metal chelating phytochelatins, xenobiotic defence compound and regulator of cell proliferation. Homoglutathione (hGSH) is a GSH homologue that is present in several taxa in the family of Fabaceae. It is thought that hGSH performs many of the stress-defence roles typically ascribed to GSH, yet little is known about the potential involvement of hGSH in controlling cell proliferation. Here we show that hGSH/GSH ratios vary across organs and cells and that these changes in hGSH/GSH ratio occur during dedifferentiation and/or cell cycle activation events. The use of a GSH/hGSH biosynthesis inhibitor resulted in impaired cytokinesis in isolated protoplasts, showing the critical importance of these thiol-compounds for cell division. However, exposure of isolated protoplasts to exogenous GSH accelerated cytokinesis, while exogenous hGSH was found to inhibit the same process. We conclude that GSH and hGSH have distinct functional roles in cell cycle regulation in Medicago sativa L. GSH is associated with meristemic cells, and promotes cell cycle activation and induction of somatic embryogenesis, while hGSH is associated with differentiated cells and embryo proliferation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
2017-01-01
The conserved target of rapamycin (TOR) pathway integrates growth and development with available nutrients, but how cellular glucose controls TOR function and signaling is poorly understood. Here, we provide functional evidence from the devastating rice blast fungus Magnaporthe oryzae that glucose can mediate TOR activity via the product of a novel carbon-responsive gene, ABL1, in order to tune cell cycle progression during infection-related development. Under nutrient-free conditions, wild type (WT) M. oryzae strains form terminal plant-infecting cells (appressoria) at the tips of germ tubes emerging from three-celled spores (conidia). WT appressorial development is accompanied by one round of mitosis followed by autophagic cell death of the conidium. In contrast, Δabl1 mutant strains undergo multiple rounds of accelerated mitosis in elongated germ tubes, produce few appressoria, and are abolished for autophagy. Treating WT spores with glucose or 2-deoxyglucose phenocopied Δabl1. Inactivating TOR in Δabl1 mutants or glucose-treated WT strains restored appressorium formation by promoting mitotic arrest at G1/G0 via an appressorium- and autophagy-inducing cell cycle delay at G2/M. Collectively, this work uncovers a novel glucose-ABL1-TOR signaling axis and shows it engages two metabolic checkpoints in order to modulate cell cycle tuning and mediate terminal appressorial cell differentiation. We thus provide new molecular insights into TOR regulation and cell development in response to glucose. PMID:28072818
Marroquin-Guzman, Margarita; Sun, Guangchao; Wilson, Richard A
2017-01-01
The conserved target of rapamycin (TOR) pathway integrates growth and development with available nutrients, but how cellular glucose controls TOR function and signaling is poorly understood. Here, we provide functional evidence from the devastating rice blast fungus Magnaporthe oryzae that glucose can mediate TOR activity via the product of a novel carbon-responsive gene, ABL1, in order to tune cell cycle progression during infection-related development. Under nutrient-free conditions, wild type (WT) M. oryzae strains form terminal plant-infecting cells (appressoria) at the tips of germ tubes emerging from three-celled spores (conidia). WT appressorial development is accompanied by one round of mitosis followed by autophagic cell death of the conidium. In contrast, Δabl1 mutant strains undergo multiple rounds of accelerated mitosis in elongated germ tubes, produce few appressoria, and are abolished for autophagy. Treating WT spores with glucose or 2-deoxyglucose phenocopied Δabl1. Inactivating TOR in Δabl1 mutants or glucose-treated WT strains restored appressorium formation by promoting mitotic arrest at G1/G0 via an appressorium- and autophagy-inducing cell cycle delay at G2/M. Collectively, this work uncovers a novel glucose-ABL1-TOR signaling axis and shows it engages two metabolic checkpoints in order to modulate cell cycle tuning and mediate terminal appressorial cell differentiation. We thus provide new molecular insights into TOR regulation and cell development in response to glucose.
Solar-cell interconnect design for terrestrial photovoltaic modules
NASA Technical Reports Server (NTRS)
Mon, G. R.; Moore, D. M.; Ross, R. G., Jr.
1984-01-01
Useful solar cell interconnect reliability design and life prediction algorithms are presented, together with experimental data indicating that the classical strain cycle (fatigue) curve for the interconnect material does not account for the statistical scatter that is required in reliability predictions. This shortcoming is presently addressed by fitting a functional form to experimental cumulative interconnect failure rate data, which thereby yields statistical fatigue curves enabling not only the prediction of cumulative interconnect failures during the design life of an array field, but also the quantitative interpretation of data from accelerated thermal cycling tests. Optimal interconnect cost reliability design algorithms are also derived which may allow the minimization of energy cost over the design life of the array field.
Solar-cell interconnect design for terrestrial photovoltaic modules
NASA Astrophysics Data System (ADS)
Mon, G. R.; Moore, D. M.; Ross, R. G., Jr.
1984-11-01
Useful solar cell interconnect reliability design and life prediction algorithms are presented, together with experimental data indicating that the classical strain cycle (fatigue) curve for the interconnect material does not account for the statistical scatter that is required in reliability predictions. This shortcoming is presently addressed by fitting a functional form to experimental cumulative interconnect failure rate data, which thereby yields statistical fatigue curves enabling not only the prediction of cumulative interconnect failures during the design life of an array field, but also the quantitative interpretation of data from accelerated thermal cycling tests. Optimal interconnect cost reliability design algorithms are also derived which may allow the minimization of energy cost over the design life of the array field.
Accelerator-Reactor Coupling for Energy Production in Advanced Nuclear Fuel Cycles
NASA Astrophysics Data System (ADS)
Heidet, Florent; Brown, Nicholas R.; Haj Tahar, Malek
This article is a review of several accelerator-reactor interface issues and nuclear fuel cycle applications of accelerator-driven subcritical systems. The systems considered here have the primary goal of energy production, but that goal is accomplished via a specific application in various proposed nuclear fuel cycles, such as breed-and-burn of fertile material or burning of transuranic material. Several basic principles are reviewed, starting from the proton beam window including the target, blanket, reactor core, and up to the fuel cycle. We focus on issues of interest, such as the impact of the energy required to run the accelerator and associated systems on the potential electricity delivered to the grid. Accelerator-driven systems feature many of the constraints and issues associated with critical reactors, with the added challenges of subcritical operation and coupling to an accelerator. Reliable accelerator operation and avoidance of beam trips are critically important. One interesting challenge is measurement of blanket subcriticality level during operation. We also review the potential benefits of accelerator-driven systems in various nuclear fuel cycle applications. Ultimately, accelerator-driven subcritical systems with the goal of transmutation of transuranic material have lower 100,000-year radioactivity than a critical fast reactor with recycling of uranium and plutonium.
The cell-in-series method: A technique for accelerated electrode degradation in redox flow batteries
Pezeshki, Alan M.; Sacci, Robert L.; Veith, Gabriel M.; ...
2015-11-21
Here, we demonstrate a novel method to accelerate electrode degradation in redox flow batteries and apply this method to the all-vanadium chemistry. Electrode performance degradation occurred seven times faster than in a typical cycling experiment, enabling rapid evaluation of materials. This method also enables the steady-state study of electrodes. In this manner, it is possible to delineate whether specific operating conditions induce performance degradation; we found that both aggressively charging and discharging result in performance loss. Post-mortem x-ray photoelectron spectroscopy of the degraded electrodes was used to resolve the effects of state of charge (SoC) and current on the electrodemore » surface chemistry. For the electrode material tested in this work, we found evidence that a loss of oxygen content on the negative electrode cannot explain decreased cell performance. Furthermore, the effects of decreased electrode and membrane performance on capacity fade in a typical cycling battery were decoupled from crossover; electrode and membrane performance decay were responsible for a 22% fade in capacity, while crossover caused a 12% fade.« less
Furukawa, Ayako; Tada-Oikawa, Saeko; Kawanishi, Shosuke; Oikawa, Shinji
2007-01-01
It has been reported that p53 acetylation, which promotes cellular senescence, can be regulated by the NAD(+)-dependent deacetylase SIRT1, the human homolog of yeast Sir2, a protein that modulates lifespan. To clarify the role of SIRT1 in cellular senescence induced by oxidative stress, we treated normal human diploid fibroblast TIG-3 cells with H(2)O(2) and examined DNA cleavage, depletion of intracellular NAD(+), expression of p21, SIRT1, and acetylated p53, cell cycle arrest, and senescence-associated beta-galactosidase (SA-beta-gal) activity. DNA cleavage was observed immediately in TIG-3 cells treated with H(2)O(2), though no cell death was observed. NAD(+) levels in TIG-3 cells treated with H(2)O(2) were also decreased significantly. Pre-incubation with the poly (ADP-ribose) polymerase (PARP) inhibitor resulted in preservation of intracellular NAD(+) levels. The amount of acetylated p53 was increased in TIG-3 cells at 4h after H(2)O(2) treatment, while there was little to no decrease in SIRT1 protein expression. The expression level of p21 was increased at 12h and continued to increase for up to 24h. Additionally, exposure of TIG-3 cells to H(2)O(2) induced cell cycle arrest at 24h and increased SA-beta-gal activity at 48h. This pathway likely plays an important role in the acceleration of cellular senescence by oxidative stress.
Wu, Jinghai; Dauchy, Robert T; Tirrell, Paul C; Wu, Steven S; Lynch, Darin T; Jitawatanarat, Potjana; Burrington, Christine M; Dauchy, Erin M; Blask, David E; Greene, Michael W
2011-04-01
Regulation of diurnal and circadian rhythms and cell proliferation are coupled in all mammals, including humans. However, the molecular mechanisms by which diurnal and circadian rhythms regulate cell proliferation are relatively poorly understood. In this study, we report that tumor growth in nude rats bearing human steroid receptor-negative MCF-7 breast tumors can be significantly accelerated by exposing the rats to light at night (LAN). Under normal conditions of an alternating light/dark cycle, proliferating cell nuclear antigen (PCNA) levels in tumors were maximal in the early light phase but remained at very low levels throughout the daily 24-hour cycle period monitored. Surprisingly, PCNA was expressed in tumors continually at a high level throughout the entire 24-hour period in LAN-exposed nude rats. Daily fluctuations of Akt and mitogen activated protein kinase activation in tumors were also disrupted by LAN. These fluctuations did not track with PCNA changes, but we found that activation of the Akt stimulatory kinase phosphoinositide-dependent protein kinase 1 (PDK1) directly correlated with PCNA levels. Expression of insulin-like growth factor 1 receptor (IGF-1R), an upstream signaling molecule for PDK1, also correlated with fluctuations of PDK1/PCNA in the LAN group. In addition, circulating IGF-1 concentrations were elevated in LAN-exposed tumor-bearing nude rats. Finally, RNAi-mediated knockdown of PDK1 led to a reduction in PCNA expression and cell proliferation in vitro and tumor growth in vivo, indicating that PDK1 regulates breast cancer growth in a manner correlated with PCNA expression. Taken together, our findings demonstrate that LAN exposure can accelerate tumor growth in vivo, in part through continuous activation of IGF-1R/PDK1 signaling.
Cuende, J; Moreno, S; Bolaños, J P; Almeida, A
2008-05-22
In neuroblastoma cells, retinoic acid induces cell cycle arrest and differentiation through degradation of the F-box protein, Skp2, and stabilization of cyclin-dependent kinase inhibitor, p27. However, the mechanism responsible for retinoic acid-mediated Skp2 destabilization is unknown. Since Skp2 is degraded by anaphase-promoting complex (APC)(Cdh1), here we studied whether retinoic acid promotes differentiation of human SH-SY5Y neuroblastoma cells by modulating Cdh1. We found that retinoic acid induced the nuclear accumulation of Cdh1 that paralleled Skp2 destabilization and p27 accumulation. The mRNA and protein abundance of Rae1-a nuclear export factor that limits APC(Cdh1) activity in mitosis-decreased upon retinoic acid-induced inhibition of neuroblastoma cell proliferation. Furthermore, either Rae1 overexpression or Cdh1 inhibition promoted Skp2 accumulation, p27 destabilization and prevented retinoic acid-induced cell cycle arrest and differentiation. Conversely, inhibition of Rae1 accelerated retinoic acid-induced differentiation. Thus, retinoic acid downregulates Rae1, hence facilitating APC(Cdh1)-mediated Skp2 degradation leading to the arrest of cell cycle progression and neuroblastoma differentiation.
Ferreira-Aparicio, Paloma; Chaparro, Antonio M; Folgado, M Antonia; Conde, Julio J; Brightman, Edward; Hinds, Gareth
2017-03-29
Degradation of a polymer electrolyte membrane fuel cell (PEMFC) with electrosprayed cathode catalyst layers is investigated during cyclic start-up and shut-down events. The study is carried out within a single cell incorporating an array of reference electrodes that enables measurement of cell current as a function of local cathode potential (localized polarization curves). Accelerated degradation of the cell by start-up/shut-down cycling gives rise to inhomogeneous performance loss, which is more severe close to the gas outlet and occurs predominantly during start-up. The degradation consists primarily of loss of cathode catalyst activity and increase in cell internal resistance, which is attributed to carbon corrosion and Pt aggregation in both anode and cathode. Cells with an electrosprayed cathode catalyst layer show lower degradation rates during the first 100 cycles, compared with those of a conventional gas diffusion electrode. This difference in behavior is attributed to the high hydrophobicity of the electrosprayed catalyst layer microstructure, which retards the kinetics of corrosion of the carbon support. In the long term, however, the degradation rate is dominated by the Pt/C ratio in the cathode catalyst layer.
Krüger, Angela V; Jelier, Rob; Dzyubachyk, Oleh; Zimmerman, Timo; Meijering, Erik; Lehner, Ben
2015-02-15
Chromatin regulators are widely expressed proteins with diverse roles in gene expression, nuclear organization, cell cycle regulation, pluripotency, physiology and development, and are frequently mutated in human diseases such as cancer. Their inhibition often results in pleiotropic effects that are difficult to study using conventional approaches. We have developed a semi-automated nuclear tracking algorithm to quantify the divisions, movements and positions of all nuclei during the early development of Caenorhabditis elegans and have used it to systematically study the effects of inhibiting chromatin regulators. The resulting high dimensional datasets revealed that inhibition of multiple regulators, including F55A3.3 (encoding FACT subunit SUPT16H), lin-53 (RBBP4/7), rba-1 (RBBP4/7), set-16 (MLL2/3), hda-1 (HDAC1/2), swsn-7 (ARID2), and let-526 (ARID1A/1B) affected cell cycle progression and caused chromosome segregation defects. In contrast, inhibition of cir-1 (CIR1) accelerated cell division timing in specific cells of the AB lineage. The inhibition of RNA polymerase II also accelerated these division timings, suggesting that normal gene expression is required to delay cell cycle progression in multiple lineages in the early embryo. Quantitative analyses of the dataset suggested the existence of at least two functionally distinct SWI/SNF chromatin remodeling complex activities in the early embryo, and identified a redundant requirement for the egl-27 and lin-40 MTA orthologs in the development of endoderm and mesoderm lineages. Moreover, our dataset also revealed a characteristic rearrangement of chromatin to the nuclear periphery upon the inhibition of multiple general regulators of gene expression. Our systematic, comprehensive and quantitative datasets illustrate the power of single cell-resolution quantitative tracking and high dimensional phenotyping to investigate gene function. Furthermore, the results provide an overview of the functions of essential chromatin regulators during the early development of an animal. Copyright © 2014 Elsevier Inc. All rights reserved.
Stamatin, Serban N; Speder, Jozsef; Dhiman, Rajnish; Arenz, Matthias; Skou, Eivind M
2015-03-25
In the presented work, the electrochemical stability of platinized silicon carbide is studied. Postmortem transmission electron microscopy and X-ray photoelectron spectroscopy were used to document the change in the morphology and structure upon potential cycling of Pt/SiC catalysts. Two different potential cycle aging tests were used in order to accelerate the support corrosion, simulating start-up/shutdown and load cycling. On the basis of the results, we draw two main conclusions. First, platinized silicon carbide exhibits improved electrochemical stability over platinized active carbons. Second, silicon carbide undergoes at least mild oxidation if not even silicon leaching.
New activators and inhibitors in the hair cycle clock: targeting stem cells’ state of competence
Plikus, Maksim V.
2014-01-01
Summary The timing mechanism of the hair cycle remains poorly understood. However, it has become increasingly clear that the telogen-to-anagen transition is controlled jointly by at least the bone morphogenic protein (BMP), WNT, fibroblast growth factor (FGF), and transforming growth factor (TGF)-β signaling pathways. New research shows that Fgf18 signaling in hair follicle stem cells synergizes BMP-mediated refractivity, whereas Tgf-β2 signaling counterbalances it. Loss of Fgf18 signaling markedly accelerates anagen initiation, whereas loss of Tgf-β2 signaling significantly delays it, supporting key roles for these pathways in hair cycle timekeeping. PMID:22499035
Evaluation of Cycle Life and Characterization of YTP 45 Ah Li-Ion Battery for EMU
NASA Technical Reports Server (NTRS)
Deng, Yi; Jeevarajan, Judith; Rehm, Raymond; Bragg, Bobby; Strangways, Brad
2002-01-01
Li-ion batteries, with longer cycle life and higher energy density features, are now more and more attractive and applied in multiple fields. The YTP 45 Ah Li-ion battery has been evaluated here and may be employed in EMU in the future. Evaluations were on: (1) Cycle life tests - 500 cycles total (completed 40 cycles in simulated shuttle use mode and 460 cycles in an accelerated use mode, and recorded differential voltage of individual cell in battery); (2) Characterization test - discharge capacity measurement in environment temperature of -10, 25, 50 C before and after 500 cycles; and (3) Thermal testing - charge and discharge at 50 C and -10 C before and after 500 cycles. The battery showed less than a 9% drop of initial discharge capacity and energy within 500 cycles with 475 cycles 59% DOD plus 25 cycles 100% DOD. The EOD voltage ranged from 16.0 to 18.0 V, which fits the requirement for operating the EMU.
Aging and insulin signaling differentially control normal and tumorous germline stem cells.
Kao, Shih-Han; Tseng, Chen-Yuan; Wan, Chih-Ling; Su, Yu-Han; Hsieh, Chang-Che; Pi, Haiwei; Hsu, Hwei-Jan
2015-02-01
Aging influences stem cells, but the processes involved remain unclear. Insulin signaling, which controls cellular nutrient sensing and organismal aging, regulates the G2 phase of Drosophila female germ line stem cell (GSC) division cycle in response to diet; furthermore, this signaling pathway is attenuated with age. The role of insulin signaling in GSCs as organisms age, however, is also unclear. Here, we report that aging results in the accumulation of tumorous GSCs, accompanied by a decline in GSC number and proliferation rate. Intriguingly, GSC loss with age is hastened by either accelerating (through eliminating expression of Myt1, a cell cycle inhibitory regulator) or delaying (through mutation of insulin receptor (dinR) GSC division, implying that disrupted cell cycle progression and insulin signaling contribute to age-dependent GSC loss. As flies age, DNA damage accumulates in GSCs, and the S phase of the GSC cell cycle is prolonged. In addition, GSC tumors (which escape the normal stem cell regulatory microenvironment, known as the niche) still respond to aging in a similar manner to normal GSCs, suggesting that niche signals are not required for GSCs to sense or respond to aging. Finally, we show that GSCs from mated and unmated females behave similarly, indicating that female GSC-male communication does not affect GSCs with age. Our results indicate the differential effects of aging and diet mediated by insulin signaling on the stem cell division cycle, highlight the complexity of the regulation of stem cell aging, and describe a link between ovarian cancer and aging. © 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Miro, Caterina; Ambrosio, Raffaele; De Stefano, Maria Angela; Di Girolamo, Daniela; Di Cicco, Emery; Cicatiello, Annunziata Gaetana; Mancino, Giuseppina; Porcelli, Tommaso; Raia, Maddalena; Del Vecchio, Luigi; Salvatore, Domenico; Dentice, Monica
2017-04-01
Thyroid hormones (THs) mediate pleiotropic cellular processes involved in metabolism, cellular proliferation, and differentiation. The intracellular hormonal environment can be tailored by the type 1 and 2 deiodinase enzymes D2 and D3, which catalyze TH activation and inactivation respectively. In many cellular systems, THs exert well-documented stimulatory or inhibitory effects on cell proliferation; however, the molecular mechanisms by which they control rates of cell cycle progression have not yet been entirely clarified. We previously showed that D3 depletion or TH treatment influences the proliferation and survival of basal cell carcinoma (BCC) cells. Surprisingly, we also found that BCC cells express not only sustained levels of D3 but also robust levels of D2. The aim of the present study was to dissect the contribution of D2 to TH metabolism in the BCC context, and to identify the molecular changes associated with cell proliferation and survival induced by TH and mediated by D2 and D3. We used the CRISPR/Cas9 technology to genetically deplete D2 and D3 in BCC cells and studied the consequences of depletion on cell cycle progression and on cell death. Cell cycle progression was analyzed by fluorescence activated cell sorting analysis of synchronized cells, and the apoptosis rate by annexin V incorporation. Mechanistic investigations revealed that D2 inactivation accelerates cell cycle progression thereby enhancing the proportion of S-phase cells and cyclin D1 expression. Conversely, D3 mutagenesis drastically suppressed cell proliferation and enhanced apoptosis of BCC cells. Furthermore, the basal apoptotic rate was oppositely regulated in D2- and D3-depleted cells. Our results indicate that BCC cells constitute an example in which the TH signal is finely tuned by the concerted expression of opposite-acting deiodinases. The dual regulation of D2 and D3 expression plays a critical role in cell cycle progression and cell death by influencing cyclin D1-mediated entry into the G1-S phase. These findings reinforce the concept that TH is a potential therapeutic target in human BCC.
Progress with palbociclib in breast cancer: latest evidence and clinical considerations
Rocca, Andrea; Schirone, Alessio; Maltoni, Roberta; Bravaccini, Sara; Cecconetto, Lorenzo; Farolfi, Alberto; Bronte, Giuseppe; Andreis, Daniele
2016-01-01
Deregulation of the cell cycle is a hallmark of cancer, and research on cell cycle control has allowed identification of potential targets for anticancer treatment. Palbociclib is a selective inhibitor of the cyclin-dependent kinases 4 and 6 (CDK4/6), which are involved, with their coregulatory partners cyclin D, in the G1-S transition. Inhibition of this step halts cell cycle progression in cells in which the involved pathway, including the retinoblastoma protein (Rb) and the E2F family of transcription factors, is functioning, although having been deregulated. Among breast cancers, those with functioning cyclin D-CDK4/6-Rb-E2F are mainly hormone-receptor (HR) positive, with some HER2-positive and rare triple-negative cases. Deregulation results from genetic or otherwise occurring hyperactivation of molecules subtending cell cycle progression, or inactivation of cell cycle inhibitors. Based on results of randomized clinical trials, palbociclib was granted accelerated approval by the US Food and Drug Administration (FDA) for use in combination with letrozole as initial endocrine-based therapy for metastatic disease in postmenopausal women with HR-positive, HER2-negative breast cancer, and was approved for use in combination with fulvestrant in women with HR-positive, HER2-negative advanced breast cancer with disease progression following endocrine therapy. This review provides an update of the available knowledge on the cell cycle and its regulation, on the alterations in cyclin D-CDK4/6-Rb-E2F axis in breast cancer and their roles in endocrine resistance, on the preclinical activity of CDK4/6 inhibitors in breast cancer, both as monotherapy and as partners of combinatorial synergic treatments, and on the clinical development of palbociclib in breast cancer. PMID:28203301
Impaired light detection of the circadian clock in a zebrafish melanoma model
Hamilton, Noémie; Diaz-de-Cerio, Natalia; Whitmore, David
2015-01-01
The circadian clock controls the timing of the cell cycle in healthy tissues and clock disruption is known to increase tumourigenesis. Melanoma is one of the most rapidly increasing forms of cancer and the precise molecular circadian changes that occur in a melanoma tumor are unknown. Using a melanoma zebrafish model, we have explored the molecular changes that occur to the circadian clock within tumors. We have found disruptions in melanoma clock gene expression due to a major impairment to the light input pathway, with a parallel loss of light-dependent activation of DNA repair genes. Furthermore, the timing of mitosis in tumors is perturbed, as well as the regulation of certain key cell cycle regulators, such that cells divide arhythmically. The inability to co-ordinate DNA damage repair and cell division is likely to promote further tumourigenesis and accelerate melanoma development. PMID:25832911
Impaired light detection of the circadian clock in a zebrafish melanoma model.
Hamilton, Noémie; Diaz-de-Cerio, Natalia; Whitmore, David
2015-01-01
The circadian clock controls the timing of the cell cycle in healthy tissues and clock disruption is known to increase tumourigenesis. Melanoma is one of the most rapidly increasing forms of cancer and the precise molecular circadian changes that occur in a melanoma tumor are unknown. Using a melanoma zebrafish model, we have explored the molecular changes that occur to the circadian clock within tumors. We have found disruptions in melanoma clock gene expression due to a major impairment to the light input pathway, with a parallel loss of light-dependent activation of DNA repair genes. Furthermore, the timing of mitosis in tumors is perturbed, as well as the regulation of certain key cell cycle regulators, such that cells divide arhythmically. The inability to co-ordinate DNA damage repair and cell division is likely to promote further tumourigenesis and accelerate melanoma development.
Signal of Acceleration and Physical Mechanism of Water Cycle in Xinjiang, China
Feng, Guo-Lin; Wu, Yong-Ping
2016-01-01
Global warming accelerates water cycle with features of regional difference. However, little is known about the physical mechanism behind the phenomenon. To reveal the links between water cycle and climatic environment, we analyzed the changes of water cycle elements and their relationships with climatic and environmental factors. We found that when global warming was significant during the period of 1986-2003, the precipitation in Tarim mountains as well as Xinjiang increased rapidly except for Tarim plains, which indicated that there existed a signal of acceleration for water cycle in Xinjiang. The speed of water cycle is mainly affected by altitude, latitude, longitude, slope direction, and the most fundamental element is temperature. Moreover, according to Clausius-Kela Bai Lung relation, we found that the climate change induced the increase of temperature and accelerated the local water cycle only for the wet places. Our results provide a possible physical mechanisms of water cycle and thus well link the climate change to water circulation. PMID:27907078
Signal of Acceleration and Physical Mechanism of Water Cycle in Xinjiang, China.
Feng, Guo-Lin; Wu, Yong-Ping
2016-01-01
Global warming accelerates water cycle with features of regional difference. However, little is known about the physical mechanism behind the phenomenon. To reveal the links between water cycle and climatic environment, we analyzed the changes of water cycle elements and their relationships with climatic and environmental factors. We found that when global warming was significant during the period of 1986-2003, the precipitation in Tarim mountains as well as Xinjiang increased rapidly except for Tarim plains, which indicated that there existed a signal of acceleration for water cycle in Xinjiang. The speed of water cycle is mainly affected by altitude, latitude, longitude, slope direction, and the most fundamental element is temperature. Moreover, according to Clausius-Kela Bai Lung relation, we found that the climate change induced the increase of temperature and accelerated the local water cycle only for the wet places. Our results provide a possible physical mechanisms of water cycle and thus well link the climate change to water circulation.
Effect of LEO cycling at shallow depths of discharge on MANTECH IPV nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Smithrick, John J.
1988-01-01
An individual pressure vessel nickel-hydrogen battery is being considered as an alternate for a nickel-cadmium battery on the Hubble Space Telescope. The space telescope battery will primarily be operating at a shallow depth of discharge (10 percent DOD) with an occasional 40 percent DOD. This shallow DOD raises several issues: (1) What is the cycle life. It is projected to be acceptable; however, there is no reported real time data base for validation. (2) The state of charge of the nickel electrode at the beginning of charge is 90 percent. Will this cause an acceleration of divergence in the battery individual cell voltages. (3) After prolonged cycling at 10 percent DOD, will there be enough capacity remaining to support the 40 percent DOD. (4) Is the state of charge really 90 percent during cycling. There is no reported real time data base at shallow depths of discharge. A data base to address the above issues was initiated.
Kim, Ok-Hee; Cho, Yoon-Hwan; Jeon, Tae-Yeol; Kim, Jung Won; Cho, Yong-Hun; Sung, Yung-Eun
2015-07-01
Core-shell structure nanoparticles have been the subject of many studies over the past few years and continue to be studied as electrocatalysts for fuel cells. Therefore, many excellent core-shell catalysts have been fabricated, but few studies have reported the real application of these catalysts in a practical device actual application. In this paper, we demonstrate the use of platinum (Pt)-exoskeleton structure nanoparticles as cathode catalysts with high stability and remarkable Pt mass activity and report the outstanding performance of these materials when used in membrane-electrode assemblies (MEAs) within a polymer electrolyte membrane fuel cell. The stability and degradation characteristics of these materials were also investigated in single cells in an accelerated degradation test using load cycling, which is similar to the drive cycle of a polymer electrolyte membrane fuel cell used in vehicles. The MEAs with Pt-exoskeleton structure catalysts showed enhanced performance throughout the single cell test and exhibited improved degradation ability that differed from that of a commercial Pt/C catalyst.
Accelerator–Reactor Coupling for Energy Production in Advanced Nuclear Fuel Cycles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heidet, Florent; Brown, Nicholas R.; Haj Tahar, Malek
2015-01-01
This article is a review of several accelerator-reactor interface issues and nuclear fuel cycle applications of accelerator-driven subcritical systems. The systems considered here have the primary goal of energy production, but that goal is accomplished via a specific application in various proposed nuclear fuel cycles, such as breed-and-burn of fertile material or burning of transuranic material. Several basic principles are reviewed, starting from the proton beam window including the target, blanket, reactor core, and up to the fuel cycle. We focused on issues of interest, e.g. the impact of the energy required to run the accelerator and associated systems onmore » the potential electricity delivered to the grid. Accelerator-driven systems feature many of the constraints and issues associated with critical reactors, with the added challenges of subcritical operation and coupling to an accelerator. Reliable accelerator operation and avoidance of beam trips are a critically important. One interesting challenge is measurement of blanket subcriticality level during operation. We also reviewed the potential benefits of accelerator-driven systems in various nuclear fuel cycle applications. Ultimately, accelerator-driven subcritical systems with the goal of transmutation of transuranic material have lower 100,000-year radioactivity versus a critical fast reactor with recycle of uranium and plutonium.« less
Germinal-center development of memory B cells driven by IL-9 from follicular helper T cells.
Wang, Yifeng; Shi, Jingwen; Yan, Jiacong; Xiao, Zhengtao; Hou, Xiaoxiao; Lu, Peiwen; Hou, Shiyue; Mao, Tianyang; Liu, Wanli; Ma, Yuanwu; Zhang, Lianfeng; Yang, Xuerui; Qi, Hai
2017-08-01
Germinal centers (GCs) support high-affinity, long-lived humoral immunity. How memory B cells develop in GCs is not clear. Through the use of a cell-cycle-reporting system, we identified GC-derived memory precursor cells (GC-MP cells) that had quit cycling and reached G0 phase while in the GC, exhibited memory-associated phenotypes with signs of affinity maturation and localized toward the GC border. After being transferred into adoptive hosts, GC-MP cells reconstituted a secondary response like genuine memory B cells. GC-MP cells expressed the interleukin 9 (IL-9) receptor and responded to IL-9. Acute treatment with IL-9 or antibody to IL-9 accelerated or retarded the positioning of GC-MP cells toward the GC edge and exit from the GC, and enhanced or inhibited the development of memory B cells, which required B cell-intrinsic responsiveness to IL-9. Follicular helper T cells (T FH cells) produced IL-9, and deletion of IL-9 from T cells or, more specifically, from GC T FH cells led to impaired memory formation of B cells. Therefore, the GC development of memory B cells is promoted by T FH cell-derived IL-9.
Lee, Geoffrey; Espirito Santo, Ana Isabel; Zwingenberger, Stefan; Cai, Lawrence; Vogl, Thomas; Feldmann, Marc; Horwood, Nicole J; Chan, James K; Nanchahal, Jagdeep
2018-05-08
A major discovery of recent decades has been the existence of stem cells and their potential to repair many, if not most, tissues. With the aging population, many attempts have been made to use exogenous stem cells to promote tissue repair, so far with limited success. An alternative approach, which may be more effective and far less costly, is to promote tissue regeneration by targeting endogenous stem cells. However, ways of enhancing endogenous stem cell function remain poorly defined. Injury leads to the release of danger signals which are known to modulate the immune response, but their role in stem cell-mediated repair in vivo remains to be clarified. Here we show that high mobility group box 1 (HMGB1) is released following fracture in both humans and mice, forms a heterocomplex with CXCL12, and acts via CXCR4 to accelerate skeletal, hematopoietic, and muscle regeneration in vivo. Pretreatment with HMGB1 2 wk before injury also accelerated tissue regeneration, indicating an acquired proregenerative signature. HMGB1 led to sustained increase in cell cycling in vivo, and using Hmgb1 -/- mice we identified the underlying mechanism as the transition of multiple quiescent stem cells from G 0 to G Alert HMGB1 also transitions human stem and progenitor cells to G Alert Therefore, exogenous HMGB1 may benefit patients in many clinical scenarios, including trauma, chemotherapy, and elective surgery. Copyright © 2018 the Author(s). Published by PNAS.
Sun, H; Lesche, R; Li, D M; Liliental, J; Zhang, H; Gao, J; Gavrilova, N; Mueller, B; Liu, X; Wu, H
1999-05-25
To investigate the molecular basis of PTEN-mediated tumor suppression, we introduced a null mutation into the mouse Pten gene by homologous recombination in embryonic stem (ES) cells. Pten-/- ES cells exhibited an increased growth rate and proliferated even in the absence of serum. ES cells lacking PTEN function also displayed advanced entry into S phase. This accelerated G1/S transition was accompanied by down-regulation of p27(KIP1), a major inhibitor for G1 cyclin-dependent kinases. Inactivation of PTEN in ES cells and in embryonic fibroblasts resulted in elevated levels of phosphatidylinositol 3,4,5,-trisphosphate, a product of phosphatidylinositol 3 kinase. Consequently, PTEN deficiency led to dosage-dependent increases in phosphorylation and activation of Akt/protein kinase B, a well-characterized target of the phosphatidylinositol 3 kinase signaling pathway. Akt activation increased Bad phosphorylation and promoted Pten-/- cell survival. Our studies suggest that PTEN regulates the phosphatidylinositol 3,4, 5,-trisphosphate and Akt signaling pathway and consequently modulates two critical cellular processes: cell cycle progression and cell survival.
Cai, Liangliang; Ye, Hongzhi; Yu, Fangrong; Li, Huiting; Chen, Jiashou; Liu, Xianxiang
2013-05-01
It has been recently shown that polysaccharides isolated from plants exhibit a number of beneficial therapeutic properties. Bauhinia championii (Benth.) Benth. has been widely used for the clinical treatment of knee osteoarthritis (OA) in China. However, the underlying molecular mechanisms of knee OA treatment have yet to be elucidated. In the present study, we investigated the effects of Bauhinia championii (Benth.) Benth. polysaccharides (BCBPs) on the proliferation and cell cycle of chondrocytes on 4-week-old male Sprague Dawley rats. Immunohistochemical staining was used to identify chondrocytes and an MTT assay was used to evaluate cell viability. Flow cytometry was used for cell cycle analysis. The mRNA and protein expression levels of cyclin D1, CDK4 and CDK6 in chondrocytes were detected using reverse transcription polymerase chain reaction (RT-PCR) and western blot analysis, respectively. The data demonstrate that BCBP treatment increased the viability of chondrocytes. In addition, BCBP treatment reduced the cell population in the G0/G1 phase, whereas the cell population was increased in the S phase. Furthermore, BCBP treatment enhanced the expression of cyclin D1, CDK4 and CDK6. These results indicate that BCBP treatment promotes cell proliferation by accelerating the G1/S transition.
Lay, Kenneth; Kume, Tsutomu; Fuchs, Elaine
2016-01-01
Adult tissue stem cells (SCs) reside in niches, which orchestrate SC behavior. SCs are typically used sparingly and exist in quiescence unless activated for tissue growth. Whether parsimonious SC use is essential to conserve long-term tissue-regenerating potential during normal homeostasis remains poorly understood. Here, we examine this issue by conditionally ablating a key transcription factor Forkhead box C1 (FOXC1) expressed in hair follicle SCs (HFSCs). FOXC1-deficient HFSCs spend less time in quiescence, leading to markedly shortened resting periods between hair cycles. The enhanced hair cycling accelerates HFSC expenditure, and impacts hair regeneration in aging mice. Interestingly, although FOXC1-deficient HFs can still form a new bulge that houses HFSCs for the next hair cycle, the older bulge is left unanchored. As the new hair emerges, the entire old bulge, including its reserve HFSCs and SC-inhibitory inner cell layer, is lost. We trace this mechanism first, to a marked increase in cell cycle-associated transcripts upon Foxc1 ablation, and second, to a downstream reduction in E-cadherin–mediated inter-SC adhesion. Finally, we show that when the old bulge is lost with each hair cycle, overall levels of SC-inhibitory factors are reduced, further lowering the threshold for HFSC activity. Taken together, our findings suggest that HFSCs have restricted potential in vivo, which they conserve by coupling quiescence to adhesion-mediated niche maintenance, thereby achieving long-term tissue homeostasis. PMID:26912458
NASA Astrophysics Data System (ADS)
Yasuoka, Shigekazu; Ishida, Jun; Kishida, Kyosuke; Inui, Haruyuki
2017-04-01
The influence of Ce addition on the phase constitution, microstructure, hydrogen absorption/desorption properties and battery performances of newly developed rare earth (RE)-Mg-Ni hydrogen-absorbing superlattice alloys for negative electrode materials in Ni-metal hydride (MH) batteries were investigated. The partial substitution of RE (La and Nd) with Ce results in a higher discharge performance and a lower cycle life in the battery. The Ce addition greatly affects the phase constitution, which is mainly characterized by increased formation of the AB2 phase (A = RE or Mg and B = Ni or Al). The existence of the AB2 phase is found to accelerate alloy pulverization and oxidation when the alloys are used as negative electrode materials in Ni-MH model cells. The accelerated pulverization and oxidation are considered to be responsible for the observed higher discharge performance and lower cycle life in the batteries, respectively.
Mo, En-Pan; Zhang, Rong-Rong; Xu, Jun; Zhang, Huan; Wang, Xiao-Xiong; Tan, Qiu-Tong; Liu, Fang-Lan; Jiang, Ren-Wang; Cai, Shao-Hui
2016-09-16
Calotropin (M11), an active compound isolated from Asclepias curasavica L., was found to exert strong inhibitory and pro-apoptotic activity specifically against cisplatin-induced resistant non-small cell lung cancer (NSCLC) cells (A549/CDDP). Molecular mechanism study revealed that M11 induced cell cycle arrest at the G2/M phase through down-regulating cyclins, CDK1, CDK2 and up-regulating p53 and p21. Furthermore, M11 accelerated apoptosis through the mitochondrial apoptotic pathway which was accompanied by increase Bax/Bcl-2 ratio, decrease in mitochondrial membrane potential, increase in reactive oxygen species production, activations of caspases 3 and 9 as well as cleavage of poly ADP-ribose polymerase (PARP). The activation and phosphorylation of JNK was also found to be involved in M11-induced apoptosis, and SP610025 (specific JNK inhibitor) partially prevented apoptosis induced by M11. In contrast, all of the effects that M11 induce cell cycle arrest and apoptosis in A549/CDDP cells were not significant in A549 cells. Drugs with higher sensitivity against resistant tumor cells than the parent cells are rather rare. Results of this study supported the potential application of M11 on the non-small lung cancer (NSCLC) with cisplatin resistance. Copyright © 2016 Elsevier Inc. All rights reserved.
Long, Lin; He, Jian-Zhong; Chen, Ye; Xu, Xiu-E; Liao, Lian-Di; Xie, Yang-Min; Li, En-Min; Xu, Li-Yan
2018-05-07
Riboflavin is an essential component of the human diet and its derivative cofactors play an established role in oxidative metabolism. Riboflavin deficiency has been linked with various human diseases. The objective of this study was to identify whether riboflavin depletion promotes tumorigenesis. HEK293T and NIH3T3 cells were cultured in riboflavin-deficient or riboflavin-sufficient medium and passaged every 48 h. Cells were collected every 5 generations and plate colony formation assays were performed to observe cell proliferation. Subcutaneous tumorigenicity assays in NU/NU mice were used to observe tumorigenicity of riboflavin-depleted HEK293T cells. Mechanistically, gene expression profiling and gene ontology analysis were used to identify abnormally expressed genes induced by riboflavin depletion. Western blot analyses, cell cycle analyses, and chromatin immunoprecipitation were used to validate the expression of cell cycle-related genes. Plate colony formation of NIH3T3 and HEK293T cell lines was enhanced >2-fold when cultured in riboflavin-deficient medium for 10-20 generations. Moreover, we observed enhanced subcutaneous tumorigenicity in NU/NU mice following injection of riboflavin-depleted compared with normal HEK293T cells (55.6% compared with 0.0% tumor formation, respectively). Gene expression profiling and gene ontology analysis revealed that riboflavin depletion induced the expression of cell cycle-related genes. Validation experiments also found that riboflavin depletion decreased p21 and p27 protein levels by ∼20%, and increased cell cycle-related and expression-elevated protein in tumor (CREPT) protein expression >2-fold, resulting in cyclin D1 and CDK4 levels being increased ∼1.5-fold, and cell cycle acceleration. We also observed that riboflavin depletion decreased intracellular riboflavin levels by 20% and upregulated expression of riboflavin transporter genes, particularly SLC52A3, and that the changes in CREPT and SLC52A3 correlated with specific epigenetic changes in their promoters in riboflavin-depleted HEK293T cells. Riboflavin depletion contributes to HEK293T and NIH3T3 cell tumorigenesis and may be a risk factor for tumor development.
Gene Expression in Mammalian Cells After Exposure to 95 MeV Argon Ions
NASA Astrophysics Data System (ADS)
Arenz, A.; Hellweg, C. E.; Baumstark-Khan, C.
Cell response to genotoxic agents is complex and involves the participation of different classes of genes (DNA repair, cell cycle control, signal transduction, apoptosis and oncogenesis). The unique feature of the space radiation environment is the dominance of high-energy charged particles (HZE or high LET radiation) which present a significant hazard to space flight crews, and accelerator-based experiments are underway to quantify the health risks due to unavoidable radiation exposure. High linear energy transfer (LET) radiation has an increased relative biological effectiveness (RBE) as compared to X-rays for cell death induction, gene mutation, genomic instability, and carcinogenesis. The tumour suppressor gene p53 plays a crucial role in maintaining the integrity of the genome. The p53 protein acts as a transcription factor that mediates cell cycle arrest and apoptosis by binding to DNA and activating transcription of specific genes. It is also though to be involved in damage repair by transcriptional activation of the newly identified p53 dependent ribonuclease subunit R2 (p53R2) that is directly involved in the p53 cell cycle checkpoint for repair of damaged DNA. In that case it is responsible for nucleotide delivery for DNA repair synthesis. DNA damages of cultured human cells (e.g. MCF-7, AGS, A549) exposed to accelerated argon ions at the French heavy ion facility GANIL were analysed for expression levels of certain damage- and apoptosis-relevant genes. RNA was extracted from cells exposed to different particle fluences after various recovery times. A real-time QRT-PCR assay was applied, which employs both relative and absolute quantification of a candidate mRNA biomarker. The expressions of different DNA damage inducible genes (e.g. p53R2, GADD45, p21) were analysed. A reproducible up-regulation representing a twofold to fourfold change in p53R2 gene expression level was confirmed for X-irradiated and Ar-ion exposed cells dependent on dose. Kinetics of p53R2 gene expression modulations shows a response lasting up to 24 hours after irradiation.
Durable electrocatalytic-activity of Pt-Au/C cathode in PEMFCs.
Selvaganesh, S Vinod; Selvarani, G; Sridhar, P; Pitchumani, S; Shukla, A K
2011-07-21
Longevity remains as one of the central issues in the successful commercialization of polymer electrolyte membrane fuel cells (PEMFCs) and primarily hinges on the durability of the cathode. Incorporation of gold (Au) to platinum (Pt) is known to ameliorate both the electrocatalytic activity and stability of cathode in relation to pristine Pt-cathodes that are currently being used in PEMFCs. In this study, an accelerated stress test (AST) is conducted to simulate prolonged fuel-cell operating conditions by potential cycling the carbon-supported Pt-Au (Pt-Au/C) cathode. The loss in performance of PEMFC with Pt-Au/C cathode is found to be ∼10% after 7000 accelerated potential-cycles as against ∼60% for Pt/C cathode under similar conditions. These data are in conformity with the electrochemical surface-area values. PEMFC with Pt-Au/C cathode can withstand >10,000 potential cycles with very little effect on its performance. X-ray diffraction and transmission electron microscopy studies on the catalyst before and after AST suggest that incorporating Au with Pt helps mitigate aggregation of Pt particles during prolonged fuel-cell operations while X-ray photoelectron spectroscopy reflects that the metallic nature of Pt is retained in the Pt-Au catalyst during AST in comparison to Pt/C that shows a major portion of Pt to be present as oxidic platinum. Field-emission scanning electron microscopy conducted on the membrane electrode assembly before and after AST suggests that incorporating Au with Pt helps mitigating deformations in the catalyst layer. This journal is © the Owner Societies 2011
Shortening tobacco life cycle accelerates functional gene identification in genomic research.
Ning, G; Xiao, X; Lv, H; Li, X; Zuo, Y; Bao, M
2012-11-01
Definitive allocation of function requires the introduction of genetic mutations and analysis of their phenotypic consequences. Novel, rapid and convenient techniques or materials are very important and useful to accelerate gene identification in functional genomics research. Here, over-expression of PmFT (Prunus mume), a novel FT orthologue, and PtFT (Populus tremula) lead to shortening of the tobacco life cycle. A series of novel short life cycle stable tobacco lines (30-50 days) were developed through repeated self-crossing selection breeding. Based on the second transformation via a gusA reporter gene, the promoter from BpFULL1 in silver birch (Betula pendula) and the gene (CPC) from Arabidopsis thaliana were effectively tested using short life cycle tobacco lines. Comparative analysis among wild type, short life cycle tobacco and Arabidopsis transformation system verified that it is optional to accelerate functional gene studies by shortening host plant material life cycle, at least in these short life cycle tobacco lines. The results verified that the novel short life cycle transgenic tobacco lines not only combine the advantages of economic nursery requirements and a simple transformation system, but also provide a robust, effective and stable host system to accelerate gene analysis. Thus, shortening tobacco life cycle strategy is feasible to accelerate heterologous or homologous functional gene identification in genomic research. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin
2012-01-01
Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell proliferation and migration. Pokemon knockdown inhibited the PI3K/Akt and c-Raf/MEK/ERK pathways and modulated the expression of various cell cycle regulators in HepG2 and Huh-7 cells. Therefore, Pokemon may also be involved in cell cycle progression in these cells. We confirmed that Pokemon silencing suppresses hepatocellular carcinoma growth in tumor xenograft mice. These results suggest that Pokemon promotes cell proliferation and migration in hepatocellular carcinoma and accelerates tumor development in an Akt- and ERK-signaling-dependent manner. PMID:23300578
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azad, Arun, E-mail: arun.azad@bccancer.bc.ca; Department of Pathology, St. Vincent's Hospital, University of Melbourne, Parkville, Victoria; Bukczynska, Patricia
Purpose: To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. Methods and Materials: The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs,more » and accelerated senescence after radiation. Results: Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Conclusion: Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination.« less
Coverage-dependent amplifiers of vegetation change on global water cycle dynamics
NASA Astrophysics Data System (ADS)
Feng, Huihui; Zou, Bin; Luo, Juhua
2017-07-01
The terrestrial water cycle describes the circulation of water worldwide from one store to another via repeated evapotranspiration (E) from land and precipitation (P) back to the surface. The cycle presents significant spatial variability, which is strongly affected by natural climate and anthropogenic influences. As one of the major anthropogenic influences, vegetation change unavoidably alters surface property and subsequent the terrestrial water cycle, while its contribution is yet difficult to isolate from the mixed influences. Here, we use satellite and in-situ datasets to identify the terrestrial water cycle dynamics in spatial detail and to evaluate the impact of vegetation change. Methodologically, the water cycle is identified by the indicator of difference between evapotranspiration and precipitation (E-P). Then the scalar form of the indicator's trend (ΔE + ΔP) is used for evaluating the dynamics of water cycle, with the positive value means acceleration and negative means deceleration. Then, the contributions of climate and vegetation change are isolated by the trajectory-based method. Our results indicate that 4 accelerating and 4 decelerating water cycles can be identified, affecting 42.11% of global land. The major water cycle type is characterized by non-changing precipitation and increasing evapotranspiration (PNO-EIN), which covers 20.88% of globally land. Vegetation change amplifies both accelerating and decelerating water cycles. It tends to intensify the trend of the decelerating water cycles, while climate change weakens the trend. In the accelerating water cycles, both vegetation and climate change present positive effect to intensify the trend. The effect of plant cover change varies with the coverage. In particular, vegetation change intensifies the water cycle in moderately vegetated regions (0.1 < NDVI < 0.6), but weakens the cycle in sparsely or highly vegetated regions (NDVI < 0.1 or 0.6 < NDVI < 0.8). In extremely vegetated regions (NDVI > 0.85), the water cycle is accelerated because of the significant increase of precipitation. We conclude that vegetation change acts as an amplifier for both accelerating and decelerating terrestrial water cycles, depending on the degree of vegetation coverage.
Accelerator Reactor Coupling for Energy Production in Advanced Nuclear Fuel Cycles
Brown, Nicholas R.; Heidet, Florent; Haj Tahar, Malek
2016-01-01
This article is a review of several accelerator–reactor interface issues and nuclear fuel cycle applications of acceleratordriven subcritical systems. The systems considered here have the primary goal of energy production, but that goal is accomplished via a specific application in various proposed nuclear fuel cycles, such as breed-and-burn of fertile material or burning of transuranic material. Several basic principles are reviewed, starting from the proton beam window including the target, blanket, reactor core, and up to the fuel cycle. We focus on issues of interest, such as the impact of the energy required to run the accelerator and associated systemsmore » on the potential electricity delivered to the grid. Accelerator-driven systems feature many of the constraints and issues associated with critical reactors, with the added challenges of subcritical operation and coupling to an accelerator. Reliable accelerator operation and avoidance of beam trips are critically important. One interesting challenge is measurement of blanket subcriticality level during operation. We also review the potential benefits of accelerator-driven systems in various nuclear fuel cycle applications. Ultimately, accelerator-driven subcritical systems with the goal of transmutation of transuranic material have lower 100,000-year radioactivity than a critical fast reactor with recycling of uranium and plutonium.« less
Beinke, C; Port, M; Ullmann, R; Gilbertz, K; Majewski, M; Abend, M
2018-06-01
Dicentric chromosome analysis (DCA) is the gold standard for individual radiation dose assessment. However, DCA is limited by the time-consuming phytohemagglutinin (PHA)-mediated lymphocyte activation. In this study using human peripheral blood lymphocytes, we investigated PHA-associated whole genome gene expression changes to elucidate this process and sought to identify suitable gene targets as a means of meeting our long-term objective of accelerating cell cycle kinetics to reduce DCA culture time. Human peripheral whole blood from three healthy donors was separately cultured in RPMI/FCS/antibiotics with BrdU and PHA-M. Diluted whole blood samples were transferred into PAXgene tubes at 0, 12, 24 and 36 h culture time. RNA was isolated and aliquots were used for whole genome gene expression screening. Microarray results were validated using qRT-PCR and differentially expressed genes [significantly (FDR corrected) twofold different from the 0 h value reference] were analyzed using several bioinformatic tools. The cell cycle positions and DNA-synthetic activities of lymphocytes were determined by analyzing the correlated total DNA content and incorporated BrdU level with flow cytometry after continued BrdU incubation. From 42,545 transcripts of the whole genome microarray 47.6%, on average, appeared expressed. The number of differentially expressed genes increased linearly from 855 to 2,858 and 4,607 at 12, 24 and 36 h after PHA addition, respectively. Approximately 2-3 times more up- than downregulated genes were observed with several hundred genes differentially expressed at each time point. Earliest enrichment was observed for gene sets related to the nucleus (12 h) followed by genes assigned to intracellular structures such as organelles (24 h) and finally genes related to the membrane and the extracellular matrix were enriched (36 h). Early gene expression changes at 12 h, in particular, were associated with protein classes such as chemokines/cytokines (e.g., CXCL1, CXCL2) and chaperones. Genes coding for biological processes involved in cell cycle control (e.g., MYBL2, RBL1, CCNA, CCNE) and DNA replication (e.g., POLA, POLE, MCM) appeared enriched at 24 h and later, but many more biological processes (42 altogether) showed enrichment as well. Flow cytometry data fit together with gene expression and bioinformatic analyses as cell cycle transition into S phase was observed with interindividual differences from 12 h onward, whereas progression into G 2 as well as into the second G 1 occurred from 36 h onward after activation. Gene set enrichment analysis over time identifies, in particular, two molecular categories of PHA-responsive gene targets (cytokine and cell cycle control genes). Based on that analysis target genes for cell cycle acceleration in lymphocytes have been identified ( CDKN1A/B/C, RBL-1/RBL-2, E2F2, Deaf-1), and it remains undetermined whether the time expenditure for DCA can be reduced by influencing gene expression involved in the regulatory circuits controlling PHA-associated cell cycle entry and/or progression at a specific early cell cycle phase.
Browaeys-Poly, Edith; Perdereau, Dominique; Lescuyer, Arlette; Burnol, Anne-Françoise; Cailliau, Katia
2009-12-01
Estrogen-independent breast cancer cell growth is under the control of fibroblast growth factors receptors (FGFRs), but the role of phospholipase C gamma (PLC(gamma)) and Akt, the downstream effectors activated by FGFRs, in cell proliferation is still unresolved. FGFRs from highly invasive MDA-MB-231 cells were expressed in Xenopus oocyte, a powerful model system to assess the G(2)/M checkpoint regulation. Under FGF1 stimulation, an analysis of the progression in the M-phase of the cell cycle and of the Akt signaling cascades were performed using the phosphatidylinositol-3-kinase inhibitor, LY294002, and a mimetic peptide of the SH3 domain of PLC(gamma). Activated Akt binds and phosphorylates PLC(gamma) before Akt targets the tumor suppressor Chfr. Disruption of the Akt-PLC(gamma) interaction directs Akt binding to Chfr and accelerates the alleviation of the G(2)/M checkpoint. The PLC(gamma)-Akt interaction, triggered by FGF receptors from estrogen-independent breast cancer cells MDA-MB-231, regulates progression in the M-phase of the cell cycle.
Kiso, Minako; Manabe, Noboru; Komatsu, Kohji; Shimabe, Munetake; Miyamoto, Hajime
2003-12-01
Senescence accelerated mouse-prone (SAMP) mice with a shortened life span show accelerated changes in many of the signs of aging and a shorter reproductive life span than SAM-resistant (SAMR) controls. We previously showed that functional regression (progesterone dissimilation) occurs in abnormally accumulated luteal bodies (aaLBs) of SAMP mice, but structural regression of luteal cells in aaLB is inhibited. A deficiency of luteal cell apoptosis causes the abnormal accumulation of LBs in SAMP ovaries. In the present study, to show the abnormality of Fas ligand (FasL)/Fas-mediated apoptosis signal transducing factors in the aaLBs of the SAMP ovaries, we assessed the changes in the expression of FasL, Fas, caspase-8 and caspase-3 mRNAs by reverse transcription-polymerase chain reaction, and in the expression and localization of FasL, Fas and activated caspase-3 proteins by Western blotting and immunohistochemistry, respectively, during the estrus cycle/luteolysis. These mRNAs and proteins were expressed in normal LBs of both SAMP and SAMR ovaries, but not at all or only in trace amounts in aaLBs of SAMP, indicating that structural regression is inhibited by blockage of the expression of these transducing factors in luteal cells of aaLBs in SAMP mice.
MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.
Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad
2010-11-01
MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.
Genome-wide differential gene expression in immortalized DF-1 chicken embryo fibroblast cell line
2011-01-01
Background When compared to primary chicken embryo fibroblast (CEF) cells, the immortal DF-1 CEF line exhibits enhanced growth rates and susceptibility to oxidative stress. Although genes responsible for cell cycle regulation and antioxidant functions have been identified, the genome-wide transcription profile of immortal DF-1 CEF cells has not been previously reported. Global gene expression in primary CEF and DF-1 cells was performed using a 4X44K chicken oligo microarray. Results A total of 3876 differentially expressed genes were identified with a 2 fold level cutoff that included 1706 up-regulated and 2170 down-regulated genes in DF-1 cells. Network and functional analyses using Ingenuity Pathways Analysis (IPA, Ingenuity® Systems, http://www.ingenuity.com) revealed that 902 of 3876 differentially expressed genes were classified into a number of functional groups including cellular growth and proliferation, cell cycle, cellular movement, cancer, genetic disorders, and cell death. Also, the top 5 gene networks with intermolecular connections were identified. Bioinformatic analyses suggested that DF-1 cells were characterized by enhanced molecular mechanisms for cell cycle progression and proliferation, suppressing cell death pathways, altered cellular morphogenesis, and accelerated capacity for molecule transport. Key molecules for these functions include E2F1, BRCA1, SRC, CASP3, and the peroxidases. Conclusions The global gene expression profiles provide insight into the cellular mechanisms that regulate the unique characteristics observed in immortal DF-1 CEF cells. PMID:22111699
Teng, Yan; Sun, An-Na; Pan, Xiao-Chen; Yang, Guan; Yang, Lei-Lei; Wang, Ming-Rong; Yang, Xiao
2006-07-15
The genetic bases underlying esophageal tumorigenesis are poorly understood. Our previous studies have shown that coordinated deletion of the Smad4 and PTEN genes results in accelerated hair loss and skin tumor formation in mice. Herein, we exemplify that the concomitant inactivation of Smad4 and PTEN accelerates spontaneous forestomach carcinogenesis at complete penetrance during the first 2 months of age. All of the forestomach tumors were invasive squamous cell carcinomas (SCCs), which recapitulated the natural history and pathologic features of human esophageal SCCs. A small population of the SCC lesions was accompanied by adenocarcinomas at the adjacent submucosa region in the double mutant mice. The rapid progression of forestomach tumor formation in the Smad4 and PTEN double knockout mice corresponded to a dramatic increase in esophageal and forestomach epithelial proliferation. The decreased expression of p27, p21, and p16 together with the overexpression of cyclin D1 contributed cooperatively to the accelerated forestomach tumorigenesis in the double mutant mice. Our results point strongly to the crucial relevance of synergy between Smad4 and PTEN to suppress forestomach tumorigenesis through the cooperative induction of cell cycle inhibitors.
Daigle, Jean-Christophe; Asakawa, Yuichiro; Beaupré, Mélanie; Vieillette, René; Laul, Dharminder; Trudeau, Michel; Zaghib, Karim
2017-12-13
Lithium titanium oxide (Li 4 Ti 5 O 12 )-based cells are a very promising battery technology for ultrafast-charge-discharge and long-cycle-life batteries. However, the surface reactivity of lithium titanium oxide in the presence of organic electrolytes continues to be a problem that may cause expansion of pouch cells. In this study, we report on the development of a simple and economical grafting method for forming hybrid polymer-Li 4 Ti 15 O 12 nanoparticles, which can be successfully applied in lithium-ion batteries. This method utilizes a low-cost and scalable hydrophobic polymer that is applicable in industrial processes. The hybrid materials demonstrated exceptional capability for preventing the degradation of cells in accelerated aging and operating over 150 cycles at 1C and 45 °C.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahluwalia, R. K.; Wang, X.; Peng, J. -K.
Here, the durability of de-alloyed platinum-nickel catalysts supported on high-surface area carbon (d-PtNi/C) in optimized electrodes and membrane electrode assemblies (MEAs) under an accelerated stress test (AST) protocol is investigated with the objective of developing a quantitative understanding of the degradation mechanisms and their relationship to the electrode structure, pre-conditioning, and operating conditions. It is found that the cell degradation can be mitigated by controlling the voltage cycle, acid washing the MEA to remove Ni contaminants that enter the electrode and membrane during fabrication, and monitoring the operating conditions. For example, the electrochemical surface area (ECSA) loss is <25% aftermore » 30,000 triangle cycles with 0.925 V upper potential limit if the MEA is acid washed and extensive diagnostics are avoided. The parameters that exacerbate the cell degradation also accelerate the rate at which Ni leaches out from the catalyst. A mechanistic model is presented for the degradation in performance of d-PtNi/C electrodes. The model correlates a) the degradation in ORR mass and specific activities with ECSA and Ni losses, b) the decrease in limiting current density ( iL), which is inversely proportional to the O 2 mass transport resistance, with the degradation in catalyst roughness factor, and c) the increase in mass transfer overpotentials with the reduced current density, i/iL .« less
Ahluwalia, R. K.; Wang, X.; Peng, J. -K.; ...
2018-04-25
Here, the durability of de-alloyed platinum-nickel catalysts supported on high-surface area carbon (d-PtNi/C) in optimized electrodes and membrane electrode assemblies (MEAs) under an accelerated stress test (AST) protocol is investigated with the objective of developing a quantitative understanding of the degradation mechanisms and their relationship to the electrode structure, pre-conditioning, and operating conditions. It is found that the cell degradation can be mitigated by controlling the voltage cycle, acid washing the MEA to remove Ni contaminants that enter the electrode and membrane during fabrication, and monitoring the operating conditions. For example, the electrochemical surface area (ECSA) loss is <25% aftermore » 30,000 triangle cycles with 0.925 V upper potential limit if the MEA is acid washed and extensive diagnostics are avoided. The parameters that exacerbate the cell degradation also accelerate the rate at which Ni leaches out from the catalyst. A mechanistic model is presented for the degradation in performance of d-PtNi/C electrodes. The model correlates a) the degradation in ORR mass and specific activities with ECSA and Ni losses, b) the decrease in limiting current density ( iL), which is inversely proportional to the O 2 mass transport resistance, with the degradation in catalyst roughness factor, and c) the increase in mass transfer overpotentials with the reduced current density, i/iL .« less
A drug-induced accelerated senescence (DIAS) is a possibility to study aging in time lapse.
Alili, Lirija; Diekmann, Johanna; Giesen, Melanie; Holtkötter, Olaf; Brenneisen, Peter
2014-06-01
Currently, the oxidative stress (or free radical) theory of aging is the most popular explanation of how aging occurs at the molecular level. Accordingly, a stress-induced senescence-like phenotype of human dermal fibroblasts can be induced in vitro by the exposure of human diploid fibroblasts to subcytotoxic concentrations of hydrogen peroxide. However, several biomarkers of replicative senescence e.g. cell cycle arrest and enlarged morphology are abrogated 14 days after treatment, indicating that reactive oxygen species (ROS) rather acts as a trigger for short-term senescence (1-3 days) than being responsible for the maintenance of the senescence-like phenotype. Further, DNA-damaging factors are discussed resulting in a permanent senescent cell type. To induce long-term premature senescence and to understand the molecular alterations occurring during the aging process, we analyzed mitomycin C (MMC) as an alkylating DNA-damaging agent and ROS producer. Human dermal fibroblasts (HDF), used as model for skin aging, were exposed to non-cytotoxic concentrations of MMC and analyzed for potential markers of cellular aging, for example enlarged morphology, activity of senescence-associated-ß-galactosidase, cell cycle arrest, increased ROS production and MMP1-activity, which are well-documented for HDF in replicative senescence. Our data show that mitomycin C treatment results in a drug-induced accelerated senescence (DIAS) with long-term expression of senescence markers, demonstrating that a combination of different susceptibility factors, here ROS and DNA alkylation, are necessary to induce a permanent senescent cell type.
Live Cell in Vitro and in Vivo Imaging Applications: Accelerating Drug Discovery
Isherwood, Beverley; Timpson, Paul; McGhee, Ewan J; Anderson, Kurt I; Canel, Marta; Serrels, Alan; Brunton, Valerie G; Carragher, Neil O
2011-01-01
Dynamic regulation of specific molecular processes and cellular phenotypes in live cell systems reveal unique insights into cell fate and drug pharmacology that are not gained from traditional fixed endpoint assays. Recent advances in microscopic imaging platform technology combined with the development of novel optical biosensors and sophisticated image analysis solutions have increased the scope of live cell imaging applications in drug discovery. We highlight recent literature examples where live cell imaging has uncovered novel insight into biological mechanism or drug mode-of-action. We survey distinct types of optical biosensors and associated analytical methods for monitoring molecular dynamics, in vitro and in vivo. We describe the recent expansion of live cell imaging into automated target validation and drug screening activities through the development of dedicated brightfield and fluorescence kinetic imaging platforms. We provide specific examples of how temporal profiling of phenotypic response signatures using such kinetic imaging platforms can increase the value of in vitro high-content screening. Finally, we offer a prospective view of how further application and development of live cell imaging technology and reagents can accelerate preclinical lead optimization cycles and enhance the in vitro to in vivo translation of drug candidates. PMID:24310493
Galindo, Mario; Pratap, Jitesh; Young, Daniel W.; Hovhannisyan, Hayk; Im, Hee-Jeong; Choi, Je-Yong; Lian, Jane B.; Stein, Janet L.; Stein, Gary S.; van Wijnen, Andre J.
2010-01-01
The Runx2 (CBFA1/AML3/PEBP2αA) transcription factor promotes skeletal cell differentiation, but it also has a novel cell growth regulatory activity in osteoblasts. We addressed here whether Runx2 activity is functionally linked to cell cycle-related mechanisms that control normal osteoblast proliferation and differentiation. We found that the levels of Runx2 gene transcription, mRNA and protein, are each up-regulated with cessation of cell growth (i.e. G0/G1 transition) in preconfluent MC3T3 osteoblastic cells that do not yet express mature bone phenotypic gene expression. Cell growth regulation of Runx2 is also observed in primary calvarial osteoblasts and other osteoblastic cells with relatively normal cell growth characteristics, but not in osteosarcoma cells (e.g. SAOS-2 and ROS17/2.8). Runx2 levels are cell cycle-regulated in MC3T3 cells with respect to the G1/S and M/G1 transitions: expression oscillates from maximal levels during early G1 to minimal levels during early S phase and mitosis. However, in normal or immortalized (e.g. ATDC5) chondrocytic cells, Runx2 expression is suppressed during quiescence, and Runx2 levels are not regulated during G1 and S phase in ATDC5 cells. Antisense or small interfering RNA-mediated reduction of the low physiological levels of Runx2 in proliferating MC3T3 cells does not accelerate cell cycle progression. However, forced expression of Runx2 suppresses proliferation of MC3T3 preosteoblasts or C2C12 mesenchymal cells which have osteogenic potential. Forced elevation of Runx2 in synchronized MC3T3 cells causes a delay in G1. We propose that Runx2 levels and function are biologically linked to a cell growth-related G1 transition in osteoblastic cells. PMID:15781466
Zaïm, N; Thévenet, M; Lifschitz, A; Faure, J
2017-09-01
We propose a method to generate femtosecond, relativistic, and high-charge electron bunches using few-cycle and tightly focused radially polarized laser pulses. In this scheme, the incident laser pulse reflects off an overdense plasma that injects electrons into the reflected pulse. Particle-in-cell simulations show that the plasma injects electrons ideally, resulting in a dramatic increase of charge and energy of the accelerated electron bunch in comparison to previous methods. This method can be used to generate femtosecond pC bunches with energies in the 1-10 MeV range using realistic laser parameters corresponding to current kHz laser systems.
A Mechanistic Thermal Fatigue Model for SnAgCu Solder Joints
NASA Astrophysics Data System (ADS)
Borgesen, Peter; Wentlent, Luke; Hamasha, Sa'd.; Khasawneh, Saif; Shirazi, Sam; Schmitz, Debora; Alghoul, Thaer; Greene, Chris; Yin, Liang
2018-02-01
The present work offers both a complete, quantitative model and a conservative acceleration factor expression for the life span of SnAgCu solder joints in thermal cycling. A broad range of thermal cycling experiments, conducted over many years, has revealed a series of systematic trends that are not compatible with common damage functions or constitutive relations. Complementary mechanical testing and systematic studies of the evolution of the microstructure and damage have led to a fundamental understanding of the progression of thermal fatigue and failure. A special experiment was developed to allow the effective deconstruction of conventional thermal cycling experiments and the finalization of our model. According to this model, the evolution of damage and failure in thermal cycling is controlled by a continuous recrystallization process which is dominated by the coalescence and rotation of dislocation cell structures continuously added to during the high-temperature dwell. The dominance of this dynamic recrystallization contribution is not consistent with the common assumption of a correlation between the number of cycles to failure and the total work done on the solder joint in question in each cycle. It is, however, consistent with an apparent dependence on the work done during the high-temperature dwell. Importantly, the onset of this recrystallization is delayed by pinning on the Ag3Sn precipitates until these have coarsened sufficiently, leading to a model with two terms where one tends to dominate in service and the other in accelerated thermal cycling tests. Accumulation of damage under realistic service conditions with varying dwell temperatures and times is also addressed.
MicroRNA-188 suppresses G1/S transition by targeting multiple cyclin/CDK complexes.
Wu, Jiangbin; Lv, Qing; He, Jie; Zhang, Haoxiang; Mei, Xueshuang; Cui, Kai; Huang, Nunu; Xie, Weidong; Xu, Naihan; Zhang, Yaou
2014-10-11
Accelerated cell cycle progression is the common feature of most cancers. MiRNAs can act as oncogenes or tumor suppressors by directly modulating cell cycle machinery. It has been shown that miR-188 is upregulated in UVB-irradiated mouse skin and human nasopharyngeal carcinoma CNE cells under hypoxic stress. However, little is known about the function of miR-188 in cell proliferation and growth control. Overexpression of miR-188 inhibits cell proliferation, tumor colony formation and G1/S cell cycle transition in human nasopharyngeal carcinoma CNE cells. Using bioinformatics approach, we identify a series of genes regulating G1/S transition as putative miR-188 targets. MiR-188 inhibits both mRNA and protein expression of CCND1, CCND3, CCNE1, CCNA2, CDK4 and CDK2, suppresses Rb phosphorylation and downregulates E2F transcriptional activity. The expression level of miR-188 also inversely correlates with the expression of miR-188 targets in human nasopharyngeal carcinoma (NPC) tissues. Moreover, studies in xenograft mouse model reveal that miR-188 is capable of inhibiting tumor initiation and progression by suppressing target genes expression and Rb phosphorylation. This study demonstrates that miR-188 exerts anticancer effects, via downregulation of multiple G1/S related cyclin/CDKs and Rb/E2F signaling pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tian, Junqiang; Doi, Hiroshi; Saar, Matthias
2013-12-01
Purpose: It was recently reported that the organic arsenic compound darinaparsin (DPS) is a cytotoxin and radiosensitizer of tumor cells in vitro and in subcutaneous xenograft tumors. Surprisingly, it was also found that DPS protects normal intestinal crypt epithelial cells (CECs) from clonogenic death after ionizing radiation (IR). Here we tested the DPS radiosensitizing effect in a clinically relevant model of prostate cancer and explored the radioprotective effect and mechanism of DPS on CECs. Methods and Materials: The radiation modification effect of DPS was tested in a mouse model of orthotopic xenograft prostate cancer and of IR-induced acute gastrointestinal syndrome.more » The effect of DPS on CEC DNA damage and DNA damage responses was determined by immunohistochemistry. Results: In the mouse model of IR-induced gastrointestinal syndrome, DPS treatment before IR accelerated recovery from body weight loss and increased animal survival. DPS decreased post-IR DNA damage and cell death, suggesting that the radioprotective effect was mediated by enhanced DNA damage repair. Shortly after DPS injection, significant cell cycle arrest was observed in CECs at both G1/S and G2/M checkpoints, which was accompanied by the activation of cell cycle inhibitors p21 and growth arrest and DNA-damage-inducible protein 45 alpha (GADD45A). Further investigation revealed that DPS activated ataxia telangiectasia mutated (ATM), an important inducer of DNA damage repair and cell cycle arrest. Conclusions: DPS selectively radioprotected normal intestinal CECs and sensitized prostate cancer cells in a clinically relevant model. This effect may be, at least in part, mediated by DNA damage response activation and has the potential to significantly increase the therapeutic index of radiation therapy.« less
The NMDA receptor NR2A subunit regulates proliferation of MKN45 human gastric cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Kanako; Department of Anesthesiology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya 663-8501; Kanno, Takeshi
2008-03-07
The present study investigated proliferation of MKN28 and MKN45 human gastric cancer cells regulated by the N-methyl-D-aspartate (NMDA) receptor subunit. The NMDA receptor antagonist DL-2-amino-5-phosphonovaleric acid (AP5) inhibited proliferation of MKN45 cells, but not MKN28 cells. Of the NMDA subunits such as NR1, NR2 (2A, 2B, 2C, and 2D), and NR3 (3A and 3B), all the NMDA subunit mRNAs except for the NR2B subunit mRNA were expressed in both MKN28 and MKN45 cells. MKN45 cells were characterized by higher expression of the NR2A subunit mRNA and lower expression of the NR1 subunit mRNA, but MKN28 otherwise by higher expression ofmore » the NR1 subunit mRNA and lower expression of the NR2A subunit mRNA. MKN45 cell proliferation was also inhibited by silencing the NR2A subunit-targeted gene. For MKN45 cells, AP5 or knocking-down the NR2A subunit increased the proportion of cells in the G{sub 1} phase of cell cycling and decreased the proportion in the S/G{sub 2} phase. The results of the present study, thus, suggest that blockage of NMDA receptors including the NR2A subunit suppresses MKN45 cell proliferation due to cell cycle arrest at the G{sub 1} phase; in other words, the NR2A subunit promotes MKN45 cell proliferation by accelerating cell cycling.« less
Duodu, Godfred Odame; Goonetilleke, Ashantha; Ayoko, Godwin A
2016-04-01
Organochlorine pesticides (OCPs) are ubiquitous environmental contaminants with adverse impacts on aquatic biota, wildlife and human health even at low concentrations. However, conventional methods for their determination in river sediments are resource intensive. This paper presents an approach that is rapid and also reliable for the detection of OCPs. Accelerated Solvent Extraction (ASE) with in-cell silica gel clean-up followed by Triple Quadrupole Gas Chromatograph Mass Spectrometry (GCMS/MS) was used to recover OCPs from sediment samples. Variables such as temperature, solvent ratio, adsorbent mass and extraction cycle were evaluated and optimized for the extraction. With the exception of Aldrin, which was unaffected by any of the variables evaluated, the recovery of OCPs from sediment samples was largely influenced by solvent ratio and adsorbent mass and, to some extent, the number of cycles and temperature. The optimized conditions for OCPs extraction in sediment with good recoveries were determined to be 4 cycles, 4.5 g of silica gel, 105 °C, and 4:3 v/v DCM: hexane mixture. With the exception of two compounds (α-BHC and Aldrin) whose recoveries were low (59.73 and 47.66% respectively), the recovery of the other pesticides were in the range 85.35-117.97% with precision <10% RSD. The method developed significantly reduces sample preparation time, the amount of solvent used, matrix interference, and is highly sensitive and selective. Copyright © 2015 Elsevier B.V. All rights reserved.
Accelerated Thermal Cycling and Failure Mechanisms for BGA and CSP Assemblies
NASA Technical Reports Server (NTRS)
Ghaffarian, Reza
2000-01-01
This paper reviews the accelerated thermal cycling test methods that are currently used by industry to characterize the interconnect reliability of commercial-off-the-shelf (COTS) ball grid array (BGA) and chip scale package (CSP) assemblies. Acceleration induced failure mechanisms varied from conventional surface mount (SM) failures for CSPs. Examples of unrealistic life projections for other CSPs are also presented. The cumulative cycles to failure for ceramic BGA assemblies performed under different conditions, including plots of their two Weibull parameters, are presented. The results are for cycles in the range of -30 C to 100 C, -55 C to 100 C, and -55 C to 125 C. Failure mechanisms as well as cycles to failure for thermal shock and thermal cycling conditions in the range of -55 C to 125 C were compared. Projection to other temperature cycling ranges using a modified Coffin-Manson relationship is also presented.
Recent Advances in Catalyst Accelerated Stress Tests for Polymer Electrolyte Membrane Fuel Cells
Stariha, Sarah; Macauley, Natalia; Sneed, Brian T.; ...
2018-03-15
The U.S. Department of Energy (DOE) set the 2020 durability target for polymer electrolyte membrane fuel cell transportation applications at 5000 hours. Since it is impractical to test every fuel cell for this length of time, there is ever increasing interest in developing accelerated stress tests (ASTs) that can accurately simulate the material component degradation in the membrane electrode assembly (MEA) observed under automotive operating conditions, but over a much shorter time frame. In this study, a square-wave catalyst AST was examined that shows a 5X time acceleration factor over the triangle-wave catalyst AST and a 25X time acceleration factormore » over the modified wet drive-cycle catalyst durability protocol, significantly decreasing the testing time. These acceleration factors were correlated to the platinum (Pt) particle size increase and associated decrease in electrochemical surface area (ECSA). This square-wave AST has been adopted by the DOE as a standard protocol to evaluate catalyst durability. We also compare three catalyst-durability protocols using state-of-the-art platinum-cobalt catalysts supported on high surface area carbon (SOA Pt-Co/HSAC) in the cathode catalyst layer. The results for each of the three tests showed both catalyst particle size increase and transition metal leaching. Moreover the acceleration factors for the alloy catalysts were smaller due to Co leaching being the predominant mechanism of voltage decay in ~5 nm PtCo/C catalysts. Finally, an extremely harsh carbon corrosion AST was run using the same SOA Pt-Co/HSAC catalyst. This showed minimal change in particle size and a low percentage Co loss from the cathode catalyst particles, despite a significant loss in catalyst layer thickness and cell performance. The carbon corrosion rates during these various ASTs were directly measured by monitoring the CO 2 emission from the cathode, further confirming the ability of the square-wave AST to evaluate the electro-catalyst independently of the support.« less
Recent Advances in Catalyst Accelerated Stress Tests for Polymer Electrolyte Membrane Fuel Cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stariha, Sarah; Macauley, Natalia; Sneed, Brian T.
The U.S. Department of Energy (DOE) set the 2020 durability target for polymer electrolyte membrane fuel cell transportation applications at 5000 hours. Since it is impractical to test every fuel cell for this length of time, there is ever increasing interest in developing accelerated stress tests (ASTs) that can accurately simulate the material component degradation in the membrane electrode assembly (MEA) observed under automotive operating conditions, but over a much shorter time frame. In this study, a square-wave catalyst AST was examined that shows a 5X time acceleration factor over the triangle-wave catalyst AST and a 25X time acceleration factormore » over the modified wet drive-cycle catalyst durability protocol, significantly decreasing the testing time. These acceleration factors were correlated to the platinum (Pt) particle size increase and associated decrease in electrochemical surface area (ECSA). This square-wave AST has been adopted by the DOE as a standard protocol to evaluate catalyst durability. We also compare three catalyst-durability protocols using state-of-the-art platinum-cobalt catalysts supported on high surface area carbon (SOA Pt-Co/HSAC) in the cathode catalyst layer. The results for each of the three tests showed both catalyst particle size increase and transition metal leaching. Moreover the acceleration factors for the alloy catalysts were smaller due to Co leaching being the predominant mechanism of voltage decay in ~5 nm PtCo/C catalysts. Finally, an extremely harsh carbon corrosion AST was run using the same SOA Pt-Co/HSAC catalyst. This showed minimal change in particle size and a low percentage Co loss from the cathode catalyst particles, despite a significant loss in catalyst layer thickness and cell performance. The carbon corrosion rates during these various ASTs were directly measured by monitoring the CO 2 emission from the cathode, further confirming the ability of the square-wave AST to evaluate the electro-catalyst independently of the support.« less
Empirical membrane lifetime model for heavy duty fuel cell systems
NASA Astrophysics Data System (ADS)
Macauley, Natalia; Watson, Mark; Lauritzen, Michael; Knights, Shanna; Wang, G. Gary; Kjeang, Erik
2016-12-01
Heavy duty fuel cells used in transportation system applications such as transit buses expose the fuel cell membranes to conditions that can lead to lifetime-limiting membrane failure via combined chemical and mechanical degradation. Highly durable membranes and reliable predictive models are therefore needed in order to achieve the ultimate heavy duty fuel cell lifetime target of 25,000 h. In the present work, an empirical membrane lifetime model was developed based on laboratory data from a suite of accelerated membrane durability tests. The model considers the effects of cell voltage, temperature, oxygen concentration, humidity cycling, humidity level, and platinum in the membrane using inverse power law and exponential relationships within the framework of a general log-linear Weibull life-stress statistical distribution. The obtained model is capable of extrapolating the membrane lifetime from accelerated test conditions to use level conditions during field operation. Based on typical conditions for the Whistler, British Columbia fuel cell transit bus fleet, the model predicts a stack lifetime of 17,500 h and a membrane leak initiation time of 9200 h. Validation performed with the aid of a field operated stack confirmed the initial goal of the model to predict membrane lifetime within 20% of the actual operating time.
Role of Mitochondrial Oxidative Stress in Spaceflight-Induced Tissue Degeneration
NASA Technical Reports Server (NTRS)
Torres, Samantha M.; Schreurs, Ann-Sofie; Truong, Tiffany A.; Tahimic, Candice; Globus, Ruth
2017-01-01
Microgravity and ionizing radiation in the spaceflight environment poses multiple challenges to homeostasis and may contribute to cellular stress. Effects may include increased generation of reactive oxygen species (ROS), DNA damage and repair error, cell cycle arrest, cell senescence or death. Our central hypothesis is that prolonged exposure to the spaceflight environment leads to the excess production of ROS and oxidative damage, culminating in accelerated tissue degeneration. The main goal of this project is to determine the importance of cellular redox defense for physiological adaptations and tissue degeneration in the space environment.
Accelerated aging of phenolic-bonded flakeboards
Andrew J. Baker; Robert H. Gillespie
1978-01-01
Specimens of phenolic-bonded flakeboard, vertical-grain southern pine and Douglas-fir, and marine-grade Douglas-fir plywood were exposed to four accelerated aging situations. These consisted of: 1) Multiple cycles of boiling and elevated-temperature drying, 2) multiple cycles of vacuum- pressure soaking and intermediate-temperature drying, 3) the six-cycle ASTM D-1037...
Qi, Honggang; Wen, Bifeng; Wu, Qihang; Cheng, Wei; Lou, Jiangyong; Wei, Junjun; Huang, Jianjun; Yao, Xuping; Weng, Guobin
2018-06-01
Increasing evidence has indicated the important roles of long non-coding RNAs (lncRNAs) in tumorigenesis and cellular progression, including prostate cancer. In this study, we aim to investigate the expression level of SNHG7 and its biological functions on prostate cancer cells. Results indicated that SNHG7 expression was significantly up-regulated in prostate cancer tissue and cell lines. Besides, the overexpression of SNHG7 was closely correlated with the poor prognosis. In vitro and in vivo, experiments demonstrated that SNHG7 knockdown markedly inhibited prostate cancer proliferation and cycle-related protein (CDK4, CDK6, Cyclin D1), induced cell cycle arrest at G0/G1 phase and suppressed tumor growth. Moreover, miR-503 was predicted by bioinformatics tools and validated using luciferase reporter assay to both directly inhibited SNHG7 and Cyclin D1 expression by targeting their RNA 3'-UTR. In conclusion, results present that SNHG7 regulates the cycle progression and acts as an oncogenic gene in the prostate cancer tumorigenesis via miR-503/Cyclin D1 pathway, revealing the vital role of lncRNA/miRNA/mRNA axis in prostate cancer carcinogenesis. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srivastava, Janmejai K.; Department of Urology, University Hospitals of Cleveland, Cleveland, OH 44106; Gupta, Sanjay
2006-07-28
One of the requisite of cancer chemopreventive agent is elimination of damaged or malignant cells through cell cycle inhibition or induction of apoptosis without affecting normal cells. In this study, employing normal human prostate epithelial cells (PrEC), virally transformed normal human prostate epithelial cells (PZ-HPV-7), and human prostate cancer cells (LNCaP, DU145, and PC-3), we evaluated the growth-inhibitory and apoptotic effects of tocotrienol-rich fraction (TRF) extracted from palm oil. TRF treatment to PrEC and PZ-HPV-7 resulted in almost identical growth-inhibitory responses of low magnitude. In sharp contrast, TRF treatment resulted in significant decreases in cell viability and colony formation inmore » all three prostate cancer cell lines. The IC{sub 5} values after 24 h TRF treatment in LNCaP, PC-3, and DU145 cells were in the order 16.5, 17.5, and 22.0 {mu}g/ml. TRF treatment resulted in significant apoptosis in all the cell lines as evident from (i) DNA fragmentation (ii) fluorescence microscopy, and (iii) cell death detection ELISA, whereas the PrEC and PZ-HPV-7 cells did not undergo apoptosis, but showed modestly decreased cell viability only at a high dose of 80 {mu}g/ml. In cell cycle analysis, TRF (10-40 {mu}g/ml) resulted in a dose-dependent G0/G1 phase arrest and sub G1 accumulation in all three cancer cell lines but not in PZ-HPV-7 cells. These results suggest that the palm oil derivative TRF is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. TRF offers significant promise as a chemopreventive and/or therapeutic agent against prostate cancer.« less
NASA Astrophysics Data System (ADS)
Friesen, Alex; Horsthemke, Fabian; Mönnighoff, Xaver; Brunklaus, Gunther; Krafft, Roman; Börner, Markus; Risthaus, Tim; Winter, Martin; Schappacher, Falko M.
2016-12-01
The impact of cycling at low temperatures on the thermal and mechanical abuse behavior of commercial 18650-type lithium ion cells was compared to fresh cells. Post-mortem analyses revealed a deposition of high surface area lithium (HSAL) metal on the graphite surface accompanied by severe electrolyte decomposition. Heat wait search (HWS) tests in an accelerating rate calorimeter (ARC) were performed to investigate the thermal abuse behavior of aged and fresh cells under quasi-adiabatic conditions, showing a strong shift of the onset temperature for exothermic reactions. HSAL deposition promotes the reduction of the carbonate based electrolyte due to the high reactivity of lithium metal with high surface area, leading to a thermally induced decomposition of the electrolyte to produce volatile gaseous products. Nail penetration tests showed a change in the thermal runaway (TR) behavior affected by the decomposition reaction. This study indicates a greater thermal hazard for LIB cells at higher SOC and experiencing aging at low temperature.
A cell-free framework for rapid biosynthetic pathway prototyping and enzyme discovery.
Karim, Ashty S; Jewett, Michael C
2016-07-01
Speeding up design-build-test (DBT) cycles is a fundamental challenge facing biochemical engineering. To address this challenge, we report a new cell-free protein synthesis driven metabolic engineering (CFPS-ME) framework for rapid biosynthetic pathway prototyping. In our framework, cell-free cocktails for synthesizing target small molecules are assembled in a mix-and-match fashion from crude cell lysates either containing selectively enriched pathway enzymes from heterologous overexpression or directly producing pathway enzymes in lysates by CFPS. As a model, we apply our approach to n-butanol biosynthesis showing that Escherichia coli lysates support a highly active 17-step CoA-dependent n-butanol pathway in vitro. The elevated degree of flexibility in the cell-free environment allows us to manipulate physiochemical conditions, access enzymatic nodes, discover new enzymes, and prototype enzyme sets with linear DNA templates to study pathway performance. We anticipate that CFPS-ME will facilitate efforts to define, manipulate, and understand metabolic pathways for accelerated DBT cycles without the need to reengineer organisms. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Accelerated Thermal Cycling and Failure Mechanisms
NASA Technical Reports Server (NTRS)
Ghaffarian, R.
1999-01-01
This paper reviews the accelerated thermal cycling test methods that are currently used by industry to characterize the interconnect reliability of commercial-off-the-shelf (COTS) ball grid array (BGA) and chip scale package (CSP) assemblies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wei, Zhengxi, E-mail: weizhengxi@gmail.com; Song, Xiulong; Shaikh, Zahir A., E-mail: zshaikh@uri.edu
Cadmium (Cd) is a carcinogenic metal which is implicated in breast cancer by epidemiological studies. It is reported to promote breast cancer cell growth in vitro through membrane receptors. The study described here examined Cd-mediated growth of non-metastatic human breast cancer derived cells that lack receptors for estrogen, progesterone, and HER2. Treatment of triple-negative HCC 1937 cells with 0.1–0.5 μM Cd increased cell growth by activation of AKT and ERK. Accelerated cell cycle progression was achieved by increasing the levels of cyclins A, B, and E, as well as those of CDKs 1 and 2. Although triple negative cells lackmore » estrogen receptor, they express high levels of EGFR. Therefore, further studies on HCC 1937 and another triple-negative cell line, HCC 38, were conducted using specific siRNA and an inhibitor of EGFR to determine whether EGFR was responsible for mediating the effect of Cd. The results revealed that in both cell types EGFR was not only activated upon Cd treatment, but was also essential for the downstream activation of AKT and ERK. Based on these observations, it is concluded that, in breast cancer cells lacking estrogen receptor, sub-micromolar concentration of Cd can promote cell proliferation. Furthermore, that EGFR plays a critical role in this process. - Highlights: • Sub-micromolar concentrations of Cd promote cell growth in breast cancer cells that lack ER, PR, and HER2. • The increase in cell number is not due to reduction in apoptosis. • Growth promotion involves AKT and ERK signaling and downstream stimulation of cell cycle progression. • Initiation of cell growth by Cd occurs at the cell membrane and requires the activation of EGFR.« less
Noncoding RNPs of viral origin.
Steitz, Joan; Borah, Sumit; Cazalla, Demian; Fok, Victor; Lytle, Robin; Mitton-Fry, Rachel; Riley, Kasandra; Samji, Tasleem
2011-03-01
Like their host cells, many viruses produce noncoding (nc)RNAs. These show diversity with respect to time of expression during viral infection, length and structure, protein-binding partners and relative abundance compared with their host-cell counterparts. Viruses, with their limited genomic capacity, presumably evolve or acquire ncRNAs only if they selectively enhance the viral life cycle or assist the virus in combating the host's response to infection. Despite much effort, identifying the functions of viral ncRNAs has been extremely challenging. Recent technical advances and enhanced understanding of host-cell ncRNAs promise accelerated insights into the RNA warfare mounted by this fascinating class of RNPs.
Goldberg, V E; Polyakova, T Yu; Popova, N O; Vysotskaya, V V; Simolina, E I; Belevich, Yu V; Tuzikova, T P; Goldberg, A V; Zhdanov, V V; Miroshnichenko, L A; Udut, E V; Simanina, E V; Dygai, A M; Zyuz'kov, G N
2017-08-01
The toxic effects of combined cisplatin/docetaxel therapy cycles on erythroid and granulocytic hematopoietic lineages as well as their intercycle recovery were examined in patients with stage III-IV non-small-cell lung carcinoma. Responsiveness of the blood system to this therapy remained at a high level. Combined therapy pronouncedly activated the key elements of the erythroid and granulocytic hematopoietic lineages leading to accumulation of immature and mature myelokaryocytes in the bone marrow, enlargement of the medullary pool of mature neutrophils, and increase in the count of medullary erythroid and granulocytic precursor cells under conditions of their accelerated maturation.
Noncoding RNPs of Viral Origin
Steitz, Joan; Borah, Sumit; Cazalla, Demian; Fok, Victor; Lytle, Robin; Mitton-Fry, Rachel; Riley, Kasandra; Samji, Tasleem
2011-01-01
SUMMARY Like their host cells, many viruses produce noncoding (nc)RNAs. These show diversity with respect to time of expression during viral infection, length and structure, protein-binding partners and relative abundance compared with their host-cell counterparts. Viruses, with their limited genomic capacity, presumably evolve or acquire ncRNAs only if they selectively enhance the viral life cycle or assist the virus in combating the host’s response to infection. Despite much effort, identifying the functions of viral ncRNAs has been extremely challenging. Recent technical advances and enhanced understanding of host-cell ncRNAs promise accelerated insights into the RNA warfare mounted by this fascinating class of RNPs. PMID:20719877
Li, Zhenhui; Luo, Qingbin; Xu, Haiping; Zheng, Ming; Abdalla, Bahareldin Ali; Feng, Min; Cai, Bolin; Zhang, Xiaocui; Nie, Qinghua; Zhang, Xiquan
2017-01-01
Avian leukosis virus subgroup J (ALV-J) is an oncogenic retrovirus that has a similar replication cycle to multiple viruses and therefore can be used as a model system for viral entry into host cells. However, there are few reports on the genes or microRNAs (miRNAs) that are responsible for the replication of ALV-J. Our previous miRNA and RNA sequencing data showed that the expression of miR-34b-5p was significantly upregulated in ALV-J-infected chicken spleens compared to non-infected chicken spleens, but melanoma differentiation-associated gene 5 (MDA5) had the opposite expression pattern. In this study, a dual-luciferase reporter assay showed that MDA5 is a direct target of miR-34b-5p. In vitro, overexpression of miR-34b-5p accelerated the proliferation of ALV-J-infected cells by inducing the progression from G2 to S phase and it promoted cell migration. Ectopic expression of MDA5 inhibited ALV-J-infected cell proliferation, the cell cycle and cell migration, and knockdown of MDA5 promoted proliferation, the cell cycle and migration. In addition, during ALV-J infections, MDA5 can detect virus invasion and it triggers the MDA5 signaling pathway. MDA5 overexpression can activate the MDA5 signaling pathway, and thus it can inhibit the mRNA and protein expression of the ALV-J env gene and it can suppress virion secretion. In contrast, in response to the knockdown of MDA5 by small interfering RNA (siRNA) or an miR-34b-5p mimic, genes in the MDA5 signaling pathway were significantly downregulated (P < 0.05), but the mRNA and protein expression of ALV-J env and the sample-to-positive ratio of virion in the supernatants were increased. This indicates that miR-34b-5p is able to trigger the MDA5 signaling pathway and affect ALV-J infections. Together, these results suggest that miR-34b-5p targets MDA5 to accelerate the proliferation and migration of ALV-J-infected cells, and it promotes ALV-J replication, via the MDA5 signaling pathway. PMID:28194372
Li, Zhenhui; Luo, Qingbin; Xu, Haiping; Zheng, Ming; Abdalla, Bahareldin Ali; Feng, Min; Cai, Bolin; Zhang, Xiaocui; Nie, Qinghua; Zhang, Xiquan
2017-01-01
Avian leukosis virus subgroup J (ALV-J) is an oncogenic retrovirus that has a similar replication cycle to multiple viruses and therefore can be used as a model system for viral entry into host cells. However, there are few reports on the genes or microRNAs (miRNAs) that are responsible for the replication of ALV-J. Our previous miRNA and RNA sequencing data showed that the expression of miR-34b-5p was significantly upregulated in ALV-J-infected chicken spleens compared to non-infected chicken spleens, but melanoma differentiation-associated gene 5 ( MDA5 ) had the opposite expression pattern. In this study, a dual-luciferase reporter assay showed that MDA5 is a direct target of miR-34b-5p. In vitro , overexpression of miR-34b-5p accelerated the proliferation of ALV-J-infected cells by inducing the progression from G2 to S phase and it promoted cell migration. Ectopic expression of MDA5 inhibited ALV-J-infected cell proliferation, the cell cycle and cell migration, and knockdown of MDA5 promoted proliferation, the cell cycle and migration. In addition, during ALV-J infections, MDA5 can detect virus invasion and it triggers the MDA5 signaling pathway. MDA5 overexpression can activate the MDA5 signaling pathway, and thus it can inhibit the mRNA and protein expression of the ALV-J env gene and it can suppress virion secretion. In contrast, in response to the knockdown of MDA5 by small interfering RNA (siRNA) or an miR-34b-5p mimic, genes in the MDA5 signaling pathway were significantly downregulated ( P < 0.05), but the mRNA and protein expression of ALV-J env and the sample-to-positive ratio of virion in the supernatants were increased. This indicates that miR-34b-5p is able to trigger the MDA5 signaling pathway and affect ALV-J infections. Together, these results suggest that miR-34b-5p targets MDA5 to accelerate the proliferation and migration of ALV-J-infected cells, and it promotes ALV-J replication, via the MDA5 signaling pathway.
Valero, María Ll; Mello de Queiroz, Fernanda; Stühmer, Walter; Viana, Félix; Pardo, Luis A
2012-01-01
Overexpression of the cation-permeable channel TRPM8 in prostate cancers might represent a novel opportunity for their treatment. Inhibitors of TRPM8 reduce the growth of prostate cancer cells. We have used two recently described and highly specific blockers, AMTB and JNJ41876666, and RNAi to determine the relevance of TRPM8 expression in the proliferation of non-tumor and tumor cells. Inhibition of the expression or function of the channel reduces proliferation rates and proliferative fraction in all tumor cells tested, but not of non-tumor prostate cells. We observed no consistent acceleration of growth after stimulation of the channel with menthol or icilin, indicating that basal TRPM8 expression is enough to sustain growth of prostate cancer cells.
TOFA suppresses ovarian cancer cell growth in vitro and in vivo.
Li, Shu; Qiu, Lihua; Wu, Buchu; Shen, Haoran; Zhu, Jing; Zhou, Liang; Gu, Liying; Di, Wen
2013-08-01
A characteristic feature of cancer cells is the activation of de novo fatty acid synthesis. Acetyl‑CoA carboxylase (ACC) is a key enzyme in fatty acid synthesis, accelerating the reaction that carboxylates cytosolic acetyl‑CoA to form malonyl‑CoA. ACC is highly expressed in several types of human cancer and is important in breast and prostate cancer cell growth. The aim of the present study was to investigate the effects of 5‑tetradecyloxy‑2‑furoic acid (TOFA), an allosteric inhibitor of ACC, on the proliferation and cell cycle progression of the ovarian cancer cell lines COC1 and COC1/DDP. TOFA was found to be cytotoxic to COC1 and COC1/DDP cells with a 50% inhibitory concentration (IC50) of ~26.1 and 11.6 µg/ml, respectively. TOFA inhibited the proliferation of the cancer cells examined in a time‑ and dose‑dependent manner, arrested the cells in the G0/G1 cell cycle phase and induced apoptosis. The expression of the cell cycle regulating proteins cyclin D1 and cyclin-dependent kinase (CDK) 4, as well as the expression of the apoptosis‑related proteins caspase‑3 and Bcl‑2, were detected by western blot analysis. Cyclin D1, CDK4 and Bcl‑2 protein expression was inhibited by TOFA, while caspase‑3 was cleaved and activated. To the best of our knowledge, the present study demonstrated for the first time that TOFA inhibits COC1/DDP cell growth in ovarian tumor mouse xenografts. By inhibiting ACC, TOFA may be a promising small molecule agent for ovarian cancer therapy.
Qiu, Weiming; Lei, Mingxing; Zhou, Ling; Bai, Xiufeng; Lai, Xiangdong; Yu, Yu; Yang, Tian; Lian, Xiaohua
2017-06-01
Regeneration of hair follicles relies on activation of hair follicle stem cells during telogen to anagen transition process in hair cycle. This process is rigorously controlled by intrinsic and environmental factors. 12-o-tetradecanoylphorbol-13-acetate (TPA), a tumor promoter, accelerates reentry of hair follicles into anagen phase. However, it is unclear that how TPA promotes the hair regeneration. In the present study, we topically applied TPA onto the dorsal skin of 2-month-old C57BL/6 female mice to examine the activity of hair follicle stem cells and alteration of signaling pathways during hair regeneration. We found that refractory telogen hair follicles entered anagen prematurely after TPA treatment, with the enhanced proliferation of CD34-positive hair follicle stem cells. Meanwhile, we observed Akt signaling was activated in epidermis, hair infundibulum, bulge and hair bulb, and Wnt signaling was also activated after hair follicle stem cells proliferation. Importantly, after overexpression of DKK1, a specific Wnt signaling inhibitor, the accelerated reentry of hair follicles into anagen induced by TPA was abolished. Our data indicated that TPA-induced hair follicle regeneration is associated with activation of Akt and Wnt/β-catenin signaling.
Effects of external pressure on the performance and ageing of single-layer lithium-ion pouch cells
NASA Astrophysics Data System (ADS)
Mussa, Abdilbari Shifa; Klett, Matilda; Lindbergh, Göran; Lindström, Rakel Wreland
2018-05-01
The effects of external compression on the performance and ageing of NMC(1/3)/Graphite single-layer Li-ion pouch cells are investigated using a spring-loaded fixture. The influence of pressure (0.66, 0.99, 1.32, and 1.98 MPa) on impedance is characterized in fresh cells that are subsequently cycled at the given pressure levels. The aged cells are analyzed for capacity fade and impedance rise at the cell and electrode level. The effect of pressure distribution that may occur in large-format cells or in a battery pack is simulated using parallel connected cells. The results show that the kinetic and mass transport resistance increases with pressure in a fresh cell. An optimum pressure around 1.3 MPa is shown to be beneficial to reduce cyclable-lithium loss during cycling. The minor active mass losses observed in the electrodes are independent of the ageing pressure, whereas ageing pressure affects the charge transfer resistance of both NMC and graphite electrodes and the ohmic resistance of the cell. Pressure distribution induces current distribution but the enhanced current throughput at lower pressures cell does not accelerate its ageing. Conclusions from this work can explain some of the discrepancies in non-uniform ageing reported in the literature and indicate coupling between electrochemistry and mechanics.
Accelerated and real-time geosynchronous life cycling test performance of nickel-hydrogen batteries
NASA Technical Reports Server (NTRS)
Green, R. S.
1985-01-01
RCA Astro-Electronics currently has four nickel-hydrogen storage battery modules (11 cells each) on test in simulated geosynchronous life cycle regimes. These battery modules are of identical design to those used on the GSTAR (GTE Satellite Corp.) and Spacenet (GTE Spacenet Corp.) communications satellites. The batteries are being tested using an automated test station equipped with computer-controlled environmental chambers and recording equipment. The two battery types, 30 ampere-hours and 40 ampere-hours (GSTAR and Spacenet, respectively), are being electrically cycled using identical 44-day eclipse sequences at 5 C and vary with respect to depth of discharge, recharge ratio, duration of accumulated suntime, and the use of a reconditioning sequence. The test parameters are outlined and the preliminary test data and results are presented.
Adhesive Bonding and Corrosion Protection of a Die Cast Magnesium Automotive Door
NASA Astrophysics Data System (ADS)
Bretz, G. T.; Lazarz, K. A.; Hill, D. J.; Blanchard, P. J.
It is well known that magnesium alloys, in close proximity to other alloys, are susceptible to galvanic corrosion. Combined with this fact, in automotive applications, it is rare that magnesium will be present in the absence of other alloys such as steel or aluminum. Therefore, in wet applications, where the galvanic cell is completed, it is necessary to isolate the magnesium in order to prevent accelerated corrosion. There are numerous commercial pre-treatments available for magnesium, however this paper focuses on conversion coatings in conjunction with a spray powder coat. By means of example, results for a hem flange joint on an AM50 die cast magnesium door structure will be presented. The outer door skin is an aluminum alloy hemmed around a cast magnesium flange. An adhesive is used between the inner and outer to help with stiffness and NVH (Noise, Vibration and Harshness). Results from bonded lap-shear coupon tests that have been exposed to accelerated corrosion cycles are presented. A second phase of this work considered a surrogate hem flange coupon, which was similarly exposed to the same accelerated corrosion cycle. Results from both of these tests are presented within this paper along with a discussion as to their suitability for use within automotive applications.
Design Challenges of a Rapid Cycling Synchrotron for Carbon/Proton Therapy
NASA Astrophysics Data System (ADS)
Cook, Nathan
2012-03-01
The growing interest in radiation therapy with protons and light ions has driven demand for new methods of ion acceleration and the delivery of ion beams. One exciting new platform for ion beam acceleration and delivery is the rapid cycling synchrotron. Operating at 15Hz, rapid cycling achieves faster treatment times by making beam extraction possible at any energy during the cycle. Moreover, risk to the patient is reduced by requiring fewer particles in the beam line at a given time, thus eliminating the need for passive filtering and reducing the consequences of a malfunction. Lastly, the ability to switch between carbon ion and proton beam therapy provides the machine with an unmatched flexibility. However, these features do stipulate challenges in accelerator design. Maintaining a compact lattice requires careful tuning of lattice functions, tight focusing combined function magnets, and fast injection and extraction systems. Providing the necessary acceleration over a short cycle time also necessitates a five-fold frequency swing for carbon ions, further burdening the design requirements of ferrite-driven radiofrequency cavities. We will consider these challenges as well as some solutions selected for our current design.
Suo, Liye; Sundberg, John P; Everts, Helen B
2015-05-01
Alopecia areata (AA) is an autoimmune hair loss disease caused by a cell-mediated immune attack of the lower portion of the cycling hair follicle. Feeding mice 3-7 times the recommended level of dietary vitamin A accelerated the progression of AA in the graft-induced C3H/HeJ mouse model of AA. In this study, we also found that dietary vitamin A, in a dose dependent manner, activated the hair follicle stem cells (SCs) to induce the development and growth phase of the hair cycle (anagen), which may have made the hair follicle more susceptible to autoimmune attack. Our purpose here is to determine the mechanism by which dietary vitamin A regulates the hair cycle. We found that vitamin A in a dose-dependent manner increased nuclear localized beta-catenin (CTNNB1; a marker of canonical wingless-type Mouse Mammary Tumor Virus integration site family (WNT) signaling) and levels of WNT7A within the hair follicle bulge in these C3H/HeJ mice. These findings suggest that feeding mice high levels of dietary vitamin A increases WNT signaling to activate hair follicle SCs. © 2014 by the Society for Experimental Biology and Medicine.
Mechanisms of taste bud cell loss after head and neck irradiation.
Nguyen, Ha M; Reyland, Mary E; Barlow, Linda A
2012-03-07
Taste loss in human patients following radiotherapy for head and neck cancer is a common and significant problem, but the cellular mechanisms underlying this loss are not understood. Taste stimuli are transduced by receptor cells within taste buds, and like epidermal cells, taste cells are regularly replaced throughout adult life. This renewal relies on progenitor cells adjacent to taste buds, which continually supply new cells to each bud. Here we treated adult mice with a single 8 Gy dose of x-ray irradiation to the head and neck, and analyzed taste epithelium at 1-21 d postirradiation (dpi). We found irradiation targets the taste progenitor cells, which undergo cell cycle arrest (1-3 dpi) and apoptosis (within 1 dpi). Taste progenitors resume proliferation at 5-7 dpi, with the proportion of cells in S and M phase exceeding control levels at 5-6 and 6 dpi, respectively, suggesting that proliferation is accelerated and/or synchronized following radiation damage. Using 5-bromo-2-deoxyuridine birthdating to identify newborn cells, we found that the decreased proliferation following irradiation reduces the influx of cells at 1-2 dpi, while the robust proliferation detected at 6 dpi accelerates entry of new cells into taste buds. In contrast, the number of differentiated taste cells was not significantly reduced until 7 dpi. These data suggest a model where continued natural taste cell death, paired with temporary interruption of cell replacement, underlies taste loss after irradiation.
Mechanisms of taste bud cell loss after head and neck irradiation
Nguyen, Ha M.; Reyland, Mary E.; Barlow, Linda A.
2012-01-01
Taste loss in human patients following radiotherapy for head and neck cancer is a common and significant problem, but the cellular mechanisms underlying this loss are not understood. Taste stimuli are transduced by receptor cells within taste buds, and like epidermal cells, taste cells are regularly replaced throughout adult life. This renewal relies on a progenitor cells adjacent to taste buds, which continually supply new cells to each bud. Here we treated adult mice with a single 8 Gy dose of X-ray irradiation to the head and neck, and analyzed taste epithelium at 1–21 days post-irradiation (dpi). We found irradiation targets the taste progenitor cells, which undergo cell cycle arrest (1–3 dpi) and apoptosis (within 1 dpi). Taste progenitors resume proliferation at 5–7 dpi, with the proportion of cells in S and M phase exceeding control levels at 5–6 and 6 dpi, respectively, suggesting that proliferation is accelerated and/or synchronized following radiation damage. Using BrdU birthdating to identify newborn cells, we found that the decreased proliferation following irradiation reduces the influx of cells at 1–2 dpi, while the robust proliferation detected at 6 dpi accelerates entry of new cells into taste buds. By contrast, the number of differentiated taste cells was not significantly reduced until 7 dpi. These data suggest a model where continued natural taste cell death, paired with temporary interruption of cell replacement underlies taste loss after irradiation. PMID:22399770
Lehmann, Christian; Friess, Thomas; Birzele, Fabian; Kiialainen, Anna; Dangl, Markus
2016-06-28
Venetoclax, a small molecule BH3 mimetic which inhibits the anti-apoptotic protein Bcl-2, and idasanutlin, a selective MDM2 antagonist, have both shown activity as single-agent treatments in pre-clinical and clinical studies in acute myeloid leukemia (AML). In this study, we deliver the rationale and molecular basis for the combination of idasanutlin and venetoclax for treatment of p53 wild-type AML. The effect of idasanutlin and venetoclax combination on cell viability, apoptosis, and cell cycle progression was investigated in vitro using established AML cell lines. In vivo efficacy was demonstrated in subcutaneous and orthotopic xenograft models generated in female nude or non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice. Mode-of-action analyses were performed by means of cell cycle kinetic studies, RNA sequencing as well as western blotting experiments. Combination treatment with venetoclax and idasanutlin results in synergistic anti-tumor activity compared with the respective single-agent treatments in vitro, in p53 wild-type AML cell lines, and leads to strongly superior efficacy in vivo, in subcutaneous and orthotopic AML models. The inhibitory effects of idasanutlin were cell-cycle dependent, with cells arresting in G1 in consecutive cycles and the induction of apoptosis only evident after cells had gone through at least two cell cycles. Combination treatment with venetoclax removed this dependency, resulting in an acceleration of cell death kinetics. As expected, gene expression studies using RNA sequencing showed significant alterations to pathways associated with p53 signaling and cell cycle arrest (CCND1 pathway) in response to idasanutlin treatment. Only few gene expression changes were observed for venetoclax treatment and combination treatment, indicating that their effects are mediated mainly at the post-transcriptional level. Protein expression studies demonstrated that inhibition of the anti-apoptotic protein Mcl-1 contributed to the activity of venetoclax and idasanutlin, with earlier inhibition of Mcl-1 in response to combination treatment contributing to the superior combined activity. The role of Mcl-1 was confirmed by small hairpin RNA gene knockdown studies. Our findings provide functional and molecular insight on the superior anti-tumor activity of combined idasanutlin and venetoclax treatment in AML and support its further exploration in clinical studies.
The Nucleosome Remodeling and Deacetylase (NuRD) Complex in Development and Disease
Basta, Jeannine; Rauchman, Michael
2014-01-01
The Nucleosome Remodeling and Deacetylase (NuRD) complex is one of the major chromatin remodeling complexes found in cells. It plays an important role in regulating gene transcription, genome integrity and cell cycle progression. Through its impact on these basic cellular processes, increasing evidence indicates that alterations in the activity of this macromolecular complex can lead to developmental defects, oncogenesis and accelerated ageing. Recent genetic and biochemical studies have elucidated the mechanisms of NuRD action in modifying the chromatin landscape. These advances have the potential to lead to new therapeutic approaches to birth defects and cancer. PMID:24880148
Sensory role of actin in auxin-dependent responses of tobacco BY-2.
Huang, Xiang; Maisch, Jan; Nick, Peter
2017-11-01
Polar auxin transport depends on the polar localization of auxin-efflux carriers. The cycling of these carriers between cell interior and plasma membrane depends on actin. The dynamic of actin not only affects auxin transport, but also changes the auxin-responsiveness. To study the potential link between auxin responsiveness and actin dynamics, we investigated developmental responses of the non-transformed BY-2 (Nicotiana tabacum L. cv Bright Yellow 2) cell line and the transgenic BY-2 strain GF11 (stably transformed BY-2 cells with a GFP-fimbrin actin-binding domain 2 construct). The developmental process was divided into three distinct stages: cell cycling, cell elongation and file disintegration. Several phenotypes were measured to monitor the cellular responses to different concentrations of exogenous natural auxin (Indole-3-acetic acid, IAA). We found that auxin stimulated and prolonged the mitotic activity, and delayed the exit from the proliferation phase. However, both responses were suppressed in the GF11 line. At the stationary phase of the cultivation cycle, auxin strongly accelerated the cell file disintegration. Interestingly, it was not suppressed but progressed to a more complete disintegration in the GF11 line. During the cultivation cycle, we also followed the organization of actin in the GF11 line and did not detect any significant difference in actin organization from untreated control or exogenous IAA treatment. Therefore, our findings indicate that the specific differences observed in the GF11 line must be linked with a function of actin that is not structural. It means that there is a sensory role of actin for auxin signaling. Copyright © 2017 Elsevier GmbH. All rights reserved.
The Biological Role of Nestin(+)-Cells in Physiological and Pathological Cardiovascular Remodeling
Calderone, Angelino
2018-01-01
The intermediate filament protein nestin was identified in diverse populations of cells implicated in cardiovascular remodeling. Cardiac resident neural progenitor/stem cells constitutively express nestin and following an ischemic insult migrate to the infarct region and participate in angiogenesis and neurogenesis. A modest number of normal adult ventricular fibroblasts express nestin and the intermediate filament protein is upregulated during the progression of reparative and reactive fibrosis. Nestin depletion attenuates cell cycle re-entry suggesting that increased expression of the intermediate filament protein in ventricular fibroblasts may represent an activated phenotype accelerating the biological impact during fibrosis. Nestin immunoreactivity is absent in normal adult rodent ventricular cardiomyocytes. Following ischemic damage, the intermediate filament protein is induced in a modest population of pre-existing adult ventricular cardiomyocytes bordering the peri-infarct/infarct region and nestin(+)-ventricular cardiomyocytes were identified in the infarcted human heart. The appearance of nestin(+)-ventricular cardiomyocytes post-myocardial infarction (MI) recapitulates an embryonic phenotype and depletion of the intermediate filament protein inhibits cell cycle re-entry. Recruitment of the serine/threonine kinase p38 MAPK secondary to an overt inflammatory response after an ischemic insult may represent a seminal event limiting the appearance of nestin(+)-ventricular cardiomyocytes and concomitantly suppressing cell cycle re-entry. Endothelial and vascular smooth muscle cells (VSMCs) express nestin and upregulation of the intermediate filament protein may directly contribute to vascular remodeling. This review will highlight the biological role of nestin(+)-cells during physiological and pathological remodeling of the heart and vasculature and discuss the phenotypic advantage attributed to the intermediate filament protein. PMID:29492403
CdS thin film solar cells for terrestrial power
NASA Technical Reports Server (NTRS)
Shirland, F. A.
1975-01-01
The development of very low cost long lived Cu2S/CdS thin film solar cells for large scale energy conversion is reported. Excellent evaporated metal grid patterns were obtained using a specially designed aperture mask. Vacuum evaporated gold and copper grids of 50 lines per inch and 1 micron thickness were adequate electrically for the fine mesh contacting grid. Real time roof top sunlight exposure tests of encapsulated CdS cells showed no loss in output after 5 months. Accelerated life testing of encapsulated cells showed no loss of output power after 6 months of 12 hour dark-12 hour AMI illumination cycles at 40 C, 60 C, 80 C and 100 C temperatures. However, the cells changed their basic parameters, such as series and shunt resistance and junction capacitance.
NASA Astrophysics Data System (ADS)
Chhina, H.; Campbell, S.; Kesler, O.
The oxidation of carbon catalyst supports to carbon dioxide gas leads to degradation in catalyst performance over time in proton exchange membrane fuel cells (PEMFCs). The electrochemical stability of Pt supported on tungsten carbide has been evaluated on a carbon-based gas diffusion layer (GDL) at 80 °C and compared to that of HiSpec 4000™ Pt/Vulcan XC-72R in 0.5 M H 2SO 4. Due to other electrochemical processes occurring on the GDL, detailed studies were also performed on a gold mesh substrate. The oxygen reduction reaction (ORR) activity was measured both before and after accelerated oxidation cycles between +0.6 V and +1.8 V vs. RHE. Tafel plots show that the ORR activity remained high even after accelerated oxidation tests for Pt/tungsten carbide, while the ORR activity was extremely poor after accelerated oxidation tests for HiSpec 4000™. In order to make high surface area tungsten carbide, three synthesis routes were investigated. Magnetron sputtering of tungsten on carbon was found to be the most promising route, but needs further optimization.
Towne, Danli L; Nicholl, Emily E; Comess, Kenneth M; Galasinski, Scott C; Hajduk, Philip J; Abraham, Vivek C
2012-09-01
Efficient elucidation of the biological mechanism of action of novel compounds remains a major bottleneck in the drug discovery process. To address this need in the area of oncology, we report the development of a multiparametric high-content screening assay panel at the level of single cells to dramatically accelerate understanding the mechanism of action of cell growth-inhibiting compounds on a large scale. Our approach is based on measuring 10 established end points associated with mitochondrial apoptosis, cell cycle disruption, DNA damage, and cellular morphological changes in the same experiment, across three multiparametric assays. The data from all of the measurements taken together are expected to help increase our current understanding of target protein functions, constrain the list of possible targets for compounds identified using phenotypic screens, and identify off-target effects. We have also developed novel data visualization and phenotypic classification approaches for detailed interpretation of individual compound effects and navigation of large collections of multiparametric cellular responses. We expect this general approach to be valuable for drug discovery across multiple therapeutic areas.
Dynamics of temporal variations in phonatory flow.
Krane, Michael H; Barry, Michael; Wei, Timothy
2010-07-01
This paper addresses the dynamic relevance of time variations of phonatory airflow, commonly neglected under the quasisteady phonatory flow assumption. In contrast to previous efforts, which relied on direct measurement of glottal impedance, this work uses spatially and temporally resolved measurements of the velocity field to estimate the unsteady and convective acceleration terms in the unsteady Bernoulli equation. Theoretical considerations suggest that phonatory flow is inherently unsteady when two related conditions apply: (1) that the unsteady and convective accelerations are commensurate, and (2) that the inertia of the glottal jet is non-negligible. Acceleration waveforms, computed from experimental data, show that unsteady and convective accelerations to be the same order of magnitude, throughout the cycle, and that the jet flow contributes significantly to the unsteady acceleration. In the middle of the cycle, however, jet inertia is negligible because the convective and unsteady accelerations nearly offset one another in the jet region. These results, consistent with previous findings treating quasisteady phonatory flow, emphasize that unsteady acceleration cannot be neglected during the final stages of the phonation cycle, during which voice sound power and spectral content are largely determined. Furthermore, glottal jet dynamics must be included in any model of phonatory airflow.
Dynamics of temporal variations in phonatory flow1
Krane, Michael H.; Barry, Michael; Wei, Timothy
2010-01-01
This paper addresses the dynamic relevance of time variations of phonatory airflow, commonly neglected under the quasisteady phonatory flow assumption. In contrast to previous efforts, which relied on direct measurement of glottal impedance, this work uses spatially and temporally resolved measurements of the velocity field to estimate the unsteady and convective acceleration terms in the unsteady Bernoulli equation. Theoretical considerations suggest that phonatory flow is inherently unsteady when two related conditions apply: (1) that the unsteady and convective accelerations are commensurate, and (2) that the inertia of the glottal jet is non-negligible. Acceleration waveforms, computed from experimental data, show that unsteady and convective accelerations to be the same order of magnitude, throughout the cycle, and that the jet flow contributes significantly to the unsteady acceleration. In the middle of the cycle, however, jet inertia is negligible because the convective and unsteady accelerations nearly offset one another in the jet region. These results, consistent with previous findings treating quasisteady phonatory flow, emphasize that unsteady acceleration cannot be neglected during the final stages of the phonation cycle, during which voice sound power and spectral content are largely determined. Furthermore, glottal jet dynamics must be included in any model of phonatory airflow. PMID:20649231
NASA Astrophysics Data System (ADS)
Watanabe, Shoichiro; Kinoshita, Masahiro; Hosokawa, Takashi; Morigaki, Kenichi; Nakura, Kensuke
2014-08-01
Cycle performance of a LiAl0.10Ni0.76Co0.14O2 (NCA) cathode/graphite cell closely depended on the range of depth of discharge in charge-discharge processes (ΔDOD). When ΔDOD was 10-70%, cycle performance at 25 °C was maintained even at 60 °C. Deterioration phenomena were analyzed by electrochemical method, X-ray photoelectron spectroscopy (XPS), X-ray diffractometry (XRD), and micro-cracks in NCA particles were analyzed with cross-sectional views by scanning electron microscopy (SEM). Many micro-cracks were observed only after a 0-100% DOD region cycle test. Cycle tests in several restricted ΔDOD conditions showed that the deterioration was closely related to not the upper and lower limits of DOD or operation voltage but the width of ΔDOD.
Effects of carbon-ion beams on human pancreatic cancer cell lines that differ in genetic status.
Matsui, Yoshifumi; Asano, Takehide; Kenmochi, Takashi; Iwakawa, Mayumi; Imai, Takashi; Ochiai, Takenori
2004-02-01
The relative biologic effectiveness (RBE) of carbon-ion beams at 3 different linear energy transfer (LET) values (13, 50, and 80 keV/microm) accelerated by the Heavy Ion Medical Accelerator in Chiba on human pancreatic cancer cell lines differing in genetic status was determined. The RBE values were calculated as D10, the dose (Gy) required to reduce the surviving fraction to 10%, relative to X-rays. We also investigated apoptosis and the relationship between D10 and the cell cycle checkpoint using morphologic examination and flow cytometry analysis, respectively. The RBE values calculated by the D10 values ranged from 1.16 to 1.77 for the 13-keV/microm beam and from 1.83 to 2.46 for the 80-keV/microm beam. A correlation between the D10 values of each cell line and intensity of G2/M arrest was observed. In contrast, LET values did not clearly correlate with induction of apoptosis. These results suggest that carbon-ion beam therapy is a promising modality. Elucidation of the mechanisms of G2/M arrest and apoptosis may provide clues to enhancing the effects of radiation on pancreatic cancer.
Brandi, Jessica; Dando, Ilaria; Pozza, Elisa Dalla; Biondani, Giulia; Jenkins, Rosalind; Elliott, Victoria; Park, Kevin; Fanelli, Giuseppina; Zolla, Lello; Costello, Eithne; Scarpa, Aldo; Cecconi, Daniela; Palmieri, Marta
2017-01-06
Recently, we have shown that the secretome of pancreatic cancer stem cells (CSCs) is characterized by proteins that participate in cancer differentiation, invasion, and metastasis. However, the differentially expressed intracellular proteins that lead to the specific characteristics of pancreatic CSCs have not yet been identified, and as a consequence the deranged metabolic pathways are yet to be elucidated. To identify the modulated proteins of pancreatic CSCs, iTRAQ-based proteomic analysis was performed to compare the proteome of Panc1 CSCs and Panc1 parental cells, identifying 230 modulated proteins. Pathway analysis revealed activation of glycolysis, the pentose phosphate pathway, the pyruvate-malate cycle, and lipid metabolism as well as downregulation of the Krebs cycle, the splicesome and non-homologous end joining. These findings were supported by metabolomics and immunoblotting analysis. It was also found that inhibition of fatty acid synthase by cerulenin and of mevalonate pathways by atorvastatin have a greater anti-proliferative effect on cancer stem cells than parental cells. Taken together, these results clarify some important aspects of the metabolic network signature of pancreatic cancer stem cells, shedding light on key and novel therapeutic targets and suggesting that fatty acid synthesis and mevalonate pathways play a key role in ensuring their viability. To better understand the altered metabolic pathways of pancreatic cancer stem cells (CSCs), a comprehensive proteomic analysis and metabolite profiling investigation of Panc1 and Panc1 CSCs were carried out. The findings obtained indicate that Panc1 CSCs are characterized by upregulation of glycolysis, pentose phosphate pathway, pyruvate-malate cycle, and lipid metabolism and by downregulation of Krebs cycle, spliceosome and non-homologous end joining. Moreover, fatty acid synthesis and mevalonate pathways are shown to play a critical contribution to the survival of pancreatic cancer stem cells. This study is helpful for broadening the knowledge of pancreatic cancer stem cells and could accelerate the development of novel therapeutic strategies. Copyright © 2016 Elsevier B.V. All rights reserved.
Carrier-Envelope Phase Effects in Plasma-Based Electron Acceleration with Few-Cycle Laser Pulses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nerush, E. N.; Kostyukov, I. Yu.
2009-07-17
Carrier-envelope phase effects during the interaction of relativistically intense few-cycle laser pulses with a plasma are studied in the 'bubble' regime when an electron cavity (bubble) is formed behind the pulse. We show that for few-cycle laser pulses the cavity shape becomes asymmetric and depends strongly on the carrier-envelope phase. The carrier-envelope phase varies when the laser pulse propagates in plasma, which causes transverse oscillations of the cavity. Furthermore, the beam of electrons trapped by the cavity becomes modulated in the polarization plane. To describe these effects we derive an analytical model extended beyond the ponderomotive approximation. The degree ofmore » plasma cavity asymmetry as a function of the laser-plasma parameters is calculated. The obtained results are verified by particle-in-cell simulations.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-20
... DEPARTMENT OF JUSTICE Antitrust Division Notice Pursuant to the National Cooperative Research and Production Act of 1993--Cooperative Research Group on Diesel Aftertreatment Accelerated Aging Cycles--Heavy... Institute-- Cooperative Research Group on Diesel Aftertreatment Accelerated Aging Cycles--Heavy-Duty...
Study of the damage evolution function of tin silver copper in cycling
NASA Astrophysics Data System (ADS)
Qasaimeh, Awni
The present research focused on the assessment of solder joint fatigue life in microelectronics assemblies. A general concern of any reliability engineer is whether accelerated tests are relevant to field conditions. The risk of this was minimized by developing an approach to reduce the duration of an accelerated thermal cycling test, thus allowing for the use of less accelerated test conditions. For this purpose the conventional dye and pry technique was improved and used together with artificial neural networks to measure and characterize very early stages of crack growth. The same work also demonstrated a quantitative link between thermal cycling induced recrystallization and a strong acceleration of the subsequent fatigue crack growth and failure. A new study was conducted in which different combinations of annealing and isothermal cycling provided a systematic characterization of the effects of a range of individual parameters on the recrystallization. Experiments showed the ongoing coarsening of secondary precipitates to have a clear effect on recrystallization. The rate of recrystallization was also shown not to scale with the inelastic energy deposition. This means that the most popular current thermal cycling model cannot apply to SnAgCu solder joints. Recrystallization of the Sn grains is usually not the rate limiting mechanism in isothermal cycling. The crack initiation stage often takes up a much greater fraction of the overall life, and the eventual failure of BGA joints tends to involve transgranular crack growth instead. Cycling of individual solder joints allowed for monitoring of the evolution of the solder properties and the rate of inelastic energy deposition. Both the number of cycles to crack initiation and the subsequent number of cycles to failure were shown to be determined by the inelastic energy deposition. This provides for a simple model for the extrapolation of accelerated test results to the much milder cycling amplitudes characteristic of long term service conditions based on conventional Finite Element Modeling. It also offers a critical basis for the ongoing development of a practical model to account for the often dramatic break-down of Miner's rule of linear damage accumulation under variable cycling amplitudes as expected in realistic applications.
Prospects for Accelerator Technology
NASA Astrophysics Data System (ADS)
Todd, Alan
2011-02-01
Accelerator technology today is a greater than US$5 billion per annum business. Development of higher-performance technology with improved reliability that delivers reduced system size and life cycle cost is expected to significantly increase the total accelerator technology market and open up new application sales. Potential future directions are identified and pitfalls in new market penetration are considered. Both of the present big market segments, medical radiation therapy units and semiconductor ion implanters, are approaching the "maturity" phase of their product cycles, where incremental development rather than paradigm shifts is the norm, but they should continue to dominate commercial sales for some time. It is anticipated that large discovery-science accelerators will continue to provide a specialty market beset by the unpredictable cycles resulting from the scale of the projects themselves, coupled with external political and economic drivers. Although fraught with differing market entry difficulties, the security and environmental markets, together with new, as yet unrealized, industrial material processing applications, are expected to provide the bulk of future commercial accelerator technology growth.
NASA Astrophysics Data System (ADS)
Hardikar, Kedar Y.; Liu, Bill J. J.; Bheemreddy, Venkata
2016-09-01
Gaining an understanding of degradation mechanisms and their characterization are critical in developing relevant accelerated tests to ensure PV module performance warranty over a typical lifetime of 25 years. As newer technologies are adapted for PV, including new PV cell technologies, new packaging materials, and newer product designs, the availability of field data over extended periods of time for product performance assessment cannot be expected within the typical timeframe for business decisions. In this work, to enable product design decisions and product performance assessment for PV modules utilizing newer technologies, Simulation and Mechanism based Accelerated Reliability Testing (SMART) methodology and empirical approaches to predict field performance from accelerated test results are presented. The method is demonstrated for field life assessment of flexible PV modules based on degradation mechanisms observed in two accelerated tests, namely, Damp Heat and Thermal Cycling. The method is based on design of accelerated testing scheme with the intent to develop relevant acceleration factor models. The acceleration factor model is validated by extensive reliability testing under different conditions going beyond the established certification standards. Once the acceleration factor model is validated for the test matrix a modeling scheme is developed to predict field performance from results of accelerated testing for particular failure modes of interest. Further refinement of the model can continue as more field data becomes available. While the demonstration of the method in this work is for thin film flexible PV modules, the framework and methodology can be adapted to other PV products.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-24
... DEPARTMENT OF JUSTICE Antitrust Division Notice Pursuant to the National Cooperative Research and Production Act of 1993--Cooperative Research Group On: Diesel After Treatment Accelerated Aging Cycles--Heavy... Institute--Cooperative Research Group on Diesel After Treatment Accelerated Aging Cycles--Heavy-Duty...
Accelerated Aging Experiments for Prognostics of Damage Growth in Composite Materials
2011-09-01
possible resource to collect such data is an accelerated aging platform. To that end this paper describes a fatigue cycling experiment with the goal to...possible resource to collect such data is an accelerated aging platform. To that end this paper describes a fatigue cycling experiment with the goal to...suffer from two damage types: matrix micro-cracks and inter- laminar delamination. When subject to fatigue loading matrix micro-cracks develop in the
Du, Yu; Tu, Yong-Sheng; Tang, Yong-Bo; Huang, Yun-Ying; Zhou, Fang-Min; Tian, Tian; Li, Xiao-Yan
2018-06-01
ClC-3 is involved in the proliferation and migration of several cancer cells. However, ClC-3 expression and its role of cell-cycle control in multiple myeloma (MM) has not yet been investigated. MM cells were treated with different concentrations of IGF (30, 100, 300 ng/mL), and their proliferation was examined by CCK-8. The effects of ClC-3 on cell cycle progression was detected by flow cytometry. Western blot was used to analyze the relative levels of ClC3, CD138, P21, P27, CDK, p-Erk1/2, and t-Erk1/2 protein expression. Transfection of RPMI8226 with gpClC-3 cDNA and siRNA alters the expression of ClC-3. We compared the expression of ClC-3 in primary myeloma cells and in MM cell lines (U266 and RPMI8266) with that in normal plasma cells (PCs) from normal subjects and found that myeloma cells from patients and MM cell lines had significantly higher expression of ClC-3. Additionally, silencing of ClC-3 with the small interfering RNA (siRNA) that targets human ClC-3 decreased proliferation of RPMI8226 after IGF-1 treatment and slowed cell cycle progression from G0/G1 to S phase, which was associated with diminished phosphorylation of ERK1/2, down-expression of cyclin E, cyclin D1 and up-regulation of p27 and p21. By contrast, overexpression of ClC-3 potentiated cell proliferation induced by IGF-1, raised the percentage of S phase cells, enhanced phosphorylation of ERK1/2, downregulated p27 and p21 and upregulated cyclin E and cyclin D1. ClC-3 accelerated G0/G1 to S phase transition in the cell cycle by modulating ERK1/2 kinase activity and expression of G1/S transition related proteins, making ClC-3 an attractive therapeutic target in MM.
Pleiotrophin mediates hematopoietic regeneration via activation of RAS.
Himburg, Heather A; Yan, Xiao; Doan, Phuong L; Quarmyne, Mamle; Micewicz, Eva; McBride, William; Chao, Nelson J; Slamon, Dennis J; Chute, John P
2014-11-01
Hematopoietic stem cells (HSCs) are highly susceptible to ionizing radiation-mediated death via induction of ROS, DNA double-strand breaks, and apoptotic pathways. The development of therapeutics capable of mitigating ionizing radiation-induced hematopoietic toxicity could benefit both victims of acute radiation sickness and patients undergoing hematopoietic cell transplantation. Unfortunately, therapies capable of accelerating hematopoietic reconstitution following lethal radiation exposure have remained elusive. Here, we found that systemic administration of pleiotrophin (PTN), a protein that is secreted by BM-derived endothelial cells, substantially increased the survival of mice following radiation exposure and after myeloablative BM transplantation. In both models, PTN increased survival by accelerating the recovery of BM hematopoietic stem and progenitor cells in vivo. PTN treatment promoted HSC regeneration via activation of the RAS pathway in mice that expressed protein tyrosine phosphatase receptor-zeta (PTPRZ), whereas PTN treatment did not induce RAS signaling in PTPRZ-deficient mice, suggesting that PTN-mediated activation of RAS was dependent upon signaling through PTPRZ. PTN strongly inhibited HSC cycling following irradiation, whereas RAS inhibition abrogated PTN-mediated induction of HSC quiescence, blocked PTN-mediated recovery of hematopoietic stem and progenitor cells, and abolished PTN-mediated survival of irradiated mice. These studies demonstrate the therapeutic potential of PTN to improve survival after myeloablation and suggest that PTN-mediated hematopoietic regeneration occurs in a RAS-dependent manner.
Fimia, Gian Maria; Gottifredi, Vanesa; Bellei, Barbara; Ricciardi, Maria Rosaria; Tafuri, Agostino; Amati, Paolo; Maione, Rossella
1998-01-01
It is commonly accepted that pathways that regulate proliferation/differentiation processes, if altered in their normal interplay, can lead to the induction of programmed cell death. In a previous work we reported that Polyoma virus Large Tumor antigen (PyLT) interferes with in vitro terminal differentiation of skeletal myoblasts by binding and inactivating the retinoblastoma antioncogene product. This inhibition occurs after the activation of some early steps of the myogenic program. In the present work we report that myoblasts expressing wild-type PyLT, when subjected to differentiation stimuli, undergo cell death and that this cell death can be defined as apoptosis. Apoptosis in PyLT-expressing myoblasts starts after growth factors removal, is promoted by cell confluence, and is temporally correlated with the expression of early markers of myogenic differentiation. The block of the initial events of myogenesis by transforming growth factor β or basic fibroblast growth factor prevents PyLT-induced apoptosis, while the acceleration of this process by the overexpression of the muscle-regulatory factor MyoD further increases cell death in this system. MyoD can induce PyLT-expressing myoblasts to accumulate RB, p21, and muscle- specific genes but is unable to induce G00 arrest. Several markers of different phases of the cell cycle, such as cyclin A, cdk-2, and cdc-2, fail to be down-regulated, indicating the occurrence of cell cycle progression. It has been frequently suggested that apoptosis can result from an unbalanced cell cycle progression in the presence of a contrasting signal, such as growth factor deprivation. Our data involve differentiation pathways, as a further contrasting signal, in the generation of this conflict during myoblast cell apoptosis. PMID:9614186
Premature aging of the hippocampal neurogenic niche in adult Bmal1-deficient mice.
Ali, Amira A H; Schwarz-Herzke, Beryl; Stahr, Anna; Prozorovski, Timour; Aktas, Orhan; von Gall, Charlotte
2015-06-01
Hippocampal neurogenesis undergoes dramatic age-related changes. Mice with targeted deletion of the clock geneBmal1 (Bmal1(-/-)) show disrupted regulation of reactive oxygen species homeostasis, accelerated aging, neurodegeneration and cognitive deficits. As proliferation of neuronal progenitor/precursor cells (NPCs) is enhanced in young Bmal1(-/-) mice, we tested the hypothesis that this results in premature aging of hippocampal neurogenic niche in adult Bmal1(-/-) mice as compared to wildtype littermates. We found significantly reduced pool of hippocampal NPCs, scattered distribution, enhanced survival of NPCs and an increased differentiation of NPCs into the astroglial lineage at the expense of the neuronal lineage. Immunoreaction of the redox sensitive histone deacetylase Sirtuine 1, peroxisomal membrane protein at 70 kDa and expression of the cell cycle inhibitor p21(Waf1/CIP1) were increased in adult Bmal1(-/-) mice. In conclusion, genetic disruption of the molecular clockwork leads to accelerated age-dependent decline in adult neurogenesis presumably as a consequence of oxidative stress.
Computer modeling of photodegradation
NASA Technical Reports Server (NTRS)
Guillet, J.
1986-01-01
A computer program to simulate the photodegradation of materials exposed to terrestrial weathering environments is being developed. Input parameters would include the solar spectrum, the daily levels and variations of temperature and relative humidity, and materials such as EVA. A brief description of the program, its operating principles, and how it works was initially described. After that, the presentation focuses on the recent work of simulating aging in a normal, terrestrial day-night cycle. This is significant, as almost all accelerated aging schemes maintain a constant light illumination without a dark cycle, and this may be a critical factor not included in acceleration aging schemes. For outdoor aging, the computer model is indicating that the night dark cycle has a dramatic influence on the chemistry of photothermal degradation, and hints that a dark cycle may be needed in an accelerated aging scheme.
TGFβ restores hematopoietic homeostasis after myelosuppressive chemotherapy
Brenet, Fabienne; Kermani, Pouneh; Spektor, Roman; Rafii, Shahin
2013-01-01
Myelosuppression is a life-threatening complication of antineoplastic therapy, but treatment is restricted to a few cytokines with unilineage hematopoietic activity. Although hematopoietic stem cells (HSCs) are predominantly quiescent during homeostasis, they are rapidly recruited into cell cycle by stresses, including myelosuppressive chemotherapy. Factors that induce HSCs to proliferate during stress have been characterized, but it is not known how HSC quiescence is then reestablished. In this study, we show that TGFβ signaling is transiently activated in hematopoietic stem and progenitor cells (HSPCs) during hematopoietic regeneration. Blockade of TGFβ signaling after chemotherapy accelerates hematopoietic reconstitution and delays the return of cycling HSCs to quiescence. In contrast, TGFβ blockade during homeostasis fails to induce cycling of HSPCs. We identified the cyclin-dependent kinase inhibitor Cdkn1c (p57) as a key downstream mediator of TGFβ during regeneration because the recovery of chimeric mice, incapable of expressing p57 in HSPCs, phenocopies blockade of TGFβ signaling after chemotherapy. This study demonstrates that context-dependent activation of TGFβ signaling is central to an unrecognized counterregulatory mechanism that promotes homeostasis once hematopoiesis has sufficiently recovered from myelosuppressive chemotherapy. These results open the door to new, potentially superior, approaches to promote multilineage hematopoietic recovery by blocking the TGFβ signaling that dampens regeneration. PMID:23440043
Rapid cycling medical synchrotron and beam delivery system
Peggs, Stephen G [Port Jefferson, NY; Brennan, J Michael [East Northport, NY; Tuozzolo, Joseph E [Sayville, NY; Zaltsman, Alexander [Commack, NY
2008-10-07
A medical synchrotron which cycles rapidly in order to accelerate particles for delivery in a beam therapy system. The synchrotron generally includes a radiofrequency (RF) cavity for accelerating the particles as a beam and a plurality of combined function magnets arranged in a ring. Each of the combined function magnets performs two functions. The first function of the combined function magnet is to bend the particle beam along an orbital path around the ring. The second function of the combined function magnet is to focus or defocus the particle beam as it travels around the path. The radiofrequency (RF) cavity is a ferrite loaded cavity adapted for high speed frequency swings for rapid cycling acceleration of the particles.
Hubble Space Telescope solar cell module thermal cycle test
NASA Technical Reports Server (NTRS)
Douglas, Alexander; Edge, Ted; Willowby, Douglas; Gerlach, Lothar
1992-01-01
The Hubble Space Telescope (HST) solar array consists of two identical double roll-out wings designed after the Hughes flexible roll-up solar array (FRUSA) and was developed by the European Space Agency (ESA) to meet specified HST power output requirements at the end of 2 years, with a functional lifetime of 5 years. The requirement that the HST solar array remain functional both mechanically and electrically during its 5-year lifetime meant that the array must withstand 30,000 low Earth orbit (LEO) thermal cycles between approximately +100 and -100 C. In order to evaluate the ability of the array to meet this requirement, an accelerated thermal cycle test in vacuum was conducted at NASA's Marshall Space Flight Center (MSFC), using two 128-cell solar array modules which duplicated the flight HST solar array. Several other tests were performed on the modules. The thermal cycle test was interrupted after 2,577 cycles, and a 'cold-roll' test was performed on one of the modules in order to evaluate the ability of the flight array to survive an emergency deployment during the dark (cold) portion of an orbit. A posttest static shadow test was performed on one of the modules in order to analyze temperature gradients across the module. Finally, current in-flight electrical performance data from the actual HST flight solar array will be tested.
2013-01-01
Background The previous investigation demonstrated the radioprotective efficacy of peptides isolated from the venom of Buthus Martti Karsch. In this study, the effect of isolated scorpion venom peptide II (SVPII) on irradiated M-NFS-60 cells and mouse bone marrow mononuclear cells (BM-MNCs) was observed. The AlamarBlue cell viability assay, a colony-forming unit (CFU) assay, flow cytometry (FCM), immunofluorescence, and Western blotting were used to evaluate cell proliferation, cell cycle progression, and the expression of the IL-3 receptor (IL-3R) protein in non-irradiated and irradiated cells. Results Proliferation of irradiated M-NFS-60 cells was significantly accelerated by SPVII, and this effect was further enhanced by co-application of IL-3. Similarly, SPVII increased the number of BM-MNC CFUs and this proliferative effect was greater in the presence of SVPII plus IL-3. In addition, SPVII significantly altered cell cycle progression; SVPII enhanced the fraction of unirradiated M-NFS-60 cells in S phase and the fraction of irradiated M-NFS-60 cells arrested in G2/M. The expression of IL-3R protein by unirradiated M-NFS-60 cells was enhanced significantly by SVPII, and SVPII-induced IL-3R overexpression was 10-fold greater in irradiated M-NFS-60 cells. Conclusions These results indicated the hematopoietic growth factor (HGF)-like effects of SVPII on irradiated cells, possibly mediated by upregulation of IL-3R. PMID:23835458
NASA Technical Reports Server (NTRS)
DeSilva, J .H. S. R.; Udinwe, V.; Sideris, P. J.; Smart, M. C.; Krause, F. C.; Hwang, C.; Smith, K. A.; Greenbaum, S. G.
2012-01-01
Solid electrolyte interphase (SEI) formation in lithium ion cells prepared with advanced electrolytes is investigated by solid state multinuclear (7Li, 19F, 31P) magnetic resonance (NMR) measurements of electrode materials harvested from cycled cells subjected to an accelerated aging protocol. The electrolyte composition is varied to include the addition of fluorinated carbonates and triphenyl phosphate (TPP, a flame retardant). In addition to species associated with LiPF6 decomposition, cathode NMR spectra are characterized by the presence of compounds originating from the TPP additive. Substantial amounts of LiF are observed in the anodes as well as compounds originating from the fluorinated carbonates.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-06-04
... DEPARTMENT OF JUSTICE Antitrust Division Notice Pursuant to the National Cooperative Research and Production Act of 1993--Diesel After Treatment Accelerated Aging Cycles--Heavy-Duty Notice is hereby given... Group on Diesel After treatment Accelerated Aging Cycles--Heavy-Duty (``DAAAC-HD'') has filed written...
Life cycle assessment of molten carbonate fuel cells: State of the art and strategies for the future
NASA Astrophysics Data System (ADS)
Mehmeti, Andi; Santoni, Francesca; Della Pietra, Massimiliano; McPhail, Stephen J.
2016-03-01
This study aims to review and provide an up to date international life cycle thinking literature with particular emphasis on life cycle assessment (LCA), applied to Molten Carbonate Fuel Cells (MCFCs), a technology forcefully entering the field of decentralized heat and power generation. Critical environmental issues, comparison of results between studies and improvement strategies are analyzed and highlighted. The findings stress that MCFC environmental performance is heavily influenced by the current use of non-renewable energy and high material demand of rare minerals which generate high environmental burdens in the manufacturing stage, thereby confirming the prominent role of these processes in a comprehensive LCA study. The comparison of operational phases highlights that MCFCs are robust and able to compete with other mature technologies contributing substantially to airborne emissions reduction and promoting a switch to renewable fuels, however, further progress and market competitiveness urges adoption of an eco-efficiency philosophy to forge the link between environmental and economic concerns. Adopting a well-organized systematic research driven by life cycle models and eco-efficiency principles stakeholders will glean valuable information to make well balanced decisions for improving performance towards the concept 'producing more quality with less resources' and accelerate market penetration of the technology.
Impact of Helicobacter pylori on the healing process of the gastric barrier
Mnich, Eliza; Kowalewicz-Kulbat, Magdalena; Sicińska, Paulina; Hinc, Krzysztof; Obuchowski, Michał; Gajewski, Adrian; Moran, Anthony P; Chmiela, Magdalena
2016-01-01
AIM To determine the impact of selected well defined Helicobacter pylori (H. pylori) antigens on gastric barrier cell turnover. METHODS In this study, using two cellular models of gastric epithelial cells and fibroblasts, we have focused on exploring the effects of well defined H. pylori soluble components such as glycine acid extract antigenic complex (GE), subunit A of urease (UreA), cytotoxin associated gene A protein (CagA) and lipopolysaccharide (LPS) on cell turnover by comparing the wound healing capacity of the cells in terms of their proliferative and metabolic activity as well as cell cycle distribution. Toxic effects of H. pylori components have been assessed in an association with damage to cell nuclei and inhibition of signal transducer and activator of transcription 3 (STAT3) phosphorylation. RESULTS We showed that H. pylori GE, CagA and UreA promoted regeneration of epithelial cells and fibroblasts, which is necessary for effective tissue healing. However, in vivo increased proliferative activity of these cells may constitute an increased risk of gastric neoplasia. In contrast, H. pylori LPS showed a dose-dependent influence on the process of wound healing. At a low concentration (1 ng/mL) H. pylori LPS accelerated of healing epithelial cells, which was linked to significantly enhanced cell proliferation and MTT reduction as well as lack of alterations in cell cycle and downregulation of epidermal growth factor (EGF) production as well as cell nuclei destruction. By comparison, H. pylori LPS at a high concentration (25 ng/mL) inhibited the process of wound repair, which was related to diminished proliferative activity of the cells, cell cycle arrest, destruction of cell nuclei and downregulation of the EGF/STAT3 signalling pathway. CONCLUSION In vivo H. pylori LPS driven effects might lead to the maintenance of chronic inflammatory response and pathological disorders on the level of the gastric mucosal barrier. PMID:27672275
Savych, Iuliia; Subianto, Surya; Nabil, Yannick; Cavaliere, Sara; Jones, Deborah; Rozière, Jacques
2015-07-14
Novel platinum-catalysed, corrosion-resistant, loose-tube-structured electrocatalysts for proton exchange membrane fuel cells have been obtained using single-needle electrospinning associated with a microwave-assisted polyol method. Monodisperse platinum particles supported on Nb-SnO2 demonstrated higher electrochemical stability than conventional Pt/C electrodes during ex situ potential cycling and comparable activity in the oxygen reduction reaction. In situ fuel cell operation under accelerated stress test conditions of a membrane electrode assembly elaborated using a Pt/C anode and Pt/Nb-SnO2 cathode confirmed that the voltage loss is significantly lower for the novel cathode than for an MEA prepared using conventional Pt/C supported electrocatalysts. Furthermore, the Nb-SnO2 stabilised the supported platinum nanoparticles against dissolution, migration and reprecipitation in the membrane. Pt/Nb-SnO2 loose-tubes constitute a mitigation strategy for two known degradation mechanisms in PEMFC: corrosion of the carbon support at the cathode, and dissolution of Pt at high cell voltages.
Bunel, Valérian; Antoine, Marie-Hélène; Stévigny, Caroline; Nortier, Joëlle; Duez, Pierre
2016-01-01
Aristolochic acids (AA) are nephrotoxic agents found in Aristolochia species whose consumption leads to the onset of a progressive tubulointerstitial fibrosis. This AA-nephropathy was first reported during the Belgian outbreak of the 1990's in which more than a hundred patients consumed slimming pills containing an Aristolochia species and Magnolia officinalis. The patients developed an end-stage kidney disease requiring dialysis or transplantation. Magnolol and honokiol are bioactive compounds from M. officinalis known for their potent antioxidant activity. As they can alleviate oxidative stress, we investigated their respective effects on AA-mediated tubulotoxicity using HK-2 cells. Magnolol and honokiol were able to reduce the oxidative stress associated with AA-treatment. Cytotoxicity alleviation was further investigated and overall cell viability measurements unexpectedly revealed that both compounds worsened the survival of AA-treated cells. Flow cytometry analyses of annexin V/PI stained cells indicated that the lignans efficiently prevented AA-induced apoptosis; but favored necrosis. Microscopy observations highlighted extensive vacuolization; other types of cell death, including autophagy, paraptosis or accelerated senescence were excluded. Ki-67 index and cell cycle analysis indicated that both magnolol and honokiol inhibited proliferation by blocking the cell cycle at the G1 phase; they also prevented the AA-induced G2/M arrest. Copyright © 2015 Elsevier Ltd. All rights reserved.
Haddad, Ahmed Q; Fleshner, Neil; Nelson, Colleen; Saour, Basil; Musquera, Mireia; Venkateswaran, Vasundara; Klotz, Laurence
2010-01-01
We have previously demonstrated the antiproliferative effect of two flavonoids-2,2'-dihydroxychalcone (DHC), a novel synthetic flavonoid, and fisetin, a naturally occurring flavonol-in prostate cancer cells. In this study, we further examine the mechanisms of these compounds on survival and proliferation pathways. DHC and fisetin (1-50 microM) caused a dose-dependent reduction in viability, a concomitant increase in apoptosis in PC3 cells at 72 h, and a decrease in clonogenic survival at 24 h treatment. DHC was considerably more potent than fisetin in these cytotoxicity assays. The mechanism of accelerated cellular senescence was not activated by either compound in PC3 or lymph node carcinoma of the prostate (LNCaP) cells. Gene expression alterations in PC3 and LNCaP cells treated with 15 muM DHC and 25 microM fisetin for 6 to 24 h were determined by oligonucleotide array. Amongst the most highly represented functional categories of genes altered by both compounds was the cell cycle category. In total, 100 cell cycle genes were altered by DHC and fisetin including 27 genes with key functions in G2/M phase that were downregulated by both compounds. Other functional categories altered included chromosome organization, apoptosis, and stress response. These results demonstrate the multiple mechanisms of antitumor activity of DHC and fisetin in prostate cancer cells in vitro.
Effects of iron ions, protons and X rays on human lens cell differentiation.
Chang, P Y; Bjornstad, K A; Rosen, C J; McNamara, M P; Mancini, R; Goldstein, L E; Chylack, L T; Blakely, E A
2005-10-01
We have investigated molecular changes in cultured differentiating human lens epithelial cells exposed to high-energy accelerated iron-ion beams as well as to protons and X rays. In this paper, we present results on the effects of radiation on gene families that include or are related to DNA damage, cell cycle regulators, cell adhesion molecules, and cell cytoskeletal function. A limited microarray survey with a panel of cell cycle-regulated genes illustrates that irradiation with protons altered the gene expression pattern of human lens epithelial cells. A focus of our work is CDKN1A (p21(CIP1/WAF1)), a protein that we demonstrate here has a role in several pathways functionally related to LET-responsive radiation damage. We quantitatively assessed RNA and protein expression in a time course before and after single 4-Gy radiation doses and demonstrated that transcription and translation of CDKN1A are both temporally regulated after exposure. Furthermore, we show qualitative differences in the distribution of CDKN1A immunofluorescence signals after exposure to X rays, protons or iron ions, suggesting that LET effects likely play a role in the misregulation of gene function in these cells. A model of molecular and cellular events is proposed to account for precataractous changes in the human lens after exposure to low- or high-LET radiations.
Lee, Jun Ho; Patel, Kalpesh; Tae, Hyun Jin; Lustig, Ana; Kim, Jie Wan; Mattson, Mark P.; Taub, Dennis D.
2014-01-01
Thymic atrophy occurs during normal aging, and is accelerated by exposure to chronic stressors that elevate glucocorticoid levelsand impair the naïve T cell output. The orexigenic hormone ghrelin was recently shown to attenuate age-associated thymic atrophy. Here, we report that ghrelin enhances the proliferation of murine CD4+ primary T cells and a CD4+ T-cell line. Ghrelin induced activation of the ERK1/2 and Akt signaling pathways, via upstream activation of phosphatidylinositol-3-kinase and protein kinase C, to enhance T-cell proliferation. Moreover, ghrelin induced expression of the cell cycle proteins cyclin D1, cyclin E, cyclin-dependent kinase 2 (CDK2) and retinoblastoma phosphorylation. Finally, ghrelin activated the above-mentioned signaling pathways and stimulated thymocyte proliferation in young and older mice in vivo. PMID:25447526
Engineering biological systems using automated biofoundries
Chao, Ran; Mishra, Shekhar; Si, Tong; Zhao, Huimin
2017-01-01
Engineered biological systems such as genetic circuits and microbial cell factories have promised to solve many challenges in the modern society. However, the artisanal processes of research and development are slow, expensive, and inconsistent, representing a major obstacle in biotechnology and bioengineering. In recent years, biological foundries or biofoundries have been developed to automate design-build-test engineering cycles in an effort to accelerate these processes. This review summarizes the enabling technologies for such biofoundries as well as their early successes and remaining challenges. PMID:28602523
Wang, Yiping; Cheng, Xiangdong; Samma, Muhammad Kaleem; Kung, Sam K P; Lee, Clement M; Chiu, Sung Kay
2018-06-01
c-Myc is a highly pleiotropic transcription factor known to control cell cycle progression, apoptosis, and cellular transformation. Normally, ectopic expression of c-Myc is associated with promoting cell proliferation or triggering cell death via activating p53. However, it is not clear how the levels of c-Myc lead to different cellular responses. Here, we generated a series of stable RPE cell clones expressing c-Myc at different levels, and found that consistent low level of c-Myc induced cellular senescence by activating AP4 in post-confluent RPE cells, while the cells underwent cell death at high level of c-Myc. In addition, high level of c-Myc could override the effect of AP4 on cellular senescence. Further knockdown of AP4 abrogated senescence-like phenotype in cells expressing low level of c-Myc, and accelerated cell death in cells with medium level of c-Myc, indicating that AP4 was required for cellular senescence induced by low level of c-Myc.
Martin, Bernd T; Kleiber, Kai; Wixler, Viktor; Raab, Monika; Zimmer, Brigitte; Kaufmann, Manfred; Strebhardt, Klaus
2007-07-15
The transcriptional cofactor FHL2 interacts with a broad variety of transcription factors and its expression is often deregulated in various types of cancer. Here we analyzed for the first time the molecular function of FHL2 in breast cancer. FHL2 is overexpressed in almost all human mammary carcinoma samples tested but not in normal breast tissues and only low levels of FHL2 expression were present in four premalignant ductal carcinoma in situ (DCIS). Cell cycle analysis revealed an upregulation of endogenous FHL2 towards G2/M in MDA-MB 231 cells and an accelerated G2/M transition when FHL2 expression was suppressed in these cells. In search for G2/M specific target genes regulated by FHL2, we found that expression of the cell cycle inhibitor p21Cip1/Waf1 (hereafter p21) is dependent on FHL2 in MDA-MB 231 breast cancer cells. Downregulation of FHL2 by shRNA abrogated the cell cycle dependent upregulation of p21 as well as the induction of p21 in response to treatment with the DNA damaging agent doxorubicin. FHL2-dependent p21 expression occurs in a p53-independent manner and p21 expression can be downregulated by specific inhibition of mitogen-activated protein kinases (MAPKs), implicating an involvement of MAPK signaling in this regulation. Analysis of FHL2 contribution to the MAPK signaling identified FHL2 as an important downstream effector of MAPKs in breast cancer cells, capable of transactivating endogenous AP1 target genes as well as AP1 dependent reporter genes. Finally, downregulation of FHL2 reduces the ability of MDA-MB 231 cells to form colonies in soft agar, while FHL2 overexpression enhances colony formation of breast cancer cells. Thus, our findings indicate that overexpression of the transcriptional cofactor FHL2 contributes to breast cancer development by mediating transcriptional activation of MAPK target genes known to be involved in cancer progression, such as p21.
42 CFR 412.116 - Method of payment.
Code of Federal Regulations, 2012 CFR
2012-10-01
...) Recovery of payment. Recovery of the accelerated payment is made by recoupment as hospital bills are... made on an interim basis. (f) Accelerated payments—(1) General rule. Upon request, an accelerated... intermediary beyond its normal billing cycle. (2) Approval of payment. A hospital's request for an accelerated...
42 CFR 412.116 - Method of payment.
Code of Federal Regulations, 2011 CFR
2011-10-01
...) Recovery of payment. Recovery of the accelerated payment is made by recoupment as hospital bills are... made on an interim basis. (f) Accelerated payments—(1) General rule. Upon request, an accelerated... intermediary beyond its normal billing cycle. (2) Approval of payment. A hospital's request for an accelerated...
42 CFR 412.116 - Method of payment.
Code of Federal Regulations, 2014 CFR
2014-10-01
...) Recovery of payment. Recovery of the accelerated payment is made by recoupment as hospital bills are... made on an interim basis. (f) Accelerated payments—(1) General rule. Upon request, an accelerated... intermediary beyond its normal billing cycle. (2) Approval of payment. A hospital's request for an accelerated...
42 CFR 412.116 - Method of payment.
Code of Federal Regulations, 2013 CFR
2013-10-01
...) Recovery of payment. Recovery of the accelerated payment is made by recoupment as hospital bills are... made on an interim basis. (f) Accelerated payments—(1) General rule. Upon request, an accelerated... intermediary beyond its normal billing cycle. (2) Approval of payment. A hospital's request for an accelerated...
Erbin loss promotes cancer cell proliferation through feedback activation of Akt-Skp2-p27 signaling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Hao; Laboratory of Cellular and Molecular Immunology, Medical School of Henan University, Kaifeng 475004; Song, Yuhua
2015-07-31
Erbin localizes at the basolateral membrane to regulate cell junctions and polarity in epithelial cells. Dysregulation of Erbin has been implicated in tumorigenesis, and yet it is still unclear if and how disrupted Erbin regulates the biological behavior of cancer cells. We report here that depletion of Erbin leads to cancer cell excessive proliferation in vitro and in vivo. Erbin deficiency accelerates S-phase entry by down-regulating CDK inhibitors p21 and p27 via two independent mechanisms. Mechanistically, Erbin loss promotes p27 degradation by enhancing E3 ligase Skp2 activity though augmenting Akt signaling. Interestingly, we also show that Erbin is an unstable protein whenmore » the Akt-Skp2 signaling is aberrantly activated, which can be specifically destructed by SCF-Skp2 ligase. Erbin loss facilitates cell proliferation and migration in Skp2-dependent manner. Thus, our finding illustrates a novel negative feedback loop between Erbin and Akt-Skp2 signaling. It suggests disrupted Erbin links polarity loss, hyperproliferation and tumorigenesis. - Highlights: • Erbin loss leads to cancer cell excessive proliferation in vitro and in vivo. • Erbin loss accelerates cell cycle though down-regulating p21 and p27 expression. • Erbin is a novel negative modulator of Akt1-Skp2-p27 signaling pathway. • Our study suggests that Erbin loss contributes to Skp2 oncogenic function.« less
Li, Tuo; Zhao, Zhenwen; Wang, Quan; Xie, Pengfei; Ma, Jiahai
2016-11-15
Quinone-hydroquinone analogues have been proven to be efficient promoters of Fenton reactions by accelerating the Fe(III)/Fe(II) redox cycle along with self-destruction. However, so far there is little information on non-quinone-hydroquinone cocatalyst for Fenton reactions. This study found that cysteine, a common aliphatic amino acid, can strongly enhance Fenton degradation of organic pollutants by accelerating Fe(III)/Fe(II) redox cycle, as quinone-hydroquinone analogues do. Further, cysteine is superior to quinone-hydroquinone analogues in catalytic activity, H 2 O 2 utilization and atmospheric limits. The cocatalysis mechanism based on the cycle of cysteine/cystine was proposed. Copyright © 2016 Elsevier Ltd. All rights reserved.
Huang, Tonglie; Zhang, Kuo; Sun, Lijuan; Xue, Xiaochang; Zhang, Cun; Shu, Zhen; Mu, Nan; Gu, Jintao; Zhang, Wangqian; Wang, Yukun; Zhang, Yingqi; Zhang, Wei
2015-01-01
Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC)-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs). Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of extracellular signal-regulated kinases 1 and 2 (ERK1/2) as well as its downstream targets, including c-Fos, c-Jun, and Egr-1, which are key molecules involved in cell growth, migration, and angiogenesis. Altogether, our results indicated that BPC-157 treatment may accelerate wound healing in a model of alkali burn-induced skin injury. The therapeutic mechanism may be associated with accelerated granulation tissue formation, reepithelialization, dermal remodeling, and collagen deposition through ERK1/2 signaling pathway. PMID:25995620
Huang, Tonglie; Zhang, Kuo; Sun, Lijuan; Xue, Xiaochang; Zhang, Cun; Shu, Zhen; Mu, Nan; Gu, Jintao; Zhang, Wangqian; Wang, Yukun; Zhang, Yingqi; Zhang, Wei
2015-01-01
Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC)-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin-eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs). Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of extracellular signal-regulated kinases 1 and 2 (ERK1/2) as well as its downstream targets, including c-Fos, c-Jun, and Egr-1, which are key molecules involved in cell growth, migration, and angiogenesis. Altogether, our results indicated that BPC-157 treatment may accelerate wound healing in a model of alkali burn-induced skin injury. The therapeutic mechanism may be associated with accelerated granulation tissue formation, reepithelialization, dermal remodeling, and collagen deposition through ERK1/2 signaling pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Xiaobing; Wu, Yaxun; Wang, Yuchan
YB-1 is a multifunctional protein, which has been shown to correlate with resistance to treatment of various tumor types. This study investigated the expression and biologic function of YB-1 in diffuse large B-cell lymphoma (DLBCL). Immunohistochemical analysis showed that the expression statuses of YB-1 and pYB-1{sup S102} were reversely correlated with the clinical outcomes of DLBCL patients. In addition, we found that YB-1 could promote the proliferation of DLBCL cells by accelerating the G1/S transition. Ectopic expression of YB-1 could markedly increase the expression of cell cycle regulators cyclin D1 and cyclin E. Furthermore, we found that adhesion of DLBCLmore » cells to fibronectin (FN) could increase YB-1 phosphorylation at Ser102 and pYB-1{sup S102} nuclear translocation. In addition, overexpression of YB-1 could increase the adhesion of DLBCL cells to FN. Intriguingly, we found that YB-1 overexpression could confer drug resistance through cell-adhesion dependent and independent mechanisms in DLBCL. Silencing of YB-1 could sensitize DLBCL cells to mitoxantrone and overcome cell adhesion-mediated drug resistance (CAM-DR) phenotype in an AKT-dependent manner. - Highlights: • The expression statuses of YB-1 and pYB-1{sup S102} are reversely correlated with outcomes of DLBCL patients. • YB-1 promotes cell proliferation by accelerating G1/S transition in DLBCL. • YB-1 confers drug resistance to mitoxantrone in DLBCL.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stariha, Sarah; Macauley, Natalia; Sneed, Brian T.
The U.S. Department of Energy (DOE) set the 2020 durability target for polymer electrolyte membrane fuel cell transportation applications at 5000 hours. Since it is impractical to test every fuel cell for this length of time, there is ever increasing interest in developing accelerated stress tests (ASTs) that can accurately simulate the material component degradation in the membrane electrode assembly (MEA) observed under automotive operating conditions, but over a much shorter time frame. In this study, a square-wave catalyst AST was examined that shows a 5X time acceleration factor over the triangle-wave catalyst AST and a 25X time acceleration factormore » over the modified wet drive-cycle catalyst durability protocol, significantly decreasing the testing time. These acceleration factors were correlated to the platinum (Pt) particle size increase and associated decrease in electrochemical surface area (ECSA). This square-wave AST has been adopted by the DOE as a standard protocol to evaluate catalyst durability. We also compare three catalyst-durability protocols using state-of-the-art platinum-cobalt catalysts supported on high surface area carbon (SOA Pt-Co/HSAC) in the cathode catalyst layer. The results for each of the three tests showed both catalyst particle size increase and transition metal leaching. Moreover the acceleration factors for the alloy catalysts were smaller due to Co leaching being the predominant mechanism of voltage decay in ~5 nm PtCo/C catalysts. Finally, an extremely harsh carbon corrosion AST was run using the same SOA Pt-Co/HSAC catalyst. This showed minimal change in particle size and a low percentage Co loss from the cathode catalyst particles, despite a significant loss in catalyst layer thickness and cell performance. The carbon corrosion rates during these various ASTs were directly measured by monitoring the CO 2 emission from the cathode, further confirming the ability of the square-wave AST to evaluate the electro-catalyst independently of the support.« less
NASA Astrophysics Data System (ADS)
Zhou, Jianxin; Kang, Wen; Li, Shuai; Liu, Yudong; Liu, Yiqin; Xu, Shouyan; Guo, Xiaoling; Wu, Xi; Deng, Changdong; Li, Li; Wu, Yuwen; Wang, Sheng
2018-02-01
The China Spallation Neutron Source (CSNS) has two major accelerator systems, a linear accelerator and a rapid cycling synchrotron (RCS). The RCS accelerator is used to accumulate and accelerate protons from the energy of 80 MeV to the design energy of 1.6 GeV at the repetition rate of 25 Hz, and extract the high energy beam to the target. The main magnets of the RCS accelerator are excited by AC current with DC bias. The magnetic field quality is very important for the RCS accelerator operation, since it should guarantee and focus a circulating beam. In order to characterize the AC magnets, a small flip coil measurement system has been developed and one of each type of AC magnets has been studied. The measurement system and selected measurement results are presented in this paper.
NASA Technical Reports Server (NTRS)
Frickland, P. O.; Repar, J.
1982-01-01
A previously developed test design for accelerated aging of photovoltaic modules was experimentally evaluated. The studies included a review of relevant field experience, environmental chamber cycling of full size modules, and electrical and physical evaluation of the effects of accelerated aging during and after the tests. The test results indicated that thermally induced fatigue of the interconnects was the primary mode of module failure as measured by normalized power output. No chemical change in the silicone encapsulant was detectable after 360 test cycles.
[Acceleration of Embryonic Development of Pinus sibirica Trees with a One-Year Reproductive Cycle].
Tret'yakova, I N; Lukina, N V
2016-01-01
The study of the formation of embryonic structures in Pinus sibirica forms with a one-year reproductive cycle showed that the acceleration of the embryonic process manifested itself as a reduction of the coenocytic stage of the female gametophyte development (1.5 months instead of 1 year). The egg was not fertilized because of the asynchronous maturation of male and female gametophytes. Seeds without embryos were formed. We assumed that the acceleration of the reproductive process in Pinus sibirica was caused by a mutation in the female generative organs.
Survival of tumor cells after proton irradiation with ultra-high dose rates
2011-01-01
Background Laser acceleration of protons and heavy ions may in the future be used in radiation therapy. Laser-driven particle beams are pulsed and ultra high dose rates of >109 Gy s-1may be achieved. Here we compare the radiobiological effects of pulsed and continuous proton beams. Methods The ion microbeam SNAKE at the Munich tandem accelerator was used to directly compare a pulsed and a continuous 20 MeV proton beam, which delivered a dose of 3 Gy to a HeLa cell monolayer within < 1 ns or 100 ms, respectively. Investigated endpoints were G2 phase cell cycle arrest, apoptosis, and colony formation. Results At 10 h after pulsed irradiation, the fraction of G2 cells was significantly lower than after irradiation with the continuous beam, while all other endpoints including colony formation were not significantly different. We determined the relative biological effectiveness (RBE) for pulsed and continuous proton beams relative to x-irradiation as 0.91 ± 0.26 and 0.86 ± 0.33 (mean and SD), respectively. Conclusions At the dose rates investigated here, which are expected to correspond to those in radiation therapy using laser-driven particles, the RBE of the pulsed and the (conventional) continuous irradiation mode do not differ significantly. PMID:22008289
NASA Astrophysics Data System (ADS)
Pohl, E.; Maximini, M.; Bauschulte, A.; vom Schloß, J.; Hermanns, R. T. E.
2015-02-01
HT-PEM fuel cells suffer from performance losses due to degradation effects. Therefore, the durability of HT-PEM is currently an important factor of research and development. In this paper a novel approach is presented for an integrated short term and long term simulation of HT-PEM accelerated lifetime testing. The physical phenomena of short term and long term effects are commonly modeled separately due to the different time scales. However, in accelerated lifetime testing, long term degradation effects have a crucial impact on the short term dynamics. Our approach addresses this problem by applying a novel method for dual time scale simulation. A transient system simulation is performed for an open voltage cycle test on a HT-PEM fuel cell for a physical time of 35 days. The analysis describes the system dynamics by numerical electrochemical impedance spectroscopy. Furthermore, a performance assessment is performed in order to demonstrate the efficiency of the approach. The presented approach reduces the simulation time by approximately 73% compared to conventional simulation approach without losing too much accuracy. The approach promises a comprehensive perspective considering short term dynamic behavior and long term degradation effects.
Xavier, Joana M; Morgado, Ana L; Rodrigues, Cecília MP; Solá, Susana
2014-01-01
The low survival and differentiation rates of stem cells after either transplantation or neural injury have been a major concern of stem cell-based therapy. Thus, further understanding long-term survival and differentiation of stem cells may uncover new targets for discovery and development of novel therapeutic approaches. We have previously described the impact of mitochondrial apoptosis-related events in modulating neural stem cell (NSC) fate. In addition, the endogenous bile acid, tauroursodeoxycholic acid (TUDCA) was shown to be neuroprotective in several animal models of neurodegenerative disorders by acting as an anti-apoptotic and anti-oxidant molecule at the mitochondrial level. Here, we hypothesize that TUDCA might also play a role on NSC fate decision. We found that TUDCA prevents mitochondrial apoptotic events typical of early-stage mouse NSC differentiation, preserves mitochondrial integrity and function, while enhancing self-renewal potential and accelerating cell cycle exit of NSCs. Interestingly, TUDCA prevention of mitochondrial alterations interfered with NSC differentiation potential by favoring neuronal rather than astroglial conversion. Finally, inhibition of mitochondrial reactive oxygen species (mtROS) scavenger and adenosine triphosphate (ATP) synthase revealed that the effect of TUDCA is dependent on mtROS and ATP regulation levels. Collectively, these data underline the importance of mitochondrial stress control of NSC fate decision and support a new role for TUDCA in this process. PMID:25483094
Yang, Liulin; Li, Yun; Wei, Zhi; Chang, Xiao
2018-06-01
Neuroblastoma is a highly complex and heterogeneous cancer in children. Acquired genomic alterations including MYCN amplification, 1p deletion and 11q deletion are important risk factors and biomarkers in neuroblastoma. Here, we performed a co-expression-based gene network analysis to study the intrinsic association between specific genomic changes and transcriptome organization. We identified multiple gene coexpression modules which are recurrent in two independent datasets and associated with functional pathways including nervous system development, cell cycle, immune system process and extracellular matrix/space. Our results also indicated that modules involved in nervous system development and cell cycle are highly associated with MYCN amplification and 1p deletion, while modules responding to immune system process are associated with MYCN amplification only. In summary, this integrated analysis provides novel insights into molecular heterogeneity and pathogenesis of neuroblastoma. This article is part of a Special Issue entitled: Accelerating Precision Medicine through Genetic and Genomic Big Data Analysis edited by Yudong Cai & Tao Huang. Copyright © 2017. Published by Elsevier B.V.
Microinjection of recombinant O-GlcNAc transferase potentiates Xenopus oocytes M-phase entry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dehennaut, Vanessa; EA 4020, Laboratoire de Regulation des Signaux de Division, USTL, IFR147, Villeneuve d'Ascq; Hanoulle, Xavier
2008-05-02
In order to understand the importance of the cytosolic and nuclear-specific O-linked N-acetylglucosaminylation (O-GlcNAc) on cell cycle regulation, we recently reported that inhibition of O-GlcNAc transferase (OGT) delayed or blocked Xenopus laevis oocyte germinal vesicle breakdown (GVBD). Here, we show that increased levels of the long OGT isoform (ncOGT) accelerate X. laevis oocyte GVBD. A N-terminally truncated isoform (sOGT) with a similar in vitro catalytic activity towards a synthetic CKII-derived peptide had no effect, illustrating the important role played by the N-terminal tetratrico-peptide repeats. ncOGT microinjection in the oocytes increases both the speed and extent of O-GlcNAc addition, leads tomore » a quicker activation of the MPF and MAPK pathways and finally results in a faster GVBD. Microinjection of anti-OGT antibodies leads to a delay of the GVBD kinetics. Our results hence demonstrate that OGT is a key molecule for the timely progression of the cell cycle.« less
Why is solar cycle 24 an inefficient producer of high-energy particle events?
NASA Astrophysics Data System (ADS)
Vainio, Rami; Raukunen, Osku; Tylka, Allan J.; Dietrich, William F.; Afanasiev, Alexandr
2017-08-01
Aims: The aim of the study is to investigate the reason for the low productivity of high-energy SEPs in the present solar cycle. Methods: We employ scaling laws derived from diffusive shock acceleration theory and simulation studies including proton-generated upstream Alfvén waves to find out how the changes observed in the long-term average properties of the erupting and ambient coronal and/or solar wind plasma would affect the ability of shocks to accelerate particles to the highest energies. Results: Provided that self-generated turbulence dominates particle transport around coronal shocks, it is found that the most crucial factors controlling the diffusive shock acceleration process are the number density of seed particles and the plasma density of the ambient medium. Assuming that suprathermal populations provide a fraction of the particles injected to shock acceleration in the corona, we show that the lack of most energetic particle events as well as the lack of low charge-to-mass ratio ion species in the present cycle can be understood as a result of the reduction of average coronal plasma and suprathermal densities in the present cycle over the previous one.
Thermal Cycling of Mir Cooperative Solar Array (MCSA) Test Panels
NASA Technical Reports Server (NTRS)
Hoffman, David J.; Scheiman, David A.
1997-01-01
The Mir Cooperative Solar Array (MCSA) project was a joint US/Russian effort to build a photovoltaic (PV) solar array and deliver it to the Russian space station Mir. The MCSA is currently being used to increase the electrical power on Mir and provide PV array performance data in support of Phase 1 of the International Space Station (ISS), which will use arrays based on the same solar cells used in the MCSA. The US supplied the photovoltaic power modules (PPMs) and provided technical and programmatic oversight while Russia provided the array support structures and deployment mechanism and built and tested the array. In order to ensure that there would be no problems with the interface between US and Russian hardware, an accelerated thermal life cycle test was performed at NASA Lewis Research Center on two representative samples of the MCSA. Over an eight-month period (August 1994 - March 1995), two 15-cell MCSA solar array 'mini' panel test articles were simultaneously put through 24,000 thermal cycles (+80 C to -100 C), equivalent to four years on-orbit. The test objectives, facility, procedure and results are described in this paper. Post-test inspection and evaluation revealed no significant degradation in the structural integrity of the test articles and no electrical degradation, not including one cell damaged early as an artifact of the test and removed from consideration. The interesting nature of the performance degradation caused by this one cell, which only occurred at elevated temperatures, is discussed. As a result of this test, changes were made to improve some aspects of the solar cell coupon-to-support frame interface on the flight unit. It was concluded from the results that the integration of the US solar cell modules with the Russian support structure would be able to withstand at least 24,000 thermal cycles (4 years on-orbit).
Orihuela, Pedro A; Zuñiga, Lidia M; Rios, Mariana; Parada-Bustamante, Alexis; Sierralta, Walter D; Velásquez, Luis A; Croxatto, Horacio B
2009-11-30
Mating changes the mode of action of 17beta-estradiol (E2) to accelerate oviductal egg transport from a nongenomic to a genomic mode, although in both pathways estrogen receptors (ER) are required. This change was designated as intracellular path shifting (IPS). Herein, we examined the subcellular distribution of ESR1 and ESR2 (formerly known as ER-alpha and ER-beta) in oviductal epithelial cells of rats on day 1 of cycle (C1) or pregnancy (P1) using immunoelectron microscopy for ESR1 and ESR2. The effect of mating on intraoviductal ESR1 or ESR2 signaling was then explored comparing the expression of E2-target genes c-fos, brain creatine kinase (Ckb) and calbindin 9 kDa (s100g) in rats on C1 or P1 treated with selective agonists for ESR1 (PPT) or ESR2 (DPN). The effect of ER agonists on egg transport was also evaluated on C1 or P1 rats. Receptor immunoreactivity was associated with the nucleus, cytoplasm and plasma membrane of the epithelial cells. Mating affected the subcellular distribution of both receptors as well as the response to E2. In C1 and P1 rats, PPT increased Ckb while both agonists increased c-fos. DPN increased Ckb and s100g only in C1 and P1 rats, respectively. PPT accelerated egg transport in both groups and DPN accelerated egg transport only in C1 rats. Estrogen receptors present a subcellular distribution compatible with E2 genomic and nongenomic signaling in the oviductal epithelial cells of C1 and P1 although IPS occurs independently of changes in the distribution of ESR1 and ESR2 in the oviductal epithelial cells. Mating affected intraoviductal ER-signaling and induced loss of functional involvement of ESR2 on E2-induced accelerated egg transport. These findings reveal a profound influence on the ER signaling pathways exerted by mating in the oviduct.
Isochronous (CW) Non-Scaling FFAGs: Design and Simulation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnstone, C.; Berz, M.; Makino, K.
2010-11-04
The drive for higher beam power, high duty cycle, and reliable beams at reasonable cost has focused international attention and design effort on fixed field accelerators, notably Fixed-Field Alternating Gradient accelerators (FFAGs). High-intensity GeV proton drivers encounter duty cycle and space-charge limits in the synchrotron and machine size concerns in the weaker-focusing cyclotrons. A 10-20 MW proton driver is challenging, if even technically feasible, with conventional accelerators--with the possible exception of a SRF linac, which has a large associated cost and footprint. Recently, the concept of isochronous orbits has been explored and developed for nonscaling FFAGs using powerful new methodologiesmore » in FFAG accelerator design and simulation. The property of isochronous orbits enables the simplicity of fixed RF and, by tailoring a nonlinear radial field profile, the FFAG can remain isochronous beyond the energy reach of cyclotrons, well into the relativistic regime. With isochronous orbits, the machine proposed here has the high average current advantage and duty cycle of the cyclotron in combination with the strong focusing, smaller losses, and energy variability that are more typical of the synchrotron. This paper reports on these new advances in FFAG accelerator technology and presents advanced modeling tools for fixed-field accelerators unique to the code COSY INFINITY.« less
Pleiotrophin mediates hematopoietic regeneration via activation of RAS
Himburg, Heather A.; Yan, Xiao; Doan, Phuong L.; Quarmyne, Mamle; Micewicz, Eva; McBride, William; Chao, Nelson J.; Slamon, Dennis J.; Chute, John P.
2014-01-01
Hematopoietic stem cells (HSCs) are highly susceptible to ionizing radiation–mediated death via induction of ROS, DNA double-strand breaks, and apoptotic pathways. The development of therapeutics capable of mitigating ionizing radiation–induced hematopoietic toxicity could benefit both victims of acute radiation sickness and patients undergoing hematopoietic cell transplantation. Unfortunately, therapies capable of accelerating hematopoietic reconstitution following lethal radiation exposure have remained elusive. Here, we found that systemic administration of pleiotrophin (PTN), a protein that is secreted by BM-derived endothelial cells, substantially increased the survival of mice following radiation exposure and after myeloablative BM transplantation. In both models, PTN increased survival by accelerating the recovery of BM hematopoietic stem and progenitor cells in vivo. PTN treatment promoted HSC regeneration via activation of the RAS pathway in mice that expressed protein tyrosine phosphatase receptor-zeta (PTPRZ), whereas PTN treatment did not induce RAS signaling in PTPRZ-deficient mice, suggesting that PTN-mediated activation of RAS was dependent upon signaling through PTPRZ. PTN strongly inhibited HSC cycling following irradiation, whereas RAS inhibition abrogated PTN-mediated induction of HSC quiescence, blocked PTN-mediated recovery of hematopoietic stem and progenitor cells, and abolished PTN-mediated survival of irradiated mice. These studies demonstrate the therapeutic potential of PTN to improve survival after myeloablation and suggest that PTN-mediated hematopoietic regeneration occurs in a RAS-dependent manner. PMID:25250571
Accelerated life assessment of coating on the radar structure components in coastal environment.
Liu, Zhe; Ming, ZhiMao
2016-07-04
This paper aimed to build an accelerated life test scheme and carry out quantitative analysis between accelerated life test in the laboratory and actual service for the coating composed of epoxy primer and polyurethane paint on structure components of some kind of radar served in the coastal environment of South China Sea. The accelerated life test scheme was built based on the service environment and failure analysis of the coating. The quantitative analysis between accelerated life test and actual service was conducted by comparing the gloss loss, discoloration, chalking, blistering, cracking and electrochemical impedance spectroscopy of the coating. The main factors leading to the coating failure were ultraviolet radiation, temperature, moisture, salt fog and loads, the accelerated life test included ultraviolet radiation, damp heat, thermal shock, fatigue and salt spray. The quantitative relationship was that one cycle of the accelerated life test was equal to actual service for one year. It was established that one cycle of the accelerated life test was equal to actual service for one year. It provided a precise way to predict actual service life of newly developed coatings for the manufacturer.
Mareková, M; Vávrová, J; Vokurková, D; Psutka, J
2003-01-01
Acute promyelocytic leukemia is characterized by a block of myeloid differentiation. The incubation of cells with 1 micromol/l all-trans retinoic acid (ATRA) for 72 h induced differentiation of HL-60 cells and increased the number of CD11b positive cells. Morphological and functional changes were accompanied by a loss of proliferative capacity. Differentiation caused by preincubation of leukemic cells HL-60 with ATRA is accompanied by loss of clonogenicity (control cells: 870 colonies/10(3) cells, cells preincubated with ATRA: 150 colonies/10(3) cells). D0 for undifferentiated cells was 2.35 Gy, for ATRA differentiated cells 2.46 Gy. Statistical comparison of clonogenity curves indicated that in the whole range 0.5-10 Gy the curves are not significantly different, however, in the range 0.5-3 Gy ATRA differentiated cells were significantly more radioresistant than non-differentiated cells. When HL-60 cells preincubated with 1 micromol/l ATRA were irradiated by a sublethal dose of 6 Gy, more marked increase of apoptotic cells number was observed 24 h after irradiation and the surviving cells were mainly in the G1 phase of the cell cycle, while only irradiated cells were accumulated in G(2) phase. Our results imply that preincubation of cells with ATRA accelerates apoptosis occurrence (24 h) after irradiation by high sublethal dose of 6 Gy. Forty-eight hours after 6 Gy irradiation, late apoptotic cells were found in the group of ATRA pretreated cells, as determined by APO2.7 positivity. This test showed an increased effect (considering cell death induction) in comparison to ATRA or irradiation itself.
Rapid DNA replication origin licensing protects stem cell pluripotency
Matson, Jacob Peter; Dumitru, Raluca; Coryell, Philip; Baxley, Ryan M; Chen, Weili; Twaroski, Kirk; Webber, Beau R; Tolar, Jakub; Bielinsky, Anja-Katrin; Purvis, Jeremy E
2017-01-01
Complete and robust human genome duplication requires loading minichromosome maintenance (MCM) helicase complexes at many DNA replication origins, an essential process termed origin licensing. Licensing is restricted to G1 phase of the cell cycle, but G1 length varies widely among cell types. Using quantitative single-cell analyses, we found that pluripotent stem cells with naturally short G1 phases load MCM much faster than their isogenic differentiated counterparts with long G1 phases. During the earliest stages of differentiation toward all lineages, MCM loading slows concurrently with G1 lengthening, revealing developmental control of MCM loading. In contrast, ectopic Cyclin E overproduction uncouples short G1 from fast MCM loading. Rapid licensing in stem cells is caused by accumulation of the MCM loading protein, Cdt1. Prematurely slowing MCM loading in pluripotent cells not only lengthens G1 but also accelerates differentiation. Thus, rapid origin licensing is an intrinsic characteristic of stem cells that contributes to pluripotency maintenance. PMID:29148972
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomisawa, N.
1989-07-04
This patent describes a spark ignition timing control system for an internal combustion engine, it comprises: sensor means monitoring preselected parameters for producing a sensor signal; first means for deriving a spark ignition timing on the basis of data contained in the sensor signal; second means for detecting an engine acceleration demand for producing an accelerating condition indicative signal; and third means, responsive to the accelerating condition indicative signal, for modifying the spark ignition timing derived by the first means after expiration of a first predetermined period of time of occurence of the accelerating condition indicative signal, in such amore » manner that the spark ignition timing is advanced and retarded for suppressing cycle-to-cycle fluctuation of engine speed and for smoothly increasing engine speed.« less
The clock is ticking. Ageing of the circadian system: From physiology to cell cycle.
Terzibasi-Tozzini, Eva; Martinez-Nicolas, Antonio; Lucas-Sánchez, Alejandro
2017-10-01
The circadian system is the responsible to organise the internal temporal order in relation to the environment of every process of the organisms producing the circadian rhythms. These rhythms have a fixed phase relationship among them and with the environment in order to optimise the available energy and resources. From a cellular level, circadian rhythms are controlled by genetic positive and negative auto-regulated transcriptional and translational feedback loops, which generate 24h rhythms in mRNA and protein levels of the clock components. It has been described about 10% of the genome is controlled by clock genes, with special relevance, due to its implications, to the cell cycle. Ageing is a deleterious process which affects all the organisms' structures including circadian system. The circadian system's ageing may produce a disorganisation among the circadian rhythms, arrhythmicity and, even, disconnection from the environment, resulting in a detrimental situation to the organism. In addition, some environmental conditions can produce circadian disruption, also called chronodisruption, which may produce many pathologies including accelerated ageing. Finally, some strategies to prevent, palliate or counteract chronodisruption effects have been proposed to enhance the circadian system, also called chronoenhancement. This review tries to gather recent advances in the chronobiology of the ageing process, including cell cycle, neurogenesis process and physiology. Copyright © 2017 Elsevier Ltd. All rights reserved.
Strong, Amy L.; Bowles, Annie C.; MacCrimmon, Connor P.; Lee, Stephen J.; Frazier, Trivia P.; Katz, Adam J.; Gawronska-Kozak, Barbara; Bunnell, Bruce A.
2015-01-01
Background: As the world’s population lives longer, the number of individuals at risk for pressure ulcers will increase considerably in the coming decades. In developed countries, up to 18% of nursing home residents suffer from pressure ulcers and the resulting hospital costs can account for up to 4% of a nation’s health care budget. Although full-thickness surgical skin wounds have been used as a model, preclinical rodent studies have demonstrated that repeated cycles of ischemia and reperfusion created by exposure to magnets most closely mimic the human pressure ulcer condition. Methods: This study uses in vivo and in vitro quantitative parameters to characterize the temporal kinetics and histology of pressure ulcers in young, female C57BL/6 mice exposed to 2 or 3 ischemia-reperfusion cycles. This pressure ulcer model was validated further in studies examining the efficacy of adipose-derived stromal/stem cell administration. Results: Optimal results were obtained with the 2-cycle model based on the wound size, histology, and gene expression profile of representative angiogenic and reparative messenger RNAs. When treated with adipose-derived stromal/stem cells, pressure ulcer wounds displayed a dose-dependent and significant acceleration in wound closure rates and improved tissue histology. Conclusion: These findings document the utility of this simplified preclinical model for the evaluation of novel tissue engineering and medical approaches to treat pressure ulcers in humans. PMID:25878945
Lima, Kelly Goulart; Krause, Gabriele Catyana; da Silva, Elisa Feller Gonçalves; Xavier, Léder Leal; Martins, Léo Anderson Meira; Alice, Laura Manzoli; da Luz, Luiza Bueno; Gassen, Rodrigo Benedetti; Filippi-Chiela, Eduardo Cremonese; Haute, Gabriela Viegas; Garcia, Maria Claudia Rosa; Funchal, Giselle Afonso; Pedrazza, Leonardo; Reghelin, Camille Kirinus; de Oliveira, Jarbas Rodrigues
2018-04-01
Octyl gallate (OG) is an antioxidant that has shown anti-tumor, anti-diabetic and anti-amyloidogenic activities. Mitochondria play an important role in hepatocellular carcinoma, mainly by maintaining accelerated cellular proliferation through the production of ATP. Thus, the mitochondria may be a target for antitumor therapies. Here, we investigated the effects of OG in the hepatocarcinoma cell line (HepG2) and the mechanisms involved. We report, for the first time, that treatment with OG for 24h inhibited HepG2 cell growth by decreasing mitochondrial activity and mass, which led to the reduction of ATP levels. This reduction in the energy supply triggered a decrease in Ki67 protein expression, leading cells to cycle arrest. In addition, treatment with two doses of OG for 48h induced loss of mitochondrial functionality, mitochondrial swelling and apoptosis. Finally, we report that HepG2 cells had no resistance to treatment after multiple doses. Collectively, our findings indicate that metabolic dysregulation and Ki67 protein reduction are key events in the initial anti-proliferative action of OG, whereas mitochondrial swelling and apoptosis induction are involved in the action mechanism of OG after prolonged exposure. This suggests that OG targets mitochondria, thus representing a candidate for further research on therapies for hepatocarcinoma. Copyright © 2017 Elsevier Ltd. All rights reserved.
Balsalobre-Fernández, Carlos; Tejero-González, Carlos Mª; del Campo-Vecino, Juan; Alonso-Curiel, Dionisio
2013-01-01
The aim of this study was to determine the effects of a power training cycle on maximum strength, maximum power, vertical jump height and acceleration in seven high-level 400-meter hurdlers subjected to a specific training program twice a week for 10 weeks. Each training session consisted of five sets of eight jump-squats with the load at which each athlete produced his maximum power. The repetition maximum in the half squat position (RM), maximum power in the jump-squat (W), a squat jump (SJ), countermovement jump (CSJ), and a 30-meter sprint from a standing position were measured before and after the training program using an accelerometer, an infra-red platform and photo-cells. The results indicated the following statistically significant improvements: a 7.9% increase in RM (Z=−2.03, p=0.021, δc=0.39), a 2.3% improvement in SJ (Z=−1.69, p=0.045, δc=0.29), a 1.43% decrease in the 30-meter sprint (Z=−1.70, p=0.044, δc=0.12), and, where maximum power was produced, a change in the RM percentage from 56 to 62% (Z=−1.75, p=0.039, δc=0.54). As such, it can be concluded that strength training with a maximum power load is an effective means of increasing strength and acceleration in high-level hurdlers. PMID:23717361
Balsalobre-Fernández, Carlos; Tejero-González, Carlos M; Del Campo-Vecino, Juan; Alonso-Curiel, Dionisio
2013-03-01
The aim of this study was to determine the effects of a power training cycle on maximum strength, maximum power, vertical jump height and acceleration in seven high-level 400-meter hurdlers subjected to a specific training program twice a week for 10 weeks. Each training session consisted of five sets of eight jump-squats with the load at which each athlete produced his maximum power. The repetition maximum in the half squat position (RM), maximum power in the jump-squat (W), a squat jump (SJ), countermovement jump (CSJ), and a 30-meter sprint from a standing position were measured before and after the training program using an accelerometer, an infra-red platform and photo-cells. The results indicated the following statistically significant improvements: a 7.9% increase in RM (Z=-2.03, p=0.021, δc=0.39), a 2.3% improvement in SJ (Z=-1.69, p=0.045, δc=0.29), a 1.43% decrease in the 30-meter sprint (Z=-1.70, p=0.044, δc=0.12), and, where maximum power was produced, a change in the RM percentage from 56 to 62% (Z=-1.75, p=0.039, δc=0.54). As such, it can be concluded that strength training with a maximum power load is an effective means of increasing strength and acceleration in high-level hurdlers.
Calculations of the Acceleration of Centrifugal Loading on Adherent Cells
NASA Astrophysics Data System (ADS)
Chen, Kang; Song, Yang; Liu, Qing; Zhang, Chunqiu
2017-07-01
Studies have shown that the morphology and function of living cells are greatly affected by the state of different high acceleration. Based on the centrifuge, we designed a centrifugal cell loading machine for the mechanical biology of cells under high acceleration loading. For the machine, the feasibility of the experiment was studied by means of constant acceleration or variable acceleration loading in the Petri dish fixture and/or culture flask. Here we analyzed the distribution of the acceleration of the cells with the change of position and size of the culturing device quantitatively. It is obtained that Petri dish fixture and/or culture flask can be used for constant acceleration loading by experiments; the centripetal acceleration of the adherent cells increases with the increase of the distance between the rotor center of the centrifuge and the fixture of the Petri dish and the size of the fixture. It achieves the idea that the general biology laboratory can conduct the study of mechanical biology at high acceleration. It also provides a basis for more accurate study of the law of high acceleration on mechanobiology of cells.
The Fate of a Normal Human Cell Traversed by a Single Charged Particle
NASA Astrophysics Data System (ADS)
Fournier, C.; Zahnreich, S.; Kraft, D.; Friedrich, T.; Voss, K.-O.; Durante, M.; Ritter, S.
2012-09-01
The long-term ``fate'' of normal human cells after single hits of charged particles is one of the oldest unsolved issues in radiation protection and cellular radiobiology. Using a high-precision heavy-ion microbeam we could target normal human fibroblasts with exactly one or five carbon ions and measured the early cytogenetic damage and the late behaviour using single-cell cloning. Around 70% of the first cycle cells presented visible aberrations in mFISH after a single ion traversal, and about 5% of the cells were still able to form colonies. In one third of selected high-proliferative colonies we observed clonal (radiation-induced) aberrations. Terminal differentiation and markers of senescence (PCNA, p16) in the descendants of cells traversed by one carbon ion occurred earlier than in controls, but no evidence of radiation-induced chromosomal instability was found. We conclude that cells surviving single-ion traversal, often carrying clonal chromosome aberrations, undergo accelerated senescence but maintain chromosomal stability.
The Fate of a Normal Human Cell Traversed by a Single Charged Particle
Fournier, C.; Zahnreich, S.; Kraft, D.; Friedrich, T.; Voss, K.-O.; Durante, M.; Ritter, S.
2012-01-01
The long-term “fate” of normal human cells after single hits of charged particles is one of the oldest unsolved issues in radiation protection and cellular radiobiology. Using a high-precision heavy-ion microbeam we could target normal human fibroblasts with exactly one or five carbon ions and measured the early cytogenetic damage and the late behaviour using single-cell cloning. Around 70% of the first cycle cells presented visible aberrations in mFISH after a single ion traversal, and about 5% of the cells were still able to form colonies. In one third of selected high-proliferative colonies we observed clonal (radiation-induced) aberrations. Terminal differentiation and markers of senescence (PCNA, p16) in the descendants of cells traversed by one carbon ion occurred earlier than in controls, but no evidence of radiation-induced chromosomal instability was found. We conclude that cells surviving single-ion traversal, often carrying clonal chromosome aberrations, undergo accelerated senescence but maintain chromosomal stability. PMID:22966418
[Effect of EMP-1 gene on human esophageal cancer cell line].
Wang, Hai-tao; Liu, Zhi-hua; Wang, Xiu-qin; Wu, Min
2002-03-01
EMP-1 was selected from a series of differential expressed genes obtained from cDNA microarray in the authors' lab. Epithelial membrane pnteiu-1 gene (EMP-1) was expressed 6 fold lower in esophageal cancer than in normal tissue. The authors further designed the experiment to study the effect of human EMP-1 gene on human esophageal cancer cell line in order to explain the function of this gene on the carcinogensis and progression esophageal cancer. EMP-1 gene was cloned into eukaryotic vector and transfected into the human esophageal cancer cell line. The transfection effect was qualified by Western blot and RT-PCR method. The cell growth curve was observed and the cell cycle was checked by FACS method. EMP-1 was transfected into EC9706 cell line and its expression was up-regulated. The cell growth is accelerated and expression of EMP-1 is linked to induction of S phase arrest. EMP-1 gene has some relationship with carcinogenesis of esophagus.
COP9 Signalosome Subunit Csn8 Is Involved in Maintaining Proper Duration of the G1 Phase*
Liu, Cheng; Guo, Li-Quan; Menon, Suchithra; Jin, Dan; Pick, Elah; Wang, Xuejun; Deng, Xing Wang; Wei, Ning
2013-01-01
The COP9 signalosome (CSN) is a conserved protein complex known to be involved in developmental processes of eukaryotic organisms. Genetic disruption of a CSN gene causes arrest during early embryonic development in mice. The Csn8 subunit is the smallest and the least conserved subunit, being absent from the CSN complex of several fungal species. Nevertheless, Csn8 is an integral component of the CSN complex in higher eukaryotes, where it is essential for life. By characterizing the mouse embryonic fibroblasts (MEFs) that express Csn8 at a low level, we found that Csn8 plays an important role in maintaining the proper duration of the G1 phase of the cell cycle. A decreased level of Csn8, either in Csn8 hypomorphic MEFs or following siRNA-mediated knockdown in HeLa cells, accelerated cell growth rate. Csn8 hypomorphic MEFs exhibited a shortened G1 duration and affected expression of G1 regulators. In contrast to Csn8, down-regulation of Csn5 impaired cell proliferation. Csn5 proteins were found both as a component of the CSN complex and outside of CSN (Csn5-f), and the amount of Csn5-f relative to CSN was increased in the Csn8 hypomorphic cells. We conclude that CSN harbors both positive and negative regulators of the cell cycle and therefore is poised to influence the fate of a cell at the crossroad of cell division, differentiation, and senescence. PMID:23689509
Spatio-temporal radiation biology with conventionally or laser-accelerated particles for ELIMED
NASA Astrophysics Data System (ADS)
Ristić-Fira, A.; Bulat, T.; Keta, O.; Romano, F.; Cirrone, P.; Cuttone, G.; Petrović, I.
2013-07-01
The aim of this study is to investigate the behavior of radio-resistant human malignant cells, thus enabling better understanding of radiobiological effects of ions in such a case. Radiation sources such as accelerated continuous ion beams and laser technology-based ultra short radiation sources with energy of around 10 MeV will be used. The HTB140 melanoma cells are chosen since it has been shown that they represent the limit case of cellular radio-resistance among the studied tumor cell lines. These cells are particularly interesting as they provide data on the very edge of inactivation capacity of each beam line that is tested. After exposing the cell monolayers to continuous radiations of low (γ-rays) and high (protons) linear energy transfer, the kinetics of disappearance of the phosphorylated histone H2AX (γ-H2AX) foci per cell will be determined. The same procedure will be performed with the pulsed high dose rate protons. Detection and quantification of γ-H2AX foci will be performed by immunohistochemical 3D time-dependent imaging analyses using laser scanning confocal microscopy. Immunoblotting will enable the follow-up of the relation between γ-H2AX and cell cycle arrest via the p53/p21 pathway. In such a way the spatio-temporal changes on sub-cellular level will be visualized, quantified and compared. These results will show whether there is a difference in the effects on cells between continuous and pulsed irradiation mode. Therefore, they will contribute to the data base that might promote pulsed sources for medical treatments of malignant growths.
Do ungulates accelerate or decelerate nitrogen cycling?
Singer, F.J.; Schoenecker, K.A.
2003-01-01
Nitrogen (N) is an essential nutrient for plants and animals, and N may be limiting in many western US grassland and shrubland ungulate winter ranges. Ungulates may influence N pools and they may alter N inputs and outputs (losses) to the ecosystem in a number of ways. In this paper we compare the ecosystem effects of ungulate herbivory in two western national parks, Rocky Mountain National Park (RMNP), Colorado, and Yellowstone National Park (YNP), Wyoming. We compare ungulate herbivory effects on N pools, N fluxes, N yields, and plant productivity in the context of the accelerating and decelerating nutrient cycling scenarios [Ecology 79 (1998) 165]. We concluded that the YNP grasslands fit the accelerating nutrient cycling scenario for ungulate herbivory: in response to grazing, grassland plant species abundance was largely unaltered, net annual aboveground primary productivity (NAPP) was stimulated (except during drought), consumption of key N-rich forages by ungulates was moderate and their abundance was sustained, soil N mineralization rates doubled, N pools increased, aboveground N yield increased, and N concentrations increased in most grassland plant species. Grazing in grasslands in RMNP resulted in no consistent detectable acceleration or deceleration of nutrient cycling. Grazing effects in short willow and aspen vegetation types in RMNP fit the decelerating nutrient cycling scenario of Ritchie et al. [Ecology 79 (1998) 165]. Key N-rich forages declined due to herbivory (willows, aspen, herbaceous vegetation). Aboveground production declined, soil N mineralization rates declined, N pools declined (NO3− pools were 30% that of ungrazed controls), and aboveground N yield declined. We believe that the higher ungulate densities and rates of plant consumption in RMNP, large declines in N-rich forage plants, and possibly a tendency of ungulates to move N from willow and aspen vegetation types to other types in RMNP, contributed to deceleration of nutrient cycling in two vegetation types in RMNP compared to acceleration in grasslands in YNP.
Wang, Ying; Chen, Jiarui; Tang, Weiqing; Zhang, Yanping; Li, Xiaoyan
2017-01-01
FABP4 is widely expressed in both normal and pathologic tissues. It promotes cell proliferation, survival and migration of endothelial cells, and therefore, angiogenesis. However, the role of FABP4 in hemangioma or hemangioma endothelial cells (HemECs) has not been explored. In this study, we investigated whether FABP4 directly regulates the proliferation of HemECs. The expression of cell cycle checkpoint genes was analyzed with the microarray data of human dermal microvascular endothelial cells (HDVECs) and infantile hemangioma endothelial cells. Real-time RT-PCR and western blotting were used to examine the expression of FABP4 in HemECs. Next, the FABP4 expression was inhibited in HemECs using siRNA or rapamycin and upregulated using retroviral transduction of HemECs to assess its influence on proliferation of HemECs. The microarray data showed that cell cycle checkpoint genes were upregulated in HemECs. Moreover, HemECs showed significantly higher proliferation rates than HDVECs. The expression of FABP4 and mTOR was increased in the HemECs. While FABP4 knockdown reduced the BrdU incorporation and cell number of HemECs as expected, cell proliferation was accelerated by FABP4 over-expression. Moreover, rapamycin (10nM) inhibited mTOR-FABP4 signaling and HemEC proliferation. Taken together, these results indicated that mTOR signaling pathway-activated FABP4 directly regulates the proliferation of endothelial cells in hemangioma. Rapamycin and inhibitors of FABP4 have therapeutic potential for treating infantile hemangiomas. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
A 1 GeV CW FFAG High Intensity Proton Driver
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnstone, C.; Sheehy, S. L.
2012-05-01
The drive for high beam power, high duty cycle, and reliable beams at reasonable cost has focused world attention on fixed-field accelerators, notably Fixed-Field Alternating Gradient accelerators (FFAGs). High-intensity GeV proton drivers are of particular interest, as these encounter duty cycle and space-charge limits in the synchrotron and machine size concerns in the weaker-focusing cyclotron. Recently, the concept of isochronous orbits has been explored and developed for non-scaling FFAGs using powerful new methodologies in FFAG accelerator design. These new breeds of FFAGs have been identified by international collaborations for serious study thanks to their potential applications including Accelerator Driven Subcriticalmore » Reactors (ADS) a nd Accelerator Transmutation of Waste. The extreme reliability requirements for ADS mandate CW operation capability and the FFAG s strong focusing, particularly in the vertical, will serve to mitigate the effect of space charge (as compared with the weak- focusing cyclotron). This paper reports on these new advances in FFAG accelerator technology and presents a stable, 0.25-1GeV isochronous FFAG for an accelerator driven subcritical reactor.« less
Degradation and biocompatibility of multi-stage nanovectors in physiological systems
Martinez, Jonathan O.; Evangelopoulos, Michael; Chiappini, Ciro; Liu, Xuewu; Ferrari, Mauro; Tasciotti, Ennio
2014-01-01
The careful scrutiny of drug delivery systems is essential to evaluate and justify their potential for the clinic. Among the various studies necessary for pre-clinical testing, the impact of degradation is commonly overlooked. In this paper, we investigate the effect of fabrication (porosity and nucleation layer) and environment (buffer and pH) factors on the degradation kinetics of multi-stage nanovectors (MSV) composed of porous silicon. The degradation by-products of MSV were exposed to endothelial cells and analyzed for detrimental effects on cellular internalization, architecture, proliferation, and cell cycle. Increases in porosity resulted in accelerated degradation exhibiting smaller sized particles at comparable times. Removal of the nucleation layer (thin layer of small pores formed during the initial steps of etching) triggered a premature collapse of the entire central porous region of MSV. Variations in buffers prompted a faster degradation rate yielding smaller MSV within faster time frames while increases in pH stimulated erosion of MSV and thus faster degradation. In addition, exposure to these degradation by-products provoked negligible impact on the proliferation and cell cycle phases on primary endothelial cells. Here, we propose methods that lay the foundation for future investigations towards understanding the impact of the degradation of drug delivery platforms. PMID:25269799
Results of Long Term Life Tests of Large Scale Lithium-Ion Cells
NASA Astrophysics Data System (ADS)
Inoue, Takefumi; Imamura, Nobutaka; Miyanaga, Naozumi; Yoshida, Hiroaki; Komada, Kanemi
2008-09-01
High energy density Li-ion cells have been introduced to latest satellites and another space usage. We have started development of large scale Li-ion cells for space applications in 1997. The chemical design was fixed in 1999.It is very important to confirm life performance to apply satellite applications because it requires long mission life such as 15 years for GEO and 5 to 7 years for LEO. Therefore we started life test at various conditions. And the tests have reached 8 to 9 years in actual calendar time. Semi - accelerated GEO tests which gives both calendar and cycle loss have been reached 42 season that corresponds 21 years in orbit. The specific energy range is 120 - 130 Wh/kg at EOL. According to the test results, we have confirmed that our Li-ion cell meets general requirements for space application such as GEO and LEO with quite high specific energy.
Selective Cytotoxicity of Rhodium Metalloinsertors in Mismatch Repair-Deficient Cells†
Ernst, Russell J.; Komor, Alexis C.; Barton, Jacqueline K.
2011-01-01
Mismatches in DNA occur naturally during replication and as a result of endogenous DNA damaging agents, but the mismatch repair (MMR) pathway acts to correct mismatches before subsequent rounds of replication. Rhodium metalloinsertors bind to DNA mismatches with high affinity and specificity and represent a promising strategy to target mismatches in cells. Here we examine the biological fate of rhodium metalloinsertors bearing dipyridylamine ancillary ligands in cells deficient in MMR versus those that are MMR-proficient. These complexes are shown to exhibit accelerated cellular uptake which permits the observation of various cellular responses, including disruption of the cell cycle, monitored by flow cytometry assays, and induction of necrosis, monitored by dye exclusion and caspase inhibition assays, that occur preferentially in the MMR-deficient cell line. These cellular responses provide insight into the mechanisms underlying the selective activity of this novel class of targeted anti-cancer agents. PMID:22103240
Erol, Almila; Winham, Stacey J; McElroy, Susan L; Frye, Mark A; Prieto, Miguel L; Cuellar-Barboza, Alfredo B; Fuentes, Manuel; Geske, Jennifer; Mori, Nicole; Biernacka, Joanna M; Bobo, William V
2015-09-01
To examine the independent effects of sex on the risk of rapid cycling and other indicators of adverse illness course in patients with bipolar I disorder (BP-I) or bipolar II disorder (BP-II). We analyzed data from the first 1,225 patients enrolled in the Mayo Clinic Individualized Medicine Biobank for Bipolar Disorder. Demographic and clinical variables were ascertained using standardized questionnaires; height and weight were assessed to determine body mass index (BMI). Rates of rapid cycling, cycle acceleration, and increased severity of mood episodes over time were compared between women and men overall and within subgroups defined by bipolar disorder subtype (BP-I or BP-II). Multiple logistic regression analysis was used to assess the independent effect of sex on the risk of these indicators of adverse illness course. Women had significantly higher rates of rapid cycling than men. Overall rates of rapid cycling were higher in patients with BP-II than BP-I; and sex differences in the rate of rapid cycling were more pronounced in patients with BP-II than BP-I, although the power to detect statistically significant differences was reduced due to the lower sample size of subjects with BP-II. Female sex was a significant predictor of rapid cycling, cycle acceleration, and increased severity of mood episodes over time after adjusting for age, bipolar disorder subtype, BMI, having any comorbid psychiatric disorder, and current antidepressant use. Female sex was associated with significantly higher risk of rapid cycling, cycle acceleration, and increased severity of mood episodes over time in a sample of 1,225 patients with bipolar disorders. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The dynamics of two linearly coupled Goodwin oscillators
NASA Astrophysics Data System (ADS)
Antonova, A. O.; Reznik, S. N.; Todorov, M. D.
2017-10-01
In this paper the Puu model of the interaction of Goodwin's business cycles for two regions is reconsidered. We investigated the effect of the accelerator coefficients and the Hicksian 'ceiling' and 'floor' parameters on the time dynamics of incomes for different values of marginal propensity to import. The cases when the periods of isolated Goodwin's cycles are close, and when they differ approximately twice are considered. By perturbation theory we obtained the formulas for slowly varying amplitudes and phase difference of weakly nonlinear coupled Goodwin oscillations. The coupled oscillations of two Goodwin's cycles with piecewise linear accelerators with only 'floor' are considered.
2012-01-01
Background Various by-products of the cellular metabolism, such as reactive carbonyl species (RCS) are potentially harmful to cells and tissues, and play a role in many physiological and pathological processes. Among various RCS is the highly reactive dicarbonyl glyoxal (GO), which is a natural physiological metabolite produced by the auto-oxidation of glucose, and can form covalent adducts known as advanced glycation endproducts (AGE). We have previously reported that GO accelerates ageing and causes premature senescence in normal human skin fibroblasts. Results Using a bone marrow-derived telomerase-immortalised mesenchymal stem cell line hMSC-TERT we have observed that an exposure of cells to 0.75 mM and 1 mM GO induces irreversible cellular senescence within 3 days. Induction of senescence in hMSC-TERT was demonstrated by a variety of markers, including characteristic cell morphology and enlargement, vacuolisation, multinucleation, induction of senescence associated β-galactosidase, cell cycle arrest, and increased levels of a cell cycle inhibitor p16. These changes were accompanied by increased extent of DNA breaks as measured by the comet assay, and increased levels of the AGE product, carboxymethyl-lysine (CML). Furthermore, the in vitro differentiation potential of hMSC-TERT to become functional osteoblasts was highly reduced in GO-treated stem cells, as determined by alkaline phosphatase (ALP) activity and mineralized matrix (MM) formation. Conclusions The results of our study imply that an imbalanced glucose metabolism can reduce the functioning ability of stem cells in vivo both during ageing and during stem cell-based therapeutic interventions. PMID:22424056
HBeAg-induced miR-106b promotes cell growth by targeting the retinoblastoma gene.
Samal, Jasmine; Kandpal, Manish; Vivekanandan, Perumal
2017-10-30
Chronic HBV infection is a major cause of hepatocellular carcinoma (HCC). The association between hepatitis B "e" antigen (HBeAg) and HCC is well-established by epidemiological studies. Nonetheless, the biological role of HBeAg in HCC remains enigmatic. We investigate the role of HBeAg in HBV-related HCC. Our findings suggest that HBeAg enhances cell proliferation and accelerates progression from G0/G1 phase to the S phase of the cell cycle in Huh7 cells. Examination of host gene expression and miRNA expression profiles reveals a total of 21 host genes and 12 host miRNAs that were differentially regulated in cells expressing HBeAg. Importantly, HBeAg induced the expression of miR-106b, an oncogenic miRNA. Interestingly, HBeAg-expression results in a significant reduction in the expression of retinoblastoma (Rb) gene, an experimentally validated target of miR-106b. Inhibition of miR-106b significantly increased the expression of the Rb gene, resulting in reduced cell proliferation and slowing of cell cycle progression from the G0/G1 phase to S phase. These observations suggest that the up-regulation of miR-106b by HBeAg contributes to the pathogenesis of HBV-related HCC by down-regulating the Rb gene. Our results highlight a role for HBeAg in HCC and provide a novel perspective on the molecular mechanisms underlying HBV-related HCC.
NASA Astrophysics Data System (ADS)
Watanabe, Shoichiro; Kinoshita, Masahiro; Hosokawa, Takashi; Morigaki, Kenichi; Nakura, Kensuke
2014-07-01
Cycle performance at 60 °C for a Li Al0.10Ni0.76Co0.14O2 (NCA) cathode/graphite cell was greatly improved when a DOD range in charge-discharge cycling (ΔDOD) was restricted. The deterioration mechanism was analyzed by X-ray photoelectron spectroscopy (XPS), high-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) and scanning transmission electron microscopy-electron energy-loss spectroscopy (STEM-EELS). Only after the cycle test in the ΔDOD of 0-100%, many micro-cracks were generated in the inter-surface between the primary particles which aggregated to form the secondary particles, and a NiO-like resistance layer with Fm3m rock salt structure was formed on each primary particle which was contact with other primary particles and electrolyte. It can be concluded that the lack of contact between the primary particles with the micro-crack generation and the formation of the new resistance layer are responsible for the capacity fading and the rise in impedance during charge-discharge cycle in the wide ΔDOD.
Effect of Reprocessing and Accelerated Weathering on Impact-Modified Recycled Blend
NASA Astrophysics Data System (ADS)
Ramesh, V.; Mohanty, Smita; Biswal, Manoranjan; Nayak, Sanjay K.
2015-12-01
Recovery of recycled polycarbonate, acrylonitrile butadiene styrene, high-impact polystyrene, and its blends from waste electrical and electronic equipment plastics products properties were enhanced by the addition of virgin polycarbonate and impact modifier. The optimized blend formulation was processed through five cycles, at processing temperature, 220-240 °C and accelerated weathering up to 700 h. Moreover, the effect of reprocessing and accelerated weathering in the physical properties of the modified blends was investigated by mechanical, thermal, rheological, and morphological studies. The results show that in each reprocessing cycle, the tensile strength and impact strength decreased significantly and the similar behavior has been observed from accelerated weathering. Subsequently, the viscosity decreases and this decrease becomes the effect of thermal and photo-oxidative degradation. This can be correlated with FTIR analysis.
Tan, Shu-Tao; Liu, Sheng-Ye; Wu, Bin
2016-10-01
TRIM29 overexpression has been reported in several human malignancies and showed correlation with cancer cell malignancy. The aim of the current study is to examine its clinical significance and biological roles in human bladder cancer tissues and cell lines. A total of 102 cases of bladder cancer tissues were examined for TRIM29 expression by immunohistochemistry. siRNA and plasmid transfection were performed in 5637 and BIU-87 cell lines. Cell Counting Kit-8, flow cytometry, western blot, and real-time polymerase chain reaction were performed to examine its biological roles and mechanism in bladder cancer cells. We found that TRIM29 overexpression showed correlation with invading depth (p=0.0087). Knockdown of TRIM29 expression in bladder cancer cell line 5637 inhibited cell growth rate and cell cycle transition while its overexpression in BIU-87 cells accelerated cell proliferation and cell cycle progression. TRIM29 overexpression also inhibited cell apoptosis induced by cisplatin. In addition, we demonstrated that TRIM29 depletion decreased while its overexpression led to upregulated expression of cyclin D1, cyclin E, and Bcl-2. We also showed that TRIM29 knockdown inhibited protein kinase C (PKC) and nuclear factor κB (NF-κB) signaling while its overexpression stimulated the PKC and NF-κB pathways. BAY 11-7082 (NF-κB inhibitor) partly attenuated the effect of TRIM29 on expression of cyclin and Bcl-2. Treatment with PKC inhibitor staurosporine resulted in ameliorated TRIM29 induced activation of NF-κB. The current study demonstrated that TRIM29 upregulates cyclin and Bcl family proteins level to facilitate malignant cell growth and inhibit drug-induced apoptosis in bladder cancer, possibly through PKC-NF-κB signaling pathways.
Topical application of quercetin improves wound healing in pressure ulcer lesions.
Yin, Guimei; Wang, Zhijing; Wang, Zhaoxia; Wang, Xirui
2018-05-07
The ischemia-reperfusion (I/R) induced skin lesion has been identified as primary cause of pressure ulcers. To date, attempts to prevent pressure ulcers have not produced a significant improvement. Quercetin, one of the most widely distributed flavonoids in fruits and vegetables, exhibits its antioxidant and anti-inflammatory properties against many diseases, including ischemic heart disease, atherosclerosis, and renal injury. In vitro wound scratch assay was first used to assess the function of quercetin in wounding cell model. Next, animal pressure ulcers model was established with two cycles of I/R. The impact of quercetin in the wound recovery, immune cell infiltration and pro-inflammatory cytokines production was investigated in this model. Mechanistic regulation of quercetin at the wound site was also studied. Quercetin accelerated wound closure in cell scratch assay. Dose response study suggested 1 μM quercetin for in vivo study. In I/R injury model, quercetin treatment significantly accelerated wound closure, reduced immune cell infiltration and pro-inflammatory cytokines production. Signaling study showed quercetin treatment inhibited MAPK but not NFĸB activation. Quercetin treatment improved the wound healing process in I/R lesions by suppressing MAPK pathway. Our results supported that quercetin could be a potential therapeutic agent for pressure ulcers. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wientjes, F.B.; Nanninga, N.
1989-06-01
The rate at which the peptidoglycan of Escherichia coli is synthesized during the division cycle was studied with two methods. One method involved synchronization of E. coli MC4100 lysA cultures by centrifugal elutriation and subsequent pulse-labeling of the synchronously growing cultures with (meso-{sup 3}H)diaminopimelic acid (({sup 3}H)Dap). The second method was autoradiography of cells pulse-labeled with ({sup 3}H)Dap. It was found that the peptidoglycan is synthesized at a more or less exponentially increasing rate during the division cycle with a slight acceleration in this rate as the cells start to constrict. Apparently, polar cap formation requires synthesis of extra surfacemore » components, presumably to accommodate for a change in the surface-to-volume ratio. Furthermore, it was found that the pool size of Dap was constant during the division cycle. Close analysis of the topography of ({sup 3}H)Dap incorporation at the constriction site revealed that constriction proceeded by synthesis of peptidoglycan at the leading edge of the invaginating cell envelope. During constriction, no reallocation of incorporation occurred, i.e., the incorporation at the leading edge remained high throughout the process of constriction. Impairment of penicillin-binding protein 3 by mutation or by the specific {beta}-lactam antibiotic furazlocillin did not affect ({sup 3}H)Dap incorporation during initiation of constriction. However, the incorporation at the constriction site was inhibited in later stages of the constriction process. It is concluded that during division at least two peptidoglycan-synthesizing systems are operating sequentially.« less
The effect of SiO2/Au core-shell nanoparticles on breast cancer cell's radiotherapy.
Darfarin, Ghazal; Salehi, Roya; Alizadeh, Effat; Nasiri Motlagh, Behnam; Akbarzadeh, Abolfazl; Farajollahi, Alireza
2018-05-09
Recently it has been shown that radiation dose enhancement could be achievable in radiotherapy using nanoparticles (NPs). In this study, evaluation was made to determine efficiency of gold-silica shell-core NP in megavoltage irradiation of MCF7 breath cancer cells. Gold-silicon oxide shell-core NPs were obtained by conjugation of gold NP with amine or thiol functionalized silica NPs (AuN@SiO 2 and AuS@SiO 2 ). Cellular uptake and cytotoxicity of NPs were examined by fluorescent microscopy and MTT assay, respectively. MCF-7 breast cancer cells were treated with both NPs and irradiation was made with X-ray energies of 6 and 18 MV to the absorbed dose of 2, 4 and 8 Gy using Simense linear accelerator. The efficiency of radiation therapy was then evaluated by MTT and Brdu assay, DAPI staining and cell cycle analysis. TEM images indicated that synthesized NPs had average diameter of 25 nm. Cellular uptake demonstrated that the internalization of AuS@SiO 2 and AuN@SiO 2 NPs amounted to 18% and 34%, 3 h post treatment, respectively. Nontoxicity of prepared NPs on MCF-7 cells was proved by MTT and Brdu assays as well as DAPI staining and cell cycle studies. The highest enhancement in radiation dose was observed in the cells that irradiated with radiation energy of 18 MV and absorbed of 8 Gy at NPs concentration of 200 ppm. The Brdu findings revealed that the cytotoxicity and apoptosis on MCF-7 cells are dose dependent with a significantly more death in AuN@SiO 2 (amine) exposed cells (p < .05). Analysis also revealed interruption in cell cycle by demonstrating lack of cells, in S phase in amine treated cells (AuN@SiO 2 ) at given dose of 8 Gy using 18 MV X-ray in comparison to thiol treated cells. Based on the results of the study it can be concluded that the gold-silicon oxide shell-core NPs could play an effective role in radiotherapy of MCF-7 breast cancer cells.
Irvine, S E; Dombi, P; Farkas, Gy; Elezzabi, A Y
2006-10-06
Control over basic processes through the electric field of a light wave can lead to new knowledge of fundamental light-matter interaction phenomena. We demonstrate, for the first time, that surface-plasmon (SP) electron acceleration can be coherently controlled through the carrier-envelope phase (CEP) of an excitation optical pulse. Analysis indicates that the physical origin of the CEP sensitivity arises from the electron's ponderomotive interaction with the oscillating electromagnetic field of the SP wave. The ponderomotive electron acceleration mechanism provides sensitive (nJ energies), high-contrast, single-shot CEP measurement capability of few-cycle laser pulses.
Shi, Lei; Young, Trevor L; Kim, Jincheol; Sheng, Yun; Wang, Lei; Chen, Yifeng; Feng, Zhiqiang; Keevers, Mark J; Hao, Xiaojing; Verlinden, Pierre J; Green, Martin A; Ho-Baillie, Anita W Y
2017-08-02
Metal halide perovskite solar cells (PSCs) have undergone rapid progress. However, unstable performance caused by sensitivity to environmental moisture and high temperature is a major impediment to commercialization of PSCs. In the present work, a low-temperature, glass-glass encapsulation technique using high performance polyisobutylene (PIB) as the moisture barrier is investigated on planar glass/FTO/TiO 2 /FAPbI 3 /PTAA/gold perovskite solar cells. PIB was applied as either an edge seal or blanket layer. Electrical connections to the encapsulated PSCs were provided by either the FTO or Au layers. Results of a "calcium test" demonstrated that a PIB edge-seal effectively prevents moisture ingress. A shelf life test was performed and the PIB-sealed PSC was stable for at least 200 days. Damp heat and thermal cycling tests, in compliance with IEC61215:2016, were used to evaluate different encapsulation methods. Current-voltage measurements were performed regularly under simulated AM1.5G sunlight to monitor changes in PCE. The best results we have achieved to date maintained the initial efficiency after 540 h of damp heat testing and 200 thermal cycles. To the best of the authors' knowledge, these are among the best damp heat and thermal cycle test results for perovskite solar cells published to date. Given the modest performance of the cells (8% averaged from forward and reverse scans) especially with the more challenging FAPbI 3 perovskite material tested in this work, it is envisaged that better stability results can be further achieved when higher performance perovskite solar cells are encapsulated using the PIB packaging techniques developed in this work. We propose that heat rather than moisture was the main cause of our PSC degradation. Furthermore, we propose that preventing the escape of volatile decomposition products from the perovskite solar cell materials is the key for stability. PIB encapsulation is a very promising packaging solution for perovskite solar cells, given its demonstrated effectiveness, ease of application, low application temperature, and low cost.
Cardiopulmonary Responses to Supine Cycling during Short-Arm Centrifugation
NASA Technical Reports Server (NTRS)
Vener, J. M.; Simonson, S. R.; Stocks, J.; Evettes, S.; Bailey, K.; Biagini, H.; Jackson, C. G. R.; Greenleaf, J. E.; Dalton, Bonnie P. (Technical Monitor)
2001-01-01
The purpose of this study was to investigate cardiopulmonary responses to supine cycling with concomitant +G(sub z) acceleration using the NASA/Ames Human Powered Short-Arm Centrifuge (HPC). Subjects were eight consenting males (32+/-5 yrs, 178+/-5 cm, 86.1+/- 6.2 kg). All subjects completed two maximal exercise tests on the HPC (with and without acceleration) within a three-day period. A two tailed t-test with statistical significance set at p less than or equal to 0.05 was used to compare treatments. Peak acceleration was 3.4+/-0.1 G(sub z), (head to foot acceleration). Peak oxygen uptake (VO2(sub peak) was not different between treatment groups (3.1+/-0.1 Lmin(exp -1) vs. 3.2+/-0.1 Lmin(exp -1) for stationary and acceleration trials, respectively). Peak HR and pulmonary minute ventilation (V(sub E(sub BTPS))) were significantly elevated (p less than or equal to 0.05) for the acceleration trial (182+/-3 BPM (Beats per Minute); 132.0+/-9.0 Lmin(exp -1)) when compared to the stationary trial (175+/-3 BPM; 115.5+/-8.5 Lmin(exp -1)). Ventilatory threshold expressed as a percent of VO2(sub peak) was not different for acceleration and stationary trials (72+/-2% vs. 68+/-2% respectively). Results suggest that 3.4 G(sub z) acceleration does not alter VO2(sub peak) response to supine cycling. However, peak HR and V(sub E(sub BTPS)) response may be increased while ventilatory threshold response expressed as a function of percent VO2(sub peak) is relatively unaffected. Thus, traditional exercise prescription based on VO2 response would be appropriate for this mode of exercise. Prescriptions based on HR response may require modification.
Ionic Liquid-Enhanced Solid State Electrolyte Interface (SEI) for Lithium Sulfur Batteries
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Jianming; Gu, Meng; Chen, Honghao
2013-05-16
Li-S battery is a complicated system with many challenges existing before its final market penetration. While most of the reported work for Li-S batteries is focused on the cathode design, we demonstrate in this work that the anode consumption accelerated by corrosive polysulfide solution also critically determines the Li-S cell performance. To validate this hypothesis, ionic liquid (IL) N-methyl-N-butylpyrrolidinium bis(trifluoromethylsulfonyl)imide (Py14TFSI) has been employed to modify the properties of SEI layer formed on Li metal surface in Li-S batteries. It is found that the IL-enhanced passivation film on the lithium anode surface exhibits much different morphology and chemical compositions, effectivelymore » protecting lithium metal from continuous attack by soluble polysulfides. Therefore, both cell impedance and the irreversible consumption of polysulfides on lithium metal are reduced. As a result, the Coulombic efficiency and the cycling stability of Li-S batteries have been greatly improved. After 120 cycles, Li-S battery cycled in the electrolyte containing IL demonstrates a high capacity retention of 94.3% at 0.1 C rate. These results unveil another important failure mechanism for Li-S batteries and shin the light on the new approaches to improve Li-S battery performances.« less
The role of accelerators in the nuclear fuel cycle
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takahashi, Hiroshi.
1990-01-01
The use of neutrons produced by the medium energy proton accelerator (1 GeV--3 GeV) has considerable potential in reconstructing the nuclear fuel cycle. About 1.5 {approximately} 2.5 ton of fissile material can be produced annually by injecting a 450 MW proton beam directly into fertile materials. A source of neutrons, produced by a proton beam, to supply subcritical reactors could alleviate many of the safety problems associated with critical assemblies, such as positive reactivity coefficients due to coolant voiding. The transient power of the target can be swiftly controlled by controlling the power of the proton beam. Also, the usemore » of a proton beam would allow more flexibility in the choice of fuel and structural materials which otherwise might reduce the reactivity of reactors. This paper discusses the rate of accelerators in the transmutation of radioactive wastes of the nuclear fuel cycles. 34 refs., 17 figs., 9 tabs.« less
Enabling large-scale viscoelastic calculations via neural network acceleration
NASA Astrophysics Data System (ADS)
Robinson DeVries, P.; Thompson, T. B.; Meade, B. J.
2017-12-01
One of the most significant challenges involved in efforts to understand the effects of repeated earthquake cycle activity are the computational costs of large-scale viscoelastic earthquake cycle models. Deep artificial neural networks (ANNs) can be used to discover new, compact, and accurate computational representations of viscoelastic physics. Once found, these efficient ANN representations may replace computationally intensive viscoelastic codes and accelerate large-scale viscoelastic calculations by more than 50,000%. This magnitude of acceleration enables the modeling of geometrically complex faults over thousands of earthquake cycles across wider ranges of model parameters and at larger spatial and temporal scales than have been previously possible. Perhaps most interestingly from a scientific perspective, ANN representations of viscoelastic physics may lead to basic advances in the understanding of the underlying model phenomenology. We demonstrate the potential of artificial neural networks to illuminate fundamental physical insights with specific examples.
Results of heavy ion radiotherapy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castro, J.R.
1994-04-01
The potential of heavy ion therapy for clinical use in cancer therapy stems from the biological parameters of heavy charged particles, and their precise dose localization. Biologically, carbon, neon and other heavy ion beams (up to about silicon) are clinically useful in overcoming the radioresistance of hypoxic tumors, thus increasing biological effectiveness relative to low-LET x-ray or electron beams. Cells irradiated by heavy ions show less variation in cell-cycle related radiosensitivity and decreased repair of radiation injury. The physical parameters of these heavy charged particles allow precise delivery of high radiation doses to tumors while minimizing irradiation of normal tissues.more » Clinical use requires close interaction between radiation oncologists, medical physicists, accelerator physicists, engineers, computer scientists and radiation biologists.« less
Repair of DNA damage induced by accelerated heavy ions--a mini review.
Okayasu, Ryuichi
2012-03-01
Increasing use of heavy ions for cancer therapy and concerns from exposure to heavy charged particles in space necessitate the study of the basic biological mechanisms associated with exposure to heavy ions. As the most critical damage induced by ionizing radiation is DNA double strand break (DSB), this review focuses on DSBs induced by heavy ions and their repair processes. Compared with X- or gamma-rays, high-linear energy transfer (LET) heavy ion radiation induces more complex DNA damage, categorized into DSBs and non-DSB oxidative clustered DNA lesions (OCDL). This complexity makes the DNA repair process more difficult, partially due to retarded enzymatic activities, leading to increased chromosome aberrations and cell death. In general, the repair process following heavy ion exposure is LET-dependent, but with nonhomologous end joining defective cells, this trend is less emphasized. The variation in cell survival levels throughout the cell cycle is less prominent in cells exposed to high-LET heavy ions when compared with low LET, but this mechanism has not been well understood until recently. Involvement of several DSB repair proteins is suggested to underlie this interesting phenomenon. Recent improvements in radiation-induced foci studies combined with high-LET heavy ion exposure could provide a useful opportunity for more in depth study of DSB repair processes. Accelerated heavy ions have become valuable tools to investigate the molecular mechanisms underlying repair of DNA DSBs, the most crucial form of DNA damage induced by radiation and various chemotherapeutic agents. Copyright © 2011 UICC.
Li, F Y; Sheng, Z M; Chen, M; Yu, L L; Meyer-ter-Vehn, J; Mori, W B; Zhang, J
2014-10-01
Attosecond bursts of coherent synchrotronlike radiation are found when driving ultrathin relativistic electron disks in a quasi-one-dimensional regime of wakefield acceleration, in which the laser waist is larger than the wake wavelength. The disks of overcritical density shrink radially due to focusing wakefields, thus providing the transverse currents for the emission of an intense, radially polarized, half-cycle pulse of about 100 attoseconds in duration. The electromagnetic pulse first focuses to a peak intensity (7×10(20)W/cm(2)) 10 times larger than the driving pulse and then emerges as a conical beam. Basic dynamics of the radiative process are derived analytically and in agreement with particle-in-cell simulations. By making use of gas targets instead of solids to form the ultrathin disks, this method allows for high repetition rates required for applications.
Cyclin-Dependent Kinase Inhibitors for the Treatment of Breast Cancer: Past, Present, and Future.
DiPippo, Adam J; Patel, Neelam K; Barnett, Chad M
2016-06-01
Treatment of metastatic breast cancer (MBC) that is resistant to endocrine therapy presents a significant clinical challenge. The well-known role of cell cycle dysregulation in these patients is partly mediated by cyclin-dependent kinase (CDK) activity. Specific cyclin and CDK complexes regulate cell cycle progression by managing the transition through the cell cycle, and inhibition of CDKs represents an important target for novel agents. First-generation CDK inhibitors (e.g., flavopiridol) were relatively nonselective and had an unacceptable toxicity profile in early trials. Second-generation CDK inhibitors were designed to target the CDK4 and CDK6 (CDK4/6) pathway and have shown promising clinical activity with an acceptable toxicity profile in patients with MBC. Palbociclib is a first-in-class CDK4/6 inhibitor that was granted accelerated U.S. Food and Drug Administration approval in combination with letrozole for the treatment of MBC in the first-line setting (February 2015) as well as in combination with fulvestrant for MBC that had progressed on previous endocrine therapy (February 2016). Other CDK4/6 inhibitors, including ribociclib and abemaciclib, are under investigation as monotherapy and in combination with endocrine or anti-human epidermal growth receptor 2 therapy for the treatment of MBC. Ongoing clinical trials should provide additional information to guide the appropriate use of these agents and identify patient populations that could derive the most benefit. © 2016 Pharmacotherapy Publications, Inc.
Atg7-Mediated Autophagy Is Involved in the Neural Crest Cell Generation in Chick Embryo.
Wang, Guang; Chen, En-Ni; Liang, Chang; Liang, Jianxin; Gao, Lin-Rui; Chuai, Manli; Münsterberg, Andrea; Bao, Yongping; Cao, Liu; Yang, Xuesong
2018-04-01
Autophagy plays a very important role in numerous physiological and pathological events. However, it still remains unclear whether Atg7-induced autophagy is involved in the regulation of neural crest cell production. In this study, we found the co-location of Atg7 and Pax7 + neural crest cells in early chick embryo development. Upregulation of Atg7 with unilateral transfection of full-length Atg7 increased Pax7 + and HNK-1 + cephalic and trunk neural crest cell numbers compared to either Control-GFP transfection or opposite neural tubes, suggesting that Atg7 over-expression in neural tubes could enhance the production of neural crest cells. BMP4 in situ hybridization and p-Smad1/5/8 immunofluorescent staining demonstrated that upregulation of Atg7 in neural tubes suppressed the BMP4/Smad signaling, which is considered to promote the delamination of neural crest cells. Interestingly, upregulation of Atg7 in neural tubes could significantly accelerate cell progression into the S phase, implying that Atg7 modulates cell cycle progression. However, β-catenin expression was not significantly altered. Finally, we demonstrated that upregulation of the Atg7 gene could activate autophagy as did Atg8. We have also observed that similar phenotypes, such as more HNK-1 + neural crest cells in the unilateral Atg8 transfection side of neural tubes, and the transfection with full-length Atg8-GFP certainly promote the numbers of BrdU + neural crest cells in comparison to the GFP control. Taken together, we reveal that Atg7-induced autophagy is involved in regulating the production of neural crest cells in early chick embryos through the modification of the cell cycle.
Cars Gone Wild: The Major Contributor to Unintended Acceleration in Automobiles is Pedal Error.
Schmidt, Richard A; Young, Douglas E
2010-01-01
"Unintended-acceleration" automobile accidents typically begin when the driver first enters the car, starts the engine, and intends to press his/her right foot on the brake while shifting from Park to a drive gear (Drive or Reverse). The driver reports an unintended (uncommanded) full-throttle acceleration, coupled with a loss of braking, until the episode ends in a crash. Pedal misapplications - where the right foot contacts the accelerator instead of the brake that was intended - have been linked to these accidents (Schmidt, 1989, 1993) which, in the 1980s, were thought to occur only at the start of a driving cycle (and/or with the car in Park). But, in 1997, we identified over 200 pedal errors as the cause of accidents reported in the North Carolina database; these crashes occurred during the driving cycle (Schmidt et al., 1997), and/or with the vehicle in a gear other than Park. Our present work provides a more thorough analysis of these North Carolina Police Accident Reports from 1979 to 1995. The vast majority of pedal misapplications (over 92%) (a) occurred during the driving cycle, (b) were generally in "unhurried" conditions, and (c) were categorically separate from those events referred to as unintended-acceleration episodes at start-up. These ideas are explanatory for the recent (2009-2010) surge of unintended-acceleration reports, perhaps even suggesting that all of these crashes are caused by pedal errors, and that none of them are based on some vehicle defect(s).
BOD1 Is Required for Cognitive Function in Humans and Drosophila
Motazacker, M. Mahdi; Nijhof, Bonnie; Castells-Nobau, Anna; Asztalos, Zoltan; Weißmann, Robert; Behjati, Farkhondeh; Tzschach, Andreas; Felbor, Ute; Scherthan, Harry; Sayfati, Seyed Morteza; Ropers, H. Hilger.; Kahrizi, Kimia; Najmabadi, Hossein; Swedlow, Jason R.; Schenck, Annette; Kuss, Andreas W.
2016-01-01
Here we report a stop-mutation in the BOD1 (Biorientation Defective 1) gene, which co-segregates with intellectual disability in a large consanguineous family, where individuals that are homozygous for the mutation have no detectable BOD1 mRNA or protein. The BOD1 protein is required for proper chromosome segregation, regulating phosphorylation of PLK1 substrates by modulating Protein Phosphatase 2A (PP2A) activity during mitosis. We report that fibroblast cell lines derived from homozygous BOD1 mutation carriers show aberrant localisation of the cell cycle kinase PLK1 and its phosphatase PP2A at mitotic kinetochores. However, in contrast to the mitotic arrest observed in BOD1-siRNA treated HeLa cells, patient-derived cells progressed through mitosis with no apparent segregation defects but at an accelerated rate compared to controls. The relatively normal cell cycle progression observed in cultured cells is in line with the absence of gross structural brain abnormalities in the affected individuals. Moreover, we found that in normal adult brain tissues BOD1 expression is maintained at considerable levels, in contrast to PLK1 expression, and provide evidence for synaptic localization of Bod1 in murine neurons. These observations suggest that BOD1 plays a cell cycle-independent role in the nervous system. To address this possibility, we established two Drosophila models, where neuron-specific knockdown of BOD1 caused pronounced learning deficits and significant abnormalities in synapse morphology. Together our results reveal novel postmitotic functions of BOD1 as well as pathogenic mechanisms that strongly support a causative role of BOD1 deficiency in the aetiology of intellectual disability. Moreover, by demonstrating its requirement for cognitive function in humans and Drosophila we provide evidence for a conserved role of BOD1 in the development and maintenance of cognitive features. PMID:27166630
Zhao, Zhenjun; Johnson, Michael S; Chen, Biyi; Grace, Michael; Ukath, Jaysree; Lee, Vivienne S; McRobb, Lucinda S; Sedger, Lisa M; Stoodley, Marcus A
2016-06-01
OBJECT Stereotactic radiosurgery (SRS) is an established intervention for brain arteriovenous malformations (AVMs). The processes of AVM vessel occlusion after SRS are poorly understood. To improve SRS efficacy, it is important to understand the cellular response of blood vessels to radiation. The molecular changes on the surface of AVM endothelial cells after irradiation may also be used for vascular targeting. This study investigates radiation-induced externalization of phosphatidylserine (PS) on endothelial cells using live-cell imaging. METHODS An immortalized cell line generated from mouse brain endothelium, bEnd.3 cells, was cultured and irradiated at different radiation doses using a linear accelerator. PS externalization in the cells was subsequently visualized using polarity-sensitive indicator of viability and apoptosis (pSIVA)-IANBD, a polarity-sensitive probe. Live-cell imaging was used to monitor PS externalization in real time. The effects of radiation on the cell cycle of bEnd.3 cells were also examined by flow cytometry. RESULTS Ionizing radiation effects are dose dependent. Reduction in the cell proliferation rate was observed after exposure to 5 Gy radiation, whereas higher radiation doses (15 Gy and 25 Gy) totally inhibited proliferation. In comparison with cells treated with sham radiation, the irradiated cells showed distinct pseudopodial elongation with little or no spreading of the cell body. The percentages of pSIVA-positive cells were significantly higher (p = 0.04) 24 hours after treatment in the cultures that received 25- and 15-Gy doses of radiation. This effect was sustained until the end of the experiment (3 days). Radiation at 5 Gy did not induce significant PS externalization compared with the sham-radiation controls at any time points (p > 0.15). Flow cytometric analysis data indicate that irradiation induced growth arrest of bEnd.3 cells, with cells accumulating in the G2 phase of the cell cycle. CONCLUSIONS Ionizing radiation causes remarkable cellular changes in endothelial cells. Significant PS externalization is induced by radiation at doses of 15 Gy or higher, concomitant with a block in the cell cycle. Radiation-induced markers/targets may have high discriminating power to be harnessed in vascular targeting for AVM treatment.
The temperature of quiescent streamers during solar cycles 23 and 24
DOE Office of Scientific and Technical Information (OSTI.GOV)
Landi, E.; Testa, P.
2014-05-20
Recent in-situ determinations of the temporal evolution of the charge state distribution in the fast and slow solar wind have shown a general decrease in the degree of ionization of all the elements in the solar wind along solar cycles 23 and 24. Such a decrease has been interpreted as a cooling of the solar corona which occurred during the decline and minimum phase of solar cycle 23 from 2000 to 2010. In the present work, we investigate whether spectroscopic determinations of the temperature of the quiescent streamers show signatures of coronal plasma cooling during cycles 23 and 24. Wemore » measure the coronal electron density and thermal structure at the base of 60 quiescent streamers observed from 1996 to 2013 by SOHO/SUMER and Hinode/EIS and find that both quantities do now show any significant dependence on the solar cycle. We argue that if the slow solar wind is accelerated from the solar photosphere or chromosphere, the measured decrease in the in-situ wind charge state distribution might be due to an increased efficiency in the wind acceleration mechanism at low altitudes. If the slow wind originates from the corona, a combination of density and wind acceleration changes may be responsible for the in-situ results.« less
2009-01-01
Background Mating changes the mode of action of 17beta-estradiol (E2) to accelerate oviductal egg transport from a nongenomic to a genomic mode, although in both pathways estrogen receptors (ER) are required. This change was designated as intracellular path shifting (IPS). Methods Herein, we examined the subcellular distribution of ESR1 and ESR2 (formerly known as ER-alpha and ER-beta) in oviductal epithelial cells of rats on day 1 of cycle (C1) or pregnancy (P1) using immunoelectron microscopy for ESR1 and ESR2. The effect of mating on intraoviductal ESR1 or ESR2 signaling was then explored comparing the expression of E2-target genes c-fos, brain creatine kinase (Ckb) and calbindin 9 kDa (s100g) in rats on C1 or P1 treated with selective agonists for ESR1 (PPT) or ESR2 (DPN). The effect of ER agonists on egg transport was also evaluated on C1 or P1 rats. Results Receptor immunoreactivity was associated with the nucleus, cytoplasm and plasma membrane of the epithelial cells. Mating affected the subcellular distribution of both receptors as well as the response to E2. In C1 and P1 rats, PPT increased Ckb while both agonists increased c-fos. DPN increased Ckb and s100g only in C1 and P1 rats, respectively. PPT accelerated egg transport in both groups and DPN accelerated egg transport only in C1 rats. Conclusion Estrogen receptors present a subcellular distribution compatible with E2 genomic and nongenomic signaling in the oviductal epithelial cells of C1 and P1 although IPS occurs independently of changes in the distribution of ESR1 and ESR2 in the oviductal epithelial cells. Mating affected intraoviductal ER-signaling and induced loss of functional involvement of ESR2 on E2-induced accelerated egg transport. These findings reveal a profound influence on the ER signaling pathways exerted by mating in the oviduct. PMID:19948032
Engineering biological systems using automated biofoundries.
Chao, Ran; Mishra, Shekhar; Si, Tong; Zhao, Huimin
2017-07-01
Engineered biological systems such as genetic circuits and microbial cell factories have promised to solve many challenges in the modern society. However, the artisanal processes of research and development are slow, expensive, and inconsistent, representing a major obstacle in biotechnology and bioengineering. In recent years, biological foundries or biofoundries have been developed to automate design-build-test engineering cycles in an effort to accelerate these processes. This review summarizes the enabling technologies for such biofoundries as well as their early successes and remaining challenges. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Zhang, Na; Bai, Guangzhen; Zhong, Daixing; Su, Kai; Liu, Boya; Li, Xiaofei; Wang, Yunjie; Wang, Xiaoping
2014-01-01
Thyroid cancer-1 (TC-1), a natively disordered protein, is widely expressed in vertebrates and overexpressed in many kinds of tumors. However, its exact role and regulation mechanism in human non-small cell lung cancer (NSCLC) are still unclear. In the present study, we found that TC-1 is highly expressed in NSCLC and that its aberrant expression is strongly associated with NSCLC cell proliferation. Exogenous TC-1 overexpression promotes cell proliferation, accelerates the cell G1-to-S-phase transition, and reduces apoptosis in NSCLC. The knockdown of TC-1, however, inhibits NSCLC cell proliferation, cycle transition, and apoptosis resistance. Furthermore, we also demonstrated that PD173074, which functions as an inhibitor of the TC-1 in NSCLC, decreases the expression of TC-1 and inhibits TC-1 overexpression mediated cell proliferation in vitro and in vivo. Nevertheless, the inhibition function of PD173074 on NSCLC cell proliferation was eliminated in cells with TC-1 knockdown. These results suggest that PD173074 plays a significant role in TC-1 overexpression mediated NSCLC cell proliferation and may be a potential intervention target for the prevention of cell proliferation in NSCLC. PMID:24941347
New therapeutic possibilities for vein graft disease in the post-edifoligide era.
Cai, Xinjiang; Freedman, Neil J
2006-07-01
Vein graft neointimal hyperplasia involves proliferation and migration of vascular smooth muscle cells into the vessel intima, and ultimately engenders accelerated atherosclerosis and vein graft failure. Since a myriad of stimuli provoke smooth muscle cell proliferation, molecular therapies for vein graft disease have targeted mechanisms fundamental to all cell proliferation - the 'cell-cycle' machinery. Preclinically, the most successful of these therapies has been edifoligide (E2F decoy), a double-stranded oligodeoxynucleotide that binds to the transcription factor known as E2F. Recently, PRoject of Ex vivo vein GRaft Engineering via Transfection (PREVENT) III and IV demonstrated that edifoligide failed to benefit human vein grafts employed to treat lower-extremity ischemia and coronary heart disease, respectively. The clinical failure of edifoligide calls into question previous models of vein graft disease and lends credence to recent animal studies demonstrating that vein graft arterialization substantially involves the immigration into the vein graft of a variety of vascular progenitor cells. Future vein graft disease therapies will likely target not only proliferation of graft-intrinsic cells, but also immigration of graft-extrinsic cells.
Future orbital transfer vehicle technology study. Volume 1: Executive summary
NASA Technical Reports Server (NTRS)
Davis, E. E.
1982-01-01
Reusable space and ground based LO2/LH2 OTV's, both advanced space engines and aero assist capability were compared. The SB OTV provided advantages in life cycle cost, performance and potential for improvement. An all LO2/LH2 OTV fleet was also compared with a fleet of LO2/.H2 OTV's and electric OTV's. The normal growth technology electric OTV used silicon cells with heavy shielding and argon ion thrusters. In this case, the LO2/LH2 OTV fleet provided a 23% advantage in total transportation cost. An accelerated technology LF2/LH2 OTV provided improvements in performance relative to LO2/.H2 OTV but has higher DDT&E cost which negated its cost effectiveness. The accelerated technology electric vehicle used GaAs cells and annealing but still did not result in the mixed fleet being any cheaper than an all LO2/LH2 OTV fleet. It is concluded that reusable LO2/LH2 OTV's can serve all general purpose cargo roles between LEO and GEO for the forseeable future. The most significant technology for the second generation vehicle would be space debris protection, on orbit propellant storage and transfer and on orbit maintenance capability.
Zhu, Minghua; Zhao, Hongxia; Xia, Deming; Du, Juan; Xie, Huaijun; Chen, Jingwen
2018-08-30
An accelerated solvent extraction (ASE) with in-cell clean-up method coupled to ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) was developed to determine 21 antibiotics in sea cucumber. The analytes include 10 sulfonamides, 4 fluoroquinolones, 3 amphenicols, 2 beta-lactams, 1 lincosamide and trimethoprim. Optimal parameters of ASE method were obtained at 80 °C, 1 static cycle of 5 min with methanol/acetonitrile (1/1, v/v) using 2 g of C18 as adsorbent. Recoveries at 50.1-129.2% were achieved with RSD under 20%. Method detection limits ranged from 0.03 to 2.9 μg kg -1 . Compared to the reported ultrasound-assisted extraction method, the proposed method offered comparable extraction efficiency for sulfonamides from sea cucumber, but higher for other categories of antibiotics. This validated method was then successfully applied to sea cucumber samples and 9 antibiotics were detected with the highest concentration up to 57.7 μg kg -1 for norfloxacin. Copyright © 2018 Elsevier Ltd. All rights reserved.
Brenet, Fabienne; Scandura, Joseph M
2015-01-01
Hematopoietic stressors such as infection, bleeding, or toxic injury trigger a hematopoietic adaptation that sacrifices hematopoietic stem and progenitor cell (HSPC) quiescence to meet an urgent need for new blood cell production. Once the hematopoietic demands are adequately met, homeostasis must be restored. Transforming growth factor β (TGFβ) signaling is a central mediator mandating the return of HSPCs to quiescence after stress. Blockade of TGFβ signaling after hematopoietic stress delays the return of cycling HSPCs to quiescence and in so doing promotes hematopoietic stem cell (HSC) self-renewal and accelerates hematopoietic reconstitution. These findings open the door to new therapeutics that modulate the hematopoietic adaptation to stress. In this review, we will discuss the complex context-dependent activities of TGFβ in hematopoiesis and the potential benefits and limitations of using TGFβ pathway inhibitors to promote multilineage hematopoietic reconstitution after myelosuppressive chemotherapy. PMID:27308454
Sharma, Aman; Maiz, Alejandra M; Tucker, William R; Cukras, Catherine
2018-05-16
To report a case of accelerated retinal toxicity due to hydroxychloroquine (HCQ) use for treatment of Sjögren syndrome in a patient treated with concomitant chemotherapy for breast cancer. Observational case report. A 56-year-old white woman using 400 mg HCQ (7.1 mg/kg real body weight) daily for a total of 2 years and 10 months for treatment of Sjögren syndrome with concomitant use of docetaxel and cyclophosphamide therapy (21-day cycle, 4 cycles) followed by anastrozole for breast cancer, presented with visual complaints and findings of severe HCQ toxicity. Concomitant breast cancer therapy may have a synergistic effect with HCQ leading to accelerated retinal toxicity. As such potential acceleration is poorly understood, patients on HCQ who are treated with concomitant chemotherapy should be considered for more frequent retinal screenings to maximize safety and preservation of vision.
Characteristics of MIC-1 antlerogenic stem cells and their effect on hair growth in rabbits.
Cegielski, Marek; Izykowska, Ilona; Chmielewska, Magdalena; Dziewiszek, Wojciech; Bochnia, Marek; Calkosinski, Ireneusz; Dziegiel, Piotr
2013-01-01
We characterized growth factors produced by MIC-1 antlerogenic stem cells and attempted to apply those cells to stimulate hair growth in rabbits. We evaluated the gene and protein expression of growth factors by immunocytochemical and molecular biology techniques in MIC-1 cells. An animal model was used to assess the effects of xenogenous stem cells on hair growth. In the experimental group, rabbits were intradermally injected with MIC-1 stem cells, whereas the control group rabbits were given vehicle-only. After 1, 2 and 4 weeks, skin specimen were collected for histological and immunohistochemical tests. MIC-1 antlerogenic stem cells express growth factors, as confirmed at the mRNA and protein levels. Histological and immunohistochemical analysis demonstrated an increase in the number of hair follicles, as well as the amount of secondary hair in the follicles, without an immune response in animals injected intradermally with MIC-1 cells, compared to animals receiving vehicle-alone. MIC-1 cells accelerated hair growth in rabbits due to the activation of cells responsible for the regulation of the hair growth cycle through growth factors. Additionally, the xenogenous cell implant did not induce immune response.
Loss of Telomeres in the Progeny of Human Lymphocytes Exposed to Energetic Heavy Ions
NASA Technical Reports Server (NTRS)
Cucinotta, F.A.; George, K.; Durante, M.
2006-01-01
We have used cross-species multi-color banding (RxFISH) combined with telomere FISH probes, to measure chromosomal aberrations in the progeny of human peripheral blood lymphocytes exposed to ionizing radiation. Accelerated iron particles (energy 1 GeV/nucleon) induced many more terminal deletions than the same dose of gamma-rays. We found that truncated chromosomes without telomeres could be transmitted for at least three cell cycles following exposure, and represented about 10% of all aberrations observed in the progeny of cells exposed to iron ions. High energy heavy ions generate the most significant health risk for human space exploration and the results suggest that telomere loss may be the leading mechanism for their high efficiency in the induction of late effects.
Slot-coupled CW standing wave accelerating cavity
Wang, Shaoheng; Rimmer, Robert; Wang, Haipeng
2017-05-16
A slot-coupled CW standing wave multi-cell accelerating cavity. To achieve high efficiency graded beta acceleration, each cell in the multi-cell cavity may include different cell lengths. Alternatively, to achieve high efficiency with acceleration for particles with beta equal to 1, each cell in the multi-cell cavity may include the same cell design. Coupling between the cells is achieved with a plurality of axially aligned kidney-shaped slots on the wall between cells. The slot-coupling method makes the design very compact. The shape of the cell, including the slots and the cone, are optimized to maximize the power efficiency and minimize the peak power density on the surface. The slots are non-resonant, thereby enabling shorter slots and less power loss.
Cell cycle-regulated proteolysis of mitotic target proteins.
Bastians, H; Topper, L M; Gorbsky, G L; Ruderman, J V
1999-11-01
The ubiquitin-dependent proteolysis of mitotic cyclin B, which is catalyzed by the anaphase-promoting complex/cyclosome (APC/C) and ubiquitin-conjugating enzyme H10 (UbcH10), begins around the time of the metaphase-anaphase transition and continues through G1 phase of the next cell cycle. We have used cell-free systems from mammalian somatic cells collected at different cell cycle stages (G0, G1, S, G2, and M) to investigate the regulated degradation of four targets of the mitotic destruction machinery: cyclins A and B, geminin H (an inhibitor of S phase identified in Xenopus), and Cut2p (an inhibitor of anaphase onset identified in fission yeast). All four are degraded by G1 extracts but not by extracts of S phase cells. Maintenance of destruction during G1 requires the activity of a PP2A-like phosphatase. Destruction of each target is dependent on the presence of an N-terminal destruction box motif, is accelerated by additional wild-type UbcH10 and is blocked by dominant negative UbcH10. Destruction of each is terminated by a dominant activity that appears in nuclei near the start of S phase. Previous work indicates that the APC/C-dependent destruction of anaphase inhibitors is activated after chromosome alignment at the metaphase plate. In support of this, we show that addition of dominant negative UbcH10 to G1 extracts blocks destruction of the yeast anaphase inhibitor Cut2p in vitro, and injection of dominant negative UbcH10 blocks anaphase onset in vivo. Finally, we report that injection of dominant negative Ubc3/Cdc34, whose role in G1-S control is well established and has been implicated in kinetochore function during mitosis in yeast, dramatically interferes with congression of chromosomes to the metaphase plate. These results demonstrate that the regulated ubiquitination and destruction of critical mitotic proteins is highly conserved from yeast to humans.
Featherston, Jonathan; Arakaki, Yoko; Hanschen, Erik R; Ferris, Patrick J; Michod, Richard E; Olson, Bradley J S C; Nozaki, Hisayoshi; Durand, Pierre M
2018-04-01
Multicellularity is the premier example of a major evolutionary transition in individuality and was a foundational event in the evolution of macroscopic biodiversity. The volvocine chlorophyte lineage is well suited for studying this process. Extant members span unicellular, simple colonial, and obligate multicellular taxa with germ-soma differentiation. Here, we report the nuclear genome sequence of one of the most morphologically simple organisms in this lineage-the 4-celled colonial Tetrabaena socialis and compare this to the three other complete volvocine nuclear genomes. Using conservative estimates of gene family expansions a minimal set of expanded gene families was identified that associate with the origin of multicellularity. These families are rich in genes related to developmental processes. A subset of these families is lineage specific, which suggests that at a genomic level the evolution of multicellularity also includes lineage-specific molecular developments. Multiple points of evidence associate modifications to the ubiquitin proteasomal pathway (UPP) with the beginning of coloniality. Genes undergoing positive or accelerating selection in the multicellular volvocines were found to be enriched in components of the UPP and gene families gained at the origin of multicellularity include components of the UPP. A defining feature of colonial/multicellular life cycles is the genetic control of cell number. The genomic data presented here, which includes diversification of cell cycle genes and modifications to the UPP, align the genetic components with the evolution of this trait.
Thompson, Elizabeth A; Zhu, Songyun; Hall, Jonathan R; House, John S; Ranjan, Rakesh; Burr, Jeanne A; He, Yu-Ying; Owens, David M; Smart, Robert C
2011-06-01
Human epidermis is routinely subjected to DNA damage induced by UVB solar radiation. Cell culture studies have revealed an unexpected role for C/EBPα (CCAAT/enhancer-binding protein-α) in the DNA damage response network, where C/EBPα is induced following UVB DNA damage, regulates the G(1) checkpoint, and diminished or ablated expression of C/EBPα results in G(1) checkpoint failure. In the current study we observed that C/EBPα is induced in normal human epidermal keratinocytes and in the epidermis of human subjects exposed to UVB radiation. The analysis of human skin precancerous and cancerous lesions (47 cases) for C/EBPα expression was conducted. Actinic keratoses, a precancerous benign skin growth and precursor to squamous cell carcinoma (SCC), expressed levels of C/EBPα similar to normal epidermis. Strikingly, all invasive SCCs no longer expressed detectable levels of C/EBPα. To determine the significance of C/EBPα in UVB-induced skin cancer, SKH-1 mice lacking epidermal C/EBPα (CKOα) were exposed to UVB. CKOα mice were highly susceptible to UVB-induced SCCs and exhibited accelerated tumor progression. CKOα mice displayed keratinocyte cell cycle checkpoint failure in vivo in response to UVB that was characterized by abnormal entry of keratinocytes into S phase. Our results demonstrate that C/EBPα is silenced in human SCC and loss of C/EBPα confers susceptibility to UVB-induced skin SCCs involving defective cell cycle arrest in response to UVB.
Thompson, Elizabeth A.; Zhu, Songyun; Hall, Jonathan R.; House, John S.; Ranjan, Rakesh; Burr, Jeanne A.; He, Yu-Ying; Owens, David M.; Smart, Robert C.
2012-01-01
Human epidermis is routinely subjected to DNA damage induced by UVB solar radiation. Cell culture studies have revealed an unexpected role for C/EBPα (CCAAT/enhancer-binding protein-α) in the DNA damage response network, where C/EBPα is induced following UVB DNA damage, regulates the G1 checkpoint, and diminished or ablated expression of C/EBPα results in G1 checkpoint failure. In the current study we observed that C/EBPα is induced in normal human epidermal keratinocytes and in the epidermis of human subjects exposed to UVB radiation. The analysis of human skin precancerous and cancerous lesions (47 cases) for C/EBPα expression was conducted. Actinic keratoses, a precancerous benign skin growth and precursor to squamous cell carcinoma (SCC), expressed levels of C/EBPα similar to normal epidermis. Strikingly, all invasive SCCs no longer expressed detectable levels of C/EBPα. To determine the significance of C/EBPα in UVB-induced skin cancer, SKH-1 mice lacking epidermal C/EBPα (CKOα) were exposed to UVB. CKOα mice were highly susceptible to UVB-induced SCCs and exhibited accelerated tumor progression. CKOα mice displayed keratinocyte cell cycle checkpoint failure in vivo in response to UVB that was characterized by abnormal entry of keratinocytes into S phase. Our results demonstrate that C/EBPα is silenced in human SCC and loss of C/EBPα confers susceptibility to UVB-induced skin SCCs involving defective cell cycle arrest in response to UVB. PMID:21346772
Accelerated lymphocyte recovery after alemtuzumab does not predict multiple sclerosis activity.
Kousin-Ezewu, Onajite; Azzopardi, Laura; Parker, Richard A; Tuohy, Orla; Compston, Alastair; Coles, Alasdair; Jones, Joanne
2014-06-17
To test the hypothesis that accelerated peripheral blood mononuclear cell recovery after alemtuzumab treatment of multiple sclerosis is associated with recurrent disease activity and to investigate the claim that CD4 counts greater than 388.5 × 10(6) cells/mL at 12 months can be used to identify patients who may benefit from further treatment. A total of 108 patients were followed for a median of 99 months post alemtuzumab. Patients were classified as active or nonactive after each cycle of treatment based on clinical relapse, increasing disability, or new T2/enhancing MRI lesions. These outcomes were correlated with CD4, CD8, CD19, CD56+ NK, and monocyte counts. Of 108 patients, 56 (52%) relapsed at some point during follow-up. Mean annualized relapse rate after alemtuzumab was 0.17 vs 1.67 prior to treatment (equating to a 90% reduction). Of 108 patients, 28 (26%) met the criteria for sustained accumulation of disability. Median time to the lower limit of normal for CD19, CD8, and CD4 was 3, 19.5, and 32 months, respectively. There was no significant difference in the recovery of any cell population between patients with and without disease activity or accumulation of disability after treatment. This study does not support the use of cell counts as biomarkers for identifying patients at greater risk of active disease following treatment with alemtuzumab. © 2014 American Academy of Neurology.
NASA Technical Reports Server (NTRS)
Lathrop, J. W.; Davis, C. W.; Royal, E.
1982-01-01
The use of accelerated testing methods in a program to determine the reliability attributes of terrestrial silicon solar cells is discussed. Different failure modes are to be expected when cells with and without encapsulation are subjected to accelerated testing and separate test schedules for each are described. Unencapsulated test cells having slight variations in metallization are used to illustrate how accelerated testing can highlight different diffusion related failure mechanisms. The usefulness of accelerated testing when applied to encapsulated cells is illustrated by results showing that moisture related degradation may be many times worse with some forms of encapsulation than with no encapsulation at all.
High field gradient particle accelerator
Nation, John A.; Greenwald, Shlomo
1989-01-01
A high electric field gradient electron accelerator utilizing short duration, microwave radiation, and capable of operating at high field gradients for high energy physics applications or at reduced electric field gradients for high average current intermediate energy accelerator applications. Particles are accelerated in a smooth bore, periodic undulating waveguide, wherein the period is so selected that the particles slip an integral number of cycles of the r.f. wave every period of the structure. This phase step of the particles produces substantially continuous acceleration in a traveling wave without transverse magnetic or other guide means for the particle.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piekarz, Henryk; Hays, Steven; /Fermilab
We propose to build the DSF-MR (Double Super-Ferric Main Ring), 480 GeV, fast-cycling (2 second repetition rate) two-beam proton accelerator in the Main Ring tunnel of Fermilab. This accelerator design is based on the super-ferric magnet technology developed for the VLHC, and extended recently to the proposed LER injector for the LHC and fast cycling SF-SPS at CERN. The DSF-MR accelerator system will constitute the final stage of the proton source enabling production of two neutrino beams separated by 2 second time period. These beams will be sent alternately to two detectors located at {approx} 3000 km and {approx} 7500more » km away from Fermilab. It is expected that combination of the results from these experiments will offer more than 3 order of magnitudes increased sensitivity for detection and measurement of neutrino oscillations with respect to expectations in any current experiment, and thus may truly enable opening the window into the physics beyond the Standard Model. We examine potential sites for the long baseline neutrino detectors accepting beams from Fermilab. The current injection system consisting of 400 MeV Linac, 8 GeV Booster and the Main Injector can be used to accelerate protons to 45 GeV before transferring them to the DSF-MR. The implementation of the DSF-MR will allow for an 8-fold increase in beam power on the neutrino production target. In this note we outline the proposed new arrangement of the Fermilab accelerator complex. We also briefly describe the DSF-MR magnet design and its power supply, and discuss necessary upgrade of the Tevatron RF system for the use with the DSF-MR accelerator. Finally, we outline the required R&D, cost estimate and possible timeline for the implementation of the DSF-MR accelerator.« less
A highly durable fuel cell electrocatalyst based on double-polymer-coated carbon nanotubes
Berber, Mohamed R.; Hafez, Inas H.; Fujigaya, Tsuyohiko; Nakashima, Naotoshi
2015-01-01
Driven by the demand for the commercialization of fuel cell (FC) technology, we describe the design and fabrication of a highly durable FC electrocatalyst based on double-polymer-coated carbon nanotubes for use in polymer electrolyte membrane fuel cells. The fabricated electrocatalyst is composed of Pt-deposited polybenzimidazole-coated carbon nanotubes, which are further coated with Nafion. By using this electrocatalyst, a high FC performance with a power density of 375 mW/cm2 (at 70 ˚C, 50% relative humidity using air (cathode)/H2(anode)) was obtained, and a remarkable durability of 500,000 accelerated potential cycles was recorded with only a 5% loss of the initial FC potential and 20% loss of the maximum power density, which were far superior properties compared to those of the membrane electrode assembly prepared using carbon black in place of the carbon nanotubes. The present study indicates that the prepared highly durable fuel cell electrocatalyst is a promising material for the next generation of PEMFCs. PMID:26594045
A highly durable fuel cell electrocatalyst based on double-polymer-coated carbon nanotubes.
Berber, Mohamed R; Hafez, Inas H; Fujigaya, Tsuyohiko; Nakashima, Naotoshi
2015-11-23
Driven by the demand for the commercialization of fuel cell (FC) technology, we describe the design and fabrication of a highly durable FC electrocatalyst based on double-polymer-coated carbon nanotubes for use in polymer electrolyte membrane fuel cells. The fabricated electrocatalyst is composed of Pt-deposited polybenzimidazole-coated carbon nanotubes, which are further coated with Nafion. By using this electrocatalyst, a high FC performance with a power density of 375 mW/cm(2) (at 70 ˚C, 50% relative humidity using air (cathode)/H2(anode)) was obtained, and a remarkable durability of 500,000 accelerated potential cycles was recorded with only a 5% loss of the initial FC potential and 20% loss of the maximum power density, which were far superior properties compared to those of the membrane electrode assembly prepared using carbon black in place of the carbon nanotubes. The present study indicates that the prepared highly durable fuel cell electrocatalyst is a promising material for the next generation of PEMFCs.
Traveling wave linear accelerator with RF power flow outside of accelerating cavities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dolgashev, Valery A.
A high power RF traveling wave accelerator structure includes a symmetric RF feed, an input matching cell coupled to the symmetric RF feed, a sequence of regular accelerating cavities coupled to the input matching cell at an input beam pipe end of the sequence, one or more waveguides parallel to and coupled to the sequence of regular accelerating cavities, an output matching cell coupled to the sequence of regular accelerating cavities at an output beam pipe end of the sequence, and output waveguide circuit or RF loads coupled to the output matching cell. Each of the regular accelerating cavities hasmore » a nose cone that cuts off field propagating into the beam pipe and therefore all power flows in a traveling wave along the structure in the waveguide.« less
Treatment of chronic myelogenous leukemia with interleukin-2: a phase II study in 21 patients.
Vey, N; Blaise, D; Lafage, M; Olive, D; Viens, P; Baume, D; Camerlo, J; Stoppa, A M; Gabus, R; Brandely, M; Hercend, T; Maraninchi, D
1999-03-01
We designed a phase II study to assess the activity of recombinant interleukin-2 (rIL-2) in patients with chronic myelogenous leukemia (CML). Study population included 11 patients in the chronic phase of CML (6 in hematologic remission and 5 with active disease), 6 patients in the accelerated phase, and 4 in blastic phase of CML. Patients received three 5-day cycles administrated every other week. rIL-2 was given as intravenous bolus infusions of 8 x 10(6) IU/m2 three times a day during cycle 1 and twice a day during cycles 2 and 3. Response to rIL-2 was assessed on day 45. No hematologic response was achieved in the patients with evaluable disease. One patient in hematologic remission with rIL-2 achieved a major response (from 72% to 9% Ph+ metaphases), and two patients had some degree of reduction of Ph+ metaphases. Responses were short-lived (< 6 months), but two of these three patients achieved a new cytogenetic response with interferon given post-rIL-2. A significant immune activation was achieved with rIL-2 including a marked increase in CD3+/CD25+ cells, CD56+ cells, and in natural killer/lymphokine activated killer cell cytotoxic activity. These results confirm preclinical studies, which showed that IL-2 has antileukemic activity in CML. However, the responses observed were short lived and restricted to a subgroup of patients with low disease burden. This invites further studies testing its impact in situations of minimal disease or in combination with other cytokines.
Thankayyan R, Santhosh Kumar; Sithul, Hima; Sreeharshan, Sreeja
2012-01-01
The main aim of the present work was to investigate the potential effect of acetone extract of Ficus religosa leaf (FAE) in multiple apoptosis signalling in human breast cancer cells. FAE treatment significantly induced dose and time dependent, irreversible inhibition of breast cancer cell growth with moderate toxicity to normal breast epithelial cells. This observation was validated using Sulforhodamine B assay. Cell cycle analysis by Flow cytometry showed cell cycle arrest in G1 phase and induction of sub-G0 peak. FAE induced chromatin condensation and displayed an increase in apoptotic population in Annexin V-FITC/PI (Fluorescein isothiocyanate/Propidium iodide) double staining. FAE stimulated the loss of mitochondrial membrane potential in multiple breast cancer cell lines when compared to normal diploid cells. To understand the role of Bax in FAE induced apoptosis, we employed a sensitive cell based platform of MCF-7 cells expressing Bax-EGFP. Bax translocation to mitochondria was accompanied by the disruption of mitochondrial membrane potential and marked elevation in LEHDase activity (Caspase 9). Consistent with this data, FAE induced Caspase activation as evidenced by ratio change in FRET Caspase sensor expressing MCF-7 cell line and cleavage of prominent Caspases and PARP. Interestingly, FAE accelerated cell death in a mitochondrial dependent manner in continuous live cell imaging mode indicating its possible photosensitizing effect. Intracellular generation of reactive oxygen species (ROS) by FAE played a critical role in mediating apoptotic cell death and photosensitizing activity. FAE induced dose and time dependent inhibition of cancer cell growth which was associated with Bax translocation and mitochondria mediated apoptosis with the activation of Caspase 9 dependent Caspase cascade. FAE also possessed strong photosensitizing effect on cancer cell line that was mediated through rapid mitochondrial transmembrane potential loss and partial Caspase activation involving generation of intracellular ROS. PMID:22792212
Liu, Liang; Liu, Xu-Sheng; Zhang, Xiao-Qi; Ming, Jia; Xu, Hui; Cheng, Tian-Min
2005-02-01
To explore the mechanism by which macrophages regulate angiogenesis by co-culturing human umbilical vein endothelial cells (ECV-304) with human macrophage cells (U937) stimulated by concanavalin A (ConA). Monolayer ECV-304 cells growing to 60% confluence were co-cultured with 1 x 10(5)/ml U937 cells in the presence or absence of ConA (ConA+U937+ECV-304 and U937+ECV-304 groups, respectively), with non-treated and ConA-treated ECV-304 cells serving as the control groups (ECV-304 and ConA+ECV-304 groups, respectively). Forty-eight h later, U937 cells were removed from the cell co-culture for examining changes in DNA synthesis of ECV-304 cells with (3)H-TdR incorporation assay and for cell cycle analysis with flow cytometry. RT-PCR was employed to assess the influence of macrophages stimulated by ConA on the expression of the target genes. With immunofluorescent method, the changes in the expression of integrin receptor alphavbeta3 of ECV-304 were determined. A significant increase in S-phase ECV-304 cells with enhanced DNA synthesis was observed after co-culture of the cells with ConA-stimulated U937 cells (P<0.01), which also resulted in significant up-regulation of the expressions of KDR mRNA (0.879+/-0.003), Hoxb2 mRNA (0.947+/-0.003) and integrin receptor alphavbeta3 (10.26+/-1.73). Macrophages can accelerate the proliferation, migration and adhesion of the vascular endothelial cells to the basilar membrane matrix by affecting their cell cycle, DNA synthesis, expression of KDR mRNA, Hoxb2 mRNA and integrin alphavbeta3, so as to modulate the angiogenetic process of the latter cells.
Jia, Gui-Qing; Zhang, Ming-Ming; Wang, Kang; Zhao, Gao-Ping; Pang, Ming-Hui; Chen, Zhe-Yu
2018-05-08
Emerging evidence has identified that long non-coding RNAs (lncRNAs) may play an important role in the pathogenesis of many cancer types, including colorectal cancer (CRC). However, the role of PlncRNA-1 in CRC remains unclear. The aim of our present study was to investigate the potential functions of PlncRNA-1 in CRC and to identify the underlying mechanisms of action. We demonstrated that up-regulated PlncRNA-1 in CRC tissues and cells promoted cell proliferation by accelerating cell cycle process and inhibiting cell apoptosis in vitro, enhanced tumor growth and matastasis in vivo and was associated with cell migration and invasion, EMT process of CRC cells. In addition, PlncRNA-1 was a target of miR-204 and enhanced the expression of an endogenous miR-204 target, MMP9 in CRC cells. Furthermore, we found that PlncRNA-1 activates Wnt/β-catenin pathway through the miR-204 in CRC cells. These results suggest that the PlncRNA-1/miR-204/ Wnt/β-catenin regulatory network may shed light on tumorigenesis in CRC. © 2018 Wiley Periodicals, Inc.
Chen, Jian; Chen, Shuai; Wang, Jiahui; Zhang, Mingjun; Gong, Zhaohua; Wei, Youheng; Li, Li; Zhang, Yuanyuan; Zhao, Xuemei; Jiang, Songmin; Yu, Long
2015-01-01
Cyclophilin J (CYPJ) is a new member of the peptidyl-prolyl cis/trans-isomerase (PPIase) identified with upregulated expression in human glioma. However, the biological function of CYPJ remained unclear. We aimed to study the role of CYPJ in hepatocellular carcinoma (HCC) carcinogenesis and its therapeutic potential. We determined the expression of CYPJ in HCC/adjacent normal tissues using Western blot, Northern blot and semi-quantitative RT-PCR, analyzed the biochemical characteristics of CYPJ, and resolved the 3D-structure of CYPJ/Cyclosporin A (CsA) complex. We also studied the roles of CYPJ in cell cycle, cyclin D1 regulation, in vitro and in vivo tumor growth. We found that CYPJ expression was upregulated in over 60% HCC tissues. The PPIase activity of CYPJ could be inhibited by the widely used immunosuppressive drug CsA. CYPJ was found expressed in the whole cell of HCC with preferential location at the cell nucleus. CYPJ promoted the transition of cells from G1 phase to S phase in a PPIase-dependent manner by activating cyclin D1 promoter. CYPJ overexpression accelerated liver cell growth in vitro (cell growth assay, colony formation) and in vivo (xenograft tumor formation). Inhibition of CYPJ by its inhibitor CsA or CYPJ-specific RNAi diminished the growth of liver cancer cells in vitro and in vivo. In conclusion, CYPJ could facilitate HCC growth by promoting cell cycle transition from G1 to S phase through the upregulation of cyclin D1. Suppression of CYPJ could repress the growth of HCC, which makes CYPJ a potential target for the development of new strategies to treat this malignancy. PMID:26020957
Zhang, Xiaojian; Liu, Huan; Wang, Jinrong; Ren, Guangyuan; Xie, Beizhen; Liu, Hong; Zhu, Ying; Jiang, Lei
2015-11-28
Dissimilatory metal reducing bacteria are capable of extracellular electron transfer (EET) to insoluble metal oxides as external electron acceptors for their anaerobic respiration, which is recognized as an important energy-conversion process in natural and engineered environments, such as in mineral cycling, bioremediation, and microbial fuel/electrolysis cells. However, the low EET efficiency remains one of the major bottlenecks for its practical application. We report firstly that the microbial current generated by Shewanella loihica PV-4 (S. loihica PV-4) could be greatly improved that is up to ca. 115 fold, by adding antimony-doped tin oxide (ATO) nanoparticles in the electrochemical reactor. The results demonstrate that the biocompatible, electrically conductive ATO nanoparticles acted as active microelectrodes could facilitate the formation of a cells/ATO composite biofilm and the reduction of the outer membrane c-type cytochromes (OM c-Cyts) that are beneficial for the electron transfer from cells to electrode. Meanwhile, a synergistic effect between the participation of OM c-Cyts and the accelerated EET mediated by cell-secreted flavins may play an important role for the enhanced current generation in the presence of ATO nanoparticles. Moreover, it is worth noting that the TCA cycle in S. loihica PV-4 cells is activated by adding ATO nanoparticles, even if the potential is poised at +0.2 V, thereby also improving the EET process. The results presented here may provide a simple and effective strategy to boost the EET of S. loihica PV-4 cells, which is conducive to providing potential applications in bioelectrochemical systems.
Wu, Changshun; Song, Zezhong; Liu, Huiling; Pan, Jihong; Jiang, Huiyu; Liu, Chao; Yan, Zexing; Feng, Hong; Sun, Shui
2017-07-01
Fibroblast-like synoviocytes derived from patients with rheumatoid arthritis play a key role by local production of cytokines and proteolytic enzymes that degrade the extracellular matrix and cartilage. These synoviocytes acquire phenotypic characteristics commonly observed in transformed cells, like anchorage-independent growth, increased proliferation and invasiveness, and insensitivity to apoptosis. Furin is a ubiquitous proprotein convertase that is capable of cleaving precursors of a wide variety of proteins. In patients with rheumatoid arthritis, furin is reported to be highly expressed in the synovial pannus compared with healthy persons. However, the mechanisms are poorly understood. This study is to explore the effect of furin overexpression in rheumatoid synoviocytes. In this study, RNA interference was used to knock down furin expression and to assess the resultant effects on biological behaviors of synoviocytes, such as cell proliferation, invasion, migration, cell cycle and cell apoptosis. In addition, the production of inflammatory cytokines was evaluated. The results showed that the inhibition of furin enhanced proliferation, invasion, and migration of synoviocytes in vitro. Cell cycle was accelerated and cell death was affected by furin knockdown. Also, the inhibition of furin increased interleukin-1β and tumor necrosis factor-α secretion of synoviocytes. Inhibition of furin enhances invasive phenotype of synoviocytes from patients with rheumatoid arthritis, implying a protective role of furin. Agents targeting upregulation of furin may have therapeutic potential for rheumatoid arthritis. Copyright © 2016 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
NASA Technical Reports Server (NTRS)
Imig, L. A.; Garrett, L. E.
1973-01-01
Possibilities for reducing fatigue-test time for supersonic-transport materials and structures were studied in tests with simulated flight-by-flight loading. In order to determine whether short-time tests were feasible, the results of accelerated tests (2 sec per flight) were compared with the results of real-time tests (96 min per flight). The effects of design mean stress, the stress range for ground-air-ground cycles, simulated thermal stress, the number of stress cycles in each flight, and salt corrosion were studied. The flight-by-flight stress sequences were applied to notched sheet specimens of Ti-8Al-1Mo-1V and Ti-6Al-4V titanium alloys. A linear cumulative-damage analysis accounted for large changes in stress range of the simulated flights but did not account for the differences between real-time and accelerated tests. The fatigue lives from accelerated tests were generally within a factor of two of the lives from real-time tests; thus, within the scope of the investigation, accelerated testing seems feasible.
Voltage control on a train system
Gordon, Susanna P.; Evans, John A.
2004-01-20
The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.
Method of managing interference during delay recovery on a train system
Gordon, Susanna P.; Evans, John A.
2005-12-27
The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.
Efficient high density train operations
Gordon, Susanna P.; Evans, John A.
2001-01-01
The present invention provides methods for preventing low train voltages and managing interference, thereby improving the efficiency, reliability, and passenger comfort associated with commuter trains. An algorithm implementing neural network technology is used to predict low voltages before they occur. Once voltages are predicted, then multiple trains can be controlled to prevent low voltage events. Further, algorithms for managing inference are presented in the present invention. Different types of interference problems are addressed in the present invention such as "Interference. During Acceleration", "Interference Near Station Stops", and "Interference During Delay Recovery." Managing such interference avoids unnecessary brake/acceleration cycles during acceleration, immediately before station stops, and after substantial delays. Algorithms are demonstrated to avoid oscillatory brake/acceleration cycles due to interference and to smooth the trajectories of closely following trains. This is achieved by maintaining sufficient following distances to avoid unnecessary braking/accelerating. These methods generate smooth train trajectories, making for a more comfortable ride, and improve train motor reliability by avoiding unnecessary mode-changes between propulsion and braking. These algorithms can also have a favorable impact on traction power system requirements and energy consumption.
Simulation and experiment of thermal fatigue in the CPV die attach
NASA Astrophysics Data System (ADS)
Bosco, Nick; Silverman, Timothy; Kurtz, Sarah
2012-10-01
FEM simulation and accelerated thermal cycling have been performed for the CPV die attach. Trends in fatigue damage accumulation and equivalent test time are explored and found to be most sensitive to temperature ramp rate. Die attach crack growth is measured through cycling and found to be in excellent agreement with simulations of the inelastic strain energy accumulated. Simulations of an entire year of weather data provides for the relative ranking of fatigue damage between four cities as well as their equivalent accelerated test time.
Gedeon, Patrick C; Thomas, James R; Madura, Jeffry D
2015-01-01
Molecular dynamics simulation provides a powerful and accurate method to model protein conformational change, yet timescale limitations often prevent direct assessment of the kinetic properties of interest. A large number of molecular dynamic steps are necessary for rare events to occur, which allow a system to overcome energy barriers and conformationally transition from one potential energy minimum to another. For many proteins, the energy landscape is further complicated by a multitude of potential energy wells, each separated by high free-energy barriers and each potentially representative of a functionally important protein conformation. To overcome these obstacles, accelerated molecular dynamics utilizes a robust bias potential function to simulate the transition between different potential energy minima. This straightforward approach more efficiently samples conformational space in comparison to classical molecular dynamics simulation, does not require advanced knowledge of the potential energy landscape and converges to the proper canonical distribution. Here, we review the theory behind accelerated molecular dynamics and discuss the approach in the context of modeling protein conformational change. As a practical example, we provide a detailed, step-by-step explanation of how to perform an accelerated molecular dynamics simulation using a model neurotransmitter transporter embedded in a lipid cell membrane. Changes in protein conformation of relevance to the substrate transport cycle are then examined using principle component analysis.
High Intensity Proton Accelerator Project in Japan (J-PARC).
Tanaka, Shun-ichi
2005-01-01
The High Intensity Proton Accelerator Project, named as J-PARC, was started on 1 April 2001 at Tokai-site of JAERI. The accelerator complex of J-PARC consists of three accelerators: 400 MeV Linac, 3 GeV rapid cycle synchrotron and 50 GeV synchrotron; and four major experimental facilities: Material and Life Science Facility, Nuclear and Particle Physics Facility, Nuclear Transmutation Experiment Facility and Neutrino Facility. The outline of the J-PARC is presented with the current status of construction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Piekarz, Henryk; /Fermilab
The authors outline primary physics motivation, present proposed new arrangement for Fermilab accelerator complex, and then discuss possible long-range application of fast-cycling superconducting synchrotrons at Fermilab.
Cellular STAT3 functions via PCBP2 to restrain Epstein-Barr Virus lytic activation in B lymphocytes.
Koganti, Siva; Clark, Carissa; Zhi, Jizu; Li, Xiaofan; Chen, Emily I; Chakrabortty, Sharmistha; Hill, Erik R; Bhaduri-McIntosh, Sumita
2015-05-01
A major hurdle to killing Epstein-Barr virus (EBV)-infected tumor cells using oncolytic therapy is the presence of a substantial fraction of EBV-infected cells that does not support the lytic phase of EBV despite exposure to lytic cycle-promoting agents. To determine the mechanism(s) underlying this refractory state, we developed a strategy to separate lytic from refractory EBV-positive (EBV(+)) cells. By examining the cellular transcriptome in separated cells, we previously discovered that high levels of host STAT3 (signal transducer and activator of transcription 3) curtail the susceptibility of latently infected cells to lytic cycle activation signals. The goals of the present study were 2-fold: (i) to determine the mechanism of STAT3-mediated resistance to lytic activation and (ii) to exploit our findings to enhance susceptibility to lytic activation. We therefore analyzed our microarray data set, cellular proteomes of separated lytic and refractory cells, and a publically available STAT3 chromatin immunoprecipitation sequencing (ChIP-Seq) data set to identify cellular PCBP2 [poly(C)-binding protein 2], an RNA-binding protein, as a transcriptional target of STAT3 in refractory cells. Using Burkitt lymphoma cells and EBV(+) cell lines from patients with hypomorphic STAT3 mutations, we demonstrate that single cells expressing high levels of PCBP2 are refractory to spontaneous and induced EBV lytic activation, STAT3 functions via cellular PCBP2 to regulate lytic susceptibility, and suppression of PCBP2 levels is sufficient to increase the number of EBV lytic cells. We expect that these findings and the genome-wide resources that they provide will accelerate our understanding of a longstanding mystery in EBV biology and guide efforts to improve oncolytic therapy for EBV-associated cancers. Most humans are infected with Epstein-Barr virus (EBV), a cancer-causing virus. While EBV generally persists silently in B lymphocytes, periodic lytic (re)activation of latent virus is central to its life cycle and to most EBV-related diseases. However, a substantial fraction of EBV-infected B cells and tumor cells in a population is refractory to lytic activation. This resistance to lytic activation directly and profoundly impacts viral persistence and the effectiveness of oncolytic therapy for EBV(+) cancers. To identify the mechanisms that underlie susceptibility to EBV lytic activation, we used host gene and protein expression profiling of separated lytic and refractory cells. We find that STAT3, a transcription factor overactive in many cancers, regulates PCBP2, a protein important in RNA biogenesis, to regulate susceptibility to lytic cycle activation signals. These findings advance our understanding of EBV persistence and provide important leads on devising methods to improve viral oncolytic therapies. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Worwood, Daniel; Kellner, Quirin; Wojtala, Malgorzata; Widanage, W. D.; McGlen, Ryan; Greenwood, David; Marco, James
2017-04-01
Conventional cooling approaches that target either a singular tab or outer surface of common format cylindrical lithium-ion battery cells suffer from a high cell thermal resistance. Under an aggressive duty cycle, this resistance can result in the formation of large in-cell temperature gradients and high hot spot temperatures, which are known to accelerate ageing and further reduce performance. In this paper, a novel approach to internal thermal management of cylindrical battery cells to lower the thermal resistance for heat transport through the inside of the cell is investigated. The effectiveness of the proposed method is analysed for two common cylindrical formats when subject to highly aggressive electrical loading conditions representative of a high performance electric vehicle (EV) and hybrid electric vehicle (HEV). A mathematical model that captures the dominant thermal properties of the cylindrical cell is created and validated using experimental data. Results from the extensive simulation study indicate that the internal cooling strategy can reduce the cell thermal resistance by up to 67.8 ± 1.4% relative to single tab cooling, and can emulate the performance of a more complex pack-level double tab cooling approach whilst targeting cooling at a single tab.
Martin-Ruiz, Carmen; Saretzki, Gabriele; Petrie, Joanne; Ladhoff, Juliane; Jeyapalan, Jessie; Wei, Wenyi; Sedivy, John; von Zglinicki, Thomas
2004-04-23
The replicative life span of human fibroblasts is heterogeneous, with a fraction of cells senescing at every population doubling. To find out whether this heterogeneity is due to premature senescence, i.e. driven by a nontelomeric mechanism, fibroblasts with a senescent phenotype were isolated from growing cultures and clones by flow cytometry. These senescent cells had shorter telomeres than their cycling counterparts at all population doubling levels and both in mass cultures and in individual subclones, indicating heterogeneity in the rate of telomere shortening. Ectopic expression of telomerase stabilized telomere length in the majority of cells and rescued them from early senescence, suggesting a causal role of telomere shortening. Under standard cell culture conditions, there was a minor fraction of cells that showed a senescent phenotype and short telomeres despite active telomerase. This fraction increased under chronic mild oxidative stress, which is known to accelerate telomere shortening. It is possible that even high telomerase activity cannot fully compensate for telomere shortening in all cells. The data show that heterogeneity of the human fibroblast replicative life span can be caused by significant stochastic cell-to-cell variation in telomere shortening.
Liu, Yue-E; Lin, Qiang; Meng, Fan-Jie; Chen, Xue-Ji; Ren, Xiao-Cang; Cao, Bin; Wang, Na; Zong, Jie; Peng, Yu; Ku, Ya-Jun; Chen, Yan
2013-08-11
Increasing the radiotherapy dose can result in improved local control for non-small-cell lung cancer (NSCLC) and can thereby improve survival. Accelerated hypofractionated radiotherapy can expose tumors to a high dose of radiation in a short period of time, but the optimal treatment regimen remains unclear. The purpose of this study was to evaluate the feasibility of utilizing high-dose accelerated hypofractionated three-dimensional conformal radiotherapy (at 3 Gy/fraction) with concurrent vinorelbine (NVB) and carboplatin (CBP) chemotherapy for the treatment of local advanced NSCLC. Untreated patients with unresectable stage IIIA/IIIB NSCLC or patients with a recurrence of NSCLC received accelerated hypofractionated three-dimensional conformal radiotherapy. The total dose was greater than or equal to 60 Gy. The accelerated hypofractionated radiotherapy was conducted once daily at 3 Gy/fraction with 5 fractions per week, and the radiotherapy was completed in 5 weeks. In addition to radiotherapy, the patients also received at least 1 cycle of a concurrent two-drug chemotherapy regimen of NVB and CBP. A total of 26 patients (19 previously untreated cases and 7 cases of recurrent disease) received 60Gy-75Gy radiotherapy with concurrent chemotherapy. All of the patients underwent evaluations for toxicity and preliminary therapeutic efficacy. There were no treatment-related deaths within the entire patient group. The major acute adverse reactions were radiation esophagitis (88.5%) and radiation pneumonitis (42.3%). The percentages of grade III acute radiation esophagitis and grade III radiation pneumonitis were 15.4% and 7.7%, respectively. Hematological toxicities were common and did not significantly affect the implementation of chemoradiotherapy after supportive treatment. Two patients received high dose of 75 Gy had grade III late esophageal toxicity, and none had grade IV and above. Grade III and above late lung toxicity did not occur. High-dose accelerated hypofractionated three-dimensional conformal radiotherapy with a dose of 60 Gy or greater with concurrent NVB and CBP chemotherapy might be feasible. However esophagus toxicity needs special attention. A phase I trial is recommended to obtain the maximum tolerated radiation dose of accelerated hypofractionated radiotherapy with concurrent chemotherapy.
2013-01-01
Background Increasing the radiotherapy dose can result in improved local control for non-small-cell lung cancer (NSCLC) and can thereby improve survival. Accelerated hypofractionated radiotherapy can expose tumors to a high dose of radiation in a short period of time, but the optimal treatment regimen remains unclear. The purpose of this study was to evaluate the feasibility of utilizing high-dose accelerated hypofractionated three-dimensional conformal radiotherapy (at 3 Gy/fraction) with concurrent vinorelbine (NVB) and carboplatin (CBP) chemotherapy for the treatment of local advanced NSCLC. Methods Untreated patients with unresectable stage IIIA/IIIB NSCLC or patients with a recurrence of NSCLC received accelerated hypofractionated three-dimensional conformal radiotherapy. The total dose was greater than or equal to 60 Gy. The accelerated hypofractionated radiotherapy was conducted once daily at 3 Gy/fraction with 5 fractions per week, and the radiotherapy was completed in 5 weeks. In addition to radiotherapy, the patients also received at least 1 cycle of a concurrent two-drug chemotherapy regimen of NVB and CBP. Results A total of 26 patients (19 previously untreated cases and 7 cases of recurrent disease) received 60Gy-75Gy radiotherapy with concurrent chemotherapy. All of the patients underwent evaluations for toxicity and preliminary therapeutic efficacy. There were no treatment-related deaths within the entire patient group. The major acute adverse reactions were radiation esophagitis (88.5%) and radiation pneumonitis (42.3%). The percentages of grade III acute radiation esophagitis and grade III radiation pneumonitis were 15.4% and 7.7%, respectively. Hematological toxicities were common and did not significantly affect the implementation of chemoradiotherapy after supportive treatment. Two patients received high dose of 75 Gy had grade III late esophageal toxicity, and none had grade IV and above. Grade III and above late lung toxicity did not occur. Conclusion High-dose accelerated hypofractionated three-dimensional conformal radiotherapy with a dose of 60 Gy or greater with concurrent NVB and CBP chemotherapy might be feasible. However esophagus toxicity needs special attention. A phase I trial is recommended to obtain the maximum tolerated radiation dose of accelerated hypofractionated radiotherapy with concurrent chemotherapy. PMID:23937855
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arsenyev, Sergey Andreyevich; Simakov, Evgenya Ivanovna; Shchegolkov, Dmitry
2015-04-29
We report the design and experimental data for a copper prototype of a superconducting radio-frequency (SRF) accelerator module. The five-cell module has an incorporated photonic band gap (PBG) cell with couplers. The purpose of the PBG cell is to achieve better higher order mode (HOM) damping, which is vital for preserving the quality of high-current electron beams. Better HOM damping raises the current threshold for beam instabilities in novel SRF accelerators. The PBG design also increases the real-estate gradient of the linac because both HOM damping and the fundamental power coupling can be done through the PBG cell instead ofmore » on the beam pipe via complicated end assemblies. First, we will discuss the design and accelerating properties of the structure. The five-cell module was optimized to provide good HOM damping while maintaining the same accelerating properties as conventional elliptical-cell modules. We will then discuss the process of tuning the structure to obtain the desired accelerating gradient profile. Finally, we will list measured quality factors for the accelerating mode and the most dangerous HOMs.« less
NASA Astrophysics Data System (ADS)
Kim, Sung-Kon; Kim, Ki-Hyun; Park, Jung Ock; Kim, Kihyun; Ko, Taeyun; Choi, Seong-Woo; Pak, Chanho; Chang, Hyuk; Lee, Jong-Chan
2013-03-01
For polymer electrolyte membrane fuel cell (PEMFC) applications at elevated temperature (>100 °C), a series of cross-linked benzoxazine-benzimidazole copolymer, P(HFa-co-BI), membranes are prepared by casting a solution of poly[2,2‧-(m-phenylene)-5,5‧-bibenzimidazole] (PBI) and di-functional benzoxazine monomer, 6,6‧-(hexafluoroisopropylidene)bis(3-phenyl-3,4-dihydro-2H-benzoxazine) (HFa), in N,N-dimethylacetamide prior to stepwise heating to 250 °C. The films are also viable to manufacture to large quantities and area by roll-to-roll coating. The resulting cross-linked copolymer, P(HFa-co-BI), membranes are found to be thermally and mechanically stable. Although the proton conductivity values of P(HFa-co-BI) membranes are smaller than that of the PBI membrane, their cell performance (0.68 V at 0.2 A cm-2 at 150 °C) is close to that of PBI membrane and their long-term durability (ca. 3116 cycles on in situ accelerated lifetime mode of load cycling testing) is found to be far superior to the PBI membrane.
Exploratory Research and Development Fund, FY 1990
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-05-01
The Lawrence Berkeley Laboratory Exploratory R D Fund FY 1990 report is compiled from annual reports submitted by principal investigators following the close of the fiscal year. This report describes the projects supported and summarizes their accomplishments. It constitutes a part of an Exploratory R D Fund (ERF) planning and documentation process that includes an annual planning cycle, projection selection, implementation, and review. The research areas covered in this report are: Accelerator and fusion research; applied science; cell and molecular biology; chemical biodynamics; chemical sciences; earth sciences; engineering; information and computing sciences; materials sciences; nuclear science; physics and research medicinemore » and radiation biophysics.« less
Accelerating Technology Development through Integrated Computation and Experimentation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shekhawat, Dushyant; Srivastava, Rameshwar D.; Ciferno, Jared
2013-08-15
This special section of Energy & Fuels comprises a selection of papers presented at the topical conference “Accelerating Technology Development through Integrated Computation and Experimentation”, sponsored and organized by the United States Department of Energy’s National Energy Technology Laboratory (NETL) as part of the 2012 American Institute of Chemical Engineers (AIChE) Annual Meeting held in Pittsburgh, PA, Oct 28-Nov 2, 2012. That topical conference focused on the latest research and development efforts in five main areas related to fossil energy, with each area focusing on the utilization of both experimental and computational approaches: (1) gas separations (membranes, sorbents, and solventsmore » for CO{sub 2}, H{sub 2}, and O{sub 2} production), (2) CO{sub 2} utilization (enhanced oil recovery, chemical production, mineralization, etc.), (3) carbon sequestration (flow in natural systems), (4) advanced power cycles (oxy-combustion, chemical looping, gasification, etc.), and (5) fuel processing (H{sub 2} production for fuel cells).« less
Sheybani, Roya; Meng, Ellis
2015-01-01
Recombination of electrolysis gases (oxidation of hydrogen and reduction of oxygen) is an important factor in operation efficiency of devices employing electrolysis such as actuators and also unitized regenerative fuel cells. Several methods of improving recombination speed and repeatability were developed for application to electrolysis microactuators with Nafion®-coated catalytic electrodes. Decreasing the electrolysis chamber volume increased the speed, consistency, and repeatability of the gas recombination rate. To further improve recombination performance, methods to increase the catalyst surface area, hydrophobicity, and availability were developed and evaluated. Of these, including in the electrolyte pyrolyzed-Nafion®-coated Pt segments contained in the actuator chamber accelerated recombination by increasing the catalyst surface area and decreasing the gas transport diffusion path. This approach also reduced variability in recombination encountered under varying actuator orientation (resulting in differing catalyst/gas bubble proximity) and increased the rate of recombination by 2.3 times across all actuator orientations. Repeatability of complete recombination for different generated gas volumes was studied through cycling. PMID:26251561
Upadhya, Vinayak; Pai, Sandeep R.; Sharma, Ajay K.; Hegde, Harsha V.; Kholkute, Sanjiva D.; Joshi, Rajesh K.
2014-01-01
Effects of varying temperatures with constant pressure of solvent on extraction efficiency of two chemically different alkaloids were studied. Camptothecin (CPT) from stem of Nothapodytes nimmoniana (Grah.) Mabb. and piperine from the fruits of Piper nigrum L. were extracted using Accelerated Solvent Extractor (ASE). Three cycles of extraction for a particular sample cell at a given temperature assured complete extraction. CPT and piperine were determined and quantified by using a simple and efficient UFLC-PDA (245 and 343 nm) method. Temperature increased efficiency of extraction to yield higher amount of CPT, whereas temperature had diminutive effect on yield of piperine. Maximum yield for CPT was achieved at 80°C and for piperine at 40°C. Thus, the study determines compound specific extraction of CPT from N. nimmoniana and piperine from P. nigrum using ASE method. The present study indicates the use of this method for simple, fast, and accurate extraction of the compound of interest. PMID:24527258
High field gradient particle accelerator
Nation, J.A.; Greenwald, S.
1989-05-30
A high electric field gradient electron accelerator utilizing short duration, microwave radiation, and capable of operating at high field gradients for high energy physics applications or at reduced electric field gradients for high average current intermediate energy accelerator applications is disclosed. Particles are accelerated in a smooth bore, periodic undulating waveguide, wherein the period is so selected that the particles slip an integral number of cycles of the r.f. wave every period of the structure. This phase step of the particles produces substantially continuous acceleration in a traveling wave without transverse magnetic or other guide means for the particle. 10 figs.
Jain, Abhishek; Chen, Wei Ning
2018-05-01
Nickel (Ni(II)) toxicity is addressed by many different bacteria, but bacterial responses to nickel stress are still unclear. Therefore, we studied the effect of Ni(II) toxicity on cell proliferation of α-proteobacterium Caulobacter crescentus. Next, we showed the mechanism that allows C. crescentus to survive in Ni(II) stress condition. Our results revealed that the growth of C. crescentus is severely affected when the bacterium was exposed to different Ni(II) concentrations, 0.003 mM slightly affected the growth, 0.008 mM reduced the growth by 50%, and growth was completely inhibited at 0.015 mM. It was further shown that Ni(II) toxicity induced mislocalization of major regulatory proteins such as MipZ, FtsZ, ParB, and MreB, resulting in dysregulation of the cell cycle. GC-MS metabolomics analysis of Ni(II) stressed C. crescentus showed an increased level of nine important metabolites including TCA cycle intermediates and amino acids. This indicates that changes in central carbon metabolism and nitrogen metabolism are linked with the disruption of cell division process. Addition of malic acid, citric acid, alanine, proline, and glutamine to 0.015 mM Ni(II)-treated C. crescentus restored its growth. Thus, the present work shows a protective effect of these organic acids and amino acids on Ni(II) toxicity. Metabolic stimulation through the PutA/GlnA pathway, accelerated degradation of CtrA, and Ni-chelation by organic acids or amino acids are some of the possible mechanisms suggested to be involved in enhancing C. crescentus's tolerance. Our results shed light on the mechanism of increased Ni(II) tolerance in C. crescentus which may be useful in bioremediation strategies and synthetic biology applications such as the development of whole cell biosensor.
The 19q12 bladder cancer GWAS signal: association with cyclin E function and aggressive disease
Fu, Yi-Ping; Kohaar, Indu; Moore, Lee E.; Lenz, Petra; Figueroa, Jonine D.; Tang, Wei; Porter-Gill, Patricia; Chatterjee, Nilanjan; Scott-Johnson, Alexandra; Garcia-Closas, Montserrat; Muchmore, Brian; Baris, Dalsu; Paquin, Ashley; Ylaya, Kris; Schwenn, Molly; Apolo, Andrea B.; Karagas, Margaret R.; Tarway, McAnthony; Johnson, Alison; Mumy, Adam; Schned, Alan; Guedez, Liliana; Jones, Michael A.; Kida, Masatoshi; Monawar Hosain, GM; Malats, Nuria; Kogevinas, Manolis; Tardon, Adonina; Serra, Consol; Carrato, Alfredo; Garcia-Closas, Reina; Lloreta, Josep; Wu, Xifeng; Purdue, Mark; Andriole, Gerald L.; Grubb, Robert L.; Black, Amanda; Landi, Maria T.; Caporaso, Neil E.; Vineis, Paolo; Siddiq, Afshan; Bueno-de-Mesquita, H. Bas; Trichopoulos, Dimitrios; Ljungberg, Börje; Severi, Gianluca; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth C.; Tjønneland, Anne; Brennan, Paul; Chang-Claude, Jenny; Riboli, Elio; Prescott, Jennifer; Chen, Constance; De Vivo, Immaculata; Govannucci, Edward; Hunter, David; Kraft, Peter; Lindstrom, Sara; Gapstur, Susan M.; Jacobs, Eric J.; Diver, W. Ryan; Albanes, Demetrius; Weinstein, Stephanie J.; Virtamo, Jarmo; Kooperberg, Charles; Hohensee, Chancellor; Rodabough, Rebecca J.; Cortessis, Victoria K.; Conti, David V.; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Haiman, Christopher A.; Cussenot, Olivier; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Porru, Stefano; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Grossman, H. Barton; Wang, Zhaoming; Deng, Xiang; Chung, Charles C.; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Fraumeni, Joseph; Chanock, Stephen J.; Hewitt, Stephen M.; Silverman, Debra T.; Rothman, Nathaniel; Prokunina-Olsson, Ludmila
2014-01-01
A genome-wide association study (GWAS) of bladder cancer identified a genetic marker rs8102137 within the 19q12 region as a novel susceptibility variant. This marker is located upstream of the CCNE1 gene, which encodes cyclin E, a cell cycle protein. We performed genetic fine mapping analysis of the CCNE1 region using data from two bladder cancer GWAS (5,942 cases and 10,857 controls). We found that the original GWAS marker rs8102137 represents a group of 47 linked SNPs (with r2≥0.7) associated with increased bladder cancer risk. From this group we selected a functional promoter variant rs7257330, which showed strong allele-specific binding of nuclear proteins in several cell lines. In both GWAS, rs7257330 was associated only with aggressive bladder cancer, with a combined per-allele odds ratio (OR) =1.18 (95%CI=1.09-1.27, p=4.67×10−5 vs. OR =1.01 (95%CI=0.93-1.10, p=0.79) for non-aggressive disease, with p=0.0015 for case-only analysis. Cyclin E protein expression analyzed in 265 bladder tumors was increased in aggressive tumors (p=0.013) and, independently, with each rs7257330-A risk allele (ptrend=0.024). Over-expression of recombinant cyclin E in cell lines caused significant acceleration of cell cycle. In conclusion, we defined the 19q12 signal as the first GWAS signal specific for aggressive bladder cancer. Molecular mechanisms of this genetic association may be related to cyclin E over-expression and alteration of cell cycle in carriers of CCNE1 risk variants. In combination with established bladder cancer risk factors and other somatic and germline genetic markers, the CCNE1 variants could be useful for inclusion into bladder cancer risk prediction models. PMID:25320178
Huang, Yuehua; Tai, Andrew W; Tong, Shuping; Lok, Anna S F
2013-06-01
Hepatitis B virus (HBV) core promoter (CP) mutations have been associated with an increased risk of hepatocellular carcinoma (HCC) in clinical studies. We previously reported that a combination of CP mutations seen in HCC patients, expressed in HBx gene, increased SKP2 (S-phase kinase-associated protein 2) expression, thereby promoting cellular proliferation. Here, we investigate the possible mechanisms by which CP mutations upregulate SKP2. We used immunoblotting and ATPlite assay to validate the effect of CP mutations in full-length HBV genome on cell cycle regulator levels and cell proliferation. Activation of SKP2 mRNA was assessed by quantitative real-time PCR in primary human hepatocytes (PHH) and HCC cell lines. Effect of CP mutations on SKP2 promoter activity was determined by luciferase assay. Target regulation of E2F1 on SKP2 was analyzed by siRNAs. CP mutations in full-length HBV genome upregulated SKP2 expression, thereby downregulating cell cycle inhibitors and accelerating cellular proliferation. CP mutations enhanced SKP2 promoter activity but had no effect on SKP2 protein stability. Mapping of the SKP2 promoter identified a region necessary for activation by CP mutations that contains an E2F1 response element. Knocking down E2F1 reduced the effects of CP mutations on SKP2 and cellular proliferation. The effect of CP mutations on E2F1 might be mediated through hyperphosphorylation of RB. HBV CP mutations enhance SKP2 transcription by activating the E2F1 transcription factor and in turn downregulate cell cycle inhibitors, thus providing a potential mechanism for an association between CP mutations and HCC. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping
2017-10-03
The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo . Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo . Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro . Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence.
Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping
2017-01-01
The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo. Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo. Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro. Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence. PMID:29108242
The Energy Efficiency of High Intensity Proton Driver Concepts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yakovlev, Vyacheslav; Grillenberger, Joachim; Kim, Sang-Ho
2017-05-01
For MW class proton driver accelerators the energy efficiency is an important aspect; the talk reviews the efficiency of different accelerator concepts including s.c./n.c. linac, rapid cycling synchrotron, cyclotron; the potential of these concepts for very high beam power is discussed.
Goodwin accelerator model revisited with fixed time delays
NASA Astrophysics Data System (ADS)
Matsumoto, Akio; Merlone, Ugo; Szidarovszky, Ferenc
2018-05-01
Dynamics of Goodwin's accelerator business cycle model is reconsidered. The model is characterized by a nonlinear accelerator and an investment time delay. The role of the nonlinearity for the birth of persistent oscillations is fully discussed in the existing literature. On the other hand, not much of the role of the delay has yet been revealed. The purpose of this paper is to show that the delay really matters. In the original framework of Goodwin [6], it is first demonstrated that there is a threshold value of the delay: limit cycles arise for smaller values than the threshold and so do sawtooth oscillations for larger values. In the extended framework in which a consumption or saving delay, in addition to the investment delay, is introduced, three main results are demonstrated under assumption of the identical length of investment and consumption delays. The dynamics with consumption delay is basically the same as that of the single delay model. Second, in the case of saving delay, the steady state can coexist with the stable and unstable limit cycles in the stable case. Third, in the unstable case, there is an interval of delay in which the limit cycle or the sawtooth oscillation emerges depending on the choice of the constant initial function.
HDAC9 promotes glioblastoma growth via TAZ-mediated EGFR pathway activation.
Yang, Rui; Wu, Yanan; Wang, Mei; Sun, Zhongfeng; Zou, Jiahua; Zhang, Yundong; Cui, Hongjuan
2015-04-10
Histone deacetylase 9 (HDAC9), a member of class II HDACs, regulates a wide variety of normal and abnormal physiological functions. We found that HDAC9 is over-expressed in prognostically poor glioblastoma patients. Knockdown HDAC9 decreased proliferation in vitro and tumor formation in vivo. HDAC9 accelerated cell cycle in part by potentiating the EGFR signaling pathway. Also, HDAC9 interacted with TAZ, a key downstream effector of Hippo pathway. Knockdown of HDAC9 decreased the expression of TAZ. We found that overexpressed TAZ in HDAC9-knockdown cells abrogated the effects induced by HDAC9 silencing both in vitro and in vivo. We demonstrated that HDAC9 promotes tumor formation of glioblastoma via TAZ-mediated EGFR pathway activation, and provide the evidence for promising target for the treatment of glioblastoma.
Plaga, Wulf; Stamm, Irmela; Schairer, Hans Ulrich
1998-01-01
The myxobacterium Stigmatella aurantiaca passes through a life cycle that involves formation of a multicellular fruiting body as the most complex stage. An early step in this differentiation process depends on a signal factor secreted by the cells when nutrients become limited. The formation of a fruiting body from a small cell population can be accelerated by addition of this secreted material. The bioactive compound was found to be steam volatile. It was purified to homogeneity by steam distillation followed by reversed-phase and normal-phase HPLC. The pheromone was named stigmolone, in accordance with the structure 2,5,8-trimethyl-8-hydroxy-nonan-4-one, as determined by NMR and mass spectrometry. Stigmolone represents a structurally unique and highly bioactive prokaryotic pheromone that is effective in the bioassay at 1 nM concentration. PMID:9736724
Plaga, W; Stamm, I; Schairer, H U
1998-09-15
The myxobacterium Stigmatella aurantiaca passes through a life cycle that involves formation of a multicellular fruiting body as the most complex stage. An early step in this differentiation process depends on a signal factor secreted by the cells when nutrients become limited. The formation of a fruiting body from a small cell population can be accelerated by addition of this secreted material. The bioactive compound was found to be steam volatile. It was purified to homogeneity by steam distillation followed by reversed-phase and normal-phase HPLC. The pheromone was named stigmolone, in accordance with the structure 2,5, 8-trimethyl-8-hydroxy-nonan-4-one, as determined by NMR and mass spectrometry. Stigmolone represents a structurally unique and highly bioactive prokaryotic pheromone that is effective in the bioassay at 1 nM concentration.
Maximum cycle work output optimization for generalized radiative law Otto cycle engines
NASA Astrophysics Data System (ADS)
Xia, Shaojun; Chen, Lingen; Sun, Fengrui
2016-11-01
An Otto cycle internal combustion engine which includes thermal and friction losses is investigated by finite-time thermodynamics, and the optimization objective is the maximum cycle work output. The thermal energy transfer from the working substance to the cylinder inner wall follows the generalized radiative law (q∝Δ (Tn)). Under the condition that all of the fuel consumption, the compression ratio and the cycle period are given, the optimal piston trajectories for both the examples with unlimited and limited accelerations on every stroke are determined, and the cycle-period distribution among all strokes is also optimized. Numerical calculation results for the case of radiative law are provided and compared with those obtained for the cases of Newtonian law and linear phenomenological law. The results indicate that the optimal piston trajectory on each stroke contains three sections, which consist of an original maximum-acceleration and a terminal maximum-deceleration parts; for the case of radiative law, optimizing the piston motion path can achieve an improvement of more than 20% in both the cycle-work output and the second-law efficiency of the Otto cycle compared with the conventional near-sinusoidal operation, and heat transfer mechanisms have both qualitative and quantitative influences on the optimal paths of piston movements.
Female acceleration tolerance: effects of menstrual state and physical condition.
Heaps, C L; Fischer, M D; Hill, R C
1997-06-01
The literature contains a paucity of information on female tolerance to high sustained acceleration. With women now flying high-performance aircraft, gender-specific factors that may affect female acceleration tolerance have become increasingly important. The purpose of this investigation was to determine how menstrual state and physical condition affect acceleration tolerance. We hypothesized the menstrual cycle would have no effect on acceleration tolerance and that a positive correlation would exist between physical fitness level and tolerance to high sustained acceleration. Centrifuge exposures on 8 female subjects consisted of a relaxed gradual-onset run (0.1 G.s-1) to the visual endpoint, a rapid-onset run (6 G.s-1) to +5 GZ for 15 s, and a +4.5 to +7 GZ simulated aerial combat maneuver (SACM) to physical exhaustion. Acceleration tolerance data were collected at onset of menstruation and 1, 2 and 3 weeks following the onset for two complete menstrual cycles. On separate days, body composition, anaerobic power output and peak oxygen uptake were determined. Retrospective data from 10 male subjects who had performed the +4.5 to +7 GZ SACM were analyzed and compared to these data. Analysis of variance revealed no significant difference in relaxed tolerance or SACM duration between the four selected menstrual cycle time points. Time-to-fatigue on the +4.5 to +7 GZ SACM was positively (p < or = 0.05) correlated with absolute fat-free mass (r = 0.87) and anaerobic power production (r = 0.76) in female subjects. However, when these variables were adjusted for total body mass, the significant correlations no longer existed. No correlation was found between SACM duration and absolute (L min-1) nor relative (ml.kg-1.min-1) aerobic fitness. Time-to-fatigue during the SACM was not significantly different between male and female subjects (250 +/- 97 and 246 +/- 149 s, respectively).
ATR inhibition controls aggressive prostate tumors deficient in Y-linked histone demethylase KDM5D.
Komura, Kazumasa; Yoshikawa, Yuki; Shimamura, Teppei; Chakraborty, Goutam; Gerke, Travis A; Hinohara, Kunihiko; Chadalavada, Kalyani; Jeong, Seong Ho; Armenia, Joshua; Du, Shin-Yi; Mazzu, Ying Z; Taniguchi, Kohei; Ibuki, Naokazu; Meyer, Clifford A; Nanjangud, Gouri J; Inamoto, Teruo; Lee, Gwo-Shu Mary; Mucci, Lorelei A; Azuma, Haruhito; Sweeney, Christopher J; Kantoff, Philip W
2018-06-04
Epigenetic modifications control cancer development and clonal evolution in various cancer types. Here, we show that loss of the male-specific histone demethylase lysine-specific demethylase 5D (KDM5D) encoded on the Y chromosome epigenetically modifies histone methylation marks and alters gene expression, resulting in aggressive prostate cancer. Fluorescent in situ hybridization demonstrated that segmental or total deletion of the Y chromosome in prostate cancer cells is one of the causes of decreased KDM5D mRNA expression. The result of ChIP-sequencing analysis revealed that KDM5D preferably binds to promoter regions with coenrichment of the motifs of crucial transcription factors that regulate the cell cycle. Loss of KDM5D expression with dysregulated H3K4me3 transcriptional marks was associated with acceleration of the cell cycle and mitotic entry, leading to increased DNA-replication stress. Analysis of multiple clinical data sets reproducibly showed that loss of expression of KDM5D confers a poorer prognosis. Notably, we also found stress-induced DNA damage on the serine/threonine protein kinase ATR with loss of KDM5D. In KDM5D-deficient cells, blocking ATR activity with an ATR inhibitor enhanced DNA damage, which led to subsequent apoptosis. These data start to elucidate the biological characteristics resulting from loss of KDM5D and also provide clues for a potential novel therapeutic approach for this subset of aggressive prostate cancer.
Keratin14 mRNA expression in human pneumocytes during quiescence, repair and disease
Confalonieri, Marco; Buratti, Emanuele; Grassi, Gabriele; Bussani, Rossana; Chilosi, Marco; Farra, Rossella; Abrami, Michela; Stuani, Cristiana; Salton, Francesco; Ficial, Miriam; Confalonieri, Paola; Zandonà, Lorenzo; Romano, Maurizio
2017-01-01
The lung alveoli slowly self-renew pneumocytes, but their facultative regeneration capacity is rapidly efficient after an injury, so fibrosis infrequently occurs. We recently observed Keratin 14 (KRT14) expression during diffuse alveolar damage (DAD), but not in controls. We wonder if KRT14 may be a marker of pneumocyte transition from quiescence to regeneration. Quantitative PCR and Western blot analyses highlighted the presence of KRT14 (mRNA and protein) only in human lung samples with DAD or interstitial lung disease (ILD). In the exponentially growing cell lines A549 and H441, the mRNA and protein levels of KRT14 peaked at day one after cell seeding and decreased at day two, opposite to what observed for the proliferation marker E2F1. The inverse relation of KRT14 versus E2F1 expression holds true also for other proliferative markers, such as cyclin E1 and cyclin D1. Of interest, we also found that E2F1 silencing caused cell cycle arrest and increased KRT14 expression, whilst E2F1 stimulation induced cell cycle progression and decreased KRT14. KRT14 also increased in proliferative pneumocytes (HPAEpiC) just before transdifferentiation. Overall, our results suggest that KRT14 is a viable biomarker of pneumocyte activation, and repair/regeneration. The involvement of KRT14 in regenerative process may suggest a novel pharmaceutical target to accelerate lung repair. PMID:28199407
Keratin14 mRNA expression in human pneumocytes during quiescence, repair and disease.
Confalonieri, Marco; Buratti, Emanuele; Grassi, Gabriele; Bussani, Rossana; Chilosi, Marco; Farra, Rossella; Abrami, Michela; Stuani, Cristiana; Salton, Francesco; Ficial, Miriam; Confalonieri, Paola; Zandonà, Lorenzo; Romano, Maurizio
2017-01-01
The lung alveoli slowly self-renew pneumocytes, but their facultative regeneration capacity is rapidly efficient after an injury, so fibrosis infrequently occurs. We recently observed Keratin 14 (KRT14) expression during diffuse alveolar damage (DAD), but not in controls. We wonder if KRT14 may be a marker of pneumocyte transition from quiescence to regeneration. Quantitative PCR and Western blot analyses highlighted the presence of KRT14 (mRNA and protein) only in human lung samples with DAD or interstitial lung disease (ILD). In the exponentially growing cell lines A549 and H441, the mRNA and protein levels of KRT14 peaked at day one after cell seeding and decreased at day two, opposite to what observed for the proliferation marker E2F1. The inverse relation of KRT14 versus E2F1 expression holds true also for other proliferative markers, such as cyclin E1 and cyclin D1. Of interest, we also found that E2F1 silencing caused cell cycle arrest and increased KRT14 expression, whilst E2F1 stimulation induced cell cycle progression and decreased KRT14. KRT14 also increased in proliferative pneumocytes (HPAEpiC) just before transdifferentiation. Overall, our results suggest that KRT14 is a viable biomarker of pneumocyte activation, and repair/regeneration. The involvement of KRT14 in regenerative process may suggest a novel pharmaceutical target to accelerate lung repair.
Effects of ionizing radiation on bone cell differentiation in an experimental murine bone cell model
NASA Astrophysics Data System (ADS)
Baumstark-Khan, Christa; Lau, Patrick; Hellweg, Christine; Reitz, Guenther
During long-term space travel astronauts are exposed to a complex mixture of different radiation types under conditions of dramatically reduced weight-bearing activity. It has been validated that astronauts loose a considerable amount of bone mass at a rate up to one to two percent each month in space. Therapeutic doses of ionizing radiation cause bone damage and increase fracture risks after treatment for head-and-neck cancer and in pelvic irradiation. For low radiation doses, the possibility of a disturbed healing potential of bone was described. Radiation induced damage has been discussed to inflict mainly on immature and healing bone. Little is known about radiation effects on bone remodelling and even less on the combined action of microgravity and radiation. Bone remodelling is a life-long process performed by balanced action of cells from the osteoblast and osteoclast lineages. While osteoblasts differentiate either into bone-lining cells or into osteocytes and play a crucial role in bone matrix synthesis, osteoclasts are responsible for bone resorption. We hypothesize that the balance between bone matrix assembly by osteocytes and bone degradation by osteoclasts is modulated by microgravity as well as by ionizing radiation. To address this, a cell model consisting of murine cell lines with the potential to differentiate into bone-forming osteoblasts (OCT-1, MC3T3-E1 S24, and MC3T3-E1 S4) was used for studying radiation response after exposure to simulated components of cosmic radiation. Cells were exposed to graded doses of 150 kV X-rays, α particles (0.525 MeV/u, 160 keV/µm; PTB, Braunschweig, Germany) and accelerated heavy ions (75 MeV/u carbon, 29 keV/µm; 95 MeV/u argon, 230 keV/µm; GANIL, Caen, France). Cell survival was measured as colony forming ability; cell cycle progression was analyzed via fluorescence-activated cell scanning (FACS) by measurement of the content of propidium iodide-stained DNA, DNA damage was visualized by γH2AX-immunostaining. Osteoblastogenesis was estimated by measurement of alkaline phosphatase (ALP) activity and production of mineralized matrix (von-Kossa staining, Alizarin Red staining). During the process of osteoblastic cell differentiation, the expression of the bone specific marker genes osteocalcin (OCN) and osteopontin (OPN) were recorded by quantitative real time reverse transcription PCR (qRT-PCR). Compared with standard culture conditions, the osteogenic marker genes OCN and OPN were highly expressed during the differentiation process induced either by osteo-inductive media additives (50 µg/ml ascorbic acid, 10 mmol/l β-glycero phosphate) or by sparsely ionizing radiation (X-rays). After 21 days of postirradiation incubation sparsely ionizing radiation could be shown to induce the formation of bone-like nodules (von-Kossa staining) for OCT-1 and MC3T3-E1 S4 cells but nor for MC3T3- E1 S24 cells. Ionizing radiation leads to a cell cycle arrest which is resolved in a dose and time dependent way. This was accompanied by a dose dependent regulation of the cyclin kinase inhibitor CDKN1A (p21/WAF) and transforming growth factor beta 1 (TGF-β1). TGF-β1 is known to affect osteoblast differentiation, matrix formation and mineralization. Modulation of its expression could influence the expression of main osteogenic transcription factors. For exposure with high LET radiation a pronounced cell cycle block was evident. The expression of the osteogenic marker genes OCN and Osterix (OSX) was increased in the OCT-1 cells with differentiation potential for exposure to α particles and accelerated carbon and argon ions. The results on the expression of differentiation markers during radiation-induced premature differentiation of bone cells of the osteoblast lineage show that densely ionizing radiation results in expression of proteins essential for bone formation and consequently in an increase in bone volume. Such an effect has been observed in in-vivo carbon ion irradiated rats. As radiation dependent permanent cell cycle blocks lead to a depletion of proliferation-competent cells from the osteoblastic precursor pool in the body, a gradual decrease of bone mass in weightlessness may be attributed to synergistic effects of radiation and weightlessness.
BBU design of linear induction accelerator cells for radiography application
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shang, C.C.; Chen, Y.J.; Gaporaso, G.J.
1997-05-06
There is an ongoing effort to develop accelerating modules for high-current electron accelerators for advanced radiography application. Accelerating modules with low beam-cavity coupling impedances along with gap designs with acceptable field stresses comprise a set of fundamental design criteria. We examine improved cell designs which have been developed for accelerator application in several radiographic operating regimes. We evaluate interaction impedances, analyze the effects of beam structure coupling on beam dynamics (beam break-up instability and corkscrew motion). We also provide estimates of coupling through interesting new high-gradient insulators and evaluate their potential future application in induction cells.
The RNA binding protein tristetraprolin down-regulates autophagy in lung adenocarcinoma cells.
Dong, Fei; Li, Cen; Wang, Pu; Deng, Xiaoya; Luo, Qinli; Tang, Xiaokui; Xu, Li
2018-06-01
Tristetraprolin (TTP) is the most well-known member of RNA-binding zinc-finger protein that play a significant role in accelerating mRNA decay. Increasingly studies have reported that TTP was functioned as a tumor suppressor gene in several types of carcinomas, while its underlying mechanism is not clear yet. In the current study, we found that TTP overexpression decreased cell proliferation and increased cell death in lung adenocarcinoma cells, with the cell cycle arrest at the S phase. Remarkably, instead of inducing cell apoptosis directly, TTP overexpression alters cell autophagy. Our studies demonstrate that TTP overexpression has no effect on apoptosis related genes, but decreases the expression of autophagy-related genes, including Beclin 1 and LC3II. The level of autophagy flux assessed by infection with the mGFP-RFP-LC3 adenovirus construction has been blocked by TTP overexpression. Moreover, the autophagic vacuoles number detected by transmission electron microscopy decreased with TTP expression up-regulation. Our results indicate, for the first time, that TTP suppresses cell proliferation and increases cell death through cell autophagy pathway in lung cancer cells. Our study provides a new angle of view for TTP function as a tumor suppressor which could be targeted in tumor treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Er-Wen; Department of Forensic Pathology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou; Xue, Sheng-Jiang
Highlights: • Levels of EEN expression paralleled with the rate of cell proliferation. • EEN was involved in the proliferation and survival of multiple myeloma (MM) cells. • EEN regulated the activity of IGF-1-Akt/mTOR pathway. • EEN regulated proliferation and survival of MM cells by enhancing IGF-1 secretion. - Abstract: The molecular mechanisms of multiple myeloma are not well defined. EEN is an endocytosis-regulating molecule. Here we report that EEN regulates the proliferation and survival of multiple myeloma cells, by regulating IGF-1 secretion. In the present study, we observed that EEN expression paralleled with cell proliferation, EEN accelerated cell proliferation,more » facilitated cell cycle transition from G1 to S phase by regulating cyclin-dependent kinases (CDKs) pathway, and delayed cell apoptosis via Bcl2/Bax-mitochondrial pathway. Mechanistically, we found that EEN was indispensable for insulin-like growth factor-1 (IGF-1) secretion and the activation of protein kinase B-mammalian target of rapamycin (Akt-mTOR) pathway. Exogenous IGF-1 overcame the phenotype of EEN depletion, while IGF-1 neutralization overcame that of EEN over-expression. Collectively, these data suggest that EEN may play a pivotal role in excessive cell proliferation and insufficient cell apoptosis of bone marrow plasma cells in multiple myeloma. Therefore, EEN may represent a potential diagnostic marker or therapeutic target for multiple myeloma.« less
Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C
2001-05-01
Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.
Cycle-powered short radius (1.9M) centrifuge: exercise vs. passive acceleration
NASA Technical Reports Server (NTRS)
Greenleaf, J. E.; Gundo, D. P.; Watenpaugh, D. E.; Mulenburg, G. M.; Marchman, N.; Looft-Wilson, R.; Hargens, A. R.
1996-01-01
A human-powered short-arm centrifuge is described. This centrifuge could be used during spaceflight to provide +Gz acceleration while subjects performed exercise, thus supplying two forms of weightlessness countermeasures. Results from a study of cardiovascular responses while using the centrifuge are presented.
DOT National Transportation Integrated Search
1986-09-01
Accelerated laboratory atmospheric exposure simulation tests with an acceleration factor of 50 and extending for a maximum of 2200 wet-dry cycles (6-year exposure equivalent) gave corrosion loss data that agreed fairly well with the field data derive...
Arsac, L M; Belli, A; Lacour, J R
1996-01-01
A friction loaded cycle ergometer was instrumented with a strain gauge and an incremental encoder to obtain accurate measurement of human mechanical work output during the acceleration phase of a cycling sprint. This device was used to characterise muscle function in a group of 15 well-trained male subjects, asked to perform six short maximal sprints on the cycle against a constant friction load. Friction loads were successively set at 0.25, 0.35, 0.45, 0.55, 0.65 and 0.75 N.kg-1 body mass. Since the sprints were performed from a standing start, and since the acceleration was not restricted, the greatest attention was paid to the measurement of the acceleration balancing load due to flywheel inertia. Instantaneous pedalling velocity (v) and power output (P) were calculated each 5 ms and then averaged over each downstroke period so that each pedal downstroke provided a combination of v, force and P. Since an 8-s acceleration phase was composed of about 21 to 34 pedal downstrokes, this many v-P combinations were obtained amounting to 137-180 v-P combinations for all six friction loads in one individual, over the widest functional range of pedalling velocities (17-214 rpm). Thus, the individual's muscle function was characterised by the v-P relationships obtained during the six acceleration phases of the six sprints. An important finding of the present study was a strong linear relationship between individual optimal velocity (vopt) and individual maximal power output (Pmax) (n = 15, r = 0.95, P < 0.001) which has never been observed before. Since vopt has been demonstrated to be related to human fibre type composition both vopt, Pmax and their inter-relationship could represent a major feature in characterising muscle function in maximal unrestricted exercise. It is suggested that the present method is well suited to such analyses.
Future orbital transfer vehicle technology study. Volume 2: Technical report
NASA Technical Reports Server (NTRS)
Davis, E. E.
1982-01-01
Missions for future orbit transfer vehicles (1995-2010) are identified and the technology, operations and vehicle concepts that satisfy the transportation requirements are defined. Comparison of reusable space and ground based LO2/LH2 OTV's was made. Both vehicles used advanced space engines and aero assist capability. The SB OTV provided advantages in life cycle cost, performance and potential for improvement. Comparison of an all LO2/LH2 OTV fleet with a fleet of LO2/LH2 OTVs and electric OTV's was also made. The normal growth technology electric OTV used silicon cells with heavy shielding and argon ion thrusters. This provided a 23% advantage in total transportation cost. The impact of accelerated technology was considered in terms of improvements in performance and cost effectiveness. The accelerated technology electric vehicle used GaAs cells and annealing but did not result in the mixed fleet being any cheaper than an all LO2/LH2 OTV fleet. It is concluded that reusable LO2/LH2 OTV's can serve all general purpose cargo roles between LEO and GEO for the forseeable future. The most significant technology for the second generation vehicle would be space debris protection, on-orbit propellant storage and transfer and on-orbit maintenance capability.
Al-Haj, Latifa; Blackshear, Perry J.; Khabar, Khalid S.A.
2012-01-01
The p21Cip1/WAF1 plays an important role in cell-cycle arrest. Here, we find that RNase L regulates p21-mediated G1 growth arrest in AU-rich elements-dependent manner. We found a significant loss of p21 mRNA expression in RNASEL−/− MEFs and that the overexpression of RNase L in HeLa cells induces p21 mRNA expression. The p21 mRNA half-life significantly changes as a result of RNase L modulation, indicating a post-transcriptional effect. Indeed, we found that RNase L promotes tristetraprolin (TTP/ZFP36) mRNA decay. This activity was not seen with dimerization- and nuclease-deficient RNase L mutants. Deficiency in TTP led to increases in p21 mRNA and protein. With induced ablation of RNase L, TTP mRNA and protein expressions were higher, while p21 expression became reduced. We further establish that TTP, but not C124R TTP mutant, binds to, and accelerates the decay of p21 mRNA. The p21 mRNA half-life was prolonged in TTP−/− MEFs. The TTP regulation of p21 mRNA decay required functional AU-rich elements. Thus, we demonstrate a novel mechanism of regulating G1 growth arrest by an RNase L-TTP-p21 axis. PMID:22718976
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Undariopsis peterseniana Promotes Hair Growth by the Activation of Wnt/β-Catenin and ERK Pathways
Kang, Jung-Il; Kim, Min-Kyoung; Lee, Ji-Hyeok; Jeon, You-Jin; Hwang, Eun-Kyoung; Koh, Young-Sang; Hyun, Jin-Won; Kwon, Soon-Young; Yoo, Eun-Sook; Kang, Hee-Kyoung
2017-01-01
In this study, we investigated the effect and mechanism of Undariopsis peterseniana, an edible brown alga, on hair growth. The treatment of vibrissa follicles with U. peterseniana extract ex vivo for 21 days significantly increased the hair-fiber lengths. The U. peterseniana extract also significantly accelerated anagen initiation in vivo. Moreover, we found that U. peterseniana extract was able to open the KATP channel, which may contribute to increased hair growth. The U. peterseniana extract decreased 5α-reductase activity and markedly increased the proliferation of dermal papilla cells, a central regulator of the hair cycle. The U. peterseniana extract increased the levels of cell cycle proteins, such as Cyclin D1, phospho(ser780)-pRB, Cyclin E, phospho-CDK2, and CDK2. The U. peterseniana extract also increased the phosphorylation of ERK and the levels of Wnt/β-catenin signaling proteins such as glycogen synthase kinase-3β (GSK-3β) and β-catenin. These results suggested that the U. peterseniana extract had the potential to influence hair growth by dermal papilla cells proliferation through the activation of the Wnt/β-catenin and ERK pathways. We isolated a principal of the U. peterseniana extract, which was subsequently identified as apo-9′-fucoxanthinone, a trichogenic compound. The results suggested that U. peterseniana extract may have a pivotal role in the treatment of alopecia. PMID:28475144
Undariopsis peterseniana Promotes Hair Growth by the Activation of Wnt/β-Catenin and ERK Pathways.
Kang, Jung-Il; Kim, Min-Kyoung; Lee, Ji-Hyeok; Jeon, You-Jin; Hwang, Eun-Kyoung; Koh, Young-Sang; Hyun, Jin-Won; Kwon, Soon-Young; Yoo, Eun-Sook; Kang, Hee-Kyoung
2017-05-05
In this study, we investigated the effect and mechanism of Undariopsis peterseniana , an edible brown alga, on hair growth. The treatment of vibrissa follicles with U. peterseniana extract ex vivo for 21 days significantly increased the hair-fiber lengths. The U. peterseniana extract also significantly accelerated anagen initiation in vivo. Moreover, we found that U. peterseniana extract was able to open the K ATP channel, which may contribute to increased hair growth. The U. peterseniana extract decreased 5α-reductase activity and markedly increased the proliferation of dermal papilla cells, a central regulator of the hair cycle. The U. peterseniana extract increased the levels of cell cycle proteins, such as Cyclin D1, phospho(ser780)-pRB, Cyclin E, phospho-CDK2, and CDK2. The U. peterseniana extract also increased the phosphorylation of ERK and the levels of Wnt/β-catenin signaling proteins such as glycogen synthase kinase-3β (GSK-3β) and β-catenin. These results suggested that the U. peterseniana extract had the potential to influence hair growth by dermal papilla cells proliferation through the activation of the Wnt/β-catenin and ERK pathways. We isolated a principal of the U. peterseniana extract, which was subsequently identified as apo-9'-fucoxanthinone, a trichogenic compound. The results suggested that U. peterseniana extract may have a pivotal role in the treatment of alopecia.
Wang, Chen-Hao; Hsu, Hsin-Cheng; Wang, Kai-Ching
2014-08-01
Carbon-supported Pt, Pd, Pd-Pt core-shell (Pt(shell)-Pd(core)/C) and Ir-decorated Pd-Pt core-shell (Ir-decorated Pt(shell)-Pd(core)/C) catalysts were synthesized, and their physical properties, electrochemical behaviors, oxygen reduction reaction (ORR) characteristics and proton exchange membrane fuel cell (PEMFC) performances were investigated herein. From the XRD patterns and TEM images, Ir-decorated Pt(shell)-Pd(core)/C has been confirmed that Pt was deposited on the Pd nanoparticle which had the core-shell structure. Ir-decorated Pt(shell)-Pd(core)/C has more positive OH reduction peak than Pt/C, which is beneficial to weaken the binding energy of Pt-OH during the ORR. Thus, Ir-decorated Pt(shell)-Pd(core)/C has higher ORR activity than Pt/C. The maximum power density of H2-O2 PEMFC using Ir-decorated Pt(shell)-Pd(core)/C is 792.2 mW cm(-2) at 70°C, which is 24% higher than that using Pt/C. The single-cell accelerated degradation test of PEMFC using Ir-decorated Pt(shell)-Pd(core)/C shows good durability by the potential cycling of 40,000 cycles. This study concludes that Ir-decorated Pt(shell)-Pd(core)/C has the low Pt content, but it can facilitate the low-cost and high-efficient PEMFC. Copyright © 2013 Elsevier Inc. All rights reserved.
Asai, M; Ikeda, M; Akiyama, M; Oshima, I; Shibata, S
2000-09-08
We analyzed effects of aging on behavioral rhythms in the mouse showing senescence acceleration, SAMP8 strains. The free-running rhythms had longer free-running periods (tau) in SAMP8 than in the control strain (SAMR1). Drinking of melatonin promoted the adaptation to advanced LD in SAMR1 but not in SAMP8, although both strains exhibited melatonin MT1 and MT2 receptors. The present results suggest that melatonin promotes the adaptation to advanced LD cycles in normal aging mice.
Accelerated formation of cubic phases in phosphatidylethanolamine dispersions.
Tenchov, B; Koynova, R; Rapp, G
1998-01-01
By means of x-ray diffraction we show that several sodium salts and the disaccharides sucrose and trehalose strongly accelerate the formation of cubic phases in phosphatidylethanolamine (PE) dispersions upon temperature cycling through the lamellar liquid crystalline-inverted hexagonal (Lalpha-HII) phase transition. Ethylene glycol does not have such an effect. The degree of acceleration increases with the solute concentration. Such an acceleration has been observed for dielaidoyl PE (DEPE), dihexadecyl PE, and dipalmitoyl PE. It was investigated in detail for DEPE dispersions. For DEPE (10 wt% of lipid) aqueous dispersions at 1 M solute concentration, 10-50 temperature cycles typically result in complete conversion of the Lalpha phase into cubic phase. Most efficient is temperature cycling executed by laser flash T-jumps. In that case the conversion completes within 10-15 cycles. However, the cubic phases produced by laser T-jumps are less ordered in comparison to the rather regular cubic structures produced by linear, uniform temperature cycling at 10 degrees C/min. Temperature cycles at scan rates of 1-3 degrees C/min also induce the rapid formation of cubic phases. All solutes used induce the formation of Im3m (Q229) cubic phase in 10 wt% DEPE dispersions. The initial Im3m phases appearing during the first temperature cycles have larger lattice parameters that relax to smaller values with continuation of the cycling after the disappearance of the Lalpha phase. A cooperative Im3m --> Pn3m transition takes place at approximately 85 degrees C and transforms the Im3m phase into a mixture of coexisting Pn3m (Q224) and Im3m phases. The Im3m/Pn3m lattice parameter ratio is 1. 28, as could be expected from a representation of the Im3m and Pn3m phases with the primitive and diamond infinite periodic minimal surfaces, respectively. At higher DEPE contents ( approximately 30 wt%), cubic phase formation is hindered after 20-30 temperature cycles. The conversion does not go through, but reaches a stage with coexisting Ia3d (Q230) and Lalpha phases. Upon heating, the Ia3d phase cooperatively transforms into a mixture of, presumably, Im3m and Pn3m phases at about the temperature of the Lalpha-HII transition. This transformation is readily reversible with the temperature. The lattice parameters of the DEPE cubic phases are temperature-insensitive in the Lalpha temperature range and decrease with the temperature in the range of the HII phase. PMID:9675186
Cars Gone Wild: The Major Contributor to Unintended Acceleration in Automobiles is Pedal Error
Schmidt, Richard A.; Young, Douglas E.
2010-01-01
“Unintended-acceleration” automobile accidents typically begin when the driver first enters the car, starts the engine, and intends to press his/her right foot on the brake while shifting from Park to a drive gear (Drive or Reverse). The driver reports an unintended (uncommanded) full-throttle acceleration, coupled with a loss of braking, until the episode ends in a crash. Pedal misapplications – where the right foot contacts the accelerator instead of the brake that was intended – have been linked to these accidents (Schmidt, 1989, 1993) which, in the 1980s, were thought to occur only at the start of a driving cycle (and/or with the car in Park). But, in 1997, we identified over 200 pedal errors as the cause of accidents reported in the North Carolina database; these crashes occurred during the driving cycle (Schmidt et al., 1997), and/or with the vehicle in a gear other than Park. Our present work provides a more thorough analysis of these North Carolina Police Accident Reports from 1979 to 1995. The vast majority of pedal misapplications (over 92%) (a) occurred during the driving cycle, (b) were generally in “unhurried” conditions, and (c) were categorically separate from those events referred to as unintended-acceleration episodes at start-up. These ideas are explanatory for the recent (2009–2010) surge of unintended-acceleration reports, perhaps even suggesting that all of these crashes are caused by pedal errors, and that none of them are based on some vehicle defect(s). PMID:21833265
A CW FFAG for Proton Computed Tomography
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnstone, C.; Neuffer, D. V.; Snopok, P.
2012-05-01
An advantage of the cyclotron in proton therapy is the continuous (CW) beam output which reduces complexity and response time in the dosimetry requirements and beam controls. A CW accelerator requires isochronous particle orbits at all energie s through the acceleration cycle and present compact isochronous cyclotrons for proton therapy reach only 250 MeV (kinetic energy) which is required for patient treatment, but low for full Proton Computed Tomography (PCT) capability. PCT specifications ne ed 300-330 MeV in order for protons to transit the human body. Recent innovations in nonscaling FFAG design have achieved isochronous performance in a compact (~3more » m radius) design at these higher energies. Preliminary isochronous designs are presented her e. Lower energy beams can be efficiently extracted for patient treatment without changes to the acceleration cycle and magnet currents.« less
Solder joint aging characteristics from the MC2918 firing set of a B61 accelerated aging unit (AAU)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vianco, P.T.; Rejent, J.A.
1997-10-01
The B61 accelerated aging unit (AAU) provided a unique opportunity to document the effects of a controlled, long-term thermal cycling environment on the aging of materials used in the device. This experiment was of particular interest to solder technologists because thermal cycling environments are a predominant source of solder joint failures in electronic assemblies. Observations of through hole solder joints in the MC2918 Firing Set from the B61 AAU did not reveal signs of catastrophic failure. Quantitative analyses of the microstructural metrics of intermetallic compound layer thickness and Pb-rich phase particle distributions indicated solder joint aging that was commensurate withmore » the accelerated aging environment. The effects of stress-enhanced coarsening of the Pb-rich phase were also documented.« less
CD271 regulates the proliferation and motility of hypopharyngeal cancer cells.
Mochizuki, Mai; Tamai, Keiichi; Imai, Takayuki; Sugawara, Sayuri; Ogama, Naoko; Nakamura, Mao; Matsuura, Kazuto; Yamaguchi, Kazunori; Satoh, Kennichi; Sato, Ikuro; Motohashi, Hozumi; Sugamura, Kazuo; Tanaka, Nobuyuki
2016-07-29
CD271 (p75 neurotrophin receptor) plays both positive and negative roles in cancer development, depending on the cell type. We previously reported that CD271 is a marker for tumor initiation and is correlated with a poor prognosis in human hypopharyngeal cancer (HPC). To clarify the role of CD271 in HPC, we established HPC cell lines and knocked down the CD271 expression using siRNA. We found that CD271-knockdown completely suppressed the cells' tumor-forming capability both in vivo and in vitro. CD271-knockdown also induced cell-cycle arrest in G0 and suppressed ERK phosphorylation. While treatment with an ERK inhibitor only partially inhibited cell growth, CDKN1C, which is required for maintenance of quiescence, was strongly upregulated in CD271-depleted HPC cells, and the double knockdown of CD271 and CDKN1C partially rescued the cells from G0 arrest. In addition, either CD271 depletion or the inhibition of CD271-RhoA signaling by TAT-Pep5 diminished the in vitro migration capability of the HPC cells. Collectively, CD271 initiates tumor formation by increasing the cell proliferation capacity through CDKN1C suppression and ERK-signaling activation, and by accelerating the migration signaling pathway in HPC.
Cairney, C J; Sanguinetti, G; Ranghini, E; Chantry, A D; Nostro, M C; Bhattacharyya, A; Svendsen, C N; Keith, W N; Bellantuono, I
2009-04-01
Stem cells are central to the development and maintenance of many tissues. This is due to their capacity for extensive proliferation and differentiation into effector cells. More recently it has been shown that the proliferative and differentiative ability of stem cells decreases with age, suggesting that this may play a role in tissue aging. Down syndrome (DS), is associated with many of the signs of premature tissue aging including T-cell deficiency, increased incidence of early Alzheimer-type, Myelodysplastic-type disease and leukaemia. Previously we have shown that both hematopoietic (HSC) and neural stem cells (NSC) in patients affected by DS showed signs of accelerated aging. In this study we tested the hypothesis that changes in gene expression in HSC and NSC of patients affected by DS reflect changes occurring in stem cells with age. The profiles of genes expressed in HSC and NSC from DS patients highlight pathways associated with cellular aging including a downregulation of DNA repair genes and increases in proapoptotic genes, s-phase cell cycle genes, inflammation and angiogenesis genes. Interestingly, Notch signaling was identified as a potential hub, which when deregulated may drive stem cell aging. These data suggests that DS is a valuable model to study early events in stem cell aging.
Synthesis and Characterization of Mixed-Conducting Corrosion Resistant Oxide Supports
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramani, Vijay K.
An extensive search and evaluation of electrochemically stable catalyst supports (including metal oxides like RuO2-SiO2, RuO2-TiO2, and ITO was perfomed during the 4 years of the project. The suports were also catalyzed by deposition of Pt and tested for its performance and electrochemical stability in RDE and fuel cell experiments. For testing the electrochemical stability and fuel cell performance of the catalysts and supports, we have employed the protocols in use at the Department of Energy and Nissan Technological Center North America (NTCNA). The use of such procedures allows a precise and reproducible estimation of the performance and stability ofmore » the materials and permits comparisons among laboratories and DOE funded projects. RuO2-SiO2 catalyst supports showed no loss in surface area during start-stop stability tests that were performed by cycling the electrode potential between 0 V to 1.8 V for 1000 cycles. Catalyzed support (40% Pt/RuO2-SiO2; 1:1 mole ratio) were tested in a PEFC, resulting in a current density of 750 mA/cm2 at 0.6 Volts, and a maximum power density of 570 mW/cm2. Measurements were conducted at 80 ºC with 75% relative humidity of the inlet gases (H2/O2); Pt loadings were 0.4 mg/cm2 at the cathode and 0.2 mg/cm2 at the anode. Start-stop stability tests for support and catalyzed support performed in RDE and PEFC set-ups have confirmed RuO2-TiO2 support stability. The beginning of life performance was exactly equal to end of life performance (in an MEA that has been subjected to severe start-stop cycling for 10,000 start/stop cycles between 1 V to 1.5 V). This result was in sharp contrast to baseline Pt/C catalyst that showed significant performance deterioration after accelerated stability tests. The Pt/TRO showed minimal loss in performance upon exposure to start-stop cycles. The loss in cell voltage at 1 A/cm2 at 100% RH was almost 700 mV for Pt/C whereas it was only ca. 15 mV for Pt/TRO. 40% RH data (of inlet gases) revealed a similar trend in terms of stability – exceptional stability for Pt/TRO as opposed to very poor stability for Pt/HSAC. These observations were attributed to the much higher stability of the TRO support compared to Carbon. The carbon dioxide concentration in the cathode exit stream during the accelerated degradation test with Pt/TRO (start-stop protocol) was extremely low (between 3 to 10 ppm of CO2). In contrast, the CO2 emission levels from a conventional Pt/C catalyst were found to be approx. 200 ppm. This observation was a clear indicator that the main source of carbon being oxidized to carbon dioxide in an MEA was the carbon catalyst support, and not the gas diffusion layer or the graphite flow fields. Indium tin oxide (ITO) was also evaluated as a catalyst support for PEFCs. Pt/ITO was very stable under start-up/shutdown accelerated degradation protocol (RDE tests in perchloric acid). The ECSA change was less than 4% over 10,000 cycles. The load cycling accelerated protocol (from 0.6 to 0.95 V vs. RHE) resulted in a loss of approximately 34% of the initial ECSA after 10,000 cycles. However, fuel cell testing resulted in a very low performing catalyst. XPS spectroscopy was employed to investigate the changes in the catalysts occuring during fuel cell operation. It was observed a shift of In 3d5/2 and In 3d3/2 peaks towards higher binding energies. This can be explained by the formation of hydroxides or oxy-hydroxides in the surface of the catalyst. O1s spectrum for Pt/ITO catalyst after being operated in the fuel cell, also confirmed the formation of significant amounts of surface hydroxides (12 to 16%). The presence of surface hydroxides in the catalyst increased the electrode resistivity affecting fuel cell performance. NTCNA performed a detailed analysis of transport phenomena (reactants and products to/from the Pt active sites) in both commercial catalyst and Pt/RTO (in order to have a better understanding at the basic level). The proton resistance (Rionomer) in Pt/C and Pt/RTO cathode catalyst layers were 150 and 12 mΩ-cm2, respectively. Pt/RTO catalyst layer has about an order or magnitude lower proton transfer resistance than Pt/C catalyst layer. Since the ionomer/support ratio that was used in formulating the ink for both catalysts was the same (0.9), it is expected that the volumetric coverage of ionomer of both catalysts will be significantly different due to the disparity in the surface areas (Pt/C had ~ 800 m2/g, while Pt/RTO had ~ 50 m2/g). The differences in the ionomer volumetric coverage and the ionomer film thickness may explain the significantly higher proton conductivity in the Pt/RTO catalyst layer when compared to Pt/HSAC. It is therefore very important to optimize the ionomer loadings when synthesizing new catalyst supports (and never rely on values for carbon-based commercial catalysts). Finally, NTCNA has elaborated a cost model for non-carbon support materials considering their durability benefits. Material costs for production of Pt/ RuO2-TiO2 electrodes were compared to Pt/C. RuO2-TiO2 support was more expensive than carbon but the total material cost was still dominated by platinum cost. Though ruthenium is considered a precious metal, its cost is far less than platinum. It should also be noted that ruthenium only makes up 38% of the mass of the support, while the rest is inexpensive TiO2. After considering the durability advantages of Pt/RTO, cost model showed that even with almost double the Pt loading (0.35 vs 0.18 mgPt/cm2), Pt/RTO ($22.7/kWnet) is only slightly more expensive than Pt/C ($21.9/kWnet).« less
Laranjeiro, Ricardo; Tamai, T Katherine; Letton, William; Hamilton, Noémie; Whitmore, David
2018-04-01
Studies from a number of model systems have shown that the circadian clock controls expression of key cell cycle checkpoints, thus providing permissive or inhibitory windows in which specific cell cycle events can occur. However, a major question remains: Is the clock actually regulating the cell cycle through such a gating mechanism or, alternatively, is there a coupling process that controls the speed of cell cycle progression? Using our light-responsive zebrafish cell lines, we address this issue directly by synchronizing the cell cycle in culture simply by changing the entraining light-dark (LD) cycle in the incubator without the need for pharmacological intervention. Our results show that the cell cycle rapidly reentrains to a shifted LD cycle within 36 h, with changes in p21 expression and subsequent S phase timing occurring within the first few hours of resetting. Reentrainment of mitosis appears to lag S phase resetting by 1 circadian cycle. The range of entrainment of the zebrafish clock to differing LD cycles is large, from 16 to 32 hour periods. We exploited this feature to explore cell cycle entrainment at both the population and single cell levels. At the population level, cell cycle length is shortened or lengthened under corresponding T-cycles, suggesting that a 1:1 coupling mechanism is capable of either speeding up or slowing down the cell cycle. However, analysis at the single cell level reveals that this, in fact, is not true and that a gating mechanism is the fundamental method of timed cell cycle regulation in zebrafish. Cell cycle length at the single cell level is virtually unaltered with varying T-cycles.
Tamai, T. Katherine; Letton, William; Hamilton, Noémie; Whitmore, David
2018-01-01
Studies from a number of model systems have shown that the circadian clock controls expression of key cell cycle checkpoints, thus providing permissive or inhibitory windows in which specific cell cycle events can occur. However, a major question remains: Is the clock actually regulating the cell cycle through such a gating mechanism or, alternatively, is there a coupling process that controls the speed of cell cycle progression? Using our light-responsive zebrafish cell lines, we address this issue directly by synchronizing the cell cycle in culture simply by changing the entraining light-dark (LD) cycle in the incubator without the need for pharmacological intervention. Our results show that the cell cycle rapidly reentrains to a shifted LD cycle within 36 h, with changes in p21 expression and subsequent S phase timing occurring within the first few hours of resetting. Reentrainment of mitosis appears to lag S phase resetting by 1 circadian cycle. The range of entrainment of the zebrafish clock to differing LD cycles is large, from 16 to 32 hour periods. We exploited this feature to explore cell cycle entrainment at both the population and single cell levels. At the population level, cell cycle length is shortened or lengthened under corresponding T-cycles, suggesting that a 1:1 coupling mechanism is capable of either speeding up or slowing down the cell cycle. However, analysis at the single cell level reveals that this, in fact, is not true and that a gating mechanism is the fundamental method of timed cell cycle regulation in zebrafish. Cell cycle length at the single cell level is virtually unaltered with varying T-cycles. PMID:29444612
Data Requirements for Ceiling and Visibility Products Development
1994-04-13
and Water - Cycle Experiment (GEWEX), STORM 1, and the Naval Research Laboratory’s Coastal Me- teorology Accelerated Research Initiative field... Water - Cycle Experiment HPCN High Plains Climate Network lOP Intensive Observation Period ICN Illinois Climate Network ITWS Integrated Terminal Weather
Sheen, Yi-Shuan; Fan, Sabrina Mai-Yi; Chan, Chih-Chieh; Wu, Yueh-Feng; Jee, Shiou-Hwa; Lin, Sung-Jan
2015-01-01
Hair follicles are located at the interface of the external and internal environments and their cycling has been shown to be regulated by intra- and extra-follicular factors. The aim of this study is to examine whether or how hair follicles respond to visible light. We examined the effect of 3 mW red (630 nm, 1 J/cm(2)), 2 mW green (522 nm, 1 J/cm(2)), and 2 mW blue light (463 nm, 1 J/cm(2)) on telogen in mice for 3 weeks. The photobiologic effects of red light on cell proliferation of outer root sheath keratinocytes and dermal papilla cells were studied in vitro. We found that red light accelerated anagen entry faster than green and blue light in mice. Red light irradiation stimulated the proliferation of both outer root sheath keratinocytes and dermal papilla cells in a dose-dependent manner by promoting cell cycle progression. This stimulative effect was mediated via extracellular signal-regulated kinase phosphorylation in both cells. In a co-culture condition, dermal papilla cells irradiated by red light further enhanced keratinocyte proliferation, suggesting enhanced epithelial-mesenchymal interaction. In search for factors that mediated this paracrine effect, we found fibroblast growth factor 7 was upregulated in both mRNA and protein levels. The stimulative paracrine effect on keratinocytes was significantly inhibited by neutralizing antibody against fibroblast growth factor 7. These results suggest that hair follicles respond to visible light in vivo. Red light may promote physiological telogen to anagen transition by directly stimulating outer root sheath keratinocytes and indirectly by enhancing epithelial-mesenchymal interaction in vitro. © 2014 Wiley Periodicals, Inc.
Long life nickel electrodes for a nickel-hydrogen cell. I Initial performance
NASA Technical Reports Server (NTRS)
Lim, H. S.; Verzwyvelt, S. A.; Blaser, C.; Keener, K. M.
1983-01-01
In order to develop a long life nickel electrode for a Ni/H2 cell, an investigation was begun to study the effects of sinter structure and active material loading level on the long life performance of nickel electrodes. This paper is a report on the initial performance of these electrodes as a part of an accelerated life test program. Seven different types of nickel plaques were made which included three levels of both their mechanical strength and median pore size. These plaques were impregnated with three levels of active material loading. The resultant electrodes were tested by a 200-cycle stress test which was conducted in flooded electrolyte, and also for initial performance in a Ni/H2 boiler plate cell. An interesting and unexpected observation was that an increased initial utilization of the active material was due more to its complete discharge to the lower average oxidation state than its increased charge acceptance in the charged state.
Mechanism of Growth Enhancement of Plants Induced by Active Species in Plasmas
NASA Astrophysics Data System (ADS)
Watanabe, Satoshi; Ono, Reoto; Hayashi, Nobuya
2015-09-01
Plant growth enhances when seeds are irradiated by plasma. However the mechanism of the growth enhancement by plasma has not been clarified. In this study, growth enhancement of plants using various active species and variation of plant cells are investigated. RF plasma is generated under conditions where pressure is 60 Pa and input electrical power is 60 W. Irradiation period varies from 0 (control) to 75 min. Air plasma shows maximum growth of plants with irradiation period of 60 min on the other hand, oxygen plasma shows the maximum growth with irradiation period of 15 min. From change of gaseous species and pressure dependence, growth enhancing factor is expected to be active oxygen species produced in plasma. According to gene expression analysis of Arabidopsis, there are two speculated mechanism of plant growth enhancement. The first is acceleration of cell cycle by gene expressions of photosynthesis and glycolytic pathway, and the second is increase of cell size via plant hormone production.
Analysis of Factors Affecting the Performance of RLV Thrust Cell Liners
NASA Technical Reports Server (NTRS)
Arnold, Steven M. (Technical Monitor); Butler, Daniel T., Jr.; Pinders, Marek-Jerzy
2004-01-01
The reusable launch vehicle (RLV) thrust cell liner, or thrust chamber, is a critical component of the Space Shuttle Main Engine (SSME). It is designed to operate in some of the most severe conditions seen in engineering practice. This requirement, in conjunction with experimentally observed 'dog-house' failure modes characterized by bulging and thinning of the cooling channel wall, provides the motivation to study the factors that influence RLV thrust cell liner performance. Factors or parameters believed to be directly related to the observed characteristic deformation modes leading to failure under in-service loading conditions are identified, and subsequently investigated using the cylindrical version of the higher-order theory for functionally graded materials in conjunction with the Robinson's unified viscoplasticity theory and the power-law creep model for modeling the response of the liner s constituents. Configurations are analyzed in which specific modifications in cooling channel wall thickness or constituent materials are made to determine the influence of these parameters on the deformations resulting in the observed failure modes in the outer walls of the cooling channel. The application of thermal barrier coatings and functional grading are also investigated within this context. Comparison of the higher-order theory results based on the Robinson and power-law creep model predictions has demonstrated that, using the available material parameters, the power-law creep model predicts more precisely the experimentally observed deformation leading to the 'dog-house' failure mode for multiple short cycles, while also providing much improved computational efficiency. However, for a single long cycle, both models predict virtually identical deformations. Increasing the power-law creep model coefficients produces appreciable deformations after just one long cycle that would normally be obtained after multiple cycles, thereby enhancing the efficiency of the analysis. This provides a basis for the development of an accelerated modeling procedure to further characterize dog-house deformation modes in RLV thrust cell liners. Additionally, the results presented herein have demonstrated that the mechanism responsible for deformation leading to 'dog-house' failure modes is driven by pressure, creep/relaxation and geometric effects.
Saikko, Vesa
2015-01-21
The temporal change of the direction of sliding relative to the ultrahigh molecular weight polyethylene (UHMWPE) component of prosthetic joints is known to be of crucial importance with respect to wear. One complete revolution of the resultant friction vector is commonly called a wear cycle. It was hypothesized that in order to accelerate the wear test, the cycle frequency may be substantially increased if the circumference of the slide track is reduced in proportion, and still the wear mechanisms remain realistic and no overheating takes place. This requires an additional slow motion mechanism with which the lubrication of the contact is maintained and wear particles are conveyed away from the contact. A three-station, dual motion high frequency circular translation pin-on-disk (HF-CTPOD) device with a relative cycle frequency of 25.3 Hz and an average sliding velocity of 27.4 mm/s was designed. The pins circularly translated at high frequency (1.0 mm per cycle, 24.8 Hz, clockwise), and the disks at low frequency (31.4mm per cycle, 0.5 Hz, counter-clockwise). In a 22 million cycle (10 day) test, the wear rate of conventional gamma-sterilized UHMWPE pins against polished CoCr disks in diluted serum was 1.8 mg per 24 h, which was six times higher than that in the established 1 Hz CTPOD device. The wear mechanisms were similar. Burnishing of the pin was the predominant feature. No overheating took place. With the dual motion HF-CTPOD method, the wear testing of UHMWPE as a bearing material in total hip arthroplasty can be substantially accelerated without concerns of the validity of the wear simulation. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Colgan, William Terence; Rajaram, Harihar; Anderson, Robert S.; Steffen, Konrad; Zwally, H. Jay; Phillips, Thomas; Abdalati, Waleed
2012-01-01
Ice velocities observed in 2005/06 at three GPS stations along the Sermeq Avannarleq flowline, West Greenland, are used to characterize an observed annual velocity cycle. We attempt to reproduce this annual ice velocity cycle using a 1-D ice-flow model with longitudinal stresses coupled to a 1-D hydrology model that governs an empirical basal sliding rule. Seasonal basal sliding velocity is parameterized as a perturbation of prescribed winter sliding velocity that is proportional to the rate of change of glacier water storage. The coupled model reproduces the broad features of the annual basal sliding cycle observed along this flowline, namely a summer speed-up event followed by a fall slowdown event. We also evaluate the hypothesis that the observed annual velocity cycle is due to the annual calving cycle at the terminus. We demonstrate that the ice acceleration due to a catastrophic calving event takes an order of magnitude longer to reach CU/ETH ('Swiss') Camp (46km upstream of the terminus) than is observed. The seasonal acceleration observed at Swiss Camp is therefore unlikely to be the result of velocity perturbations propagated upstream via longitudinal coupling. Instead we interpret this velocity cycle to reflect the local history of glacier water balance.
Cell cycle regulation in human embryonic stem cells: links to adaptation to cell culture.
Barta, Tomas; Dolezalova, Dasa; Holubcova, Zuzana; Hampl, Ales
2013-03-01
Cell cycle represents not only a tightly orchestrated mechanism of cell replication and cell division but it also plays an important role in regulation of cell fate decision. Particularly in the context of pluripotent stem cells or multipotent progenitor cells, regulation of cell fate decision is of paramount importance. It has been shown that human embryonic stem cells (hESCs) show unique cell cycle characteristics, such as short doubling time due to abbreviated G1 phase; these properties change with the onset of differentiation. This review summarizes the current understanding of cell cycle regulation in hESCs. We discuss cell cycle properties as well as regulatory machinery governing cell cycle progression of undifferentiated hESCs. Additionally, we provide evidence that long-term culture of hESCs is accompanied by changes in cell cycle properties as well as configuration of several cell cycle regulatory molecules.
Li, Liu; Song, Hao; Zhong, Liang; Yang, Rong; Yang, Xiao-Qun; Jiang, Kai-Ling; Liu, Bei-Zhong
2015-01-01
Acute promyelocytic leukemia (APL) is a subtype of acute myeloid leukemia (AML). With the application of all-trans retinoic acid (ATRA) and arsenic trioxide (ATO), APL becomes one of best prognosis of leukemia. However, ATRA and ATO are not effective against all APLs. Therefore, a new strategy for APL treatment is necessary. Here, we investigated whether lithium chloride (LiCl), a drug used for the treatment of mental illness, could promote apoptosis in human leukemia NB4 cells. We observed that treatment with LiCl significantly accelerated apoptosis in NB4 cells and led to cell cycle arrest at G2/M phase. Moreover, LiCl significantly increased the level of Ser9-phosphorylated glycogen synthase kinase 3β(p-GSK-3β), and decreased the level of Akt1 protein in a dose-dependent manner. In addition, LiCl inhibition of c-Myc also enhanced cell death with a concomitant increase in β-catnin. Taken together, these findings demonstrated that LiCl promoted apoptosis in NB4 cells through the Akt signaling pathway and that G2/M phase arrest was induced by increase of p-GSK-3β(S9).
CD271 regulates the proliferation and motility of hypopharyngeal cancer cells
Mochizuki, Mai; Tamai, Keiichi; Imai, Takayuki; Sugawara, Sayuri; Ogama, Naoko; Nakamura, Mao; Matsuura, Kazuto; Yamaguchi, Kazunori; Satoh, Kennichi; Sato, Ikuro; Motohashi, Hozumi; Sugamura, Kazuo; Tanaka, Nobuyuki
2016-01-01
CD271 (p75 neurotrophin receptor) plays both positive and negative roles in cancer development, depending on the cell type. We previously reported that CD271 is a marker for tumor initiation and is correlated with a poor prognosis in human hypopharyngeal cancer (HPC). To clarify the role of CD271 in HPC, we established HPC cell lines and knocked down the CD271 expression using siRNA. We found that CD271-knockdown completely suppressed the cells’ tumor-forming capability both in vivo and in vitro. CD271-knockdown also induced cell-cycle arrest in G0 and suppressed ERK phosphorylation. While treatment with an ERK inhibitor only partially inhibited cell growth, CDKN1C, which is required for maintenance of quiescence, was strongly upregulated in CD271-depleted HPC cells, and the double knockdown of CD271 and CDKN1C partially rescued the cells from G0 arrest. In addition, either CD271 depletion or the inhibition of CD271-RhoA signaling by TAT-Pep5 diminished the in vitro migration capability of the HPC cells. Collectively, CD271 initiates tumor formation by increasing the cell proliferation capacity through CDKN1C suppression and ERK-signaling activation, and by accelerating the migration signaling pathway in HPC. PMID:27469492
Batu Pahat Driving Cycle for Light Duty Gasoline Engine
NASA Astrophysics Data System (ADS)
Zainul Abidin, Zainul Ameerul Ikhsan B.; Faisal Hushim, Mohd; Ahmad, Osman Bin
2017-08-01
Driving cycle is a series of data points that represents the vehicle speed versus time. Transient driving cycles involve many changes such as frequent speed changes during typical on-road driving condition [2]. Model driving cycles involve protracted periods at constant speeds. The Batu Pahat Driving Cycle (BPDC) developed to represent the driving pattern of people in a district of Batu Pahat. Based on this driving cycle, it will be a reference to other researchers to study about the gases emission release and fuel consumption by the vehicle on the dynamometer or automotive simulation based on this driving cycle. Existing driving cycles used such as the New European Driving Cycle (NEDC), the Federal Test Procedure (FTP-72/75, and Japan 10-15 Mode Cycle is not appropriate for Batu Pahat district because of different road conditions, driving habits and environmental of developed driving cycle countries are not same [2][14]. Batu Pahat drive cycle was developed for low-capacity gasoline engine under 150 cc and operating on urban roads, rural roads and road around Universiti Tun Hussein Onn. The importance of these driving cycle as the reference for other research to measure and do automotive simulation regarding fuel consumption and gas emission release from the motorcycle for these three type of driving cycle area. Another use for driving cycles is in vehicle simulations [3]. More specifically, they are used in propulsion system simulations to predict the performance of internal combustion engines, transmissions, electric drive systems, batteries, fuel cell systems, and similar components [18]. Data collection methods used in this study is the use of Global Positioning System (GPS). The results obtained are not similar to each other due to differences in congestion on data taken. From the driving cycle graph obtained, such as the average velocity, maximum velocity, the duration and Positive Acceleration Kinetic Energy (PKE) can be determined. In addition, the best driving cycle sample can be determined from the sum of error calculated. The least sum of error means the best driving cycle
Advances in Nonlinear Non-Scaling FFAGs
NASA Astrophysics Data System (ADS)
Johnstone, C.; Berz, M.; Makino, K.; Koscielniak, S.; Snopok, P.
Accelerators are playing increasingly important roles in basic science, technology, and medicine. Ultra high-intensity and high-energy (GeV) proton drivers are a critical technology for accelerator-driven sub-critical reactors (ADS) and many HEP programs (Muon Collider) but remain particularly challenging, encountering duty cycle and space-charge limits in the synchrotron and machine size concerns in the weaker-focusing cyclotrons; a 10-20 MW proton driver is not presently considered technically achievable with conventional re-circulating accelerators. One, as-yet, unexplored re-circulating accelerator, the Fixed-field Alternating Gradient or FFAG, is an attractive alternative to the other approaches to a high-power beam source. Its strong focusing optics can mitigate space charge effects and achieve higher bunch charges than are possible in a cyclotron, and a recent innovation in design has coupled stable tunes with isochronous orbits, making the FFAG capable of fixed-frequency, CW acceleration, as in the classical cyclotron but beyond their energy reach, well into the relativistic regime. This new concept has been advanced in non-scaling nonlinear FFAGs using powerful new methodologies developed for FFAG accelerator design and simulation. The machine described here has the high average current advantage and duty cycle of the cyclotron (without using broadband RF frequencies) in combination with the strong focusing, smaller losses, and energy variability that are more typical of the synchrotron. The current industrial and medical standard is a cyclotron, but a competing CW FFAG could promote a shift in this baseline. This paper reports on these new advances in FFAG accelerator technology and presents advanced modeling tools for fixed-field accelerators unique to the code COSY INFINITY.1
A map of protein dynamics during cell-cycle progression and cell-cycle exit
Gookin, Sara; Min, Mingwei; Phadke, Harsha; Chung, Mingyu; Moser, Justin; Miller, Iain; Carter, Dylan
2017-01-01
The cell-cycle field has identified the core regulators that drive the cell cycle, but we do not have a clear map of the dynamics of these regulators during cell-cycle progression versus cell-cycle exit. Here we use single-cell time-lapse microscopy of Cyclin-Dependent Kinase 2 (CDK2) activity followed by endpoint immunofluorescence and computational cell synchronization to determine the temporal dynamics of key cell-cycle proteins in asynchronously cycling human cells. We identify several unexpected patterns for core cell-cycle proteins in actively proliferating (CDK2-increasing) versus spontaneously quiescent (CDK2-low) cells, including Cyclin D1, the levels of which we find to be higher in spontaneously quiescent versus proliferating cells. We also identify proteins with concentrations that steadily increase or decrease the longer cells are in quiescence, suggesting the existence of a continuum of quiescence depths. Our single-cell measurements thus provide a rich resource for the field by characterizing protein dynamics during proliferation versus quiescence. PMID:28892491
In vitro and in silico modeling of chromosomal instability
NASA Astrophysics Data System (ADS)
Andreev, Sergey; Eidelman, Yuri; Krasavin, Eugene; Govorun, Raisa; Koshlan, Igor; Pyatenko, Valentina; Korovchuk, Olga; Khvostunov, Igor; Sevankaev, Alexander
Exposure to ionizing radiation increases cancer risk in human population. Cancer is thought to originate from an altered expression of certain number of specific genes. It is widely recognized that chromosome aberrations (CA) are involved in stable change in expression of genes by gain or loss of their functions. Thus CA can contribute to initiation or progression of cancer. Radiation induces CA immediately after exposure (in first cell cycle) and results in formation of delayed CA in descendants of irradiated cells, or chromosomal instability phenotype (CI). Therefore quantification of CI is a prerequisite of any mechanistic model of radiation induced cancer risks. To quantify CI we designed a set of in vitr o and in silico experiments. Two experimental models for study of CI in vitro, CHO-K1 wild-type and V79 HPRT-mutant cells, were exploited. Chromosome and chromatid type aberrations (Giemsa staining) were scored following exposure to gamma-radiation and accelerated ions (protons, LET=0.22 keV/µm, 7 Li3+ , LET=20 keV/µm, 14 7+ N , LET=77 keV/µm). The obtained results suggested that slowly growing colonies of HPRT mutant cells originating from lowand high-LET irradiated wt V79 cells were formed. After 14 N7+ ions irradiation about 50-100% of colonies had the decreased growth rate and CI phenotype was observed mainly in slowly growing colonies. High, compared to control, level of unstable CA (dicentrics) was observed in the progeny of gamma-irradiated CHO-K1 cells at different time points up to 30 cell generations. CA frequency, the number of cells with aberrations and the shape of a CA-vs-time curve were found to be dependent on the cell culture state (stationary or logarithmic phase) in which they were irradiated. Inhibition of replication and repair DNA synthesis by ara-C and hydroxyurea resulted in small modification of CA dynamics for stat-phase cells. For log-phase cell culture, in contrast, DNA synthesis inhibitors drastically impacted CA dynamics. In order to investigate the relationship between radiation-induced DNA double-strand breaks, CA and their transmission through cell division cycles we proposed a mechanism of CI incorporating the idea of breakage-fusion-bridge cycle. It explains in biophysical terms the generation of CA, in particular, of unstable type, in cells survived radiation exposure. The in silico experiments were carried out to elucidate different scenarios of CI. The computational data showed that the increased frequency of delayed dicentrics at different times after exposure could be well described for both stat and log-phase exposed cultures by the proposed mechanism if the fraction of cells in different cell cycle phases at the time of iradiation is taken into account. The perspectives for further experimental and theoretical mechanistic study of CI and possible implications for cancer risk modeling are discussed.
Temporal and Spatial Dynamics of Diel-Cycling Hypoxia in Four Northern Gulf of Mexico Estuaries
Eutrophication of coastal ecosystems has accelerated in recent decades due to population growth and associated nutrient pollution, resulting in increased incidence of hypoxia. Shallow and highly productive estuaries and embayments are particularly susceptible to diel-cycling hypo...
Kosir, Mary Ann; Fuller, Lisa; Tyburski, James; Berant, Lisa; Yu, Minghuan
2008-11-01
Surgical training integrates the 4 steps of the Kolb learning cycle. Residents who scored at 30th percentile or less on the American Board of Surgery In-Training Exam (ABSITE) were enrolled in the Accelerated Clinical Education in Surgery (ACES) course that incorporated the Kolb cycle. For concrete experience, Surgical Education and Self-Assessment Program (SESAP-13) was completed according to the syllabus. For reflective consideration, further reading was done on SESAP 13 topics and corresponding ABSITE Keywords. For the abstract hypotheses step; these keywords and topics were reviewed with the mentor. Active testing involved a required weekly on-line quiz based on the syllabus. Correct scores on the ABSITE increased for 78.6% of residents in the ACES course, with 28.6% scoring 30th percentile or greater. Senior percent correct scores increased by 7.3% and junior percentile scores by 12.5%. Remediation using the Kolb cycle improved ABSITE performance for a majority of participants.
Cell division cycle 45 promotes papillary thyroid cancer progression via regulating cell cycle.
Sun, Jing; Shi, Run; Zhao, Sha; Li, Xiaona; Lu, Shan; Bu, Hemei; Ma, Xianghua
2017-05-01
Cell division cycle 45 was reported to be overexpressed in some cancer-derived cell lines and was predicted to be a candidate oncogene in cervical cancer. However, the clinical and biological significance of cell division cycle 45 in papillary thyroid cancer has never been investigated. We determined the expression level and clinical significance of cell division cycle 45 using The Cancer Genome Atlas, quantitative real-time polymerase chain reaction, and immunohistochemistry. A great upregulation of cell division cycle 45 was observed in papillary thyroid cancer tissues compared with adjacent normal tissues. Furthermore, overexpression of cell division cycle 45 positively correlates with more advanced clinical characteristics. Silence of cell division cycle 45 suppressed proliferation of papillary thyroid cancer cells via G1-phase arrest and inducing apoptosis. The oncogenic activity of cell division cycle 45 was also confirmed in vivo. In conclusion, cell division cycle 45 may serve as a novel biomarker and a potential therapeutic target for papillary thyroid cancer.
Han, Changseok; Zhao, Amy; Varughese, Eunice; Sahle-Demessie, E
2018-01-01
Nano-fillers are increasingly incorporated into polymeric materials to improve the mechanical, barrier or other matrix properties of nanocomposites used for consumer and industrial applications. However, over the life cycle, these nanocomposites could degrade due to exposure to environmental conditions, resulting in the release of embedded nanomaterials from the polymer matrix into the environment. This paper presents a rigorous study on the degradation and the release of nanomaterials from food packaging composites. Films of nano-clay-loaded low-density polyethylene (LDPE) composite for food packaging applications were prepared with the spherilene technology and exposed to accelerated weathering of ultraviolet (UV) irradiation or low concentration of ozone at 40 °C. The changes in the structural, surface morphology, chemical and physical properties of the films during accelerated weathering were investigated. Qualitative and quantitative changes in properties of pristine and aged materials and the release of nano-clay proceeded slowly until 130 hr irradiation and then accelerated afterward resulting complete degradation. Although nano-clay increased the stability of LDPE and improved thermal and barrier properties, they accelerated the UV oxidation of LDPE. With increasing exposure to UV, the surface roughness, chemiluminescence index, and carbonyl index of the samples increased while decreasing the intensity of the wide-angle X-ray diffraction pattern. Nano-clay particles with sizes ranging from 2-8 nm were released from UV and ozone weathered composite. The concentrations of released nanoparticles increased with an increase in aging time. Various toxicity tests, including reactive oxygen species generation and cell activity/viability were also performed on the released nano-clay and clay polymer. The released nano-clays basically did not show toxicity. Our combined results demonstrated the degradation properties of nano-clay particle-embedded LDPE composites toxicity of released nano-clay particles to A594 adenocarcinomic human alveolar basal epithelial cells was observed, which will help with future risk based-formulations of exposure.
Securin is a target of the UV response pathway in mammalian cells.
Romero, Francisco; Gil-Bernabé, Ana M; Sáez, Carmen; Japón, Miguel A; Pintor-Toro, José A; Tortolero, María
2004-04-01
All eukaryotic cells possess elaborate mechanisms to protect genome integrity and ensure survival after DNA damage, ceasing proliferation and granting time for DNA repair. Securin is an inhibitory protein that is bound to a protease called Separase to inhibit sister chromatid separation until the onset of anaphase. At the metaphase-to-anaphase transition, Securin is degraded by the anaphase-promoting complex or cyclosome, and Separase contributes to the release of cohesins from the chromosome, allowing for the segregation of sister chromatids to opposite spindle poles. Here we provide evidence that human Securin (hSecurin) has a novel role in cell cycle arrest after exposure to UV light or ionizing radiation. In fact, irradiation downregulated the level of hSecurin protein, accelerating its degradation via the proteasome and reducing hSecurin mRNA translation, but the presence of hSecurin is necessary for cell proliferation arrest following UV treatment. Moreover, an alteration of UV-induced hSecurin downregulation could lead directly to the accumulation of DNA damage and the subsequent development of malignant tumors.
Methylglyoxal Mediates Adipocyte Proliferation by Increasing Phosphorylation of Akt1
Jia, Xuming; Chang, Tuanjie; Wilson, Thomas W.; Wu, Lingyun
2012-01-01
Methylglyoxal (MG) is a highly reactive metabolite physiologically presented in all biological systems. The effects of MG on diabetes and hypertension have been long recognized. In the present study, we investigated the potential role of MG in obesity, one of the most important factors to cause metabolic syndrome. An increased MG accumulation was observed in the adipose tissue of obese Zucker rats. Cell proliferation assay showed that 5–20 µM of MG stimulated the proliferation of 3T3-L1 cells. Further study suggested that accumulated-MG stimulated the phosphorylation of Akt1 and its targets including p21 and p27. The activated Akt1 then increased the activity of CDK2 and accelerated the cell cycle progression of 3T3-L1 cells. The effects of MG were efficiently reversed by advanced glycation end product (AGE) breaker alagebrium and Akt inhibitor SH-6. In summary, our study revealed a previously unrecognized effect of MG in stimulating adipogenesis by up-regulation of Akt signaling pathway and this mechanism might offer a new approach to explain the development of obesity. PMID:22606274
A holistic aging model for Li(NiMnCo)O2 based 18650 lithium-ion batteries
NASA Astrophysics Data System (ADS)
Schmalstieg, Johannes; Käbitz, Stefan; Ecker, Madeleine; Sauer, Dirk Uwe
2014-07-01
Knowledge on lithium-ion battery aging and lifetime estimation is a fundamental aspect for successful market introduction in high-priced goods like electric mobility. This paper illustrates the parameterization of a holistic aging model from accelerated aging tests. More than 60 cells of the same type are tested to analyze different impact factors. In calendar aging tests three temperatures and various SOC are applied to the batteries. For cycle aging tests especially different cycle depths and mean SOC are taken into account. Capacity loss and resistance increase are monitored as functions of time and charge throughput during the tests. From these data physical based functions are obtained, giving a mathematical description of aging. To calculate the stress factors like temperature or voltage, an impedance based electric-thermal model is coupled to the aging model. The model accepts power and current profiles as input, furthermore an ambient air temperature profile can be applied. Various drive cycles and battery management strategies can be tested and optimized using the lifetime prognosis of this tool. With the validation based on different realistic driving profiles and temperatures, a robust foundation is provided.
NASA Astrophysics Data System (ADS)
Zeng, Pan; Huang, Liwu; Zhang, Xinling; Han, Yamiao; Chen, Yungui
2018-01-01
Lithium-sulfur (Li-S) batteries are considered as one of the most promising chemistries in secondary energy storage field owing to their high energy density. However, the poor electrochemical performance mainly associated with the polysulfides shuttle has greatly hampered their practical application. Herein, a simple acetylene black (AB)-CoS2 coated separator is first designed to suppress the migration of polysulfides. The AB-CoS2 modified separator can not only efficiently capture the polysulfides by forming strong chemical bonding but also guarantee the rapid lithium ions diffusion. Moreover, the AB-CoS2 coating could serve as an upper current collector to accelerate electron transport for reinforcing the utilization of sulfur and ensuring the reactivation of the trapped active material. Consequently, the Li-S cell using AB-CoS2 modified separator shows a long-term cycling stability with an extremely low decay rate (0.09% per cycle) up to 450 cycles at a high rate of 2 C (3350 mA g-1). It also exhibits excellent rate capabilities, which maintains a capacity of 475 mAh g-1 even at 4.0 C rate.
Tyrosine phosphorylation switching of a G protein.
Li, Bo; Tunc-Ozdemir, Meral; Urano, Daisuke; Jia, Haiyan; Werth, Emily G; Mowrey, David D; Hicks, Leslie M; Dokholyan, Nikolay V; Torres, Matthew P; Jones, Alan M
2018-03-30
Heterotrimeric G protein complexes are molecular switches relaying extracellular signals sensed by G protein-coupled receptors (GPCRs) to downstream targets in the cytoplasm, which effect cellular responses. In the plant heterotrimeric GTPase cycle, GTP hydrolysis, rather than nucleotide exchange, is the rate-limiting reaction and is accelerated by a receptor-like regulator of G signaling (RGS) protein. We hypothesized that posttranslational modification of the Gα subunit in the G protein complex regulates the RGS-dependent GTPase cycle. Our structural analyses identified an invariant phosphorylated tyrosine residue (Tyr 166 in the Arabidopsis Gα subunit AtGPA1) located in the intramolecular domain interface where nucleotide binding and hydrolysis occur. We also identified a receptor-like kinase that phosphorylates AtGPA1 in a Tyr 166 -dependent manner. Discrete molecular dynamics simulations predicted that phosphorylated Tyr 166 forms a salt bridge in this interface and potentially affects the RGS protein-accelerated GTPase cycle. Using a Tyr 166 phosphomimetic substitution, we found that the cognate RGS protein binds more tightly to the GDP-bound Gα substrate, consequently reducing its ability to accelerate GTPase activity. In conclusion, we propose that phosphorylation of Tyr 166 in AtGPA1 changes the binding pattern with AtRGS1 and thereby attenuates the steady-state rate of the GTPase cycle. We coin this newly identified mechanism "substrate phosphoswitching." © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pezeshki, Alan M.; Sacci, Robert L.; Veith, Gabriel M.
Here, we demonstrate a novel method to accelerate electrode degradation in redox flow batteries and apply this method to the all-vanadium chemistry. Electrode performance degradation occurred seven times faster than in a typical cycling experiment, enabling rapid evaluation of materials. This method also enables the steady-state study of electrodes. In this manner, it is possible to delineate whether specific operating conditions induce performance degradation; we found that both aggressively charging and discharging result in performance loss. Post-mortem x-ray photoelectron spectroscopy of the degraded electrodes was used to resolve the effects of state of charge (SoC) and current on the electrodemore » surface chemistry. For the electrode material tested in this work, we found evidence that a loss of oxygen content on the negative electrode cannot explain decreased cell performance. Furthermore, the effects of decreased electrode and membrane performance on capacity fade in a typical cycling battery were decoupled from crossover; electrode and membrane performance decay were responsible for a 22% fade in capacity, while crossover caused a 12% fade.« less
Observation of the limit cycle in asymmetric plasma divided by a magnetic filter
NASA Astrophysics Data System (ADS)
Ohi, Kazuo; Naitou, Hiroshi; Tauchi, Yasushi; Fukumasa, Osamu
2001-01-01
An asymmetric plasma divided by a magnetic filter is numerically simulated by the one-dimensional particle-in-cell code VSIM1D [Koga et al., J. Phys. Soc. Jpn. 68, 1578 (1999)]. Depending on the asymmetry, the system behavior is static or dynamic. In the static state, the potentials of the main plasma and the subplasma are given by the sheath potentials, φM˜3TMe/e and φS˜3TSe/e, respectively, with e being an electron charge and TMe and TSe being electron temperatures (TMe>TSe). In the dynamic state, while φM˜3TMe/e, φS oscillates periodically between φS,min˜3TSe/e and φS,max˜3TMe/e. The ions accelerated by the time varying potential gap get into the subplasma and excite the laminar shock waves. The period of the limit cycle is determined by the transit time of the shock wave structure.
Tiwari, Jitendra N.; Nath, Krishna; Kumar, Susheel; Tiwari, Rajanish N.; Kemp, K. Christian; Le, Nhien H.; Youn, Duck Hyun; Lee, Jae Sung; Kim, Kwang S.
2013-01-01
Nanosize platinum clusters with small diameters of 2–4 nm are known to be excellent catalysts for the oxygen reduction reaction. The inherent catalytic activity of smaller platinum clusters has not yet been reported due to a lack of preparation methods to control their size (<2 nm). Here we report the synthesis of platinum clusters (diameter ≤1.4 nm) deposited on genomic double-stranded DNA–graphene oxide composites, and their high-performance electrocatalysis of the oxygen reduction reaction. The electrochemical behaviour, characterized by oxygen reduction reaction onset potential, half-wave potential, specific activity, mass activity, accelerated durability test (10,000 cycles) and cyclic voltammetry stability (10,000 cycles) is attributed to the strong interaction between the nanosize platinum clusters and the DNA–graphene oxide composite, which induces modulation in the electronic structure of the platinum clusters. Furthermore, we show that the platinum cluster/DNA–graphene oxide composite possesses notable environmental durability and stability, vital for high-performance fuel cells and batteries. PMID:23900456
Identification of Cell Cycle-Regulated Genes by Convolutional Neural Network.
Liu, Chenglin; Cui, Peng; Huang, Tao
2017-01-01
The cell cycle-regulated genes express periodically with the cell cycle stages, and the identification and study of these genes can provide a deep understanding of the cell cycle process. Large false positives and low overlaps are big problems in cell cycle-regulated gene detection. Here, a computational framework called DLGene was proposed for cell cycle-regulated gene detection. It is based on the convolutional neural network, a deep learning algorithm representing raw form of data pattern without assumption of their distribution. First, the expression data was transformed to categorical state data to denote the changing state of gene expression, and four different expression patterns were revealed for the reported cell cycle-regulated genes. Then, DLGene was applied to discriminate the non-cell cycle gene and the four subtypes of cell cycle genes. Its performances were compared with six traditional machine learning methods. At last, the biological functions of representative cell cycle genes for each subtype are analyzed. Our method showed better and more balanced performance of sensitivity and specificity comparing to other machine learning algorithms. The cell cycle genes had very different expression pattern with non-cell cycle genes and among the cell-cycle genes, there were four subtypes. Our method not only detects the cell cycle genes, but also describes its expression pattern, such as when its highest expression level is reached and how it changes with time. For each type, we analyzed the biological functions of the representative genes and such results provided novel insight to the cell cycle mechanisms. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsunaga, Toshiyuki, E-mail: matsunagat@gifu-pu.ac.jp; Morikawa, Yoshifumi; Haga, Mariko
2014-07-15
Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levelsmore » of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up-regulation. • AKR1B10 acts as a key regulator for MMP2 induction via activation of MAPK cascade. • AKR1B10 is a predominant reductase involved in redox-cycling of 9,10-PQ in the cells.« less
NASA Astrophysics Data System (ADS)
Arias, Enrique; de Oliveira, Thiago R.; Sarandy, M. S.
2018-02-01
We introduce a quantum heat engine performing an Otto cycle by using the thermal properties of the quantum vacuum. Since Hawking and Unruh, it has been established that the vacuum space, either near a black hole or for an accelerated observer, behaves as a bath of thermal radiation. In this work, we present a fully quantum Otto cycle, which relies on the Unruh effect for a single quantum bit (qubit) in contact with quantum vacuum fluctuations. By using the notions of quantum thermodynamics and perturbation theory we obtain that the quantum vacuum can exchange heat and produce work on the qubit. Moreover, we obtain the efficiency and derive the conditions to have both a thermodynamic and a kinematic cycle in terms of the initial populations of the excited state, which define a range of allowed accelerations for the Unruh engine.
Cell cycle phases in the unequal mother/daughter cell cycles of Saccharomyces cerevisiae.
Brewer, B J; Chlebowicz-Sledziewska, E; Fangman, W L
1984-11-01
During cell division in the yeast Saccharomyces cerevisiae mother cells produce buds (daughter cells) which are smaller and have longer cell cycles. We performed experiments to compare the lengths of cell cycle phases in mothers and daughters. As anticipated from earlier indirect observations, the longer cell cycle time of daughter cells is accounted for by a longer G1 interval. The S-phase and the G2-phase are of the same duration in mother and daughter cells. An analysis of five isogenic strains shows that cell cycle phase lengths are independent of cell ploidy and mating type.
Yao, Qihan; Shi, Zhou; Liu, Qingqing; Gu, Zhengyang; Ning, Ruihuan
2018-02-01
This research focused on the influence of different separator compartments on the performance of capacitive deionization (CDI) cells in terms of brackish water treatment. For comparison, different separators including filter paper(FP), carbon nanotube (CNT), and stainless steel fiber (SSF) on deionization and desorption rate of salt were examined. The best performance was obtained when the CNT separator was packed, followed by SSF and FP. Reducing the cell voltage from 1.2 to 0.4 V decreased the salt removal and electrode regeneration rate of SSF-CDI. Electrochemical impedance spectrometry (EIS) analysis revealed that the resistance and specific capacitance of separator materials are essential to the desalination and desorption performance of CDI. The electric double layers (EDLs) accelerated the ion transfer in the flow chamber due to storing excess ions, therefore increasing the desalination and electrode regeneration rate.
Carbon nanocages: a new support material for Pt catalyst with remarkably high durability.
Wang, Xiao Xia; Tan, Zhe Hua; Zeng, Min; Wang, Jian Nong
2014-03-24
Low durability is the major challenge hindering the large-scale implementation of proton exchange membrane fuel cell (PEMFC) technology, and corrosion of carbon support materials of current catalysts is the main cause. Here, we describe the finding of remarkably high durability with the use of a novel support material. This material is based on hollow carbon nanocages developed with a high degree of graphitization and concurrent nitrogen doping for oxidation resistance enhancement, uniform deposition of fine Pt particles, and strong Pt-support interaction. Accelerated degradation testing shows that such designed catalyst possesses a superior electrochemical activity and long-term stability for both hydrogen oxidation and oxygen reduction relative to industry benchmarks of current catalysts. Further testing under conditions of practical fuel cell operation reveals almost no degradation over long-term cycling. Such a catalyst of high activity, particularly, high durability, opens the door for the next-generation PEMFC for "real world" application.
Low dose irradiation facilitates hepatocellular carcinoma genesis involving HULC.
Li, Yuan; Ge, Chang; Feng, Guoxing; Xiao, Huiwen; Dong, Jiali; Zhu, Changchun; Jiang, Mian; Cui, Ming; Fan, Saijun
2018-03-24
Irradiation exposure positive correlates with tumor formation, such as breast cancer and lung cancer. However, whether low dose irradiation induces hepatocarcinogenesis and the underlying mechanism remain poorly defined. In the present study, we reported that low dose irradiation facilitated the proliferation of hepatocyte through up-regulating HULC in vitro and in vivo. Low dose irradiation exposure elevated HULC expression level in hepatocyte. Deletion of heightened HULC erased the cells growth accelerated following low dose irradiation exposure. CDKN1, the neighbor gene of HULC, was down-regulated by overexpression of HULC following low dose irradiation exposure via complementary base pairing, resulting in promoting cell cycle process. Thus, our findings provide new insights into the mechanism of low dose irradiation-induced hepatocarcinogenesis through HULC/CDKN1 signaling, and shed light on the potential risk of low dose irradiation for the development of hepatocellular carcinoma in pre-clinical settings. © 2018 Wiley Periodicals, Inc.
NWSC nickel cadmium spacecraft cell accelerated life test program data analysis
NASA Technical Reports Server (NTRS)
Lander, J.
1980-01-01
An analysis of the data leading to a proposed accelerated life test scheme to test a nickel cadmium cell under spacecraft usage conditions is described. The amount and concentration of electrolyte and the amount of precharge in the cell are discussed in relation to the design of the cell and the accelerated test design. A failure analysis of the cell is summarized. The analysis included such environmental test variables as the depth of discharge, the temperature, the amount of recharge and the charge and discharge rate.
Complex chromatid-isochromatid exchanges following irradiation with heavy ions?
Loucas, B D; Eberle, R L; Durante, M; Cornforth, M N
2004-01-01
We describe a peculiar and relatively rare type of chromosomal rearrangement induced in human peripheral lymphocytes that were ostensibly irradiated in G(0) phase of the cell cycle by accelerated heavy ions, and which, to the best of our knowledge, have not been previously described. The novel rearrangements which were detected using mFISH following exposure to 500 MeV/nucleon and 5 GeV/n 56Fe particles, but were not induced by either 137Cs gamma rays or 238Pu alpha particles, can alternatively be described as either complex chromatid-isochromatid or complex chromatid-chromosome exchanges. Different mechanisms potentially responsible for their formation are discussed. Copyright 2003 S. Karger AG, Basel
Exploratory Research and Development Fund, FY 1990. Report on Lawrence Berkeley Laboratory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-05-01
The Lawrence Berkeley Laboratory Exploratory R&D Fund FY 1990 report is compiled from annual reports submitted by principal investigators following the close of the fiscal year. This report describes the projects supported and summarizes their accomplishments. It constitutes a part of an Exploratory R&D Fund (ERF) planning and documentation process that includes an annual planning cycle, projection selection, implementation, and review. The research areas covered in this report are: Accelerator and fusion research; applied science; cell and molecular biology; chemical biodynamics; chemical sciences; earth sciences; engineering; information and computing sciences; materials sciences; nuclear science; physics and research medicine and radiationmore » biophysics.« less
A fiber-coupled 9xx module with tap water cooling
NASA Astrophysics Data System (ADS)
Schleuning, D.; Anthon, D.; Chryssis, A.; Ryu, G.; Liu, G.; Winhold, H.; Fan, L.; Xu, Z.; Tanbun-Ek, T.; Lehkonen, S.; Acklin, B.
2016-03-01
A novel, 9XX nm fiber-coupled module using arrays of highly reliable laser diode bars has been developed. The module is capable of multi-kW output power in a beam parameter product of 80 mm-mrad. The module incorporates a hard-soldered, isolated stack package compatible with tap-water cooling. Using extensive, accelerated multi-cell life-testing, with more than ten million device hours of test, we have demonstrated a MTTF for emitters of >500,000 hrs. In addition we have qualified the module in hard-pulse on-off cycling and stringent environmental tests. Finally we have demonstrated promising results for a next generation 9xx nm chip design currently in applications and qualification testing
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
Indirect-fired gas turbine dual fuel cell power cycle
Micheli, Paul L.; Williams, Mark C.; Sudhoff, Frederick A.
1996-01-01
A fuel cell and gas turbine combined cycle system which includes dual fuel cell cycles combined with a gas turbine cycle wherein a solid oxide fuel cell cycle operated at a pressure of between 6 to 15 atms tops the turbine cycle and is used to produce CO.sub.2 for a molten carbonate fuel cell cycle which bottoms the turbine and is operated at essentially atmospheric pressure. A high pressure combustor is used to combust the excess fuel from the topping fuel cell cycle to further heat the pressurized gas driving the turbine. A low pressure combustor is used to combust the excess fuel from the bottoming fuel cell to reheat the gas stream passing out of the turbine which is used to preheat the pressurized air stream entering the topping fuel cell before passing into the bottoming fuel cell cathode. The CO.sub.2 generated in the solid oxide fuel cell cycle cascades through the system to the molten carbonate fuel cell cycle cathode.
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Activating β-catenin signaling in CD133-positive dermal papilla cells increases hair inductivity
Zhou, Linli; Yang, Kun; Xu, Mingang; Andl, Thomas; Millar, Sarah; Boyce, Steven; Zhang, Yuhang
2016-01-01
Bioengineering hair follicles using cells isolated from human tissue remains as a difficult task. Dermal papilla (DP) cells are known to guide the growth and cycling activities of hair follicles by interacting with keratinocytes. However, DP cells quickly lose their inductivity during in vitro passaging. Rodent DP cell cultures need external addition of chemical factors, including WNT and BMP molecules, to maintain the hair inductive property. CD133 is expressed by a small subpopulation of DP cells that are capable of inducing hair follicle formation in vivo. We report here that expression of a stabilized form of β-catenin promoted clonal growth of CD133-positive (CD133+) DP cells in in vitro three-dimensional hydrogel culture while maintaining expression of DP markers, including alkaline phosphatase (AP), CD133, and Integrin α8. After a two-week in vitro culture, cultured CD133+ DP cells with up-regulated β-catenin activity led to an accelerated in vivo hair growth in reconstituted skin than control cells. Further analysis showed that matrix cell proliferation and differentiation were significantly promoted in hair follicles when β-catenin signaling was upregulated in CD133+ DP cells. Our data highlight an important role for β-catenin signaling in promoting the inductive capability of CD133+ DP cells for in vitro expansion and in vivo hair follicle regeneration, which could potentially be applied to cultured human DP cells. PMID:27312243
Measuring cell cycle progression kinetics with metabolic labeling and flow cytometry.
Fleisig, Helen; Wong, Judy
2012-05-22
Precise control of the initiation and subsequent progression through the various phases of the cell cycle are of paramount importance in proliferating cells. Cell cycle division is an integral part of growth and reproduction and deregulation of key cell cycle components have been implicated in the precipitating events of carcinogenesis. Molecular agents in anti-cancer therapies frequently target biological pathways responsible for the regulation and coordination of cell cycle division. Although cell cycle kinetics tend to vary according to cell type, the distribution of cells amongst the four stages of the cell cycle is rather consistent within a particular cell line due to the consistent pattern of mitogen and growth factor expression. Genotoxic events and other cellular stressors can result in a temporary block of cell cycle progression, resulting in arrest or a temporary pause in a particular cell cycle phase to allow for instigation of the appropriate response mechanism. The ability to experimentally observe the behavior of a cell population with reference to their cell cycle progression stage is an important advance in cell biology. Common procedures such as mitotic shake off, differential centrifugation or flow cytometry-based sorting are used to isolate cells at specific stages of the cell cycle. These fractionated, cell cycle phase-enriched populations are then subjected to experimental treatments. Yield, purity and viability of the separated fractions can often be compromised using these physical separation methods. As well, the time lapse between separation of the cell populations and the start of experimental treatment, whereby the fractionated cells can progress from the selected cell cycle stage, can pose significant challenges in the successful implementation and interpretation of these experiments. Other approaches to study cell cycle stages include the use of chemicals to synchronize cells. Treatment of cells with chemical inhibitors of key metabolic processes for each cell cycle stage are useful in blocking the progression of the cell cycle to the next stage. For example, the ribonucleotide reductase inhibitor hydroxyurea halts cells at the G1/S juncture by limiting the supply of deoxynucleotides, the building blocks of DNA. Other notable chemicals include treatment with aphidicolin, a polymerase alpha inhibitor for G1 arrest, treatment with colchicine and nocodazole, both of which interfere with mitotic spindle formation to halt cells in M phase and finally, treatment with the DNA chain terminator 5-fluorodeoxyridine to initiate S phase arrest. Treatment with these chemicals is an effective means of synchronizing an entire population of cells at a particular phase. With removal of the chemical, cells rejoin the cell cycle in unison. Treatment of the test agent following release from the cell cycle blocking chemical ensures that the drug response elicited is from a uniform, cell cycle stage-specific population. However, since many of the chemical synchronizers are known genotoxic compounds, teasing apart the participation of various response pathways (to the synchronizers vs. the test agents) is challenging. Here we describe a metabolic labeling method for following a subpopulation of actively cycling cells through their progression from the DNA replication phase, through to the division and separation of their daughter cells. Coupled with flow cytometry quantification, this protocol enables for measurement of kinetic progression of the cell cycle in the absence of either mechanically- or chemically- induced cellular stresses commonly associated with other cell cycle synchronization methodologies. In the following sections we will discuss the methodology, as well as some of its applications in biomedical research.
Suetens, Annelies; Konings, Katrien; Moreels, Marjan; Quintens, Roel; Verslegers, Mieke; Soors, Els; Tabury, Kevin; Grégoire, Vincent; Baatout, Sarah
2016-01-01
The use of charged-particle beams, such as carbon ions, is becoming a more and more attractive treatment option for cancer therapy. Given the precise absorbed dose-localization and an increased biological effectiveness, this form of therapy is much more advantageous compared to conventional radiotherapy, and is currently being used for treatment of specific cancer types. The high ballistic accuracy of particle beams deposits the maximal dose to the tumor, while damage to the surrounding healthy tissue is limited. In order to better understand the underlying mechanisms responsible for the increased biological effectiveness, we investigated the DNA damage and repair kinetics and cell cycle progression in two p53 mutant cell lines, more specifically a prostate (PC3) and colon (Caco-2) cancer cell line, after exposure to different radiation qualities. Cells were irradiated with various absorbed doses (0, 0.5, and 2 Gy) of accelerated 13C-ions at the Grand Accélérateur National d’Ions Lourds facility (Caen, France) or with X-rays (0, 0.1, 0.5, 1, 2, and 5 Gy). Microscopic analysis of DNA double-strand breaks showed dose-dependent increases in γ-H2AX foci numbers and foci occupancy after exposure to both types of irradiation, in both cell lines. However, 24 h after exposure, residual damage was more pronounced after lower doses of carbon ion irradiation compared to X-irradiation. Flow cytometric analysis showed that carbon ion irradiation induced a permanent G2/M arrest in PC3 cells at lower doses (2 Gy) compared to X-rays (5 Gy), while in Caco-2 cells the G2/M arrest was transient after irradiation with X-rays (2 and 5 Gy) but persistent after exposure to carbon ions (2 Gy). PMID:27148479
The cell cycle as a brake for β-cell regeneration from embryonic stem cells.
El-Badawy, Ahmed; El-Badri, Nagwa
2016-01-13
The generation of insulin-producing β cells from stem cells in vitro provides a promising source of cells for cell transplantation therapy in diabetes. However, insulin-producing cells generated from human stem cells show deficiency in many functional characteristics compared with pancreatic β cells. Recent reports have shown molecular ties between the cell cycle and the differentiation mechanism of embryonic stem (ES) cells, assuming that cell fate decisions are controlled by the cell cycle machinery. Both β cells and ES cells possess unique cell cycle machinery yet with significant contrasts. In this review, we compare the cell cycle control mechanisms in both ES cells and β cells, and highlight the fundamental differences between pluripotent cells of embryonic origin and differentiated β cells. Through critical analysis of the differences of the cell cycle between these two cell types, we propose that the cell cycle of ES cells may act as a brake for β-cell regeneration. Based on these differences, we discuss the potential of modulating the cell cycle of ES cells for the large-scale generation of functionally mature β cells in vitro. Further understanding of the factors that modulate the ES cell cycle will lead to new approaches to enhance the production of functional mature insulin-producing cells, and yield a reliable system to generate bona fide β cells in vitro.
Johard, Helena; Mahdessian, Diana; Fedr, Radek; Marks, Carolyn; Medalová, Jiřina; Souček, Karel; Lundberg, Emma; Linnarsson, Sten; Bryja, Vítězslav; Sekyrova, Petra; Altun, Mikael; Andäng, Michael
2017-01-01
The cell cycle coordinates core functions such as replication and cell division. However, cell-cycle-regulated transcription in the control of non-core functions, such as cell identity maintenance through specific transcription factors (TFs) and signalling pathways remains unclear. Here, we provide a resource consisting of mapped transcriptomes in unsynchronized HeLa and U2OS cancer cells sorted for cell cycle phase by Fucci reporter expression. We developed a novel algorithm for data analysis that enables efficient visualization and data comparisons and identified cell cycle synchronization of Notch signalling and TFs associated with development. Furthermore, the cell cycle synchronizes with the circadian clock, providing a possible link between developmental transcriptional networks and the cell cycle. In conclusion we find that cell cycle synchronized transcriptional patterns are temporally compartmentalized and more complex than previously anticipated, involving genes, which control cell identity and development. PMID:29228002
G-protein-coupled receptor 137 accelerates proliferation of urinary bladder cancer cells in vitro.
Du, Yiheng; Bi, Wenhuan; Zhang, Fei; Wu, Wenbo; Xia, Shujie; Liu, Haitao
2015-01-01
Urinary bladder cancer is a worldwide concern because of its level of incidence and recurrence. To search an effective therapeutic strategy for urinary bladder cancer, it is important to identify proteins involved in tumorigenesis that could serve as potential targets for diagnosis and treatment. G-protein-coupled receptors (GPRs) constitute a large protein family of receptors that sense molecules outside the cell and activate signal transduction pathways and cellular responses inside the cell. GPR137 is a newly discovered human gene encoding orphan GPRs. In this study, we aimed to investigate the physiological role of GPR137 in urinary bladder cancer. The effect of GPR137 on cell growth was examined via an RNA interference (RNAi) lentivirus system in two human urinary bladder cancer cell lines BT5637 and T24. Lentivirus-mediated RNAi could specifically suppressed GPR137 expression in vitro, resulting in alleviated cell viability and impaired colony formation, as well as blocks G0/G1 and S phases of the cell cycle. These results suggested GPR137 as an essential player in urinary bladder cancer cell growth, and it may serve as a potential target for gene therapy in the treatment of urinary bladder cancer. © 2014 International Union of Biochemistry and Molecular Biology, Inc.
Fine regulation of RhoA and Rock is required for skeletal muscle differentiation.
Castellani, Loriana; Salvati, Erica; Alemà, Stefano; Falcone, Germana
2006-06-02
The RhoA GTPase controls a variety of cell functions such as cell motility, cell growth, and gene expression. Previous studies suggested that RhoA mediates signaling inputs that promote skeletal myogenic differentiation. We show here that levels and activity of RhoA protein are down-regulated in both primary avian myoblasts and mouse satellite cells undergoing differentiation, suggesting that a fine regulation of this GTPase is required. In addition, ectopic expression of activated RhoA in primary quail myocytes, but not in mouse myocytes, inhibits accumulation of muscle-specific proteins and cell fusion. By disrupting RhoA signaling with specific inhibitors, we have shown that this GTPase, although required for cell identity in proliferating myoblasts, is not essential for commitment to terminal differentiation and muscle gene expression. Ectopic expression of an activated form of its downstream effector, Rock, impairs differentiation of both avian and mouse myoblasts. Conversely, Rock inhibition with specific inhibitors and small interfering RNA-mediated gene silencing leads to accelerated progression in the lineage and enhanced cell fusion, underscoring a negative regulatory function of Rock in myogenesis. Finally, we have reported that Rock acts independently from RhoA in preventing myoblast exit from the cell cycle and commitment to differentiation and may receive signaling inputs from Raf-1 kinase.
Optics measurement and correction during acceleration with beta-squeeze in RHIC
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, C.; Marusic, A.; Minty, M.
2015-05-03
In the past, beam optics correction at RHIC has only taken place at injection and at final energy, with interpolation of corrections partially into the acceleration cycle. Recent measurements of the beam optics during acceleration and squeeze have evidenced significant beta-beats that, if corrected, could minimize undesirable emittance dilutions and maximize the spin polarization of polarized proton beams by avoiding the high-order multipole fields sampled by particles within the bunch. We recently demonstrated successful beam optics corrections during acceleration at RHIC. We verified conclusively the superior control of the beam realized via these corrections
Effect of buoyancy on fuel containment in an open-cycle gas-core nuclear rocket engine.
NASA Technical Reports Server (NTRS)
Putre, H. A.
1971-01-01
Analysis aimed at determining the scaling laws for the buoyancy effect on fuel containment in an open-cycle gas-core nuclear rocket engine, so conducted that experimental conditions can be related to engine conditions. The fuel volume fraction in a short coaxial flow cavity is calculated with a programmed numerical solution of the steady Navier-Stokes equations for isothermal, variable density fluid mixing. A dimensionless parameter B, called the Buoyancy number, was found to correlate the fuel volume fraction for large accelerations and various density ratios. This parameter has the value B = 0 for zero acceleration, and B = 350 for typical engine conditions.
Hsu, Hung-Yao
2016-01-01
Bone cells are deformed according to mechanical stimulation they receive and their mechanical characteristics. However, how osteoblasts are affected by mechanical vibration frequency and acceleration amplitude remains unclear. By developing 3D osteoblast finite element (FE) models, this study investigated the effect of cell shapes on vibration characteristics and effect of acceleration (vibration intensity) on vibrational responses of cultured osteoblasts. Firstly, the developed FE models predicted natural frequencies of osteoblasts within 6.85–48.69 Hz. Then, three different levels of acceleration of base excitation were selected (0.5, 1, and 2 g) to simulate vibrational responses, and acceleration of base excitation was found to have no influence on natural frequencies of osteoblasts. However, vibration response values of displacement, stress, and strain increased with the increase of acceleration. Finally, stress and stress distributions of osteoblast models under 0.5 g acceleration in Z-direction were investigated further. It was revealed that resonance frequencies can be a monotonic function of cell height or bottom area when cell volumes and material properties were assumed as constants. These findings will be useful in understanding how forces are transferred and influence osteoblast mechanical responses during vibrations and in providing guidance for cell culture and external vibration loading in experimental and clinical osteogenesis studies. PMID:28074178
Singh, N; Lim, R B; Sawyer, M A
2000-07-01
The cell cycle and the cell cycle control system are the engines that drive life. They allow for the processes of cell renewal and the growth of organisms, under controlled conditions. The control system is essential for the monitoring of normal cell growth and replication of genetic material and to ensure that normal, functional daughter cells are produced at completion of each cell cycle. Although certain clinical applications exist which take advantage of the events of the cell cycle, our understanding of its mechanisms and how to manipulate them is infantile. The next decades will continue to see the effort of many researchers focused upon unlocking the mysteries of the cell cycle and the cell cycle control system.
Implications of improved measurements of the highest energy SEPs by AMS and PAMELA
NASA Astrophysics Data System (ADS)
Whitman, K.; Bindi, V.; Consolandi, C.; Corti, C.; Yamashiro, B.
2017-08-01
Solar energetic particles (SEP) are a key target of heliophysics research, not only as exemplars of particle acceleration and transport processes that are ubiquitous in astrophysical plasmas, but also as the most intense transient radiation hazard for human and robotic space explorers. SEPs are very well-observed by spacecraft covering particle energies below several hundred MeV/nucleon. Multiple missions, stretching back over decades, have yielded a fairly complete description of SEP intensity, energy spectra, and composition up to a few hundred MeV/nucleon. SEP characteristics at higher energies are, by comparison, only poorly understood due to the relative dearth of high-energy measurements. This lack of high energy measurements has contributed to a disagreement within the heliophysics community regarding the source regions and mechanisms that accelerate particles up to GeV energies. In solar cycle 24, the Payload for Antimatter Matter Exploration and Light-nuclei Astrophysics (PAMELA) and the Alpha Magnetic Spectrometer (AMS) have been taking measurements of the highest energy SEPs from ∼ 100 MeV to the GeV. Since the literature has discussed SEP acceleration to GeV energies in terms of Ground Level Enhancements (GLE), we will review the findings for GLEs in solar cycle 23. We will discuss the models and theories that address acceleration up to the GeV and how AMS and PAMELA measurements have the potential to advance the current understanding of SEP acceleration physics. Lastly, only 1-2 GLEs have occurred during solar cycle 24, so we will explore a set of SEP events that were observed in the ⩾100 MeV GOES channels, most of which were also observed by PAMELA and AMS.
Pathological implications of cell cycle re-entry in Alzheimer disease.
Bonda, David J; Lee, Hyun-pil; Kudo, Wataru; Zhu, Xiongwei; Smith, Mark A; Lee, Hyoung-gon
2010-06-29
The complex neurodegeneration underlying Alzheimer disease (AD), although incompletely understood, is characterised by an aberrant re-entry into the cell cycle in neurons. Pathological evidence, in the form of cell cycle markers and regulatory proteins, suggests that cell cycle re-entry is an early event in AD, which precedes the formation of amyloid-beta plaques and neurofibrillary tangles (NFTs). Although the exact mechanisms that induce and mediate these cell cycle events in AD are not clear, significant advances have been made in further understanding the pathological role of cell cycle re-entry in AD. Importantly, recent studies indicate that cell cycle re-entry is not a consequence, but rather a cause, of neurodegeneration, suggesting that targeting of cell cycle re-entry may provide an opportunity for therapeutic intervention. Moreover, multiple inducers of cell cycle re-entry and their interactions in AD have been proposed. Here, we review the most recent advances in understanding the pathological implications of cell cycle re-entry in AD.
Footitt, Steven; Ölçer-Footitt, Hülya; Hambidge, Angela J; Finch-Savage, William E
2017-08-01
Environmental signals drive seed dormancy cycling in the soil to synchronize germination with the optimal time of year, a process essential for species' fitness and survival. Previous correlation of transcription profiles in exhumed seeds with annual environmental signals revealed the coordination of dormancy-regulating mechanisms with the soil environment. Here, we developed a rapid and robust laboratory dormancy cycling simulation. The utility of this simulation was tested in two ways: firstly, using mutants in known dormancy-related genes [DELAY OF GERMINATION 1 (DOG1), MOTHER OF FLOWERING TIME (MFT), CBL-INTERACTING PROTEIN KINASE 23 (CIPK23) and PHYTOCHROME A (PHYA)] and secondly, using further mutants, we test the hypothesis that components of the circadian clock are involved in coordination of the annual seed dormancy cycle. The rate of dormancy induction and relief differed in all lines tested. In the mutants, dog1-2 and mft2, dormancy induction was reduced but not absent. DOG1 is not absolutely required for dormancy. In cipk23 and phyA dormancy, induction was accelerated. Involvement of the clock in dormancy cycling was clear when mutants in the morning and evening loops of the clock were compared. Dormancy induction was faster when the morning loop was compromised and delayed when the evening loop was compromised. © 2017 The Authors Plant, Cell & Environment Published by John Wiley & Sons Ltd.
Kabani, Sarah; Waterfall, Martin; Matthews, Keith R
2010-01-01
Studies on the cell-cycle of Trypanosoma brucei have revealed several unusual characteristics that differ from the model eukaryotic organisms. However, the inability to isolate homogenous populations of parasites in distinct cell-cycle stages has limited the analysis of trypanosome cell division and complicated the understanding of mutant phenotypes with possible impact on cell-cycle related events. Although hydroxyurea-induced cell-cycle arrest in procyclic and bloodstream forms has been applied recently with success, such block-release protocols can complicate the analysis of cell-cycle regulated events and have the potential to disrupt important cell-cycle checkpoints. An alternative approach based on flow cytometry of parasites stained with Vybrant DyeCycle Orange circumvents this problem, but is restricted to procyclic form parasites. Here, we apply Vybrant Dyecycle Violet staining coupled with flow cytometry to effectively select different cell-cycle stages of bloodstream form trypanosomes. Moreover, the sorted parasites remain viable, although synchrony is rapidly lost. This method enables cell-cycle enrichment of populations of trypanosomes in their mammal infective stage, particularly at the G1 phase.
Kabani, Sarah; Waterfall, Martin; Matthews, Keith R.
2010-01-01
Studies on the cell-cycle of Trypanosoma brucei have revealed several unusual characteristics that differ from the model eukaryotic organisms. However, the inability to isolate homogenous populations of parasites in distinct cell-cycle stages has limited the analysis of trypanosome cell division and complicated the understanding of mutant phenotypes with possible impact on cell-cycle related events. Although hydroxyurea-induced cell-cycle arrest in procyclic and bloodstream forms has been applied recently with success, such block-release protocols can complicate the analysis of cell-cycle regulated events and have the potential to disrupt important cell-cycle checkpoints. An alternative approach based on flow cytometry of parasites stained with Vybrant DyeCycle Orange circumvents this problem, but is restricted to procyclic form parasites. Here, we apply Vybrant Dyecycle Violet staining coupled with flow cytometry to effectively select different cell-cycle stages of bloodstream form trypanosomes. Moreover, the sorted parasites remain viable, although synchrony is rapidly lost. This method enables cell-cycle enrichment of populations of trypanosomes in their mammal infective stage, particularly at the G1 phase. PMID:19729042
Inflammation-induced S100A8 activates Id3 and promotes colorectal tumorigenesis.
Zhang, Xuemei; Ai, Feiyan; Li, Xiayu; She, Xiaoling; Li, Nan; Tang, Anliu; Qin, Zailong; Ye, Qiurong; Tian, Li; Li, Guiyuan; Shen, Shourong; Ma, Jian
2015-12-15
The aberrant expression of S100A8 and S100A9 is linked to nonresolving inflammation and ultimately to carcinogenesis, whereas the underlying mechanism that allows inflammation to progress to specific cancer types remains unknown. Here, we report that S100A8 was induced by inflammation and then promoted colorectal tumorigenesis downstream by activating Id3 (inhibitor of differentiation 3). Using gene expression profiling and immunohistochemistry, we found that both S100A8 and S100A9 were upregulated in the chemically-induced colitis-associated cancer mouse model and in human colorectal cancer specimens. Furthermore, we showed that S100A8 and S100A9 acted as chemoattractant proteins by recruiting macrophages, promoting the proliferation and invasion of colon cancer cell, as well as spurring the cycle that culminates in the acceleration of cancer metastasis in a nude mouse model. S100A8 regulated colon cancer cell cycle and proliferation by inducing Id3 expression while inhibiting p21. Id3 expression was regulated by Smad5, which was directly phosphorylated by Akt1. Our study revealed a novel mechanism in which inflammation-induced S100A8 promoted colorectal tumorigenesis by acting upstream to activate the Akt1-Smad5-Id3 axis. © 2015 UICC.
Mechanisms of skin aging induced by EGFR inhibitors.
Gerber, Peter Arne; Buhren, Bettina Alexandra; Schrumpf, Holger; Hevezi, Peter; Bölke, Edwin; Sohn, Dennis; Jänicke, Reiner U; Belum, Viswanath Reddy; Robert, Caroline; Lacouture, Mario E; Homey, Bernhard
2016-10-01
The mechanisms of skin aging have not been completely elucidated. Anecdotal data suggests that EGFR inhibition accelerates aging-like skin changes. The objective of the study was to evaluate the clinical characteristics and investigate the cellular and molecular mechanisms underlying skin changes associated with the use of EFGRIs. Patients during prolonged treatment with EGFRIs (>3 months) were analyzed for aging-like skin changes. Baseline EGFR expression was compared in young (<25 years old) vs. old (> 65 years old) skin. In addition, the regulation of extracellular matrix, senescence-associated genes, and cell cycle status was measured in primary human keratinocytes treated with erlotinib in vitro. There were progressive signs of skin aging, including xerosis cutis, atrophy, rhytide formation, and/or actinic purpura in 12 patients. Keratinocytes treated with erlotinib in vitro showed a significant down-modulation of hyaluronan synthases (HAS2 and HAS3), whereas senescence-associated genes (p21, p53, IL-6, maspin) were upregulated, along with a G1 cell cycle arrest and stronger SA β-Gal activity. There was significantly decreased baseline expression in EGFR density in aged skin, when compared to young controls. EGFR inhibition results in molecular alterations in keratinocytes that may contribute to the observed skin aging of patients treated with respective targeted agents.
Mechanisms of skin aging induced by EGFR inhibitors
Gerber, Peter Arne; Buhren, Bettina Alexandra; Schrumpf, Holger; Hevezi, Peter; Bölke, Edwin; Sohn, Dennis; Jänicke, Reiner; Belum, Viswanath Reddy; Robert, Caroline; Lacouture, Mario E.; Homey, Bernhard
2017-01-01
BACKGROUND The mechanisms of skin aging have not been completely elucidated. Anecdotal data suggests that EGFR inhibition accelerates aging-like skin changes. OBJECTIVE To evaluate the clinical characteristics and investigate the cellular and molecular mechanisms underlying skin changes associated with the use of EFGRIs. PATIENTS AND METHODS Patients during prolonged treatment with EGFRIs (>3 months) were analyzed for aging-like skin changes. Baseline EGFR expression was compared in young (< 25 years old) vs. old (> 65 years old) skin. In addition, the regulation of extracellular matrix, senescence-associated genes, and cell cycle status was measured in primary human keratinocytes treated with erlotinib in vitro. RESULTS Progressive signs of skin aging, including xerosis cutis, atrophy, rhytide formation and/or actinic purpura in 12 patients. Keratinocytes treated with erlotinib in vitro showed a significant down-modulation of hyaluronan synthases (HAS2 and HAS3), whereas senescence-associated genes (p21, p53, IL-6, maspin) were upregulated, along with a G1 cell cycle arrest and stronger SA β-Gal activity. There was significantly decreased baseline expression in EGFR-density in aged skin, when compared to young controls. CONCLUSIONS EGFR inhibition results in molecular alterations in keratinocytes that may contribute to the observed skin aging of patients treated with respective targeted agents. PMID:27165055
Bacterial Acclimation Inside an Aqueous Battery.
Dong, Dexian; Chen, Baoling; Chen, P
2015-01-01
Specific environmental stresses may lead to induced genomic instability in bacteria, generating beneficial mutants and potentially accelerating the breeding of industrial microorganisms. The environmental stresses inside the aqueous battery may be derived from such conditions as ion shuttle, pH gradient, free radical reaction and electric field. In most industrial and medical applications, electric fields and direct currents are used to kill bacteria and yeast. However, the present study focused on increasing bacterial survival inside an operating battery. Using a bacterial acclimation strategy, both Escherichia coli and Bacillus subtilis were acclimated for 10 battery operation cycles and survived in the battery for over 3 days. The acclimated bacteria changed in cell shape, growth rate and colony color. Further analysis indicated that electrolyte concentration could be one of the major factors determining bacterial survival inside an aqueous battery. The acclimation process significantly improved the viability of both bacteria E. coli and B. subtilis. The viability of acclimated strains was not affected under battery cycle conditions of 0.18-0.80 mA cm(-2) and 1.4-2.1 V. Bacterial addition within 1.0×10(10) cells mL(-1) did not significantly affect battery performance. Because the environmental stress inside the aqueous battery is specific, the use of this battery acclimation strategy may be of great potential for the breeding of industrial microorganisms.
Jiang, Lihua; Wang, Qingsong; Sun, Jinhua
2018-06-05
LiNi x Co y Mn z O 2 (NCM) cathode material with high energy density is one of the best choices for power batteries. But the safety issue also becomes more prominent with higher nickel content. The improvement of thermal stability by material modification is often complex and limited. In this study, a composite safety electrolyte additive consisting of perfluoro-2-methyl-3-pentanone, N, N-Dimethylacetamide (and fluorocarbon surfactant is proved to be effective and simple in improving the thermal stability of NCM materials. Electrochemical compatibility of composite safety electrolyte with various NCM materials is investigated. Uniform interface film, lower impedance and polarization for NCM (622) cycled in composite safety electrolyte are proved to be the main reasons to ensure good cycle performance. Homemade pouch cells (NCM (622)/C) are used to verify the effectiveness for practical application, accelerating rate calorimeter and nail penetration test shows a slower temperature rise and delay of thermal runaway. For heating experiment, no fire appears for pouch cell with composite safety electrolyte. Thus, this composite safety electrolyte is effective to improve the safety of lithium ion batteries with NCM materials.(. Copyright © 2018 Elsevier B.V. All rights reserved.
Permanent magnet focused X-band photoinjector
Yu, David U. L.; Rosenzweig, James
2002-09-10
A compact high energy photoelectron injector integrates the photocathode directly into a multicell linear accelerator with no drift space between the injection and the linac. High electron beam brightness is achieved by accelerating a tightly focused electron beam in an integrated, multi-cell, X-band rf linear accelerator (linac). The photoelectron linac employs a Plane-Wave-Transformer (PWT) design which provides strong cell-to-cell coupling, easing manufacturing tolerances and costs.
Restoration effects on N cycling pools and processes
James M. Vose; Chris Geron; John Walker; Karsten Raulund-Rasmussen
2005-01-01
Over the past several years, there has been an acceleration of restoration efforts to mitigate the consequences (i.e., ground and surface water chemical pollutants, erosion, etc.) of degraded ecosystems and enhance structural and functional components of watershed ecosystems that regulate biogeochemical cycling and associated aquatic components. Biogeochemical...
N cycling in SPRUCE (Spruce Peatlands Response Under Climatic and Environmental Changes)
Peatlands located in boreal regions make up a third of global wetland area and are expected to have the highest temperature increases in response to climate change. As climate warms, we expect peat decomposition may accelerate, altering the cycling of nitrogen. Alterations in th...
Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope
2018-05-01
Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that immunological responses to core+1/ARFP have been correlated with liver disease severity in chronic HCV patients, we expect that the present work will assist in clarifying the pathophysiological relevance of this protein as a biomarker of disease progression. Copyright © 2018 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilbert, James A.; Kariuki, Nancy N.; Wang, Xiaoping
2015-08-01
The evolution of Pt nanoparticle cathode electrocatalyst size distribution in a polymer electrolyte membrane fuel cell (PEMFC) was followed during accelerated stress tests using in-operando anomalous small-angle X-ray scattering (ASAXS). This evolution was compared to that observed in an aqueous electrolyte environment using stagnant electrolyte, flowing electrolyte, and flowing electrolyte at elevated temperature to reveal the different degradation trends in the PEMFC and aqueous environments and to determine the relevance of aqueous measurements to the stability of Pt nanoparticle catalyst in the fuel cell environment. The observed changes in the particle size distributions (PSDs) were analyzed to elucidate the extentmore » and mechanisms of particle growth and corresponding mass and active surface area losses in the different environments. These losses indicate a Pt nanoparticle surface area loss mechanism controlled by Pt dissolution, the particle size dependence of Pt dissolution, the loss of dissolved Pt into the membrane and electrolyte, and, to a lesser extent, the re-deposition of dissolved Pt onto larger particles. Based on the geometric surface area loss, mass loss, and mean particle size increase trends, the aqueous environment best reflecting the fuel cell environment was found to be one in which the electrolyte is flowing rather than stagnant. Pt nanoparticle surface area loss resulting from potential cycling can be inhibited by reducing the number of particles smaller than a critical particle diameter (CPD), which was found to be similar to 3.5 to similar to 4 nm, with the CPD dependent on both the cycling protocol (square wave vs triangle wave) and the catalyst environment (fuel cell, aqueous stagnant, aqueous flowing electrolyte, or elevated temperature flowing electrolyte)« less
Carrieri, Damian; Momot, Dariya; Brasg, Ian A; Ananyev, Gennady; Lenz, Oliver; Bryant, Donald A; Dismukes, G Charles
2010-10-01
Sodium concentration cycling was examined as a new strategy for redistributing carbon storage products and increasing autofermentative product yields following photosynthetic carbon fixation in the cyanobacterium Arthrospira (Spirulina) maxima. The salt-tolerant hypercarbonate strain CS-328 was grown in a medium containing 0.24 to 1.24 M sodium, resulting in increased biosynthesis of soluble carbohydrates to up to 50% of the dry weight at 1.24 M sodium. Hypoionic stress during dark anaerobic metabolism (autofermentation) was induced by resuspending filaments in low-sodium (bi)carbonate buffer (0.21 M), which resulted in accelerated autofermentation rates. For cells grown in 1.24 M NaCl, the fermentative yields of acetate, ethanol, and formate increase substantially to 1.56, 0.75, and 1.54 mmol/(g [dry weight] of cells·day), respectively (36-, 121-, and 6-fold increases in rates relative to cells grown in 0.24 M NaCl). Catabolism of endogenous carbohydrate increased by approximately 2-fold upon hypoionic stress. For cultures grown at all salt concentrations, hydrogen was produced, but its yield did not correlate with increased catabolism of soluble carbohydrates. Instead, ethanol excretion becomes a preferred route for fermentative NADH reoxidation, together with intracellular accumulation of reduced products of acetyl coenzyme A (acetyl-CoA) formation when cells are hypoionically stressed. In the absence of hypoionic stress, hydrogen production is a major beneficial pathway for NAD(+) regeneration without wasting carbon intermediates such as ethanol derived from acetyl-CoA. This switch presumably improves the overall cellular economy by retaining carbon within the cell until aerobic conditions return and the acetyl unit can be used for biosynthesis or oxidized via respiration for a much greater energy return.
Abbott, David H; Vepraskas, Sarah H; Horton, Teresa H; Terasawa, Ei; Levine, Jon E
2018-06-15
Ovarian theca cell hyperandrogenism in women with PCOS is compounded by androgen receptor-mediated impairment of estradiol and progesterone negative feedback regulation of episodic LH release. The resultant LH hypersecretion, likely the product of accelerated episodic release of GnRH from the median eminence of the hypothalamus, hyperstimulates ovarian theca cell steroidogenesis, enabling testosterone (T) and androstenedione excess. Prenatally androgenized female monkeys (PA) exposed to fetal male levels of T during early-to-mid gestation, when adult, demonstrate PCOS-like traits, including high T and LH levels. This study tests the hypothesis that progesterone resistance-associated acceleration in episodic LH release contributes to PA monkey LH excess. 4 PA and 3 regularly cycling, healthy control adult female rhesus monkeys of comparable age and body mass index underwent (1) a 10 h, frequent intravenous sampling assessment for LH episodic release, immediately followed by (2) IV infusion of exogenous GnRH to quantify continuing pituitary LH responsiveness, and subsequently (3) an SC injection of a progesterone receptor antagonist, mifepristone, to examine LH responses to blockade of progesterone-mediated action. Compared to controls, the relatively hyperandrogenic PA females exhibited ~100% increase (p = 0.037) in LH pulse frequency, positive correlation of LH pulse amplitude (p = 0.017) with androstenedione, ~100% greater increase (p = 0.034) in acute (0--10 min) LH responses to exogenous GnRH, and an absence (p = 0.008) of modest LH elevation following acute progesterone receptor blockade suggestive of diminished progesterone negative feedback. Such dysregulation of LH release in PCOS-like monkeys implicates impaired feedback control of episodic release of hypothalamic GnRH reminiscent of PCOS neuroendocrinopathy. 2018 S. Karger AG, Basel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rekaa, V. L.; Chapman, S. C.; Dendy, R. O., E-mail: v.l.rekaa@fys.uio.no
2014-08-10
Supernova remnant and heliopause termination shock plasmas may contain significant populations of minority heavy ions, with relative number densities n{sub α}/n{sub i} up to 50%. Preliminary kinetic simulations of collisionless shocks in these environments showed that the reformation cycle and acceleration mechanisms at quasi-perpendicular shocks can depend on the value of n{sub α}/n{sub i} . Shock reformation unfolds on ion spatio-temporal scales, requiring fully kinetic simulations of particle dynamics, together with the self-consistent electric and magnetic fields. This paper presents the first set of particle-in-cell simulations for two ion species, protons (n{sub p} ) and α-particles (n{sub α}), with differingmore » mass and charge-to-mass ratios, that spans the entire range of n{sub α}/n{sub i} from 0% to 100%. The interplay between the differing gyro length scales and timescales of the ion species is crucial to the time-evolving phenomenology of the shocks, the downstream turbulence, and the particle acceleration at different n{sub α}/n{sub i} . We show how the overall energization changes with n{sub α}/n{sub i} , and relate this to the processes individual ions undergo in the shock region and in the downstream turbulence, and to the power spectra of magnetic field fluctuations. The crossover between shocks dominated by the respective ion species happens when n{sub α}/n{sub i} = 25%, and minority ion energization is strongest in this regime. Energization of the majority ion species scales with injection energy. The power spectrum of the downstream turbulence includes peaks at sequential ion cyclotron harmonics, suggestive of ion ring-beam collective instability.« less
Chemomechanically engineered 3D organotypic platforms of bladder cancer dormancy and reactivation.
Pavan Grandhi, Taraka Sai; Potta, Thrimoorthy; Nitiyanandan, Rajeshwar; Deshpande, Indrani; Rege, Kaushal
2017-10-01
Tumors undergo periods of dormancy followed by reactivation leading to metastatic disease. Arrest in the G0/G1 phase of the cell cycle and resistance to chemotherapeutic drugs are key hallmarks of dormant tumor cells. Here, we describe a 3D platform of bladder cancer cell dormancy and reactivation facilitated by a novel aminoglycoside-derived hydrogel, Amikagel. These 3D dormant tumor microenvironments (3D-DTMs) were arrested in the G0/G1 phase and were highly resistant to anti-proliferative drugs. Inhibition of targets in the cellular protein production machinery led to induction of endoplasmic reticulum (ER) stress and complete ablation of 3D-DTMs. Nanoparticle-mediated calcium delivery significantly accelerated ER stress-mediated 3D-DTM death. Transfer of 3D-DTMs onto weaker and adhesive Amikagels resulted in selective reactivation of a sub-population of N-cadherin deficient cells from dormancy. Whole-transcriptome analyses further indicated key biochemical differences between dormant and proliferative cancer cells. Taken together, our results indicate that 3D bladder cancer microenvironments of dormancy and reactivation can facilitate fundamental advances and novel drug discovery in cancer. Copyright © 2017. Published by Elsevier Ltd.
Masunaga, Shin-Ichiro; Ando, Koichi; Uzawa, Akiko; Hirayama, Ryoichi; Furusawa, Yoshiya; Koike, Sachiko; Sakurai, Yoshinori; Nagata, Kenji; Suzuki, Minoru; Kashino, Genro; Kinashi, Yuko; Tanaka, Hiroki; Maruhashi, Akira; Ono, Koji
2008-01-01
To clarify the radiosensitivity of intratumor quiescent cells in vivo to accelerated carbon ion beams and reactor neutron beams. Squamous cell carcinoma VII tumor-bearing mice were continuously given 5-bromo-2'-deoxyuridine to label all intratumor proliferating cells. Next, they received accelerated carbon ion or gamma-ray high-dose-rate (HDR) or reduced-dose-rate (RDR) irradiation. Other tumor-bearing mice received reactor thermal or epithermal neutrons with RDR irradiation. Immediately after HDR and RDR irradiation or 12 h after HDR irradiation, the response of quiescent cells was assessed in terms of the micronucleus frequency using immunofluorescence staining for 5-bromo-2'-deoxyuridine. The response of the total (proliferating plus quiescent) tumor cells was determined from the 5-bromo-2'-deoxyuridine nontreated tumors. The difference in radiosensitivity between the total and quiescent cell populations after gamma-ray irradiation was markedly reduced with reactor neutron beams or accelerated carbon ion beams, especially with a greater linear energy transfer (LET) value. Clearer repair in quiescent cells than in total cells through delayed assay or a decrease in the dose rate with gamma-ray irradiation was efficiently inhibited with carbon ion beams, especially with a greater LET. With RDR irradiation, the radiosensitivity to accelerated carbon ion beams with a greater LET was almost similar to that to reactor thermal and epithermal neutron beams. In terms of tumor cell-killing effect as a whole, including quiescent cells, accelerated carbon ion beams, especially with greater LET values, are very useful for suppressing the dependency on the heterogeneity within solid tumors, as well as depositing the radiation dose precisely.
Alteration of cell cycle progression by Sindbis virus infection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yi, Ruirong; Saito, Kengo; Isegawa, Naohisa
We examined the impact of Sindbis virus (SINV) infection on cell cycle progression in a cancer cell line, HeLa, and a non-cancerous cell line, Vero. Cell cycle analyses showed that SINV infection is able to alter the cell cycle progression in both HeLa and Vero cells, but differently, especially during the early stage of infection. SINV infection affected the expression of several cell cycle regulators (CDK4, CDK6, cyclin E, p21, cyclin A and cyclin B) in HeLa cells and caused HeLa cells to accumulate in S phase during the early stage of infection. Monitoring SINV replication in HeLa and Veromore » cells expressing cell cycle indicators revealed that SINV which infected HeLa cells during G{sub 1} phase preferred to proliferate during S/G{sub 2} phase, and the average time interval for viral replication was significantly shorter in both HeLa and Vero cells infected during G{sub 1} phase than in cells infected during S/G{sub 2} phase. - Highlights: • SINV infection was able to alter the cell cycle progression of infected cancer cells. • SINV infection can affect the expression of cell cycle regulators. • SINV infection exhibited a preference for the timing of viral replication among the cell cycle phases.« less
An accelerated test design for use with synchronous orbit. [on Ni-Cd cell degradation behavior
NASA Technical Reports Server (NTRS)
Mcdermott, P. P.; Vasanth, K. L.
1980-01-01
The Naval Weapons Support Center at Crane, Indiana has conducted a large scale accelerated test of 6.0 Ah Ni-Cd cells. Data from the Crane test have been used to develop an equation for the description of Ni-Cd cell behavior in geosynchronous orbit. This equation relates the anticipated time to failure for a cell in synchronous orbit to temperature and overcharge rate sustained by the cell during the light period. A test design is suggested which uses this equation for setting test parameters for future accelerated testing.
Srivastava, Pallavi; Sarma, Asitikantha
2018-01-01
High linear energy transfer (LET) radiation or heavy ion such as carbon ion radiation is used as a method for advanced radiotherapy in the treatment of cancer. It has many advantages over the conventional photon based radiotherapy using Co-60 gamma or high energy X-rays from a Linear Accelerator. However, charged particle therapy is very costly. One way to reduce the cost as well as irradiation effects on normal cells is to reduce the dose of radiation by enhancing the radiation sensitivity through the use of a radiomodulator. PNKP (polynucleotide kinase/phosphatase) is an enzyme which plays important role in the non-homologous end joining (NHEJ) DNA repair pathway. It is expected that inhibition of PNKP activity may enhance the efficacy of the charged particle irradiation in the radioresistant prostate cancer cell line PC-3. To test this hypothesis, we investigated cellular radiosensitivity by clonogenic cell survival assay in PC-3 cells.12Carbon ion beam of62 MeVenergy (equivalent 5.16 MeV/nucleon) and with an entrance LET of 287 kev/μm was used for the present study. Apoptotic parameters such as nuclear fragmentation and caspase-3 activity were measured by DAPI staining, nuclear ladder assay and colorimetric caspase-3method. Cell cycle arrest was determined by FACS analysis. Cell death was enhanced when carbon ion irradiation is combined with PNKPi (PNKP inhibitor) to treat cells as compared to that seen for PNKPi untreated cells. A low concentration (10μM) of PNKPi effectively radiosensitized the PC-3 cells in terms of reduction of dose in achieving the same survival fraction. PC-3 cells underwent significant apoptosis and cell cycle arrest too was enhanced at G2/M phase when carbon ion irradiation was combined with PNKPi treatment. Our findings suggest that combined treatment of carbon ion irradiation and PNKP inhibition could enhance cellular radiosensitivity in a radioresistant prostate cancer cell line PC-3. The synergistic effect of PNKPi and carbon ion irradiation could be used as a promising method for carbon-ion therapy in radioresistant cells. PMID:29320576
NASA Astrophysics Data System (ADS)
Osswald, P. J.; Erhard, S. V.; Rheinfeld, A.; Rieger, B.; Hoster, H. E.; Jossen, A.
2016-10-01
The influence of cell temperature on the current density distribution and accompanying inhomogeneities in state of charge (SOC) during cycling is analyzed in this work. To allow for a detailed insight in the electrochemical behavior of the cell, commercially available 26650 cells were modified to allow for measuring local potentials at four different, nearly equidistant positions along the electrodes. As a follow-up to our previous work investigating local potentials within a cell, we apply this method for studying SOC deviations and their sensitivity to cell temperature. The local potential distribution was studied during constant current discharge operations for various current rates and discharge pulses in order to evoke local inhomogeneities for temperatures ranging from 10 °C to 40 °C. Differences in local potentials were considered for estimating local SOC variations within the electrodes. It could be observed that even low currents such as 0.1C can lead to significant inhomogeneities, whereas a higher cell temperature generally results in more pronounced inhomogeneities. A rapid SOC equilibration can be observed if the variation in the SOC distribution corresponds to a considerable potential difference defined by the open circuit voltage of either the positive or negative electrode. With increasing temperature, accelerated equalization effects can be observed.
Ahmed, Noha S; Ghatak, Subhadip; El Masry, Mohamed S; Gnyawali, Surya C; Roy, Sashwati; Amer, Mohamed; Everts, Helen; Sen, Chandan K; Khanna, Savita
2017-11-01
Unlike the epidermis, which regenerates continually, hair follicles anchored in the subcutis periodically regenerate by spontaneous repetitive cycles of growth (anagen), degeneration (catagen), and rest (telogen). The loss of hair follicles in response to injuries or pathologies such as alopecia endangers certain inherent functions of the skin. Thus, it is of interest to understand mechanisms underlying follicular regeneration in adults. In this work, a phytochemical rich in the natural vitamin E tocotrienol (TRF) served as a productive tool to unveil a novel epidermal pathway of hair follicular regeneration. Topical TRF application markedly induced epidermal hair follicle development akin to that during fetal skin development. This was observed in the skin of healthy as well as diabetic mice, which are known to be resistant to anagen hair cycling. TRF suppressed epidermal E-cadherin followed by 4-fold induction of β-catenin and its nuclear translocation. Nuclear β-catenin interacted with Tcf3. Such sequestration of Tcf3 from its otherwise known function to repress pluripotent factors induced the plasticity factors Oct4, Sox9, Klf4, c-Myc, and Nanog. Pharmacological inhibition of β-catenin arrested anagen hair cycling by TRF. This work reports epidermal E-cadherin/β-catenin as a novel pathway capable of inducing developmental folliculogenesis in the adult skin. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Yeckel, Andrew; Derby, Jeffrey J.
2000-02-01
Three-dimensional axisymmetric, time-dependent simulations of the high-pressure vertical Bridgman growth of large-diameter cadmium zinc telluride are performed to study the effect of accelerated crucible rotation (ACRT) on crystal growth dynamics. The model includes details of heat transfer, melt convection, solid-liquid interface shape, and dilute zinc segregation. Application of ACRT greatly improves mixing in the melt, but causes an overall increased deflection of the solid-liquid interface. The flow exhibits a Taylor-Görtler instability at the crucible sidewall, which further enhances melt mixing. The rate of mixing depends strongly on the length of the ACRT cycle, with an optimum half-cycle length between 2 and 4 Ekman time units. Significant melting of the crystal occurs during a portion of the rotation cycle, caused by periodic reversal of the secondary flow at the solid-liquid interface, indicating the possibility of compositional striations.
Performance and Reliability of Bonded Interfaces for High-Temperature Packaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paret, Paul P
2017-08-02
Sintered silver has proven to be a promising candidate for use as a die-attach and substrate-attach material in automotive power electronics components. It holds promise of greater reliability than lead-based and lead-free solders, especially at higher temperatures (>200 degrees C). Accurate predictive lifetime models of sintered silver need to be developed and its failure mechanisms thoroughly characterized before it can be deployed as a die-attach or substrate-attach material in wide-bandgap device-based packages. Mechanical characterization tests that result in stress-strain curves and accelerated tests that produce cycles-to-failure result will be conducted. Also, we present a finite element method (FEM) modeling methodologymore » that can offer greater accuracy in predicting the failure of sintered silver under accelerated thermal cycling. A fracture mechanics-based approach is adopted in the FEM model, and J-integral/thermal cycle values are computed.« less
Accelerating assimilation development for new observing systems using EFSO
NASA Astrophysics Data System (ADS)
Lien, Guo-Yuan; Hotta, Daisuke; Kalnay, Eugenia; Miyoshi, Takemasa; Chen, Tse-Chun
2018-03-01
To successfully assimilate data from a new observing system, it is necessary to develop appropriate data selection strategies, assimilating only the generally useful data. This development work is usually done by trial and error using observing system experiments (OSEs), which are very time and resource consuming. This study proposes a new, efficient methodology to accelerate the development using ensemble forecast sensitivity to observations (EFSO). First, non-cycled assimilation of the new observation data is conducted to compute EFSO diagnostics for each observation within a large sample. Second, the average EFSO conditionally sampled in terms of various factors is computed. Third, potential data selection criteria are designed based on the non-cycled EFSO statistics, and tested in cycled OSEs to verify the actual assimilation impact. The usefulness of this method is demonstrated with the assimilation of satellite precipitation data. It is shown that the EFSO-based method can efficiently suggest data selection criteria that significantly improve the assimilation results.
Model of Energy Spectrum Parameters of Ground Level Enhancement Events in Solar Cycle 23
NASA Astrophysics Data System (ADS)
Wu, S.-S.; Qin, G.
2018-01-01
Mewaldt et al. (2012) fitted the observations of the ground level enhancement (GLE) events during solar cycle 23 to the double power law equation to obtain the four spectral parameters, the normalization constant C, low-energy power law slope γ1, high-energy power law slope γ2, and break energy E0. There are 16 GLEs from which we select 13 for study by excluding some events with complicated situation. We analyze the four parameters with conditions of the corresponding solar events. According to solar event conditions, we divide the GLEs into two groups, one with strong acceleration by interplanetary shocks and another one without strong acceleration. By fitting the four parameters with solar event conditions we obtain models of the parameters for the two groups of GLEs separately. Therefore, we establish a model of energy spectrum of solar cycle 23 GLEs, which may be used in prediction in the future.
Saitou, Takashi; Imamura, Takeshi
2016-01-01
Cell cycle progression is strictly coordinated to ensure proper tissue growth, development, and regeneration of multicellular organisms. Spatiotemporal visualization of cell cycle phases directly helps us to obtain a deeper understanding of controlled, multicellular, cell cycle progression. The fluorescent ubiquitination-based cell cycle indicator (Fucci) system allows us to monitor, in living cells, the G1 and the S/G2/M phases of the cell cycle in red and green fluorescent colors, respectively. Since the discovery of Fucci technology, it has found numerous applications in the characterization of the timing of cell cycle phase transitions under diverse conditions and various biological processes. However, due to the complexity of cell cycle dynamics, understanding of specific patterns of cell cycle progression is still far from complete. In order to tackle this issue, quantitative approaches combined with mathematical modeling seem to be essential. Here, we review several studies that attempted to integrate Fucci technology and mathematical models to obtain quantitative information regarding cell cycle regulatory patterns. Focusing on the technological development of utilizing mathematics to retrieve meaningful information from the Fucci producing data, we discuss how the combined methods advance a quantitative understanding of cell cycle regulation. © 2015 Japanese Society of Developmental Biologists.
Load-dependent ADP binding to myosins V and VI: Implications for subunit coordination and function
Oguchi, Yusuke; Mikhailenko, Sergey V.; Ohki, Takashi; Olivares, Adrian O.; De La Cruz, Enrique M.; Ishiwata, Shin'ichi
2008-01-01
Dimeric myosins V and VI travel long distances in opposite directions along actin filaments in cells, taking multiple steps in a “hand-over-hand” fashion. The catalytic cycles of both myosins are limited by ADP dissociation, which is considered a key step in the walking mechanism of these motors. Here, we demonstrate that external loads applied to individual actomyosin V or VI bonds asymmetrically affect ADP affinity, such that ADP binds weaker under loads assisting motility. Model-based analysis reveals that forward and backward loads modulate the kinetics of ADP binding to both myosins, although the effect is less pronounced for myosin VI. ADP dissociation is modestly accelerated by forward loads and inhibited by backward loads. Loads applied in either direction slow ADP binding to myosin V but accelerate binding to myosin VI. We calculate that the intramolecular load generated during processive stepping is ≈2 pN for both myosin V and myosin VI. The distinct load dependence of ADP binding allows these motors to perform different cellular functions. PMID:18509050
The Influence of PV Module Materials and Design on Solder Joint Thermal Fatigue Durability
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bosco, Nick; Silverman, Timothy J.; Kurtz, Sarah
Finite element model (FEM) simulations have been performed to elucidate the effect of flat plate photovoltaic (PV) module materials and design on PbSn eutectic solder joint thermal fatigue durability. The statistical method of Latin Hypercube sampling was employed to investigate the sensitivity of simulated damage to each input variable. Variables of laminate material properties and their thicknesses were investigated. Using analysis of variance, we determined that the rate of solder fatigue was most sensitive to solder layer thickness, with copper ribbon and silicon thickness being the next two most sensitive variables. By simulating both accelerated thermal cycles (ATCs) and PVmore » cell temperature histories through two characteristic days of service, we determined that the acceleration factor between the ATC and outdoor service was independent of the variables sampled in this study. This result implies that an ATC test will represent a similar time of outdoor exposure for a wide range of module designs. This is an encouraging result for the standard ATC that must be universally applied across all modules.« less
Cell Cycle Control in the Early Embryonic Development of Aquatic Animal Species
Siefert, Joseph C.; Clowdus, Emily A.; Sansam, Christopher L.
2016-01-01
The cell cycle is integrated with many aspects of embryonic development. Not only is proper control over the pace of cell proliferation important, but also the timing of cell cycle progression is coordinated with transcription, cell migration, and cell differentiation. Due to the ease with which the embryos of aquatic organisms can be observed and manipulated, they have been a popular choice for embryologists throughout history. In the cell cycle field, aquatic organisms have been extremely important because they have played a major role in the discovery and analysis of key regulators of the cell cycle. In particular, the frog Xenopus laevis has been instrumental for understanding how the basic embryonic cell cycle is regulated. More recently, the zebrafish has been used to understand how the cell cycle is remodeled during vertebrate development and how it is regulated during morphogenesis. This review describes how some of the unique strengths of aquatic species have been leveraged for cell cycle research and suggests how species such as Xenopus and zebrafish will continue to reveal the roles of the cell cycle in human biology and disease. PMID:26475527
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xia, Bing; Department of Radiation Oncology, Hangzhou Cancer Hospital, Hangzhou; Hong, Ling-Zhi
Purpose: To prospectively investigate the efficacy and toxicity of accelerated hypofractionated thoracic radiation therapy (HypoTRT) combined with concurrent chemotherapy in the treatment of limited-stage small-cell lung cancer (LS-SCLC), with the hypothesis that both high radiation dose and short radiation time are important in this setting. Methods and Materials: Patients with previously untreated LS-SCLC, Eastern Cooperative Oncology Group performance status of 0 to 2, and adequate organ function were eligible. HypoTRT of 55 Gy at 2.5 Gy per fraction over 30 days was given on the first day of the second or third cycle of chemotherapy. An etoposide/cisplatin regimen was given to 4 tomore » 6 cycles. Patients who had a good response to initial treatment were offered prophylactic cranial irradiation. The primary endpoint was the 2-year progression-free survival rate. Results: Fifty-nine patients were enrolled from July 2007 through February 2012 (median age, 58 years; 86% male). The 2-year progression-free survival rate was 49.0% (95% confidence interval [CI] 35.3%-62.7%). Median survival time was 28.5 months (95% CI 9.0-48.0 months); the 2-year overall survival rate was 58.2% (95% CI 44.5%-71.9%). The 2-year local control rate was 76.4% (95% CI 63.7%-89.1%). The severe hematologic toxicities (grade 3 or 4) were leukopenia (32%), neutropenia (25%), and thrombocytopenia (15%). Acute esophagitis and pneumonitis of grade ≥3 occurred in 25% and 10% of the patients, respectively. Thirty-eight patients (64%) received prophylactic cranial irradiation. Conclusion: Our study showed that HypoTRT of 55 Gy at 2.5 Gy per fraction daily concurrently with etoposide/cisplatin chemotherapy has favorable survival and acceptable toxicity. This radiation schedule deserves further investigation in LS-SCLC.« less
Cell cycle arrest in the jewel wasp Nasonia vitripennis in larval diapause.
Shimizu, Yuta; Mukai, Ayumu; Goto, Shin G
2018-04-01
Insects enter diapause to synchronise their life cycle with biotic and abiotic environmental conditions favourable for their development, reproduction, and survival. One of the most noticeable characteristics of diapause is the blockage of ontogeny. Although this blockage should occur with the cessation of cellular proliferation, i.e. cell cycle arrest, it was confirmed only in a few insect species and information on the molecular pathways involved in cell cycle arrest is limited. In the present study, we investigated developmental and cell cycle arrest in diapause larvae of the jewel wasp Nasonia vitripennis. Developmental and cell cycle arrest occur in the early fourth instar larval stage of N. vitripennis under short days. By entering diapause, the S fraction of the cell cycle disappears and approximately 80% and 20% of cells arrest their cell cycle in the G0/G1 and G2 phases, respectively. We further investigated expression of cell cycle regulatory genes and some housekeeping genes to dissect molecular mechanisms underlying the cell cycle arrest. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Mahin Shirazi, Sam
Accelerated thermal cycling (ATC) tests are the most commonly used tests for the thermo-mechanical performance assessment of microelectronics assemblies. Currently used reliability models have failed to incorporate the microstructural dependency of lead free solder joint behavior and its microstructure evolution during cycling. Thus, it is essential to have a mechanistic understanding of the effect of cycling parameters on damage evolution and failure of lead free solder joints in ATC. Recrystallization has been identified as the damage rate controlling mechanism in ATC. Usually it takes 1/3 of life for completion of recrystallization regardless of cycling parameters. Thus, the life of the solder joints can be predicted by estimating global recrystallization. The objective of the first part of the study was to examine whether the damage scenario applies in service is the same as the harsh thermal cycling tests (i.e. 0/100 °C and -40/125 °C) commonly used in industry. Microstructure analysis results on a variety of lead free solder SnAgCu assemblies subjected to the both harsh (0/100 °C) and mild (20/80 °C) ATC confirmed similar failure mechanism under the both testing conditions. Sn grain morphology (interlaced versus beach ball) has a significant effect on the thermo-mechanical performance (and thus the model) of the lead free solder joints. The longer thermal cycling lifetime observed in the interlaced solder joints subjected to the ATC compared to the beach ball structure was correlated to the different initial microstructure and the microstructure evolution during cycling. For the modeling proposes, the present study was focused on Sn-Ag-Cu solder joints with either a single Sn grain or beach ball structure. Microstructural analysis results of the simulated thermal cycling experiment revealed that, the life can be approximated as determined by the accumulation of a certain amount of work during the high temperature dwells. Finally the effect of precipitates spacing on acceleration factor was investigated. Results indicated that a smaller initial precipitate spacing would tend to result in a longer life in mild thermal cycling/service (where there is lower stresses). Accordingly, it is essential to incorporate the dependence of damage rate (i.e. recrystallization) on precipitate coarsening in any predictions.
Modelling cell cycle synchronisation in networks of coupled radial glial cells.
Barrack, Duncan S; Thul, Rüdiger; Owen, Markus R
2015-07-21
Radial glial cells play a crucial role in the embryonic mammalian brain. Their proliferation is thought to be controlled, in part, by ATP mediated calcium signals. It has been hypothesised that these signals act to locally synchronise cell cycles, so that clusters of cells proliferate together, shedding daughter cells in uniform sheets. In this paper we investigate this cell cycle synchronisation by taking an ordinary differential equation model that couples the dynamics of intracellular calcium and the cell cycle and extend it to populations of cells coupled via extracellular ATP signals. Through bifurcation analysis we show that although ATP mediated calcium release can lead to cell cycle synchronisation, a number of other asynchronous oscillatory solutions including torus solutions dominate the parameter space and cell cycle synchronisation is far from guaranteed. Despite this, numerical results indicate that the transient and not the asymptotic behaviour of the system is important in accounting for cell cycle synchronisation. In particular, quiescent cells can be entrained on to the cell cycle via ATP mediated calcium signals initiated by a driving cell and crucially will cycle in near synchrony with the driving cell for the duration of neurogenesis. This behaviour is highly sensitive to the timing of ATP release, with release at the G1/S phase transition of the cell cycle far more likely to lead to near synchrony than release during mid G1 phase. This result, which suggests that ATP release timing is critical to radial glia cell cycle synchronisation, may help us to understand normal and pathological brain development. Copyright © 2015 Elsevier Ltd. All rights reserved.
Studies on Muon Induction Acceleration and an Objective Lens Design for Transmission Muon Microscope
NASA Astrophysics Data System (ADS)
Artikova, Sayyora; Yoshida, Mitsuhiro; Naito, Fujio
Muon acceleration will be accomplished by a set of induction cells, where each increases the energy of the muon beam by an increment of up to 30 kV. The cells are arranged in a linear way resulting in total accelerating voltage of 300 kV. Acceleration time in the linac is about hundred nanoseconds. Induction field calculation is based on an electrostatic approximation. Beam dynamics in the induction accelerator is investigated and final beam focusing on specimen is realized by designing a pole piece lens.
Unraveling Interfaces between Energy Metabolism and Cell Cycle in Plants.
Siqueira, João Antonio; Hardoim, Pablo; Ferreira, Paulo C G; Nunes-Nesi, Adriano; Hemerly, Adriana S
2018-06-19
Oscillation in energy levels is widely variable in dividing and differentiated cells. To synchronize cell proliferation and energy fluctuations, cell cycle-related proteins have been implicated in the regulation of mitochondrial energy-generating pathways in yeasts and animals. Plants have chloroplasts and mitochondria, coordinating the cell energy flow. Recent findings suggest an integrated regulation of these organelles and the nuclear cell cycle. Furthermore, reports indicate a set of interactions between the cell cycle and energy metabolism, coordinating the turnover of proteins in plants. Here, we discuss how cell cycle-related proteins directly interact with energy metabolism-related proteins to modulate energy homeostasis and cell cycle progression. We provide interfaces between cell cycle and energy metabolism-related proteins that could be explored to maximize plant yield. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wu, Ping; Liu, Siyuan; Su, Jianyu; Chen, Jianping; Li, Lin; Zhang, Runguang; Chen, Tianfeng
2017-10-18
Cancer cells are well known to require a constant supply of protein, lipid, RNA, and DNA via altered metabolism for accelerated cell proliferation. Targeting metabolic pathways is, therefore, a promising therapeutic strategy for cancers. Isoquercitrin (ISO) is widely distributed in dietary and medicinal plants and displays selective cytotoxicity to cancer cells, primarily by inducing apoptosis and cell cycle arrest. The aims of this study were to find out whether ISO could stabilize in a bladder-like acidic environment and inhibit bladder cancer cell proliferation by affecting their metabolism, and to investigate its molecular mechanism. In this study, the exposure of T24 bladder cancer cells to ISO (20-80 μM) decreased cell viability by causing ROS overproduction. This ROS change regulated the AMPK signaling pathway, and caused Caspase-dependent apoptosis as well as metabolism dysfunction. Metabolic alterations elevated metabolic pathway variation, which in turn destabilized lipid synthesis and altered anaerobic glycolysis. This linkage was proved by immunoblotting assay, and metabolomics as identified by UHPLC-QTOF-MS. Our findings provide comprehensive evidence that ISO influenced T24 bladder cancer cell metabolism, and that this process was mainly involved in activating the AMPK pathway. This study could lead to an understanding of how ISO suppresses bladder cancer cell growth, and whether the affected cancer metabolism is a common mechanism by which nutritional compounds suppress cancers.
Solomon, Lauren A; Podder, Shreya; He, Jessica; Jackson-Chornenki, Nicholas L; Gibson, Kristen; Ziliotto, Rachel G; Rhee, Jess; DeKoter, Rodney P
2017-05-15
During macrophage development, myeloid progenitor cells undergo terminal differentiation coordinated with reduced cell cycle progression. Differentiation of macrophages from myeloid progenitors is accompanied by increased expression of the E26 transformation-specific transcription factor PU.1. Reduced PU.1 expression leads to increased proliferation and impaired differentiation of myeloid progenitor cells. It is not understood how PU.1 coordinates macrophage differentiation with reduced cell cycle progression. In this study, we utilized cultured PU.1-inducible myeloid cells to perform genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis coupled with gene expression analysis to determine targets of PU.1 that may be involved in regulating cell cycle progression. We found that genes encoding cell cycle regulators and enzymes involved in lipid anabolism were directly and inducibly bound by PU.1 although their steady-state mRNA transcript levels were reduced. Inhibition of lipid anabolism was sufficient to reduce cell cycle progression in these cells. Induction of PU.1 reduced expression of E2f1 , an important activator of genes involved in cell cycle and lipid anabolism, indirectly through microRNA 223. Next-generation sequencing identified microRNAs validated as targeting cell cycle and lipid anabolism for downregulation. These results suggest that PU.1 coordinates cell cycle progression with differentiation through induction of microRNAs targeting cell cycle regulators and lipid anabolism. Copyright © 2017 American Society for Microbiology.
ATM-Mediated Transcriptional and Developmental Responses to γ-rays in Arabidopsis
Renou, Jean-Pierre; Pichon, Olivier; Fochesato, Sylvain; Ortet, Philippe; Montané, Marie-Hélène
2007-01-01
ATM (Ataxia Telangiectasia Mutated) is an essential checkpoint kinase that signals DNA double-strand breaks in eukaryotes. Its depletion causes meiotic and somatic defects in Arabidopsis and progressive motor impairment accompanied by several cell deficiencies in patients with ataxia telangiectasia (AT). To obtain a comprehensive view of the ATM pathway in plants, we performed a time-course analysis of seedling responses by combining confocal laser scanning microscopy studies of root development and genome-wide expression profiling of wild-type (WT) and homozygous ATM-deficient mutants challenged with a dose of γ-rays (IR) that is sublethal for WT plants. Early morphologic defects in meristematic stem cells indicated that AtATM, an Arabidopsis homolog of the human ATM gene, is essential for maintaining the quiescent center and controlling the differentiation of initial cells after exposure to IR. Results of several microarray experiments performed with whole seedlings and roots up to 5 h post-IR were compiled in a single table, which was used to import gene information and extract gene sets. Sequence and function homology searches; import of spatio-temporal, cell cycling, and mutant-constitutive expression characteristics; and a simplified functional classification system were used to identify novel genes in all functional classes. The hundreds of radiomodulated genes identified were not a random collection, but belonged to functional pathways such as those of the cell cycle; cell death and repair; DNA replication, repair, and recombination; and transcription; translation; and signaling, indicating the strong cell reprogramming and double-strand break abrogation functions of ATM checkpoints. Accordingly, genes in all functional classes were either down or up-regulated concomitantly with downregulation of chromatin deacetylases or upregulation of acetylases and methylases, respectively. Determining the early transcriptional indicators of prolonged S-G2 phases that coincided with cell proliferation delay, or an anticipated subsequent auxin increase, accelerated cell differentiation or death, was used to link IR-regulated hallmark functions and tissue phenotypes after IR. The transcription burst was almost exclusively AtATM-dependent or weakly AtATR-dependent, and followed two major trends of expression in atm: (i)-loss or severe attenuation and delay, and (ii)-inverse and/or stochastic, as well as specific, enabling one to distinguish IR/ATM pathway constituents. Our data provide a large resource for studies on the interaction between plant checkpoints of the cell cycle, development, hormone response, and DNA repair functions, because IR-induced transcriptional changes partially overlap with the response to environmental stress. Putative connections of ATM to stem cell maintenance pathways after IR are also discussed. PMID:17487278
ATM-mediated transcriptional and developmental responses to gamma-rays in Arabidopsis.
Ricaud, Lilian; Proux, Caroline; Renou, Jean-Pierre; Pichon, Olivier; Fochesato, Sylvain; Ortet, Philippe; Montané, Marie-Hélène
2007-05-09
ATM (Ataxia Telangiectasia Mutated) is an essential checkpoint kinase that signals DNA double-strand breaks in eukaryotes. Its depletion causes meiotic and somatic defects in Arabidopsis and progressive motor impairment accompanied by several cell deficiencies in patients with ataxia telangiectasia (AT). To obtain a comprehensive view of the ATM pathway in plants, we performed a time-course analysis of seedling responses by combining confocal laser scanning microscopy studies of root development and genome-wide expression profiling of wild-type (WT) and homozygous ATM-deficient mutants challenged with a dose of gamma-rays (IR) that is sublethal for WT plants. Early morphologic defects in meristematic stem cells indicated that AtATM, an Arabidopsis homolog of the human ATM gene, is essential for maintaining the quiescent center and controlling the differentiation of initial cells after exposure to IR. Results of several microarray experiments performed with whole seedlings and roots up to 5 h post-IR were compiled in a single table, which was used to import gene information and extract gene sets. Sequence and function homology searches; import of spatio-temporal, cell cycling, and mutant-constitutive expression characteristics; and a simplified functional classification system were used to identify novel genes in all functional classes. The hundreds of radiomodulated genes identified were not a random collection, but belonged to functional pathways such as those of the cell cycle; cell death and repair; DNA replication, repair, and recombination; and transcription; translation; and signaling, indicating the strong cell reprogramming and double-strand break abrogation functions of ATM checkpoints. Accordingly, genes in all functional classes were either down or up-regulated concomitantly with downregulation of chromatin deacetylases or upregulation of acetylases and methylases, respectively. Determining the early transcriptional indicators of prolonged S-G2 phases that coincided with cell proliferation delay, or an anticipated subsequent auxin increase, accelerated cell differentiation or death, was used to link IR-regulated hallmark functions and tissue phenotypes after IR. The transcription burst was almost exclusively AtATM-dependent or weakly AtATR-dependent, and followed two major trends of expression in atm: (i)-loss or severe attenuation and delay, and (ii)-inverse and/or stochastic, as well as specific, enabling one to distinguish IR/ATM pathway constituents. Our data provide a large resource for studies on the interaction between plant checkpoints of the cell cycle, development, hormone response, and DNA repair functions, because IR-induced transcriptional changes partially overlap with the response to environmental stress. Putative connections of ATM to stem cell maintenance pathways after IR are also discussed.
The signaling pathways by which the Fas/FasL system accelerates oocyte aging.
Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He
2016-02-01
In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis.
Design of horizontal test cryostat for testing two 650 MHz cavities: cryogenic considerations
NASA Astrophysics Data System (ADS)
Khare, P.; Gilankar, S.; Kush, P. K.; Lakshminarayanan, A.; Choubey, R.; Ghosh, R.; Jain, A.; Patel, H.; Gupta, P. D.; Hocker, A.; Ozelis, J. P.; Geynisman, M.; Reid, C.; Poloubotko, V.; Mitchell, D.; Peterson, T. J.; Nicol, T. H.
2017-02-01
Horizontal Test Cryostat has been designed for testing two 650 MHz "dressed" Superconducting Radio Frequency (SCRF) cavities in a single testing cycle at Raja Ramanna Centre for Advanced Technology, India (RRCAT) in collaboration with Fermi National Accelerator Laboratory, USA (FNAL). This cryostat will facilitate testing of two 5-cell 650 MHz SCRF cavities, in CW or pulsed regime, for upcoming High Intensity Superconducting Proton Accelerator projects at both countries. Two such HTS facilities are planned, one at RRCAT for Indian Spallation Neutron Source project (ISNS), which is on the horizon, and the other at FNAL, USA. A test cryostat, a part of horizontal test stand-2 (HTS-2) will be set up at RRCAT for Indian project. In order to maximize the utility of this facility, it can also be used to test two dressed 9-cell 1.3 GHz cavities and other similarly-sized devices. The facility assumes, as an input, the availability of liquid nitrogen at 80 K and liquid helium at 4.5 K and 2 K, with a refrigeration capacity of approximately 50 W at 2 K. Design work of cryostat has been completed and now procurement process is in progress. This paper discusses salient features of the cryostat. It also describes different design calculations and ANSYS analysis for cool down of few subsystems like cavity support system and liquid nitrogen cooled thermal radiation shield of horizontal test cryostat..
3D Analysis of Fuel Cell Electrocatalyst Degradation on Alternate Carbon Supports.
Sneed, Brian T; Cullen, David A; Reeves, Kimberly S; Dyck, Ondrej E; Langlois, David A; Mukundan, Rangachary; Borup, Rodney L; More, Karren L
2017-09-06
Understanding the mechanisms associated with Pt/C electrocatalyst degradation in proton exchange membrane fuel cell (PEMFC) cathodes is critical for the future development of higher-performing materials; however, there is a lack of information regarding Pt coarsening under PEMFC operating conditions within the cathode catalyst layer. We report a direct and quantitative 3D study of Pt dispersions on carbon supports (high surface area carbon (HSAC), Vulcan XC-72, and graphitized carbon) with varied surface areas, graphitic character, and Pt loadings ranging from 5 to 40 wt %. This is accomplished both before and after catalyst-cycling accelerated stress tests (ASTs) through observations of the cathode catalyst layer of membrane electrode assemblies. Electron tomography results show Pt nanoparticle agglomeration occurs predominantly at junctions and edges of aggregated graphitized carbon particles, leading to poor Pt dispersion in the as-prepared catalysts and increased coalescence during ASTs. Tomographic reconstructions of Pt/HSAC show much better initial Pt dispersions, less agglomeration, and less coarsening during ASTs in the cathode. However, a large loss of the electrochemically active surface area (ECSA) is still observed and is attributed to accelerated Pt dissolution and nanoparticle coalescence. Furthermore, a strong correlation between Pt particle/agglomerate size and measured ECSA is established and is proposed as a more useful metric than average crystallite size in predicting degradation behavior across different catalyst systems.
3D Analysis of Fuel Cell Electrocatalyst Degradation on Alternate Carbon Supports
Sneed, Brian T.; Cullen, David A.; Reeves, Kimberly S.; ...
2017-08-15
Understanding the mechanisms associated with Pt/C electrocatalyst degradation in proton exchange membrane fuel cell (PEMFC) cathodes is critical for the future development of higher-performing materials; however, there is a lack of information regarding Pt coarsening under PEMFC operating conditions within the cathode catalyst layer. We report a direct and quantitative 3D study of Pt dispersions on carbon supports (high surface area carbon (HSAC), Vulcan XC-72, and graphitized carbon) with varied surface areas, graphitic character, and Pt loadings ranging from 5 to 40 wt %. This is accomplished both before and after catalyst-cycling accelerated stress tests (ASTs) through observations of themore » cathode catalyst layer of membrane electrode assemblies. Electron tomography results show Pt nanoparticle agglomeration occurs predominantly at junctions and edges of aggregated graphitized carbon particles, leading to poor Pt dispersion in the as-prepared catalysts and increased coalescence during ASTs. Tomographic reconstructions of Pt/HSAC show much better initial Pt dispersions, less agglomeration, and less coarsening during ASTs in the cathode. However, a large loss of the electrochemically active surface area (ECSA) is still observed and is attributed to accelerated Pt dissolution and nanoparticle coalescence. Moreover, a strong correlation between Pt particle/agglomerate size and measured ECSA is established and is proposed as a more useful metric than average crystallite size in predicting degradation behavior across different catalyst systems.« less
3D Analysis of Fuel Cell Electrocatalyst Degradation on Alternate Carbon Supports
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sneed, Brian T.; Cullen, David A.; Reeves, Kimberly S.
Understanding the mechanisms associated with Pt/C electrocatalyst degradation in proton exchange membrane fuel cell (PEMFC) cathodes is critical for the future development of higher-performing materials; however, there is a lack of information regarding Pt coarsening under PEMFC operating conditions within the cathode catalyst layer. We report a direct and quantitative 3D study of Pt dispersions on carbon supports (high surface area carbon (HSAC), Vulcan XC-72, and graphitized carbon) with varied surface areas, graphitic character, and Pt loadings ranging from 5 to 40 wt %. This is accomplished both before and after catalyst-cycling accelerated stress tests (ASTs) through observations of themore » cathode catalyst layer of membrane electrode assemblies. Electron tomography results show Pt nanoparticle agglomeration occurs predominantly at junctions and edges of aggregated graphitized carbon particles, leading to poor Pt dispersion in the as-prepared catalysts and increased coalescence during ASTs. Tomographic reconstructions of Pt/HSAC show much better initial Pt dispersions, less agglomeration, and less coarsening during ASTs in the cathode. However, a large loss of the electrochemically active surface area (ECSA) is still observed and is attributed to accelerated Pt dissolution and nanoparticle coalescence. Moreover, a strong correlation between Pt particle/agglomerate size and measured ECSA is established and is proposed as a more useful metric than average crystallite size in predicting degradation behavior across different catalyst systems.« less
Montemurro, Chiara; Vadrevu, Suryakiran; Gurlo, Tatyana; Butler, Alexandra E; Vongbunyong, Kenny E; Petcherski, Anton; Shirihai, Orian S; Satin, Leslie S; Braas, Daniel; Butler, Peter C; Tudzarova, Slavica
2017-01-01
Cell replication is a fundamental attribute of growth and repair in multicellular organisms. Pancreatic beta-cells in adults rarely enter cell cycle, hindering the capacity for regeneration in diabetes. Efforts to drive beta-cells into cell cycle have so far largely focused on regulatory molecules such as cyclins and cyclin-dependent kinases (CDKs). Investigations in cancer biology have uncovered that adaptive changes in metabolism, the mitochondrial network, and cellular Ca 2+ are critical for permitting cells to progress through the cell cycle. Here, we investigated these parameters in the replication-competent beta-cell line INS 832/13. Cell cycle synchronization of this line permitted evaluation of cell metabolism, mitochondrial network, and cellular Ca 2+ compartmentalization at key cell cycle stages. The mitochondrial network is interconnected and filamentous at G1/S but fragments during the S and G2/M phases, presumably to permit sorting to daughter cells. Pyruvate anaplerosis peaks at G1/S, consistent with generation of biomass for daughter cells, whereas mitochondrial Ca 2+ and respiration increase during S and G2/M, consistent with increased energy requirements for DNA and lipid synthesis. This synchronization approach may be of value to investigators performing live cell imaging of Ca 2+ or mitochondrial dynamics commonly undertaken in INS cell lines because without synchrony widely disparate data from cell to cell would be expected depending on position within cell cycle. Our findings also offer insight into why replicating beta-cells are relatively nonfunctional secreting insulin in response to glucose. They also provide guidance on metabolic requirements of beta-cells for the transition through the cell cycle that may complement the efforts currently restricted to manipulating cell cycle to drive beta-cells through cell cycle.
Mancebo Quintana, J M; Mancebo Quintana, S
2012-01-01
The origin of sex is becoming a vexatious issue for Evolutionary Biology. Numerous hypotheses have been proposed, based on the genetic effects of sex, on trophic effects or on the formation of cysts and syncytia. Our approach addresses the change in cell cycle duration which would cause cell fusion. Several results are obtained through graphical and mathematical analysis and computer simulations. (1) In poor environments, cell fusion would be an advantageous strategy, as fusion between cells of different size shortens the cycle of the smaller cell (relative to the asexual cycle), and the majority of mergers would occur between cells of different sizes. (2) The easiest-to-evolve regulation of cell proliferation (sexual/asexual) would be by modifying the checkpoints of the cell cycle. (3) A regulation of this kind would have required the existence of the G2 phase, and sex could thus be the cause of the appearance of this phase. Regarding cell cycle, (4) the exponential curve is the only cell growth curve that has no effect on the optimal cell size in unicellular species; (5) the existence of a plateau with no growth at the end of the cell cycle explains the circadian cell cycle observed in unicellular algae.
A balance of FGF and BMP signals regulates cell cycle exit and Equarin expression in lens cells
Jarrin, Miguel; Pandit, Tanushree; Gunhaga, Lena
2012-01-01
In embryonic and adult lenses, a balance of cell proliferation, cell cycle exit, and differentiation is necessary to maintain physical function. The molecular mechanisms regulating the transition of proliferating lens epithelial cells to differentiated primary lens fiber cells are poorly characterized. To investigate this question, we used gain- and loss-of-function analyses to modulate fibroblast growth factor (FGF) and/or bone morphogenetic protein (BMP) signals in chick lens/retina explants. Here we show that FGF activity plays a key role for proliferation independent of BMP signals. Moreover, a balance of FGF and BMP signals regulates cell cycle exit and the expression of Ccdc80 (also called Equarin), which is expressed at sites where differentiation of lens fiber cells occurs. BMP activity promotes cell cycle exit and induces Equarin expression in an FGF-dependent manner. In contrast, FGF activity is required but not sufficient to induce cell cycle exit or Equarin expression. Furthermore, our results show that in the absence of BMP activity, lens cells have increased cell cycle length or are arrested in the cell cycle, which leads to decreased cell cycle exit. Taken together, these findings suggest that proliferation, cell cycle exit, and early differentiation of primary lens fiber cells are regulated by counterbalancing BMP and FGF signals. PMID:22718906
Power Cycle Testing of Power Switches: A Literature Survey
DOE Office of Scientific and Technical Information (OSTI.GOV)
GopiReddy, Lakshmi Reddy; Tolbert, Leon M.; Ozpineci, Burak
Reliability of power converters and lifetime prediction has been a major topic of research in the last few decades, especially for traction applications. The main failures in high power semiconductors are caused by thermomechanical fatigue. Power cycling and temperature cycling are the two most common thermal acceleration tests used in assessing reliability. The objective of this paper is to study the various power cycling tests found in the literature and to develop generalized steps in planning application specific power cycling tests. A comparison of different tests based on the failures, duration, test circuits, and monitored electrical parameters is presented.
Power Cycle Testing of Power Switches: A Literature Survey
GopiReddy, Lakshmi Reddy; Tolbert, Leon M.; Ozpineci, Burak
2014-09-18
Reliability of power converters and lifetime prediction has been a major topic of research in the last few decades, especially for traction applications. The main failures in high power semiconductors are caused by thermomechanical fatigue. Power cycling and temperature cycling are the two most common thermal acceleration tests used in assessing reliability. The objective of this paper is to study the various power cycling tests found in the literature and to develop generalized steps in planning application specific power cycling tests. A comparison of different tests based on the failures, duration, test circuits, and monitored electrical parameters is presented.
Cheng, Chao; Ung, Matthew; Grant, Gavin D.; Whitfield, Michael L.
2013-01-01
Cell cycle is a complex and highly supervised process that must proceed with regulatory precision to achieve successful cellular division. Despite the wide application, microarray time course experiments have several limitations in identifying cell cycle genes. We thus propose a computational model to predict human cell cycle genes based on transcription factor (TF) binding and regulatory motif information in their promoters. We utilize ENCODE ChIP-seq data and motif information as predictors to discriminate cell cycle against non-cell cycle genes. Our results show that both the trans- TF features and the cis- motif features are predictive of cell cycle genes, and a combination of the two types of features can further improve prediction accuracy. We apply our model to a complete list of GENCODE promoters to predict novel cell cycle driving promoters for both protein-coding genes and non-coding RNAs such as lincRNAs. We find that a similar percentage of lincRNAs are cell cycle regulated as protein-coding genes, suggesting the importance of non-coding RNAs in cell cycle division. The model we propose here provides not only a practical tool for identifying novel cell cycle genes with high accuracy, but also new insights on cell cycle regulation by TFs and cis-regulatory elements. PMID:23874175
Cycle life test and failure model of nickel-hydrogen cells
NASA Technical Reports Server (NTRS)
Smithrick, J. J.
1983-01-01
Six ampere hour individual pressure vessel nickel hydrogen cells were charge/discharge cycled to failure. Failure as used here is defined to occur when the end of discharge voltage degraded to 0.9 volts. They were cycled under a low earth orbit cycle regime to a deep depth of discharge (80 percent of rated ampere hour capacity). Both cell designs were fabricated by the same manufacturer and represent current state of the art. A failure model was advanced which suggests both cell designs have inadequate volume tolerance characteristics. The limited existing data base at a deep depth of discharge (DOD) was expanded. Two cells of each design were cycled. One COMSAT cell failed at cycle 1712 and the other failed at cycle 1875. For the Air Force/Hughes cells, one cell failed at cycle 2250 and the other failed at cycle 2638. All cells, of both designs, failed due to low end of discharge voltage (0.9 volts). No cell failed due to electrical shorts. After cell failure, three different reconditioning tests (deep discharge, physical reorientation, and open circuit voltage stand) were conducted on all cells of each design. A fourth reconditioning test (electrolyte addition) was conducted on one cell of each design. In addition post cycle cell teardown and failure analysis were performed on the one cell of each design which did not have electrolyte added after failure.
Brandmaier, Andrew; Hou, Sheng-Qi; Shen, Wen H
2017-07-21
Continuous and error-free chromosome inheritance through the cell cycle is essential for genomic stability and tumor suppression. However, accumulation of aberrant genetic materials often causes the cell cycle to go awry, leading to malignant transformation. In response to genotoxic stress, cells employ diverse adaptive mechanisms to halt or exit the cell cycle temporarily or permanently. The intrinsic machinery of cycling, resting, and exiting shapes the cellular response to extrinsic stimuli, whereas prevalent disruption of the cell cycle machinery in tumor cells often confers resistance to anticancer therapy. Phosphatase and tensin homolog (PTEN) is a tumor suppressor and a guardian of the genome that is frequently mutated or deleted in human cancer. Moreover, it is increasingly evident that PTEN deficiency disrupts the fundamental processes of genetic transmission. Cells lacking PTEN exhibit cell cycle deregulation and cell fate reprogramming. Here, we review the role of PTEN in regulating the key processes in and out of cell cycle to optimize genomic integrity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Accelerated Test Method for Corrosion Protective Coatings Project
NASA Technical Reports Server (NTRS)
Falker, John; Zeitlin, Nancy; Calle, Luz
2015-01-01
This project seeks to develop a new accelerated corrosion test method that predicts the long-term corrosion protection performance of spaceport structure coatings as accurately and reliably as current long-term atmospheric exposure tests. This new accelerated test method will shorten the time needed to evaluate the corrosion protection performance of coatings for NASA's critical ground support structures. Lifetime prediction for spaceport structure coatings has a 5-year qualification cycle using atmospheric exposure. Current accelerated corrosion tests often provide false positives and negatives for coating performance, do not correlate to atmospheric corrosion exposure results, and do not correlate with atmospheric exposure timescales for lifetime prediction.
Xiao, Jian-Ying; Liu, Chao; Sun, Xiao-Han; Yu, Bing-Zhi
2012-02-25
To further test whether protein kinase A (PKA) can affect the mitotic cell cycle, one-cell stage mouse embryos at S phase (22 h after hCG injection) were incubated in M16 medium containing various concentrations of H-89, a PKA inhibitor. With increasing concentrations of H-89 (0-50 μmol/L), the G(2) phase of eggs was decreased and the cleavage rate was accelerated. A concentration of 40 μmol/L H-89 led to all of the mouse eggs entering the M phase of mitosis. Furthermore, to study the role of PKA in regulating the phosphorylation status of S149 and S321 sites of cell division cycle 25B (CDC25B) on one-cell stage fertilized mouse eggs, pBSK-CDC25B-WT, pBSK-CDC25B-S149A, pBSK-CDC25B-S321A and pBSK-CDC25B-S149A/S321A were transcribed into mRNAs in vitro, then mRNAs were microinjected into S phase of mouse fertilized eggs and cultured in M16 medium pretreated with H-89. Then, the cleavage of fertilized eggs, maturation promoting factor (MPF) activity and phosphorylation status of CDC2-Tyr15 were observed. In the presence of 40 μmol/L H-89, the cleavage rate of fertilized eggs in CDC25B-S/A-mRNAs and CDC25B-WT-mRNA injected groups was significantly higher than that in the control groups, and the peak of MPF activity appeared in the CDC25B-S/A-mRNAs and CDC25B-WT-mRNA injected groups earlier than that in the control groups. CDC2-Tyr15 phosphorylation state was consistent with MPF activity. In conclusion, the present study suggests that PKA regulates the early development of mouse embryos by phosphorylation of S149 and S321 of CDC25B, which plays an important role in the regulation of G(2)/M transition in the mitotic cell cycle of fertilized mouse eggs.
Beyer, Dániel; Tándor, Ildikó; Kónya, Zoltán; Bátori, Róbert; Roszik, Janos; Vereb, György; Erdődi, Ferenc; Vasas, Gábor; M-Hamvas, Márta; Jambrovics, Károly; Máthé, Csaba
2012-01-01
Background and Aims Microcystin-LR (MCY-LR) is a cyanobacterial toxin, a specific inhibitor of type 1 and 2A protein phosphatases (PP1 and PP2A) with significant impact on aquatic ecosystems. It has the potential to alter regulation of the plant cell cycle. The aim of this study was improved understanding of the mitotic alterations induced by cyanotoxin in Vicia faba, a model organism for plant cell biology studies. Methods Vicia faba seedlings were treated over the long and short term with MCY-LR purified in our laboratory. Short-term treatments were performed on root meristems synchronized with hydroxylurea. Sections of lateral root tips were labelled for chromatin, phosphorylated histone H3 and β-tubulin via histochemical and immunohistochemical methods. Mitotic activity and the occurrence of mitotic alterations were detected and analysed by fluorescence microscopy. The phosphorylation state of histone H3 was studied by Western blotting. Key Results Long-term MCY-LR exposure of lateral root tip meristems increased the percentage of either early or late mitosis in a concentration-dependent manner. We observed hypercondensed chromosomes and altered sister chromatid segregation (lagging chromosomes) leading to the formation of micronuclei, accompanied by the formation of disrupted, multipolar and monopolar spindles, disrupted phragmoplasts and the hyperphosphorylation of histone H3 at Ser10. Short-term MCY-LR treatment of synchronized cells showed that PP1 and PP2A inhibition delayed the onset of anaphase at 1 µg mL−1 MCY-LR, accelerated cell cycle at 10 µg mL−1 MCY-LR and induced the formation of lagging chromosomes. In this case mitotic microtubule alterations were not detected, but histone H3 was hyperphosphorylated. Conclusions MCY-LR delayed metaphase–anaphase transition. Consequently, it induced aberrant chromatid segregation and micronucleus formation that could be associated with both H3 hyperphosphorylation and altered microtubule organization. However, these two phenomena seemed to be independent. The toxin may be a useful tool in the study of plant cell cycle regulation. PMID:22819947
Beyer, Dániel; Tándor, Ildikó; Kónya, Zoltán; Bátori, Róbert; Roszik, Janos; Vereb, György; Erdodi, Ferenc; Vasas, Gábor; M-Hamvas, Márta; Jambrovics, Károly; Máthé, Csaba
2012-09-01
Microcystin-LR (MCY-LR) is a cyanobacterial toxin, a specific inhibitor of type 1 and 2A protein phosphatases (PP1 and PP2A) with significant impact on aquatic ecosystems. It has the potential to alter regulation of the plant cell cycle. The aim of this study was improved understanding of the mitotic alterations induced by cyanotoxin in Vicia faba, a model organism for plant cell biology studies. Vicia faba seedlings were treated over the long and short term with MCY-LR purified in our laboratory. Short-term treatments were performed on root meristems synchronized with hydroxylurea. Sections of lateral root tips were labelled for chromatin, phosphorylated histone H3 and β-tubulin via histochemical and immunohistochemical methods. Mitotic activity and the occurrence of mitotic alterations were detected and analysed by fluorescence microscopy. The phosphorylation state of histone H3 was studied by Western blotting. Long-term MCY-LR exposure of lateral root tip meristems increased the percentage of either early or late mitosis in a concentration-dependent manner. We observed hypercondensed chromosomes and altered sister chromatid segregation (lagging chromosomes) leading to the formation of micronuclei, accompanied by the formation of disrupted, multipolar and monopolar spindles, disrupted phragmoplasts and the hyperphosphorylation of histone H3 at Ser10. Short-term MCY-LR treatment of synchronized cells showed that PP1 and PP2A inhibition delayed the onset of anaphase at 1 µg mL(-1) MCY-LR, accelerated cell cycle at 10 µg mL(-1) MCY-LR and induced the formation of lagging chromosomes. In this case mitotic microtubule alterations were not detected, but histone H3 was hyperphosphorylated. MCY-LR delayed metaphase-anaphase transition. Consequently, it induced aberrant chromatid segregation and micronucleus formation that could be associated with both H3 hyperphosphorylation and altered microtubule organization. However, these two phenomena seemed to be independent. The toxin may be a useful tool in the study of plant cell cycle regulation.
Role of High-End Computing in Meeting NASA's Science and Engineering Challenges
NASA Technical Reports Server (NTRS)
Biswas, Rupak
2006-01-01
High-End Computing (HEC) has always played a major role in meeting the modeling and simulation needs of various NASA missions. With NASA's newest 62 teraflops Columbia supercomputer, HEC is having an even greater impact within the Agency and beyond. Significant cutting-edge science and engineering simulations in the areas of space exploration, Shuttle operations, Earth sciences, and aeronautics research, are already occurring on Columbia, demonstrating its ability to accelerate NASA s exploration vision. The talk will describe how the integrated supercomputing production environment is being used to reduce design cycle time, accelerate scientific discovery, conduct parametric analysis of multiple scenarios, and enhance safety during the life cycle of NASA missions.
Two-phase turbine engines. [using gas-liquid mixture accelerated in nozzles
NASA Technical Reports Server (NTRS)
Elliott, D. G.; Hays, L. G.
1976-01-01
A description is given of a two-phase turbine which utilizes a uniform mixture of gas and liquid accelerated in nozzles of the types reported by Elliott and Weinberg (1968). The mixture acts directly on an axial flow or tangential impulse turbine or is separated into gas and liquid streams which operate separately on a gas turbine and a hydraulic turbine. The basic two-phase cycles are examined, taking into account working fluids, aspects of nozzle expansion, details of turbine cycle operation, and the effect of mixture ratio variation. Attention is also given to two-phase nozzle efficiency, two-phase turbine operating characteristics and efficiencies, separator turbines, and impulse turbine experiments.
Numerical analysis and experiment to identify origin of buckling in rapid cycling synchrotron core
NASA Astrophysics Data System (ADS)
Morita, Y.; Kageyama, T.; Akoshima, M.; Torizuka, S.; Tsukamoto, M.; Yamashita, S.; Yoshikawa, N.
2013-11-01
The accelerating cavities used in the rapid cycling synchrotron (RCS) of the Japan Proton Accelerator Research Complex (J-PARC) are loaded with magnetic alloy (MA) cores. Over lengthly periods of RCS operation, significant reductions in the impedance of the cavities resulting from the buckling of the cores were observed. A series of thermal structural simulations and compressive strength tests showed that the buckling can be attributed to the low-viscosity epoxy resin impregnation of the MA core that causes the stiffening of the originally flexible MA-ribbon-wound core. Our results showed that thermal stress can be effectively reduced upon using a core that is not epoxy-impregnated.
At-Risk Readers: Part II--Breaking the Cycle (Research into Practice).
ERIC Educational Resources Information Center
Goetze, Sandra K.; McElroy, Linda J.; Beach, Sara Ann
1997-01-01
Asserts that the cycle of at-risk readers' self-perception and teachers' perception can be broken by providing rich, accelerated literacy instruction. Discusses early intervention programs, such as Reading Recovery and Early Intervention in Reading, and other intervention models such as Success for All. Describes teaching strategies used to…
The therapeutic potential of cell cycle targeting in multiple myeloma.
Maes, Anke; Menu, Eline; Veirman, Kim De; Maes, Ken; Vand Erkerken, Karin; De Bruyne, Elke
2017-10-27
Proper cell cycle progression through the interphase and mitosis is regulated by coordinated activation of important cell cycle proteins (including cyclin-dependent kinases and mitotic kinases) and several checkpoint pathways. Aberrant activity of these cell cycle proteins and checkpoint pathways results in deregulation of cell cycle progression, which is one of the key hallmarks of cancer. Consequently, intensive research on targeting these cell cycle regulatory proteins identified several candidate small molecule inhibitors that are able to induce cell cycle arrest and even apoptosis in cancer cells. Importantly, several of these cell cycle regulatory proteins have also been proposed as therapeutic targets in the plasma cell malignancy multiple myeloma (MM). Despite the enormous progress in the treatment of MM the past 5 years, MM still remains most often incurable due to the development of drug resistance. Deregulated expression of the cyclins D is observed in virtually all myeloma patients, emphasizing the potential therapeutic interest of cyclin-dependent kinase inhibitors in MM. Furthermore, other targets have also been identified in MM, such as microtubules, kinesin motor proteins, aurora kinases, polo-like kinases and the anaphase promoting complex/cyclosome. This review will provide an overview of the cell cycle proteins and checkpoint pathways deregulated in MM and discuss the therapeutic potential of targeting proteins or protein complexes involved in cell cycle control in MM.
Progress towards computer simulation of NiH2 battery performance over life
NASA Technical Reports Server (NTRS)
Zimmerman, Albert H.; Quinzio, M. V.
1995-01-01
The long-term performance of rechargeable battery cells has traditionally been verified through life-testing, a procedure that generally requires significant commitments of funding and test resources. In the situation of nickel hydrogen battery cells, which have the capability of providing extremely long cycle life, the time and cost required to conduct even accelerated testing has become a serious impediment to transitioning technology improvements into spacecraft applications. The utilization of computer simulations to indicate the changes in performance to be expected in response to design or operating changes in nickel hydrogen cells is therefore a particularly attractive tool in advanced battery development, as well as for verifying performance in different applications. Computer-based simulations of the long-term performance of rechargeable battery cells have typically had very limited success in the past. There are a number of reasons for the lack in progress in this area. First, and probably most important, all battery cells are relatively complex electrochemical systems, in which performance is dictated by a large number of interacting physical and chemical processes. While the complexity alone is a significant part of the problem, in many instances the fundamental chemical and physical processes underlying long-term degradation and its effects on performance have not even been understood. Second, while specific chemical and physical changes within cell components have been associated with degradation, there has been no generalized simulation architecture that enables the chemical and physical structure (and changes therein) to be translated into cell performance. For the nickel hydrogen battery cell, our knowledge of the underlying reactions that control the performance of this cell has progressed to where it clearly is possible to model them. The recent development of a relative generalized cell modelling approach provides the framework for translating the chemical and physical structure of the components inside a cell into its performance characteristics over its entire cycle life. This report describes our approach to this task in terms of defining those processes deemed critical in controlling performance over life, and the model architecture required to translate the fundamental cell processes into performance profiles.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, Ya-Hsin; Huang, Su-Chin; Lin, Chun-Ju
Environmental cigarette smoke has been suggested to promote lung adenocarcinoma progression through aryl hydrocarbon receptor (AhR)-signaled metabolism. However, whether AhR facilitates metabolic activation or detoxification in exposed adenocarcinoma cells remains ambiguous. To address this question, we have modified the expression level of AhR in two human lung adenocarcinoma cell lines and examined their response to an extract of cigarette sidestream smoke particulates (CSSP). We found that overexpression of AhR in the CL1-5 cell line reduced CSSP-induced ROS production and oxidative DNA damage, whereas knockdown of AhR expression increased ROS level in CSSP-exposed H1355 cells. Oxidative stress sensor Nrf2 and itsmore » target gene NQO1 were insensitive to AhR expression level and CSSP treatment in human lung adenocarcinoma cells. In contrast, induction of AhR expression concurrently increased mRNA expression of xenobiotic-metabolizing genes CYP1B1, UGT1A8, and UGT1A10 in a ligand-independent manner. It appeared that AhR accelerated xenobiotic clearing and diminished associated oxidative stress by coordinate regulation of a set of phase I and II metabolizing genes. However, the AhR-signaled protection could not shield cells from constant oxidative stress. Prolonged exposure to high concentrations of CSSP induced G0/G1 cell cycle arrest via the p53–p21–Rb1 signaling pathway. Despite no effect on DNA repair rate, AhR facilitated the recovery of cells from growth arrest when CSSP exposure ended. AhR-overexpressing lung adenocarcinoma cells exhibited an increased anchorage-dependent and independent proliferation when recovery from exposure. In summary, our data demonstrated that AhR protected lung adenocarcinoma cells against CSSP-induced oxidative stress and promoted post-exposure clonogenicity. -- Highlights: ► AhR expression level influences cigarette sidestream smoke-induced ROS production. ► AhR reduces oxidative stress by coordinate regulation of metabolizing genes. ► Constant exposure to cigarette smoke arrests cell cycle via p53–p21–Rb1 signaling. ► AhR increases post-exposure clonogenicity of lung adenocarcinoma cells.« less