Science.gov

Sample records for accenture sap solutions

  1. Solution structural studies and low-resolution model of the Schizosaccharomyces pombe sap1 protein.

    PubMed

    Bada, M; Walther, D; Arcangioli, B; Doniach, S; Delarue, M

    2000-07-14

    Sap1 is a DNA-binding protein involved in controlling the mating type switch in fission yeast Schizosaccharomyces pombe. In the absence of any significant sequence similarity with any structurally known protein, a variety of biophysical techniques has been used to probe the solution low-resolution structure of the sap1 protein. First, sap1 is demonstrated to be an unusually elongated dimer in solution by measuring the translational diffusion coefficient with two independent techniques: dynamic light-scattering and ultracentrifugation. Second, sequence analysis revealed the existence of a long coiled-coil region, which is responsible for dimerization. The length of the predicted coiled-coil matches estimates drawn from the hydrodynamic experimental behaviour of the molecule. In addition, the same measurements done on a shorter construct with a coiled-coil region shortened by roughly one-half confirmed the localization of the long coiled-coil region. A crude T-shape model incorporating all these information was built. Third, small-angle X-ray scattering (SAXS) of the free molecule provided additional evidence for the model. In particular, the P(r) curve strikingly demonstrates the existence of long intramolecular distances. Using a novel 3D reconstruction algorithm, a low resolution 3D model of the protein has been independently constructed that matches the SAXS experimental data. It also fits the translation diffusion coefficients measurements and agrees with the first T-shaped model. This low-resolution model has clearly biologically relevant new functional implications, suggesting that sap1 is a bifunctional protein, with the two active sites being separated by as much as 120 A; a tetrapeptide repeated four times at the C terminus of the molecule is postulated to be of utmost functional importance.

  2. SAP: Is it the Network Centric Logistics Solution for the Army Medical Department?

    DTIC Science & Technology

    2007-11-02

    Combines SCM , CRM , and product life cycle management to meet ongoing needs after the initial sale/delivery. 3.2 Supply Chain Collaboration 3.2.1...however the original CASS-M was designed especially for medical logistics battalions with the concept of managing warehouses through the receiving, issue ...TMIP Network Centric Logistics Solution 40 An important issue that the reader needs to consider and understand is that the operating systems

  3. A phloem-sap feeder mixes phloem and xylem sap to regulate osmotic potential.

    PubMed

    Pompon, Julien; Quiring, Dan; Goyer, Claudia; Giordanengo, Philippe; Pelletier, Yvan

    2011-09-01

    Phloem-sap feeders (Hemiptera) occasionally consume the dilute sap of xylem, a behaviour that has previously been associated with replenishing water balance following dehydration. However, a recent study reported that non-dehydrated aphids ingested xylem sap. Here, we tested the hypothesis that the consumption of xylem sap, which has a low osmolality, is a general response to osmotic stresses other than dehydration. Alate aphids were subjected to different treatments and subsequently transferred onto a plant, where electrical penetration graph (EPG) was used to estimate durations of passive phloem sap consumption and active sucking of xylem sap. The proportion of time aphids fed on xylem sap (i.e., time spent feeding on xylem sap/total time spent feeding on phloem plus xylem sap) was used as a proxy of the solute concentration of the uptake. The proportion of time alate aphids fed on xylem sap increased: (1) with the time spent imbibing an artificial diet containing a solution of sucrose, which is highly concentrated in phloem sap and is mainly responsible for the high osmotic potential of phloem sap; (2) with the osmotic potential of the artificial diet, when osmotic potential excess was not related to sucrose concentration; and (3) when aphids were deprived of primary symbionts, a condition previously shown to lead to a higher haemolymph osmotic potential. All our results converge to support the hypothesis that xylem sap consumption contributes to the regulation of the osmotic potential in phloem-sap feeders.

  4. SAP family proteins.

    PubMed

    Fujita, A; Kurachi, Y

    2000-03-05

    Thus far, five members including Dlg, SAP97/hDlg, SAP90/PSD-95, SAP102, and PSD-93/chapsyn110 which belong to SAP family have been identified. Recent studies have revealed that these proteins play important roles in the localization and function of glutamate receptors and K(+) channels. Although most of them have been reported to be localized to the synapse, only one member, SAP97, is expressed also in the epithelial cells. In this review, we have summarized structural characters of SAP family proteins and discuss their functions in neurons and epithelial cells.

  5. Xylem sap proteomics.

    PubMed

    de Bernonville, Thomas Dugé; Albenne, Cécile; Arlat, Matthieu; Hoffmann, Laurent; Lauber, Emmanuelle; Jamet, Elisabeth

    2014-01-01

    Proteomic analysis of xylem sap has recently become a major field of interest to understand several biological questions related to plant development and responses to environmental clues. The xylem sap appears as a dynamic fluid undergoing changes in its proteome upon abiotic and biotic stresses. Unlike cell compartments which are amenable to purification in sufficient amount prior to proteomic analysis, the xylem sap has to be collected in particular conditions to avoid contamination by intracellular proteins and to obtain enough material. A model plant like Arabidopsis thaliana is not suitable for such an analysis because efficient harvesting of xylem sap is difficult. The analysis of the xylem sap proteome also requires specific procedures to concentrate proteins and to focus on proteins predicted to be secreted. Indeed, xylem sap proteins appear to be synthesized and secreted in the root stele or to originate from dying differentiated xylem cells. This chapter describes protocols to collect xylem sap from Brassica species and to prepare total and N-glycoprotein extracts for identification of proteins by mass spectrometry analyses and bioinformatics.

  6. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  7. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  8. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  9. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  10. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Maple sap. 1437.107 Section 1437.107 Agriculture... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is limited to maple sap produced on private property for sale as sap or syrup. Eligible maple sap must...

  11. From Sap to Syrup

    ERIC Educational Resources Information Center

    Bjork, Janna

    2005-01-01

    Warm days, cold nights, melting snow-signs winter is waning and spring is nearing. Though winter may just be getting started in some areas, it's always fun to appreciate the good things about winter, including the special time at the end of winter in New England known as "sugaring time." The sap starts flowing in the sugar maples, and…

  12. Structural and binding studies of SAP-1 protein with heparin.

    PubMed

    Yadav, Vikash K; Mandal, Rahul S; Puniya, Bhanwar L; Kumar, Rahul; Dey, Sharmistha; Singh, Sarman; Yadav, Savita

    2015-03-01

    SAP-1 is a low molecular weight cysteine protease inhibitor (CPI) which belongs to type-2 cystatins family. SAP-1 protein purified from human seminal plasma (HuSP) has been shown to inhibit cysteine and serine proteases and exhibit interesting biological properties, including high temperature and pH stability. Heparin is a naturally occurring glycosaminoglycan (with varied chain length) which interacts with a number of proteins and regulates multiple steps in different biological processes. As an anticoagulant, heparin enhances inhibition of thrombin by the serpin antithrombin III. Therefore, we have employed surface plasmon resonance (SPR) to improve our understanding of the binding interaction between heparin and SAP-1 (protease inhibitor). SPR data suggest that SAP-1 binds to heparin with a significant affinity (KD = 158 nm). SPR solution competition studies using heparin oligosaccharides showed that the binding of SAP-1 to heparin is dependent on chain length. Large oligosaccharides show strong binding affinity for SAP-1. Further to get insight into the structural aspect of interactions between SAP-1 and heparin, we used modelled structure of the SAP-1 and docked with heparin and heparin-derived polysaccharides. The results suggest that a positively charged residue lysine plays important role in these interactions. Such information should improve our understanding of how heparin, present in the reproductive tract, regulates cystatins activity.

  13. Sapping In Nirgal Vallis

    NASA Astrophysics Data System (ADS)

    Jaumann, R.; Reiss, D.

    The topographic information provided by the Mars Orbiter Laser Altimeter has been used in combination with Viking and Mars Observer Camera imagery to estimate the three-dimensional structure of the Nirgal Vallis drainage system in order to constrain the formation process. Based on precisely correlated Viking, Mars Orbiter Laser Altimeter (MOLA) and Mars Orbiter Camera (MOC) cartographic data (1,2), we have measured morphometric and topologic parameters (3,4,5,6,7) of the valley network. Although there is no single parameter, which unambiguously distinguishes between run-off and sapping, the combination of parameters such as surface dip angle, longitudinal profile, width to depth ratio, drainage density, structural control, valley terminations and bifurcation ratio will constrain the formation process. All topographic based valley network parameters indicate an origin by groundwater sapping processes and headward erosion for Nirgal Vallis and confirms former geomorphologic analyses. The extremely low drainage density of Nirgal Vallis may either be caused by very slow erosion, due to low groundwater supply or arid conditions, or by sequential interruptions of the erosion process due to probable climate changes. (1) Zeitler and Oberst, 1999; JGR, 104, 14051. (2) Hauber et al., 2000, Int. Arch. Photogram. Rem. Sens. XXXIII, 360. (3) Horton, 1945, Geol. Sic. Amer. 56. 275. (4) Strahler, 1964, In: Handbook Appl. Hydrogeol. McGraw Hill. (5) Leopold et al, 1964, In: Fluvial Proc. Geomorph. Freeman (6) Summerfield, 1991, In: Global Geomorph. Longman, Burnt Mill.(7) Ritter et al. 1995, In: Processes Geomorph. Wm.C.Brown Publ..

  14. Measuring sap flow in plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow measurements provide a powerful tool for quantifying plant water use and monitoring qualitative physiological responses of plants to environmental conditions. As such, sap flow methods are widely employed to invesitgate the agronomic, ecological and hydrological outcomes of plant growth. T...

  15. Redox‐dependent disulfide bond formation in SAP30L corepressor protein: Implications for structure and function

    PubMed Central

    Laitaoja, Mikko; Tossavainen, Helena; Pihlajamaa, Tero; Valjakka, Jarkko; Viiri, Keijo; Lohi, Olli; Permi, Perttu

    2015-01-01

    Abstract Sin3A‐associated protein 30‐like (SAP30L) is one of the key proteins in a multi‐subunit protein complex involved in transcriptional regulation via histone deacetylation. SAP30L, together with a highly homologous SAP30 as well as other SAP proteins (i.e., SAP25, SAP45, SAP130, and SAP180), is an essential component of the Sin3A corepressor complex, although its actual role has remained elusive. SAP30L is thought to function as an important stabilizing and bridging molecule in the complex and to mediate its interactions with other corepressors. SAP30L has been previously shown to contain an N‐terminal Cys3His type zinc finger (ZnF) motif, which is responsible for the key protein–protein, protein–DNA, and protein–lipid interactions. By using high‐resolution mass spectrometry, we studied a redox‐dependent disulfide bond formation in SAP30L ZnF as a regulatory mechanism for its structure and function. We showed that upon oxidative stress SAP30L undergoes the formation of two specific disulfide bonds, a vicinal Cys29‐Cys30 and Cys38‐Cys74, with a concomitant release of the coordinated zinc ion. The oxidized protein was shown to remain folded in solution and to bind signaling phospholipids. We also determined a solution NMR structure for SAP30L ZnF that showed an overall fold similar to that of SAP30, determined earlier. The NMR titration experiments with lipids and DNA showed that the binding is mediated by the C‐terminal tail as well as both α‐helices of SAP30L ZnF. The implications of these results for the structure and function of SAP30L are discussed. PMID:26609676

  16. Wireless sap flow measurement system

    NASA Astrophysics Data System (ADS)

    Kuo, C.; Davis, T. W.; Tseng, C.; Cheng, C.; Liang, X.; Yu, P.

    2010-12-01

    This study exhibits a measurement system for wireless sensor networks to measure sap flow in multiple locations simultaneously. Transpiration is a major component of the land-surface system because it is indicative of the water movement between the soil and the air. Sap flow can be used to approximate transpiration. In forests, transpiration cannot be represented by the sap flow from a single tree. Multi-location sap flow measurements are required to show the heterogeneity caused by different trees or soil conditions. Traditional multi-location measurements require manpower and capital for data collection and instrument maintenance. Fortunately, multi-location measurements can be achieved by using the new technology of wireless sensor networks. With multi-hop communication protocol, data can be forwarded to the base station via multiple sensor nodes. This communication protocol can provide reliable data collection with the least power consumption. This study encountered two major problems. The first problem was signal amplification. The Crossbow IRIS mote was selected as the sensor node that receives the temperature data of the sap flow probe (thermocouple) through a MDA300 data acquisition board. However, the wireless sensor node could not directly receive any data from the thermocouples since the least significant bit value of the MDA300, 0.6 mV, is much higher than the voltage signal generated. Thus, the signal from the thermocouple must be amplified to exceed this threshold. The second problem is power management. A specific heat differential is required for the thermal dissipation method of measuring sap flow. Thus, an adjustable DC power supply is necessary for calibrating the heater's temperature settings. A circuit was designed to combine the signal amplifier and power regulator. The regulator has been designed to also provide power to the IRIS mote to extend battery life. This design enables wireless sap flow measurements in the forest. With the

  17. Tree Hydraulics: How Sap Rises

    ERIC Educational Resources Information Center

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown--a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by…

  18. Is the ABA concentration in the sap collected by pressurizing leaves relevant for analysing drought effects on stomata? Evidence from ABA-fed leaves of transgenic plants with modified capacities to synthesize ABA.

    PubMed

    Borel, Charlotte; Simonneau, Thierry

    2002-02-01

    Most studies on the role of ABA in the stomatal response of the whole plant to drought rely on a good estimate of ABA concentration in xylem sap. In this report, varying volumes of sap (V(sap)) were collected by pressurizing leaves cut from several lines of N. plumbaginifolia with modified capacities to synthesize ABA. Leaves were fed with solutions of known ABA concentration ([ABA](solution) from 0-500 micromol m(-3)) for 2-3 h before sap collection. ABA concentration in extruded sap ([ABA](sap)) was compared with [ABA](solution). In low-volume extracts (less than 0.35 mm(3) cm(-2) leaf area) collected from leaves of well-watered plants, [ABA](sap) was close to [ABA](solution). For all lines, [ABA](sap) decreased with increasing V(sap). The same dilution effect was observed for leaves pressurized just after sampling on droughted plants, suggesting, as for detached leaves fed with ABA, that [ABA](sap) in low-volume extracts approximated well with the concentration of ABA entering leaves still attached on droughted plants. However, ABA-fed leaves sampled from droughted plants yielded higher [ABA](sap) than ABA-fed leaves sampled from well-watered plants. [ABA](sap) was also increased, although very slightly, when leaves were preincubated in highly enriched ABA solution. This indicates that some leaf ABA contributed to the ABA concentration returned in the extruded sap. Consistently, [ABA](sap) in medium-volume extracts (0.35-0.65 mm(3) cm(-2) leaf area) was lower for leaves sampled on under-producing lines than on the wild type. Despite these distortions between [ABA](solution) and [ABA](sap) in medium-volume extracts, stomatal conductance of ABA-fed leaves closely correlated with [ABA](sap) with a similar relationship in all cases, whilst relationships with [ABA](solution) were more scattered.

  19. THE CELL SAP OF HYDRODICTYON

    PubMed Central

    Blinks, L. R.; Nielsen, John P.

    1940-01-01

    Analysis of the cell sap of Hydrodictyon patenaeforme Pocock, from California indicates the usual marked accumulation of potassium, which is 4000 times as concentrated as in the surrounding pond water. Small amounts of sodium and calcium were found. Chloride makes up about three-fourths of the anions, with a very high sulfate, and much lower bicarbonate concentration accounting for most of the remainder. Electrical conductivity and osmotic studies indicate that the analyzed elements are ionized, and account for most of the sap's osmotic pressure. pH is 5.5 to 6.0. The analytical procedure was designed to determine as many of the cations as possible on one small sample. Hydrodictyon is a large multinucleate cell belonging to an order (Chlorococcales) new to permeability and accumulation studies. PMID:19873174

  20. The sap of Acer okamotoanum decreases serum alcohol levels after acute ethanol ingestion in rats.

    PubMed

    Yoo, Yeong-Min; Jung, Eui-Man; Kang, Ha-Young; Choi, In-Gyu; Choi, Kyung-Chul; Jeung, Eui-Bae

    2011-10-01

    In the present study, we examined whether Acer okamotoanum (A. okamotoanum) sap decreased the serum alcohol and acetaldehyde levels after acute ethanol treatment in a rat model. Male rats were orally administered 25, 50 or 100% A. okamotoanum sap 30 min prior to oral challenge with 3 ml of ethanol (15 ml/kg of a 20% ethanol solution in water), and the blood concentrations of alcohol and acetaldehyde were analyzed up to 7 h after the treatment. Pre-treatment with the sap significantly decreased the blood ethanol and acetaldehyde concentrations after 5 h when compared with ethanol treatment alone (a negative control). The expression levels of liver alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) mRNA were increased significantly in animals pre-treated with A. okamotoanum sap when compared with negative and positive controls. The data suggest that sap pre-treatment enhanced the alcohol metabolism rate in the rat liver. To investigate the involvement of mitochondrial regulation in the ethanol-induced hepatocyte apoptosis, we carried out an immunohistochemical analysis of Bax and Bcl-2. Pre-treatment with sap significantly decreased Bax expression and increased Bcl-2 expression 7 h after ethanol administration when compared with the negative control. The data suggest that A. okamotoanum sap pre-treatment may reduce the alcohol-induced oxidative stress in the rat liver.

  1. Tree hydraulics: how sap rises

    NASA Astrophysics Data System (ADS)

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown—a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by transpiration or capillary action; we investigate the effectiveness of both these forces for the two conduit architectures considered. The level of analysis is appropriate for undergraduates. The subject is of broad interest because it provides a naturally-occurring example of an unusual metastable state of matter: liquid under tension.

  2. N-SAP and G-SAP neutron and gamma ray albedo model scatter shield analysis program

    NASA Technical Reports Server (NTRS)

    Sapovchak, B. J.; Stephenson, L. D.

    1967-01-01

    Computer program calculates neutron or gamma ray first order scattering from a plane or cylindrical surface to a detector point. The SAP Codes, G-SAP and N-SAP, constitute a multiple scatter albedo model shield analysis.

  3. Effect of L-Valine on the growth and characterization of Sodium Acid Phthalate (SAP) single crystals

    NASA Astrophysics Data System (ADS)

    Nirmala, L. Ruby; Prakash, J. Thomas Joseph

    2013-06-01

    Undoped and amino acid doped good quality single crystals of Sodium Acid Phthalate crystals (SAP) were grown by slow evaporation solution growth technique which are semiorganic in nature. The effect of amino acid (L-Valine) dopant on the growth and the properties of SAP single crystal was investigated. The single crystal X-ray diffraction studies and FT-IR studies were carried out to identify the crystal structure and the presence of functional groups in undoped and L-Valine doped SAP crystals. The transparent nature of the grown crystal was observed using UV-Visible spectrum. The thermal decomposition of the doped SAP crystals was investigated by thermo gravimetric analysis (TGA) and differential thermal analysis (DTA). The enhancement in the NLO property of the undoped and L-Valine doped SAP crystals using KDP crystal as a reference was studied using SHG measurements. Vickers micro hardness measurements are used for the study of mechanical strength of the grown crystals.

  4. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence.

    PubMed Central

    Hube, B; Sanglard, D; Odds, F C; Hess, D; Monod, M; Schäfer, W; Brown, A J; Gow, N A

    1997-01-01

    Secreted aspartyl proteinases (Saps), encoded by a gene family with at least nine members (SAP1 to SAP9), are one of the most discussed virulence factors produced by the human pathogen Candida albicans. In order to study the role of each Sap isoenzyme in pathogenicity, we have constructed strains which harbor mutations at selected SAP genes. SAP1, SAP2, and SAP3, which are regulated differentially in vitro, were mutated by targeted gene disruption. The growth rates of all homozygous null mutants were similar to those of the isogenic wild-type parental strain (SC5314) in complex and defined media. In medium with protein as the sole source of nitrogen, sap1 and sap3 mutants grew with reduced growth rates but reached optical densities similar to those measured for SC5314. In contrast, sap2 null mutants tended to clump, grew poorly in this medium, and produced the lowest proteolytic activity. Addition of ammonium ions reversed such growth defects. These results support the view that Sap2 is the dominant isoenzyme. When sap1, sap2, and sap3 mutants were injected intravenously in guinea pigs and mice, the animals had increased survival rates compared to those of control animals infected with SC5314. However, reduction of proteolytic activity in vitro did not correlate directly with the extent of attenuation of virulence observed for all Sap-deficient mutants. These data suggest that SAP1, SAP2, and SAP3 all contribute to the overall virulence of C. albicans and presumably all play important roles during disseminated infections. PMID:9284116

  5. Mekong Floods Fill Tonle Sap

    NASA Technical Reports Server (NTRS)

    2002-01-01

    The monsoon season in Southeast Asia brings recurring, often devastating floods to countries in the region, but these floods also play a necessary role in the region's water cycle. These MODIS images centered on Cambodia reveal extensive flooding of the Mekong River, which comes in from Laos in the north, to the right of center in the images, and flows south through Cambodia and southeast through Vietnam to empty into the South China Sea. The true-color image shows the brownish, sediment-laden floodwaters filling the Mekong Delta in southern Cambodia and Vietnam on September 15, 2001. The false color image above has been enhanced to bring out the contrast between the floodwaters and the lands, with sediment-carrying floodwaters in purple. Sediment can be seen flowing into the South China Sea as well. This year's floods have affected over a million people, and 100 people have been killed in Vietnam alone. The monsoon floods bring not only devastation, but renewal. The large body of water just left of center in Cambodia is the Tonle Sap. This shallow lake plays a changing role in the regional water cycle. During the dry season, the stream-fed Tonle Sap drains via the Tonle Sab River into the Mekong River. During the wet season (June-November), flooding of the Mekong reverses the course of the Tonle Sab, roughly tripling the lake's size from about 3000 km2 to about 10,000. When the dry season returns, the lake once again begins to drain into the Mekong Delta, where it provides a flow of fresh water that balances the intrusion of salty seawater into the delta's agricultural lands. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  6. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 1 2014-10-01 2014-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  7. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  8. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  9. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  10. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  11. Application of superabsorbent polymers (SAP) as desiccants to dry maize and reduce aflatoxin contamination.

    PubMed

    Mbuge, Duncan O; Negrini, Renata; Nyakundi, Livine O; Kuate, Serge P; Bandyopadhyay, Ranajit; Muiru, William M; Torto, Baldwyn; Mezzenga, Raffaele

    2016-08-01

    The ability of superabsorbent polymers (SAP) in drying maize and controlling aflatoxin contamination was studied under different temperatures, drying times and SAP-to-maize ratios. Temperature and drying time showed significant influence on the aflatoxin formation. SAP-to-maize ratios between 1:1 and 1:5 showed little or no aflatoxin contamination after drying to the optimal moisture content (MC) of 13 %, while for ratios 1:10 and 1:20, aflatoxin contamination was not well controlled due to the overall higher MC and drying time, which made these ratios unsuitable for the drying process. Results clearly show that temperature, frequency of SAP change, drying time and SAP-to-maize ratio influenced the drying rate and aflatoxin contamination. Furthermore, it was shown that SAP had good potential for grain drying and can be used iteratively, which can make this system an optimal solution to reduce aflatoxin contamination in maize, particular for developing countries and resource-lacking areas.

  12. The FORTRAN static source code analyzer program (SAP) system description

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Merwarth, P.; Oneill, M.; Goorevich, C.; Waligora, S.

    1982-01-01

    A source code analyzer program (SAP) designed to assist personnel in conducting studies of FORTRAN programs is described. The SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. The processing performed by SAP and of the routines, COMMON blocks, and files used by SAP are described. The system generation procedure for SAP is also presented.

  13. Spring sapping on the lower continental slope, offshore New Jersey

    USGS Publications Warehouse

    Robb, James M.

    1984-01-01

    Undersea discharge of ground water during periods of lower sea level may have eroded valleys on part of the lower continental slope, offshore New Jersey. Steep-headed basins, cliffed and terraced walls, and irregular courses of these valleys may have been produced by sapping of exposed near-horizontal Tertiary strata. Joints in Eocene calcareous rocks would have localized ground-water movement. Some karstlike features of the submarine topography and the outcrops suggest that solution of the calcareous rocks also took place.

  14. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins, which are likely to be important players in th...

  15. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in the...

  16. Implementation of SAP Waste Management System

    SciTech Connect

    Frost, M.L.; LaBorde, C.M.; Nichols, C.D.

    2008-07-01

    The Y-12 National Security Complex (Y-12) assumed responsibility for newly generated waste on October 1, 2005. To ensure effective management and accountability of newly generated waste, Y-12 has opted to utilize SAP, Y-12's Enterprise Resource Planning (ERP) tool, to track low-level radioactive waste (LLW), mixed waste (MW), hazardous waste, and non-regulated waste from generation through acceptance and disposal. SAP Waste will include the functionality of the current waste tracking system and integrate with the applicable modules of SAP already in use. The functionality of two legacy systems, the Generator Entry System (GES) and the Waste Information Tracking System (WITS), and peripheral spreadsheets, databases, and e-mail/fax communications will be replaced by SAP Waste. Fundamentally, SAP Waste will promote waste acceptance for certification and disposal, not storage. SAP Waste will provide a one-time data entry location where waste generators can enter waste container information, track the status of their waste, and maintain documentation. A benefit of the new system is that it will provide a single data repository where Y-12's Waste Management organization can establish waste profiles, verify and validate data, maintain inventory control utilizing hand-held data transfer devices, schedule and ship waste, manage project accounting, and report on waste handling activities. This single data repository will facilitate the production of detailed waste generation reports for use in forecasting and budgeting, provide the data for required regulatory reports, and generate metrics to evaluate the performance of the Waste Management organization and its subcontractors. SAP Waste will replace the outdated and expensive legacy system, establish tools the site needs to manage newly generated waste, and optimize the use of the site's ERP tool for integration with related business processes while promoting disposition of waste. (authors)

  17. (BOREAS) BOREAS TE-7 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Hogg, E. H.; Hurdle, P. A.

    2000-01-01

    The BOREAS TE-7 team collected data sets in support of its efforts to characterize and interpret information on the sap flow of boreal vegetation. The heat pulse method was used to monitor sap flow and to estimate rates of transpiration from aspen, black spruce, and mixed wood forests at the SSAOA, MIX, SSA-OBS. and Batoche sites in Saskatchewan, Canada. Measurements were made at the various sites from May to October 1994, May to October 1995, and April to October 1996. A scaling procedure was used to estimate canopy transpiration rates from the sap flow measurements. The data were stored in tabular ASCII files. Analyses to date show a tendency for sap flow in aspen to remain remarkably constant over a wide range of environmental conditions VPD from 1.0 to 4.8 kPa and solar radiation less than 400 W/sq m). For forests with high aerodynamic conductance, the results would indicate an inverse relationship between stomatal conductance and VPD, for VPD greater than 1 kPa. A possible interpretation is that stomata are operating to maintain leaf water potentials above a critical minimum value, which in turn places a maximum value on the rate of sap flow that can be sustained by the tree. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distrobuted Activity Archive Center (DAAC).

  18. BOREAS TE-11 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Saugier, Bernard

    2000-01-01

    The BOREAS TE-11 team collected several data sets in support of its efforts to characterize and interpret information on the sap flow, gas exchange, and lichen photosynthesis of boreal vegetation and meteorological data of the area studied. This data set contains measurements of sap flow conducted at the SSA-OJP site in the growing seasons of 1993 and 1994. The data are stored in ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  19. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  20. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  1. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  2. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  3. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  4. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 7 2012-10-01 2012-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  5. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 7 2013-10-01 2013-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  6. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 7 2014-10-01 2014-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  7. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 7 2011-10-01 2011-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  8. Surface Absorption Polarization Sensors (SAPS), Final Technical Report, Laser Probing of Immobilized SAPS Actuators Component

    SciTech Connect

    Joseph I. Cline

    2010-04-22

    A novel hypothesized detection scheme for the detection of chemical agents was proposed: SAPS ``Surface-Adsorbed Polarization Sensors''. In this technique a thin layer of molecular rotors is adsorbed to a surface. The rotors can be energized by light absorption, but are otherwise locked in position or alternatively rotate slowly. Using polarized light, the adsorbed rotors are turned as an ensemble. Chemical agent (analyte) binding that alters the rotary efficiency would be detected by sensitive polarized absorption techniques. The mechanism of the SAPS detection can be mechanical, chemical, or photochemical: only a change in rotary efficiency is required. To achieve the goal of SAPS detection, new spectroscopic technique, polarized Normal Incidence Cavity Ringdown Spectroscopy (polarized NICRDS), was developed. The technique employs very sensitive and general Cavity Ringdown absorption spectroscopy along with the ability to perform polarized absorption measurements. Polarized absorption offers the ability to measure the angular position of molecular chromophores. In the new experiments a thin layer of SAPS sensors (roughly corresponding to a monolayer coverage on a surface) immobilized in PMMA. The PMMA layer is less than 100~nm thick and is spin-coated onto a flat fused-silica substrate. The new technique was applied to study the photoisomerization-driven rotary motion of a family of SAPS actuators based on a family of substituted dibenzofulvene rotors based upon 9-(2,2,2- triphenylethylidene)fluorene. By varying the substitution to include moieties such as nitro, amino, and cyano the absorption spectrum and the quantum efficiency of photoisomerization can be varied. This SAPS effect was readily detected by polarized NICRDS. The amino substituted SAPS actuator binds H+ to form an ammonium species which was shown to have a much larger quantum efficiency for photoisomerization. A thin layer of immobilized amino actuators were then shown by polarized NICRDS to have a

  9. Handling of the demilitarized zone using service providers in SAP

    NASA Astrophysics Data System (ADS)

    Iovan, A.; Robu, R.

    2016-02-01

    External collaboration needs to allow data access from the Internet. In a trusted Internet collaboration scenario where the external user works on the same data like the internal user direct access to the data in the Intranet is required. The paper presents a solution to get access to certain data in the Enterprise Resource Planning system, having the User Interface on a system in the Demilitarized Zone and the database on a system which is located in the trusted area. Using the Service Provider Interface framework, connections between separate systems can be created in different areas of the network. The paper demonstrates how to connect the two systems, one in the Demilitarized Zone and one in the trusted area, using SAP ERP 6.0 with Enhancement Package 7. In order to use the Service Provider Interface SAP Business Suite Foundation component must be installed in both systems. The advantage of using the Service Provider Interface framework is that the external user works on the same data like the internal user (and not on copies). This assures data consistency and less overhead for backup and security systems.

  10. Sorption kinetics of superabsorbent polymers (SAPs) in fresh Portland cement-based pastes visualized and quantified by neutron radiography and correlated to the progress of cement hydration

    SciTech Connect

    Schroefl, Christof; Mechtcherine, Viktor; Vontobel, Peter; Hovind, Jan; Lehmann, Eberhard

    2015-09-15

    Water sorption of two superabsorbent polymers in cement-based pastes has been characterized by neutron radiography. Cement pastes with W/C of 0.25 and 0.50 and one additionally containing silica fume (W/C = 0.42) were investigated. The SAPs differed in their inherent sorption kinetics in extracted cement pore solution (SAP 1: self-releasing; SAP 2: retentive). Desorption from SAP 1 started very early after paste preparation. Hence, its individual non-retentiveness governs its behavior only. SAP 2 released water into all matrices, but its kinetics were different. In the paste with the highest W/C, some moderate water release was recorded from the beginning. In the other two pastes, SAP 2 retained its stored liquid during the dormant period, i.e., up to the percolation threshold. Intense desorption then set in and continued throughout the acceleration period. These findings explain the pronouncedly higher efficiency of SAP 2 as internal curing admixture as compared to SAP 1.

  11. Changes in the Proteome of Xylem Sap in Brassica oleracea in Response to Fusarium oxysporum Stress.

    PubMed

    Pu, Zijing; Ino, Yoko; Kimura, Yayoi; Tago, Asumi; Shimizu, Motoki; Natsume, Satoshi; Sano, Yoshitaka; Fujimoto, Ryo; Kaneko, Kentaro; Shea, Daniel J; Fukai, Eigo; Fuji, Shin-Ichi; Hirano, Hisashi; Okazaki, Keiichi

    2016-01-01

    Fusarium oxysporum f.sp. conlutinans (Foc) is a serious root-invading and xylem-colonizing fungus that causes yellowing in Brassica oleracea. To comprehensively understand the interaction between F. oxysporum and B. oleracea, composition of the xylem sap proteome of the non-infected and Foc-infected plants was investigated in both resistant and susceptible cultivars using liquid chromatography-tandem mass spectrometry (LC-MS/MS) after in-solution digestion of xylem sap proteins. Whole genome sequencing of Foc was carried out and generated a predicted Foc protein database. The predicted Foc protein database was then combined with the public B. oleracea and B. rapa protein databases downloaded from Uniprot and used for protein identification. About 200 plant proteins were identified in the xylem sap of susceptible and resistant plants. Comparison between the non-infected and Foc-infected samples revealed that Foc infection causes changes to the protein composition in B. oleracea xylem sap where repressed proteins accounted for a greater proportion than those of induced in both the susceptible and resistant reactions. The analysis on the proteins with concentration change > = 2-fold indicated a large portion of up- and down-regulated proteins were those acting on carbohydrates. Proteins with leucine-rich repeats and legume lectin domains were mainly induced in both resistant and susceptible system, so was the case of thaumatins. Twenty-five Foc proteins were identified in the infected xylem sap and 10 of them were cysteine-containing secreted small proteins that are good candidates for virulence and/or avirulence effectors. The findings of differential response of protein contents in the xylem sap between the non-infected and Foc-infected samples as well as the Foc candidate effectors secreted in xylem provide valuable insights into B. oleracea-Foc interactions.

  12. Concentrations of metals and potential metal-binding compounds and speciation of Cd, Zn and Cu in phloem and xylem saps from castor bean plants (Ricinus communis) treated with four levels of cadmium.

    PubMed

    Hazama, Kenji; Nagata, Shinji; Fujimori, Tamaki; Yanagisawa, Shuichi; Yoneyama, Tadakatsu

    2015-06-01

    We examined the concentrations of metals (Cd, Zn, Cu, Fe and Mn) and potential metal-binding compounds [nicotianamine (NA), thiol compounds and citrate] in xylem and phloem saps from 4-week-old castor bean plants (Ricinus communis) treated with 0 (control), 0.1, 1.0, and 10 μM Cd for 3 weeks. Treatment with 0.1 and 1 μM Cd produced no visible damage, while 10 μM Cd retarded growth. Cadmium concentrations in both saps were higher than those in the culture solution at 0.1 μM, similar at 1.0 μM and lower at 10 μM. Cd at 10 μM reduced Cu and Fe concentrations in both saps. NA concentrations measured by capillary electrophoresis-mass spectrometry (MS) in xylem sap (20 μM) were higher than the Cu concentrations, and those in phloem sap (150 μM) were higher than those of Zn, Fe and Cu combined. Reduced glutathione concentrations differed in xylem and phloem saps (1-2 and 30-150 μM, respectively), but oxidized glutathione concentrations were similar. Phloem sap phytochelatin 2 concentration increased from 0.8 μM in controls to 8 μM in 10 μM Cd. Free citrate was 2-4 μM in xylem sap and 70-100 μM in phloem sap. Total bound forms of Cd in phloem and xylem saps from 1 μM Cd-treated plants were 54 and 8%, respectively. Treatment of phloem sap with proteinaseK reduced high-molecular compounds while increasing fractions of low-molecular Cd-thiol complexes. Zinc-NA, Fe-NA and Cu-NA were identified in the phloem sap fraction of control plants by electrospray ionization time-of-flight MS, and the xylem sap contained Cu-NA.

  13. Sampling and analysis of phloem sap.

    PubMed

    Dinant, Sylvie; Kehr, Julia

    2013-01-01

    The transport tubes of the phloem are essential for higher plants. They not only provide the route for the distribution of assimilates produced during photosynthesis from source to sink organs but also (re-) distribute mineral nutrients. Additionally, the phloem is essential for sending information between distant plant organs and steering developmental and defense processes. For example, flowering and tuberization time are controlled by phloem-mobile signals and important defense reactions on the whole plant level, like systemic acquired resistance or systemic gene silencing, are spread through the phloem. In addition, recent results demonstrate that also the allocation of mineral nutrients is coordinated by phloem mobile signaling molecules. However, in many studies the important analysis of phloem sap is neglected, probably because the content of sieve tubes is not easy to access. This chapter will describe the current methods for sampling and analysis of phloem sap in order to encourage researchers to include the analysis of this crucial compartment in their relevant studies.

  14. Comparison of Sugars, Iridoid Glycosides and Amino Acids in Nectar and Phloem Sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus

    PubMed Central

    Lohaus, Gertrud; Schwerdtfeger, Michael

    2014-01-01

    Background Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Methodology and Principal Findings Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. Conclusions/Significance The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar

  15. Faculty performance evaluation: the CIPP-SAPS model.

    PubMed

    Mitcham, M

    1981-11-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-input-process-product) model is introduced and its development in a CIPP-SAPS (self-administrative-peer-student) model is pursued. Data sources for the SAPS portion of the model are discussed. A suggestion for the use of the CIPP-SAPS model within a teaching contract plan is explored.

  16. Expression of SAP5 and SAP9 in Candida albicans biofilms: comparison of bloodstream isolates with isolates from other sources.

    PubMed

    Joo, Min Young; Shin, Jong Hee; Jang, Hee-Chang; Song, Eun Song; Kee, Seung Jung; Shin, Myung Geun; Suh, Soon Pal; Ryang, Dong Wook

    2013-11-01

    Secreted aspartic proteases (Sap), encoded by a family of 10 SAP genes, are key virulence determinants in Candida albicans. Although biofilm-associated bloodstream infections (BSIs) are frequently caused by C. albicans, SAP gene expression in C. albicans biofilms formed by BSI isolates has not been evaluated. We compared the expression of two SAP genes, SAP5 and SAP9, in C. albicans biofilms formed by BSI isolates with those formed by isolates from other body sites. Sixty-three C. albicans isolates were analyzed, comprising 35 BSI isolates and 28 from other sites. A denture-strip biofilm model was used, and expression of the two SAP genes was quantified by real-time RT-PCR during planktonic or biofilm growth. Mean SAP5 expression levels of the BSI isolates were 3.59-fold and 3.86-fold higher in 24-h and 48-h biofilms, respectively, than in planktonic cells. These results did not differ from those for isolates from other sites (2.71-fold and 2.8-fold for 24-h and 48-h biofilms, respectively). By contrast, mean SAP9 expression during biofilm formation was higher in BSI isolates (2.89-fold and 3.29-fold at 24 and 48 h, respectively) than in isolates from other sites (1.27-fold and 1.32-fold at 24 and 48 h, respectively; both, P < 0.001). These results show, for the first time, that both SAP5 and SAP9 are upregulated in C. albicans biofilms formed by BSI isolates, and that BSI isolates may have a greater capacity to express SAP9 under biofilm conditions than isolates from other sites.

  17. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes.

    PubMed

    Rodríguez-Celma, Jorge; Ceballos-Laita, Laura; Grusak, Michael A; Abadía, Javier; López-Millán, Ana-Flor

    2016-08-01

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in their functionalities. However, detailed information about their proteomes is only starting to arise due to the difficulties inherent to the collection methods. This review compiles the proteomic information available to date in these three plant fluids, and compares the proteomes obtained in different plant species in order to shed light into conserved functions in each plant fluid. Inter-species comparisons indicate that all these fluids contain the protein machinery for self-maintenance and defense, including proteins related to cell wall metabolism, pathogen defense, proteolysis, and redox response. These analyses also revealed that proteins may play more relevant roles in signaling in the phloem sap and apoplastic fluid than in the xylem sap. A comparison of the proteomes of the three fluids indicates that although functional categories are somewhat similar, proteins involved are likely to be fluid-specific, except for a small group of proteins present in the three fluids, which may have a universal role, especially in cell wall maintenance and defense. This article is part of a Special Issue entitled: Plant Proteomics--a bridge between fundamental processes and crop production, edited by Dr. Hans-Peter Mock.

  18. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false May employees or employers seek a second SAP... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an employee... seek a second SAP's evaluation in order to obtain another recommendation. (b) As an employer, you...

  19. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  20. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  1. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  2. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  3. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  4. Stem sap flow in plants under low gravity conditions

    NASA Astrophysics Data System (ADS)

    Tokuda, Ayako; Hirai, Hiroaki; Kitaya, Yoshiaki

    2016-07-01

    A study was conducted to obtain a fundamental knowledge for plant functions in bio-regenerative life support systems in space. Stem sap flow in plants is important indicators for water transport from roots to atmosphere through leaves. In this study, stem sap flow in sweetpotato was assessed at gravity levels from 0.01 to 2 g for about 20 seconds each during parabolic airplane flights. Stem sap flow was monitored with a heat balance method in which heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by convection with the sap flow through xylems of the vascular tissue. Thermal images of stem surfaces near heated points were captured using infrared thermography and the internal heat convection corresponding to the sap flow was analyzed. In results, the sap flow in stems was suppressed more at lower gravity levels without forced air circulation. No suppression of the stem sap flow was observed with forced air circulation. Suppressed sap flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is essential to culture healthy plants at a high growth rate under low gravity conditions in space.

  5. SAPS onset timing during substorms and the westward traveling surge

    NASA Astrophysics Data System (ADS)

    Mishin, Evgeny, V.

    2016-07-01

    We present multispacecraft observations in the magnetosphere and conjugate ionosphere of the onset time of subauroral polarization streams (SAPS) and tens of keV ring current injections on the duskside in three individual substorms. This is probably the first unequivocal determination of the substorm SAPS onset timing. The time lag between the SAPS and substorm onsets is much shorter than the gradient-curvature drift time of ˜10 keV ions in the plasmasphere. It seemingly depends on the propagation time of substorm-injected plasma from the dipolarization onset region to the plasmasphere, as well as on the SAPS position. These observations suggest that fast onset SAPS and ring current injections are causally related to the two-loop system of the westward traveling surge.

  6. Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity.

    PubMed

    Chen, Shasha; Cai, Chenxu; Li, Zehua; Liu, Guangao; Wang, Yuande; Blonska, Marzenna; Li, Dan; Du, Juan; Lin, Xin; Yang, Meixiang; Dong, Zhongjun

    2017-02-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) mutations in X-linked lymphoproliferative disease (XLP) lead to defective NKT cell development and impaired humoral immunity. Because of the redundancy of SLAM family receptors (SFRs) and the complexity of SAP actions, how SFRs and SAP mediate these processes remains elusive. Here, we examined NKT cell development and humoral immunity in mice completely deficient in SFR. We found that SFR deficiency severely impaired NKT cell development. In contrast to SAP deficiency, SFR deficiency caused no apparent defect in follicular helper T (TFH) cell differentiation. Intriguingly, the deletion of SFRs completely rescued the severe defect in TFH cell generation caused by SAP deficiency, whereas SFR deletion had a minimal effect on the defective NKT cell development in SAP-deficient mice. These findings suggest that SAP-dependent activating SFR signaling is essential for NKT cell selection; however, SFR signaling is inhibitory in SAP-deficient TFH cells. Thus, our current study revises our understanding of the mechanisms underlying T cell defects in patients with XLP.

  7. Assessing Leading ERP-SAP Implementation in Leading Firms in Indonesia

    NASA Astrophysics Data System (ADS)

    Syaiful, B.; Gunawan, W.

    2017-01-01

    Enterprise resource planning (ERP) enables to bring critical capabilities to an organisation, however, the implementation of such capabilities is often surrounded with problems. The implementing ERP-SAP in Indonesian enterprises are still facing tremendous challenges with the failure rate can reach more than 80% of the cases. The article examines the common problems faced by the consultants whenever they deal with their clients, from the practical perspectives. The article takes the multiple case studies of the leading enterprises in Indonesia, such as: KS (largest steel producer), GEM (large mining producer), and HS (large retailer), with the aim to identify the root of problems of SAP implementation. The outcome of the study is expected to provide the consultants with the guideline to understand the ERP implementation process in their clients and effective solutions to cope with it.

  8. Freshwater bryozoa of Tonle Sap, Cambodia.

    PubMed

    Hirose, Masato; Mawatari, Shunsuke F

    2007-06-01

    We identified a collection of freshwater bryozoans from Tonle Sap (meaning Tonle Lake), Cambodia, a body of water fed by the Mekong River and characterized by extreme fluctuations in water level between the wet and dry seasons. The collection also included specimens from the moat of Angkor Wat, located at the north end of the lake. We found four phylactolaemate species (Plumatella bombayensis, Plumatella casmiana, Plumatella vorstmani, Hyalinella lendenfeldi) and one ctenostome species (Hislopia cambodgiensis) from the lake, and only a single, additional phylactolaemate species (Plumatella javanica) from the moat. We provide brief descriptions of these species, photographs of colonies for some, and photomicrographs by light and scanning electron microscopy (SEM) of statoblasts. None of the species encountered in this study is endemic to Cambodia, and the wide distributions of the species are possibly related to the dispersability of floatoblasts by birds. We briefly discuss some of the taxonomic problems surrounding Hislopia cambodgiensis.

  9. Transient response of sap flow to wind speed.

    PubMed

    Chu, Chia R; Hsieh, Cheng-I; Wu, Shen-Yuang; Phillips, Nathan G

    2009-01-01

    Transient responses of sap flow to step changes in wind speed were experimentally investigated in a wind tunnel. A Granier-type sap flow sensor was calibrated and tested in a cylindrical tube for analysis of its transient time response. Then the sensor was used to measure the transient response of a well-watered Pachira macrocarpa plant to wind speed variations. The transient response of sap flow was described using the resistance-capacitance model. The steady sap flow rate increased as the wind speed increased at low wind speeds. Once the wind speed exceeded 8.0 m s(-1), the steady sap flow rate did not increase further. The transpiration rate, measured gravimetrically, showed a similar trend. The response of nocturnal sap flow to wind speed variation was also measured and compared with the results in the daytime. Under the same wind speed, the steady sap flow rate was smaller than that in the daytime, indicating differences between diurnal and nocturnal hydraulic function, and incomplete stomatal closure at night. In addition, it was found that the temporal response of the Granier sensor is fast enough to resolve the transient behaviour of water flux in plant tissue.

  10. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct...

  11. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How will MMS process my SAP? 285.613 Section... MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided... be complex or significant; (2) We will notify you if your submitted SAP lacks any...

  12. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I include in my SAP? 285.610 Section... I include in my SAP? Your SAP must include the following information, as applicable. (a) For all activities you propose to conduct under your SAP, you must provide the following information: ER29AP09.115...

  13. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results...

  14. Sapflow+: a four-needle heat-pulse sap flow sensor enabling nonempirical sap flux density and water content measurements.

    PubMed

    Vandegehuchte, Maurits W; Steppe, Kathy

    2012-10-01

    • To our knowledge, to date, no nonempirical method exists to measure reverse, low or high sap flux density. Moreover, existing sap flow methods require destructive wood core measurements to determine sapwood water content, necessary to convert heat velocity to sap flux density, not only damaging the tree, but also neglecting seasonal variability in sapwood water content. • Here, we present a nonempirical heat-pulse-based method and coupled sensor which measure temperature changes around a linear heater in both axial and tangential directions after application of a heat pulse. By fitting the correct heat conduction-convection equation to the measured temperature profiles, the heat velocity and water content of the sapwood can be determined. • An identifiability analysis and validation tests on artificial and real stem segments of European beech (Fagus sylvatica L.) confirm the applicability of the method, leading to accurate determinations of heat velocity, water content and hence sap flux density. • The proposed method enables sap flux density measurements to be made across the entire natural occurring sap flux density range of woody plants. Moreover, the water content during low flows can be determined accurately, enabling a correct conversion from heat velocity to sap flux density without destructive core measurements.

  15. Sap Flow Sensors: Construction, Quality Control and Comparison

    PubMed Central

    Davis, Tyler W.; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors. PMID:22368504

  16. Sap flow sensors: construction, quality control and comparison.

    PubMed

    Davis, Tyler W; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors.

  17. Variability of sap flow on forest hillslopes: patterns and controls

    NASA Astrophysics Data System (ADS)

    Hassler, Sibylle; Blume, Theresa

    2013-04-01

    Sap flow in trees is an essential variable in integrated studies of hydrologic fluxes. It gives indication of transpiration rates for single trees and, with a suitable method of upscaling, for whole stands. This information is relevant for hydrologic and climate models, especially for the prediction of change in water fluxes in the soil-plant-atmosphere continuum under climate change. To this end, we do not only need knowledge concerning the response of sapflow to atmospheric forcing but also an understanding of the main controls on its spatial variability. Our study site consists of several subcatchments of the Attert basin in Luxembourg underlain by schists of the Ardennes massif. Within these subcatchments we measure sap flow in more than 20 trees on a range of forested hillslopes covered by a variety of temperate deciduous tree species such as beech, oak, hornbeam and maple as well as conifers such as firs. Our sap flow sensors are based on the heat pulse velocity method and consist of three needles, one needle acting as the heating device and the other two holding three thermistors each, enabling us to simultaneously measure sap flow velocity at three different depths within the tree. In close proximity to the trees we collect additional data on soil moisture, matric potential and groundwater levels. First results show that the sensor design seems promising for an upscaling of the measured sap flow velocities to sap flow at the tree level. The maximum depth of actively used sapwood as well as the decrease in sap flow velocity with increasing depth in the tree can be determined by way of the three thermistors. Marked differences in sap flow velocity profiles are visible between the different species, resulting in differences in sap flow for trees of similar diameter. We examine the range of tree sap flow values and variation due to species, size class, slope position and exposition and finally relate them to the dynamics of soil moisture conditions with the

  18. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats

    PubMed Central

    Yakubu, Musa T.; Nurudeen, Quadri O.; Salimon, Saoban S.; Yakubu, Monsurat O.; Jimoh, Rukayat O.; Nafiu, Mikhail O.; Akanji, Musbau A.; Oladiji, Adenike T.; Williams, Felicia E.

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na+-K+-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels. PMID:25893000

  19. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats.

    PubMed

    Yakubu, Musa T; Nurudeen, Quadri O; Salimon, Saoban S; Yakubu, Monsurat O; Jimoh, Rukayat O; Nafiu, Mikhail O; Akanji, Musbau A; Oladiji, Adenike T; Williams, Felicia E

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na(+)-K(+)-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels.

  20. Effect of microgravity on sap flow in plant stems

    NASA Astrophysics Data System (ADS)

    Kitaya, Yoshiaki; Hirai, Hiroaki; Nobol Ikeda, MR..

    2012-07-01

    A fundamental study was conducted to assess the possibility of plant growth suppression caused by poor movement of air in closed plant growth facilities in space farming. Sap water flow in plant stems, which plays an important role to transport fluid and nutrients from roots to leaves, will be suppressed through suppression of transpiration because of little natural convection of air under microgravity conditions. In this study, the sap flow in tomato stems was examined using a heat flow method at 0.01 and 1.0 g for 20 seconds each during parabolic airplane flights in order to clarify the effect of microgravity on the sap flow in stems. Heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by the sap flow through xylems of the vascular tissue. The internal heat convection corresponding to the sap flow was analyzed with thermal images captured on stems near heated points. In results, the sap flow in stems at 0.01 g was suppressed under a retarded air condition at a wind speed of 0.1 m s-1 compared with that at 1 g. No suppression of the sap flow was observed under a stirred air condition at a wind speed of 0.5 m s-1. Suppressed sap water flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is, therefore, essential to culture healthy plants at a high growth rate under microgravity conditions in space.

  1. Limitations in the use of ozone to disinfect maple sap.

    PubMed

    Labbe, R G; Kinsley, M; Wu, J

    2001-01-01

    The sap of the maple sugar tree (Acer saccharum) contains 2 to 3% sucrose and is traditionally collected early in the year and concentrated by boiling to produce maple syrup. High levels of microorganisms in the sap occur during holding, leading to a darker syrup with lower economic value. We investigated the use of dissolved ozone as a method to reduce the microbial population in sap. After 40 min of ozone treatment, concentrations of up to 0.30 mg/liter were achieved but were ineffective in reducing the aerobic plate count. Three predominant colonies on nutrient agar were selected for isolation and identification from sap. These included one mucoid and one nonmucoid yeast, both identified as Candida, and Pseudomonas fluorescens. When suspended in buffer, each was readily inactivated by ozone. Addition of 3% sucrose to the buffer markedly reduced the effectiveness of ozone. With the use of an ozone generator with a larger ozone output, saturating ozone concentrations (1 mg/liter) were achieved within 5 min but were accompanied by only a 1-log reduction in aerobic plate count of maple sap. After 40 min of ozone treatment, a less than 3-log reduction occurred. The results indicate that, because of the presence of sucrose, ozone may be of limited use in reducing the microbial population in sap.

  2. Euphorbia sap keratopathy: four cases and a possible pathogenic mechanism.

    PubMed Central

    Scott, I U; Karp, C L

    1996-01-01

    AIMS: To report four cases of Euphorbia sap causing anterior segment toxicity. METHODS: Medical records of four patients who presented with Euphorbia sap keratoconjunctivitis were reviewed. Clinical findings were compared with previously published reports. RESULTS: All of these patients experienced a similar clinical course. Initial contact with Euphorbia sap caused punctate epitheliopathy; patients noted immediate burning and photophobia, but no visual loss. In all cases, patients experienced epithelial slough with delayed healing, requiring approximately 9 days to heal the epithelial defect. Patients were treated with topical antibiotics, pressure patching or a bandage contact lens, and final visual acuities were excellent in all cases. A review of the literature revealed that Euphorbia sap contains a diterpenoid diester which exhibits antineoplastic activity in rodents. CONCLUSIONS: Individuals who work with Euphorbia plants should be cautioned to wear eye protection. Patients with Euphorbia sap anterior segment toxicity should be informed that their condition may worsen initially, but that visual outcome is generally excellent. The progressive corneal epithelial sloughing and delayed corneal epithelial healing may be secondary to the antineoplastic effects of Euphorbia sap. Images PMID:8942380

  3. Validation of the scale on Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S)

    PubMed Central

    Khadra, Christelle; Le May, Sylvie; Ballard, Ariane; Théroux, Jean; Charette, Sylvie; Villeneuve, Edith; Parent, Stefan; Tsimicalis, Argerie; MacLaren Chorney, Jill

    2017-01-01

    Background Spinal fusion is a common orthopedic surgery in children and adolescents and is associated with high pain levels postoperatively. If the pain is not well managed, negative outcomes may ensue. To our knowledge, there is no measure in English that assesses patient’s satisfaction with postoperative pain management following idiopathic scoliosis surgery. The aim of the present study was to assess the psychometric properties of the satisfaction subscale of the English version of the Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S) scale. Methods Eighty-two participants aged 10–18 years, who had undergone spinal fusion surgery, fully completed the SAP-S scale at 10–14 days postdischarge. Construct validity was assessed through a principal component analysis using varimax rotation. Results Principal component analysis indicated a three-factor structure of the 13-item satisfaction subscale of the SAP-S scale. Factors referred to satisfaction regarding current medication received (Factor 1), actions taken by nurses and doctors to manage pain (Factor 2) and information received after surgery (Factor 3). Cronbach’s alpha was 0.91, showing very good internal consistency. Data on satisfaction and clinical outcomes were also reported. Conclusion The SAP-S is a valid and reliable measure of satisfaction with postoperative pain management that can be used in both research and clinical settings to improve pain management practices. Although it was developed and validated with adolescents who had undergone spinal fusion surgery, it can be used, with further validation, to assess adolescents’ satisfaction with pain management in other postoperative contexts. PMID:28138264

  4. Accumulation and conversion of sugars by developing wheat grains. VII. Effect of changes in sieve tube and endosperm cavity sap concentrations on the grain filling rate. [Triticum aestivum

    SciTech Connect

    Fisher, D.B.; Gifford, R.M.

    1987-06-01

    The extent to which wheat grain growth is dependent on transport pool solute concentration was investigated by the use of illumination and partial grain removal to vary solute concentrations in the sieve tube and endosperm cavity saps of the wheat ear (Triticum aestivum L.). Short-term grain growth rates were estimated indirectly from the product of phloem area, sieve tube sap concentration, and /sup 32/P translocation velocity. On a per grain basis, calculated rates of mass transport through the peduncle were fairly constant over a substantial range in other transport parameters (i.e. velocity, concentration, phloem area, and grain number). The rates were about 40% higher than expected; this probably reflects some unavoidable bias on faster-moving tracer in the velocity estimates. Sieve tube sap concentration increased in all experiments (by 20 to 64%), with a concomitant decline in velocity (to as low as 8% of the initial value). Endosperm cavity sucrose concentration also increased in all experiments, but cavity sap osmolality and total amino acid concentration remained nearly constant. No evidence was found for an increase in the rate of mass transport per grain through the peduncle in response to the treatments. This apparent unresponsiveness of grain growth rate to increased cavity sap sucrose concentration conflicts with earlier in vitro endosperm studies showing that sucrose uptake increased with increasing external sucrose concentration up to 150 to 200 millimolar.

  5. A Novel Putrescine Exporter SapBCDF of Escherichia coli.

    PubMed

    Sugiyama, Yuta; Nakamura, Atsuo; Matsumoto, Mitsuharu; Kanbe, Ayaka; Sakanaka, Mikiyasu; Higashi, Kyohei; Igarashi, Kazuei; Katayama, Takane; Suzuki, Hideyuki; Kurihara, Shin

    2016-12-16

    Recent research has suggested that polyamines (putrescine, spermidine, and spermine) in the intestinal tract impact the health of animals either negatively or positively. The concentration of polyamines in the intestinal tract results from the balance of uptake and export of the intestinal bacteria. However, the mechanism of polyamine export from bacterial cells to the intestinal lumen is still unclear. In Escherichia coli, PotE was previously identified as a transporter responsible for putrescine excretion in an acidic growth environment. We observed putrescine concentration in the culture supernatant was increased from 0 to 50 μm during growth of E. coli under neutral conditions. Screening for the unidentified putrescine exporter was performed using a gene knock-out collection of E. coli, and deletion of sapBCDF significantly decreased putrescine levels in the culture supernatant. Complementation of the deletion mutant with the sapBCDF genes restored putrescine levels in the culture supernatant. Additionally, the ΔsapBCDF strain did not facilitate uptake of putrescine from the culture supernatant. Quantification of stable isotope-labeled putrescine derived from stable isotope-labeled arginine supplemented in the medium revealed that SapBCDF exported putrescine from E. coli cells to the culture supernatant. It was previously reported that SapABCDF of Salmonella enterica sv. typhimurium and Haemophilus influenzae conferred resistance toantimicrobial peptides; however, the E. coli ΔsapBCDF strain did not affect resistance to antimicrobial peptide LL-37. These results strongly suggest that the natural function of the SapBCDF proteins is the export of putrescine.

  6. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (IBM VERSION)

    NASA Technical Reports Server (NTRS)

    Manteufel, R.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  7. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (DEC VAX VERSION)

    NASA Technical Reports Server (NTRS)

    Merwarth, P. D.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  8. Adulteration and Contamination of Commercial Sap of Hymenaea Species.

    PubMed

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; Dos Santos, Edson Dos Anjos; Chang, Marilene Rodrigues; Carollo, Carlos Alexandre

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as "jatobá," produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700-100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population.

  9. SAPFLUXNET: towards a global database of sap flow measurements.

    PubMed

    Poyatos, Rafael; Granda, Víctor; Molowny-Horas, Roberto; Mencuccini, Maurizio; Steppe, Kathy; Martínez-Vilalta, Jordi

    2016-12-01

    Plant transpiration is the main evaporative flux from terrestrial ecosystems; it controls land surface energy balance, determines catchment hydrological responses and influences regional and global climate. Transpiration regulation by plants is a key (and still not completely understood) process that underlies vegetation drought responses and land evaporative fluxes under global change scenarios. Thermometric methods of sap flow measurement have now been widely used to quantify whole-plant and stand transpiration in forests, shrublands and orchards around the world. A large body of research has applied sap flow methods to analyse seasonal and diurnal patterns of transpiration and to quantify their responses to hydroclimatic variability, but syntheses of sap flow data at regional to global scales are extremely rare. Here we present the SAPFLUXNET initiative, aimed at building the first global database of plant-level sap flow measurements. A preliminary metadata survey launched in December 2015 showed an encouraging response by the sap flow community, with sap flow data sets from field studies representing >160 species and >120 globally distributed sites. The main goal of SAPFLUXNET is to analyse the ecological factors driving plant- and stand-level transpiration. SAPFLUXNET will open promising research avenues at an unprecedented global scope, namely: (i) exploring the spatio-temporal variability of plant transpiration and its relationship with plant and stand attributes, (ii) summarizing physiological regulation of transpiration by means of few water-use traits, usable for land surface models, (iii) improving our understanding of the coordination between gas exchange and plant-level traits (e.g., hydraulics) and (iv) analysing the ecological factors controlling stand transpiration and evapotranspiration partitioning. Finally, SAPFLUXNET can provide a benchmark to test models of physiological controls of transpiration, contributing to improve the accuracy of

  10. Comparative Statistical Study of Some SAP UI Technologies

    NASA Astrophysics Data System (ADS)

    Berdie, Adela; Osaci, Mihaela; Dan Lemle, Ludovic

    2011-09-01

    The goal of this paper is to present a comparative study on some web UI (User Interface) technologies that involve the creation of web applications on the platform SAP Net Weaver AS 7.01 of the integrated SAP (System Application Products) system. The attention will be directed mainly to the ABAP (Advanced Business Application Programing) development environment and to the Web Dynpro (WD) technologies, Floor Plan Manager (FPM) and Web Client UI. Through this study, we make an assesment regarding the decision of choosing a technology for the realisation of a project which consists of a web application.

  11. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  12. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your...

  13. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  14. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  15. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  16. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  17. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  18. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  19. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Commercial Leases § 285.605 What is a Site Assessment Plan (SAP)? (a) A SAP describes the activities (e.g... your commercial lease, including your project easement, or to test technology devices. (1) Your...

  20. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How do I submit my SAP? 285.607 Section 285.607... Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  1. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct...

  2. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  3. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  4. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  5. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  6. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  7. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  8. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting...

  9. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND ENFORCEMENT... Commercial Leases § 285.606 What must I demonstrate in my SAP? (a) Your SAP must demonstrate that you...

  10. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  11. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if...

  12. Control of Vascular Sap pH by the Vessel-Associated Cells in Woody Species (Physiological and Immunological Studies).

    PubMed Central

    Fromard, L.; Babin, V.; Fleurat-Lessard, P.; Fromont, J. C.; Serrano, R.; Bonnemain, J. L.

    1995-01-01

    In Robinia wood, the vessel-associated cells form a continuous sleeve around the vessels. Variations in pH of the solution perfused through the vessels during the annual cycle and the opposing effects of carbonyl cyanide-m-chlorophenylhydrazone and fusicoccin on this pH value indicate that some living cells of the wood are involved in the control of vascular sap pH and that this control fluctuates with the seasons. The immunolocalization of the plasma membrane HT+-ATPase in Robinia wood was studied by the immunogold-silver-staining technique using an antibody raised against a conserved stretch of the cytoplasmic domain of the H+-ATPase. The immunostaining is much stronger in vessel-associated cells than in other living cell types (ray and axial parenchyma elements) of the secondary xylem. Our data show an efficient involvement of this cell type in the control of vascular sap pH. PMID:12228516

  13. Interactive ion-mediated sap flow regulation in olive and laurel stems: physicochemical characteristics of water transport via the pit structure.

    PubMed

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants.

  14. Interactive Ion-Mediated Sap Flow Regulation in Olive and Laurel Stems: Physicochemical Characteristics of Water Transport via the Pit Structure

    PubMed Central

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants. PMID:24852943

  15. Faculty Performance Evaluation: The CIPP-SAPS Model.

    ERIC Educational Resources Information Center

    Mitcham, Maralynne

    1981-01-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-imput-process-product) model is introduced and its development into a CIPP-SAPS (self-administrative-peer- student) model is pursued. (Author/CT)

  16. Response of Sap-Flow Measurements on Environmental Forcings

    NASA Astrophysics Data System (ADS)

    Howe, J. A.; Dragoni, D.; Schmid, H.

    2005-05-01

    The exchange of water between the atmosphere and biosphere is an important determinant of climate and the productivity of vegetation. Both evaporation and transpiration involve substantial amounts of energy exchange at the interface of the biosphere and atmosphere. Knowing how transpiration changes throughout the seasonal and diurnal cycles can help increase the understanding of how a forest reacts to changes in the biosphere and atmosphere. A common way to estimate transpiration is by measuring the sap flowing through the living tissues of trees. A study was conducted at Morgan-Monroe State Forest, a mixed deciduous forest in south central Indiana (USA), to investigate how sap flow in trees responds to changes in meteorological and environmental conditions. The heat -dissipation technique was used to estimate sap velocities from two Big Tooth Aspen (Populus grandidentata) and two Tulip Poplars (Liriodendron tulipifera). Sap velocity patterns (normalized by a reference potential evapo-transpiration) were directly compared with meteorological and ecological measurements, such as vapor pressure deficits, photosynthetic active radiation (PAR), rain fall, and soil moisture content. In this study, we also investigated the uncertainties and problems that arise in using the heat dissipation technique to extrapolate the single-tree measurements to the forest scale.

  17. Accounting Control Technology Using SAP: A Case-Based Approach

    ERIC Educational Resources Information Center

    Ragan, Joseph; Puccio, Christopher; Talisesky, Brandon

    2014-01-01

    The Sarbanes-Oxley Act (SOX) revolutionized the accounting and audit industry. The use of preventative and process controls to evaluate the continuous audit process done via an SAP ERP ECC 6.0 system is key to compliance with SOX and managing costs. This paper can be used in a variety of ways to discuss issues associated with auditing and testing…

  18. On the Relationship of SAPS to Storm-Enhanced Density

    DTIC Science & Technology

    2007-01-01

    Journal of Atmospheric and Solar - Terrestrial Physics , 69, (2007) © 2007 Elsevier Science B.V. *Massachusetts...TERRESTRIALPHYSICS ELSEVIER Journal of Atmospheric and Solar - Terrestrial Physics 69 (2007) 303--313 www.elevier.comlIocate/jastp 0o On the relationship of SAPS to...2006.07.021 304 J. C Foster et al. / Journal of " Atmospheric and Solar - Terrestrial

  19. Gravity like forces in sap conducting tissue in plants.

    NASA Astrophysics Data System (ADS)

    Wagner, Orvin

    2007-04-01

    I used miniature brass shielded Entran accelerometers in small holes in tree tissue to measure forces (penetrating the brass shield) in the direction of sap flow. These forces increased with sap flow up to 22% of gravity magnitude. It is assumed that measured forces would have been larger except for the presence of the distorting hole. These forces were measured in horizontal roots and vertical trunks (here a gravity decrease). Distances of mm. between the tissue and the accelerometer, over which the measured forces acted, could only be compared to gravity. The force's penetration of the brass shield also indicates gravity like forces. See e.g. Physiol. Chem. Phys. & Med. NMR (1995) 27: 31-34 and other publications of the author. The present generally presented controversial explanation of sap flow up tall trees apparently needs modification. Plant produced forces provide an incredible alternative. The macroscopic behavior of plants has so far been mostly ignored by physicists. The study of plants may answer some fundamental questions about gravity. (Earlier observations of weight loss in hanging weights in sap conducting tissue in bent trees led to the above work).

  20. SAP suppresses the development of experimental autoimmune encephalomyelitis in C57BL/6 mice.

    PubMed

    Ji, Zhe; Ke, Zun-Ji; Geng, Jian-Guo

    2012-04-01

    Experimental autoimmune encephalomyelitis (EAE) is a CD4(+) T cell-mediated disease of the central nervous system. Serum amyloid P component (SAP) is a highly conserved plasma protein named for its universal presence in amyloid deposits. Here we report that SAP-transgenic mice had unexpectedly attenuated EAE due to impaired encephalitogenic responses. Following induction with myelin oligodendroglial glycoprotein (MOG) peptide 35-55 in complete Freund's adjuvant, SAP-transgenic mice showed reduced spinal cord inflammation with lower severity of EAE attacks as compared with control C57BL/6 mice. However, in SAP-Knockout mice, the severity of EAE is enhanced. Adoptive transfer of Ag-restimulated T cells from wild type to SAP-transgenic mice, or transfer of SAP-transgenic Ag-restimulated T cells to control mice, induced milder EAE. T cells from MOG-primed SAP-transgenic mice showed weak proliferative responses. Furthermore, in SAP-transgenic mice, there is little infiltration of CD45-positive cells in the spinal cord. In vitro, SAP suppressed the secretion of interleukin-2 stimulated by P-selectin and blocked P-selectin binding to T cells. Moreover, SAP could change the affinity between α4-integrin and T cells. These data suggested that SAP could antagonize the development of the acute phase of inflammation accompanying EAE by modulating the function of P-selectin.

  1. SAP modulates B cell functions in a genetic background-dependent manner.

    PubMed

    Detre, Cynthia; Yigit, Burcu; Keszei, Marton; Castro, Wilson; Magelky, Erica M; Terhorst, Cox

    2013-06-01

    Mutations affecting the SLAM-associated protein (SAP) are responsible for the X-linked lympho-proliferative syndrome (XLP), a severe primary immunodeficiency syndrome with disease manifestations that include fatal mononucleosis, B cell lymphoma and dysgammaglobulinemia. It is well accepted that insufficient help by SAP-/- CD4+ T cells, in particular during the germinal center reaction, is a component of dysgammaglobulinemia in XLP patients and SAP-/- animals. It is however not well understood whether in XLP patients and SAP-/- mice B cell functions are affected, even though B cells themselves do not express SAP. Here we report that B cell intrinsic responses to haptenated protein antigens are impaired in SAP-/- mice and in Rag-/- mice into which B cells derived from SAP-/- mice together with wt CD4+ T cells had been transferred. This impaired B cells functions are in part depending on the genetic background of the SAP-/- mouse, which affects B cell homeostasis. Surprisingly, stimulation with an agonistic anti-CD40 causes strong in vivo and in vitro B cell responses in SAP-/- mice. Taken together, the data demonstrate that genetic factors play an important role in the SAP-related B cell functions. The finding that anti-CD40 can in part restore impaired B cell responses in SAP-/- mice, suggests potentially novel therapeutic interventions in subsets of XLP patients.

  2. Serum Amyloid P Component (SAP) Interactome in Human Plasma Containing Physiological Calcium Levels.

    PubMed

    Poulsen, Ebbe Toftgaard; Pedersen, Kata Wolff; Marzeda, Anna Maria; Enghild, Jan J

    2017-02-14

    The pentraxin serum amyloid P component (SAP) is secreted by the liver and found in plasma at a concentration of approximately 30 mg/L. SAP is a 25 kDa homopentamer known to bind both protein and nonprotein ligands, all in a calcium-dependent manner. The function of SAP is unclear but likely involves the humoral innate immune system spanning the complement system, inflammation, and coagulation. Also, SAP is known to bind to the generic structure of amyloid deposits and possibly to protect them against proteolysis. In this study, we have characterized the SAP interactome in human plasma containing the physiological Ca(2+) concentration using SAP affinity pull-down and co-immunoprecipitation experiments followed by mass spectrometry analyses. The analyses resulted in the identification of 33 proteins, of which 24 were direct or indirect interaction partners not previously reported. The SAP interactome can be divided into categories that include apolipoproteins, the complement system, coagulation, and proteolytic regulation.

  3. NuSAP governs chromosome oscillation by facilitating the Kid-generated polar ejection force.

    PubMed

    Li, Chenyu; Xue, Chenyi; Yang, Qiaoyun; Low, Boon Chuan; Liou, Yih-Cherng

    2016-02-03

    In vertebrate cells, chromosomes oscillate to align precisely during metaphase. NuSAP, a microtubule-associated protein, plays a critical role in stabilizing spindle microtubules. In this study, we utilize 3D time-lapse live-cell imaging to monitor the role of NuSAP in chromosome oscillation and identify NuSAP as a novel regulator of the chromokinesin, Kid. Depletion of NuSAP significantly suppresses the amplitude and velocity of chromosome oscillation. We analyse the effects of NuSAP and Kid depletion in monopolar and bipolar cells with or without kinetochore microtubule depletion. Twelve postulated conditions are deciphered to reveal the contribution of NuSAP to the polar force generated at kinetochore microtubules and to the regulation of the polar ejection force generated by Kid, thus revealing a pivotal role of NuSAP in chromosome oscillation.

  4. The FORTRAN static source code analyzer program (SAP) user's guide, revision 1

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Eslinger, S.

    1982-01-01

    The FORTRAN Static Source Code Analyzer Program (SAP) User's Guide (Revision 1) is presented. SAP is a software tool designed to assist Software Engineering Laboratory (SEL) personnel in conducting studies of FORTRAN programs. SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. This document is a revision of the previous SAP user's guide, Computer Sciences Corporation document CSC/TM-78/6045. SAP Revision 1 is the result of program modifications to provide several new reports, additional complexity analysis, and recognition of all statements described in the FORTRAN 77 standard. This document provides instructions for operating SAP and contains information useful in interpreting SAP output.

  5. Measurement and modelling of sap flow in maize plants

    NASA Astrophysics Data System (ADS)

    Heinlein, Florian; Biernath, Christian; Hoffmann, Peter; Klein, Christian; Thieme, Christoph; Priesack, Eckart

    2014-05-01

    Climate change as well as the changing composition of the atmosphere will have an impact on future yield of agricultural plants. In order to better estimate these impacts new, mechanistic plant growth models are needed. These models should be able to dynamically reproduce the plants' reactions to modified climate state variables like temperature, atmospheric CO2-concentration and water availability. In particular, to better describe the crop response to more strongly changing water availability the simulation of plant-internal water and solute transport processes in xylem and phloem needs to be improved. Our existing water transport model consists of two coupled 1-D Richards equations to calculate water transport in the soil and in the plants. This model has already been successfully applied to single Fagus sylvatica L. trees. At present it is adapted to agricultural plants such as maize. To simulate the water transport within the plants a representation of the flow paths, i.e. the plant architecture, is required. Aboveground plant structures are obtained from terrestrial laser scan (TLS) measurements at different development stages. These TLSs have been executed at the lysimeter facilities of Helmholtz Zentrum München and at the TERENO (Terrestrial Environmental Observatories) research farm Scheyern. Additionally, an L-system model is used to simulate aboveground and belowground plant architectures. In a further step, the quality of the explicit water flow model has to be tested using measurements. The Heat-Ratio-Method has been employed to directly measure sap flow in larger maize plants during a two-months-period in summer 2013 with a resolution of 10 minutes and thus, the plants' transpiration can be assessed. Water losses from the soil are determined by measuring the weight of lysimeters. From this evapotranspiration can be calculated. Transpiration and evapotranspiration are also simulated by application of the modelling system Expert-N. This framework

  6. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What activities require a revision to my SAP... Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS... your approved SAP, describing in detail the type of activities you propose to conduct. We...

  7. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis.

    PubMed

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha; Edgerton, Mira

    2015-07-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis.

  8. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis

    PubMed Central

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha

    2015-01-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis. PMID:25870228

  9. Sap flow measurements combining sap-flux density radial profiles with punctual sap-flux density measurements in oak trees (Quercus ilex and Quercus pyrenaica) - water-use implications in a water-limited savanna-

    NASA Astrophysics Data System (ADS)

    Reyes, J. Leonardo; Lubczynski1, Maciek W.

    2010-05-01

    Sap flow measurement is a key aspect for understanding how plants use water and their impacts on the ecosystems. A variety of sensors have been developed to measure sap flow, each one with its unique characteristics. When the aim of a research is to have accurate tree water use calculations, with high temporal and spatial resolution (i.e. scaled), a sensor with high accuracy, high measurement efficiency, low signal-to-noise ratio and low price is ideal, but such has not been developed yet. Granier's thermal dissipation probes (TDP) have been widely used in many studies and various environmental conditions because of its simplicity, reliability, efficiency and low cost. However, it has two major flaws when is used in semi-arid environments and broad-stem tree species: it is often affected by high natural thermal gradients (NTG), which distorts the measurements, and it cannot measure the radial variability of sap-flux density in trees with sapwood thicker than two centimeters. The new, multi point heat field deformation sensor (HFD) is theoretically not affected by NTG, and it can measure the radial variability of the sap flow at different depths. However, its high cost is a serious limitation when simultaneous measurements are required in several trees (e.g. catchment-scale studies). The underlying challenge is to develop a monitoring schema in which HFD and TDP are combined to satisfy the needs of measurement efficiency and accuracy in water accounting. To assess the level of agreement between TDP and HFD methods in quantifying sap flow rates and temporal patterns on Quercus ilex (Q.i ) and Quercus pyrenaica trees (Q.p.), three measurement schemas: standard TDP, TDP-NTG-corrected and HFD were compared in dry season at the semi-arid Sardon area, near Salamanca in Spain in the period from June to September 2009. To correct TDP measurements with regard to radial sap flow variability, a radial sap flux density correction factor was applied and tested by adjusting TDP

  10. Visualization of scattering angular distributions with the SAP code

    NASA Astrophysics Data System (ADS)

    Fernandez, J. E.; Scot, V.; Basile, S.

    2010-07-01

    SAP (Scattering Angular distribution Plot) is a graphical tool developed at the University of Bologna to compute and plot Rayleigh and Compton differential cross-sections (atomic and electronic), form-factors (FFs) and incoherent scattering functions (SFs) for single elements, compounds and mixture of compounds, for monochromatic excitation in the range of 1-1000 keV. The computation of FFs and SFs may be performed in two ways: (a) by interpolating Hubbell's data from EPDL97 library and (b) by using semi-empirical formulas as described in the text. Two kinds of normalization permit to compare the plots of different magnitudes, by imposing a similar scale. The characteristics of the code SAP are illustrated with one example.

  11. Zn and Cu complexes with glutathione in ricinis phloem sap

    SciTech Connect

    Albrigo, L.G.; Taylor, K.C. )

    1989-04-01

    To characterize phloem Cu and Zn carriers, phloem sap was collected from native stands of Ricinis communis. The sap was separated by DEAE-Sephadex ion exchange chromatography. Two peaks were resolved from subsequent Zorbax CN-HPLC (isocratic elution: 0.25% MeOH, 0.025% TFA). Both peaks contained Cu and Zn. Further assessment by Mono Q-FPLC showed that these peaks were approximately 90% homogeneous, with similar retention times. The amino acid compositions of the HPLC eluted Cu- and Zn-containing fractions were determined. Both peaks contained glutathione (cysteic acid: glutamic acid: glycine, 1:1:1). Further work is underway to verify a complexing association of these metals with glutathione.

  12. Environmental controls on sap flow in a northern hardwood forest.

    PubMed

    Bovard, B D; Curtis, P S; Vogel, C S; Su, H-B; Schmid, H P

    2005-01-01

    Our objective was to gain a detailed understanding of how photosynthetically active radiation (PAR), vapor pressure deficit (D) and soil water interact to control transpiration in the dominant canopy species of a mixed hardwood forest in northern Lower Michigan. An improved understanding of how these environmental factors affect whole-tree water use in unmanaged ecosystems is necessary in assessing the consequences of climate change on the terrestrial water cycle. We used continuously heated sap flow sensors to measure transpiration in mature trees of four species during two successive drought events. The measurements were scaled to the stand level for comparison with eddy covariance estimates of ecosystem water flux (Fw). Photosynthetically active radiation and D together explained 82% of the daytime hourly variation in plot-level transpiration, and low soil water content generally resulted in increased stomatal sensitivity to increasing D. There were also species-specific responses to drought. Quercus rubra L. showed low water use during both dry and wet conditions, and during periods of high D. Among the study species, Acer rubrum L. showed the greatest degree of stomatal closure in response to low soil water availability. Moderate increases in stomatal sensitivity to D during dry periods were observed in Populus grandidentata Michx. and Betula papyrifera Marsh. Sap flow scaled to the plot level and Fw demonstrated similar temporal patterns of water loss suggesting that the mechanisms controlling sap flow of an individual tree also control ecosystem evapotranspiration. However, the absolute magnitude of scaled sap flow estimates was consistently lower than Fw. We conclude that species-specific responses to PAR, D and soil water content are key elements to understanding current and future water fluxes in this ecosystem.

  13. p53 contributes to T cell homeostasis through the induction of pro-apoptotic SAP.

    PubMed

    Madapura, Harsha S; Salamon, Daniel; Wiman, Klas G; Lain, Sonia; Klein, George; Klein, Eva; Nagy, Noémi

    2012-12-15

    Lack of functional SAP protein, due to gene deletion or mutation, is the cause of X-linked lymphoproliferative disease (XLP), characterized by functionally impaired T and NK cells and a high risk of lymphoma development. We have demonstrated earlier that SAP has a pro-apoptotic function in T and B cells. Deficiency of this function might contribute to the pathogenesis of XLP. We have also shown that SAP is a target of p53 in B cell lines. In the present study, we show that activated primary T cells express p53, which induces SAP expression. p53 is functional as a transcription factor in activated T cells and induces the expression of p21, PUMA and MDM2. PARP cleavage in the late phase of activation indicates that T cells expressing high levels of SAP undergo apoptosis. Modifying p53 levels using Nutlin-3, which specifically dissociates the MDM2-p53 interaction, was sufficient to upregulate SAP expression, indicating that SAP is a target of p53 in T cells. We also demonstrated p53's role as a transcription factor for SAP in activated T cells by ChIP assays. Our result suggests that p53 contributes to T cell homeostasis through the induction of the pro-apoptotic SAP. A high level of SAP is necessary for the activation-induced cell death that is pivotal in termination of the T cell response.

  14. Effects of antifungal agents in sap activity of Candida albicans isolates.

    PubMed

    Costa, Carolina Rodrigues; Jesuíno, Rosália Santos Amorim; de Aquino Lemos, Janine; de Fátima Lisboa Fernandes, Orionalda; Hasimoto e Souza, Lúcia Kioko; Passos, Xisto Sena; do Rosário Rodrigues Silva, Maria

    2010-02-01

    Some antifungal agents have shown to exert effects on expression of virulent factors of Candida as the production of secretory aspartyl proteinase (Sap). In this study, we sought to determine and to compare the influence of fluconazole and voriconazole in proteinase activity of this microorganism. Thirty-one isolates obtained from oral mucosa of human immunodeficiency virus positive (HIV) patients were used in this study. The minimal inhibitory concentrations (MIC) of fluconazole and voriconazole were determined using the broth microdilution method with RPMI 1640 medium and with yeast carbon base-bovine serum albumin (YCB-BSA) medium. The Sap activity following by digestion of BSA as substrate was determined for four Candida albicans strains arbitrarily chosen according to susceptibility (susceptible or resistant) to fluconazole or voriconazole. Besides, the SAP1 to SAP7 genes were screened by PCR for the same isolates that were determined by the Sap activity. In vitro susceptibility testing using the two media presented similar MIC values. Increased Sap activity was observed in resistant isolates on presence of drugs, but the Sap activity by susceptible isolates to azoles showed different behavior on the presence of drug. We detected the presence of SAP1 to SAP7 genes from all susceptible or resistant C. albicans isolates. The present study provides important data about the proteinase activity and the presence of genes of SAP family in fluconazole and voriconazole susceptible or resistant C. albicans isolates.

  15. SapC-DOPS Nanovesicles as Targeted Therapy for Lung Cancer

    PubMed Central

    Zhao, Shuli; Chu, Zhengtao; Blanco, Victor M.; Nie, Yunzhong; Hou, Yayi; Qi, Xiaoyang

    2014-01-01

    Lung cancer is the deadliest type of cancer for both men and women. In this study, we evaluate the in vitro and in vivo efficacy of a biotherapeutic agent composed of a lysosomal protein (Saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) which can be assembled into nanovesicles (SapC-DOPS) with selective antitumor activity. SapC-DOPS targets phosphatidylserine, an anionic phospholipid preferentially exposed in the surface of cancer cells and tumor-associated vasculature. Since binding of SapC to phosphatidylserine is favored at acidic pHs, and the latter characterizes the milieu of many solid tumors, we tested the effect of pH on the binding capacity of SapC-DOPS to lung tumor cells. Results showed that SapC-DOPS binding to cancer cells was more pronounced at low pH. Viability assays on a panel of human lung tumor cells showed that SapC-DOPS cytotoxicity was positively correlated with cell surface phosphatidylserine levels, whereas mitochondrial membrane potential measurements were consistent with apoptosis-related cell death. Using a fluorescence tracking method in live mice, we show that SapC-DOPS specifically targets human lung cancer xenografts, and that systemic therapy with SapC-DOPS induces tumor apoptosis and significantly inhibits tumor growth. These results suggest that SapC-DOPS nanovesicles are a promising treatment option for lung cancer. PMID:25670331

  16. Maple sap uptake, exudation, and pressure changes correlated with freezing exotherms and thawing endotherms.

    PubMed

    Tyree, M T

    1983-10-01

    Sap flow rates and sap pressure changes were measured in dormant sugar maple trees (Acer saccharum Marsh.). In the forest, sap flow rates and pressure changes were measured from tap holes drilled into tree trunks in mature trees and sap flow rates were measured from the base of excised branches. Excised branches were also brought into the laboratory where air temperature could be carefully controlled in a refrigerated box and sap flow rates and sap pressures were measured from the cut base of the branches.Under both forest and laboratory conditions, sap uptake occurred as the wood temperature declined but much more rapid sap uptake correlated with the onset of the freezing exotherm. When sap pressures were measured under conditions of negligible volume displacement, the sap pressure rapidly fell to -60 to -80 kilopascals at the start of the freezing exotherm. The volume of water uptake and the rate of uptake depended on the rate of freezing. A slow freezing rate correlated with a large volume of water uptake, a fast freezing rate induced a smaller volume of water uptake. The volume of water uptake ranged from 0.02 to 0.055 grams water per gram dry weight of sapwood. The volume of water exuded after thawing was usually less than the volume of uptake so that after several freezing and thawing cycles the sapwood water content increased from 0.7 to 0.8 grams water per gram dry weight.These results are discussed in terms of a physical model of the mechanism of maple sap uptake and exudation first proposed by P. E. R. O'Malley. The proposed mechanism of sap uptake is by vapor distillation in air filled wood fiber lumina during the freezing of minor branches. Gravity and pressurized air bubbles (compressed during freezing) cause sap flow from the canopy down the tree after the thaw.

  17. Sap phytochemical compositions of some bananas in Thailand.

    PubMed

    Pothavorn, Pongsagon; Kitdamrongsont, Kasipong; Swangpol, Sasivimon; Wongniam, Siripope; Atawongsa, Kanokporn; Savasti, Jisnuson; Somana, Jamorn

    2010-08-11

    Banana sap has some special properties relating to various phenomena such as browning of fruits after harvesting, permanent staining of cloth and fibers, and antioxidant and antibleeding properties. Analysis of banana sap using high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) indicated the presence of phenolic and aromatic amino compounds of interest due to their special properties. With the online positive electrospray ionization mode (ESI), the possible structures of specific compounds were determined from the fragmentation patterns of each particular ion appearing in the mass spectra. The major compounds revealed from the sap of banana accessions, namely, Musa balbisiana , Musa laterita , Musa ornata , and Musa acuminata , and some cultivars were apigenin glycosides, myricetin glycoside, myricetin-3-O-rutinoside, naringenin glycosides, kaempferol-3-O-rutinoside, quercetin-3-O-rutinoside, dopamine, and N-acetylserotonin. The results indicated that there was a variety of phenolic and aromatic amino contents in many banana species. These compounds were reported to relate with biological activities. Moreover, the identities of these phytochemical compositions may be used as markers for banana diet, the assessment of physiochemical status, or the classification of banana clones.

  18. Adulteration and Contamination of Commercial Sap of Hymenaea Species

    PubMed Central

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; dos Santos, Edson dos Anjos; Chang, Marilene Rodrigues

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as “jatobá,” produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700–100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population. PMID:28303155

  19. Sap flow and sugar transport in plants

    NASA Astrophysics Data System (ADS)

    Jensen, K. H.; Berg-Sørensen, K.; Bruus, H.; Holbrook, N. M.; Liesche, J.; Schulz, A.; Zwieniecki, M. A.; Bohr, T.

    2016-07-01

    Green plants are Earth's primary solar energy collectors. They harvest the energy of the Sun by converting light energy into chemical energy stored in the bonds of sugar molecules. A multitude of carefully orchestrated transport processes are needed to move water and minerals from the soil to sites of photosynthesis and to distribute energy-rich sugars throughout the plant body to support metabolism and growth. The long-distance transport happens in the plants' vascular system, where water and solutes are moved along the entire length of the plant. In this review, the current understanding of the mechanism and the quantitative description of these flows are discussed, connecting theory and experiments as far as possible. The article begins with an overview of low-Reynolds-number transport processes, followed by an introduction to the anatomy and physiology of vascular transport in the phloem and xylem. Next, sugar transport in the phloem is explored with attention given to experimental results as well as the fluid mechanics of osmotically driven flows. Then water transport in the xylem is discussed with a focus on embolism dynamics, conduit optimization, and couplings between water and sugar transport. Finally, remarks are given on some of the open questions of this research field.

  20. Groundwater sapping channels: Summary of effects of experiments with varied stratigraphy

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig; Simmons, David W.

    1987-01-01

    Experiments in the recirculating flume sapping box have modeled valley formation by groundwater sapping processes in a number of settings. The effects of the following parameters on sapping channel morphology were examined: surface slope; stratigraphic variations in permeability cohesion and dip; and structure of joints and dikes. These kinds of modeling experiments are particularly good for: testing concepts; developing a suite of distinctive morphologies and morphometries indicative of sapping; helping to relate process to morphology; and providing data necessary to assess the relative importance of runoff, sapping, and mass wasting processes on channel development. The observations from the flume systems can be used to help interpret features observed in terrestrial and Martian settings where sapping processes are thought to have played an important role in the development of valley networks.

  1. Phosphorylated SAP155, the spliceosomal component, is localized to chromatin in postnatal mouse testes

    SciTech Connect

    Eto, Ko; Sonoda, Yoshiyuki; Jin, Yuji; Abe, Shin-ichi

    2010-03-19

    SAP155 is an essential component of the spliceosome and its phosphorylation is required for splicing catalysis, but little is known concerning its expression and regulation during spermatogenesis in postnatal mouse testes. We report that SAP155 is ubiquitously expressed in nuclei of germ and Sertoli cells within the seminiferous tubules of 6- and 35-day postpartum (dpp) testes. Analyses by fractionation of testes revealed that (1) phosphorylated SAP155 was found in the fraction containing nuclear structures at 6 dpp in amounts much larger than that at other ages; (2) non-phosphorylated SAP155 was detected in the fraction containing nucleoplasm; and (3) phosphorylated SAP155 was preferentially associated with chromatin. Our findings suggest that the active spliceosome, containing phosphorylated SAP155, performs pre-mRNA splicing on chromatin concomitant with transcription during testicular development.

  2. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  3. Dynamic control of osmolality and ionic composition of the xylem sap in two mangrove species.

    PubMed

    López-Portillo, Jorge; Ewers, Frank W; Méndez-Alonzo, Rodrigo; Paredes López, Claudia L; Angeles, Guillermo; Alarcón Jiménez, Ana Luisa; Lara-Domínguez, Ana Laura; Torres Barrera, María Del Carmen

    2014-06-01

    • Premise of the study: Xylem sap osmolality and salinity is a critical unresolved issue in plant function with impacts on transport efficiency, pressure gradients, and living cell turgor pressure, especially for halophytes such as mangrove trees.• Methods: We collected successive xylem vessel sap samples from stems and shoots of Avicennia germinans and Laguncularia racemosa using vacuum and pressure extraction and measured their osmolality. Following a series of extractions with the pressure chamber, we depressurized the shoot and pressurized again after various equilibration periods (minutes to hours) to test for dynamic control of osmolality. Transpiration and final sap osmolality were measured in shoots perfused with deionized water or different seawater dilutions.• Key results: For both species, the sap osmolality values of consecutive samples collected by vacuum extraction were stable and matched those of the initial samples extracted with the pressure chamber. Further extraction of samples with the pressure chamber decreased sap osmolality, suggesting reverse osmosis occurred. However, sap osmolalities increased when longer equilibration periods after sap extraction were allowed. Analysis of expressed sap with HPLC indicated a 1:1 relation between measured osmolality and the osmolality of the inorganic ions in the sap (mainly Na(+), K(+), and Cl(-)), suggesting no contamination by organic compounds. In stems perfused with deionized water, the sap osmolality increased to mimic the native sap osmolality.• Conclusions: Xylem sap osmolality and ionic contents are dynamically adjusted by mangroves and may help modulate turgor pressure, hydraulic conductivity, and water potential, thus being important for mangrove physiology, survival, and distribution.

  4. A New Approach to Sap Flow Measurement Using 3D Printed Gauges and Open-source Electronics

    NASA Astrophysics Data System (ADS)

    Ham, J. M.; Miner, G. L.; Kluitenberg, G. J.

    2015-12-01

    A new type of sap flow gauge was developed to measure transpiration from herbaceous plants using a modified heat pulse technique. Gauges were fabricated using 3D-printing technology and low-cost electronics to keep the materials cost under $20 (U.S.) per sensor. Each gauge consisted of small-diameter needle probes fastened to a 3D-printed frame. One needle contained a resistance heater to provide a 6 to 8 second heat pulse while the other probes measured the resultant temperature increase at two distances from the heat source. The data acquisition system for the gauges was built from a low-cost Arduino microcontroller. The system read the gauges every 10 minutes and stored the results on a SD card. Different numerical techniques were evaluated for estimating sap velocity from the heat pulse data - including analytical solutions and parameter estimation approaches . Prototype gauges were tested in the greenhouse on containerized corn and sunflower. Sap velocities measured by the gauges were compared to independent gravimetric measurements of whole plant transpiration. Results showed the system could measure daily transpiration to within 3% of the gravimetric measurements. Excellent agreement was observed when two gauges were attached the same stem. Accuracy was not affected by rapidly changing transpiration rates observed under partly cloudy conditions. The gauge-based estimates of stem thermal properties suggested the system may also detect the onset of water stress. A field study showed the gauges could run for 1 to 2 weeks on a small battery pack. Sap flow measurements on multiple corn stems were scaled up by population to estimate field-scale transpiration. During full canopy cover, excellent agreement was observed between the scaled-up sap flow measurements and reference crop evapotranspiration calculated from weather data. Data also showed promise as a way to estimate real-time canopy resistance required for model verification and development. Given the low

  5. [Application of thermal dissipation probe in the study of Bambusa chungii sap flow].

    PubMed

    Zhao, Ping; Mei, Ting-Ting; Ni, Guang-Yan; Yu, Meng-Hao; Zeng, Xiao-Ping

    2012-04-01

    Based on the validation of Granier's empirical formula for calculating tree stem sap flux density, a comparative study was conducted on the measurement of Bambusa chungi sap flow by using different lengths of thermal dissipation probe (TDP), aimed to approach the applicability of TDP in measuring the sap flow of B. chungii. The difference in the daily change of the sap flow between B. chungii and nearby growing Schima superb was also analyzed. Because of the thinner bamboo wall and the heterogeneous anatomy, the sap flux density of B. chungii measured by 10 mm long probe could be underestimated, but that measured by 8 and 5 mm long probes could be relatively accurate. The comparison of the sap flow between B. chungii and nearby growing S. superba revealed that both the mean sap flux density and its daily change pattern' s skewness of B. chungii were higher than those of S. superba, but the nighttime sap flow of B. chungii was less than that of S. superba, indicating that the water recharge of B. chungii during nighttime was less active than that of S. superba. It was suggested that using TDP to investigate the sap flow of bamboo would be feasible, but careful calibration would be required before the TDP was put into application on different bamboo species.

  6. The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

    PubMed

    Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

    2013-04-25

    The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

  7. NuSAP modulates the dynamics of kinetochore microtubules by attenuating MCAK depolymerisation activity

    PubMed Central

    Li, Chenyu; Zhang, Yajun; Yang, Qiaoyun; Ye, Fan; Sun, Stella Ying; Chen, Ee Sin; Liou, Yih-Cherng

    2016-01-01

    Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule depolymeriser, mitotic centromere-associated kinesin (MCAK), as a novel binding partner of NuSAP. We show that NuSAP regulates the dynamics and depolymerisation activity of MCAK. Phosphorylation of MCAK by Aurora B kinase, a component of the chromosomal passenger complex, significantly enhances the interaction of NuSAP with MCAK and modulates the effects of NuSAP on the depolymerisation activity of MCAK. Our results reveal an underlying mechanism by which NuSAP controls kinetochore microtubule dynamics spatially and temporally by modulating the depolymerisation function of MCAK in an Aurora B kinase-dependent manner. Hence, this study provides new insights into the function of NuSAP in spindle formation during mitosis. PMID:26733216

  8. Sap flow measurements to determine the transpiration of facade greenings

    NASA Astrophysics Data System (ADS)

    Hölscher, Marie-Therese; Nehls, Thomas; Wessolek, Gerd

    2014-05-01

    Facade greening is expected to make a major contribution to the mitigation of the urban heat-island effect through transpiration cooling, thermal insulation and shading of vertical built structures. However, no studies are available on water demand and the transpiration of urban vertical green. Such knowledge is needed as the plants must be sufficiently watered, otherwise the posited positive effects of vertical green can turn into disadvantages when compared to a white wall. Within the framework of the German Research Group DFG FOR 1736 "Urban Climate and Heat Stress" this study aims to test the practicability of the sap flow technique for transpiration measurements of climbing plants and to obtain potential transpiration rates for the most commonly used species. Using sap flow measurements we determined the transpiration of Fallopia baldschuanica, Parthenocissus tricuspidata and Hedera helix in pot experiments (about 1 m high) during the hot summer period from August 17th to August 30th 2012 under indoor conditions. Sap flow measurements corresponded well to simultaneous weight measurement on a daily base (factor 1.19). Fallopia baldschuanica has the highest daily transpiration rate based on leaf area (1.6 mm d-1) and per base area (5.0 mm d-1). Parthenocissus tricuspidata and Hedera helix show transpiration rates of 3.5 and 0.4 mm d-1 (per base area). Through water shortage, transpiration strongly decreased and leaf temperature measured by infrared thermography increased by 1 K compared to a well watered plant. We transferred the technique to outdoor conditions and will present first results for facade greenings in the inner-city of Berlin for the hottest period in summer 2013.

  9. Ternary complex factors SAP-1 and Elk-1, but not net, are functionally equivalent in thymocyte development.

    PubMed

    Costello, Patrick; Nicolas, Robert; Willoughby, Jane; Wasylyk, Bohdan; Nordheim, Alfred; Treisman, Richard

    2010-07-15

    The ternary complex factors (TCFs; SAP-1, Elk-1, and Net) are serum response factor cofactors that share many functional properties and are coexpressed in many tissues. SAP-1, the predominant thymus TCF, is required for thymocyte positive selection. In this study, we assessed whether the different TCFs are functionally equivalent. Elk-1 deletion, but not the hypomorphic Net(delta) mutation, exacerbated the SAP-1 positive selection phenotype, but triply deficient thymocytes were no more defective than SAP-1(-/-) Elk-1(-/-) cells. Inactivation of the other TCFs did not affect SAP-1-independent processes, including beta-selection, regulatory T cell selection, and negative selection, although reduced marginal zone B cells were observed in SAP-1(-/-) Elk-1(-/-) animals. Ectopic expression of Elk-1, but not Net, rescued positive selection of SAP-1(-/-) thymocytes; thus, SAP-1 and Elk-1 are functionally equivalent in this system, and the SAP-1 null selection phenotype reflects only its high expression in the thymus. Array analysis of TCR-stimulated double-positive cells identified SAP-1-dependent inducible genes whose transcription was further impaired in SAP-1(-/-) Elk-1(-/-) cells; thus, these genes, which include Egr-1 and Egr-2, represent candidate mediators of positive selection. Chromatin immunoprecipitation revealed subtly different promoter targeting between the different TCFs. Ectopic expression of Egr-1 restored positive selection in SAP-1 null thymocytes, establishing it (and possibly other Egr family members) as the major effector for ERK-SAP-1 signaling in thymocyte positive selection.

  10. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  11. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  12. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  13. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  14. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  15. Introduction of Sap ERP System Into a Heterogeneous Academic Community

    NASA Astrophysics Data System (ADS)

    Mornar, Vedran; Fertalj, Krešimir; Kalpić, Damir

    2010-06-01

    Introduction of a complex ERP system like SAP into a heterogeneous academic environment like the University of Zagreb is far from being a trivial task. The University comprises more than 30 constituents, called faculties or academies, geographically dispersed, with long and specific traditions. Financing according to the lump sum principle, enforced in Croatia as a side effect of the in Europe obligatory and omnipresent Bologna process, requires a unified view on the educational institutions in order to provide a more just and appropriate financing scheme than the current one. After the experience with own development to support educational tasks and student administration, for standard financial and administration tasks SAP has been chosen as the most appropriate platform. The developer was selected after public bidding and the authors' institution was chosen for the pilot project. The authors were playing principal roles in the process of successful deployment and still expect to offer their expertise for implementation in the rest of the University. However, serious risks stemming from lack of motivation by some constituents are present.

  16. The Holocene history and development of the Tonle Sap, Cambodia

    NASA Astrophysics Data System (ADS)

    Penny, Dan

    2006-02-01

    The Tonle Sap, the 'Great Lake' of central Cambodia, is the central component of wetland ecosystems in the lower Mekong River basin, and is of enormous conservation value. The lake's unusual hydraulic relationship with the Mekong River, and its consequent sensitivity to monsoon variability, makes the Tonle Sap sensitive to climate change. Exploring the dynamics and development of this system under different climate regimes of the past offers a perspective on possible future impacts, which is critical for sound management. Biostratigraphic and sedimentological data derived from cores of lake sediment indicate that during the period >7000 to ca. 5500 14C years Before Present the lake was less variable than present in terms of depth during the annual cycle of flood, and may have been strongly influenced by saline tidal waters associated with higher-than-present seas levels. As regional environments became drier and more seasonal in the late Holocene, more sediment was re-suspended during the increasingly marked dry season lake level minimum, lowering the effective sediment accumulation rate. Contrary to current interpretations of the history of the lake and associated wetland ecosystems, the data presented here imply that regional hydraulic connections between the lake and the Mekong River existed from at least the early Holocene.

  17. Transport of resistance-inducing sterols in phloem sap of barley.

    PubMed

    Lehrer, A T; Dugassa-Gobena, D; Vidal, S; Seifert, K

    2000-01-01

    After root application of [7alpha-3H]-7beta-hydroxysitosterol and [3alpha,6beta-3H2]-6alpha-hydroxylathosterol these sterols could be detected in the leaves and phloem sap feeding aphids. These results imply that the phloem sap is a sterol transport system in barley plants.

  18. Subcellular targeting and cytoskeletal attachment of SAP97 to the epithelial lateral membrane.

    PubMed

    Wu, H; Reuver, S M; Kuhlendahl, S; Chung, W J; Garner, C C

    1998-08-01

    The synapse-associated protein SAP97 is a member of a novel family of cortical cytoskeletal proteins involved in the localization of ion channels at such membrane specializations as synaptic junctions. These multidomain proteins have binding sites for protein 4.1, GKAPs/SAPAPs, voltage- and ligand-gated ion channels and cell-adhesion molecules containing C-terminal T/SXV motifs. In this study, we evaluated the contribution of individual domains in SAP97 to its selective recruitment and attachment to the cortical cytoskeleton in epithelial cells. We find that the PDZ, SH3 and GK domains, as well as the I3 insert in SAP97, are not essential for subcellular targeting, though both PDZ1-2 domains and the I3 insert affect the efficiency of localization. Instead, we show that the first 65 amino acid residues in SAP97, which are absent from SAP90/PSD-95 and SAP102, direct the selective subcellular localization and can mediate at least one point of attachment of SAP97 to the cytoskeleton assembled at sites of cell-cell contact. Our data demonstrate that it is the sequences unique to SAP97 that direct its subcellular targeting to the epithelial lateral membrane.

  19. Ethanol and lactic acid production using sap squeezed from old oil palm trunks felled for replanting.

    PubMed

    Kosugi, Akihiko; Tanaka, Ryohei; Magara, Kengo; Murata, Yoshinori; Arai, Takamitsu; Sulaiman, Othman; Hashim, Rokiah; Hamid, Zubaidah Aimi Abdul; Yahya, Mohd Khairul Azri; Yusof, Mohd Nor Mohd; Ibrahim, Wan Asma; Mori, Yutaka

    2010-09-01

    Old oil palm trunks that had been felled for replanting were found to contain large quantities of high glucose content sap. Notably, the sap in the inner part of the trunk accounted for more than 80% of the whole trunk weight. The glucose concentration of the sap from the inner part was 85.2g/L and decreased towards the outer part. Other sugars found in relatively low concentrations were sucrose, fructose, galactose, xylose, and rhamnose. In addition, oil palm sap was found to be rich in various kinds of amino acids, organic acids, minerals and vitamins. Based on these findings, we fermented the sap to produce ethanol using the sake brewing yeast strain, Saccharomyces cerevisiae Kyokai no.7. Ethanol was produced from the sap without the addition of nutrients, at a comparable rate and yield to the reference fermentation on YPD medium with glucose as a carbon source. Likewise, we produced lactic acid, a promising material for bio-plastics, poly-lactate, from the sap using the homolactic acid bacterium Lactobacillus lactis ATCC19435. We confirmed that sugars contained in the sap were readily converted to lactic acid with almost the same efficiency as the reference fermentation on MSR medium with glucose as a substrate. These results indicate that oil palm trunks felled for replanting are a significant resource for the production of fuel ethanol and lactic acid in palm oil-producing countries such as Malaysia and Indonesia.

  20. SAP: structure, function, and its roles in immune-related diseases.

    PubMed

    Xi, Dan; Luo, TianTian; Xiong, Haowei; Liu, Jichen; Lu, Hao; Li, Menghao; Hou, Yuqing; Guo, Zhigang

    2015-01-01

    Serum amyloid P component (SAP), also known as pentraxin-2, is a member of the pentraxin protein family with an established relationship to the immune response. In the last century, SAP has been used as a diagnostic marker in amyloidosis diagnosis and patient follow-up. SAP has been thought to have potential for treating and curing amyloidosis and fibrosis diseases. More recently, it has been shown that SAP may serve as both a diagnostic marker and a therapeutic target for many immune-related diseases, such as cardiovascular, pulmonary, nephritic, neurological and autoimmune diseases. In the cardiovascular system, SAP has been defined as the culprit in amyloidosis in the heart. SAP may also exert a protective role during the early stage of atherosclerosis and myocardial fibrosis. In noncardiovascular system diseases, SAP is being developed for the treatment of pulmonary fibrosis. In this review, we summarize SAP history, structure, and its roles in immune-related diseases in different systems with emphasis on the cardiovascular system.

  1. Circadian patterns of xylem sap properties and their covariation with plant hydraulic traits in hybrid aspen.

    PubMed

    Meitern, Annika; Õunapuu-Pikas, Eele; Sellin, Arne

    2017-03-22

    Physiological processes taking place in plants are subject to diverse circadian patterns but some of them are poorly documented in natural conditions. The daily dynamics of physico-chemical properties of xylem sap and their covariation with tree hydraulic traits were investigated in hybrid aspen (Populus tremula L.×P. tremuloides Michx) in field conditions in order to clarify which environmental drivers govern the daily variation in these parameters. K(+) concentration ([K(+)]), electrical conductivity (σsap), osmolality (Osm) and pH of the xylem sap, as well as branch hydraulic traits, were measured in the field over 24-h cycles. All studied xylem sap properties and hydraulic characteristics including whole-branch (Kwb), leaf blade (Klb) and petiole hydraulic conductances (KP) showed clear daily dynamics. Air temperature (TA) and photosynthetic photon flux density (PPFD), but also water vapour pressure deficit (VPD) and relative humidity (RH), had significant impacts on KwbKlb, KP, [K(+)] and σsap. Osm varied only with light intensity, while KB varied depending on atmospheric evaporative demand expressed as TA, VPD or RH. Xylem sap pH depended inversely on soil water potential (ΨS) and during daylight also on VPD. Although soil water content was close to saturation during the study period, ΨS influenced also [K(+)] and σsap. The present study presents evidence of coupling between circadian patterns of xylem sap properties and plant hydraulic conductance providing adequate water supply to foliage under environmental conditions characterised by diurnal variation.

  2. Detoxification of Sap from Felled Oil Palm Trunks for the Efficient Production of Lactic Acid.

    PubMed

    Kunasundari, Balakrishnan; Arai, Takamitsu; Sudesh, Kumar; Hashim, Rokiah; Sulaiman, Othman; Stalin, Natra Joseph; Kosugi, Akihiko

    2017-03-30

    The availability of fermentable sugars in high concentrations in the sap of felled oil palm trunks and the thermophilic nature of the recently isolated Bacillus coagulans strain 191 were exploited for lactic acid production under non-sterile conditions. Screening indicated that strain 191 was active toward most sugars including sucrose, which is a major component of sap. Strain 191 catalyzed a moderate conversion of sap sugars to lactic acid (53%) with a productivity of 1.56 g/L/h. Pretreatment of oil palm sap (OPS) using alkaline precipitation improved the sugar fermentability, providing a lactic acid yield of 92% and productivity of 2.64 g/L/h. To better characterize potential inhibitors in the sap, phenolic, organic, and mineral compounds were analyzed using non-treated sap and saps treated with activated charcoal and alkaline precipitation. Phthalic acid, 3,4-dimethoxybenzoic acid, aconitic acid, syringic acid, and ferulic acid were reduced in the sap after treatment. High concentrations of Mg, P, K, and Ca were also precipitated by the alkaline treatment. These results suggest that elimination of excess phenolic and mineral compounds in OPS can improve the fermentation yield. OPS, a non-food resource that is readily available in bulk quantities from plantation sites, is a promising source for lactic acid production.

  3. Using Sap Flow Monitoring for Improved Process-based Ecohydrologic Understanding 2022

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow measurements can be an important tool for unraveling the complex web of ecosystem fluxes, especially when it is combined with other measurements like eddy covariance, isotopes, remote sensing, etc. In this talk, we will demonstrate how sap flow measurements have improved our process-level u...

  4. Morphology of large valleys on Hawaii - Evidence for groundwater sapping and comparisons with Martian valleys

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig; Piper, Jonathan F.

    1986-01-01

    Morphometric data on the runoff and sapping valleys on the slopes of Hawaii and Molokai in Hawaii are analyzed. The analysis reveals a clear distinction between the runoff valleys and sapping valleys. The Hawaiian sapping valleys are characterized by: (1) steep valley walls and flat floors, (2) amphitheater heads, (3) low drainage density, (4) paucity of downstream tributaries, (5) low frequency of up-dip tributaries, and (6) structural and stratigraphic control on valley patterns. The characteristics of the Hawaiian sapping valleys are compared to Martian valleys and experimental systems, and good correlation between the data is detected. Flume experiments were also conducted to study the evolution of sapping valleys in response to variable structure and stratigraphy.

  5. Variation in mineral content of red maple sap across an atmospheric deposition gradient

    SciTech Connect

    McCormick, L.H.

    1997-11-01

    Xylem sap was collected from red maple (Acer rubrum L.) trees during the spring of 1988 and 1989 at seven forest sites along an atmospheric deposition gradient in north central Pennsylvania and analyzed for pH and twelve mineral constituents. The objectives of the study were to examine the sources and patterns of variation in red maple sap chemistry across an atmospheric deposition gradient and to assess the feasibility of using sap analysis as an indicator of nutrient bioavailability. For most sap constituents, there was considerable spatial and temporal variation in concentration. Sources of variation included within and between site variation, date, and year of collection. The nature and extent of variation varied for different constituents. Site differences were similar in 1988 and 1989 for most sap constituents and for some constituents corresponded with differences in soil levels.

  6. Collection and Chemical Composition of Phloem Sap from Citrus sinensis L. Osbeck (Sweet Orange)

    PubMed Central

    Hijaz, Faraj; Killiny, Nabil

    2014-01-01

    Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them. PMID:25014027

  7. Further studies on the reconstitution of glucosylceramidase activity by Sap C and anionic phospholipids.

    PubMed

    Salvioli, R; Tatti, M; Ciaffoni, F; Vaccaro, A M

    2000-04-21

    The reconstitution of the activity of the lysosomal enzyme glucosylceramidase requires anionic phospholipids and, at least, a protein factor, saposin C (Sap C). We have previously proposed a mechanism for the glucosylceramidase activation [Vaccaro et al. (1993) FEBS Lett. 336, 159-162] which implies that Sap C promotes the association of the enzyme with anionic phospholipid-containing membranes, thus favoring the contact between the enzyme and its lipid substrate, glucosylceramide. We have further investigated the properties of Sap C using a fluorescent hydrophobic probe such as 4, 4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS). The binding between bis-ANS and Sap C was pH-dependent, indicating that protonation leads to increased exposure of hydrophobic surfaces of Sap C. The interaction of Sap C with membranes, triggered by the development of hydrophobic properties at low pH values, was affected by the content of anionic phospholipids, such as phosphatidylserine or phosphatidylinositol, suggesting that anionic phospholipids have the potential to modulate the insertion of Sap C in the hydrophobic environment of lysosomal membranes. We previously showed that Sap C and anionic phospholipids are both required for the binding of glucosylceramidase to large vesicles. We have presently observed that Sap C is able to promote the association of glucosylceramidase with the lipid surface only when anionic phospholipids exceed a concentration of 5-10%. This level can be reached by summing lower amounts of individual anionic phospholipids, since they have additive effects. The present data extend and refine our model of the mechanism of glucosylceramidase activation and stress the key role of pH, Sap C and anionic phospholipids in promoting the interaction of the enzyme with membranes.

  8. Collection and chemical composition of phloem sap from Citrus sinensis L. Osbeck (sweet orange).

    PubMed

    Hijaz, Faraj; Killiny, Nabil

    2014-01-01

    Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them.

  9. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  10. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: If your...

  11. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  12. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... facilities authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909...) Before decommissioning the facilities under your SAP, COP, or GAP, you must submit a...

  13. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing...

  14. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  15. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  16. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within 2... decommissioning the facilities under your SAP, COP, or GAP, you must submit a decommissioning application...

  17. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  18. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: If your...

  19. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my SAP be processed for Federal... Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: ER29AP09.118...

  20. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  1. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources..., Inspections, and Facility Assessments for Activities Conducted Under SAPs, COPs and GAPs Decommissioning... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within...

  2. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How will my SAP be processed for Federal... Contents of the Site Assessment Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease...

  3. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must...

  4. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on whether it is submitted before or after your lease is...

  5. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within 2... decommissioning the facilities under your SAP, COP, or GAP, you must submit a decommissioning application...

  6. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from...

  7. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  8. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  9. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  10. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  11. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS approve the revision? (a) You...

  12. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  13. The Presence of Fast-Exchanging Proton Species in Aqueous Solutions of paraCEST Agents Can Impact Rate Constants Measured for Slower Exchanging Species When Fitting CEST Spectra to the Bloch Equations

    PubMed Central

    2015-01-01

    LnDOTA-tetraamide complexes typically exist in solution as a mixture of square-antiprismatic (SAP) and twisted square-antiprismatic (TSAP) coordination isomers. In most cases, the SAP isomer, which is preferred for CEST imaging, predominates, and the presence of the minor TSAP isomer is assumed to have little influence on quantitative measures of the water-exchange rate constant for the SAP isomer. Here, we sought to confirm the validity of this assumption by mixing two chelates with different SAP and TSAP isomer populations while measuring the water-exchange rate constant of the SAP isomer. The results show that an increase in the population of the TSAP isomer in solution results in as much as a 30% overestimation of the water-exchange rate constant for the SAP isomer when CEST spectra are fit to the Bloch equations. This effect was shown to be significant only when the TSAP isomer population exceeded 50%. PMID:25210979

  14. Dissociation of glucocerebrosidase dimer in solution by its co-factor, saposin C

    SciTech Connect

    Gruschus, James M.; Jiang, Zhiping; Yap, Thai Leong; Hill, Stephanie A.; Grishaev, Alexander; Piszczek, Grzegorz; Sidransky, Ellen; Lee, Jennifer C.

    2015-01-16

    Mutations in the gene for the lysosomal enzyme glucocerebrosidase (GCase) cause Gaucher disease and are the most common risk factor for Parkinson disease (PD). Analytical ultracentrifugation of 8 μM GCase shows equilibrium between monomer and dimer forms. However, in the presence of its co-factor saposin C (Sap C), only monomer GCase is seen. Isothermal calorimetry confirms that Sap C associates with GCase in solution in a 1:1 complex (Kd = 2.1 ± 1.1 μM). Saturation cross-transfer NMR determined that the region of Sap C contacting GCase includes residues 63–66 and 74–76, which is distinct from the region known to enhance GCase activity. Because α-synuclein (α-syn), a protein closely associated with PD etiology, competes with Sap C for GCase binding, its interaction with GCase was also measured by ultracentrifugation and saturation cross-transfer. Unlike Sap C, binding of α-syn to GCase does not affect multimerization. However, adding α-syn reduces saturation cross-transfer from Sap C to GCase, confirming displacement. To explore where Sap C might disrupt multimeric GCase, GCase x-ray structures were analyzed using the program PISA, which predicted stable dimer and tetramer forms. In conclusion, for the most frequently predicted multimer interface, the GCase active sites are partially buried, suggesting that Sap C might disrupt the multimer by binding near the active site.

  15. Dissociation of glucocerebrosidase dimer in solution by its co-factor, saposin C

    PubMed Central

    Gruschus, James M.; Jiang, Zhiping; Yap, Thai Leong; Hill, Stephanie A.; Grishaev, Alexander; Piszczek, Grzegorz; Sidransky, Ellen; Lee, Jennifer C.

    2015-01-01

    Mutations in the gene for the lysosomal enzyme glucocerebrosidase (GCase) cause Gaucher disease and are the most common risk factor for Parkinson disease (PD). Analytical ultracentrifugation of 8 μM GCase shows equilibrium between monomer and dimer forms. However, in the presence of its co-factor saposin C (Sap C), only monomer GCase is seen. Isothermal calorimetry confirms that Sap C associates with GCase in solution in a 1:1 complex (Kd = 2.1 ± 1.1 μM). Saturation cross-transfer NMR determined that the region of Sap C contacting GCase includes residues 63–66 and 74–76, which is distinct from the region known to enhance GCase activity. Because α-synuclein (α-syn), a protein closely associated with PD etiology, competes with Sap C for GCase binding, its interaction with GCase was also measured by ultracentrifugation and saturation cross-transfer. Unlike Sap C, binding of α-syn to GCase does not affect multimerization. However, adding α-syn reduces saturation cross-transfer from Sap C to GCase, confirming displacement. To explore where Sap C might disrupt multimeric GCase, GCase x-ray structures were analyzed using the program PISA, which predicted stable dimer and tetramer forms. For the most frequently predicted multimer interface, the GCase active sites are partially buried, suggesting that Sap C might disrupt the multimer by binding near the active site. PMID:25600808

  16. Dissociation of glucocerebrosidase dimer in solution by its co-factor, saposin C

    DOE PAGES

    Gruschus, James M.; Jiang, Zhiping; Yap, Thai Leong; ...

    2015-01-16

    Mutations in the gene for the lysosomal enzyme glucocerebrosidase (GCase) cause Gaucher disease and are the most common risk factor for Parkinson disease (PD). Analytical ultracentrifugation of 8 μM GCase shows equilibrium between monomer and dimer forms. However, in the presence of its co-factor saposin C (Sap C), only monomer GCase is seen. Isothermal calorimetry confirms that Sap C associates with GCase in solution in a 1:1 complex (Kd = 2.1 ± 1.1 μM). Saturation cross-transfer NMR determined that the region of Sap C contacting GCase includes residues 63–66 and 74–76, which is distinct from the region known to enhancemore » GCase activity. Because α-synuclein (α-syn), a protein closely associated with PD etiology, competes with Sap C for GCase binding, its interaction with GCase was also measured by ultracentrifugation and saturation cross-transfer. Unlike Sap C, binding of α-syn to GCase does not affect multimerization. However, adding α-syn reduces saturation cross-transfer from Sap C to GCase, confirming displacement. To explore where Sap C might disrupt multimeric GCase, GCase x-ray structures were analyzed using the program PISA, which predicted stable dimer and tetramer forms. In conclusion, for the most frequently predicted multimer interface, the GCase active sites are partially buried, suggesting that Sap C might disrupt the multimer by binding near the active site.« less

  17. Observation of intravascular changes of superabsorbent polymer microsphere (SAP-MS) with monochromatic X-ray imaging.

    PubMed

    Tanimoto, Daigo; Ito, Katsuyoshi; Yamamoto, Akira; Sone, Teruki; Kobatake, Makito; Tamada, Tsutomu; Umetani, Keiji

    2010-10-01

    This study was designed to evaluate the intravascular transformation behavior of superabsorbent polymer microsphere (SAP-MS) in vivo macroscopically by using monochromatic X-ray imaging and to quantitatively compare the expansion rate of SAP-MS among different kinds of mixtures. Fifteen rabbits were used for our study and transcatheter arterial embolization (TAE) was performed for their auricular arteries using monochromatic X-ray imaging. We used three kinds of SAP-MS (particle diameter 100-150 mum) mixture as embolic spherical particles: SAP-MS(H) absorbed with sodium meglumine ioxaglate (Hexabrix 320), SAP-MS(V) absorbed with isosmolar contrast medium (Visipaque 270), and SAP-MS(S) absorbed with 0.9% sodium saline. The initial volume of SAP-MS particles just after TAE and its final volume 10 minutes after TAE in the vessel were measured to calculate the expansion rate (ER) (n = 30). Intravascular behavior of SAP-MS particles was clearly observed in real time at monochromatic X-ray imaging. Averaged initial volumes of SAP-MS (H) (1.24 x 10(7) microm(3)) were significantly smaller (p < 0.001) than those of SAP-MS (V) (5.99 x 10(7) microm(3)) and SAP-MS (S) (5.85 x 10(7) microm(3)). Averaged final volumes of SAP-MS (H) were significantly larger than averaged initial volumes (4.41 x 10(7) microm(3) vs. 1.24 x 10(7) microm(3); p < 0.0001, ER = 3.55). There were no significant difference between averaged final volumes and averaged initial volumes of SAP-MS (V) and SAP-MS (S). SAP-MS (H), which first travels distally, reaches to small arteries, and then expands to adapt to the vessel lumen, is an effective particle as an embolic agent, causing effective embolization.

  18. Mechanical behaviour analyses of sap ascent in vascular plants.

    PubMed

    Perez-Diaz, Jose-Luis; Garcia-Prada, Juan-Carlos; Romera-Juarez, Fernando; Diez-Jimenez, Efren

    2010-09-01

    A pure mechanical anisotropic model of a tree trunk has been developed based on the 3D finite element method. It simulates the microscopic structure of vessels in the trunk of a European beech (Fagus sylvatica) in order to study and analyse its mechanical behaviour with different configurations of pressures in the conduits of xylem and phloem. The dependence of the strains at the inner bark was studied when sap pressure changed. The comparison with previously published experimental data leads to the conclusion that a great tensile stress-or 'negative pressure'-must exist in the water column in order to achieve the measured strains if only the mechanical point of view is taken into account. Moreover, the model can help to design experiments where qualitatively knowing the strains and the purely mechanical behaviour of the tree is required.

  19. Mechanical behaviour analyses of sap ascent in vascular plants

    PubMed Central

    Perez-Diaz, Jose-Luis; Garcia-Prada, Juan-Carlos; Romera-Juarez, Fernando

    2010-01-01

    A pure mechanical anisotropic model of a tree trunk has been developed based on the 3D finite element method. It simulates the microscopic structure of vessels in the trunk of a European beech (Fagus sylvatica) in order to study and analyse its mechanical behaviour with different configurations of pressures in the conduits of xylem and phloem. The dependence of the strains at the inner bark was studied when sap pressure changed. The comparison with previously published experimental data leads to the conclusion that a great tensile stress—or ‘negative pressure’—must exist in the water column in order to achieve the measured strains if only the mechanical point of view is taken into account. Moreover, the model can help to design experiments where qualitatively knowing the strains and the purely mechanical behaviour of the tree is required. PMID:21886343

  20. Cloning, expression and cellular localization of Daphnia pulex senescence-associated protein, DpSAP.

    PubMed

    Liu, Ajing; Kong, Ling; Zhang, Mingqing; Wu, Donglei; Wang, Danli; Zhao, Yunlong

    2014-01-25

    Daphnia (water fleas) are small crustaceans that undergo an unusual switch from asexual to sexual reproduction that is dependent on environmental conditions. In this study, a senescence-associated protein (SAP) from the common freshwater species Daphnia pulex was cloned using primers based on homologous sequences and rapid amplification of cDNA ends (RACE). Real-time PCR was employed to quantify the expression of D. pulex SAP (DpSAP) in individual organisms. The role of DpSAP in the reproductive transformation was further investigated in both parthenogenetic and sexual females by using digoxin-labeled SAP RNA probes and RNA whole-mount in situ hybridization. DpSAP was more highly expressed in sexual females, indicating a role in growth and reproduction. Cellular localization studies using RNA whole-mount in situ hybridization showed specific expression in the second tentacle joints. These expression patterns suggest an important role for DpSAP in the reproductive transformation of D. pulex.

  1. Phosphatidylserine-selective targeting and anticancer effects of SapC-DOPS nanovesicles on brain tumors.

    PubMed

    Blanco, Víctor M; Chu, Zhengtao; Vallabhapurapu, Subrahmanya D; Sulaiman, Mahaboob K; Kendler, Ady; Rixe, Olivier; Warnick, Ronald E; Franco, Robert S; Qi, Xiaoyang

    2014-08-30

    Brain tumors, either primary (e.g., glioblastoma multiforme) or secondary (metastatic), remain among the most intractable and fatal of all cancers. We have shown that nanovesicles consisting of Saposin C (SapC) and dioleylphosphatidylserine (DOPS) are able to effectively target and kill cancer cells both in vitro and in vivo. These actions are a consequence of the affinity of SapC-DOPS for phosphatidylserine, an acidic phospholipid abundantly present in the outer membrane of a variety of tumor cells and tumor-associated vasculature. In this study, we first characterize SapC-DOPS bioavailability and antitumor effects on human glioblastoma xenografts, and confirm SapC-DOPS specificity towards phosphatidylserine by showing that glioblastoma targeting is abrogated after in vivo exposure to lactadherin, which binds phosphatidylserine with high affinity. Second, we demonstrate that SapC-DOPS selectively targets brain metastases-forming cancer cells both in vitro, in co-cultures with human astrocytes, and in vivo, in mouse models of brain metastases derived from human breast or lung cancer cells. Third, we demonstrate that SapC-DOPS have cytotoxic activity against metastatic breast cancer cells in vitro, and prolong the survival of mice harboring brain metastases. Taken together, these results support the potential of SapC-DOPS for the diagnosis and therapy of primary and metastatic brain tumors.

  2. Haemophilus ducreyi SapA contributes to cathelicidin resistance and virulence in humans.

    PubMed

    Mount, Kristy L B; Townsend, Carisa A; Rinker, Sherri D; Gu, Xiaoping; Fortney, Kate R; Zwickl, Beth W; Janowicz, Diane M; Spinola, Stanley M; Katz, Barry P; Bauer, Margaret E

    2010-03-01

    Haemophilus ducreyi is an extracellular pathogen of human epithelial surfaces that resists human antimicrobial peptides (APs). The organism's genome contains homologs of genes sensitive to antimicrobial peptides (sap operon) in nontypeable Haemophilus influenzae. In this study, we characterized the sap-containing loci of H. ducreyi 35000HP and demonstrated that sapA is expressed in broth cultures and H. ducreyi-infected tissue; sapA is also conserved among both class I and class II H. ducreyi strains. We constructed a nonpolar sapA mutant of H. ducreyi 35000HP, designated 35000HPsapA, and compared the percent survival of wild-type 35000HP and 35000HPsapA exposed to several human APs, including alpha-defensins, beta-defensins, and the cathelicidin LL-37. Unlike an H. influenzae sapA mutant, strain 35000HPsapA was not more susceptible to defensins than strain 35000HP was. However, we observed a significant decrease in the survival of strain 35000HPsapA after exposure to LL-37, which was complemented by introducing sapA in trans. Thus, the Sap transporter plays a role in resistance of H. ducreyi to LL-37. We next compared mutant strain 35000HPsapA with strain 35000HP for their ability to cause disease in human volunteers. Although both strains caused papules to form at similar rates, the pustule formation rate at sites inoculated with 35000HPsapA was significantly lower than that of sites inoculated with 35000HP (33.3% versus 66.7%; P = 0.007). Together, these data establish that SapA acts as a virulence factor and as one mechanism for H. ducreyi to resist killing by antimicrobial peptides. To our knowledge, this is the first demonstration that an antimicrobial peptide resistance mechanism contributes to bacterial virulence in humans.

  3. Sap Flux Scaled Transpiration in Ring-porous Tree Species: Assumptions, Pitfalls and Calibration

    NASA Astrophysics Data System (ADS)

    Bush, S. E.; Hultine, K. R.; Ehleringer, J. R.

    2008-12-01

    Thermal dissipation probes for measuring sap flow (Granier-type) at the whole tree and stand level are routinely used in forest ecology and site water balance studies. While the original empirical relationship used to calculate sap flow was reported as independent of wood anatomy (ring-porous, diffuse-porous, tracheid), it has been suggested that potentially large errors in sap flow calculations may occur when using the original calibration for ring-porous species, due to large radial trends in sap velocity and/or shallow sapwood depth. Despite these concerns, sap flux measurements have rarely been calibrated in ring-porous taxa. We used a simple technique to calibrate thermal dissipation sap flux measurements on ring-porous trees in the lab. Calibration measurements were conducted on five ring-porous species in the Salt Lake City, USA metropolitan area including Quercus gambelii (Gambel oak), Gleditsia triacanthos (Honey locust), Elaeagnus angustifolia (Russian olive), Sophora japonica (Japanese pagoda), and Celtis occidentalis (Common hackberry). Six stems per species of approximately 1 m in length were instrumented with heat dissipation probes to measure sap flux concurrently with gravimetric measurements of water flow through each stem. Safranin dye was pulled through the stems following flow rate measurements to determine sapwood area. As expected, nearly all the conducting sapwood area was limited to regions within the current year growth rings. Consequently, we found that the original Granier equation underestimated sap flux density for all species considered. Our results indicate that the use of thermal dissipation probes for measuring sap flow in ring-porous species should be independently calibrated, particularly when species- specific calibration data are not available. Ring-porous taxa are widely distributed and represent an important component of the regional water budgets of many temperate regions. Our results are important for evaluating plant water

  4. Anti-transpirant activity in xylem sap from flooded tomato (Lycopersicon esculentum Mill.) plants is not due to pH-mediated redistributions of root- or shoot-sourced ABA.

    PubMed

    Else, Mark A; Taylor, June M; Atkinson, Christopher J

    2006-01-01

    In flooded soils, the rapid effects of decreasing oxygen availability on root metabolic activity are likely to generate many potential chemical signals that may impact on stomatal apertures. Detached leaf transpiration tests showed that filtered xylem sap, collected at realistic flow rates from plants flooded for 2 h and 4 h, contained one or more factors that reduced stomatal apertures. The closure could not be attributed to increased root output of the glucose ester of abscisic acid (ABA-GE), since concentrations and deliveries of ABA conjugates were unaffected by soil flooding. Although xylem sap collected from the shoot base of detopped flooded plants became more alkaline within 2 h of flooding, this rapid pH change of 0.5 units did not alter partitioning of root-sourced ABA sufficiently to prompt a transient increase in xylem ABA delivery. More shoot-sourced ABA was detected in the xylem when excised petiole sections were perfused with pH 7 buffer, compared with pH 6 buffer. Sap collected from the fifth oldest leaf of "intact" well-drained plants and plants flooded for 3 h was more alkaline, by approximately 0.4 pH units, than sap collected from the shoot base. Accordingly, xylem [ABA] was increased 2-fold in sap collected from the fifth oldest petiole compared with the shoot base of flooded plants. However, water loss from transpiring, detached leaves was not reduced when the pH of the feeding solution containing 3-h-flooded [ABA] was increased from 6.7 to 7.1 Thus, the extent of the pH-mediated, shoot-sourced ABA redistribution was not sufficient to raise xylem [ABA] to physiologically active levels. Using a detached epidermis bioassay, significant non-ABA anti-transpirant activity was also detected in xylem sap collected at intervals during the first 24 h of soil flooding.

  5. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    PubMed

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, p<0.001). When sap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  6. SAP-like domain in nucleolar spindle associated protein mediates mitotic chromosome loading as well as interphase chromatin interaction

    SciTech Connect

    Verbakel, Werner; Carmeliet, Geert; Engelborghs, Yves

    2011-08-12

    Highlights: {yields} The SAP-like domain in NuSAP is a functional DNA-binding domain with preference for dsDNA. {yields} This SAP-like domain is essential for chromosome loading during early mitosis. {yields} NuSAP is highly dynamic on mitotic chromatin, as evident from photobleaching experiments. {yields} The SAP-like domain also mediates NuSAP-chromatin interaction in interphase nucleoplasm. -- Abstract: Nucleolar spindle associated protein (NuSAP) is a microtubule-stabilizing protein that localizes to chromosome arms and chromosome-proximal microtubules during mitosis and to the nucleus, with enrichment in the nucleoli, during interphase. The critical function of NuSAP is underscored by the finding that its depletion in HeLa cells results in various mitotic defects. Moreover, NuSAP is found overexpressed in multiple cancers and its expression levels often correlate with the aggressiveness of cancer. Due to its localization on chromosome arms and combination of microtubule-stabilizing and DNA-binding properties, NuSAP takes a special place within the extensive group of spindle assembly factors. In this study, we identify a SAP-like domain that shows DNA binding in vitro with a preference for dsDNA. Deletion of the SAP-like domain abolishes chromosome arm binding of NuSAP during mitosis, but is not sufficient to abrogate its chromosome-proximal localization after anaphase onset. Fluorescence recovery after photobleaching experiments revealed the highly dynamic nature of this NuSAP-chromatin interaction during mitosis. In interphase cells, NuSAP also interacts with chromatin through its SAP-like domain, as evident from its enrichment on dense chromatin regions and intranuclear mobility, measured by fluorescence correlation spectroscopy. The obtained results are in agreement with a model where NuSAP dynamically stabilizes newly formed microtubules on mitotic chromosomes to enhance chromosome positioning without immobilizing these microtubules. Interphase NuSAP

  7. A statistical method for estimating wood thermal diffusivity and probe geometry using in situ heat response curves from sap flow measurements.

    PubMed

    Chen, Xingyuan; Miller, Gretchen R; Rubin, Yoram; Baldocchi, Dennis D

    2012-12-01

    The heat pulse method is widely used to measure water flux through plants; it works by using the speed at which a heat pulse is propagated through the system to infer the velocity of water through a porous medium. No systematic, non-destructive calibration procedure exists to determine the site-specific parameters necessary for calculating sap velocity, e.g., wood thermal diffusivity and probe spacing. Such parameter calibration is crucial to obtain the correct transpiration flux density from the sap flow measurements at the plant scale and subsequently to upscale tree-level water fluxes to canopy and landscape scales. The purpose of this study is to present a statistical framework for sampling and simultaneously estimating the tree's thermal diffusivity and probe spacing from in situ heat response curves collected by the implanted probes of a heat ratio measurement device. Conditioned on the time traces of wood temperature following a heat pulse, the parameters are inferred using a Bayesian inversion technique, based on the Markov chain Monte Carlo sampling method. The primary advantage of the proposed methodology is that it does not require knowledge of probe spacing or any further intrusive sampling of sapwood. The Bayesian framework also enables direct quantification of uncertainty in estimated sap flow velocity. Experiments using synthetic data show that repeated tests using the same apparatus are essential for obtaining reliable and accurate solutions. When applied to field conditions, these tests can be obtained in different seasons and can be automated using the existing data logging system. Empirical factors are introduced to account for the influence of non-ideal probe geometry on the estimation of heat pulse velocity, and are estimated in this study as well. The proposed methodology may be tested for its applicability to realistic field conditions, with an ultimate goal of calibrating heat ratio sap flow systems in practical applications.

  8. 6(5)Carboxyfluorescein as a tracer of phloem sap translocation

    SciTech Connect

    Grignon, N.; Touraine, B. ); Durand, M. )

    1989-06-01

    6(5)carboxyfluorescein (6(5)CF), a polar fluorescein with an apparent pK of 6.3, was introduced, as a pH 6.3 solution, into the apoplast of lamina or petioles of mature soybean leaves. Freehand sections were prepared at various times and immediately observed with a fluorescence microscope. 6(5)CF-associated fluorescence appeared in all sink organs, from shoot apex to roots. It was strictly confined to the phloem regions, even after 4 days. Its transport into young leaves ceased at approximately the time they underwent sink-to-source transition. It was never transported between two leaflets of the same leaf. Its transport was interrupted by phloem destruction. All these transport characteristics were highly reproducible, and were paralleled by those of {sup 14}C transport after application of ({sup 14}C) sucrose to leaf surfaces. In contrast with 6(5)CF, fluorescein was transported between mature leaves, and between leaflets of the same, leaf. It was not restricted to phloem, and often appeared in the xylem region. These results indicate that 6(5)CF can be used to monitor phloem sap translocation in real time, in short- and long-term experiments.

  9. Rice SAPs are responsive to multiple biotic stresses and overexpression of OsSAP1, an A20/AN1 zinc-finger protein, enhances the basal resistance against pathogen infection in tobacco.

    PubMed

    Tyagi, Himani; Jha, Shweta; Sharma, Meenakshi; Giri, Jitender; Tyagi, Akhilesh K

    2014-08-01

    Eukaryotic A20/AN1 zinc-finger proteins (ZFPs) play an important role in the regulation of immune and stress response. After elucidation of the role of first such protein, OsSAP1, in abiotic stress tolerance, 18 rice stress associated protein (SAP) genes have been shown to be regulated by multiple abiotic stresses. In the present study, expression pattern of all the 18 OsSAP genes have been analysed in response to different biotic stress simulators, in order to get insights into their possible involvement in biotic stress tolerance. Our results showed the upregulation of OsSAP1 and OsSAP11 by all biotic stress simulator treatments. Furthermore, the functional role of OsSAP1 in plant defence responses has been explored through overexpression in transgenic plants. Constitutive expression of OsSAP1 in transgenic tobacco resulted into enhanced disease resistance against virulent bacterial pathogen, together with the upregulation of known defence-related genes. Present investigation suggests that rice SAPs are responsive to multiple biotic stresses and OsSAP1 plays a key role in basal resistance against pathogen infection. This strongly supports the involvement of rice SAPs in cross-talk between biotic and abiotic stress signalling pathways, which makes them ideal candidate to design strategies for protecting crop plants against multiple stresses.

  10. Structure-function analysis of SAP97, a modular scaffolding protein that drives dendrite growth.

    PubMed

    Zhang, L; Hsu, F-C; Mojsilovic-Petrovic, J; Jablonski, A M; Zhai, J; Coulter, D A; Kalb, R G

    2015-03-01

    Activation of AMPA receptors assembled with the GluA1 subunit can promote dendrite growth in a manner that depends on its direct binding partner, SAP97. SAP97 is a modular scaffolding protein that has at least seven recognizable protein-protein interaction domains. Several complementary approaches were employed to show that the dendrite branching promoting action of full length SAP97 depends on ligand(s) that bind to the PDZ3 domain. Ligand(s) to PDZ1, PDZ2 and I3 domains also contribute to dendrite growth. The ability of PDZ3 ligand(s) to promote dendrite growth depends on localization at the plasma membrane along with GluA1 and SAP97. These results suggest that the assembly of a multi-protein complex at or near synapses is vital for the translation of AMPA-R activity into dendrite growth.

  11. An investigation of potential applications of OP-SAPS: Operational sampled analog processors

    NASA Technical Reports Server (NTRS)

    Parrish, E. A.; Mcvey, E. S.

    1976-01-01

    The impact of charge-coupled device (CCD) processors on future instrumentation was investigated. The CCD devices studied process sampled analog data and are referred to as OP-SAPS - operational sampled analog processors. Preliminary studies into various architectural configurations for systems composed of OP-SAPS show that they have potential in such diverse applications as pattern recognition and automatic control. It appears probable that OP-SAPS may be used to construct computing structures which can serve as special peripherals to large-scale computer complexes used in real time flight simulation. The research was limited to the following benchmark programs: (1) face recognition, (2) voice command and control, (3) terrain classification, and (4) terrain identification. A small amount of effort was spent on examining a method by which OP-SAPS may be used to decrease the limiting ground sampling distance encountered in remote sensing from satellites.

  12. Sapping Features of the Colorado Plateau: a Comparative Planetary Geology Field Guide

    NASA Technical Reports Server (NTRS)

    Howard, Alan D. (Editor); Kochel, R. Craig (Editor); Holt, Henry E. (Editor)

    1987-01-01

    This book is an attempt to determine geomorphic criteria to be used to distinguish between channels formed predominantly by sapping and seepage erosion and those formed principally by surface runoff processes. The geologic nature of the Colorado Plateau has resulted in geomorphic features that show similarities to some areas on Mars, especially certain valley networks within thick sandstone formations. Where spring sapping is an effective process, the valleys that develop are unique in terms of their morphology and network pattern.

  13. Radial variation in sap flow in five laurel forest tree species in Tenerife, Canary Islands.

    PubMed

    Jiménez, M. Soledad; Nadezhdina, Nadezhda; Cermák, Jan; Morales, Domingo

    2000-11-01

    Variations in radial patterns of xylem water content and sap flow rate were measured in five laurel forest tree species (Laurus azorica (Seub.) Franco, Persea indica (L.) Spreng., Myrica faya Ait., Erica arborea L. and Ilex perado Ait. ssp. platyphylla (Webb & Berth.) Tutin) growing in an experimental plot at Agua García, Tenerife, Canary Islands. Measurements were performed around midday during warm and sunny days by the heat field deformation method. In all species, water content was almost constant (around 35% by volume) over the whole xylem cross-sectional area. There were no differences in wood color over the whole cross-sectional area of the stem in most species with the exception of E. arborea, whose wood became darker in the inner layers. Radial patterns of sap flow were highly variable and did not show clear relationships with tree diameter or species. Sap flow occurred over the whole xylem cross-sectional area in some species, whereas it was limited to the outer xylem layers in others. Sap flow rate was either similar along the xylem radius or exhibited a peak in the outer part of the xylem area. Low sap flow rates with little variation in radial pattern were typical for shaded suppressed trees, whereas dominant trees exhibited high sap flow rates with a peak in the radial pattern. Stem damage resulted in a significant decrease in sap flow rate in the outer xylem layers. The outer xylem is more important for whole tree water supply than the inner xylem because of its larger size. We conclude that measurement of radial flow pattern provides a reliable method of integrating sap flow from individual measuring points to the whole tree.

  14. Water Use Patterns of Four Tropical Bamboo Species Assessed with Sap Flux Measurements.

    PubMed

    Mei, Tingting; Fang, Dongming; Röll, Alexander; Niu, Furong; Hendrayanto; Hölscher, Dirk

    2015-01-01

    Bamboos are grasses (Poaceae) that are widespread in tropical and subtropical regions. We aimed at exploring water use patterns of four tropical bamboo species (Bambusa vulgaris, Dendrocalamus asper, Gigantochloa atroviolacea, and G. apus) with sap flux measurement techniques. Our approach included three experimental steps: (1) a pot experiment with a comparison of thermal dissipation probes (TDPs), the stem heat balance (SHB) method and gravimetric readings using potted B. vulgaris culms, (2) an in situ calibration of TDPs with the SHB method for the four bamboo species, and (3) field monitoring of sap flux of the four bamboo species along with three tropical tree species (Gmelina arborea, Shorea leprosula, and Hevea brasiliensis) during a dry and a wet period. In the pot experiment, it was confirmed that the SHB method is well suited for bamboos but that TDPs need to be calibrated. In situ, species-specific parameters for such calibration formulas were derived. During field monitoring we found that some bamboo species reached high maximum sap flux densities. Across bamboo species, maximal sap flux density increased with decreasing culm diameter. In the diurnal course, sap flux densities in bamboos peaked much earlier than radiation and vapor pressure deficit (VPD), and also much earlier than sap flux densities in trees. There was a pronounced hysteresis between sap flux density and VPD in bamboos, which was less pronounced in trees. Three of the four bamboo species showed reduced sap flux densities at high VPD values during the dry period, which was associated with a decrease in soil moisture content. Possible roles of internal water storage, root pressure and stomatal sensitivity are discussed.

  15. [Application of three heat pulse technique-based methods to determine the stem sap flow].

    PubMed

    Wang, Sheng; Fan, Jun

    2015-08-01

    It is of critical importance to acquire tree transpiration characters through sap flow methodology to understand tree water physiology, forest ecology and ecosystem water exchange. Tri-probe heat pulse sensors, which are widely utilized in soil thermal parameters and soil evaporation measurement, were applied to implement Salix matsudana sap flow density (Vs) measurements via heat-ratio method (HRM), T-Max method (T-Max) and single-probe heat pulse probe (SHPP) method, and comparative analysis was conducted with additional Grainer's thermal diffusion probes (TDP) measured results. The results showed that, it took about five weeks to reach a stable measurement stage after TPHP installation, Vs measured with three methods in the early stage after installation was 135%-220% higher than Vs in the stable measurement stage, and Vs estimated via HRM, T-Max and SHPP methods were significantly linearly correlated with Vs estimated via TDP method, with R2 of 0.93, 0.73 and 0.91, respectively, and R2 for Vs measured by SHPP and HRM reached 0.94. HRM had relatively higher precision in measuring low rates and reverse sap flow. SHPP method seemed to be very promising to measure sap flow for configuration simplicity and high measuring accuracy, whereas it couldn' t distinguish directions of flow. T-Max method had relatively higher error in sap flow measurement, and it couldn' t measure sap flow below 5 cm3 · cm(-2) · h(-1), thus this method could not be used alone, however it could measure thermal diffusivity for calculating sap flow when other methods were imposed. It was recommended to choose a proper method or a combination of several methods to measure stem sap flow, based on specific research purpose.

  16. Water Use Patterns of Four Tropical Bamboo Species Assessed with Sap Flux Measurements

    PubMed Central

    Mei, Tingting; Fang, Dongming; Röll, Alexander; Niu, Furong; Hendrayanto; Hölscher, Dirk

    2016-01-01

    Bamboos are grasses (Poaceae) that are widespread in tropical and subtropical regions. We aimed at exploring water use patterns of four tropical bamboo species (Bambusa vulgaris, Dendrocalamus asper, Gigantochloa atroviolacea, and G. apus) with sap flux measurement techniques. Our approach included three experimental steps: (1) a pot experiment with a comparison of thermal dissipation probes (TDPs), the stem heat balance (SHB) method and gravimetric readings using potted B. vulgaris culms, (2) an in situ calibration of TDPs with the SHB method for the four bamboo species, and (3) field monitoring of sap flux of the four bamboo species along with three tropical tree species (Gmelina arborea, Shorea leprosula, and Hevea brasiliensis) during a dry and a wet period. In the pot experiment, it was confirmed that the SHB method is well suited for bamboos but that TDPs need to be calibrated. In situ, species-specific parameters for such calibration formulas were derived. During field monitoring we found that some bamboo species reached high maximum sap flux densities. Across bamboo species, maximal sap flux density increased with decreasing culm diameter. In the diurnal course, sap flux densities in bamboos peaked much earlier than radiation and vapor pressure deficit (VPD), and also much earlier than sap flux densities in trees. There was a pronounced hysteresis between sap flux density and VPD in bamboos, which was less pronounced in trees. Three of the four bamboo species showed reduced sap flux densities at high VPD values during the dry period, which was associated with a decrease in soil moisture content. Possible roles of internal water storage, root pressure and stomatal sensitivity are discussed. PMID:26779233

  17. Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA).

    PubMed

    Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

    2011-08-01

    During collection, maple sap is contaminated by bacteria and fungi that subsequently colonize the tubing system. The bacterial microbiota has been more characterized than the fungal microbiota, but the impact of both components on maple sap quality remains unclear. This study focused on identifying bacterial and fungal members of maple sap and correlating microbiota composition with maple sap properties. A multiplex automated ribosomal intergenic spacer analysis (MARISA) method was developed to presumptively identify bacterial and fungal members of maple sap samples collected from 19 production sites during the tapping period. Results indicate that the fungal community of maple sap is mainly composed of yeast related to Mrakia sp., Mrakiella sp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia, Mrakiella and Guehomyces peaks were identified in samples of all production sites and can be considered dominant and stable members of the fungal microbiota of maple sap. A multivariate analysis based on MARISA profiles and maple sap chemical composition data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus sp., Pseudomonas tolaasii, G. pullulans and maple sap composition at different flow periods. This study provides new insights on the relationship between microbial community and maple sap quality.

  18. Critical role of SAP in progression and reactivation but not maintenance of T cell-dependent humoral immunity.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-03-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.

  19. [Cloning and expression pattern of a zinc finger protein gene ShSAP1 in Saccharum officinarum].

    PubMed

    Li, Xiaojun; Cai, Wenwei; Zhang, Shuzhen; Xu, Liping; Chen, Ping; Wang, Jungang

    2011-06-01

    In plants, proteins with A20/AN1 zinc finger domain are involved in stress responses, named as "Stress Associated Protein" (SAP) gene family. Based on Expressed Sequence Tag (EST) sequences information in Badila Saccharum officinarum mature related cDNA library, we cloned an SAP gene from sugarcane full length cDNA library, named ShSAP1 (GenBank: Accession No. HM991960). To characterize ShSAP1, we analyzed its genome structure and expression pattern. Southern blot analysis showed ShSAP1 was present as one or two copy in the genome of Badila. Comparison of ShSAP1 1 008 bp full length cDNA with a genomic frangment (2 241 bp) generated by PCR amplification and sequencing, revealed the presence of two introns (202 bp and 1 052 bp) located in the 5'UTR region. Semiquantitative RT-PCR analysis found ShSAP1 expressed in leaves, roots and stalk in mature sugarcane. Compared with immature stems, ShSAP1 expressed higher in mature stalk. ShSAP1 was induced by different types of treatments, such as salt (200 mmol/L NaCl), drought (10% PEG 6 000), GA3 (200 mg/L), ABA (100 micromol/L) and ET (1 mmol/L) during sugarcane seedling stage. These results indicated that ShSAP1 may function in sugarcane maturation and abiotic stress response processes.

  20. Isolation and characterization of LcSAP, a Leymus chinensis gene which enhances the salinity tolerance of Saccharomyces cerevisiae.

    PubMed

    Liu, Jingying; Yang, Xiangna; Yang, Xizhe; Xu, Mingyue; Liu, Jie; Xue, Mengmeng; Ma, Pengda

    2017-02-01

    A number of members of the SAP ("stress-associated protein") gene family have been implicated in the plant stress response. Here, a SAP gene has been isolated using PCR RACE from the perennial grass Leymus chinensis, a species which has reputation for ecological adaptability. The 17.6 kDa LcSAP product comprised 161 residues, including both an A20 domain and an AN1 domain, a feature of type I SAPs. Using a semi-quantitative RT-PCR assay to profile its transcription, it was shown that LcSAP was more strongly transcribed in the leaf than in the root under control conditions. The level of LcSAP transcription began to rise 6 h after the plant's exposure to 400 mM NaCl, and the abundance of transcript remained stable for at least 24 h. Exposing the plant to 100 mM Na2CO3 also induced LcSAP transcription, but the abundance of SAP transcript faded after 6 h. When LcSAP was introduced into yeast cells, the transgenic cells grew better than wild type ones when the medium contained 1.4 M NaCl. The ability of LcSAP to respond to salinity stress in yeast suggests that it also makes a contribution to the stress tolerance shown by L. chinensis.

  1. Autophagy regulation revealed by SapM-induced block of autophagosome-lysosome fusion via binding RAB7

    SciTech Connect

    Hu, Dong; Wu, Jing; Wang, Wan; Mu, Min; Zhao, Runpeng; Xu, Xuewei; Chen, Zhaoquan; Xiao, Jian; Hu, Fengyu; Yang, Yabo; Zhang, Rongbo

    2015-05-29

    The mechanism underlying autophagy alteration by mycobacterium tuberculosis remains unclear. Our previous study shows LpqH, a lipoprotein of mycobacterium tuberculosis, can cause autophagosomes accumulation in murine macrophages. It is well known that SapM, another virulence factor, plays an important role in blocking phagosome-endosome fusion. However, the mechanism that SapM interferes with autophagy remains poorly defined. In this study, we report that SapM suppresses the autophagy flux by blocking autophagosome fusion with lysosome. Exposure to SapM results in accumulations of autophagosomes and decreased co-localization of autophagosome with lysosome. Molecularly, Rab7, a small GTPase, is blocked by SapM through its CT domain and is prevented from involvement of autophagosome-lysosome fusion. In conclusion, our study reveals that SapM takes Rab7 as a previously unknown target to govern a distinct molecular mechanism underlying autophagosome-lysosome fusion, which may bring light to a new thought about developing potential drugs or vaccines against tuberculosis. - Highlights: • A mechanism for disrupting autophagosome-lysosome fusion induced by SapM. • Rab7 is involved in SapM-inhibited autophagy. • SapM interacts with Rab7 by CT-domain. • CT-domain is indispensable to SapM-inhibited autophagy.

  2. Use of infrared camera to understand bats' access to date palm sap: implications for preventing Nipah virus transmission.

    PubMed

    Khan, M Salah Uddin; Hossain, Jahangir; Gurley, Emily S; Nahar, Nazmun; Sultana, Rebeca; Luby, Stephen P

    2010-12-01

    Pteropus bats are commonly infected with Nipah virus, but show no signs of illness. Human Nipah outbreaks in Bangladesh coincide with the date palm sap harvesting season. In epidemiologic studies, drinking raw date palm sap is a risk factor for human Nipah infection. We conducted a study to evaluate bats' access to date palm sap. We mounted infrared cameras that silently captured images upon detection of motion on date palm trees from 5:00 pm to 6:00 am. Additionally, we placed two locally used preventative techniques, bamboo skirts and lime (CaCO₃) smeared on date palm trees to assess their effectiveness in preventing bats access to sap. Out of 20 camera-nights of observations, 14 identified 132 visits of bats around the tree, 91 to the shaved surface of the tree where the sap flow originates, 4 at the stream of sap moving toward the collection pot, and no bats at the tap or on the collection pots; the remaining 6 camera-nights recorded no visits. Of the preventative techniques, the bamboo skirt placed for four camera-nights prevented bats access to sap. This study confirmed that bats commonly visited date palm trees and physically contacted the sap collected for human consumption. This is further evidence that date palm sap is an important link between Nipah virus in bats and Nipah virus in humans. Efforts that prevent bat access to the shaved surface and the sap stream of the tree could reduce Nipah spillovers to the human population.

  3. Accumulation of weathered pp'-DDE in xylem sap of grafted watermelon.

    PubMed

    Isleyen, Mehmet; Sevim, Pinar

    2012-04-01

    Movement of weathered p,p'-dichlorodiphenyldichloroethane (p,p'-DDE) from contaminated soil to the rhizosphere pore water to the xylem sap of grafted watermelon was studied under green house conditions. p,p'-DDE concentrations in pore water and xylem sap was compared in intact plants, homografted, and compatible heterografts of Cucurbita pepo spp. pepo and Citrullus lanatus plants. An average p,p'-DDE concentrations in pore water of contaminated soil ranged from 0.36 microg/L to 0.55 microg/L and there were no statistically significant among the cultivars. Conversely, the xylem sap p,p'-DDE concentration of heterografted watermelon having a zucchini rootstock and watermelon scion was 71 microg/L and it was greater than intact watermelon plants (0.49 microg/L) but less than that of intact plants of zucchini (141 microg/L). Homografting showed no effect on xylem sap p,p'-DDE concentrations of the identical cultivars. The bio-concentration factors (BCFs) which is an average p,p'-DDE concentration in xylem sap over average p,p'-DDE in pore water were 344, 325, 197, 1.28, and 0.89 for intact plant of zucchini, homografted zucchini, heterografted watermelon, homografted watermelon, and intact plant of watermelon, respectively. Xylem sap p,p'-DDE concentrations of the heterografted watermelon plants were clearly influenced by plant phylogeny and enhanced by the zucchini rootstock compared to intact watermelon plants.

  4. Insects attracted to Maple Sap: Observations from Prince Edward Island, Canada

    PubMed Central

    Majka, Christopher G.

    2010-01-01

    Abstract The collection of maple sap for the production of maple syrup is a large commercial enterprise in Canada and the United States. In Canada, which produces 85% of the world’s supply, it has an annual value of over $168 million CAD. Over 38 million trees are tapped annually, 6.5% of which use traditional buckets for sap collection. These buckets attract significant numbers of insects. Despite this, there has been very little investigation of the scale of this phenomenon and the composition of insects that are attracted to this nutrient source. The present paper reports the results of a preliminary study conducted on Prince Edward Island, Canada. Twenty-eight species of Coleoptera, Lepidoptera, and Trichoptera were found in maple sap buckets, 19 of which are known to be attracted to saps and nectars. The physiological role of sap feeding is discussed with reference to moths of the tribe Xylenini, which are active throughout the winter, and are well documented as species that feed on sap flows. Additionally, 18 of the 28 species found in this study are newly recorded in Prince Edward Island. PMID:21594122

  5. Altered thalamocortical development in the SAP102 knockout model of intellectual disability

    PubMed Central

    Crocker-Buque, Alex; Currie, Stephen P.; Luz, Liliana L.; Grant, Seth G.; Duffy, Kevin R.; Kind, Peter C.; Daw, Michael I.

    2016-01-01

    Genetic mutations known to cause intellectual disabilities (IDs) are concentrated in specific sets of genes including both those encoding synaptic proteins and those expressed during early development. We have characterized the effect of genetic deletion of Dlg3, an ID-related gene encoding the synaptic NMDA-receptor interacting protein synapse-associated protein 102 (SAP102), on development of the mouse somatosensory cortex. SAP102 is the main representative of the PSD-95 family of postsynaptic MAGUK proteins during early development and is proposed to play a role in stabilizing receptors at immature synapses. Genetic deletion of SAP102 caused a reduction in the total number of thalamocortical (TC) axons innervating the somatosensory cortex, but did not affect the segregation of barrels. On a synaptic level SAP102 knockout mice display a transient speeding of NMDA receptor kinetics during the critical period for TC plasticity, despite no reduction in GluN2B-mediated component of synaptic transmission. These data indicated an interesting dissociation between receptor kinetics and NMDA subunit expression. Following the critical period NMDA receptor function was unaffected by loss of SAP102 but there was a reduction in the divergence of TC connectivity. These data suggest that changes in synaptic function early in development caused by mutations in SAP102 result in changes in network connectivity later in life. PMID:27466188

  6. A simple, novel and high efficiency sap inoculation method to screen for tobacco streak virus.

    PubMed

    Sundaresha, S; Sreevathsa, Rohini; Balol, Gurupada B; Keshavareddy, G; Rangaswamy, K T; Udayakumar, M

    2012-10-01

    A rapid and efficient sap inoculation method for tobacco streak virus (TSV) was developed in sunflower. Sap from TSV-infected sunflower plants was freshly extracted in phosphate buffer and diluted serially from 10(-1) to 10(-8). Two-day old seedlings of sunflower were injured at the meristem and immersed in the sap for 10 min, maintained at 20 °C for 2-3 days and shifted to greenhouse. The surviving seedlings in the respective sap dilution were scored for symptoms of sunflower necrosis disease (SND). SND symptoms were seen in 80 % of the seedlings inoculated with a sap dilution of 10(-5). ELISA and RT-PCR analysis of coat protein and movement protein of TSV confirmed SND symptoms. The methodology was also found to be reproducible when the sap from the infected plants was inoculated onto healthy plants. The main aim of the study was to develop a primary screening strategy for the selection of transgenics developed for SND resistance. This methodology can also be extended for the analysis of resistance against other viruses.

  7. Isolation and characterization of SAP and CRP, two pentraxins from Pangasianodon (Pangasius) hypophthalmus.

    PubMed

    Huong Giang, Duong Thi; Van Driessche, Edilbert; Vandenberghe, Isabel; Devreese, Bart; Beeckmans, Sonia

    2010-01-01

    From the serum of Pangasianodon hypophthalmus, two proteins were isolated by affinity chromatography on Sepharose and phosphorylcholine-Sepharose. Their binding on the affinity matrices critically depends on the presence of Ca2+ ions. N-terminal sequencing and sequencing of internal tryptic peptides identified the proteins as pentraxins and from their binding properties they are identified as SAP (serum amyloid P component) and CRP (C-reactive protein). Per ml serum, 36 microg SAP and 56 microg CRP was purified. Upon gel filtration, both the SAP and CRP elute as trimers of respectively 24 kDa and 28 kDa subunits. Both proteins are devoid of inter-chain disulfide bonds. Both SAP and CRP are glycosylated and agglutinate rabbit erythrocytes and pathogenic bacteria Edwardsiella ictaluri and Aeromonas hydrophila, but not Micrococcus lysodeikticus or Escherichia coli. Haemagglutination of SAP and CRP is inhibited by galactose (MIC = 1 mM) and by phosphorylcholine (MIC = 1-2 mM), respectively. Circular dichroism studies revealed that antiparallel beta-pleated sheets are dominating the secondary structure. Upon removing the Ca(2+) ions by EDTA, slight structural changes are observed by CD spectroscopy in the near-UV region. Immunodiffusion shows that P. hypophthalmus SAP and CRP do not cross-react.

  8. Molecular pathogenesis of EBV susceptibility in XLP as revealed by analysis of female carriers with heterozygous expression of SAP.

    PubMed

    Palendira, Umaimainthan; Low, Carol; Chan, Anna; Hislop, Andrew D; Ho, Edwin; Phan, Tri Giang; Deenick, Elissa; Cook, Matthew C; Riminton, D Sean; Choo, Sharon; Loh, Richard; Alvaro, Frank; Booth, Claire; Gaspar, H Bobby; Moretta, Alessandro; Khanna, Rajiv; Rickinson, Alan B; Tangye, Stuart G

    2011-11-01

    X-linked lymphoproliferative disease (XLP) is a primary immunodeficiency caused by mutations in SH2D1A which encodes SAP. SAP functions in signalling pathways elicited by the SLAM family of leukocyte receptors. A defining feature of XLP is exquisite sensitivity to infection with EBV, a B-lymphotropic virus, but not other viruses. Although previous studies have identified defects in lymphocytes from XLP patients, the unique role of SAP in controlling EBV infection remains unresolved. We describe a novel approach to this question using female XLP carriers who, due to random X-inactivation, contain both SAP(+) and SAP(-) cells. This represents the human equivalent of a mixed bone marrow chimera in mice. While memory CD8(+) T cells specific for CMV and influenza were distributed across SAP(+) and SAP(-) populations, EBV-specific cells were exclusively SAP(+). The preferential recruitment of SAP(+) cells by EBV reflected the tropism of EBV for B cells, and the requirement for SAP expression in CD8(+) T cells for them to respond to Ag-presentation by B cells, but not other cell types. The inability of SAP(-) clones to respond to Ag-presenting B cells was overcome by blocking the SLAM receptors NTB-A and 2B4, while ectopic expression of NTB-A on fibroblasts inhibited cytotoxicity of SAP(-) CD8(+) T cells, thereby demonstrating that SLAM receptors acquire inhibitory function in the absence of SAP. The innovative XLP carrier model allowed us to unravel the mechanisms underlying the unique susceptibility of XLP patients to EBV infection in the absence of a relevant animal model. We found that this reflected the nature of the Ag-presenting cell, rather than EBV itself. Our data also identified a pathological signalling pathway that could be targeted to treat patients with severe EBV infection. This system may allow the study of other human diseases where heterozygous gene expression from random X-chromosome inactivation can be exploited.

  9. The plant hopper Issus coleoptratus can detoxify phloem sap saponins including the degradation of the terpene core.

    PubMed

    Himmelsbach, Markus; Weth, Agnes; Böhme, Christine; Schwarz, Martin; Bräunig, Peter; Baumgartner, Werner

    2016-02-10

    Issus coleoptratus is a small plant hopper which mainly feeds on the phloem sap from ivy. Although all parts of ivy are poisonous as the plant contains saponins, especially hederasaponins, I. coleoptratus can cope with the poison. In contrast to other animals like the stick insect Carausius morosus which accumulates saponins in its body, I. coleoptratus can degrade and disintegrate not only the saponins but even the genines, i.e. the triterpene core of the substances. This is perhaps made possible by a specialised midgut and/or the salivary glands. When the glands and the gut are dissected and added to saponins in solution, the saponins, including the genines, are degraded ex vivo.

  10. The plant hopper Issus coleoptratus can detoxify phloem sap saponins including the degradation of the terpene core

    PubMed Central

    Himmelsbach, Markus; Weth, Agnes; Böhme, Christine; Schwarz, Martin; Bräunig, Peter; Baumgartner, Werner

    2016-01-01

    ABSTRACT Issus coleoptratus is a small plant hopper which mainly feeds on the phloem sap from ivy. Although all parts of ivy are poisonous as the plant contains saponins, especially hederasaponins, I. coleoptratus can cope with the poison. In contrast to other animals like the stick insect Carausius morosus which accumulates saponins in its body, I. coleoptratus can degrade and disintegrate not only the saponins but even the genines, i.e. the triterpene core of the substances. This is perhaps made possible by a specialised midgut and/or the salivary glands. When the glands and the gut are dissected and added to saponins in solution, the saponins, including the genines, are degraded ex vivo. PMID:26863940

  11. [Dynamic change of Yulania sap flow before dormancy in response to environmental factors].

    PubMed

    Zhu, Zhong-Long; Jia, Zhong-Kui; Ma, Lu-Yi; Wang, Xiao-Ling; Duan, Jie

    2012-09-01

    From September 26 to November 5, 2011, the sap flow of Yulania wufengensis trees including cold-resistance type (HK) and non cold-resistance type (HF), Y. 'Sunspire' (HY), and Yulania x soulangeana (EQ) which were introduced into Beijing four years before was monitored by Flow-32 stem heat balance sensor, and, in combining with the environmental factors monitored synchronically, the changes of the sap flow before dormancy and the environmental factors were analyzed, with the responses of the sap flow to the environmental factors investigated at the scales of 0.5 h and 1 day. The sap flow of the Yulanias trees before dormancy displayed an obvious trend of declining day by day. The environmental factors affecting the sap flow could be divided into two categories, i. e., meteorological index (MI) and soil index (SI). The sap flow of the Yulanias trees had a synchronous variation rhythm with MI, and declined in parallel to SI. The combined effect of MI and SI on the diurnal changes of the sap flow was 69% - 73%. At both 0.5 h and 1 day scales, the sap flow showed significantly correlations with total radiation (Rs), air vapor pressure deficit (D), air relative humidity (RH), air temperature (Ta), and wind speed (w). The sap flow showed no significant correlations with soil temperature (Ts) and soil water content (SWC) at 0. 5 h scale, but had significant correlations with Ts, SWC, and day length (Z) at 1 day scale (the correlation efficient was about 0.8). Only Rs, Z, and D were included into the model at 1 day scale, but almost all environmental factors (except SWC and Ts) were included in the model at 0.5 h scale. Except for HF type, the regression coefficients of the model for the Yulanias trees at 1 day scale (0.92-0.96) were larger than those at 0.5 h scale (0.77-0.87), and the correlations between the dynamic changes of sap flow and the environmental factor were consistent, which was in accord with the fact that the HF could not overwinter in Beijing but the

  12. Predictive models for radial sap flux variation in coniferous, diffuse-porous and ring-porous temperate trees.

    PubMed

    Berdanier, Aaron B; Miniat, Chelcy F; Clark, James S

    2016-08-01

    Accurately scaling sap flux observations to tree or stand levels requires accounting for variation in sap flux between wood types and by depth into the tree. However, existing models for radial variation in axial sap flux are rarely used because they are difficult to implement, there is uncertainty about their predictive ability and calibration measurements are often unavailable. Here we compare different models with a diverse sap flux data set to test the hypotheses that radial profiles differ by wood type and tree size. We show that radial variation in sap flux is dependent on wood type but independent of tree size for a range of temperate trees. The best-fitting model predicted out-of-sample sap flux observations and independent estimates of sapwood area with small errors, suggesting robustness in the new settings. We develop a method for predicting whole-tree water use with this model and include computer code for simple implementation in other studies.

  13. Targeting and Cytotoxicity of SapC-DOPS Nanovesicles in Pancreatic Cancer

    PubMed Central

    Chu, Zhengtao; Abu-Baker, Shadi; Palascak, Mary B.; Ahmad, Syed A.; Franco, Robert S.; Qi, Xiaoyang

    2013-01-01

    Only a small number of promising drugs target pancreatic cancer, which is the fourth leading cause of cancer deaths with a 5-year survival of less than 5%. Our goal is to develop a new biotherapeutic agent in which a lysosomal protein (saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) are assembled into nanovesicles (SapC-DOPS) for treating pancreatic cancer. A distinguishing feature of SapC-DOPS nanovesicles is their high affinity for phosphatidylserine (PS) rich microdomains, which are abnormally exposed on the membrane surface of human pancreatic tumor cells. To evaluate the role of external cell PS, in vitro assays were used to correlate PS exposure and the cytotoxic effect of SapC-DOPS in human tumor and nontumorigenic pancreatic cells. Next, pancreatic tumor xenografts (orthotopic and subcutaneous models) were used for tumor targeting and therapeutic efficacy studies with systemic SapC-DOPS treatment. We observed that the nanovesicles selectively killed human pancreatic cancer cells in vitro by inducing apoptotic death, whereas untransformed cells remained unaffected. This in vitro cytotoxic effect correlated to the surface exposure level of PS on the tumor cells. Using xenografts, animals treated with SapC-DOPS showed clear survival benefits and their tumors shrank or disappeared. Furthermore, using a double-tracking method in live mice, we showed that the nanovesicles were specifically targeted to orthotopically-implanted, bioluminescent pancreatic tumors. These data suggest that the acidic phospholipid PS is a biomarker for pancreatic cancer that can be effectively targeted for therapy utilizing cancer-selective SapC-DOPS nanovesicles. This study provides convincing evidence in support of developing a new therapeutic approach to pancreatic cancer. PMID:24124494

  14. SAP expression in invariant NKT cells is required for cognate help to support B-cell responses.

    PubMed

    Detre, Cynthia; Keszei, Marton; Garrido-Mesa, Natividad; Kis-Toth, Katalin; Castro, Wilson; Agyemang, Amma F; Veerapen, Natacha; Besra, Gurdyal S; Carroll, Michael C; Tsokos, George C; Wang, Ninghai; Leadbetter, Elizabeth A; Terhorst, Cox

    2012-07-05

    One of the manifestations of X-linked lymphoproliferative disease (XLP) is progressive agammaglobulinemia, caused by the absence of a functional signaling lymphocyte activation molecule (SLAM)-associated protein (SAP) in T, invariant natural killer T (NKT) cells and NK cells. Here we report that α-galactosylceramide (αGalCer) activated NKT cells positively regulate antibody responses to haptenated protein antigens at multiple checkpoints, including germinal center formation and affinity maturation. Whereas NKT cell-dependent B cell responses were absent in SAP(-/-).B6 mice that completely lack NKT cells, the small number of SAP-deficient NKT cells in SAP(-/-).BALB/c mice adjuvated antibody production, but not the germinal center reaction. To test the hypothesis that SAP-deficient NKT cells can facilitate humoral immunity, SAP was deleted after development in SAP(fl/fl).tgCreERT2.B6 mice. We find that NKT cell intrinsic expression of SAP is dispensable for noncognate helper functions, but is critical for providing cognate help to antigen-specific B cells. These results demonstrate that SLAM-family receptor-regulated cell-cell interactions are not limited to T-B cell conjugates. We conclude that in the absence of SAP, several routes of NKT cell-mediated antibody production are still accessible. The latter suggests that residual NKT cells in XLP patients might contribute to variations in dysgammaglobulinemia.

  15. Arsenate Impact on the Metabolite Profile, Production, and Arsenic Loading of Xylem Sap in Cucumbers (Cucumis sativus L.).

    PubMed

    Uroic, M Kalle; Salaün, Pascal; Raab, Andrea; Feldmann, Jörg

    2012-01-01

    Arsenic uptake and translocation studies on xylem sap focus generally on the concentration and speciation of arsenic in the xylem. Arsenic impact on the xylem sap metabolite profile and its production during short term exposure has not been reported in detail. To investigate this, cucumbers were grown hydroponically and arsenate (As(V)) and DMA were used for plant treatment for 24 h. Total arsenic and arsenic speciation in xylem sap was analyzed including a metabolite profiling under As(V) stress. Produced xylem sap was quantified and absolute arsenic transported was determined. As(V) exposure had a significant impact on the metabolite profile of xylem sap. Four m/z values corresponding to four compounds were up-regulated, one compound down-regulated by As(V) exposure. The compound down-regulated was identified to be isoleucine. Furthermore, As(V) exposure had a significant influence on sap production, leading to a reduction of up to 96% sap production when plants were exposed to 1000 μg kg(-1) As(V). No difference to control plants was observed when plants were exposed to 1000 μg kg(-1) DMA. Absolute arsenic amount in xylem sap was the lowest at high As(V) exposure. These results show that As(V) has a significant impact on the production and metabolite profile of xylem sap. The physiological importance of isoleucine needs further attention.

  16. [Dynamics of sap flow density in stems of typical desert shrub Calligonum mongolicum and its responses to environmental variables].

    PubMed

    Xu, Shi-qin; Ji, Xi-bin; Jin, Bo-wen

    2016-02-01

    Independent measurements of stem sap flow in stems of Calligonum mongolicum and environmental variables using commercial sap flow gauges and a micrometeorological monitoring system, respectively, were made to simulate the variation of sap flow density in the middle range of Hexi Corridor, Northwest China during June to September, 2014. The results showed that the diurnal process of sap flow density in C. mongolicum showed a broad unimodal change, and the maximum sap flow density reached about 30 minutes after the maximum of photosynthetically active radiation (PAR) , while about 120 minutes before the maximum of temperature and vapor pressure deficit (VPD). During the studying period, sap flow density closely related with atmosphere evapor-transpiration demand, and mainly affected by PAR, temperature and VPD. The model was developed which directly linked the sap flow density with climatic variables, and good correlation between measured and simulated sap flow density was observed in different climate conditions. The accuracy of simulation was significantly improved if the time-lag effect was taken into consideration, while this model underestimated low and nighttime sap flow densities, which was probably caused by plant physiological characteristics.

  17. Grape Cultivar and Sap Culture Conditions Affect the Development of Xylella fastidiosa Phenotypes Associated with Pierce's Disease

    PubMed Central

    Hoch, Harvey C.; Burr, Thomas J.; Mowery, Patricia

    2016-01-01

    Xylella fastidiosa is a xylem-limited bacterium in plant hosts and causes Pierce’s disease (PD) of grapevines, which differ in susceptibility according to the Vitis species (spp.). In this work we compared X. fastidiosa biofilm formation and population dynamics when cultured in xylem saps from PD-susceptible and -resistant Vitis spp. under different conditions. Behaviors in a closed-culture system were compared to those in different sap-renewal cultures that would more closely mimic the physicochemical environment encountered in planta. Significant differences in biofilm formation and growth in saps from PD-susceptible and -resistant spp. were only observed using sap renewal culture. Compared to saps from susceptible V. vinifera, those from PD-resistant V. aestivalis supported lower titers of X. fastidiosa and less biofilm and V. champinii suppressed both growth and biofilm formation, behaviors which are correlated with disease susceptibility. Furthermore, in microfluidic chambers X. fastidiosa formed thick mature biofilm with three-dimensional (3-D) structures, such as pillars and mounds, in saps from all susceptible spp. In contrast, only small aggregates of various shapes were formed in saps from four out of five of the resistant spp.; sap from the resistant spp. V. mustangensis was an exception in that it also supported thick lawns of biofilm but not the above described 3-D structures typically seen in a mature biofilm from the susceptible saps. Our findings provide not only critical technical information for future bioassays, but also suggest further understanding of PD susceptibility. PMID:27508296

  18. Sap flow is Underestimated by Thermal Dissipation Sensors due to Alterations of Wood Anatomy

    NASA Astrophysics Data System (ADS)

    Marañón-Jiménez, S.; Wiedemann, A.; van den Bulcke, J.; Cuntz, M.; Rebmann, C.; Steppe, K.

    2014-12-01

    The thermal dissipation technique (TD) is one of the most commonly adopted methods for sap flow measurements. However, underestimations of up to 60% of the tree transpiration have been reported with this technique, although the causes are not certainly known. The insertion of TD sensors within the stems causes damage of the wood tissue and subsequent healing reactions, changing wood anatomy and likely the sap flow path. However, the anatomical changes in response to the insertion of sap flow sensors and the effects on the measured flow have not been assessed yet. In this study, we investigate the alteration of vessel anatomy on wounds formed around TD sensors. Our main objectives were to elucidate the anatomical causes of sap flow underestimation for ring-porous and diffuse-porous species, and relate these changes to sap flow underestimations. Successive sets of TD probes were installed in early, mid and end of the growing season in Fagus sylvatica (diffuse-porous) and Quercus petraea (ring-porous) trees. They were logged after the growing season and additional sets of sensors were installed in the logged stems with presumably no healing reaction. The wood tissue surrounding each sensor was then excised and analysed by X-ray computed microtomography (X-ray micro CT). This technique allowed the quantification of vessel anatomical characteristics and the reconstruction of the 3-D internal microstructure of the xylem vessels so that extension and shape of the altered area could be determined. Gels and tyloses clogged the conductive vessels around the sensors in both beech and oak. The extension of the affected area was larger for beech although these anatomical changes led to similar sap flow underestimations in both species. The higher vessel size in oak may explain this result and, therefore, larger sap flow underestimation per area of affected conductive tissue. The wound healing reaction likely occurred within the first weeks after sensor installation, which

  19. Campylobacter fetus sap inversion occurs in the absence of RecA function.

    PubMed

    Ray, K C; Tu, Z C; Grogono-Thomas, R; Newell, D G; Thompson, S A; Blaser, M J

    2000-10-01

    Phase variation of Campylobacter fetus surface layer proteins (SLPs) occurs by inversion of a 6.2-kb DNA segment containing the unique sap promoter, permitting expression of a single SLP-encoding gene. Previous work has shown that the C. fetus sap inversion system is RecA dependent. When we challenged a pregnant ewe with a recA mutant of wild-type C. fetus (strain 97-211) that expressed the 97-kDa SLP, 15 of the 16 ovine-passaged isolates expressed the 97-kDa protein. However, one strain (97-209) expressed a 127-kDa SLP, suggesting that chromosomal rearrangement may have occurred to enable SLP switching. Lack of RecA function in strains 97-211 and 97-209 was confirmed by their sensitivity to the DNA-damaging agent methyl methanesulfonate. Southern hybridization and PCR of these strains indicated that the aphA insertion into recA was stably present. However, Southern hybridizations demonstrated that in strain 97-209 inversion had occurred in the sap locus. PCR data confirmed inversion of the 6.2-kb DNA element and indicated that in these recA mutants the sap inversion frequency is reduced by 2 to 3 log(10) units compared to that in the wild type. Thus, although the major sap inversion pathway in C. fetus is RecA dependent, alternative lower-frequency, RecA-independent inversion mechanisms exist.

  20. Measuring Sap-Flow Velocity at Low Power with a Single Probe

    NASA Astrophysics Data System (ADS)

    Wong, B.; Glaser, S. D.

    2012-12-01

    The measurement of plant evapotranspiration under natural conditions provides information that is useful for real-time water management and understanding ecological services. It is common to use sap flow measurements to estimate ET. The common instruments to measure sap flow are unwieldy to install, consume large amounts of electrical energy, and involve a number of simplifying assumptions to transform from electrical input to heat to sap flow estimates. We present new instrumentation for an ET sensor that uses a single thermistor probe is used to implement a thermal pulse decay method to measure sap-flow velocity, which can then be converted to a volumetric flow-rate that is indicative of plant transpiration. The instrument makes use of the thermistor self-heating mode to rapidly heat the transducer isothermally. The temperature decay over time is directly proportional to sap-flow velocity. The method uses 2 milliamps to make a measurement so that a D-cell battery can supply a useful lifetime for an array of sensors. We show the results of device calibration in controlled laboratory conditions and in the field.

  1. [Stem sap flow and water consumption of Tamarix ramosissima in hinterland of Taklimakan Desert].

    PubMed

    Xu, Hao; Zhang, Xi-Ming; Yan, Hai-Long; Yao, Shi-Jun

    2007-04-01

    From April to November 2005, the stem sap flow and water consumption of Tamarix ramosissima in the hinterland of Taklimakan Desert was measured by Flow-32 System. The results showed that, in the extremely arid hinterland of Taklimakan Desert and under enough water supply, the average daily water consumption of T. ramosissima with a stem diameter of 3.5 cm and 2.0 cm was 6.322 kg and 1.179 kg, respectively in one growth season. The stem sap flow of T. ramosissima presented a single-peaked curve, with an obvious day and night variation rhythm and fluctuated with environment factors. Under enough water supply, the environmenal factors such as total radiation, wind speed and air temperature were the main factors affecting the stem sap flow, and the dynamics of stem sap flow could be predicted by the liner regression model based on total radiation and wind speed. Because of the extremely arid environment and enough water supply, T. ramosissima had a relatively higher stem sap flow rate and a great water consumption.

  2. Symbiotic maple saps minimize disruption of the mice intestinal microbiota after oral antibiotic administration.

    PubMed

    Hammami, Riadh; Ben Abdallah, Nour; Barbeau, Julie; Fliss, Ismail

    2015-01-01

    This study was undertaken to evaluate the in vivo impact of new symbiotic products based on liquid maple sap or its concentrate. Sap and concentrate, with or without inulin (2%), were inoculated with Bifidobacterium lactis Bb12 and Lactobacillus rhamnosus GG valio at initial counts of 2-4 × 10(8) cfu mL(-1). The experiments started with intra-gastric administration of antibiotic (kanamycin 40 mg in 0.1 cc) (to induce microbiota disturbance and/or diarrhea) to 3-to-5-week-old C57BL/6 female mice followed by a combination of prebiotic and probiotics included in the maple sap or its concentrate for a week. The combination inulin and probiotics in maple sap and concentrate appeared to minimize the antibiotic-induced breakdown of mice microbiota with a marked effect on bifidobacterium and bacteroides levels, thus permitting a more rapid re-establishment of the baseline microbiota levels. Results suggest that maple sap and its concentrate represent good candidates for the production of non-dairy functional foods.

  3. The correlation of virulence, pathogenicity, and itraconazole resistance with SAP activity in Candida albicans strains.

    PubMed

    Feng, Wenli; Yang, Jing; Pan, Yanwei; Xi, Zhiqin; Qiao, Zusha; Ma, Yan

    2016-02-01

    The relationship between SAP2 activity and drug resistance in Candida albicans was investigated by using itraconazole-resistant and itraconazole-sensitive C. albicans isolates. The precipitation zones were measured to analyze SAP2 activity. Mice were classified into itraconazole-resistant and -sensitive C. albicans isolate groups, and a control group, with their survival and mortality rate being observed over 30 days. The relative expression levels of CDR1, CDR2, MDR1, and SAP2 were measured using RT-PCR. It was found that the secreted aspartyl proteinase activity of itraconazole-resistant C. albicans strains was significantly higher than that of itraconazole-sensitive C. albicans strains (P < 0.001). A significantly higher mortality rate was recorded for mice treated with itraconazole-resistant C. albicans than for mice treated with itraconazole-sensitive C. albicans. In regards to the CDR1, CDR2, and MDR1 genes, there was no significant difference between the 2 groups of mice. Positive correlations between SAP2 and MDR1 and between CDR1 and CDR2 were found. The high expression level of SAP2 may relate to the virulence, pathogenicity, and resistance of C. albicans.

  4. Dissolved atmospheric gas in xylem sap measured with membrane inlet mass spectrometry.

    PubMed

    Schenk, H Jochen; Espino, Susana; Visser, Ate; Esser, Bradley K

    2016-04-01

    A new method is described for measuring dissolved gas concentrations in small volumes of xylem sap using membrane inlet mass spectrometry. The technique can be used to determine concentrations of atmospheric gases, such as argon, as reported here, or for any dissolved gases and their isotopes for a variety of applications, such as rapid detection of trace gases from groundwater only hours after they were taken up by trees and rooting depth estimation. Atmospheric gas content in xylem sap directly affects the conditions and mechanisms that allow for gas removal from xylem embolisms, because gas can dissolve into saturated or supersaturated sap only under gas pressure that is above atmospheric pressure. The method was tested for red trumpet vine, Distictis buccinatoria (Bignoniaceae), by measuring atmospheric gas concentrations in sap collected at times of minimum and maximum daily temperature and during temperature increase and decline. Mean argon concentration in xylem sap did not differ significantly from saturation levels for the temperature and pressure conditions at any time of collection, but more than 40% of all samples were supersaturated, especially during the warm parts of day. There was no significant diurnal pattern, due to high variability between samples.

  5. SCF(SAP) controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana.

    PubMed

    Wang, Zhibiao; Li, Na; Jiang, Shan; Gonzalez, Nathalie; Huang, Xiahe; Wang, Yingchun; Inzé, Dirk; Li, Yunhai

    2016-04-06

    Control of organ size by cell proliferation and growth is a fundamental process, but the mechanisms that determine the final size of organs are largely elusive in plants. We have previously revealed that the ubiquitin receptor DA1 regulates organ size by repressing cell proliferation in Arabidopsis. Here we report that a mutant allele of STERILE APETALA (SAP) suppresses the da1-1 mutant phenotype. We show that SAP is an F-box protein that forms part of a SKP1/Cullin/F-box E3 ubiquitin ligase complex and controls organ size by promoting the proliferation of meristemoid cells. Genetic analyses suggest that SAP may act in the same pathway with PEAPOD1 and PEAPOD2, which are negative regulators of meristemoid proliferation, to control organ size, but does so independently of DA1. Further results reveal that SAP physically associates with PEAPOD1 and PEAPOD2, and targets them for degradation. These findings define a molecular mechanism by which SAP and PEAPOD control organ size.

  6. SAP(E) - A cell-penetrating polyproline helix at lipid interfaces.

    PubMed

    Franz, Johannes; Lelle, Marco; Peneva, Kalina; Bonn, Mischa; Weidner, Tobias

    2016-09-01

    Cell-penetrating peptides (CPPs) are short membrane-permeating amino acid sequences that can be used to deliver cargoes, e.g. drugs, into cells. The mechanism for CPP internalization is still subject of ongoing research. An interesting family of CPPs is the sweet arrow peptides - SAP(E) - which are known to adopt a polyproline II helical secondary structure. SAP(E) peptides stand out among CPPs because they carry a net negative charge while most CPPs are positively charged, the latter being conducive to electrostatic interaction with generally negatively charged membranes. For SAP(E)s, an internalization mechanism has been proposed, based on polypeptide aggregation on the cell surface, followed by an endocytic uptake. However, this process has not yet been observed directly - since peptide-membrane interactions are inherently difficult to monitor on a molecular scale. Here, we use sum frequency generation (SFG) vibrational spectroscopy to investigate molecular interactions of SAP(E) with differently charged model membranes, in both mono- and bi-layer configurations. The data suggest that the initial binding mechanism is accompanied by structural changes of the peptide. Also, the peptide-model membrane interaction depends on the charge of the lipid headgroup with phosphocholine being a favorable binding site. Moreover, while direct penetration has also been observed for some CPPs, the spectroscopy reveals that for SAP(E), its interaction with model membranes remains limited to the headgroup region, and insertion into the hydrophobic core of the lipid layer does not occur.

  7. Observation of Intravascular Changes of Superabsorbent Polymer Microsphere (SAP-MS) with Monochromatic X-Ray Imaging

    SciTech Connect

    Tanimoto, Daigo Ito, Katsuyoshi; Yamamoto, Akira; Sone, Teruki; Kobatake, Makito; Tamada, Tsutomu; Umetani, Keiji

    2010-10-15

    This study was designed to evaluate the intravascular transformation behavior of superabsorbent polymer microsphere (SAP-MS) in vivo macroscopically by using monochromatic X-ray imaging and to quantitatively compare the expansion rate of SAP-MS among different kinds of mixtures. Fifteen rabbits were used for our study and transcatheter arterial embolization (TAE) was performed for their auricular arteries using monochromatic X-ray imaging. We used three kinds of SAP-MS (particle diameter 100-150 {mu}m) mixture as embolic spherical particles: SAP-MS(H) absorbed with sodium meglumine ioxaglate (Hexabrix 320), SAP-MS(V) absorbed with isosmolar contrast medium (Visipaque 270), and SAP-MS(S) absorbed with 0.9% sodium saline. The initial volume of SAP-MS particles just after TAE and its final volume 10 minutes after TAE in the vessel were measured to calculate the expansion rate (ER) (n = 30). Intravascular behavior of SAP-MS particles was clearly observed in real time at monochromatic X-ray imaging. Averaged initial volumes of SAP-MS (H) (1.24 x 10{sup 7} {mu}m{sup 3}) were significantly smaller (p < 0.001) than those of SAP-MS (V) (5.99 x 10{sup 7} {mu}m{sup 3}) and SAP-MS (S) (5.85 x 10{sup 7} {mu}m{sup 3}). Averaged final volumes of SAP-MS (H) were significantly larger than averaged initial volumes (4.41 x 10{sup 7} {mu}m{sup 3} vs. 1.24 x 10{sup 7} {mu}m{sup 3}; p < 0.0001, ER = 3.55). There were no significant difference between averaged final volumes and averaged initial volumes of SAP-MS (V) and SAP-MS (S). SAP-MS (H), which first travels distally, reaches to small arteries, and then expands to adapt to the vessel lumen, is an effective particle as an embolic agent, causing effective embolization.

  8. Vascular Sap Proteomics: Providing Insight into Long-Distance Signaling during Stress

    PubMed Central

    Carella, Philip; Wilson, Daniel C.; Kempthorne, Christine J.; Cameron, Robin K.

    2016-01-01

    The plant vascular system, composed of the xylem and phloem, is important for the transport of water, mineral nutrients, and photosynthate throughout the plant body. The vasculature is also the primary means by which developmental and stress signals move from one organ to another. Due to practical and technological limitations, proteomics analysis of xylem and phloem sap has been understudied in comparison to accessible sample types such as leaves and roots. However, recent advances in sample collection techniques and mass spectrometry technology are making it possible to comprehensively analyze vascular sap proteomes. In this mini-review, we discuss the emerging field of vascular sap proteomics, with a focus on recent comparative studies to identify vascular proteins that may play roles in long-distance signaling and other processes during stress responses in plants. PMID:27242852

  9. Sap flow measurement in a street and park of a hot and arid city

    NASA Astrophysics Data System (ADS)

    Cohen, S.; Shashua-Bar, L.; Potchter, O.; Yaakov, Y.; Bar-Kutiel, P.; Tanny, J.

    2012-04-01

    Urban trees mitigate hot climate by shading, but also through transpirational cooling. Transpiration from urban trees can be a significant part of the urban energy budget, but is difficult to quantify. A direct method for measuring tree transpiration is through the use of sap flow sensors. Several methods have been developed for this, where the most common use heat as a tracer of sap flow. The most popular method among plant environmental ecologists is the thermal dissipation or 'Granier' method, the latter name for its inventor. In this method continuously heated and unheated sensors are inserted into the tree stem and the temperature difference between the two is roughly inversely proportional to sap flux density. Although the method can be accurate, sap flux density can be highly variable in the stem, depending on depth in the stem and azimuth. Inter-tree variation is also large, so a number of sensors per tree and a number of trees need to be monitored for accurate determinations. Finally, it is a good idea to calibrate the sensors for the configuration and species being monitored. We measured sap flow in a tree covered open mall and a city park in Beer Sheva, Israel - a hot and arid city. Trees that shaded the open mall were of the Delonix regia species while those in the park were Prosopis and Tamarix sp. Individual tree sap flux for large trees exceeded 100 liters on many of the days, equivalent to over 100 W m-2 at mid-day. This paper will discuss methodological issues as well as some of the results.

  10. Sap flow characteristics of neotropical mangroves in flooded and drained soils

    USGS Publications Warehouse

    Krauss, Ken W.; Young, P. Joy; Chambers, Jim L.; Doyle, Thomas W.; Twilley, Robert R.

    2007-01-01

    Effects of flooding on water transport in mangroves have previously been investigated in a few studies, most of which were conducted on seedlings in controlled settings. In this study, we used heat-dissipation sap probes to determine if sap flow (Js) attenuates with radial depth into the xylem of mature trees of three south Florida mangrove species growing in Rookery Bay. This was accomplished by inserting sap probes at multiple depths and monitoring diurnal flow. For most species and diameter size class combinations tested, Js decreased dramatically beyond a radial depth of 2 or 4 cm, with little sap flow beyond a depth of 6 cm. Mean Js was reduced on average by 20% in Avicennia germinans (L.) Stearn, Laguncularia racemosa (L.) Gaertn. f. and Rhizophora mangle L. trees when soils were flooded. Species differences were highly significant, with L. racemosahaving the greatest midday Js of about 26g H2O H2O m−2s−1 at a radial depth of 2 cm compared with a mean for the other two species of about 15 g H2O m−2s−1. Sap flow at a depth of 2 cm in mangroves was commensurate with rates reported for other forested wetland tree species. We conclude that: (1) early spring flooding of basin mangrove forests causes reductions in sap flow in mature mangrove trees; (2) the sharp attenuations in Js along the radial profile have implications for understanding whole-tree water use strategies by mangrove forests; and (3) regardless of flood state, individual mangrove tree water use follows leaf-level mechanisms in being conservative.

  11. A Critical Role for the GluA1 Accessory Protein, SAP97, in Cocaine Seeking

    PubMed Central

    White, Samantha L; Ortinski, Pavel I; Friedman, Shayna H; Zhang, Lei; Neve, Rachael L; Kalb, Robert G; Schmidt, Heath D; Pierce, R Christopher

    2016-01-01

    A growing body of evidence indicates that the transport of GluA1 subunit-containing calcium-permeable AMPA receptors (CP-AMPARs) to synapses in subregions of the nucleus accumbens promotes cocaine seeking. Consistent with these findings, the present results show that administration of the CP-AMPAR antagonist, Naspm, into the caudal lateral core or caudal medial shell of the nucleus accumbens attenuated cocaine priming-induced reinstatement of drug seeking. Moreover, viral-mediated overexpression of ‘pore dead' GluA1 subunits (via herpes simplex virus (HSV) GluA1-Q582E) in the lateral core or medial shell attenuated the reinstatement of cocaine seeking. The overexpression of wild-type GluA1 subunits (via HSV GluA1-WT) in the medial shell, but not the lateral core, enhanced the reinstatement of cocaine seeking. These results indicate that activation of GluA1-containing AMPARs in subregions of the nucleus accumbens reinstates cocaine seeking. SAP97 and 4.1N are proteins involved in GluA1 trafficking to and stabilization in synapses; SAP97-GluA1 interactions also influence dendritic growth. We next examined potential roles of SAP97 and 4.1N in cocaine seeking. Viral-mediated expression of a microRNA that reduces SAP97 protein expression (HSV miSAP97) in the medial accumbens shell attenuated cocaine seeking. In contrast, a virus that overexpressed a dominant-negative form of a 4.1N C-terminal domain (HSV 4.1N-CTD), which prevents endogenous 4.1N binding to GluA1 subunits, had no effect on cocaine seeking. These results indicate that the GluA1 subunit accessory protein SAP97 may represent a novel target for pharmacotherapeutic intervention in the treatment of cocaine craving. PMID:26149358

  12. Uncertainty in sap flow-based transpiration due to xylem properties

    NASA Astrophysics Data System (ADS)

    Looker, N. T.; Hu, J.; Martin, J. T.; Jencso, K. G.

    2014-12-01

    Transpiration, the evaporative loss of water from plants through their stomata, is a key component of the terrestrial water balance, influencing streamflow as well as regional convective systems. From a plant physiological perspective, transpiration is both a means of avoiding destructive leaf temperatures through evaporative cooling and a consequence of water loss through stomatal uptake of carbon dioxide. Despite its hydrologic and ecological significance, transpiration remains a notoriously challenging process to measure in heterogeneous landscapes. Sap flow methods, which estimate transpiration by tracking the velocity of a heat pulse emitted into the tree sap stream, have proven effective for relating transpiration dynamics to climatic variables. To scale sap flow-based transpiration from the measured domain (often <5 cm of tree cross-sectional area) to the whole-tree level, researchers generally assume constancy of scale factors (e.g., wood thermal diffusivity (k), radial and azimuthal distributions of sap velocity, and conducting sapwood area (As)) through time, across space, and within species. For the widely used heat-ratio sap flow method (HRM), we assessed the sensitivity of transpiration estimates to uncertainty in k (a function of wood moisture content and density) and As. A sensitivity analysis informed by distributions of wood moisture content, wood density and As sampled across a gradient of water availability indicates that uncertainty in these variables can impart substantial error when scaling sap flow measurements to the whole tree. For species with variable wood properties, the application of the HRM assuming a spatially constant k or As may systematically over- or underestimate whole-tree transpiration rates, resulting in compounded error in ecosystem-scale estimates of transpiration.

  13. Sap flow characteristics of neotropical mangroves in flooded and drained soils.

    PubMed

    Krauss, Ken W; Young, P Joy; Chambers, Jim L; Doyle, Thomas W; Twilley, Robert R

    2007-05-01

    Effects of flooding on water transport in mangroves have previously been investigated in a few studies, most of which were conducted on seedlings in controlled settings. In this study, we used heat-dissipation sap probes to determine if sap flow (J(s)) attenuates with radial depth into the xylem of mature trees of three south Florida mangrove species growing in Rookery Bay. This was accomplished by inserting sap probes at multiple depths and monitoring diurnal flow. For most species and diameter size class combinations tested, J(s) decreased dramatically beyond a radial depth of 2 or 4 cm, with little sap flow beyond a depth of 6 cm. Mean J(s) was reduced on average by 20% in Avicennia germinans (L.) Stearn, Laguncularia racemosa (L.) Gaertn. f. and Rhizophora mangle L. trees when soils were flooded. Species differences were highly significant, with L. racemosa having the greatest midday J(s) of about 26 g H(2)O m(-2) s(-1) at a radial depth of 2 cm compared with a mean for the other two species of about 15 g H(2)O m(-2) s(-1). Sap flow at a depth of 2 cm in mangroves was commensurate with rates reported for other forested wetland tree species. We conclude that: (1) early spring flooding of basin mangrove forests causes reductions in sap flow in mature mangrove trees; (2) the sharp attenuations in J(s) along the radial profile have implications for understanding whole-tree water use strategies by mangrove forests; and (3) regardless of flood state, individual mangrove tree water use follows leaf-level mechanisms in being conservative.

  14. Campylobacter fetus uses multiple loci for DNA inversion within the 5' conserved regions of sap homologs.

    PubMed

    Tu, Z C; Ray, K C; Thompson, S A; Blaser, M J

    2001-11-01

    Campylobacter fetus cells possess multiple promoterless sap homologs, each capable of expressing a surface layer protein (SLP) by utilizing a unique promoter present on a 6.2-kb invertible element. Each sap homolog includes a 626-bp 5' conserved region (FCR) with 74 bp upstream and 552 bp within the open reading frame. After DNA inversion, the splice is seamless because the FCRs are identical. In mutant strain 23D:ACA2K101, in which sapA and sapA2 flanking the invertible element in opposite orientations were disrupted by promoterless chloramphenicol resistance (Cm(r)) and kanamycin resistance (Km(r)) cassettes, respectively, the frequency of DNA inversion is 100-fold lower than that of wild-type strain 23D. To define the roles of a 15-bp inverted repeat (IR) and a Chi-like site (CLS) in the FCR, we mutagenized each upstream of sapA2 in 23D:ACA2K101 by introducing NotI and KpnI sites to create strains 23D:ACA2K101N and 23D:ACA2K101K, respectively. Alternatively selecting colonies for Cm(r) or Km(r) showed that mutagenizing the IR or CLS had no apparent effect on the frequency of the DNA inversion. However, mapping the unique NotI or KpnI site in relation to the Cm(r) or Km(r) cassette in the cells that changed phenotype showed that splices occurred both upstream and downstream of the mutated sites. PCR and sequence analyses also showed that the splice could occur in the 425-bp portion of the FCR downstream of the cassettes. In total, these data indicate that C. fetus can use multiple sites within the FCR for its sap-related DNA inversion.

  15. Measurement of sap flow in roots of woody plants: a commentary.

    PubMed

    Burgess, S S; Adams, M A; Bleby, T M

    2000-07-01

    Measurements of sap flow in roots have recently been used to study patterns of resource acquisition by woody plants; however, the various thermometric methods employed have yielded disparate findings. These findings may be harmonized by accounting for the phenomenon of reverse sap flow in roots. We suggest that only methods capable of measuring slow and reverse rates of flow and that do not require assumptions of zero flow during the night are applicable to studies with roots. The heat ratio method and the constant power heat balance method fit these criteria, whereas the constant temperature heat balance, compensation heat pulse and thermal dissipation methods do not.

  16. Regional Evapotranspiration Estimation by Using Wireless Sap Flow and Soil Moisture Measurement Systems

    NASA Astrophysics Data System (ADS)

    Kuo, C.; Yu, P.; Yang, T.; Davis, T. W.; Liang, X.; Tseng, C.; Cheng, C.

    2011-12-01

    The objective of this study proposed herein is to estimate regional evapotranspiration via sap flow and soil moisture measurements associated with wireless sensor network in the field. Evapotranspiration is one of the important factors in water balance computation. Pan evaporation collected from the meteorological station can only be accounted as a single-point scale measurement rather than the water loss of the entire region. Thus, we need a multiple-site measurement for understanding the regional evapotranspiration. Applying sap flow method with self-made probes, we could calculate transpiration. Soil moisture measurement was used to monitor the daily soil moisture variety for evaporation. Sap flow and soil moisture measurements in multiple sites are integrated by using wireless sensor network (WSN). Then, the measurement results of each site were scaled up and combined into the regional evapotranspiration. This study used thermal dissipation method to measure sap flow in trees to represent the plant transpiration. Sap flow was measured by using the self-made sap probes which needed to be calibrated before setting up at the observation field. Regional transpiration was scaled up through the Leaf Area Index (LAI). The LAI of regional scale was from the MODIS image calculated at 1km X 1km grid size. The soil moistures collected from areas outside the distributing area of tree roots and tree canopy were used to represent the evaporation. The observation was undertaken to collect soil moisture variety from five different soil depths of 10, 20, 30, 40 and 50 cm respectively. The regional evaporation can be estimated by averaging the variation of soil moisture from each site within the region. The result data measured by both sap flow and soil moisture measurements of each site were collected through the wireless sensor network. The WSN performs the functions of P2P and mesh networking. That can collect data in multiple locations simultaneously and has less power

  17. The density of the cell sap and endoplasm of Nitellopsis and Chara

    NASA Technical Reports Server (NTRS)

    Wayne, R.; Staves, M. P.

    1991-01-01

    We measured the densities of the cell sap, endoplasm and cell wall of Nitellopsis obtusa and Chara corallina using interference microscopy, refractometry, immersion refractometry, equilibrium sedimentation and chemical microanalysis techniques. These values are important for the determination of many rheological properties of the cytoplasm as well as for understanding buoyancy regulation, dispersal mechanisms and how cells respond to gravity. The average densities of the cell sap, endoplasm and cell wall are 1,006.9, 1,016.7 and 1,371 kg m-3 for Nitellopsis and 1,005.0, 1,013.9, and 1,355.3 kg m-3 for Chara.

  18. Estimating sap flux densities in date palm trees using the heat dissipation method and weighing lysimeters.

    PubMed

    Sperling, Or; Shapira, Or; Cohen, Shabtai; Tripler, Effi; Schwartz, Amnon; Lazarovitch, Naftali

    2012-09-01

    In a world of diminishing water reservoirs and a rising demand for food, the practice and development of water stress indicators and sensors are in rapid progress. The heat dissipation method, originally established by Granier, is herein applied and modified to enable sap flow measurements in date palm trees in the southern Arava desert of Israel. A long and tough sensor was constructed to withstand insertion into the date palm's hard exterior stem. This stem is wide and fibrous, surrounded by an even tougher external non-conducting layer of dead leaf bases. Furthermore, being a monocot species, water flow does not necessarily occur through the outer part of the palm's stem, as in most trees. Therefore, it is highly important to investigate the variations of the sap flux densities and determine the preferable location for sap flow sensing within the stem. Once installed into fully grown date palm trees stationed on weighing lysimeters, sap flow as measured by the modified sensors was compared with the actual transpiration. Sap flow was found to be well correlated with transpiration, especially when using a recent calibration equation rather than the original Granier equation. Furthermore, inducing the axial variability of the sap flux densities was found to be highly important for accurate assessments of transpiration by sap flow measurements. The sensors indicated no transpiration at night, a high increase of transpiration from 06:00 to 09:00, maximum transpiration at 12:00, followed by a moderate reduction until 08:00; when transpiration ceased. These results were reinforced by the lysimeters' output. Reduced sap flux densities were detected at the stem's mantle when compared with its center. These results were reinforced by mechanistic measurements of the stem's specific hydraulic conductivity. Variance on the vertical axis was also observed, indicating an accelerated flow towards the upper parts of the tree and raising a hypothesis concerning dehydrating

  19. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  20. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  1. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  2. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  3. Effects of Acer okamotoanum sap on the function of polymorphonuclear neutrophilic leukocytes in vitro and in vivo.

    PubMed

    An, Beum-Soo; Kang, Ji-Houn; Yang, Hyun; Yang, Mhan-Pyo; Jeung, Eui-Bae

    2013-02-01

    Sap is a plant fluid that primarily consists of water and small amounts of mineral elements, sugars, hormones and other nutrients. Acer mono (A. mono) is an endemic Korean mono maple which was recently suggested to have health benefits due to its abundant calcium and magnesium ion content. In the present study, we examined the effects of sap from Acer okamotoanum (A. okamotoanum) on the phagocytic response of mouse neutrophils in vivo and rat and canine neutrophils in vitro. We tested the regulation of phagocytic activity, oxidative burst activity (OBA) and the levels of filamentous polymeric actin (F-actin) in the absence and presence of dexamethasone (DEX) in vitro and in vivo. Our results showed that DEX primarily reduced OBA in the mouse neutrophils, and that this was reversed in the presence of the sap. By contrast, the phagocytic activity of the mouse cells was not regulated by either DEX or the sap. Rat and canine polymorphonuclear neutrophilic leukocytes (PMNs) responded in vitro to the sap in a similar manner by increasing OBA. However, regulation of phagocytic activity by the sap was different between the species. In canine PMNs, phagocytic activity was enhanced by the sap at a high dose, while it did not significantly modulate this activity in rat PMNs. These findings suggest that the sap of A. okamotoanum stimulates neutrophil activity in the mouse, rat and canine by increasing OBA in vivo and in vitro, and thus may have a potential antimicrobial effect in the PMNs of patients with infections.

  4. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  5. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  6. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  7. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources BUREAU OF OCEAN ENERGY... Pipeline Deviations § 285.659 What requirements must I include in my SAP, COP, or GAP regarding air...

  8. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air...

  9. Genetic variability of the phloem sap metabolite content of maize (Zea mays L.) during the kernel-filling period.

    PubMed

    Yesbergenova-Cuny, Zhazira; Dinant, Sylvie; Martin-Magniette, Marie-Laure; Quilleré, Isabelle; Armengaud, Patrick; Monfalet, Priscilla; Lea, Peter J; Hirel, Bertrand

    2016-11-01

    Using a metabolomic approach, we have quantified the metabolite composition of the phloem sap exudate of seventeen European and American lines of maize that had been previously classified into five main groups on the basis of molecular marker polymorphisms. In addition to sucrose, glutamate and aspartate, which are abundant in the phloem sap of many plant species, large quantities of aconitate and alanine were also found in the phloem sap exudates of maize. Genetic variability of the phloem sap composition was observed in the different maize lines, although there was no obvious relationship between the phloem sap composition and the five previously classified groups. However, following hierarchical clustering analysis there was a clear relationship between two of the subclusters of lines defined on the basis of the composition of the phloem sap exudate and the earliness of silking date. A comparison between the metabolite contents of the ear leaves and the phloem sap exudates of each genotype, revealed that the relative content of most of the carbon- and nitrogen-containing metabolites was similar. Correlation studies performed between the metabolite content of the phloem sap exudates and yield-related traits also revealed that for some carbohydrates such as arabitol and sucrose there was a negative or positive correlation with kernel yield and kernel weight respectively. A posititive correlation was also found between kernel number and soluble histidine.

  10. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  11. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh

    PubMed Central

    Nahar, Nazmun; Paul, Repon C.; Sultana, Rebeca; Gurley, Emily S.; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P.

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1–1.3, p<0.001). When sap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9–1.1, p = 0.512). Respondents’ knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission. PMID:26551202

  12. Phylogeny and expression analysis of C-reactive protein (CRP) and serum amyloid-P (SAP) like genes reveal two distinct groups in fish.

    PubMed

    Lee, P T; Bird, S; Zou, J; Martin, S A M

    2017-03-20

    The acute phase response (APR) is an early innate immune function that is initiated by inflammatory signals, leading to the release of acute phase proteins to the bloodstream to re-establish homeostasis following microbial infection. In this study we analysed the Atlantic salmon (Salmo salar) whole-genome database and identified five C-reactive protein (CRP)/serum amyloid P component (SAP) like molecules namely CRP/SAP-1a, CRP/SAP-1b, CRP/SAP-1c, CRP/SAP-2 and CRP/SAP-3. These CRP/SAP genes formed two distinct sub-families, a universal group (group I) present in all vertebrates and a fish/amphibian specific group (group II). Salmon CRP/SAP-1a, CRP/SAP-1b and CRP/SAP-1c and CRP/SAP-2 belong to the group I family whilst salmon CRP/SAP-3 is a member of group II. Gene expression analysis showed that the salmon CRP/SAP-1a as well as serum amyloid A-5 (SAA-5), one of the major acute phase proteins, were significantly up-regulated by recombinant cytokines (rIL-1β and rIFNγ) in primary head kidney cells whilst the other four CRP/SAPs remained refractory. Furthermore, SAA-5 was produced as the main acute phase protein (APP) in Atlantic salmon challenged with Aeromonas salmonicida (aroA(-) strain) whilst salmon CRP/SAPs remained unaltered. Overall, these data illustrate the potential different functions of expanded salmon CRP/SAPs to their mammalian homologues.

  13. Seasonal and diel variation in xylem CO2 concentration and sap pH in sub-Mediterranean oak stems.

    PubMed

    Salomón, Roberto; Valbuena-Carabaña, María; Teskey, Robert; McGuire, Mary Anne; Aubrey, Doug; González-Doncel, Inés; Gil, Luis; Rodríguez-Calcerrada, Jesús

    2016-04-01

    Since a substantial portion of respired CO2 remains within the stem, diel and seasonal trends in stem CO2 concentration ([CO2]) are of major interest in plant respiration and carbon budget research. However, continuous long-term stem [CO2] studies are scarce, and generally absent in Mediterranean climates. In this study, stem [CO2] was monitored every 15min together with stem and air temperature, sap flow, and soil water storage during a growing season in 16 stems of Quercus pyrenaica to elucidate the main drivers of stem [CO2] at different temporal scales. Fluctuations in sap pH were also assessed during two growing seasons to evaluate potential errors in estimates of the concentration of CO2 dissolved in xylem sap ([CO2*]) calculated using Henry's law. Stem temperature was the best predictor of stem [CO2] and explained more than 90% and 50% of the variability in stem [CO2] at diel and seasonal scales, respectively. Under dry conditions, soil water storage was the main driver of stem [CO2]. Likewise, the first rains after summer drought caused intense stem [CO2] pulses, suggesting enhanced stem and root respiration and increased resistance to radial CO2 diffusion. Sap flow played a secondary role in controlling stem [CO2] variations. We observed night-time sap pH acidification and progressive seasonal alkalinization. Thus, if the annual mean value of sap pH (measured at midday) was assumed to be constant, night-time sap [CO2*] was substantially overestimated (40%), and spring and autumn sap [CO2*] were misestimated by 25%. This work highlights that diel and seasonal variations in temperature, tree water availability, and sap pH substantially affect xylem [CO2] and sap [CO2*].

  14. Interactions Between QTL SAP6 and SU91 on Resistance to Common Bacterial Blight in Red Kidney Bean and Pinto Bean Populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to common bacterial blight in common bean is a complex trait that is quantitatively inherited. We examined the interaction between two independent QTL, SAP6 and SU91, which condition resistance to CBB.The QTL were studied in a pinto bean F2 population a cross between Othello (sap6 sap6 //...

  15. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  16. 30 CFR 585.611 - What information must I submit with my SAP to assist BOEM in complying with NEPA and other...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What information must I submit with my SAP to... of the Site Assessment Plan § 585.611 What information must I submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information...

  17. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  18. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  19. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  20. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  1. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  2. 30 CFR 285.611 - What information must I submit with my SAP to assist MMS in complying with NEPA and other...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What information must I submit with my SAP to... Assessment Plan § 285.611 What information must I submit with my SAP to assist MMS in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information to assist MMS in...

  3. 30 CFR 585.611 - What information must I submit with my SAP to assist BOEM in complying with NEPA and other...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What information must I submit with my SAP to... of the Site Assessment Plan § 585.611 What information must I submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information...

  4. 30 CFR 285.611 - What information must I submit with my SAP to assist MMS in complying with NEPA and other...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What information must I submit with my SAP to... Requirements Contents of the Site Assessment Plan § 285.611 What information must I submit with my SAP to assist MMS in complying with NEPA and other relevant laws? (a) You must submit with your SAP...

  5. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  6. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  7. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  8. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  9. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  10. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  11. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  12. 30 CFR 585.611 - What information and certifications must I submit with my SAP to assist BOEM in complying with...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? 585.611 Section 585.611... with my SAP to assist BOEM in complying with NEPA and other relevant laws? You must submit, with your SAP, detailed information to assist BOEM in complying with NEPA and other relevant laws as...

  13. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  14. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  15. MusaSAP1, a A20/AN1 zinc finger gene from banana functions as a positive regulator in different stress responses.

    PubMed

    Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R

    2012-11-01

    A20/AN1 zinc finger domain containing Stress Associated Proteins (SAP) are involved in diverse stress response pathways in plants. In the present study, a novel banana SAP gene, MusaSAP1, was identified from banana EST database and was subsequently characterized by overexpression in transgenic banana plants. Expression profiling in native banana plants showed that MusaSAP1 was up-regulated by drought, salt, cold, heat and oxidative stress as well as by treatment with abscisic acid. Cellular localization assay carried out by making a MusaSAP1::GFP fusion protein indicated that MusaSAP1 is incompletely translocated to nucleus. Copy number analysis performed using real time PCR and Southern blotting indicated that MusaSAP1 occurs in the banana genome in a single copy per 11 chromosome set. Transgenic banana plants constitutively overexpressing MusaSAP1 displayed better stress endurance characteristics as compared to controls in both in vitro and ex vivo assays. Lesser membrane damage as indicated by reduced malondialdehyde levels in transgenic leaves subjected to drought, salt or oxidative stress pointed towards significant role for MusaSAP1 in stress amelioration pathways of banana. Strong up-regulation of a polyphenol oxidase (PPO) coding transcript in MusaSAP1 overexpressing plants together with induction of MusaSAP1 by wounding and methyl jasmonate treatment indicated possible involvement of MusaSAP1 in biotic stress responses where PPOs perform major functions in multiple defense pathways.

  16. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    PubMed

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  17. Nickel sorption capacity of ground xylem of Quercus ilex trees and effects of selected ligands present in the xylem sap.

    PubMed

    Araújo, Geórgia C L; Lemos, Sherlan G; Nabais, Cristina

    2009-02-15

    In this work the influence of four different ligands present in the xylem sap of Quercus ilex (histidine, citric, oxalic and aspartic acids) on Ni(II) adsorption by xylem was investigated. Grinded xylem was trapped in acrylic columns and solutions of Ni(II), in the absence and presence of the four ligands prepared in KNO(3) 0.1molL(-1) at pH 5.5, were percolated through the column. Aliquots of solutions were recovered in the column end for Ni determination by graphite furnace atomic absorption spectrometry (GFAAS). The experimental data to describe Ni sorption by xylem in both the presence and absence of ligands was better explained by the Freundlich isotherm model. The decreasing affinity order of ligands for Ni was: oxalic acid>citric acid>histidine>aspartic acid. On the other hand, the Ni(II) adsorption by xylem increased following the inverse sequence of ligands. Potentiometric titrations of acidic groups were carried out to elucidate the sorption site groups available in Q. ilex xylem. The potentiometric titration has shown three sorption sites: pK(a) 2.6 (57.7% of the sorption sites), related to monobasic aliphatic carboxylic acids or nitrogen aromatic bases, pK(a) 8.1 (9.6%) and pK(a) 9.9 (32.7%), related to phenolic groups.

  18. [Influence of measurement position on calculating pear tree stem sap flow].

    PubMed

    Sun, Huizhen; Kang, Sha-Ozhong; Gong, Daozhi

    2006-11-01

    By the method of heat pulse, this paper studied the influence of different measurement positions on calculating the stem sap flow velocity and quantity of pear trees. The results showed that at definite depths, the directional variation of the volume fraction of water and wood was lower than the seasonal change of wood physical parameters. The directional and seasonal variation of the volumetric water and wood was 0.01 - 0.03 and 0 - 0.02, and 0.02 - 0.09 and 0.02 -0.08, respectively. The sap flow velocity at definite depth, which was calculated by different depths wood physical parameters measured at the same time, had no significant difference, but that calculated by the same depth wood parameters measured at different time was significantly different. The sap flow quantity measured at the inner two points and four points was underestimated 1.5 and 4.9 times of that measured at the outer corresponding measurement positions, relative to the estimation obtained from a multi-point measurement. The sap flow quantity measured by four-point at the position of 0 - 0.6 from the cambium could represent the water consumption of whole tree.

  19. Plant eats plant: sap-feeding witchweeds and other parasitic angiosperms.

    PubMed

    Press, M C; Gurney, A L

    2000-09-01

    About one in every hundred species of flowering plant is parasitic and obtain some or all of their carbon, nutrients and water from the sap of their hosts. They possess unique morphological and metabolic adaptations but are more than just botanical curiosities.

  20. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  1. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  2. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  3. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  4. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  5. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  6. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  7. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  8. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  9. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  10. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  11. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  12. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  13. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  14. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  15. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  16. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  17. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  18. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  19. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  20. 30 CFR 585.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Section 585.605 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE... Information Requirements Site Assessment Plan and Information Requirements for Commercial Leases § 585.605... lease, including your project easement, or to test technology devices. (1) Your SAP must describe...

  1. 30 CFR 585.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Section 585.605 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE... Information Requirements Site Assessment Plan and Information Requirements for Commercial Leases § 585.605... lease, including your project easement, or to test technology devices. (1) Your SAP must describe...

  2. 30 CFR 585.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Section 585.605 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE... Information Requirements Site Assessment Plan and Information Requirements for Commercial Leases § 585.605... lease, including your project easement, or to test technology devices. (1) Your SAP must describe...

  3. Maple sap predominant microbial contaminants are correlated with the physicochemical and sensorial properties of maple syrup.

    PubMed

    Filteau, Marie; Lagacé, Luc; Lapointe, Gisèle; Roy, Denis

    2012-03-01

    Maple sap processing and microbial contamination are significant aspects that affect maple syrup quality. In this study, two sample sets from 2005 and 2008 were used to assess the maple syrup quality variation and its relationship to microbial populations, with respect to processing, production site and harvesting period. The abundance of maple sap predominant bacteria (Pseudomonas fluorescens group and two subgroups, Rahnella spp., Janthinobacterium spp., Leuconostoc mesenteroides) and yeast (Mrakia spp., Mrakiella spp.,Guehomyces pullulans) was assessed by quantitative PCR. Maple syrup properties were analyzed by physicochemical and sensorial methods. Results indicate that P. fluorescens, Mrakia spp., Mrakiella spp. G. pullulans and Rahnella spp. are stable contaminants of maple sap, as they were found for every production site throughout the flow period. Multiple factor analysis reports a link between the relative abundance of P. fluorescens group and Mrakia spp. in maple sap with maple and vanilla odor as well as flavor of maple syrup. This evidence supports the contribution of these microorganisms or a consortium of predominant microbial contaminants to the characteristic properties of maple syrup.

  4. Effects of Fe deficiency on the protein profile of Brassica napus phloem sap

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of this work was to study the effect of Fe deficiency on the protein profile of phloem sap exudates from Brassica napus using 2-DE (IEF-SDS PAGE). The experiment was repeated thrice and two technical replicates per treatment were done. Two hundred sixty-three spots were consistently detected...

  5. Protein profile of Lupinus texensis phloem sap exudates: searching for Fe- and Zn-containing proteins.

    PubMed

    Lattanzio, Giuseppe; Andaluz, Sofía; Matros, Andrea; Calvete, Juan José; Kehr, Julia; Abadía, Anunciación; Abadía, Javier; López-Millán, Ana-Flor

    2013-08-01

    The aim of this study was to obtain a comprehensive overview of the phloem sap protein profile of Lupinus texensis, with a special focus on proteins binding Fe and Zn. L. texensis was chosen as model plant given the simplicity to obtain exudates from sieve elements. Protein profiling by 2DE revealed 249 spots, and 54 of them were unambiguously identified by MALDI-MS and ESI-MS/MS. The largest number of identified protein species belongs to protein modification/turnover and general metabolism (19-21%), followed by redox homeostasis (9%) and defense and cell structural components (7%). This protein profile is similar to that reported in other plant species, suggesting that the phloem sap proteome is quite conserved. Staining of 2DE gels for Fe-containing proteins and affinity chromatography experiments revealed the presence of two low molecular weight Fe-binding proteins in phloem sap: a metallothionein-like protein type 2B identified in the Fe-affinity chromatography, and a second protein identified with both Fe staining methods. This protein species had a molecular weight of 13.5 kDa, a pI of 5.6 and 51% homology to a phloem-specific protein from Medicago truncatula. Zinc affinity chromatography revealed four Zn-binding proteins in phloem sap, one belonging to the dehydrin family and three Zn finger proteins.

  6. 'Late winter/early spring' xylem sap characteristics influence pecan crop load

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alternate bearing by individual pecan [Carya illinoinensis (Wangenh.) K. Koch] trees is problematic for nut producers and processors. There are many unknowns regarding alternate bearing physiology, such as the relationship between xylem sap flow, and its constituent sugars, with subsequent crop-loa...

  7. Limitations in the hydraulic pathway: Effects of xylem embolisms on sap velocity and flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow in plants takes place in the xylem, a hydraulic system that is usually under negative pressure and in which gas and liquid phases are separated by nanoporous, fibrous pit membranes. It has long been known that this system is at risk of drawing gas nanobubbles through these membranes into th...

  8. Integrating Enterprise Resource Planning (SAP) in the Accounting Curriculum: A Systematic Literature Review and Case Study

    ERIC Educational Resources Information Center

    Blount, Yvette; Abedin, Babak; Vatanasakdakul, Savanid; Erfani, Seyedezahra

    2016-01-01

    This study investigates how an enterprise resource planning (ERP) software package SAP was integrated into the curriculum of an accounting information systems (AIS) course in an Australian university. Furthermore, the paper provides a systematic literature review of articles published between 1990 and 2013 to understand how ERP systems were…

  9. An investigation of potential applications of OP-SAPS: Operational Sampled Analog Processors

    NASA Technical Reports Server (NTRS)

    Parrish, E. A.; Mcvey, E. S.

    1977-01-01

    The application of OP-SAP's (operational sampled analog processors) in pattern recognition system is summarized. Areas investigated include: (1) human face recognition; (2) a high-speed programmable transversal filter system; (3) discrete word (speech) recognition; and (4) a resolution enhancement system.

  10. Effects of air injection during sap processing on maple syrup color, chemical composition and flavor volatiles.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Air injection (AI) is a maple sap processing technology reported to increase the efficiency of maple syrup production by increasing production of more economically valuable light-colored maple syrup, and reducing development of loose scale mineral precipitates in syrup, and scale deposits on evapora...

  11. Better prognostic marker in ICU - APACHE II, SOFA or SAP II!

    PubMed Central

    Naqvi, Iftikhar Haider; Mahmood, Khalid; Ziaullaha, Syed; Kashif, Syed Mohammad; Sharif, Asim

    2016-01-01

    Objectives: This study was designed to determine the comparative efficacy of different scoring system in assessing the prognosis of critically ill patients. Methods: This was a retrospective study conducted in medical intensive care unit (MICU) and high dependency unit (HDU) Medical Unit III, Civil Hospital, from April 2012 to August 2012. All patients over age 16 years old who have fulfilled the criteria for MICU admission were included. Predictive mortality of APACHE II, SAP II and SOFA were calculated. Calibration and discrimination were used for validity of each scoring model. Results: A total of 96 patients with equal gender distribution were enrolled. The average APACHE II score in non-survivors (27.97+8.53) was higher than survivors (15.82+8.79) with statistically significant p value (<0.001). The average SOFA score in non-survivors (9.68+4.88) was higher than survivors (5.63+3.63) with statistically significant p value (<0.001). SAP II average score in non-survivors (53.71+19.05) was higher than survivors (30.18+16.24) with statistically significant p value (<0.001). Conclusion: All three tested scoring models (APACHE II, SAP II and SOFA) would be accurate enough for a general description of our ICU patients. APACHE II has showed better calibration and discrimination power than SAP II and SOFA. PMID:27882011

  12. Impact of the Mekong River flow alteration on the Tonle Sap flood pulse.

    PubMed

    Kummu, Matti; Sarkkula, Juha

    2008-05-01

    Rapid development in the upper reaches of the Mekong River, in the form of construction of large hydropower dams and reservoirs, large irrigation schemes, and rapid urban development, is putting water resources under stress. Recent studies have concluded that these developments will lead to flow alterations in the Mekong River. These flow alterations would threaten the sensitive ecosystems downstream, particularly Tonle Sap River, Tonle Sap Lake, its floodplain, and its gallery forest and protected areas, by changing the flood-pulse system of the lake. This article estimates the changes in parameters of the Tonle Sap flood pulse due to the aforementioned flow alterations. The impacts on the flooded area and loss of gallery forest and protected areas were analyzed using geographic information system-based methods. Relatively small rises in the dry-season lake water level would permanently inundate disproportionately large areas of floodplain, rendering it inaccessible to floodplain vegetation and eroding the productivity basis of the ecosystem. It is highly important to maintain the natural hydrological pattern of the Mekong River, particularly the dry-season water levels, to preserve Tonle Sap Lake's ecosystem productivity.

  13. N-terminal SAP97 isoforms differentially regulate synaptic structure and postsynaptic surface pools of AMPA receptors.

    PubMed

    Goodman, Lucy; Baddeley, David; Ambroziak, Wojciech; Waites, Clarissa L; Garner, Craig C; Soeller, Christian; Montgomery, Johanna M

    2017-02-28

    The location and density of postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors is controlled by scaffolding proteins within the postsynaptic density (PSD). SAP97 is a PSD protein with two N-terminal isoforms, α and β, that have opposing effects on synaptic strength thought to result from differential targeting of AMPA receptors into distinct synaptic versus extrasynaptic locations, respectively. In this study, we have applied dSTORM super resolution imaging in order to localize the synaptic and extrasynaptic pools of AMPA receptors in neurons expressing α or βSAP97. Unexpectedly, we observed that both α and βSAP97 enhanced the localization of AMPA receptors at synapses. However, this occurred via different mechanisms: αSAP97 increased PSD size and consequently the number of receptor binding sites, whilst βSAP97 increased synaptic receptor cluster size and surface AMPA receptor density at the PSD edge and surrounding perisynaptic sites without changing PSD size. αSAP97 also strongly enlarged presynaptic active zone protein clusters, consistent with both presynaptic and postsynaptic enhancement underlying the previously observed αSAP97-induced increase in AMPA receptor-mediated currents. In contrast, βSAP97-expressing neurons increased the proportion of immature filopodia that express higher levels of AMPA receptors, decreased the number of functional presynaptic terminals, and also reduced the size of the dendritic tree and delayed the maturation of mushroom spines. Our data reveal that SAP97 isoforms can specifically regulate surface AMPA receptor nanodomain clusters, with βSAP97 increasing extrasynaptic receptor domains at peri-synaptic and filopodial sites. Moreover, βSAP97 negatively regulates synaptic maturation both structurally and functionally. These data support diverging presynaptic and postsynaptic roles of SAP97 N-terminal isoforms in synapse maturation and plasticity. As numerous splice isoforms exist in

  14. A statistical method for estimating wood thermal diffusivity and probe geometry using in situ heat response curves from sap flow measurements

    SciTech Connect

    Chen, Xingyuan; Miller, Gretchen R.; Rubin, Yoram; Baldocchi, Dennis

    2012-09-13

    The heat pulse method is widely used to measure water flux through plants; it works by inferring the velocity of water through a porous medium from the speed at which a heat pulse is propagated through the system. No systematic, non-destructive calibration procedure exists to determine the site-specific parameters necessary for calculating sap velocity, e.g., wood thermal diffusivity and probe spacing. Such parameter calibration is crucial to obtain the correct transpiration flux density from the sap flow measurements at the plant scale; and consequently, to up-scale tree-level water fluxes to canopy and landscape scales. The purpose of this study is to present a statistical framework for estimating the wood thermal diffusivity and probe spacing simutaneously from in-situ heat response curves collected by the implanted probes of a heat ratio apparatus. Conditioned on the time traces of wood temperature following a heat pulse, the parameters are inferred using a Bayesian inversion technique, based on the Markov chain Monte Carlo sampling method. The primary advantage of the proposed methodology is that it does not require known probe spacing or any further intrusive sampling of sapwood. The Bayesian framework also enables direct quantification of uncertainty in estimated sap flow velocity. Experiments using synthetic data show that repeated tests using the same apparatus are essential to obtain reliable and accurate solutions. When applied to field conditions, these tests are conducted during different seasons and automated using the existing data logging system. The seasonality of wood thermal diffusivity is obtained as a by-product of the parameter estimation process, and it is shown to be affected by both moisture content and temperature. Empirical factors are often introduced to account for the influence of non-ideal probe geometry on the estimation of heat pulse velocity, and they are estimated in this study as well. The proposed methodology can be applied for

  15. Extending periodic eddy covariance latent heat fluxes through tree sap-flow measurements to estimate long-term total evaporation in a peat swamp forest

    NASA Astrophysics Data System (ADS)

    Clulow, A. D.; Everson, C. S.; Mengistu, M. G.; Price, J. S.; Nickless, A.; Jewitt, G. P. W.

    2015-05-01

    A combination of measurement and modelling was used to find a pragmatic solution to estimate the annual total evaporation from the rare and indigenous Nkazana Peat Swamp Forest (PSF) on the east coast of Southern Africa to improve the water balance estimates within the area. Actual total evaporation (ETa) was measured during three window periods (between 7 and 9 days each) using an eddy covariance (EC) system on a telescopic mast above the forest canopy. Sap flows of an understory tree and an emergent tree were measured using a low-maintenance heat pulse velocity system for an entire hydrological year (October 2009 to September 2010). An empirical model was derived, describing the relationship between ETa from the Nkazana PSF and sap-flow measurements. These overlapped during two of the window periods (R2 = 0.92 and 0.90), providing hourly estimates of ETa from the Nkazana PSF for a year, totalling 1125 mm (while rainfall was 650 mm). In building the empirical model, it was found that to include the understory tree sap flow provided no benefit to the model performance. In addition, the relationship between the emergent tree sap flow with ETa between the two field campaigns was consistent and could be represented by a single empirical model (R2 = 0.90; RMSE = 0.08 mm h-1). During the window periods of EC measurement, no single meteorological variable was found to describe the Nkazana PSF ETa satisfactorily. However, in terms of evaporation models, the hourly FAO Penman-Monteith reference evaporation (ETo) best described ETa during the August 2009 (R2 = 0.75), November 2009 (R2 = 0.85) and March 2010 (R2 = 0.76) field campaigns, compared to the Priestley-Taylor potential evaporation (ETp) model (R2 = 0.54, 0.74 and 0.62 during the respective field campaigns). From the extended record of ETa (derived in this study from sap flow) and ETo, a monthly crop factor (Kc) was derived for the Nkazana PSF, providing a method of estimating long-term swamp forest water-use from

  16. Utilization of chitosan as an antimicrobial agent for pasteurized palm sap (Borassus flabellifer Linn.) during storage.

    PubMed

    Naknean, Phisut; Jutasukosol, Keawta; Mankit, Theerarat

    2015-02-01

    The objective of this research was to assess the potential of chitosan for improvement the quality of pasteurized palm sap during storage. First, the effect of chitosan content on sensory attributes was investigated to select suitable concentration of chitosan for further study. Fresh palm sap was enriched with chitosan at various concentrations (0-2 g/L) and pasteurized at 80 °C for 10 min, consequently evaluated by consumers. It was found that samples added chitosan in the range of 0-1.00 g/L were considered acceptable. Thus, the addition chitosan in the concentration of 0-1.00 g/L was chosen for further study. The sample without chitosan addition was used as a control sample. Each selected sample was determined for their qualities during storage at 1 week interval. It was found that lightness and transmittance values of all samples tended to increase during storage. Lower PPO and invertase activity were observed in all chitosan-treated samples compared to control sample. Chitosan could minimize the loss of sucrose and the increase in glucose and fructose content during storage. In addition, an increase in chitosan concentration resulted in the increase in DPPH radical scavenging activity. Furthermore, the addition of chitosan could retard the development of microorganism during storage as demonstrated by lower microbial loads compared to control sample. It can be concluded that a combination of pasteurization with chitosan addition (0.50 g/L) and low temperature storage could preserve palm sap for approximately 6 weeks. Thus, the incorporation of chitosan in palm sap could be used as an alternative way to extend shelf life of pasteurized palm sap.

  17. [Time lag effect between poplar' s sap flow velocity and microclimate factors in agroforestry system in West Liaoning Province].

    PubMed

    Di, Sun; Guan, De-xin; Yuan, Feng-hui; Wang, An-zhi; Wu, Jia-bing

    2010-11-01

    By using Granier's thermal dissipation probe, the sap flow velocity of the poplars in agroforestry system in west Liaoning was continuously measured, and the microclimate factors were measured synchronously. Dislocation contrast method was applied to analyze the sap flow velocity and corresponding air temperature, air humidity, net radiation, and vapor pressure deficit to discuss the time lag effect between poplar' s sap flow velocity and microclimate factors on sunny days. It was found that the poplar's sap flow velocity advanced of air temperature, air humidity, and vapor pressure deficit, and lagged behind net radiation. The sap flow velocity in June, July, August, and September was advanced of 70, 30, 50, and 90 min to air temperature, of 80, 30, 40, and 90 min to air humidity, and of 90, 50, 70, and 120 min to vapor pressure deficit, but lagged behind 10, 10, 40, and 40 min to net radiation, respectively. The time lag time of net radiation was shorter than that of air temperature, air humidity, and vapor pressure. The regression analysis showed that in the cases the time lag effect was contained and not, the determination coefficients between comprehensive microclimate factor and poplar's sap flow velocity were 0.903 and 0.855, respectively, indicating that when the time lag effect was contained, the determination coefficient was ascended by 2.04%, and thus, the simulation accuracy of poplar's sap flow velocity was improved.

  18. SAP gene transfer restores cellular and humoral immune function in a murine model of X-linked lymphoproliferative disease.

    PubMed

    Rivat, Christine; Booth, Claire; Alonso-Ferrero, Maria; Blundell, Michael; Sebire, Neil J; Thrasher, Adrian J; Gaspar, H Bobby

    2013-02-14

    X-linked lymphoproliferative disease (XLP1) arises from mutations in the gene encoding SLAM-associated protein (SAP) and leads to abnormalities of NKT-cell development, NK-cell cytotoxicity, and T-dependent humoral function. Curative treatment is limited to allogeneic hematopoietic stem cell (HSC) transplantation. We tested whether HSC gene therapy could correct the multilineage defects seen in SAP(-/-) mice. SAP(-/-) murine HSCs were transduced with lentiviral vectors containing either SAP or reporter gene before transplantation into irradiated recipients. NKT-cell development was significantly higher and NK-cell cytotoxicity restored to wild-type levels in mice receiving the SAP vector in comparison to control mice. Baseline immunoglobulin levels were significantly increased and T-dependent humoral responses to NP-CGG, including germinal center formation, were restored in SAP-transduced mice.We demonstrate for the first time that HSC gene transfer corrects the cellular and humoral defects in SAP(-/-) mice providing proof of concept for gene therapy in XLP1.

  19. [Characteristics of Caragana microphylla sap flow and water consumption under different weather conditions on Horqin sandy land of northeast China].

    PubMed

    Yue, Guang-Yang; Zhao, Ha-Lin; Zhang, Tong-Hui; Yun, Jian-Ying; Niu, Li; He, Yu-Hui

    2007-10-01

    Employing heat balance Dynamax packaged sap flow measuring system and automatic weather recording system, the sap flow of artificial Caragana microphylla community on Horqin sandy land of northeast China was monitored consecutively in 2006, and the photosynthetically effective radiation, air temperature, relative humidity and wind velocity were measured synchronously. According to the manual records of weather conditions, four most representative weather conditions were gathered up to analyze the relationships of C. microphylla sap flow and its single branch water consumption with test meteorological factors. The results showed that under high air temperature and intense radiation on sunny days, the diurnal variation of C. microphylla sap flow appeared a broad peak curve, so as to adapt the circumstance of drought and water shortage via lower transpiration. The diurnal variations of sap flow and its dominant affecting factors differed with weather conditions, and photosynthetically effective radiation was always the dominant factor affecting the sap flow. The variation of the sap flow was the result of comprehensive effects of multi-meteorological factors, and the overall variation trend of water consumption of single branch was declined in the order of sunny days > cloudy days > windy days > rainy days, with the mean value being 459, 310, 281 and 193 mg x d(-1), respectively.

  20. Effect of multivalent ions on the swelling and mechanical behavior of superabsorbent polymers (SAPs) for mitigation of mortar autogenous shrinkage

    NASA Astrophysics Data System (ADS)

    Zhu, Qian

    The chemical and physical structure-property relationships of model superabsorbent polymer (SAP) hydrogels were characterized with respect to swelling behavior and mechanical properties in different ionic solutions (Na+, Ca2+, and Al3+). The model hydrogels were composed of poly(sodium acrylate-acrylamide) (PANa-PAM) copolymer with varying concentrations of PANa (0, 17, 33, 67, and 83 wt.%) and covalent crosslinking densities of 1, 1.5, and 2 wt.%. By synthesizing the hydrogels in-house, systems with independently tunable amounts of covalent crosslinking and anionic functional groups were created, allowing for the relative effects of covalent and ionic crosslinking on the properties of the hydrogels to be directly quantified. It was found that the presence of Ca2+ and Al3+ in the absorbed fluid significantly decreased the swelling capacity and altered the swelling kinetics of the PANa-PAM hydrogels. The presence of Al 3+ in solution resulted in the unexpected formation of a mechanically stiff barrier layer at the hydrogel's surface, which hindered the release of fluid and caused the overall elastic modulus of the hydrogel to increase from O(10 kPa) for hydrogels immersed in Ca2+ solutions to O(100 kPa) for hydrogels immersed in Al3+ solutions. Tensile tests performed on isolated specimens of the stiff barrier layer yielded elastic moduli in the O(50-100 MPa) range. Further experiments proved that PANa-PAM hydrogels are effective to keep mortar internal relative humidity at high value (~98%) during setting and also PANa-PAM decreased the autogenous shrinkage of mortar to less than 50 microstrain while plain mortar showed 350 microstrain.

  1. Curios relationship revealed by looking at long term data sets-The geometry and allometric scaling of diel xylem sap flux in tropical trees.

    PubMed

    Kunert, Norbert

    2016-10-20

    Daily xylem sap flux values (daily Js) and maximum xylem sap flux values (max Js) from 125 tropical trees from different study sites in the Neotropics were compared. A cross species and study site relationship was found between daily and maximum values. The relationship can be expressed as daily Js=6.5x max Js. The geometrical relationship between the maximum xylem sap flux of a given day is thus defining the daily xylem sap flux rates. Assuming a bell-shaped diurnal sap flux course and a relatively constant day length the maximum xylem sap flux is the only possible changing variable to define daily fluxes. Further, this relationship is showing the inertia of the xylem sap flux as a physical object and highlights the delayed response to environmental changes and its subsequent inevitable susceptibility under environmental stress to hydraulic failure.

  2. An empirical study of the wound effects on sap flow measured with thermal dissipation probes

    NASA Astrophysics Data System (ADS)

    Wiedemann, Andreas; Marañón-Jiménez, Sara; Herbst, Mathias; Cuntz, Matthias; Rebmann, Corinna

    2014-05-01

    The eddy covariance technique allows the estimation of the evapotranspiration (evaporation and transpiration) at the stand level. Sap flow sensors have become widely used in combination with eddy covariance to assess the contribution of plant transpiration to the ecosystem evapotranspiration. Among the different techniques, the thermal dissipation (TD) is one of the most popular methods for sap flow measurements due to its straightforward use. As other methods, the TD technique implies a damage of the wood tissue, consequently changing wood thermal properties due to healing reactions. This may lead to an underestimation of sap flow and thus, to a lack of convergence with the ecosystem water flux at the ecosystem level measured by eddy covariance. However, the wound effect has not yet been experimentally assessed for the TD method. In this study we conducted an experiment to investigate the effect of wound healing on sap flux densities measured with TD probes. Our main goal is to establish specific correction factors for both ring-porous and diffuse-porous species, according to the time that passed since installation. Successive sets of TD probes were installed in early-, mid- and end-growing season in diffuse- and ring-porous trees (Fagus sylvatica and Quercus petraea) in order to test the effects of dynamic wound formation. The trees were cut in autumn and, afterwards, additional sets of sensors were installed in each stem segment, thus without wound reaction. Natural ranges of flux densities were applied through the segments in the laboratory and measured gravimetrically and by the TD sensors simultaneously. Gravimetric flow was then compared to the TD sensors with and without wound reactions. Preliminary results show that the utilization of the original calibration function, for sensors located in older measuring points (wounded tissue) measured lower sap flux densities than sensors installed after the tree harvest (without wound). Production of thick

  3. SAP97 Controls the Trafficking and Resensitization of the Beta-1-Adrenergic Receptor through Its PDZ2 and I3 Domains

    PubMed Central

    Nooh, Mohammed M.; Naren, Anjaparavanda P.; Kim, Sung-Jin; Xiang, Yang K.; Bahouth, Suleiman W.

    2013-01-01

    Previous studies have determined that the type-1 PDZ sequence at the extreme carboxy-terminus of the ß1-adrenergic receptor (ß1-AR) binds SAP97 and AKAP79 to organize a scaffold involved in trafficking of the ß1-AR. In this study we focused on characterizing the domains in SAP97 that were involved in recycling and resensitization of the ß1-AR in HEK-293 cells. Using a SAP97 knockdown and rescue strategy, we determined that PDZ-deletion mutants of SAP97 containing PDZ2 rescued the recycling and resensitization of the ß1-AR. Among the three PDZs of SAP97, PDZ2 displayed the highest affinity in binding to the ß1-AR. Expression of isolated PDZ2, but not the other PDZs, inhibited the recycling of the ß1-AR by destabilizing the macromolecular complex involved in trafficking and functional resensitization of the ß1-AR. In addition to its PDZs, SAP97 contains other protein interacting domains, such as the I3 sequence in the SRC homology-3 (SH3) domain, which binds to AKAP79. Deletion of I3 from SAP97 (ΔI3-SAP97) did not affect the binding of SAP97 to the ß1-AR. However, ΔI3-SAP97 could not rescue the recycling of the ß1-AR because it failed to incorporate AKAP79/PKA into the SAP97-ß1-AR complex. Therefore, bipartite binding of SAP97 to the ß1-AR and to AKAP79 is necessary for SAP97-mediated effects on recycling, externalization and functional resensitization of the ß1-AR. These data establish a prominent role for PDZ2 and I3 domains of SAP97 in organizing the ß1-adrenergic receptosome involved in connecting the ß1-AR to trafficking and signaling networks. PMID:23696820

  4. A non-glycosylated and functionally deficient mutant (N215H) of the sphingolipid activator protein B (SAP-B) in a novel case of metachromatic leukodystrophy (MLD).

    PubMed

    Wrobe, D; Henseler, M; Huettler, S; Pascual Pascual, S I; Chabas, A; Sandhoff, K

    2000-02-01

    The lysosomal degradation of sphingolipids with short oligosaccharide chains depends on small glycosylated non-enzymatic sphingolipid activator proteins (SAPs, saposins). Four of the five known SAPs, SAP-A, -B, -C and -D, are derived by proteolytic processing from a common precursor protein (SAP-precursor) that is encoded by a gene on chromosome 10 consisting of 15 exons and 14 introns. SAP-B is a non-specific glycolipid binding protein that stimulates in vitro the hydrolysis of about 20 glycolipids by different enzymes. In vivo SAP-B stimulates in particular the degradation of sulphatides by arylsulphatase A. So far, four different point mutations have been identified on the SAP-B domain of the SAP-precursor gene. The mutations result in a loss of mature SAP-B, causing the lysosomal accumulation of sulphatides and other sphingolipids, resulting in variant forms of metachromatic leukodystrophy (MLD). Here we report on a patient with SAP-B deficiency that is caused by a new homoallelic point mutation that has been identified by mRNA and DNA analysis. A 643A > C transversion results in the exchange of asparagine 215 to histidine and eliminates the single glycosylation site of SAP-B. Metabolic labelling experiments showed that the mutation had no effect on the intracellular transport of the encoded precursor to the acidic compartments and its maturation in the patient's cells. All four SAPs (SAP-A to SAP-D) were detectable by immunochemical methods. SAP-B in the patient's cells was found to be slightly less stable than the protein in normal cells and corresponded in size to the deglycosylated form of the wild-type SAP-B. Feeding studies with non-glycosylated SAP-precursor, generating non-glycosylated SAP-B, showed that the loss of the carbohydrate chain reduced the intracellular activity of the protein significantly. The additional structural change of the patient's SAP-B, caused by the change of amino acid 215 from asparagine to histidine, presumably resulted in an

  5. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand

    PubMed Central

    Charles, Kerry E.; Linklater, Wayne L.

    2013-01-01

    Simple Summary Understanding the behavior of problem animal species assists in understanding and mitigating problems caused by wildlife in urban landscapes. The kākā, a threatened New Zealand native parrot, causes damage to trees while feeding on sap. Through observations of sap foraging kākā in Wellington City, this study builds on the limited knowledge of sap feeding and tests hypotheses about the age and sex of sap feeding birds. We found that sap feeding likely occurs in both sexes and across age groups, and that sap feeding birds also utilize supplementary food. This study suggests that sap is an important food source for kākā and that further provision of supplementary food is unlikely to reduce sap feeding and associated tree damage. Abstract The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60–100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed

  6. An Empirical Study of the Wound Effects on Sap Flow Measured with Thermal Dissipation Probes

    NASA Astrophysics Data System (ADS)

    Wiedemann, A.; Marañón-Jiménez, S.; Herbst, M.; Cuntz, M.; Rebmann, C.

    2014-12-01

    Sap flow sensors are common to assess the contribution of tree transpiration to ecosystem evapotranspiration (ET). Thermal dissipation (TD) is one of the most popular methods for sap measurements but the insertion of TD probes in the tree stems imply wounding of the wood tissue and a consequent alteration of the sap flow. But the determination of sap flux density (SFD) is based on an empirical function developed for freshly drilled holes and it does hence not account for the wound effect. Here we investigate the effect of wound healing on sap flow measurements with TD probes. Our objectives were (1) the establishment of correction factors to account for the wound effect and (2) the determination of the point in time after installation when the correction factors become applicable. For that we performed an experiment in which TD probes were installed successively in diffuse- and ring-porous trees (Fagus sylvatica and Quercus petraea, resp.) during the growing season. The trees were logged in fall and additional sensors were installed afterwards in the logged stems. SFDs measured by the different TD sensors were compared with gravimetric estimates in the laboratory. Gravimetric flow compared well with SFD estimates from freshly installed sensors without wound formation, with only a slight underestimation by the TDs. In contrast, older sensors, submitted to wound reactions, underestimated SFD by up to 40%. However, sensors with 5, 11 and 22 week old wounds showed no significant differences, which implies that wound healing occurs in the first weeks after scission. Similar sap flow underestimations due to wound effects were observed in both species, oak and beech. This study highlights the relevance of accounting for tree wound reactions for accurate estimation of tree transpiration based on thermal dissipation sensors. We provide a correction factor for the classical Granier TD sensors that can be used from the first weeks after installation in similar species. This

  7. Analyses of the Xylem Sap Proteomes Identified Candidate Fusarium virguliforme Proteinacious Toxins

    PubMed Central

    Abeysekara, Nilwala S.; Bhattacharyya, Madan K.

    2014-01-01

    Background Sudden death syndrome (SDS) caused by the ascomycete fungus, Fusarium virguliforme, exhibits root necrosis and leaf scorch or foliar SDS. The pathogen has never been identified from the above ground diseased foliar tissues. Foliar SDS is believed to be caused by host selective toxins, including FvTox1, secreted by the fungus. This study investigated if the xylem sap of F. virguliforme-infected soybean plants contains secreted F. virguliforme-proteins, some of which could cause foliar SDS development. Results Xylem sap samples were collected from five biological replications of F. virguliforme-infected and uninfected soybean plants under controlled conditions. We identified five F. virguliforme proteins from the xylem sap of the F. virguliforme-infected soybean plants by conducting LC-ESI-MS/MS analysis. These five proteins were also present in the excreted proteome of the pathogen in culture filtrates. One of these proteins showed high sequence identity to cerato-platanin, a phytotoxin produced by Ceratocystis fimbriata f. sp. platani to cause canker stain disease in the plane tree. Of over 500 soybean proteins identified in this study, 112 were present in at least 80% of the sap samples collected from F. virguliforme-infected and -uninfected control plants. We have identified four soybean defense proteins from the xylem sap of F. virguliforme-infected soybean plants. The data have been deposited to the ProteomeXchange with identifier PXD000873. Conclusion This study confirms that a few F. virguliforme proteins travel through the xylem, some of which could be involved in foliar SDS development. We have identified five candidate proteinaceous toxins, one of which showed high similarity to a previously characterized phytotoxin. We have also shown the presence of four soybean defense proteins in the xylem sap of F. virguliforme-infected soybean plants. This study laid the foundation for studying the molecular basis of foliar SDS development in soybean and

  8. Groundwater sapping valleys: Experimental studies, geological controls and implications to the interpretation of valley networks on Mars

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig

    1988-01-01

    An integrated approach using experimental laboratory models, field studies of terrestrial analogs, and remote studies of terrestrial field sites were applied to the goals of understanding the nature and morphology of valley networks formed by groundwater sapping. In spite of problems with scaling, the experimental studies provide valuable insights into concepts relating to the initiation, development, and evolution of valleys by groundwater sapping. These investigations are also aimed at developing geomorphic criteria for distinguishing valleys formed by surface runoff from those formed by groundwater sapping processes. Channels that were field classified as sapping vs. runoff were successfully distinguished using statistical analysis of their respective morphologies; therefore, it may be possible to use similar techniques to interpret channel genesis on Mars. The terrestrial and flume studies provide the ground truth dataset which can be used (and will be during the present year) to help interpret the genesis of valley networks on Mars.

  9. Serratus Anterior Plane (SAP) Block Used for Thoracotomy Analgesia: A Case Report.

    PubMed

    Okmen, Korgün; Okmen, Burcu Metin; Uysal, Serkan

    2016-07-01

    Thoracotomy is a surgical technique used to reach the thoracic cavity. Management of pain due to thoracotomy is important in order to protect the operative respiratory reserves and decrease complications. For thoracotomy pain, blocks (such as thoracic epidural, paravertebral, etc.) and pleural catheterization and intravenous drugs (such as nonsteroidal anti-inflammatory drugs [NSAIDs], and opioids, etc., can be used. We performed a serratus anterior plane (SAP) block followed by catheterization for thoracotomy pain. We used 20 ml 0.25% bupivacaine for analgesia in a patient who underwent wedge resection for a lung malignancy. We provided analgesia for a period of close to seven hours for the patient, whose postoperative VAS (visual analog scale) scores were recorded. We believe that an SAP block is effective and efficient for the management of pain after thoracotomy.

  10. Start-to-end global imaging as a sunward propagating, SAPS-associated giant undulation event

    SciTech Connect

    Henderson, Michael G; Donovan, Eric F; Foster, John C; Mann, Ian R; Immel, Thomas J

    2009-01-01

    We present high-time resolution global imaging of a sunward propagating giant undulation event from start to finish. The event occurred on November 24, 2001 during a very disturbed storm interval. The giant undulations began to develop at around 13UT and persisted for approximately 2 hours. The sunward propagation speed was on the order of 0.6 km/s (relative to SM coordinate system). The undulations had a wavelength of {approx} 750 km, amplitudes of {approx} 890 km and produced ULF pulsations on the ground with a period of {approx} 1108s. We show that the undulations were associated with SAPs flows that were caused by the proton plasma sheet penetrating substantially farther Earthward than the electron plasma sheet on the duskside. The observations appear to be consistent with the development of a shear flow and/or ballooning type of instability at the plasmapause driven by intense SAPS-associated shear flows.

  11. On the use of phloem sap δ13C to estimate canopy carbon discrimination

    NASA Astrophysics Data System (ADS)

    Rascher, Katherine; Máguas, Cristina; Werner, Christiane

    2010-05-01

    Although the carbon stable isotope composition (d13C) of bulk leaf material is a good integrative parameter of photosynthetic discrimination and can be used as a reliable ecological index of plant functioning; it is not a good tracer of short-term changes in photosynthetic discrimination. In contrast, d13C of phloem sap is potentially useful as an indicator of short-term changes in canopy photosynthetic discrimination. However, recent research indicates that d13C signatures may be substantially altered by metabolic processes downstream of initial leaf-level carbon fixation (e.g. post-photosynthetic fractionation). Accordingly, before phloem sap d13C can be used as a proxy for canopy level carbon discrimination an understanding of factors influencing the degree and magnitude of post-photosynthetic fractionation and how these vary between species is of paramount importance. In this study, we measured the d13C signature along the basipetal transport pathway in two co-occurring tree species in the field - an understory invasive exotic legume, Acacia longifolia, and a native pine, Pinus pinaster. We measured d13C of bulk leaf and leaf water soluble organic matter (WSOM), phloem sap sampled at two points along the plant axis and leaf and root dark respiration. In general, species differences in photosynthetic discrimination resulted in more enriched d13C values in the water-conserving P. pinaster relative to the water-spending A. longifolia. Post-photosynthetic fractionation led to differences in d13C of carbon pools along the plant axis with progressively more depleted d13C from the canopy to the trunk (~6.5 per mil depletion in A. longifolia and ~0.8per mil depletion in P. pinaster). Leaf and root respiration, d13C, were consistently enriched relative to putative substrates. We hypothesize that the pronounced enrichment of leaf respired CO2 relative to leaf WSOM may have left behind relatively depleted carbon to be loaded into the phloem resulting in d13C depletion

  12. Performance assessment of the SOFA, APACHE II scoring system, and SAPS II in intensive care unit organophosphate poisoned patients.

    PubMed

    Kim, Yong Hwan; Yeo, Jung Hoon; Kang, Mun Ju; Lee, Jun Ho; Cho, Kwang Won; Hwang, SeongYoun; Hong, Chong Kun; Lee, Young Hwan; Kim, Yang Weon

    2013-12-01

    This study assessed the ability of the Sequential Organ Failure Assessment (SOFA) and Acute Physiology, Chronic Health Evaluation (APACHE) II scoring systems, as well as the Simplified Acute Physiology Score (SAPS) II method to predict group mortality in intensive care unit (ICU) patients who were poisoned with organophosphate. The medical records of 149 organophosphate poisoned patients admitted to the ICU from September 2006 to December 2012 were retrospectively examined. The SOFA, APACHE II, and SAPS II were calculated based on initial laboratory data in the Emergency Department, and during the first 24 hr of ICU admission. The probability of death was calculated for each patient based on the SOFA score, APACHE II score, and SAPS II equations. The ability to predict group mortality by the SOFA score, APACHE II score, and SAPS II method was assessed using two by two decision matrices and receiver operating characteristic (ROC) curve analysis. A total of 131 patients (mean age, 61 yr) were enrolled. The sensitivities, specificities, and accuracies were 86.2%, 82.4%, and 83.2% for the SOFA score, respectively; 65.5%, 68.6%, and 67.9% for the APACHE II scoring system, respectively; and 86.2%, 77.5%, and 79.4% for the SAPS II, respectively. The areas under the curve in the ROC curve analysis for the SOFA score, APACHE II scoring system, and SAPS II were 0.896, 0.716, and 0.852, respectively. In conclusion, the SOFA, APACHE II, and SAPS II have different capability to discriminate and estimate early in-hospital mortality of organophosphate poisoned patients. The SOFA score is more useful in predicting mortality, and easier and simpler than the APACHE II and SAPS II.

  13. Beneficial effects of Acer okamotoanum sap on L-NAME-induced hypertension-like symptoms in a rat model.

    PubMed

    Yang, Hyun; Hwang, Inho; Koo, Tae-Hyoung; Ahn, Hyo-Jin; Kim, Sun; Park, Mi-Jin; Choi, Won-Sil; Kang, Ha-Young; Choi, In-Gyu; Choi, Kyung-Chul; Jeung, Eui-Bae

    2012-02-01

    The sap of Acer okamotoanum has been termed 'bone-benefit-water' in Korea owing to its mineral and sugar content. In particular, the calcium (Ca) and potassium (K) concentrations of the sap of Acer okamotoanum are 40- and 20-times higher, respectively, than commercial spring water. In the present study, we examined whether Acer okamotoanum sap improves or prevents hypertension-like symptoms in a rat model. Male Sprague-Dawley rats (8-weeks-old) were provided commercial spring water supplemented with 25, 50 or 100% Acer okamotoanum sap, 3% potassium ions (K+) or captopril, and treated daily for 2 weeks with NG-nitro-L-arginine methyl ester (L-NAME; 100 mg/kg/day) by subcutaneous injection, in order to induce hypertensive symptoms. Rats were euthanized 6 h following the final injection. To assess the effect of the sap on hypertension-like symptoms, we examined the mean blood pressure (BP), protein levels and localization of endothelial nitric oxide synthase (eNOS) in the descending aorta of the rats. BP levels were significantly lower in hypertensive rats received 25, 50 and 100% sap compared with rats who were administered only commercial spring water. Protein levels of eNOS were repressed in L-NAME-only-treated rats, but were elevated in the descending aorta of rats administered captopril, K+ water and Acer okamotoanum sap (25, 50 and 100%) up to the level of the sham group provided commercial spring water, and then injected with dimethyl sulfoxide for the same period of time. Localized eNOS protein was abundantly expressed in the perivascular descending aorta adipose tissue of the rats. Taken together, these results demonstrated that the sap of Acer okamotoanum ameliorated high BP induced by L-NAME treatment in a rat model.

  14. Dragon's Blood Sap (Croton Lechleri) As Storage Medium For Avulsed Teeth: In Vitro Study Of Cell Viability.

    PubMed

    Martins, Christine Men; Hamanaka, Elizane Ferreira; Hoshida, Thayse Yumi; Sell, Ana Maria; Hidalgo, Mirian Marubayashi; Silveira, Catarina Soares; Poi, Wilson Roberto

    2016-01-01

    Tooth replantation success depends on the condition of cementum periodontal ligament after tooth avulsion; which is influenced by storage medium. The dragon's blood (Croton lechleri) sap has been suggested as a promising medium because it supports collagen formation and exhibits healing, anti-inflammatory and antimicrobial properties. Thus, the aim of this study was to evaluate the efficacy of dragon's blood sap as a storage medium for avulsed teeth through evaluation of functional and metabolic cell viability. This in vitro study compared the efficacy of different storage media to maintain the viability of human peripheral blood mononuclear and periodontal ligament cells. A 10% dragon's blood sap was tested while PBS was selected as its control. Ultra pasteurized whole milk was used for comparison as a commonly used storage medium. DMEM and distilled water were the positive and negative controls, respectively. The viability was assessed through trypan blue exclusion test and colorimetric MTT assay after 1, 3, 6, 10 and 24 h of incubation. The dragon's blood sap showed promising results due to its considerable maintenance of cell viability. For trypan blue test, the dragon's blood sap was similar to milk (p<0.05) and both presented the highest viability values. For MTT, the dragon's blood sap showed better results than all storage media, even better than milk (p<0.05). It was concluded that the dragon's blood sap was as effective as milk, the gold standard for storage medium. The experimental sap preserved the membrane of all cells and the functional viability of periodontal ligament cells.

  15. Metabolic Coevolution in the Bacterial Symbiosis of Whiteflies and Related Plant Sap-Feeding Insects.

    PubMed

    Luan, Jun-Bo; Chen, Wenbo; Hasegawa, Daniel K; Simmons, Alvin M; Wintermantel, William M; Ling, Kai-Shu; Fei, Zhangjun; Liu, Shu-Sheng; Douglas, Angela E

    2015-09-15

    Genomic decay is a common feature of intracellular bacteria that have entered into symbiosis with plant sap-feeding insects. This study of the whitefly Bemisia tabaci and two bacteria (Portiera aleyrodidarum and Hamiltonella defensa) cohoused in each host cell investigated whether the decay of Portiera metabolism genes is complemented by host and Hamiltonella genes, and compared the metabolic traits of the whitefly symbiosis with other sap-feeding insects (aphids, psyllids, and mealybugs). Parallel genomic and transcriptomic analysis revealed that the host genome contributes multiple metabolic reactions that complement or duplicate Portiera function, and that Hamiltonella may contribute multiple cofactors and one essential amino acid, lysine. Homologs of the Bemisia metabolism genes of insect origin have also been implicated in essential amino acid synthesis in other sap-feeding insect hosts, indicative of parallel coevolution of shared metabolic pathways across multiple symbioses. Further metabolism genes coded in the Bemisia genome are of bacterial origin, but phylogenetically distinct from Portiera, Hamiltonella and horizontally transferred genes identified in other sap-feeding insects. Overall, 75% of the metabolism genes of bacterial origin are functionally unique to one symbiosis, indicating that the evolutionary history of metabolic integration in these symbioses is strongly contingent on the pattern of horizontally acquired genes. Our analysis, further, shows that bacteria with genomic decay enable host acquisition of complex metabolic pathways by multiple independent horizontal gene transfers from exogenous bacteria. Specifically, each horizontally acquired gene can function with other genes in the pathway coded by the symbiont, while facilitating the decay of the symbiont gene coding the same reaction.

  16. Xylem sap in cotton contains proteins that contribute to environmental stress response and cell wall development.

    PubMed

    Zhang, Zhiyong; Xin, Wanwan; Wang, Sufang; Zhang, Xin; Dai, Haifang; Sun, Runrun; Frazier, Taylor; Zhang, Baohong; Wang, Qinglian

    2015-01-01

    The xylem sap of a plant is primarily responsible for transporting molecules from the underground root system to the aboveground parts of the plant body. In order to understand the role that roots play in cotton growth and development, the components present in xylem sap must be elucidated. In this study, we used a shotgun HPLC-ESI-MS/MS proteomics approach to identify 455 peptides from the xylem sap of field-grown cotton plants at peak blooming stage. Of these peptides, 384 (84.4%) were found to be secreted proteins and 320 (70.3%) had special molecular functions. Based on Gene Ontology (GO) analysis, 348 peptides were annotated in terms of molecular function, biological process, and cellular localization, with 46.9 and 45.1% being related to catalytic activity and binding activity, respectively. Many xylem sap-containing proteins were predicted to be involved in different phases of xylem differentiation including cell wall metabolism, secondary cell wall development and patterning, and programmed cell death. The identification of starch and sucrose hydrolyzing enzymes implicated the interaction between roots and aboveground parts on the aspect of carbohydrate metabolism. Many of the proteins identified in this study are involved in defense mechanisms including pathogen-related proteins, such as peroxidases, chitinases, and germin-like proteins, proteases involved in disease resistance, and phytoalexin phenylpropanoid synthesis-related proteins. The majority of identified signaling proteins were fasciclin-like arabinogalactan proteins and kinases. The results of this study provide useful insight into the communication mechanisms between cotton roots and the rest of the cotton plant.

  17. Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

  18. Inhibitory effects of soluble algae products (SAP) released by Scenedesmus sp. LX1 on its growth and lipid production.

    PubMed

    Zhang, Tian-Yuan; Yu, Yin; Wu, Yin-Hu; Hu, Hong-Ying

    2013-10-01

    Soluble algal products (SAP) accumulated in culture medium via water reuse may affect the growth of microalga during the cultivation. Scenedesmus sp. LX1, a freshwater microalga, was used in this study to investigate the effect of SAP on growth and lipid production of microalga. Under the SAP concentrations of 6.4-25.8 mg L(-1), maximum algal density (K) and maximum growth rate (Rmax) of Scenedesmus sp. LX1 were decreased by 50-80% and 35-70% compared with the control group, respectively. The effect of SAP on lipid accumulation of Scenedesmus sp. LX1 was non-significant. According to hydrophilic-hydrophobic and acid-base properties, SAP was fractionized into six fractions. All of the fractions could inhibit the growth of Scenedesmus sp. LX1. Organic bases (HIB, HOB) and hydrophilic acids (HIA) showed the strongest inhibition. HIA could also decrease the lipid content of Scenedesmus sp. LX1 by 59.2%. As the inhibitory effect, SAP should be seriously treated before water reuse.

  19. Protein tyrosine phosphatase SAP-1 protects against colitis through regulation of CEACAM20 in the intestinal epithelium.

    PubMed

    Murata, Yoji; Kotani, Takenori; Supriatna, Yana; Kitamura, Yasuaki; Imada, Shinya; Kawahara, Kohichi; Nishio, Miki; Daniwijaya, Edwin Widyanto; Sadakata, Hisanobu; Kusakari, Shinya; Mori, Munemasa; Kanazawa, Yoshitake; Saito, Yasuyuki; Okawa, Katsuya; Takeda-Morishita, Mariko; Okazawa, Hideki; Ohnishi, Hiroshi; Azuma, Takeshi; Suzuki, Akira; Matozaki, Takashi

    2015-08-04

    Intestinal epithelial cells contribute to regulation of intestinal immunity in mammals, but the detailed molecular mechanisms of such regulation have remained largely unknown. Stomach-cancer-associated protein tyrosine phosphatase 1 (SAP-1, also known as PTPRH) is a receptor-type protein tyrosine phosphatase that is localized specifically at microvilli of the brush border in gastrointestinal epithelial cells. Here we show that SAP-1 ablation in interleukin (IL)-10-deficient mice, a model of inflammatory bowel disease, resulted in a marked increase in the severity of colitis in association with up-regulation of mRNAs for various cytokines and chemokines in the colon. Tyrosine phosphorylation of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 20, an intestinal microvillus-specific transmembrane protein of the Ig superfamily, was greatly increased in the intestinal epithelium of the SAP-1-deficient animals, suggesting that this protein is a substrate for SAP-1. Tyrosine phosphorylation of CEACAM20 by the protein tyrosine kinase c-Src and the consequent association of CEACAM20 with spleen tyrosine kinase (Syk) promoted the production of IL-8 in cultured cells through the activation of nuclear factor-κB (NF-κB). In addition, SAP-1 and CEACAM20 were found to form a complex through interaction of their ectodomains. SAP-1 and CEACAM20 thus constitute a regulatory system through which the intestinal epithelium contributes to intestinal immunity.

  20. The adaptor protein SAP regulates type II NKT-cell development, cytokine production, and cytotoxicity against lymphoma.

    PubMed

    Weng, Xiufang; Liao, Chia-Min; Bagchi, Sreya; Cardell, Susanna L; Stein, Paul L; Wang, Chyung-Ru

    2014-12-01

    CD1d-restricted NKT cells represent a unique lineage of immunoregulatory T cells that are divided into two groups, type I and type II, based on their TCR usage. Because there are no specific tools to identify type II NKT cells, little is known about their developmental requirements and functional regulation. In our previous study, we showed that signaling lymphocytic activation molecule associated protein (SAP) is essential for the development of type II NKT cells. Here, using a type II NKT-cell TCR transgenic mouse model, we demonstrated that CD1d-expressing hematopoietic cells, but not thymic epithelial cells, meditate efficient selection of type II NKT cells. Furthermore, we showed that SAP regulates type II NKT-cell development by controlling early growth response 2 protein and promyelocytic leukemia zinc finger expression. SAP-deficient 24αβ transgenic T cells (24αβ T cells) exhibited an immature phenotype with reduced Th2 cytokine-producing capacity and diminished cytotoxicity to CD1d-expressing lymphoma cells. The impaired IL-4 production by SAP-deficient 24αβ T cells was associated with reduced IFN regulatory factor 4 and GATA-3 induction following TCR stimulation. Collectively, these data suggest that SAP is critical for regulating type II NKT cell responses. Aberrant responses of these T cells may contribute to the immune dysregulation observed in X-linked lymphoproliferative disease caused by mutations in SAP.

  1. Assessment of Combined Ascorbyl Palmitate (AP) and Sodium Ascorbyl Phosphate (SAP) on Facial Skin Sebum Control in Female Healthy Volunteers.

    PubMed

    Khan, H; Akhtar, N; Ali, A

    2017-01-01

    The skin is fortified with a setup of lipophilic and hydrophilic, enzymatic and non-enzymatic antioxidant systems. Ascorbyl palmitate (AP) and sodium ascorbyl phosphate (SAP) are reported as lipophilic and hydrophilic antioxidants, respectively used for skin care. Present study was aimed to assess the combined AP (in oil phase) and SAP (in aqueous phase) via multiple emulsion (ME1) for controlling sebum secretions in healthy human females. FTIR analysis of AP and SAP was performed for identification. Multiple emulsions (ME1 and control) were prepared and analyzed for physical stability. Antioxidant activities of AP, SAP as well as ME1 (with combination of these compounds) were determined by DPPH method. 11 female volunteers were included in a single-blinded, placebo-controlled, split-face comparative study. Volunteers were instructed to apply ME1 on left cheek while control (without AP and SAP) on right cheek, for a period of 90 days. A non-invasive photometric device (Sebumeter(®)) was used for the measurement of sebum secretions on both sides of the face with subsequent time intervals. A good antioxidant activity of ME1 was observed. ME1 treatments reduced significant facial sebum secretions as compared with control/placebo treatments. It was concluded that combined AP and SAP supplementations to skin proved a promising choice for controlling facial sebum secretions and could be evaluated for undesired oily skin and acne reductions for beautifying the facial appearance.

  2. Impact of Laurel Wilt, Caused by Raffaelea lauricola, on Leaf Gas Exchange and Xylem Sap Flow in Avocado, Persea americana.

    PubMed

    Ploetz, Randy C; Schaffer, Bruce; Vargas, Ana I; Konkol, Joshua L; Salvatierra, Juanpablo; Wideman, Ronney

    2015-04-01

    Laurel wilt, caused by Raffaelea lauricola, is a destructive disease of avocado (Persea americana). The susceptibility of different cultivars and races was examined previously but more information is needed on how this host responds to the disease. In the present study, net CO2 assimilation (A), stomatal conductance of H2O (gs), transpiration (E), water use efficiency (WUE), and xylem sap flow rates were assessed in cultivars that differed in susceptibility. After artificial inoculation with R. lauricola, there was a close relationship between symptom development and reductions in A, gs, E, WUE, and mean daily sap flow in the most susceptible cultivar, 'Russell', and significantly greater disease and lower A, gs, E, WUE, and sap flow rates were usually detected after 15 days compared with the more tolerant 'Brogdon' and 'Marcus Pumpkin'. Significant differences in preinoculation A, gs, E, and WUE were generally not detected among the cultivars but preinoculation sap flow rates were greater in Russell than in Brogdon and Marcus Pumpkin. Preinoculation sap flow rates and symptom severity for individual trees were correlated at the end of an experiment (r=0.46), indicating that a plant's susceptibility to laurel wilt was related to its ability to conduct water. The potential management of this disease with clonal rootstocks that reduce sap flow rates is discussed.

  3. A comparison of sap flow and eddy fluxes of water vapor from a boreal deciduous forest

    NASA Astrophysics Data System (ADS)

    Hogg, Edward H.; Black, T. Andrew; den Hartog, Gerry; Neumann, Harold H.; Zimmermann, Reiner; Hurdle, Patrick A.; Blanken, Peter D.; Nesic, Zoran; Yang, Paul C.; Staebler, Ralf M.; McDonald, Kyle C.; Oren, Ram

    1997-12-01

    Water flux to the atmosphere was measured from a mature stand of aspen (Populus tremuloides Michx.) in Saskatchewan, Canada, as part of the Boreal Ecosystem-Atmosphere Study (BOREAS). Diurnal and seasonal changes in transpiration were monitored using two sap flow techniques and were compared against the difference between eddy correlation measurements of water vapor flux made above and below the aspen canopy. The three methods showed similar diurnal and seasonal trends in water flux, although sap flow lagged the eddy correlation measurements by about 1 hour diurnally due to changes in water storage within the trees. During the growing season, all methods showed a linear increase in midday transpiration with above-canopy vapor pressure deficit (VPD) up to ˜1 kPa, beyond which transpiration was relatively constant (VPD 1-2.5 kPa). A similar relationship was obtained when total daily transpiration was plotted against mean daytime VPD. The results are consistent with other observations that stomatal conductance of the aspen canopy decreases at high VPD. The complementary benefits of simultaneous monitoring of canopy transpiration by both eddy correlation and sap flow measurements are discussed.

  4. Transport and use of CO sub 2 in the xylem sap of Populus deltoides

    SciTech Connect

    Stringer, J.W.; Kimmerer, T.W. )

    1990-05-01

    Results of recent experiments indicate an internal cycling of respiratory CO{sub 2} in woody plants. The CO{sub 2} concentration of xylem sap expressed from the twigs of field grown Populus deltoides ranged from .14 to .50 mM. The pH of the xylem sap was 5.7 to 6.7, providing a significant bicarbonate concentration in many samples. Total dissolved inorganic carbon (DIC = CO{sub 2} + H{sub 2}CO{sub 3} + HCO{sub 3}{sup {minus}}) was 0.5 mM to 1.3 mM. Results from the analysis of xylem sap of 10 other species of woody plants were similar. To determine the fate of DIC delivered to the leaves of Populus deltoides, excised leaves were fed 1mM NaHCO{sub 3} (2 {mu}Ci NaH{sup 14}CO{sub 3} ml{sup {minus}1}). Less than 0.4% of the label escaped from the leaves, and {ge}93% was fixed. Of the carbon fixed 56% of the {sup 14}C was found in the petiole and midrib, and 14% was in the major veins, with the remaining 30% in the minor veins and lamina. Shading of the peptiole and midrib of leaves decreased the amount of fixed carbon in these tissues to 38% and increased the amount in the lamina to 55%.

  5. [A new embolic material: super absorbent polymer (SAP) microsphere and its embolic effects].

    PubMed

    Jiaqi, Y; Hori, S; Minamitani, K; Hashimoto, T; Yoshimura, H; Nomura, N; Ishida, T; Fukuda, H; Tomoda, K; Nakamura, H

    1996-01-01

    SAP-Microsphere (sodium acrylic acid-vinyl alcohol copolymer) has the ability to absorb fluids within a few minutes and increase its diameter. Its diameter can also be calibrated. The diameters in ionic contrast material and human serum are 2.1 and 3.5 times larger, respectively, than the original size. It can pass through a microcatheter with an ionic contrast material, and swells at the occluding point into the desired size. It can be recognized under fluoroscopy due to its absorption of contrast material. A total of 10 rabbit kidney embolizations were done followed by resection in 1-14 weeks. Recanalization was absent in all cases. No adhesion to the perirenal tissue was found. Limited reactive change in endothelial cells was found at one week. No changes in the smooth muscle layer were found at any time during the study. Limited infiltration of neutrophil cells was found in perivascular tissue within a period of one week. SAP-Microspheres maintained their spherical shape during a 14-week period. Extensive fibrosis and calcification were found after 4 weeks. SAP-Microspheres are promising as an embolic agent to obtain satisfactory results of embolization therapy.

  6. Effects of Fe deficiency on the protein profile of Brassica napus phloem sap.

    PubMed

    Gutierrez-Carbonell, Elain; Lattanzio, Giuseppe; Albacete, Alfonso; Rios, Juan José; Kehr, Julia; Abadía, Anunciación; Grusak, Michael A; Abadía, Javier; López-Millán, Ana Flor

    2015-11-01

    The aim of this work was to study the effect of Fe deficiency on the protein profile of phloem sap exudates from Brassica napus using 2DE (IEF-SDS-PAGE). The experiment was repeated thrice and two technical replicates per treatment were done. Phloem sap purity was assessed by measuring sugar concentrations. Two hundred sixty-three spots were consistently detected and 15.6% (41) of them showed significant changes in relative abundance (22 decreasing and 19 increasing) as a result of Fe deficiency. Among them, 85% (35 spots), were unambiguously identified. Functional categories containing the largest number of protein species showing changes as a consequence of Fe deficiency were signaling and regulation (32%), and stress and redox homeostasis (17%). The Phloem sap showed a higher oxidative stress and significant changes in the hormonal profile as a result of Fe deficiency. Results indicate that Fe deficiency elicits major changes in signaling pathways involving Ca and hormones, which are generally associated with flowering and developmental processes, causes an alteration in ROS homeostasis processes, and induces decreases in the abundances of proteins involved in sieve element repair, suggesting that Fe-deficient plants may have an impaired capacity to heal sieve elements upon injury.

  7. SAP97-mediated ADAM10 trafficking from Golgi outposts depends on PKC phosphorylation

    PubMed Central

    Saraceno, C; Marcello, E; Di Marino, D; Borroni, B; Claeysen, S; Perroy, J; Padovani, A; Tramontano, A; Gardoni, F; Di Luca, M

    2014-01-01

    A disintegrin and metalloproteinase 10 (ADAM10) is the major α-secretase that catalyzes the amyloid precursor protein (APP) ectodomain shedding in the brain and prevents amyloid formation. Its activity depends on correct intracellular trafficking and on synaptic membrane insertion. Here, we describe that in hippocampal neurons the synapse-associated protein-97 (SAP97), an excitatory synapse scaffolding element, governs ADAM10 trafficking from dendritic Golgi outposts to synaptic membranes. This process is mediated by a previously uncharacterized protein kinase C phosphosite in SAP97 SRC homology 3 domain that modulates SAP97 association with ADAM10. Such mechanism is essential for ADAM10 trafficking from the Golgi outposts to the synapse, but does not affect ADAM10 transport from the endoplasmic reticulum. Notably, this process is altered in Alzheimer's disease brains. These results help in understanding the mechanism responsible for the modulation of ADAM10 intracellular path, and can constitute an innovative therapeutic strategy to finely tune ADAM10 shedding activity towards APP. PMID:25429624

  8. E-SAP: efficient-strong authentication protocol for healthcare applications using wireless medical sensor networks.

    PubMed

    Kumar, Pardeep; Lee, Sang-Gon; Lee, Hoon-Jae

    2012-01-01

    A wireless medical sensor network (WMSN) can sense humans' physiological signs without sacrificing patient comfort and transmit patient vital signs to health professionals' hand-held devices. The patient physiological data are highly sensitive and WMSNs are extremely vulnerable to many attacks. Therefore, it must be ensured that patients' medical signs are not exposed to unauthorized users. Consequently, strong user authentication is the main concern for the success and large scale deployment of WMSNs. In this regard, this paper presents an efficient, strong authentication protocol, named E-SAP, for healthcare application using WMSNs. The proposed E-SAP includes: (1) a two-factor (i.e., password and smartcard) professional authentication; (2) mutual authentication between the professional and the medical sensor; (3) symmetric encryption/decryption for providing message confidentiality; (4) establishment of a secure session key at the end of authentication; and (5) professionals can change their password. Further, the proposed protocol requires three message exchanges between the professional, medical sensor node and gateway node, and achieves efficiency (i.e., low computation and communication cost). Through the formal analysis, security analysis and performance analysis, we demonstrate that E-SAP is more secure against many practical attacks, and allows a tradeoff between the security and the performance cost for healthcare application using WMSNs.

  9. [Radial variation and time lag of sap flow of Populus gansuensis in Minqin Oasis, Northwest].

    PubMed

    Dang, Hong-Zhong; Yang, Wen-Bin; Li, Wei; Zhang, You-Yan; Li, Chang-Long

    2014-09-01

    Sap flow of tree trunk is very important to reflect the dynamics of physiological activities, as well as to estimate the water consumption of individual plant. In the present study, we used the thermal dissipation technique to monitor the sap flow velocity (J) at four depth loci (i. e. 2 cm, 3 cm, 5 cm, 8 cm) of three Populus gansuensis trees (30 year-old) in Minqin Oasis for two consecutive growing seasons. The results showed that there were significant differences among J values at four depth loci under tree trunk cambium. J value at the 3 cm depth locus (J3) of the tree trunk was the highest, and then in sequences, were 2 cm, 5 cm and 8 cm depth loci (J2, J5 and J8). J value (J3) on typical sunny days in June with the highest atmospheric potential evapotranspiration (ET0) was up to 28.53 g · cm(-2) · h(-1), which was 1.42, 2.74 and 4.4 times of J2, J5 and J8, respectively. In the process of diurnal variation of sap flow velocity, the peak value time of J at the four depth loci of the tree trunk was different, but the differences among them were within 20 min. Furthermore, the peak value time of sap flow velocity was very different to that of solar radiation (Rs) and air vapour pressure deficit (VPD). The time lag between J and Rs was from 55 to 88 min on typical sunny days during the main growing seasons (from June to August), and, positively related to the depth of the locus under tree trunk cambium, while the time lag between J and VPD reached 60-96 min, and was negatively related to the depth of the locus. The seasonal variation patterns of J were consistent with ET0. With the increase of tree physiological activities, there was a trend that the major water transportation layer extended to the interior sapwood. The most important meteorological factor was the solar radiation, which primarily drove sap flow at different depths of tree trunk. However, the secondary factor changed along with the depth, and VPD became increasingly important with increasing the

  10. SAP-Dependent and -Independent Regulation of Innate T Cell Development Involving SLAMF Receptors.

    PubMed

    De Calisto, Jaime; Wang, Ninghai; Wang, Guoxing; Yigit, Burcu; Engel, Pablo; Terhorst, Cox

    2014-01-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) plays an essential role in the immune system mediating the function of several members of the SLAM family (SLAMF) of receptors, whose expression is essential for T, NK, and B-cell responses. Additionally, the expression of SAP in double-positive thymocytes is mandatory for natural killer T (NKT) cells and, in mouse, for innate CD8(+) T cell development. To date, only two members of the SLAMF of receptors, Slamf1 and Slamf6, have been shown to positively cooperate during NKT cell differentiation in mouse. However, it is less clear whether other members of this family may also participate in the development of these innate T cells. Here, we show that Slamf[1 + 6](-/-) and Slamf[1 + 5 + 6](-/-) B6 mice have ~70% reduction of NKT cells compared to wild-type B6 mice. Unexpectedly, the proportion of innate CD8(+) T cells slightly increased in the Slamf[1 + 5 + 6](-/-) , but not in the Slamf[1 + 6](-/-) strain, suggesting that Slamf5 may function as a negative regulator of innate CD8(+) T cell development. Accordingly, Slamf5(-/-) B6 mice showed an exclusive expansion of innate CD8(+) T cells, but not NKT cells. Interestingly, the SAP-independent Slamf7(-/-) strain showed an expansion of both splenic innate CD8(+) T cells and thymic NKT cells. On the other hand, and similar to what was recently shown in Slamf3(-/-) BALB/c mice, the proportions of thymic promyelocytic leukemia zinc finger (PLZF(hi)) NKT cells and innate CD8(+) T cells significantly increased in the SAP-independent Slamf8(-/-) BALB/c strain. In summary, these results show that NKT and innate CD8(+) T cell development can be regulated in a SAP-dependent and -independent fashion by SLAMF receptors, in which Slamf1, Slamf6, and Slamf8 affect development of NKT cells, and that Slamf5, Slamf7, and Slamf8 affect the development of innate CD8(+) T cells.

  11. Response of sap flow to environmental factors in the headwater catchment of Miyun Reservoir in subhumid North China

    NASA Astrophysics Data System (ADS)

    Tie, Qiang; Hu, Hongchang; Tian, Fuqiang; Liu, Yaping; Xu, Ran

    2015-04-01

    Since the headwater catchment of Miyun Reservoir is the main drinking water conservation area of Beijing, its water cycle is of importance for the regional water resource. Transpiration is an important component of water cycle, which can be estimated by sap flow. In this study, the dynamics of sap flow and its response to environmental factors and relationship with leaf area index (LAI) were analyzed. The field study was conducted in the Xitaizi Experimental Catchment, located in the headwater catchment of Miyun Reservoir in subhumid North China. The Aspen (Populus davidiana) and Epinette (Larix gmelinii) are the two dominant tree species. Sap flow in 15 Aspen (Populus davidiana) trees was monitored using thermal dissipation probes (TDP) during the growing season of 2013 and 2014, and sap flow in another 3 Epinette (Larix gmelinii) trees was also monitored during September and October in 2014 for comparative analysis. Physiological and biometric parameters of the selected trees and the environmental factors, including meteorological variables, soil moisture content and groundwater table depth were measured. Vapor pressure deficit (VPD), variable of transpiration (VT) and reference crop evapotranspiration (ET0) were calculated using the measured environmental factors. The LAI, which is used to characterize phenophase, was calculated using the Moderate Resolution Imaging Spectroradiometer (MODIS) LAI product (MCD15A3). Correlation analysis for daily sap flow and air temperature, relative humidity, precipitation, wind speed, solar radiation, VPD, VT and ET0 under different soil moisture and groundwater table depth conditions was performed. Diurnal course and hysteresis of sap flow were analyzed as a function of air temperature, solar radiation, VPD and VT on the typical sunny, cloudy and rainy days under different soil moisture conditions. Correlation analysis between daily sap flow and LAI showed that LAI and phenophase significantly influence sap flow and restrict

  12. Mutually exclusive distribution of the sap and eag S-layer genes and the lytB/lytA cell wall hydrolase genes in Bacillus thuringiensis.

    PubMed

    Soufiane, Brahim; Sirois, Marc; Côté, Jean-Charles

    2011-10-01

    Recently, two Bacillus thuringiensis strains were reported to synthesize parasporal inclusion bodies made not of the expected crystal (Cry) proteins but rather of the surface layer proteins (SLP) Sap (encoded by sap) and EA1 (encoded by eag), respectively. Whether the presence of the sap and eag genes is restricted to these two B. thuringiensis strains or ubiquitous in B. thuringiensis is unknown. We report here the distribution of the sap and eag genes in B. thuringiensis. Strains in the Bacillus cereus group were added for comparison purposes. We show that sap and eag are either present in tandem in 35% of the B. thuringiensis strains analysed and absent in 65% of the strains. When absent, a different tandem, the lytB/lytA cell wall hydrolase genes, is present. The distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes is not species-specific in B. thuringiensis, B. cereus and Bacillus weihenstephanensis. Bacillus anthracis and Bacillus mycoides harbor sap and eag but not lytB/lytA. The sap, eag and lytB/lytA genes were absent in Bacillus pseudomycoides. Clearly, the distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes in B. thuringiensis and in the Bacillus cereus group is mutually exclusive. We also showed that two genes involved in cell wall metabolism, csaA and csaB, are present not only upstream of the sap and eag S-layer genes, but also upstream of the lytB/lytA tandem in strains where sap and eag are absent. Bootstrapped neighbor-joining trees were inferred from the translated amino acid sequences of sap, eag and the tandem lytB/lytA, respectively.

  13. Effect of preservation methods of oil palm sap (Elaeis guineensis) on the reproductive indices of male wistar rats.

    PubMed

    Ikegwu, Theophilus Maduabuchukwu; Okafor, Gabriel Ifeanyi; Ochiogu, Izuchukwu Shedrack

    2014-12-01

    Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01-11.71%), protein (1.56-1.95%), ash (0.22-0.35%), moisture (92.55-98.24%), and alcohol (0.26-3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×10(6)), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals.

  14. Measurement of respirable superabsorbent polyacrylate (SAP) dust by ethanol derivatization using gas chromatography-mass spectrometry (GC-MS) detection.

    PubMed

    McCormack, Paul; Lemmo, John S; Macomber, Margaret; Holcomb, Mark L; Lieckfield, Robert

    2011-04-01

    Superabsorbent polyacrylate (SAP) is an important industrial chemical manufactured primarily as sodium polyacrylate but occasionally as potassium salt. It has many applications owing to its intrinsic physical property of very high water absorption, which can be more than 100 times it own weight. SAP is commonly used in disposable diapers and feminine hygiene products and is known by a number of synonyms-sodium polyacrylate, superabsorbent polyacrylate (SAP), polyacrylate absorbent (PA), and superabsorbent material (SAM). Germany and The Netherlands have adopted a nonbinding scientific guideline value 0.05 mg/m³ (8-hr time-weighted average, TWA) as the maximum allowable workplace concentration for the respirable dust of SAP (<10 μm particle diameter). Three industry associations representing Europe, the United States, and Asia have adopted the German scientific guideline value of 0.05 mg/m³ (8-hr TWA) as a voluntary guideline. A new test method based on alcohol derivatization of the acrylate was developed and validated for the analysis of respirable superabsorbent polyacrylate dust collected on filter cassettes in the workplace environment. This method is an alternative to the commonly used sodium-based method, which is limited owing to potential interference by other sources of sodium from the workplace and laboratory environments. The alcohol derivatization method effectively eliminates sodium interference from several classes of sodium compounds, as shown by their purposeful introduction at two and six times the equivalent amount of SAP present in reference samples. The accuracy of the method, as determined by comparison with sodium analysis of known reference samples, was greater than 80% over the study range of 5-50 μg of SAP dust. The lower reporting limit of the method is 3.0 μg of SAP per sample, which is equivalent to 3 (μg/m³) for an 8-hr sampling period at the recommended flow rate of 2.2 L/min.

  15. Effect of Preservation Methods of Oil Palm Sap (Elaeis guineensis) on the Reproductive Indices of Male Wistar Rats

    PubMed Central

    Ikegwu, Theophilus Maduabuchukwu; Ochiogu, Izuchukwu Shedrack

    2014-01-01

    Abstract Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01–11.71%), protein (1.56–1.95%), ash (0.22–0.35%), moisture (92.55–98.24%), and alcohol (0.26–3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×106), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals. PMID:25101691

  16. The reliability of cryoSEM for the observation and quantification of xylem embolisms and quantitative analysis of xylem sap in situ.

    PubMed

    McCully, M E; Shane, M W; Baker, A N; Huang, C X; Ling, L E; Canny, M J

    2000-04-01

    The reliability of cryoSEM for visualizing gas embolisms in xylem vessels of intact, functioning roots is examined and discussed. The possibility that these embolisms form as a result of freezing water columns under tension is discounted by a double-freeze experiment. Two regions of the same root, one frozen under tension, the other isolated from the tension by the first freeze, had the same percentage of embolisms, as did also long pieces of root frozen simultaneously along their length. The reliability of energy-dispersive X-ray analysis to measure xylem sap concentration in situ in frozen tissue was established by measurement of KCl standard solution frozen on stubs, and within xylem vessels. Solute heterogeneity within the vessels varied with freezing procedure; deep-freeze > LN2 > cryopliers > liquid ethane, but only the deep-freeze method gave unsatisfactory estimates of concentration for the standard solution. It is concluded that cryoanalytical SEM is useful for direct observation of gas and liquid-filled compartments, and for solute analyses at depth within intact plant organs.

  17. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  18. Reduced cathepsins B and D cause impaired autophagic degradation that can be almost completely restored by overexpression of these two proteases in Sap C-deficient fibroblasts.

    PubMed

    Tatti, Massimo; Motta, Marialetizia; Di Bartolomeo, Sabrina; Scarpa, Susanna; Cianfanelli, Valentina; Cecconi, Francesco; Salvioli, Rosa

    2012-12-01

    Saposin (Sap) C deficiency, a rare variant form of Gaucher disease, is due to mutations in the Sap C coding region of the prosaposin (PSAP) gene. Sap C is required as an activator of the lysosomal enzyme glucosylceramidase (GCase), which catalyzes glucosylceramide (GC) degradation. Deficit of either GCase or Sap C leads to the accumulation of undegraded GC and other lipids in lysosomes of monocyte/macrophage lineage. Recently, we reported that Sap C mutations affecting a cysteine residue result in increased autophagy. Here, we characterized the basis for the autophagic dysfunction. We analyzed Sap C-deficient and GCase-deficient fibroblasts and observed that autophagic disturbance was only associated with lack of Sap C. By a combined fluorescence microscopy and biochemical studies, we demonstrated that the accumulation of autophagosomes in Sap C-deficient fibroblasts is not due to enhanced autophagosome formation but to delayed degradation of autolysosomes caused, in part, to decreased amount and reduced enzymatic activity of cathepsins B and D. On the contrary, in GCase-deficient fibroblasts, the protein level and enzymatic activity of cathepsin D were comparable with control fibroblasts, whereas those of cathepsin B were almost doubled. Moreover, the enhanced expression of both these lysosomal proteases in Sap C-deficient fibroblasts resulted in close to functional autophagic degradation. Our data provide a novel example of altered autophagy as secondary event resulting from insufficient lysosomal function.

  19. Accumulation characteristics of soluble algal products (SAP) by a freshwater microalga Scenedesmus sp. LX1 during batch cultivation for biofuel production.

    PubMed

    Yu, Yin; Hu, Hong-Ying; Li, Xin; Wu, Yin-Hu; Zhang, Xue; Jia, Sheng-Lan

    2012-04-01

    Algae cultivation is the essential basis for microalgal biofuel production. Soluble algal products (SAP) are significant obstacle to large-scale, high-cell-density cultivation processes. SAP accumulation during batch cultivation of Scenedesmus sp. LX1 (a unique strain accumulating lipid substantially while growing fast under low-nutrient conditions) with different initial nitrogen concentrations (7.4-34.0mgNL(-1)) was investigated. The SAP content varied in the range of 3.4-17.4mgDOCL(-1) at stationary phase, with average yield per cell of 0.5-2.5pgDOCcell(-1). High SAP accumulation up to 15.2-17.4mgDOCL(-1) were observed with initial nitrogen above 20.2mgNL(-1). The maximum SAP production rate per unit culture volume (r(SAP)) was 2.6mgDOC(Ld)(-1) and that per cell (ν(SAP)) was 1.5pgDOC(celld)(-1). The r(SAP) increased with cell growth rate and decreased with cell density linearly. The SAP accumulation was majorly due to the release of growth-associated products.

  20. DC-SIGN activation mediates the differential effects of SAP and CRP on the innate immune system and inhibits fibrosis in mice.

    PubMed

    Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H

    2015-07-07

    Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti-DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics.

  1. Combination of Successive Alkalinity Producing System (SAPS) and Aeration for Passive Treatment of Highly Acidic Mine Drainage

    NASA Astrophysics Data System (ADS)

    Oh, C.; Ji, S.

    2015-12-01

    Passive treatment system has been widely used for remediation of mine drainage since its advantage of low installation and maintenance cost. The system, however, has also a disadvantage in assuring remediation and management efficiency if the drainage is highly acidic mine drainage. To remediate acid mine drainage (AMD) especially showing high acidity, passive treatment system which consists of successive alkalinity producing system (SAPS) and subsequent aeration pond was proposed and its mechanisms and efficiency was evaluated in this research. Target AMD was obtained from Waryong coal mine and showed typical characteristics of AMD having high metal concentration and low pH (acidity > 300 mg/L as CaCO3). Four experimental cases were conducted; untreated, treated with SAPS, treated with aeration, treated with SAPS and aeration to compare role and mechanism of each unit. Between organic matter and limestone layer which constitute SAPS, the former eliminated most of Fe(III) and Al in the AMD so that the latter was kept from being clogged by precipitates. Net acidity of the AMD rapidly decreased by supplement of alkalinity at the limestone layer. A primary function of SAPS, producing alkalinity constantly without clogging, was attained due to addition a portion of limestone particle into the organic matter layer. The discharge from SAPS had low ORP and DO values because of an anaerobic environment formed at the organic matter layer although its alkalinity was increased. This water quality was unfavorable for Fe(II) to be oxidized. Installation of aeration pond after SAPS, therefore, could be effective way of enhancing oxidation rate of Fe(II). Among the experimental cases, the combination of SAPS and aeration pond was only able to remediate the AMD. This concluded that to remediate highly acidic mine drainage with passive treatment system, three critical conditions were required; pre-precipitation of Fe(III) and Al at organic matter layer in SAPS, constant alkalinity

  2. Explaining spatial patterns of sap flow: day-to-day shifts in relevance of site- and tree-specific controls

    NASA Astrophysics Data System (ADS)

    Hassler, Sibylle K.; Weiler, Markus; Blume, Theresa

    2015-04-01

    Transpiration is a key process in the hydrological cycle and a sound understanding and quantification of transpiration is essential for management decisions and for hydrological and climatological modelling. To assess transpiration at the tree scale sap flow velocity is commonly measured. Besides atmospheric conditions and soil moisture state, tree-specific characteristics such as species, size or social status control sap flow of individual trees. Within forest stands, properties such as species composition, basal area or stem number also affect sap flow via competition or facilitation mechanisms. Finally, sap flow patterns might also be influenced by landscape-scale characteristics such as geology, slope position or aspect because they affect water and energy availability; however, so far little is known about these larger-scale controls. We studied the relative importance of various tree- and site-specific characteristics with linear statistical models for daily sap velocity observations on 38 trees at 12 locations in mixed beech and oak forests in a catchment in Luxemburg. The temporal variation of the predictors' importance for sap velocity patterns was then related to hydro-meteorological conditions. Results indicate that a combination of tree- and site-specific controls influence sap velocity patterns, namely tree species, tree diameter, stand basal area, geology and aspect. The temporal dynamics of these controls are related to hydro-meteorological conditions, with tree-specific controls dominating when the atmospheric gradient is strong, i.e. the vapour pressure deficit is large, leading to higher sap velocities, whereas landscape-scale site characteristics are more important during weak atmospheric gradients. The importance of individual predictors also varies between spring and summer, probably due to different soil moisture and atmospheric conditions of the two periods. We conclude that both tree- and site-specific characteristics control sap velocity

  3. A model of heat transfer in sapwood and implications for sap flux density measurements using thermal dissipation probes.

    PubMed

    Wullschleger, Stan D; Childs, Kenneth W; King, Anthony W; Hanson, Paul J

    2011-06-01

    A variety of thermal approaches are used to estimate sap flux density in stems of woody plants. Models have proved valuable tools for interpreting the behavior of heat pulse, heat balance and heat field deformation techniques, but have seldom been used to describe heat transfer dynamics for the heat dissipation method. Therefore, to better understand the behavior of heat dissipation probes, a model was developed that takes into account the thermal properties of wood, the physical dimensions and thermal characteristics of the probes, and the conductive and convective heat transfer that occurs due to water flow in the sapwood. Probes were simulated as aluminum tubes 20 mm in length and 2 mm in diameter, whereas sapwood, heartwood and bark each had a density and water fraction that determined their thermal properties. Base simulations assumed a constant sap flux density with sapwood depth and no wounding or physical disruption of xylem beyond the 2 mm diameter hole drilled for probe installation. Simulations across a range of sap flux densities showed that the dimensionless quantity k [defined as (ΔT(m) -ΔT)/ΔT, where ΔT(m) is the temperature differential (ΔT) between the heated and unheated probe under zero-flow conditions] was dependent on the thermal conductivity of the sapwood. The relationship between sap flux density and k was also sensitive to radial gradients in sap flux density and to xylem disruption near the probe. Monte Carlo analysis in which 1000 simulations were conducted while simultaneously varying thermal conductivity and wound diameter revealed that sap flux density and k showed considerable departure from the original calibration equation used with this technique. The departure was greatest for variation in sap flux density typical of ring-porous species. Depending on the specific combination of thermal conductivity and wound diameter, use of the original calibration equation resulted in an 81% under- to 48% overestimation of sap flux density

  4. Impacts of Hydrological Alterations to the Tonle Sap Ecosystem of the Mekong River Basin

    NASA Astrophysics Data System (ADS)

    Arias, M. E.; Cochrane, T. A.

    2013-12-01

    The Tonle Sap is the largest and most important natural wetland in Southeast Asia. It covers an area of more than 15,000 km2 with a unique mosaic of natural and agricultural floodplain habitats that coexist with the largest fishery in the Mekong Basin. Accelerating hydropower development and climate change, however, are altering the Mekong's hydrology, which could negatively affect downstream ecosystems. The Tonle Sap is facing a two-fold problem. First, the link between its hydrology and ecosystem properties is not well understood. Second, potential ecological changes caused by future hydrological disruptions related to hydropower and climate change are unknown. Thus, the main objective of this study was to quantify how alterations to the Mekong hydrology could affect the Tonle Sap ecosystem. An assessment of landscape patterns revealed a distinct relationship between inundation and vegetation. Habitats in the Tonle Sap were divided into five groups based on annual flood duration, as well as physiognomic factors and human activity: (1) open water, (2) gallery forest, (3) seasonally flooded habitats, (4) transitional habitats, and (5) rainfed habitats. Large shifts could occur as a result of hydropower development scenarios by the 2030s; areas optimal for gallery forest could decrease by 82% from baseline conditions, whereas areas of rainfed habitats could increase by 10-13 % (813-1061 km2). An assessment of habitat patterns demonstrated that despite the complexity and intense human use of this ecosystem, the Mekong flood-pulse hydrology is the underlying driver of habitat characteristics by (1) determining inundation depth and duration, (2) creating the main soils gradient, (3) limiting the area cleared for agriculture, (4) influencing vegetation structure and water quality, and (5) shaping the composition of plant species. A numerical model was used to estimate aquatic net primary production (NPP) as a function of hydrology, sediments, and habitat characteristics

  5. Genomic organization and characterization of mouse SAP, the gene that is altered in X-linked lymphoproliferative disease.

    PubMed

    Wu, C; Sayos, J; Wang, N; Howie, D; Coyle, A; Terhorst, C

    2000-08-01

    X-linked lymphoproliferative (XLP) disease is a fatal immunological disorder that renders the immune system unable to respond effectively to Epstein-Barr virus (EBV) infection. The gene that encodes a protein termed SAP or SH2D1A is either deleted or mutated in XLP patients, resulting in uncontrolled B- and T-cell proliferation upon EBV infection. Here, we report the cloning and characterization of the mouse SAP gene. It is localized on the mouse X chromosome and comprises four exons spanning approximately 25 kb. Its expression appears to be restricted to T lymphocytes. Whereas a high level of SAP expression is observed in Thl cells, only small amounts are detectable in Th2 cells. Moreover, SAP expression is down-regulated upon in vitro activation of T cells, including CD4+, CD8+ single-positive T cells, and Thl and Th2 cells. This study provides valuable information for in-depth genetic and biochemical analysis of the function of SAP in the immune system.

  6. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence

    PubMed Central

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-01-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence. PMID:27844021

  7. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence.

    PubMed

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-03-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence.

  8. Effects of dates pulp extract and palm sap (Phoenix dactylifera L.) on gastrointestinal transit activity in healthy rats.

    PubMed

    Souli, Abdellaziz; Sebai, Hichem; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-07-01

    The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation.

  9. Metabolite Profile Changes in Xylem Sap and Leaf Extracts of Strategy I Plants in Response to Iron Deficiency and Resupply

    PubMed Central

    Rellán-Álvarez, Rubén; El-Jendoubi, Hamdi; Wohlgemuth, Gert; Abadía, Anunciación; Fiehn, Oliver; Abadía, Javier; Álvarez-Fernández, Ana

    2011-01-01

    The metabolite profile changes induced by Fe deficiency in leaves and xylem sap of several Strategy I plant species have been characterized. We have confirmed that Fe deficiency causes consistent changes both in the xylem sap and leaf metabolite profiles. The main changes in the xylem sap metabolite profile in response to Fe deficiency include consistent decreases in amino acids, N-related metabolites and carbohydrates, and increases in TCA cycle metabolites. In tomato, Fe resupply causes a transitory flush of xylem sap carboxylates, but within 1 day the metabolite profile of the xylem sap from Fe-deficient plants becomes similar to that of Fe-sufficient controls. The main changes in the metabolite profile of leaf extracts in response to Fe deficiency include consistent increases in amino acids and N-related metabolites, carbohydrates and TCA cycle metabolites. In leaves, selected pairs of amino acids and TCA cycle metabolites show high correlations, with the sign depending of the Fe status. These data suggest that in low photosynthesis, C-starved Fe-deficient plants anaplerotic reactions involving amino acids can be crucial for short-term survival. PMID:22645546

  10. Effects of Dates Pulp Extract and Palm Sap (Phoenix dactylifera L.) on Gastrointestinal Transit Activity in Healthy Rats

    PubMed Central

    Souli, Abdellaziz; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-01-01

    Abstract The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation. PMID:24611963

  11. Swing arm profilometer: analytical solutions of misalignment errors for testing axisymmetric optics

    NASA Astrophysics Data System (ADS)

    Xiong, Ling; Luo, Xiao; Liu, Zhenyu; Wang, Xiaokun; Hu, Haixiang; Zhang, Feng; Zheng, Ligong; Zhang, Xuejun

    2016-07-01

    The swing arm profilometer (SAP) has been playing a very important role in testing large aspheric optics. As one of most significant error sources that affects the test accuracy, misalignment error leads to low-order errors such as aspherical aberrations and coma apart from power. In order to analyze the effect of misalignment errors, the relation between alignment parameters and test results of axisymmetric optics is presented. Analytical solutions of SAP system errors from tested mirror misalignment, arm length L deviation, tilt-angle θ deviation, air-table spin error, and air-table misalignment are derived, respectively; and misalignment tolerance is given to guide surface measurement. In addition, experiments on a 2-m diameter parabolic mirror are demonstrated to verify the model; according to the error budget, we achieve the SAP test for low-order errors except power with accuracy of 0.1 μm root-mean-square.

  12. Characterisation of microRNAs from apple (Malus domestica 'Royal Gala') vascular tissue and phloem sap

    PubMed Central

    2010-01-01

    Background Plant microRNAs (miRNAs) are a class of small, non-coding RNAs that play an important role in development and environmental responses. Hundreds of plant miRNAs have been identified to date, mainly from the model species for which there are available genome sequences. The current challenge is to characterise miRNAs from plant species with agricultural and horticultural importance, to aid our understanding of important regulatory mechanisms in crop species and enable improvement of crops and rootstocks. Results Based on the knowledge that many miRNAs occur in large gene families and are highly conserved among distantly related species, we analysed expression of twenty-one miRNA sequences in different tissues of apple (Malus x domestica 'Royal Gala'). We identified eighteen sequences that are expressed in at least one of the tissues tested. Some, but not all, miRNAs expressed in apple tissues including the phloem tissue were also detected in the phloem sap sample derived from the stylets of woolly apple aphids. Most of the miRNAs detected in apple phloem sap were also abundant in the phloem sap of herbaceous species. Potential targets for apple miRNAs were identified that encode putative proteins shown to be targets of corresponding miRNAs in a number of plant species. Expression patterns of potential targets were analysed and correlated with expression of corresponding miRNAs. Conclusions This study validated tissue-specific expression of apple miRNAs that target genes responsible for plant growth, development, and stress response. A subset of characterised miRNAs was also present in the apple phloem translocation stream. A comparative analysis of phloem miRNAs in herbaceous species and woody perennials will aid our understanding of non-cell autonomous roles of miRNAs in plants. PMID:20682080

  13. Comparison of different tree sap flow up-scaling procedures using Monte-Carlo simulations

    NASA Astrophysics Data System (ADS)

    Tatarinov, Fyodor; Preisler, Yakir; Roahtyn, Shani; Yakir, Dan

    2015-04-01

    An important task in determining forest ecosystem water balance is the estimation of stand transpiration, allowing separating evapotranspiration into transpiration and soil evaporation. This can be based on up-scaling measurements of sap flow in representative trees (SF), which can be done by different mathematical algorithms. The aim of the present study was to evaluate the error associated with different up-scaling algorithms under different conditions. Other types of errors (such as, measurement error, within tree SF variability, choice of sample plot etc.) were not considered here. A set of simulation experiments using Monte-Carlo technique was carried out and three up-scaling procedures were tested. (1) Multiplying mean stand sap flux density based on unit sapwood cross-section area (SFD) by total sapwood area (Klein et al, 2014); (2) deriving of linear dependence of tree sap flow on tree DBH and calculating SFstand using predicted SF by DBH classes and stand DBH distribution (Cermak et al., 2004); (3) same as method 2 but using non-linear dependency. Simulations were performed under different SFD(DBH) slope (bs, positive, negative, zero); different DBH and SFD standard deviations (Δd and Δs, respectively) and DBH class size. It was assumed that all trees in a unit area are measured and the total SF of all trees in the experimental plot was taken as the reference SFstand value. Under negative bs all models tend to overestimate SFstand and the error increases exponentially with decreasing bs. Under bs >0 all models tend to underestimate SFstand, but the error is much smaller than for bs

  14. A comparison of methods for determining field evapotranspiration: photosynthesis system, sap flow, and eddy covariance

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Tian, F.; Hu, H.; Yang, P.

    2014-03-01

    A multi-scale, multi-technique study was conducted to measure evapotranspiration and its components in a cotton field under mulched drip irrigation conditions in northwestern China. Three measurement techniques at different scales were used: a photosynthesis system (leaf scale), sap flow (plant scale), and eddy covariance (field scale). The experiment was conducted from July to September 2012. To upscale the evapotranspiration from the leaf to plant scale, an approach that incorporated the canopy structure and the relationships between sunlit and shaded leaves was proposed. To upscale the evapotranspiration from the plant to field scale, an approach based on the transpiration per unit leaf area was adopted and modified to incorporate the temporal variability in the relationship between leaf areas and stem diameter. At the plant scale, the estimate of the transpiration based on the photosynthesis system with upscaling was slightly higher (18%) than that obtained by sap flow. At the field scale, the estimates of transpiration derived from sap flow with upscaling and eddy covariance showed reasonable consistency during the cotton's open-boll growth stage, during which soil evaporation can be neglected. The results indicate that the proposed upscaling approaches are reasonable and valid. Based on the measurements and upscaling approaches, evapotranspiration components were analyzed for a cotton field under mulched drip irrigation. During the two analyzed sub-periods in July and August, evapotranspiration rates were 3.94 and 4.53 m day-1, respectively. The fraction of transpiration to evapotranspiration reached 87.1% before drip irrigation and 82.3% after irrigation. The high fraction of transpiration over evapotranspiration was principally due to the mulched film above the drip pipe, low soil water content in the inter-film zone, well-closed canopy, and high water requirement of the crop.

  15. A comparison of methods for determining field evapotranspiration: photosynthesis system, sap flow, and eddy covariance

    NASA Astrophysics Data System (ADS)

    Zhang, Z.; Tian, F.; Hu, H. C.; Hu, H. P.

    2013-11-01

    A multi-scale, multi-technique study was conducted to measure evapotranspiration and its components in a cotton field under mulched drip irrigation conditions in northwestern China. Three measurement techniques at different scales were used: photosynthesis system (leaf scale), sap flow (plant scale), and eddy covariance (field scale). The experiment was conducted from July to September 2012. To upscale the evapotranspiration from the leaf to the plant scale, an approach that incorporated the canopy structure and the relationships between sunlit and shaded leaves was proposed. To upscale the evapotranspiration from the plant to the field scale, an approach based on the transpiration per unit leaf area was adopted and modified to incorporate the temporal variability in the relationships between leaf area and stem diameter. At the plant scale, the estimate of the transpiration based on the photosynthesis system with upscaling was slightly higher (18%) than that obtained by sap flow. At the field scale, the estimates of transpiration derived from sap flow with upscaling and eddy covariance shown reasonable consistency during the cotton open boll growth stage when soil evaporation can be neglected. The results indicate that the upscaling approaches are reasonable and valid. Based on the measurements and upscaling approaches, evapotranspiration components were analyzed under mulched drip irrigation. During the two analysis sub-periods in July and August, evapotranspiration rates were 3.94 and 4.53 mm day-1, respectively. The fraction of transpiration to evapotranspiration reached 87.1% before drip irrigation and 82.3% after irrigation. The high fraction of transpiration over evapotranspiration was principally due to the mulched film above drip pipe, low soil water content in the inter-film zone, well-closed canopy, and high water requirement of the crop.

  16. Modal seismic analysis of a nuclear power plant control panel and comparison with SAP 4

    NASA Technical Reports Server (NTRS)

    Pamidi, M. R.; Pamidi, P. R.

    1976-01-01

    The application of NASTRAN to seismic analysis by considering the example of a nuclear power plant control panel was considered. A modal analysis of a three-dimensional model of the panel, consisting of beam and quadri-lateral membrane elements, is performed. Using the results of this analysis and a typical response spectrum of an earthquake, the seismic response of the structure is obtained. ALTERs required to the program in order to compute the maximum modal responses as well as the resultant response are given. The results are compared with those obtained by using the SAP IV computer program.

  17. Indiscriminate Fisheries: Understanding the Foodweb of the Great Tonle Sap Lake, Cambodia

    NASA Astrophysics Data System (ADS)

    Hannah, L.; Kaufman, L.

    2014-12-01

    Indiscriminate fisheries target multiple species with multiple gear types. In contrast to well-studied, industrialized single-species, single-gear fisheries, little theory and little but growing literature on practice exists for indiscriminate fisheries. Indiscriminate fisheries are disproportionately important in low-income countries, providing most of the animal protein intake in countries such as Cambodia and Bangladesh. Indiscriminate fisheries may be either freshwater or marine, but here we focus on what may be the largest freshwater indiscriminate fishery in the world. Cambodia's freshwater fishery stands out because it provides the majority of animal protein to over 3 million people living in poverty. The fishery of the Tonle Sap lake is one of the largest, if not the largest contributor to this freshwater fish take, and is perhaps the largest freshwater fishery in the world. In contrast to its importance, very little is known about the foodweb ecology of this system, or how community management which now governs the entire fishery, interacts with biological and physical factors such as climate change.The foodweb of the Tonle Sap has changed dramatically due to high fishing pressure. A system that once harbored giant catfish, barbs and stingrays is now dominated by fish under 20cm in length. The simplification of the system may not have reduced its productivity. Theory of indiscriminate fisheries suggests that r-selected species may be favored and that biomass available for harvest may be maximized, while being more sensitive to environmental fluctuations such as climate change due to food web simplification. The r-selection and size predictions of theory have been confirmed by observations of the Tonle Sap. Early model results suggest sensitivity to environmental stochasticity. The interaction of these ecological changes with social systems will be tested in the Tonle Sap. Fisheries management across the lake has been transferred to community management

  18. Electric Potential Variations on a Poplar: Beyond Electrokinetic Effects Associated With Sap Flow

    NASA Astrophysics Data System (ADS)

    Gibert, D.; Le Mouël, J.; Lambs, L.; Nicollin, F.; Conil, F.; Perrier, F.

    2004-12-01

    Electric potential has been monitored since December 2003 in the roots and at two circumferences and one vertical profile in a standing poplar (Populus incognitus). Electric potential is sampled using 5 mm diameter stainless steel rods, inserted 5 mm deep in the cambium, and is referenced to an unpolarizable Petiau electrode installed 80 cm deep in the soil. Various types of signals are observed. Transient signals with long relaxation times affecting some electrodes simultaneously, may be contact potentials triggered by condensation and evaporation. Diurnal variations are observed which present a seasonal variation. During winter, diurnal variations depend on the measurement point, with variable amplitudes and sometimes anticorrelations between electrodes. By contrast, a stable and coherent organization is established in the spring, with larger amplitudes, and lasts during summer. Such signals have been reported previously (Koppan et al., 2000; Morat et al., 1994; Fensom, 1963), have been interpreted as electrokinetic effects associated with sap flow. However, a comparison of the electrical signals with a measurement of the sap flow by a heat flow method, shows that the electrical variation, although clearly correlated to sap flow, is not simply proportional to it. In a living system, electrokinetic effects, in addition to thermoelectrical effects, are probably modified significantly by additional electrochemical effects, such as membrane diffusion potentials, ion active transport by proteins, and action potentials. Such effects have been evidenced in laboratory experiments with plants (e.g., Fromm and Hei, 1998). Electric potential variations in trees may thus reveal mechanisms not accessible by other methods, and maybe reveal new aspects of the physics of living systems. A better understanding of the electrical response of trees to meteorological, chemical or biological forcing may improve the knowledge of transfer processes between the soil and the atmosphere

  19. Use of sap flow measurement to characterize Terroir effect on vineyards

    NASA Astrophysics Data System (ADS)

    Mercier, V.; Payen, S.; Scholasch, T.

    2012-12-01

    Authors have shown the critical role played by vine water deficit variations in fruit and wine composition shaping the "terroir" effect. Our approach aims at characterizing terroir effect through real time sap flow measurements combined with climatic analysis. The goal is to better understand vine water needs to optimize vineyard management operations. Comparing 2 years and 2 pedological units, this study shows how vine water use can reveal the "terroir" effect during a season. MATERIAL AND METHOD Measurements were performed in 2009 and 2010 on 2 Napa vineyards, California. Climatic demand was calculated using on-site weather stations for ETref (Allen et al, 1998). In each location, 4 vines were selected. Sap flow measurements were performed using Sap IP system (Dynamax Inc, USA). We computed maximal transpiration (Tmax) as: Tmax = Kc * ETref (1) where Kc= crop coefficient Vine water deficit (S) is defined as the ratio: S= T/Tmax (2) where T is measured transpiration RESULTS Climatic comparison, Fig.1 2009 was a warm/dry season and 2010 was a cold/wet season. As of Oct. 1st, 1650 and 1400 oC.d were cumulated respectively in 2009 and 2010. Total rains (Nov. 1st to Oct 31st) were 767 mm and 904 mm respectively. Figure 1 shows that S values are lower in 2009 (around 60% from mid July) reflecting drier and hotter conditions compared to 2010 (around 80%). Soil comparison, Fig.2 Soil 1 (clay loam) and soil 2 (gravelly sandy loam) are two different soil units within the same vineyard. Water holding capacity is lower in soil 2, which induces a more limited vine water use and lower S values. On July 23rd, a heat wave caused an increase in transpiration proportionally greater than the rise in ETref. Consequently S values rise and the rise is greater in soil 1, consistent with soil moisture supply being less limiting. CONCLUSION The monitoring of sap flow is a new approach to characterize terroir effect on vine water use. It is currently being used to improve vineyard

  20. Spatial and temporal patterns of xylem sap pH derived from stems and twigs of Populus deltoides L.

    SciTech Connect

    Aubrey, Doug P.; Boyles, Justin G.; Krysinsky, Laura S.; Teskey, Robert O.

    2011-02-12

    Xylem sap pH (pHX) is critical in determining the quantity of inorganic carbon dissolved in xylem solution from gaseous [CO2] measurements. Studies of internal carbon transport have generally assumed that pHX derived from stems and twigs is similar and that pHX remains constant through time; however, no empirical studies have investigated these assumptions. If any of these assumptions are violated, potentially large errors can be introduced into calculations of dissolved CO2 in xylem and resulting estimates of internal carbon transport.Wetested the validity of assumptions related to pHX in Populus deltoides L. with a series of non-manipulative experiments. The pHX derived from stems and twigs was generally similar and remained relatively constant through a diel period. The only exception was that pHX derived from lower stem sections at night was higher than that derived from twigs. The pHX derived from stems was similar on clear days when solar radiation and vapor pressure deficit (VPD) were similar, but higher on an overcast day when solar radiation and VPD were lower. Similarly, cloudy conditions immediately before an afternoon thunderstorm increased pHX derived from twigs. The pHX derived from twigs remained similar when measured on sunny afternoons between July and October. Our results suggest that common assumptions of pHX used in studies of internal carbon transport appear valid for P. deltoides and further suggest pHX is influenced by environmental factors, such as solar radiation and VPD that affect transpiration rates.

  1. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand.

    PubMed

    Charles, Kerry E; Linklater, Wayne L

    2013-08-16

    The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60-100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed defending sap feeding sites from tui (Prosthemadera novaeseelandiae) and conspecifics. Sap appears to be an important resource for kākā across sexes and life stages, and provision of supplementary food is unlikely to reduce sap feeding and tree damage in Wellington City.

  2. Effects of sap-feeding insect herbivores on growth and reproduction of woody plants: a meta-analysis of experimental studies.

    PubMed

    Zvereva, Elena L; Lanta, Vojtech; Kozlov, Mikhail V

    2010-08-01

    The majority of generalisations concerning plant responses to herbivory are based on studies of natural or simulated defoliation. However, effects caused by insects feeding on plant sap are likely to differ from the effects of folivory. We assessed the general patterns and sources of variation in the effects of sap feeding on growth, photosynthesis, and reproduction of woody plants through a meta-analysis of 272 effect sizes calculated from 52 papers. Sap-feeders significantly reduced growth (-29%), reproduction (-17%), and photosynthesis (-27%); seedlings suffered more than saplings and mature trees. Deciduous and evergreen woody plants did not differ in their abilities to tolerate damage imposed by sap-feeders. Different plant parts, in particular below- and above-ground organs, responded similarly to damage, indicating that sap-feeders did not change the resource allocation in plants. The strongest effects were caused by mesophyll and phloem feeders, and the weakest by xylem feeders. Generalist sap-feeders reduced plant performance to a greater extent than did specialists. Methodology substantially influenced the outcomes of the primary studies; experiments conducted in greenhouses yielded stronger negative effects than field experiments; shorter (<12 months) experiments showed bigger growth reduction in response to sap feeding than longer experiments; natural levels of herbivory caused weaker effects than infestation of experimental plants by sap-feeders. Studies conducted at higher temperatures yielded stronger detrimental effects of sap-feeders on their hosts. We conclude that sap-feeders impose a more severe overall negative impact on plant performance than do defoliators, mostly due to the lower abilities of woody plants to compensate for sap-feeders' damage in terms of both growth and photosynthesis.

  3. Radial variation in sap velocity as a function of stem diameter and sapwood thickness in yellow-poplar trees.

    PubMed

    Wullschleger, Stan D.; King, Anthony W.

    2000-04-01

    Canopy transpiration and forest water use are frequently estimated as the product of sap velocity and cross-sectional sapwood area. Few studies, however, have considered whether radial variation in sap velocity and the proportion of sapwood active in water transport are significant sources of uncertainty in the extrapolation process. Therefore, radial profiles of sap velocity were examined as a function of stem diameter and sapwood thickness for yellow-poplar (Liriodendron tulipifera L.) trees growing on two adjacent watersheds in eastern Tennessee. The compensation heat pulse velocity technique was used to quantify sap velocity at four equal-area depths in 20 trees that ranged in stem diameter from 15 to 69 cm, and in sapwood thickness from 2.1 to 14.8 cm. Sap velocity was highly dependent on the depth of probe insertion into the sapwood. Rates of sap velocity were greatest for probes located in the two outer sapwood annuli (P1 and P2) and lowest for probes in closest proximity to the heartwood (P3 and P4). Relative sap velocities averaged 0.98 at P1, 0.66 at P2, 0.41 at P3 and 0.35 at P4. Tree-specific sap velocities measured at each of the four probe positions, divided by the maximum sap velocity measured (usually at P1 or P2), indicated that the fraction of sapwood functional in water transport (f(S)) varied between 0.49 and 0.96. There was no relationship between f(S) and sapwood thickness, or between f(S) and stem diameter. The fraction of functional sapwood averaged 0.66 +/- 0.13 for trees on which radial profiles were determined. No significant depth-related differences were observed for sapwood density, which averaged 469 kg m(-3) across all four probe positions. There was, however, a significant decline in sapwood water content between the two outer probe positions (1.04 versus 0.89 kg kg(-1)). This difference was not sufficient to account for the observed radial variation in sap velocity. A Monte-Carlo analysis indicated that the standard error in

  4. Use of sap flow measurements to validate stomatal functions for mature beech (Fagus sylvatica) in view of ozone uptake calculations.

    PubMed

    Braun, Sabine; Schindler, Christian; Leuzinger, Sebastian

    2010-09-01

    For a quantitative estimate of the ozone effect on vegetation reliable models for ozone uptake through the stomata are needed. Because of the analogy of ozone uptake and transpiration it is possible to utilize measurements of water loss such as sap flow for quantification of ozone uptake. This technique was applied in three beech (Fagus sylvatica) stands in Switzerland. A canopy conductance was calculated from sap flow velocity and normalized to values between 0 and 1. It represents mainly stomatal conductance as the boundary layer resistance in forests is usually small. Based on this relative conductance, stomatal functions to describe the dependence on light, temperature, vapour pressure deficit and soil moisture were derived using multivariate nonlinear regression. These functions were validated by comparison with conductance values directly estimated from sap flow. The results corroborate the current flux parameterization for beech used in the DO3SE model.

  5. Annual and seasonal variation of sap flow and conductance of pine trees grown in elevated carbon dioxide and temperature.

    PubMed

    Wang, Kai-Yun; Kellomäki, Seppo; Zha, Tianshan; Peltola, Heli

    2005-01-01

    Measurements of sap flow, crown structure, and microclimate were used to estimate the transpiration of individual 30-year-old Pinus sylvestris L. trees grown in elevated temperature and CO2. The trees were enclosed in closed-top chambers and exposed either to current ambient conditions (CON), or elevated CO2 (+350 micromol mol(-1); EC), or elevated temperature (+2 to +6 degrees C; ET) or a combination of EC and ET (ECT) since 1996, and the measurements were made from 1999 to 2001. EC significantly increased annual sap flow per tree (Ft.m) by 14% in 1999, but reduced it by 13% in 2000 and 16% in 2001. The CO2-induced increase in Ft.m in 1999 was due to a large increase in foliage area of trees, which more than compensated for a small decrease in crown conductance (Gc). The CO2-induced decreases in Ft.m in 2000 and 2001 resulted from a pronounced decline in Gc, which was much greater than the increase in foliage area. The CO2-induced increase in sensitivity of Gc at high vapour pressure deficit (VPD) did not alter the general response of sap flow to CO2 enrichment, but it did affect the diurnal courses of sap flow on some days during the main growing season (days 150-240). ET increased Ft.m by 53%, 45%, and 57% in 1999, 2000, and 2001, respectively, attributable to the combined effects of greater foliage area and maximum crown conductance, lower stomatal sensitivity to high VPD, and higher transpiration demand relative to the control treatments. There was no significant interaction between CO2 and temperature on sap flow, because ECT entailed approximately similar patterns of sap flow to ET, suggesting that the temperature played a dominate role in the case of ECT under boreal climate conditions.

  6. Antifungal and cytotoxicity activities of the fresh xylem sap of Hymenaea courbaril L. and its major constituent fisetin

    PubMed Central

    2014-01-01

    Background The great potential of plants as Hymenaea courbaril L (jatoba) has not yet been throughly explored scientifically and therefore it is very important to investigate their pharmacological and toxicological activities to establish their real efficacy and safety. This study investigated the cytotoxicity of xylem sap of Hymenaea courbaril L and its bioactivity against the fungi Cryptococcus neoformans species complex and dermatophytes. Methods The fresh xylem sap of H. courbaril was filtered resulting in an insoluble brown color precipitate and was identified as fisetin. In the filtrate was identified the mixture of fisetinediol, fustin, 3-O-methyl-2,3-trans-fustin and taxifolin, which were evaluated by broth microdilution antifungal susceptibility testing against C. neoformans species complex and dermatophytes. The fresh xylem sap and fisetin were screened for cytotoxicity against the 3T3-A31 cells of Balb/c using neutral red uptake (NRU) assay. Results The fresh xylem sap and the fisetin showed higher in vitro activity than the filtrate. The xylem sap of H. courbaril inhibited the growth of dermatophytes and of C. neoformans with minimal inhibition concentration (MIC) < 256 μg/mL, while the fisetin showed MIC < 128 μg/mL for these fungi. Fisetin showed lower toxicity (IC50 = 158 μg/mL) than the fresh xylem sap (IC50 = 109 μg/mL). Conclusion Naturally occurring fisetin can provide excellent starting points for clinical application and can certainly represent a therapeutic potential against fungal infections, because it showed in vitro antifungal activity and low toxicity on animal cells. PMID:25027026

  7. Biochemical composition of symplastic sap from sugarcane genetically modified to overproduce proline.

    PubMed

    Balestro, Graciele Carraro; Higashi, Bruna; Lopes, Sheila Mara Sanches; Gonçalves, José Eduardo; Vieira, Luiz Gonzaga Esteves; de Oliveira, Arildo José Braz; Gonçalves, Regina Aparecida Correia

    2017-04-01

    Global interest in sugarcane has increased significantly in recent years because of its economic impact on sustainable energy production. The purpose of the present study was to evaluate changes in the concentrations of total sugars, amino acids, free proline, and total proteins by colorimetric analyses and nuclear magnetic resonance (NMR) to perform a metabolic profiling of a water-soluble fraction of symplastic sap in response to the constitutive expression of a mutant Δ(1)-pyrroline-5-carboxylate synthetase (P5CS) gene from Vigna aconitifolia. However, there was not a significant increase in the free proline content in the sap of transgenic plants compared to the non-transformed control plants. The most noticeable difference between the two genotypes was an almost two-fold increase in the accumulation of sucrose in the stem internodes of P5CS transgenic sugarcane plants. The results presented in this work showed that transgenic sugarcane plants with increased levels of free proline accumulates high soluble sugar content and, therefore, may represent a novel genotype for improving sugarcane cultivars.

  8. Pulque production from fermented agave sap as a dietary supplement in Prehispanic Mesoamerica

    PubMed Central

    Correa-Ascencio, Marisol; Robertson, Ian G.; Cabrera-Cortés, Oralia; Cabrera-Castro, Rubén; Evershed, Richard P.

    2014-01-01

    Although in modern societies fermented beverages are associated with socializing, celebration, and ritual, in ancient times they were also importa`nt sources of essential nutrients and potable water. In Mesoamerica, pulque, an alcoholic beverage produced from the fermented sap of several species of maguey plants (Agavaceae; Fig. 1) is hypothesized to have been used as a dietary supplement and risk-buffering food in ancient Teotihuacan (150 B.C. to A.D. 650). Although direct archaeological evidence of pulque production is lacking, organic residue analysis of pottery vessels offers a new avenue of investigation. However, the chemical components of alcoholic beverages are water-soluble, greatly limiting their survival over archaeological timescales compared with hydrophobic lipids widely preserved in food residues. Hence, we apply a novel lipid biomarker approach that considers detection of bacteriohopanoids derived from the ethanol-producing bacterium Zymomonas mobilis for identifying pulque production/consumption in pottery vessels. Gas chromatography–mass spectrometry selected ion monitoring (m/z 191) of lipid extracts of >300 potsherds revealed characteristic bacteriohopanoid distributions in a subset of 14 potsherds. This hopanoid biomarker approach offers a new means of identifying commonly occurring bacterially fermented alcoholic beverages worldwide, including palm wine, beer, cider, perry, and other plant sap- or fruit-derived beverages [Swings J, De Ley J (1977) Bacteriol Rev 41(1):1–46]. PMID:25225408

  9. Nitrogen transport in the xylem sap of Quercus ilex: the role of ornithine.

    PubMed

    Nabais, Cristina; Hagemeyer, Jürgen; Freitas, Helena

    2005-05-01

    The storage and remobilization of nitrogen in deciduous and evergreen species is a major source of N, supporting the seasonal growth of trees. In evergreens, in addition to wood and roots, older leaves are important reservoirs of N used in the growth of new foliage. Just before bud burst, when transpiration is inactive or low, and when uptake of nitrogen by the roots may be restricted due to low temperatures, levels of organic N in the xylem are high. Amino acids usually comprise the bulk of this organic N. Changes in amino acid concentrations in early spring are thought to result mainly from hydrolysis of N reserves, and not from current N uptake. The seasonal profiles of amino acids in the xylem sap of Quercus ilex, an evergreen Mediterranean tree, were investigated. The first amino acid detected in the xylem sap before spring was ornithine, which may result from the breakdown of arginine present in storage proteins. Arginine is one of the main amino acids present in storage proteins because each arginine molecule has four nitrogen atoms. When protein degradation increases the free arginine pool, the arginase activity is enhanced and, consequently, the conversion of arginine to ornithine. It seems that ornithine has an important role in N transport early in the growth season of Q. ilex.

  10. Multiscale model of a freeze-thaw process for tree sap exudation.

    PubMed

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M

    2015-10-06

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze-thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation.

  11. The effect of pretreatment temperature on the exudation of xylem sap by detached barley root systems.

    PubMed

    Clarkson, D T; Shone, M G; Wood, A V

    1974-01-01

    Roots of barley (Hordeum vulgare L.) plants which had been grown at 20° were cooled to temperatures of 12° C or lower for 1-5 days and then returned to 20° C when measurements were made of ion and water movement into the xylem after excision. Very marked increases in exudation were observed in cooled roots, sometimes as much as four times greater than in controls kept at 20° C throughout their life. There were no consistent increases in the concentration of K(+), Ca(2+) or H2PO4' in the exudate from cooled roots and it was concluded that the extra water flow across the root occurred without any increase in the osmotic potential of the sap.Similar changes in ion absorption and translocation were found in intact plants transpiring either rapidly or slowly.Cooled roots contained appreciably more soluble carbohydrate than controls and when they were returned to 20° C their respiration was 50-120% greater. These changes were not, however, strictly correlated with differences in exudation in cooled and untreated roots. Cooled plants which had been heavily shaded respired at the same rate as controls but exuded sap at twice the rate.It is concluded that the effects of cooling on both exudation and the accumulation of roluble carbohydrate are consequences of reduced growth and the possible alteration of the selative amounts of growth substances in the root.

  12. A comprehensive strategy for identifying long-distance mobile peptides in xylem sap.

    PubMed

    Okamoto, Satoru; Suzuki, Takamasa; Kawaguchi, Masayoshi; Higashiyama, Tetsuya; Matsubayashi, Yoshikatsu

    2015-11-01

    There is a growing awareness that secreted pemediate organ-to-organ communication in higher plants. Xylem sap peptidomics is an effective but challenging approach for identifying long-distance mobile peptides. In this study we developed a simple, gel-free purification system that combines o-chlorophenol extraction with HPLC separation. Using this system, we successfully identified seven oligopeptides from soybean xylem sap exudate that had one or more post-transcriptional modifications: glycosylation, sulfation and/or hydroxylation. RNA sequencing and quantitative PCR analyses showed that the peptide-encoding genes are expressed in multiple tissues. We further analyzed the long-distance translocation of four of the seven peptides using gene-encoding peptides with single amino acid substitutions, and identified these four peptides as potential root-to-shoot mobile oligopeptides. Promoter-GUS analysis showed that all four peptide-encoding genes were expressed in the inner tissues of the root endodermis. Moreover, we found that some of these peptide-encoding genes responded to biotic and/or abiotic factors. These results indicate that our purification system provides a comprehensive approach for effectively identifying endogenous small peptides and reinforce the concept that higher plants employ various peptides in root-to-shoot signaling.

  13. Multiscale model of a freeze–thaw process for tree sap exudation

    PubMed Central

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M.

    2015-01-01

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze–thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation. PMID:26400199

  14. Baseliner: An open-source, interactive tool for processing sap flux data from thermal dissipation probes

    NASA Astrophysics Data System (ADS)

    Oishi, A. Christopher; Hawthorne, David A.; Oren, Ram

    Estimating transpiration from woody plants using thermal dissipation sap flux sensors requires careful data processing. Currently, researchers accomplish this using spreadsheets, or by personally writing scripts for statistical software programs (e.g., R, SAS). We developed the Baseliner software to help establish a standardized protocol for processing sap flux data. Baseliner enables users to QA/QC data and process data using a combination of automated steps, visualization, and manual editing. Data processing requires establishing a zero-flow reference value, or "baseline", which varies among sensors and with time. Since no set of algorithms currently exists to reliably QA/QC and estimate the zero-flow baseline, Baseliner provides a graphical user interface to allow visual inspection and manipulation of data. Data are first automatically processed using a set of user defined parameters. The user can then view the data for additional, manual QA/QC and baseline identification using mouse and keyboard commands. The open-source software allows for user customization of data processing algorithms as improved methods are developed.

  15. Multipoint MMS observations of fine-scale SAPS structure in the inner magnetosphere

    NASA Astrophysics Data System (ADS)

    Erickson, P. J.; Matsui, H.; Foster, J. C.; Torbert, R. B.; Ergun, R. E.; Khotyaintsev, Yu. V.; Lindqvist, P.-A.; Argall, M. R.; Farrugia, C. J.; Paulson, K. W.; Strangeway, R. J.; Magnes, W.

    2016-07-01

    We present detailed observations of dynamic, fine-scale inner magnetosphere-ionosphere coupling at ˜3.9 RE in the Region 2 Birkeland field-aligned current (FAC). We find that observed electrodynamic spatial/temporal scales are primarily characteristic of magnetically mapped ionospheric structure. On 15 September 2015, conjugate Magnetospheric Multiscale (MMS) spacecraft and Millstone Hill radar observations show plasmasphere boundary region subauroral polarization stream (SAPS) electric fields at L = 4.0-4.2 near 21 MLT. MMS observations reveal high-altitude ˜1 mV/m fine-scale radial and azimuthal electric field perturbations over ≤0.15 L with high spatial coherence over ≥2-3 min and show outward motion within a broader FAC of ˜0.12 μA/m2. Our analysis shows that MMS electric field fluctuations are most likely reflective of SAPS ionospheric structure at scales of ˜22 km and with ionospheric closure of small-scale filamentary FAC perturbations. The results highlight the ionosphere's importance in regulating fine-scale magnetosphere-ionosphere structure.

  16. Influence of stem temperature changes on heat pulse sap flux density measurements.

    PubMed

    Vandegehuchte, Maurits W; Burgess, Stephen S O; Downey, Alec; Steppe, Kathy

    2015-04-01

    While natural spatial temperature gradients between measurement needles have been thoroughly investigated for continuous heat-based sap flow methods, little attention has been given to how natural changes in stem temperature impact heat pulse-based methods through temporal rather than spatial effects. By modelling the theoretical equation for both an ideal instantaneous pulse and a step pulse and applying a finite element model which included actual needle dimensions and wound effects, the influence of a varying stem temperature on heat pulse-based methods was investigated. It was shown that the heat ratio (HR) method was influenced, while for the compensation heat pulse and Tmax methods changes in stem temperatures of up to 0.002 °C s(-1) did not lead to significantly different results. For the HR method, rising stem temperatures during measurements led to lower heat pulse velocity values, while decreasing stem temperatures led to both higher and lower heat pulse velocities, and to imaginary results for high flows. These errors of up to 40% can easily be prevented by including a temperature correction in the data analysis procedure, calculating the slope of the natural temperature change based on the measured temperatures before application of the heat pulse. Results of a greenhouse and outdoor experiment on Pinus pinea L. show the influence of this correction on low and average sap flux densities.

  17. Grapevine phenolic compounds in xylem sap and tissues are significantly altered during infection by Xylella fastidiosa.

    PubMed

    Wallis, Christopher M; Chen, Jianchi

    2012-09-01

    Pierce's disease of grapevine (PD), caused by the bacterial pathogen Xylella fastidiosa, remains a serious problem for grape production in California and elsewhere. This research examined induction of phenolic compounds in grapevines ('Thompson Seedless') infected with X. fastidiosa over a 6-month period. Two months postinoculation with X. fastidiosa, catechin, digalloylquinic acid, and astringin were found at greater levels in xylem sap; multiple catechins, procyanidins, and stilbenoids were found at greater levels in xylem tissues; and precursors to lignin and condensed tannins were found at greater levels in xylem cell walls. However, such large-scale inductions of phenolic compounds were not observed 4 months after inoculation. Six months after inoculation, infected plants had significantly reduced phenolic levels in xylem sap and tissues when compared with control plants, including lowered levels of lignin and condensed tannins. At 6 months, PD symptoms were severe in infected plants and most photosynthetic tissue was abscised. These results suggest that, even though grapevine hosts may initially respond to X. fastidiosa infections with increased production of phenolic compounds, ultimately, PD causes grapevines to enter a state of decline whereby diseased hosts no longer have the resources to support secondary metabolite production, including defense-associated phenolic compounds.

  18. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap.

    PubMed

    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J E; Kogel, Karl-Heinz; Kehr, Julia

    2008-01-01

    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated silicon oil. The exuding phloem sap was collected with a capillary connected to a pump. Using up to 30 plants and 600 aphids (Rhopalosiphum padi) in parallel, an average of 10 mul of phloem sap could be obtained within 6 h of sampling. In first analyses of the macromolecular content, eight so far unknown phloem mRNAs were identified by cDNA-amplified fragment length polymorphism. Transcripts in barley phloem exudates are related to metabolism, signalling, and pathogen defence, for example coding for a protein kinase and a pathogen- and insect-responsive WIR1A (wheat-induced resistance 1A)-like protein. Further, one-dimensional gel electrophoresis and subsequent partial sequencing by mass spectrometry led to the identification of seven major proteins with putative functions in stress responses and transport of mRNAs, proteins, and sugars. Two of the discovered proteins probably represent isoforms of a new phloem-mobile sucrose transporter. Notably, two-dimensional electrophoresis confirmed that there are >250 phloem proteins awaiting identification in future studies.

  19. Tree sap flow and stand transpiration of two Acacia mangium plantations in Sabah, Borneo

    NASA Astrophysics Data System (ADS)

    Cienciala, E.; Kučera, J.; Malmer, A.

    2000-09-01

    Water use of Acacia mangium trees grown in plantations was measured by a heat balance method in two stands that largely differed in tree density. Tree sap flow was closely coupled to climatic drivers and responded with minimal time delay. Using no time shift, sap flow rate could be tightly fitted to a simple equation that combined a parabolic response to radiation and an inverse linear response to air humidity. On the contrary, the analysis of canopy conductance showed no meaningful response to either individual or combined microclimatic variables. No indication of water deficit was observed, though the measurement period was during the dry period of the year. The measurements indicate a minimal diurnal use of water stored in plant tissues. The difference in tree water use from the two studied stands was effectively scaled by tree sapwood area. Canopy transpiration of the densest stand reached in average 3.9 mm d -1 compared with 2.7 mm d -1 for the stand representing the average conditions in the catchment.

  20. Phoenix dactylifera L. sap enhances wound healing in Wistar rats: Phytochemical and histological assessment.

    PubMed

    Abdennabi, Raed; Bardaa, Sana; Mehdi, Meriem; Rateb, Mostafa E; Raab, Andrea; Alenezi, Faizah N; Sahnoun, Zouheir; Gharsallah, Neji; Belbahri, Lassaad

    2016-07-01

    The sap of the date palm "Lagmi" is a clear liquid, rich in sugars and minerals, with a pleasant flavour. Folk remedies based on the use of "Lagmi" for wound healing are still practiced. However, no studies investigated the relevance of "Lagmi" for wound healing. Therefore, the aim of this study was to identify the in vivo healing properties of "lagmi" on mechanically wounded wistar rats. Injured rats were divided into three groups: a first group treated by "lagmi", a second reference group processed by CICAFLORA(®) and a third untreated control group. On the 12th day of the experiment, total healing in the first group was reached, while healing was incomplete in the other groups. The sap seems to accelerate cell proliferation and contribute to faster healing with a gain of more than 30% as compared to CICAFLORA(®). Chemical Analysis of "Lagmi" showed important radical scavenging activity and high total antioxidant capacity. Features reported to help healing process and/or provides a favourable environment for tissue healing in wound sites. Extensive characterization of "Lagmi" phenolic and flavonoid compounds by High Resolution LC-MS (LC-HRESIMS) analysis indicates "Lagmi" is an important source of known anti-inflammatory compounds as well as promising wound healing candidates.

  1. Channel initiation by groundwater sapping in Kanozan, Boso Peninsula of central Japan

    NASA Astrophysics Data System (ADS)

    Matsushi, Y.; Hattanji, T.

    2006-12-01

    Groundwater sapping is known as one of the important processes for channel initiation. We examined hydro- geomorphic factors that affect channel initiation by groundwater sapping. The study site (Mt. Kanozan) is located in Boso Peninsula, 50-km southeast of Tokyo, central Japan. Unconfined sandstone with high permeability comprises the mountain. Some features of piping, boiling and seepage erosion were found along first and second-order channels. Runoff at a spring site (SS) kept a constant discharge throughout year, and did not show any responses to typhoon storms with over 100-mm total rainfall. We surveyed micro-topography of 12 channel heads. Most channel heads have steep head slope (35-45 deg.) and gentle gradient downstream (5-10 deg.). Gentle slope of groundwater table immediately above channel head (roughly 7 deg. at the spring site SS) controls channel gradient, and affects distinct gradient transition at channel heads. We could not found any significant correlation between source area and local slope at channel heads, probably due to a scattered relation between surface drainage area and spring discharge. All channel heads are located in an altitude zone of 50-100 m, while the altitude of mountain peak is 270 m. The limited altitude distribution of channel heads implies that channel initiation of this area should be controlled by a critical altitude associated with deep groundwater flow systems.

  2. Pulque production from fermented agave sap as a dietary supplement in Prehispanic Mesoamerica.

    PubMed

    Correa-Ascencio, Marisol; Robertson, Ian G; Cabrera-Cortés, Oralia; Cabrera-Castro, Rubén; Evershed, Richard P

    2014-09-30

    Although in modern societies fermented beverages are associated with socializing, celebration, and ritual, in ancient times they were also importa`nt sources of essential nutrients and potable water. In Mesoamerica, pulque, an alcoholic beverage produced from the fermented sap of several species of maguey plants (Agavaceae; Fig. 1) is hypothesized to have been used as a dietary supplement and risk-buffering food in ancient Teotihuacan (150 B.C. to A.D. 650). Although direct archaeological evidence of pulque production is lacking, organic residue analysis of pottery vessels offers a new avenue of investigation. However, the chemical components of alcoholic beverages are water-soluble, greatly limiting their survival over archaeological timescales compared with hydrophobic lipids widely preserved in food residues. Hence, we apply a novel lipid biomarker approach that considers detection of bacteriohopanoids derived from the ethanol-producing bacterium Zymomonas mobilis for identifying pulque production/consumption in pottery vessels. Gas chromatography-mass spectrometry selected ion monitoring (m/z 191) of lipid extracts of >300 potsherds revealed characteristic bacteriohopanoid distributions in a subset of 14 potsherds. This hopanoid biomarker approach offers a new means of identifying commonly occurring bacterially fermented alcoholic beverages worldwide, including palm wine, beer, cider, perry, and other plant sap- or fruit-derived beverages [Swings J, De Ley J (1977) Bacteriol Rev 41(1):1-46].

  3. Sap-feeding insects on forest trees along latitudinal gradients in northern Europe: a climate-driven patterns.

    PubMed

    Kozlov, Mikhail V; Stekolshchikov, Andrey V; Söderman, Guy; Labina, Eugenia S; Zverev, Vitali; Zvereva, Elena L

    2015-01-01

    Knowledge of the latitudinal patterns in biotic interactions, and especially in herbivory, is crucial for understanding the mechanisms that govern ecosystem functioning and for predicting their responses to climate change. We used sap-feeding insects as a model group to test the hypotheses that the strength of plant-herbivore interactions in boreal forests decreases with latitude and that this latitudinal pattern is driven primarily by midsummer temperatures. We used a replicated sampling design and quantitatively collected and identified all sap-feeding insects from four species of forest trees along five latitudinal gradients (750-1300 km in length, ten sites in each gradient) in northern Europe (59 to 70°N and 10 to 60°E) during 2008-2011. Similar decreases in diversity of sap-feeding insects with latitude were observed in all gradients during all study years. The sap-feeder load (i.e. insect biomass per unit of foliar biomass) decreased with latitude in typical summers, but increased in an exceptionally hot summer and was independent of latitude during a warm summer. Analysis of combined data from all sites and years revealed dome-shaped relationships between the loads of sap-feeders and midsummer temperatures, peaking at 17 °C in Picea abies, at 19.5 °C in Pinus sylvestris and Betula pubescens and at 22 °C in B. pendula. From these relationships, we predict that the losses of forest trees to sap-feeders will increase by 0-45% of the current level in southern boreal forests and by 65-210% in subarctic forests with a 1 °C increase in summer temperatures. The observed relationships between temperatures and the loads of sap-feeders differ between the coniferous and deciduous tree species. We conclude that climate warming will not only increase plant losses to sap-feeding insects, especially in subarctic forests, but can also alter plant-plant interactions, thereby affecting both the productivity and the structure of future forest ecosystems.

  4. Establishment and Validation of GV-SAPS II Scoring System for Non-Diabetic Critically Ill Patients

    PubMed Central

    Liu, Wen-Yue; Lin, Shi-Gang; Zhu, Gui-Qi; Poucke, Sven Van; Braddock, Martin; Zhang, Zhongheng; Mao, Zhi; Shen, Fei-Xia

    2016-01-01

    Background and Aims Recently, glucose variability (GV) has been reported as an independent risk factor for mortality in non-diabetic critically ill patients. However, GV is not incorporated in any severity scoring system for critically ill patients currently. The aim of this study was to establish and validate a modified Simplified Acute Physiology Score II scoring system (SAPS II), integrated with GV parameters and named GV-SAPS II, specifically for non-diabetic critically ill patients to predict short-term and long-term mortality. Methods Training and validation cohorts were exacted from the Multiparameter Intelligent Monitoring in Intensive Care database III version 1.3 (MIMIC-III v1.3). The GV-SAPS II score was constructed by Cox proportional hazard regression analysis and compared with the original SAPS II, Sepsis-related Organ Failure Assessment Score (SOFA) and Elixhauser scoring systems using area under the curve of the receiver operator characteristic (auROC) curve. Results 4,895 and 5,048 eligible individuals were included in the training and validation cohorts, respectively. The GV-SAPS II score was established with four independent risk factors, including hyperglycemia, hypoglycemia, standard deviation of blood glucose levels (GluSD), and SAPS II score. In the validation cohort, the auROC values of the new scoring system were 0.824 (95% CI: 0.813–0.834, P< 0.001) and 0.738 (95% CI: 0.725–0.750, P< 0.001), respectively for 30 days and 9 months, which were significantly higher than other models used in our study (all P < 0.001). Moreover, Kaplan-Meier plots demonstrated significantly worse outcomes in higher GV-SAPS II score groups both for 30-day and 9-month mortality endpoints (all P< 0.001). Conclusions We established and validated a modified prognostic scoring system that integrated glucose variability for non-diabetic critically ill patients, named GV-SAPS II. It demonstrated a superior prognostic capability and may be an optimal scoring system

  5. A model of heat transfer in sapwood and implications for sap flux density measurements using thermal dissipation probes

    SciTech Connect

    Wullschleger, Stan D; Childs, Kenneth W; King, Anthony Wayne; Hanson, Paul J

    2011-01-01

    A variety of thermal approaches are used to estimate sap flux density in stems of woody plants. Models have proven valuable tools for interpreting the behavior of heat pulse, heat balance, and heat field deformation techniques, but have seldom been used to describe heat transfer dynamics for the heat dissipation method. Therefore, to better understand the behavior of heat dissipation probes, a model was developed that takes into account the thermal properties of wood, the physical dimensions and thermal characteristics of the probes, and the conductive and convective heat transfer that occurs due to water flow in the sapwood. Probes were simulated as aluminum tubes 20 mm in length and 2 mm in diameter, whereas sapwood, heartwood, and bark each had a density and water fraction that determined their thermal properties. Base simulations assumed a constant sap flux density with sapwood depth and no wounding or physical disruption of xylem beyond the 2 mm diameter hole drilled for probe installation. Simulations across a range of sap flux densities showed that the dimensionless quantity k defined as ( Tm T)/ T where Tm is the temperature differential ( T) between the heated and unheated probe under zero flow conditions was dependent on the thermal conductivity of the sapwood. The relationship between sap flux density and k was also sensitive to radial gradients in sap flux density and to xylem disruption near the probe. Monte Carlo analysis in which 1000 simulations were conducted while simultaneously varying thermal conductivity and wound diameter revealed that sap flux density and k showed considerable departure from the original calibration equation used with this technique. The departure was greatest for abrupt patterns of radial variation typical of ring-porous species. Depending on the specific combination of thermal conductivity and wound diameter, use of the original calibration equation resulted in an 81% under- to 48% over-estimation of sap flux density at

  6. [Stem sap flow of grape under different drip irrigation patterns and its relationships with environmental factors in arid oasis region of Shiyang River basin].

    PubMed

    Du, Tai-Sheng; Kang, Shao-Zhong; Zhang, Bao-Zhong; Li, Si-En; Yang, Xiu-Ying

    2008-02-01

    This paper studied the stem sap flow of grape in arid oasis region of Shiyang River basin under conventional drip irrigation (CDI), alternate drip irrigation (ADI), and fixed drip irrigation (FDI), and its relationships with meteorological conditions and soil moisture content. The results showed that the stem sap flow of grape had an obvious day-night rhythm synchronous with solar radiation, and was significantly higher under CDI than under ADI and FDI during new branch growth and flowering stages. Solar radiation and air temperature were the main meteorological factors affecting the hourly sap flow, and the daily stem sap flow had linear relationships with daily air temperature and wind speed. The correlation coefficients between the stem sap flow and the meteorological factors ranked in the order of CDI > ADI > FDI. There was a significant correlation between daily stem sap flow and reference crop evapotranspiration (ET0). Compared with CDI, ADI could save 50% of irrigation water while the stem sap flow only reduced by 6.56%, and an obvious compensation effect between stem sap flow and hydraulic conductivity was observed.

  7. Studies on the interactions of SAP-1 (an N-terminal truncated form of cystatin S) with its binding partners by CD-spectroscopic and molecular docking methods.

    PubMed

    Yadav, Vikash Kumar; Mandal, Rahul Shubhra; Puniya, Bhanwar Lal; Singh, Sarman; Yadav, Savita

    2015-01-01

    SAP-1 is a 113 amino acid long single-chain protein which belongs to the type 2 cystatin gene family. In our previous study, we have purified SAP-1 from human seminal plasma and observed its cross-class inhibitory property. At this time, we report the interaction of SAP-1 with diverse proteases and its binding partners by CD-spectroscopic and molecular docking methods. The circular dichroism (CD) spectroscopic studies demonstrate that the conformation of SAP-1 is changed after its complexation with proteases, and the alterations in protein secondary structure are quantitatively calculated with increase of α-helices and reduction of β-strand content. To get insight into the interactions between SAP-1 and proteases, we make an effort to model the three-dimensional structure of SAP-1 by molecular modeling and verify its stability and viability through molecular dynamics simulations and finally complexed with different proteases using ClusPro 2.0 Server. A high degree of shape complementarity is examined within the complexes, stabilized by a number of hydrogen bonds (HBs) and hydrophobic interactions. Using HB analyses in different protein complexes, we have identified a series of key residues that may be involved in the interactions between SAP-1 and proteases. These findings will assist to understand the mechanism of inhibition of SAP-1 for different proteases and provide intimation for further research.

  8. Evapotranspiration partitioning and variation of sap flow in female and male parents of maize for hybrid seed production in arid region

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding the variation of sap flow in female and male parents of maize for hybrid seed production and evapotranspiration (ET) partitioning is useful in accurately determining water use of the female and male parents and improving irrigation management of maize for hybrid seed production. Sap fl...

  9. Detection of Buried Objects by Means of a SAP Technique: Comparing MUSIC- and SVR-Based Approaches

    NASA Astrophysics Data System (ADS)

    Meschino, S.; Pajewski, L.; Pastorino, M.; Randazzo, A.; Schettini, G.

    2012-04-01

    This work is focused on the application of a Sub-Array Processing (SAP) technique to the detection of metallic cylindrical objects embedded in a dielectric half-space. The identification of buried cables, pipes, conduits, and other cylindrical utilities, is an important problem that has been extensively studied in the last years. Most commonly used approaches are based on the use of electromagnetic sensing: a set of antennas illuminates the ground and the collected echo is analyzed in order to extract information about the scenario and to localize the sought objects [1]. In a SAP approach, algorithms for the estimation of Directions of Arrival (DOAs) are employed [2]: they assume that the sources (in this paper, currents induced on buried targets) are in the far-field region of the receiving array, so that the received wavefront can be considered as planar, and the main angular direction of the field can be estimated. However, in electromagnetic sensing of buried objects, the scatterers are usually quite near to the antennas. Nevertheless, by dividing the whole receiving array in a suitable number of sub-arrays, and by finding a dominant DOA for each one, it is possible to localize objects that are in the far-field of the sub-array, although being in the near-field of the array. The DOAs found by the sub-arrays can be triangulated, obtaining a set of crossings with intersections condensed around object locations. In this work, the performances of two different DOA algorithms are compared. In particular, a MUltiple SIgnal Classification (MUSIC)-type method [3] and Support Vector Regression (SVR) based approach [4] are employed. The results of a Cylindrical-Wave Approach forward solver are used as input data of the detection procedure [5]. To process the crossing pattern, the region of interest is divided in small windows, and a Poisson model is adopted for the statistical distribution of intersections in the windows. Hypothesis testing procedures are used (imposing

  10. Comparisons of xylem sap flow and water vapour flux at the stand level and derivation of canopy conductance for Scots pine

    NASA Astrophysics Data System (ADS)

    Granier, A.; Biron, P.; Köstner, B.; Gay, L. W.; Najjar, G.

    1996-03-01

    Simultaneous measurements of xylem sap flow and water vapour flux over a Scots pine ( Pinus sylvestris) forest (Hartheim, Germany), were carried out during the Hartheim Experiment (HartX), an intensive observation campaign of the international programme REKLIP. Sap flow was measured every 30 min using both radial constant heating (Granier, 1985) and two types of Cermak sap flowmeters installed on 24 trees selected to cover a wide range of the diameter classes of the stand (min 8 cm; max 17.5 cm). Available energy was high during the observation period (5.5 to 6.9 mm.day-1), and daily cumulated sap flow on a ground area basis varied between 2.0 and 2.7 mm day-1 depending on climate conditions. Maximum hourly values of sap flow reached 0.33 mm h-1, i.e., 230 W m-2. Comparisons of sap flow with water vapour flux as measured with two OPEC (One Propeller Eddy Correlation, University of Arizona) systems showed a time lag between the two methods, sap flow lagging about 90 min behind vapour flux. After taking into account this time lag in the sap flow data set, a good agreement was found between both methods: sap flow = 0.745* vapour flux, r 2 = 0.86. The difference between the two estimates was due to understory transpiration. Canopy conductance ( g c ) was calculated from sap flow measurements using the reverse form of Penman-Monteith equation and climatic data measured 4 m above the canopy. Variations of g c were well correlated ( r 2 = 0.85) with global radiation ( R) and vapour pressure deficit ( vpd). The quantitative expression for g c = f ( R, vpd) was very similar to that previously found with maritime pine ( Pinus pinaster) in the forest of Les Landes, South Western France.

  11. Potential pathways for regulation of NK and T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4.

    PubMed

    Sayós, J; Nguyen, K B; Wu, C; Stepp, S E; Howie, D; Schatzle, J D; Kumar, V; Biron, C A; Terhorst, C

    2000-12-01

    SAP, the gene that is altered or absent in the X-linked lymphoproliferative syndrome (XLP), encodes a small protein that comprises a single SH2 domain and binds to the cell-surface protein SLAM which is present on activated or memory T and B cells. Because defective NK cell activity also has been reported in XLP patients, we studied the SAP gene in NK cells. SAP was induced upon viral infection of SCID mice and shown to be expressed in NK cells by in vitro culturing in the presence of IL-2. Moreover, SAP was expressed in the NK cell lines YT and RNK 16. Because SLAM, the cell-surface protein with which SAP interacts, and 2B4, a membrane protein having sequence homologies with SLAM, also were found to be expressed on the surfaces of activated NK and T cell populations, they may access SAP functions in these populations. Whereas we found that 2B4 also binds SAP, 2B4-SAP interactions occurred only upon tyrosine phosphorylation of 2B4. By contrast, SLAM-SAP interactions were independent of phosphorylation of Y281 and Y327 on SLAM. As CD48, the ligand for 2B4, is expressed on the surface of Epstein-Barr virus (EBV)-infected B cells, it is likely that SAP regulates signal transduction through this pair of cell-surface molecules. These data support the hypothesis that XLP is a result of both defective NK and T lymphocyte responses to EBV. The altered responses may be due to aberrant control of the signaling cascades which are initiated by the SLAM-SLAM and 2B4-CD48 interactions.

  12. Spatial variations in xylem sap flux density in the trunk of orchard-grown, mature mango trees under changing soil water conditions.

    PubMed

    Lu, Ping; Müller, Warren J.; Chacko, Elias K.

    2000-05-01

    Circumferential and radial variations in xylem sap flux density in trunks of 13-year-old mango (Mangifera indica L.) trees were investigated with Granier sap flow sensor probes under limiting and non-limiting soil water conditions. Under non-limiting soil water conditions, circumferential variation was substantial, but there was no apparent relationship between sap flux density and aspect (i.e., the radial position of the sensor probes on the trunk relative to the compass). Hourly sap flux densities over 24 hours at different aspects were highly pair-wise correlated. The relationships between different aspects were constant during well-watered periods but highly variable under changing soil water conditions. Sap flux density showed marked radial variation within the trunk and a substantial flux was observed at the center of the trunk. For each selected aspect on each tree, changes in sap flux densities over time at different depths were closely correlated, so flux at a particular depth could be extrapolated as a multiple of flux from 0 to 2 cm beneath the cambium. However, depth profiles of sap flux density differed between trees and even between aspects within a tree, and also varied in an unpredictable manner as soil water conditions changed. Nevertheless, over a period of non-limiting soil water conditions, depth profiles remained relatively constant. Based on the depth profiles obtained during these periods, a method is described for calculating total sap flow in a mango tree from sap flux density at 0-2 cm beneath the cambium. Total daily sap flows obtained were consistent with water use estimated from soil water balance.

  13. Accounting for sap flow from different parts of the root system improves the prediction of xylem ABA concentration in plants grown with heterogeneous soil moisture

    PubMed Central

    Dodd, Ian C.; Egea, Gregorio; Davies, William J.

    2008-01-01

    When soil moisture is heterogeneous, sap flow from, and ABA status of, different parts of the root system impact on leaf xylem ABA concentration ([X-ABA]leaf). The robustness of a model for predicting [X-ABA]leaf was assessed. ‘Two root-one shoot’ grafted sunflower (Helianthus annuus L.) plants received either deficit irrigation (DI, each root system received the same irrigation volumes) or partial rootzone drying (PRD, only one root system was watered and the other dried the soil). Irrespective of whether relative sap flow was assessed using sap flow sensors in vivo or by pressurization of de-topped roots, each root system contributed similarly to total sap flow during DI, while sap flow from roots in drying soil declined linearly with soil water potential (Ψsoil) during PRD. Although Ψsoil of the irrigated pot determined the threshold Ψsoil at which sap flow from roots in drying soil decreased, the slope of this decrease was independent of the wet pot Ψsoil. Irrespective of whether sap was collected from the wet or dry root system of PRD plants, or a DI plant, root xylem ABA concentration increased as Ψsoil declined. The model, which weighted ABA contributions of each root system according to the sap flow from each, almost perfectly explained [X-ABA] immediately above the graft union. That the model overestimated measured [X-ABA]leaf may result from changes in [X-ABA] along the transport pathway or an artefact of collecting xylem sap from detached leaves. The implications of declining sap flow through partially dry roots during PRD for the control of stomatal behaviour and irrigation scheduling are discussed. PMID:18940933

  14. Accounting for sap flow from different parts of the root system improves the prediction of xylem ABA concentration in plants grown with heterogeneous soil moisture.

    PubMed

    Dodd, Ian C; Egea, Gregorio; Davies, William J

    2008-01-01

    When soil moisture is heterogeneous, sap flow from, and ABA status of, different parts of the root system impact on leaf xylem ABA concentration ([X-ABA]leaf). The robustness of a model for predicting [X-ABA]leaf was assessed. 'Two root-one shoot' grafted sunflower (Helianthus annuus L.) plants received either deficit irrigation (DI, each root system received the same irrigation volumes) or partial rootzone drying (PRD, only one root system was watered and the other dried the soil). Irrespective of whether relative sap flow was assessed using sap flow sensors in vivo or by pressurization of de-topped roots, each root system contributed similarly to total sap flow during DI, while sap flow from roots in drying soil declined linearly with soil water potential (Psisoil) during PRD. Although Psisoil of the irrigated pot determined the threshold Psisoil at which sap flow from roots in drying soil decreased, the slope of this decrease was independent of the wet pot Psisoil. Irrespective of whether sap was collected from the wet or dry root system of PRD plants, or a DI plant, root xylem ABA concentration increased as Psisoil declined. The model, which weighted ABA contributions of each root system according to the sap flow from each, almost perfectly explained [X-ABA] immediately above the graft union. That the model overestimated measured [X-ABA]leaf may result from changes in [X-ABA] along the transport pathway or an artefact of collecting xylem sap from detached leaves. The implications of declining sap flow through partially dry roots during PRD for the control of stomatal behaviour and irrigation scheduling are discussed.

  15. Comparative transcriptome analysis of Gossypium hirsutum L. in response to sap sucking insects: aphid and whitefly

    PubMed Central

    2013-01-01

    Background Cotton (Gossypium hirsutum L.) is a major fiber crop that is grown worldwide; it faces extensive damage from sap-sucking insects, including aphids and whiteflies. Genome-wide transcriptome analysis was performed to understand the molecular details of interaction between Gossypium hirsutum L. and sap-sucking pests, namely Aphis gossypii (Aphid) and Bemisia tabacci (Whiteflies). Roche’s GS-Titanium was used to sequence transcriptomes of cotton infested with aphids and whiteflies for 2 h and 24 h. Results A total of 100935 contigs were produced with an average length of 529 bp after an assembly in all five selected conditions. The Blastn of the non-redundant (nr) cotton EST database resulted in the identification of 580 novel contigs in the cotton plant. It should be noted that in spite of minimal physical damage caused by the sap-sucking insects, they can change the gene expression of plants in 2 h of infestation; further change in gene expression due to whiteflies is quicker than due to aphids. The impact of the whitefly 24 h after infestation was more or less similar to that of the aphid 2 h after infestation. Aphids and whiteflies affect many genes that are regulated by various phytohormones and in response to microbial infection, indicating the involvement of complex crosstalk between these pathways. The KOBAS analysis of differentially regulated transcripts in response to aphids and whiteflies indicated that both the insects induce the metabolism of amino acids biosynthesis specially in case of whiteflies infestation at later phase. Further we also observed that expression of transcript related to photosynthesis specially carbon fixation were significantly influenced by infestation of Aphids and Whiteflies. Conclusions A comparison of different transcriptomes leads to the identification of differentially and temporally regulated transcripts in response to infestation by aphids and whiteflies. Most of these differentially expressed contigs were

  16. Impact of LbSapSal Vaccine in Canine Immunological and Parasitological Features before and after Leishmania chagasi-Challenge

    PubMed Central

    Resende, Lucilene Aparecida; Aguiar-Soares, Rodrigo Dian de Oliveira; Gama-Ker, Henrique; Roatt, Bruno Mendes; de Mendonça, Ludmila Zanandreis; Alves, Marina Luiza Rodrigues; da Silveira-Lemos, Denise; Corrêa-Oliveira, Rodrigo; Martins-Filho, Olindo Assis; Araújo, Márcio Sobreira Silva; Fujiwara, Ricardo Toshio; Gontijo, Nelder Figueiredo; Reis, Alexandre Barbosa; Giunchetti, Rodolfo Cordeiro

    2016-01-01

    Dogs represent the most important domestic reservoir of L. chagasi (syn. L. infantum). A vaccine against canine visceral leishmaniasis (CVL) would be an important tool for decreasing the anxiety related to possible L. chagasi infection and for controlling human visceral leishmaniasis (VL). Because the sand fly salivary proteins are potent immunogens obligatorily co-deposited during transmission of Leishmania parasites, their inclusion in an anti-Leishmania vaccine has been investigated in past decades. We investigated the immunogenicity of the “LbSapSal” vaccine (L. braziliensis antigens, saponin as adjuvant, and Lutzomyia longipalpis salivary gland extract) in dogs at baseline (T0), during the post-vaccination protocol (T3rd) and after early (T90) and late (T885) times following L. chagasi-challenge. Our major data indicated that immunization with “LbSapSal” is able to induce biomarkers characterized by enhanced amounts of type I (tumor necrosis factor [TNF]-α, interleukin [IL]-12, interferon [IFN]-γ) cytokines and reduction in type II cytokines (IL-4 and TGF-β), even after experimental challenge. The establishment of a prominent pro-inflammatory immune response after “LbSapSal” immunization supported the increased levels of nitric oxide production, favoring a reduction in spleen parasitism (78.9%) and indicating long-lasting protection against L. chagasi infection. In conclusion, these results confirmed the hypothesis that the “LbSapSal” vaccination is a potential tool to control the Leishmania chagasi infection. PMID:27556586

  17. Phytoplasma SAP11 alters 3-isobutyl-2-methoxypyrazine biosynthesis in Nicotiana benthamiana by suppressing NbOMT1

    PubMed Central

    Tan, Choon Meng; Li, Chia-Hua; Tsao, Nai-Wen; Su, Li-Wen; Lu, Yen-Ting; Chang, Shu Heng; Lin, Yi Yu; Liou, Jyun-Cyuan; Hsieh, Li-Ching; Yu, Jih-Zu; Sheue, Chiou-Rong; Wang, Sheng-Yang; Lee, Chin-Fa; Yang, Jun-Yi

    2016-01-01

    Phytoplasmas are bacterial phytopathogens that release virulence effectors into sieve cells and act systemically to affect the physiological and morphological state of host plants to promote successful pathogenesis. We show here that transgenic Nicotiana benthamiana lines expressing the secreted effector SAP11 from Candidatus Phytoplasma mali exhibit an altered aroma phenotype. This phenomenon is correlated with defects in the development of glandular trichomes and the biosynthesis of 3-isobutyl-2-methoxypyrazine (IBMP). IBMP is a volatile organic compound (VOC) synthesized by an O-methyltransferase, via a methylation step, from a non-volatile precursor, 3-isobutyl-2-hydroxypyrazine (IBHP). Based on comparative and functional genomics analyses, NbOMT1, which encodes an O-methyltransferase, was found to be highly suppressed in SAP11-transgenic plants. We further silenced NbOMT1 through virus-induced gene silencing and demonstrated that this enzyme influenced the accumulation of IBMP in N. benthamiana. In vitro biochemical analyses also showed that NbOMT1 can catalyse IBHP O-methylation in the presence of S-adenosyl-L-methionine. Our study suggests that the phytoplasma effector SAP11 has the ability to modulate host VOC emissions. In addition, we also demonstrated that SAP11 destabilized TCP transcription factors and suppressed jasmonic acid responses in N. benthamiana. These findings provide valuable insights into understanding how phytoplasma effectors influence plant volatiles. PMID:27279277

  18. Effects of elevated [CO(2)] and nitrogen nutrition on cytokinins in the xylem sap and leaves of cotton.

    PubMed

    Yong, J W; Wong, S C; Letham, D S; Hocart, C H; Farquhar, G D

    2000-10-01

    We measured the level of xylem-derived cytokinins (CKs) entering a cotton leaf, and the CK levels in the same leaf, thus enabling xylem sap and foliar CKs to be compared concurrently. Although zeatin was the dominant CK in xylem sap, zeatin, dihydrozeatin, and N(6)-(2-isopentenyl) adenine were present in approximately equimolar levels in leaves. Elevated [CO(2)] (EC) has an effect on the levels of cytokinins in sap and leaf tissues. This effect was modulated by the two levels of root nitrogen nutrition (2 and 12 mM nitrate). Growth enhancement (70%) in EC over plants in ambient [CO(2)] (AC) was observed for both nitrogen nutrition treatments. Low-nitrogen leaves growing in EC exhibited photosynthetic acclimation, whereas there was no sign of photosynthetic acclimation in high-nitrogen grown leaves. Under these prevailing conditions, xylem sap and leaf tissues were obtained for CK analysis. Higher nitrogen nutrition increased the delivery per unit leaf area of CKs to the leaf at AC. EC caused a greater increase in CK delivery to the leaf at low nitrogen conditions (106%) than at high nitrogen conditions (17%). EC induced a significant increase in CK content in low-nitrogen leaves, whereas CK content in leaf tissues was similar for high-nitrogen leaves growing in AC and EC.

  19. Dusky sap beetles (Coleoptera: Nitidulidae) and other kernel damaging insects in Bt and non-Bt sweet corn in Illinois.

    PubMed

    Dowd, P F

    2000-12-01

    Bt and non-Bt sweet corn hybrids (Rogers 'Empire' Bt and non-Bt, respectively) were compared for distribution of kernel damaging insect pests in central Illinois in 1998 and 1999. The occurrence and damage by caterpillars [primarily Helicoverpa zea (Boddie)] were reduced by at least 80% in each year for the Bt compared with the non-Bt hybrid. However, the incidence of sap beetle adults (primarily Carpophilus lugubris Murray) was higher, and larvae, lower for the Bt versus non-Bt in 1999. The incidence of ears with more than five kernels damaged by sap beetles was higher for the Bt compared with non-Bt hybrid in 1998 (13.8 versus 5.5%), but nearly equivalent in 1999 (15.3 versus 15.1%, respectively). Distribution of predators on plants (primarily Coccinelidae) and harvested ears (primarily Orius spp.) were not significantly different on Bt versus non-Bt hybrids. Ears with husks flush with the ear tip or with ear tips exposed had significantly higher sap beetle damage for both hybrids, and the Bt hybrids had significantly higher incidence of exposed ear tips in both years. Sap beetle numbers determined by scouting were often proportional to numbers of beetles captured in baited traps, increasing and decreasing at about the same time. However, values determined with traps were typically less variable than when scouted, and time of sampling was typically four times more rapid for each trap than for each 10 plant scout sample when measured in 1999.

  20. Water Deficit-Induced Changes in Concentrations in Proline and Some Other Amino Acids in the Phloem Sap of Alfalfa.

    PubMed

    Girousse, C.; Bournoville, R.; Bonnemain, J. L.

    1996-05-01

    Changes in amino acid composition of alfalfa (Medicago sativa L.) phloem sap were studies in response to a water deficit. Sap was collected by stylectomy. As the leaf water potential ([psi]) decreased from -0.4 to -2.0 MPa, there was significant increase of the total amino acid concentration, due to that of some amino acids: proline, valine, isoleucine, leucine, glutamic acid, aspartic acid, and threonine. Asparagine concentration, which is the main amino acid assayed in the phloem sap of alfalfa (it accounts for 70% of the total content), did not vary with the plant water status. The other amino acid concentrations remained stable as [psi] varied; in particular, [gamma]-amino butyric acid concentration remained unchanged, whereas it varied in response to wounding. The more striking change in the sieve tubes was the accumulation of proline, which was observed below a [psi] threshold value of about -0.9 MPa (concentration x60 for a decrease of [psi] from -0.9 to -2.0 MPa). The role of such changes in phloem sap amino acid concentration in osmotic adjustment of growing tissues is discussed.

  1. 49 CFR 40.307 - What is the SAP's function in prescribing the employee's follow-up tests?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What is the SAP's function in prescribing the employee's follow-up tests? 40.307 Section 40.307 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  2. 49 CFR 40.283 - How does a certification organization obtain recognition for its members as SAPs?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false How does a certification organization obtain recognition for its members as SAPs? 40.283 Section 40.283 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  3. 49 CFR 40.301 - What is the SAP's function in the follow-up evaluation of an employee?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the SAP's function in the follow-up evaluation of an employee? 40.301 Section 40.301 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  4. 49 CFR 40.293 - What is the SAP's function in conducting the initial evaluation of an employee?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What is the SAP's function in conducting the initial evaluation of an employee? 40.293 Section 40.293 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  5. 49 CFR 40.301 - What is the SAP's function in the follow-up evaluation of an employee?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What is the SAP's function in the follow-up evaluation of an employee? 40.301 Section 40.301 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  6. 49 CFR 40.301 - What is the SAP's function in the follow-up evaluation of an employee?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What is the SAP's function in the follow-up evaluation of an employee? 40.301 Section 40.301 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  7. 49 CFR 40.283 - How does a certification organization obtain recognition for its members as SAPs?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false How does a certification organization obtain recognition for its members as SAPs? 40.283 Section 40.283 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  8. 49 CFR 40.293 - What is the SAP's function in conducting the initial evaluation of an employee?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What is the SAP's function in conducting the initial evaluation of an employee? 40.293 Section 40.293 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  9. 49 CFR 40.283 - How does a certification organization obtain recognition for its members as SAPs?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false How does a certification organization obtain recognition for its members as SAPs? 40.283 Section 40.283 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  10. 49 CFR 40.301 - What is the SAP's function in the follow-up evaluation of an employee?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What is the SAP's function in the follow-up evaluation of an employee? 40.301 Section 40.301 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  11. 49 CFR 40.307 - What is the SAP's function in prescribing the employee's follow-up tests?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What is the SAP's function in prescribing the employee's follow-up tests? 40.307 Section 40.307 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  12. 49 CFR 40.283 - How does a certification organization obtain recognition for its members as SAPs?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false How does a certification organization obtain recognition for its members as SAPs? 40.283 Section 40.283 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  13. 49 CFR 40.283 - How does a certification organization obtain recognition for its members as SAPs?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false How does a certification organization obtain recognition for its members as SAPs? 40.283 Section 40.283 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  14. 49 CFR 40.293 - What is the SAP's function in conducting the initial evaluation of an employee?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What is the SAP's function in conducting the initial evaluation of an employee? 40.293 Section 40.293 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  15. 49 CFR 40.293 - What is the SAP's function in conducting the initial evaluation of an employee?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What is the SAP's function in conducting the initial evaluation of an employee? 40.293 Section 40.293 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  16. 49 CFR 40.293 - What is the SAP's function in conducting the initial evaluation of an employee?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the SAP's function in conducting the initial evaluation of an employee? 40.293 Section 40.293 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  17. 49 CFR 40.307 - What is the SAP's function in prescribing the employee's follow-up tests?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What is the SAP's function in prescribing the employee's follow-up tests? 40.307 Section 40.307 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  18. 49 CFR 40.301 - What is the SAP's function in the follow-up evaluation of an employee?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What is the SAP's function in the follow-up evaluation of an employee? 40.301 Section 40.301 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  19. 49 CFR 40.307 - What is the SAP's function in prescribing the employee's follow-up tests?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the SAP's function in prescribing the employee's follow-up tests? 40.307 Section 40.307 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  20. 49 CFR 40.307 - What is the SAP's function in prescribing the employee's follow-up tests?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What is the SAP's function in prescribing the employee's follow-up tests? 40.307 Section 40.307 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  1. Impact of LbSapSal Vaccine in Canine Immunological and Parasitological Features before and after Leishmania chagasi-Challenge.

    PubMed

    Resende, Lucilene Aparecida; Aguiar-Soares, Rodrigo Dian de Oliveira; Gama-Ker, Henrique; Roatt, Bruno Mendes; Mendonça, Ludmila Zanandreis de; Alves, Marina Luiza Rodrigues; Silveira-Lemos, Denise da; Corrêa-Oliveira, Rodrigo; Martins-Filho, Olindo Assis; Araújo, Márcio Sobreira Silva; Fujiwara, Ricardo Toshio; Gontijo, Nelder Figueiredo; Reis, Alexandre Barbosa; Giunchetti, Rodolfo Cordeiro

    2016-01-01

    Dogs represent the most important domestic reservoir of L. chagasi (syn. L. infantum). A vaccine against canine visceral leishmaniasis (CVL) would be an important tool for decreasing the anxiety related to possible L. chagasi infection and for controlling human visceral leishmaniasis (VL). Because the sand fly salivary proteins are potent immunogens obligatorily co-deposited during transmission of Leishmania parasites, their inclusion in an anti-Leishmania vaccine has been investigated in past decades. We investigated the immunogenicity of the "LbSapSal" vaccine (L. braziliensis antigens, saponin as adjuvant, and Lutzomyia longipalpis salivary gland extract) in dogs at baseline (T0), during the post-vaccination protocol (T3rd) and after early (T90) and late (T885) times following L. chagasi-challenge. Our major data indicated that immunization with "LbSapSal" is able to induce biomarkers characterized by enhanced amounts of type I (tumor necrosis factor [TNF]-α, interleukin [IL]-12, interferon [IFN]-γ) cytokines and reduction in type II cytokines (IL-4 and TGF-β), even after experimental challenge. The establishment of a prominent pro-inflammatory immune response after "LbSapSal" immunization supported the increased levels of nitric oxide production, favoring a reduction in spleen parasitism (78.9%) and indicating long-lasting protection against L. chagasi infection. In conclusion, these results confirmed the hypothesis that the "LbSapSal" vaccination is a potential tool to control the Leishmania chagasi infection.

  2. Effects of Elevated [CO2] and Nitrogen Nutrition on Cytokinins in the Xylem Sap and Leaves of Cotton1

    PubMed Central

    Yong, Jean W.H.; Wong, S. Chin; Letham, D. Stuart; Hocart, Charles H.; Farquhar, Graham D.

    2000-01-01

    We measured the level of xylem-derived cytokinins (CKs) entering a cotton leaf, and the CK levels in the same leaf, thus enabling xylem sap and foliar CKs to be compared concurrently. Although zeatin was the dominant CK in xylem sap, zeatin, dihydrozeatin, and N6-(2-isopentenyl) adenine were present in approximately equimolar levels in leaves. Elevated [CO2] (EC) has an effect on the levels of cytokinins in sap and leaf tissues. This effect was modulated by the two levels of root nitrogen nutrition (2 and 12 mm nitrate). Growth enhancement (70%) in EC over plants in ambient [CO2] (AC) was observed for both nitrogen nutrition treatments. Low-nitrogen leaves growing in EC exhibited photosynthetic acclimation, whereas there was no sign of photosynthetic acclimation in high-nitrogen grown leaves. Under these prevailing conditions, xylem sap and leaf tissues were obtained for CK analysis. Higher nitrogen nutrition increased the delivery per unit leaf area of CKs to the leaf at AC. EC caused a greater increase in CK delivery to the leaf at low nitrogen conditions (106%) than at high nitrogen conditions (17%). EC induced a significant increase in CK content in low-nitrogen leaves, whereas CK content in leaf tissues was similar for high-nitrogen leaves growing in AC and EC. PMID:11027725

  3. Comparison of sap flux, moisture flux tower and MODIS enhanced vegetation index methods for estimating riparian evapotranspiration

    USGS Publications Warehouse

    Nagler, Pamela L.; Glenn, Edward P.; Morino, Kiyomi; Neale, Christopher M.U; Cosh, Michael H.

    2010-01-01

    Riparian evapotranspiration (ET) was measured on a salt cedar (Tamarix spp.) dominated river terrace on the Lower Colorado River from 2007 to 2009 using tissue-heat-balance sap flux sensors at six sites representing very dense, medium dense, and sparse stands of plants. Salt cedar ET varied markedly across sites, and sap flux sensors showed that plants were subject to various degrees of stress, detected as mid-day depression of transpiration and stomatal conductance. Sap flux results were scaled from the leaf level of measurement to the stand level by measuring plant-specific leaf area index and fractional ground cover at each site. Results were compared to Bowen ratio moisture tower data available for three of the sites. Sap flux sensors and flux tower results ranked the sites the same and had similar estimates of ET. A regression equation, relating measured ET of salt cedar and other riparian plants and crops on the Lower Colorado River to the Enhanced Vegetation Index from the MODIS sensor on the Terra satellite and reference crop ET measured at meteorological stations, was able to predict actual ET with an accuracy or uncertainty of about 20%, despite between-site differences for salt cedar. Peak summer salt cedar ET averaged about 6 mm d-1 across sites and methods of measurement.

  4. Diurnal and seasonal variability in the radial distribution of sap flow: predicting total stem flow in Pinus taeda trees.

    PubMed

    Ford, Chelcy R; Goranson, Carol E; Mitchell, Robert J; Will, Rodney E; Teskey, Robert O

    2004-09-01

    We monitored the radial distribution of sap flux density (v; g H2O m(-2) s(-1)) in the sapwood of six plantation-grown Pinus taeda L. trees during wet and dry soil periods. Mean basal diameter of the 32-year-old trees was 33.3 cm. For all trees, the radial distribution of sap flow in the base of the stem (i.e., radial profile) was Gaussian in shape. Sap flow occurred maximally in the outer 4 cm of sapwood, comprising 50-60% of total stem flow (F), and decreased toward the center, with the innermost 4 cm of sapwood (11-15 cm) comprising less than 10% of F. The percent of flow occurring in the outer 4 cm of sapwood was stable with time (average CV < 10%); however, the percentage of flow occurring in the remaining sapwood was more variable over time (average CV > 40%). Diurnally, the radial profile changed predictably with time and with total stem flow. Seasonally, the radial profile became less steep as the soil water content (theta) declined from 0.38 to 0.21. Throughout the season, daytime sap flow also decreased as theta decreased; however, nighttime sap flow (an estimate of stored water use) remained relatively constant. As a result, the percentage of stored water use increased as theta declined. Time series analysis of 15-min values of F, theta, photosynthetically active radiation (PAR) and vapor pressure deficit (D) showed that F lagged behind D by 0-15 min and behind PAR by 15-30 min. Diurnally, the relationship between F and D was much stronger than the relationship between F and PAR, whereas no relationship was found between F and theta. An autoregressive moving average (ARIMA) model estimated that 97% of the variability in F could be predicted by D alone. Although total sap flow in all trees responded similarly to D, we show that the radial distribution of sap flow comprising total flow could change temporally, both on daily and seasonal scales.

  5. Determination of calcium ion in sap using carbon nanotube-based ion-selective electrodes.

    PubMed

    Hernández, Rafael; Riu, Jordi; Rius, F Xavier

    2010-08-01

    A new reduced-size solid-state electrode using carbon nanotubes as the transducing layer has been developed for the direct determination of Ca(2+) in sap, overcoming problems encountered by commercial ISEs analysing real complex samples. We show that this solid-contact ISE, which can be easily miniaturized, can be used directly in diluted real samples without any other pretreatment. The performance parameters of the new ISE include a Nernstian slope and excellent stability, good coefficients of selectivity, range of linearity (10(-5) to 10(-2.5) M) and limit of detection (10(-6.2) M), thus making it an excellent tool for determining Ca(2+) in a wide range of plant species.

  6. Biology bacteriocyte-associated endosymbionts of plant sap-sucking insects.

    PubMed

    Baumann, Paul

    2005-01-01

    Psyllids, whiteflies, aphids, and mealybugs are members of the suborder Sternorrhyncha and share a common property, namely the utilization of plant sap as their food source. Each of these insect groups has an obligatory association with a different prokaryotic endosymbiont, and the association is the result of a single infection followed by maternal, vertical transmission of the endosymbionts. The result of this association is the domestication of the free-living bacterium to serve the purposes of the host, namely the synthesis of essential amino acids. This domestication is probably in all cases accompanied by a major reduction in genome size. The different properties of the genomes and fragments of the genomes of these endosymbionts suggest that there are different constraints on the permissible evolutionary changes that are probably a function of the gene repertoire of the endosymbiont ancestor and the gene losses that occurred during the reduction of genome size.

  7. Mutual information detects a decreased interdependence between RR and SAP in orthostatic intolerance after microgravity condition.

    PubMed

    Raimondi, G; Chillemi, S; Michelassi, C; Di Garbo, A; Varanini, M; Legramante, J; Balocchi, R

    2002-07-01

    Orthostatic intolerance is the most serious symptom of cardiovascular deconditioning induced by microgravity. However, the exact mechanisms underlying these alterations have not been completely clarified. Several methods for studying the time series of systolic arterial pressure and RR interval have been proposed both in the time and in the frequency domain. However, these methods did not produce definitive results. In fact heart rate and arterial pressure show a complex pattern of global variability which is likely due to non linear feedback which involves the autonomic nervous system and to "stochastic" influences. Aim of this study was to evaluate the degree of interdependence between the mechanisms responsible for the variability of SAP and RR signals in subjects exposed to head down (HD). This quantification was achieved by using Mutual Information (MI).

  8. Proteome study of the phloem sap of pumpkin using multidimensional protein identification technology.

    PubMed

    Cho, Won Kyong; Chen, Xiong-Yan; Rim, Yeonggil; Chu, Hyosub; Kim, Suwha; Kim, Seon-Won; Park, Zee-Yong; Kim, Jae-Yean

    2010-07-01

    The phloem is the major transport route for both small substances and large molecules, such as proteins and RNAs, from their sources to sink tissues. To investigate the proteins present in pumpkin phloem sap, proteome analysis using multidimensional protein identification technology was carried out. Pumpkin phloem peptides obtained by liquid chromatography/mass spectrometry/mass spectrometry were searched against pumpkin protein data derived from the National Center for Biotechnology Information. A total of 47 pumpkin phloem proteins were identified. The identified proteins mainly corresponded to enzymes involved in gibberellin biosynthesis, antioxidation processes, or defense mechanisms. Interestingly, seven enzymes required for gibberellin biosynthesis were identified for the first time by this proteomics approach. In summary, the new phloem proteins identified in this study provide strong evidence for stress and defense signaling and new insights regarding the role of gibberellin in the developmental programming of higher plants through the phloem.

  9. Bioimprinted QCM sensors for virus detection-screening of plant sap.

    PubMed

    Dickert, Franz L; Hayden, Oliver; Bindeus, Roland; Mann, Karl-J; Blaas, Dieter; Waigmann, Elisabeth

    2004-04-01

    Surface imprinting techniques on polymer-coated quartz-crystal microbalances (QCM) have been used to detect tobacco mosaic viruses (TMV) in aqueous media. Molecularly imprinted polymers (MIP), tailor-made by self organisation of monomers around a template (TMV), were generated directly on the gold electrodes. Imprinted trenches on the polymer surface mimicking the shape and surface functionality of the virus serve as recognition sites for re-adsorption after washing out of the template. The sensors are applicable to TMV detection ranging from 100 ng mL(-1) to 1 mg mL(-1) within minutes. Furthermore, direct measurements without time-consuming sample preparation are possible in complex matrices such as tobacco plant sap.

  10. Nizwaside: a new anticancer pregnane glycoside from the sap of Desmidorchis flava.

    PubMed

    Hussain, Hidayat; Raees, Muhammad Adil; Rehman, Najeeb Ur; Al-Rawahi, Ahmed; Csuk, René; Khan, Husain Yar; Abbas, Ghulam; Al-Broumi, Mohammed Abdullah; Green, Ivan R; Elyassi, Ali; Mahmood, Talat; Al-Harrasi, Ahmed

    2015-12-01

    The sap from the succulent Desmidorchis flava (N.E.Br) Meve and Liede yielded a new pregnane glycoside, named nizwaside whose structure was established using 1D and 2D NMR techniques as well as mass spectrometry (ESIMS). Nizwaside was tested for anticancer, DPPH antioxidant, urease enzyme inhibition, α-glucosidase enzyme inhibition and acetylcholinesterase inhibition activities. Interestingly, nizwaside showed significant anti-proliferative effects on MDA MB231 breast cancer cells with an IC(50) of 23.5 µg/ml. Moreover, nizwaside was more effective than Doxorubicin, a well-known clinical anticancer drug, in suppressing MDA MB231 cell proliferation even at concentrations lower than that of Doxorubicin (75 µg/ml nizwaside vs. 100 µg/ml Doxorubicin). On the other hand, nizwaside showed relatively weak antioxidant activity with 15 % inhibition.

  11. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2014-03-01

    A simple, nondestructive method for the estimation of canopy CO2 uptake is important for understanding the CO2 exchange between forest and atmosphere. Canopy CO2 uptake (FCO2) of a subtropical mature A. mangium plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow-based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, we obtained an acceptable estimate of FCO2 compared to other estimates. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapor pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 gC m-2 d-1) approached the lower range of values for subtropical mixed forests, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or carbon allocation studies, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches likely reflected variability due to leaf position and age, which should be reduced for the combined sap flux and isotope technique, as it uses canopy average values of Gs and Ci/Ca.

  12. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2013-07-01

    Canopy CO2 uptake (FCO2) of a subtropical mature textit{A. mangium} plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, an acceptable estimate of FCO2 was obtained. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapour pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 g C m-2 day-1) approached the lower range of values for subtropical mixed forest, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or component carbon analysis, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches reflected variability due to leaf position and age, which could be reduced for sap flux/stable isotope, which uses canopy average values of Gs and Ci/Ca.

  13. Antioxidant activity, inhibition of nitric oxide overproduction, and in vitro antiproliferative effect of maple sap and syrup from Acer saccharum.

    PubMed

    Legault, Jean; Girard-Lalancette, Karl; Grenon, Carole; Dussault, Catherine; Pichette, André

    2010-04-01

    Antioxidant activity, inhibition of nitric oxide (NO) overproduction, and antiproliferative effect of ethyl acetate extracts of maple sap and syrup from 30 producers were evaluated in regard to the period of harvest in three different regions of Québec, Canada. Oxygen radical absorbance capacity (ORAC) values of maple sap and syrup extracts are, respectively, 12 +/- 6 and 15 +/- 5 micromol of Trolox equivalents (TE)/mg. The antioxidant activity was also confirmed by a cell-based assay. The period of harvest has no statistically significant incidence on the antioxidant activity of both extracts. The antioxidant activity of pure maple syrup was also determined using the ORAC assay. Results indicate that the ORAC value of pure maple syrup (8 +/- 2 micromol of TE/mL) is lower than the ORAC value of blueberry juice (24 +/- 1 micromol of TE/mL) but comparable to the ORAC values of strawberry (10.7 +/- 0.4 micromol of TE/mL) and orange (10.8 +/- 0.5 micromol of TE/mL) juices. Maple sap and syrup extracts showed to significantly inhibit lipopolysaccharide-induced NO overproduction in RAW264.7 murine macrophages. Maple syrup extract was significantly more active than maple sap extract, suggesting that the transformation of maple sap into syrup increases NO inhibition activity. The highest NO inhibition induced by the maple syrup extracts was observed at the end of the season. Moreover, darker maple syrup was found to be more active than clear maple syrup, suggesting that some colored oxidized compounds could be responsible in part for the activity. Finally, maple syrup extracts (50% inhibitory concentration = 42 +/- 6 microg/mL) and pure maple syrup possess a selective in vitro antiproliferative activity against cancer cells.

  14. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans

    PubMed Central

    Schwartz, Matthew L.; Jorgensen, Erik M.

    2016-01-01

    In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called “SapTrap,” that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then “trapped” in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10–37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. PMID:26837755

  15. Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis.

    PubMed

    Sugio, Akiko; Kingdom, Heather N; MacLean, Allyson M; Grieve, Victoria M; Hogenhout, Saskia A

    2011-11-29

    Phytoplasmas are insect-transmitted phytopathogenic bacteria that can alter plant morphology and the longevity and reproduction rates and behavior of their insect vectors. There are various examples of animal and plant parasites that alter the host phenotype to attract insect vectors, but it is unclear how these parasites accomplish this. We hypothesized that phytoplasmas produce effectors that modulate specific targets in their hosts leading to the changes in plant development and insect performance. Previously, we sequenced and mined the genome of Aster Yellows phytoplasma strain Witches' Broom (AY-WB) and identified 56 candidate effectors. Here, we report that the secreted AY-WB protein 11 (SAP11) effector modulates plant defense responses to the advantage of the AY-WB insect vector Macrosteles quadrilineatus. SAP11 binds and destabilizes Arabidopsis CINCINNATA (CIN)-related TEOSINTE BRANCHED1, CYCLOIDEA, PROLIFERATING CELL FACTORS 1 and 2 (TCP) transcription factors, which control plant development and promote the expression of lipoxygenase (LOX) genes involved in jasmonate (JA) synthesis. Both the Arabidopsis SAP11 lines and AY-WB-infected plants produce less JA on wounding. Furthermore, the AY-WB insect vector produces more offspring on AY-WB-infected plants, SAP11 transgenic lines, and plants impaired in CIN-TCP and JA synthesis. Thus, SAP11-mediated destabilization of CIN-TCPs leads to the down-regulation of LOX2 expression and JA synthesis and an increase in M. quadrilineatus progeny. Phytoplasmas are obligate inhabitants of their plant host and insect vectors, in which the latter transmits AY-WB to a diverse range of plant species. This finding demonstrates that pathogen effectors can reach beyond the pathogen-host interface to modulate a third organism in the biological interaction.

  16. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap

    PubMed Central

    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J. E.; Kogel, Karl-Heinz; Kehr, Julia

    2008-01-01

    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated silicon oil. The exuding phloem sap was collected with a capillary connected to a pump. Using up to 30 plants and 600 aphids (Rhopalosiphum padi) in parallel, an average of 10 μl of phloem sap could be obtained within 6 h of sampling. In first analyses of the macromolecular content, eight so far unknown phloem mRNAs were identified by cDNA-amplified fragment length polymorphism. Transcripts in barley phloem exudates are related to metabolism, signalling, and pathogen defence, for example coding for a protein kinase and a pathogen- and insect-responsive WIR1A (wheat-induced resistance 1A)-like protein. Further, one-dimensional gel electrophoresis and subsequent partial sequencing by mass spectrometry led to the identification of seven major proteins with putative functions in stress responses and transport of mRNAs, proteins, and sugars. Two of the discovered proteins probably represent isoforms of a new phloem-mobile sucrose transporter. Notably, two-dimensional electrophoresis confirmed that there are >250 phloem proteins awaiting identification in future studies. PMID:18632729

  17. Evapotranspiration in a cottonwood (Populus fremontii) restoration plantation estimated by sap flow and remote sensing methods

    USGS Publications Warehouse

    Nagler, P.; Jetton, A.; Fleming, J.; Didan, K.; Glenn, E.; Erker, J.; Morino, K.; Milliken, J.; Gloss, S.

    2007-01-01

    Native tree plantations have been proposed for the restoration of wildlife habitat in human-altered riparian corridors of western U.S. rivers. Evapotranspiration (ET) by riparian vegetation is an important, but poorly quantified, term in river water budgets. Native tree restoration plots will potentially increase ET. We used sap flow sensors and satellite imagery to estimate ET in a 8 ha, cottonwood (Populus fremontii) restoration plot on the Lower Colorado River. Biometric methods were used to scale leaf area to whole trees and stands of trees. This technique was used to validate our estimates of ET obtained by scaling from branch level to stand (or plot) level measurements of ET. Cottonwood trees used 6-10 mm day-1 of water during the peak of the growing season as determined by sap flow sensors, and annual rates scaled by time-series MODIS satellite imagery were approximately 1.2 m year-1. Although irrigation was not quantified, the field had been flood irrigated at 2 week intervals during the 3 years prior to the study, receiving approximately 2 m year-1 of water. A frequency-domain electromagnetic induction survey of soil moisture content showed that the field was saturated (26-28% gravimetric water content) at the 90-150 cm soil depth under the field. Trees were apparently rooted into the saturated soil, and considerable saving of water could potentially be achieved by modifying the irrigation regime to take into account that cottonwoods are phreatophytes. The study showed that cottonwood ET can be monitored by remote sensing methods calibrated with ground measurements with an accuracy or uncertainty of 20-30% in western riparian corridors. ?? 2007 Elsevier B.V. All rights reserved.

  18. Analyses of assumptions and errors in the calculation of stomatal conductance from sap flux measurements.

    PubMed

    Ewers, Brent E.; Oren, Ram

    2000-05-01

    We analyzed assumptions and measurement errors in estimating canopy transpiration (E(L)) from sap flux (J(S)) measured with Granier-type sensors, and in calculating canopy stomatal conductance (G(S)) from E(L) and vapor pressure deficit (D). The study was performed in 12-year-old Pinus taeda L. stands with a wide range in leaf area index (L) and growth rate. No systematic differences in J(S) were found between the north and south sides of trees. However, J(S) in xylem between 20 and 40 mm from the cambium was 50 and 39% of J(S) in the outer 20-mm band of xylem in slow- and fast-growing trees, respectively. Sap flux measured in stems did not lag J(S) measured in branches, and time and frequency domain analyses of time series indicated that variability in J(S) in stems and branches is mostly explained by variation in D. Therefore, J(S) was used to estimate transpiration, after accounting for radial patterns. There was no difference between D and leaf-to-air vapor pressure gradient, and D did not have a vertical profile in stands of either low or high L suggesting a strong canopy-atmosphere coupling. Therefore, D estimated at one point in the canopy can be used to calculate G(S) in such stands. Given the uncertainties in J(S), relative humidity, and temperature measurements, to keep errors in G(S) estimates to less than 10%, estimates of G(S) should be limited to conditions in which D >/= 0.6 kPa.

  19. The Sap Flow Dynamics and Response of Hedysarum scoparium to Environmental Factors in Semiarid Northwestern China

    PubMed Central

    Deng, Jifeng; Ding, Guodong; Gao, Guanglei; Wu, Bin; Zhang, Yuqing; Qin, Shugao; Fan, Wenhui

    2015-01-01

    Hedysarum scoparium is an important, fast-growing and drought-resistant shrub that has been extensively used for grassland restoration and preventing desertification in semiarid regions of northwestern China. The primary objective of this study was to investigate the diurnal and seasonal variations in stem sap flow (Js) and its relation to environmental factors. The stem heat balance method was applied to plants that were approximately 17 years old (with diameters of 25, 16, 13, and 9 mm at ground level and heights of 3.1, 1.8, 1.7 and 1.4 m) and growing under natural conditions. The vertical soil temperature profile (ST), soil surface heat flux (SoilG), volumetric soil moisture content (SWC) and meteorological variables such as solar radiation (Rn), air temperature (Ta), vapour pressure deficit (VPD), wind speed (Ws) relative humidity (RH) and precipitation (P) were simultaneously measured at a meteorological station on site. Results indicated that Js varied regularly during the diurnal and seasonal term. The nocturnal Js was substantial, with a seasonal variation similar to the patterns of daytime Js. The magnitude of Js changed considerably between sunny and rainy days. Redundancy (RDA) and Kendall’s tau analysis suggested that daily Js in large plants was more sensitive to environmental factors, and the variation in daily Js during the growing season could be described by a multiple linear regression against environmental variables including Ta, VPD, Ws, RH, ST, and SoilG. While the nocturnal Js in smaller plants was more sensitive to meteorological factors. Ta, VPD, and Ws were significantly correlated with nighttime Js. The hourly nighttime sap flow rate of H. scoparium corresponded closely to Ta and VPD following a non-linear pattern. The results of this study can be used to estimate the transpiration of H. scoparium. PMID:26136229

  20. THE SAP3 COMPUTER PROGRAM FOR QUANTITATIVE MULTIELEMENT ANALYSIS BY ENERGY DISPERSIVE X-RAY FLUORESCENCE

    SciTech Connect

    Nielson, K. K.; Sanders, R. W.

    1982-04-01

    SAP3 is a dual-function FORTRAN computer program which performs peak analysis of energy-dispersive x-ray fluorescence spectra and then quantitatively interprets the results of the multielement analysis. It was written for mono- or bi-chromatic excitation as from an isotopic or secondary excitation source, and uses the separate incoherent and coherent backscatter intensities to define the bulk sample matrix composition. This composition is used in performing fundamental-parameter matrix corrections for self-absorption, enhancement, and particle-size effects, obviating the need for specific calibrations for a given sample matrix. The generalized calibration is based on a set of thin-film sensitivities, which are stored in a library disk file and used for all sample matrices and thicknesses. Peak overlap factors are also determined from the thin-film standards, and are stored in the library for calculating peak overlap corrections. A detailed description is given of the algorithms and program logic, and the program listing and flow charts are also provided. An auxiliary program, SPCAL, is also given for use in calibrating the backscatter intensities. SAP3 provides numerous analysis options via seventeen control switches which give flexibility in performing the calculations best suited to the sample and the user needs. User input may be limited to the name of the library, the analysis livetime, and the spectrum filename and location. Output includes all peak analysis information, matrix correction factors, and element concentrations, uncertainties and detection limits. Twenty-four elements are typically determined from a 1024-channel spectrum in one-to-two minutes using a PDP-11/34 computer operating under RSX-11M.

  1. Suppression of nighttime sap flux with lower stem photosynthesis in Eucalyptus trees

    NASA Astrophysics Data System (ADS)

    Gao, Jianguo; Zhou, Juan; Sun, Zhenwei; Niu, Junfeng; Zhou, Cuiming; Gu, Daxing; Huang, Yuqing; Zhao, Ping

    2016-04-01

    It is widely accepted that substantial nighttime sap flux ( J s,n) or transpiration ( E) occurs in most plants, but the physiological implications are poorly known. It has been hypothesized that J s,n or E serves to enhance nitrogen uptake or deliver oxygen; however, no clear evidence is currently available. In this study, sap flux ( J s) in Eucalyptus grandis × urophylla with apparent stem photosynthesis was measured, including control trees which were covered by aluminum foil (approximately 1/3 of tree height) to block stem photosynthesis. We hypothesized that the nighttime water flux would be suppressed in trees with lower stem photosynthesis. The results showed that the green tissue degraded after 3 months, demonstrating a decrease in stem photosynthesis. The daytime J s decreased by 21.47 %, while J s,n decreased by 12.03 % in covered trees as compared to that of control, and the difference was statistically significant ( P < 0.01). The linear quantile regression model showed that J s,n decreased for a given daytime transpiration water loss, indicating that J s,n was suppressed by lower stem photosynthesis in covered trees. Predawn ( ψ pd) of covered trees was marginally higher than that of control while lower at predawn stomatal conductance ( g s), indicating a suppressed water flux in covered trees. There was no difference in leaf carbon content and δ13C between the two groups, while leaf nitrogen content and δ15N were significantly higher in covered trees than that of the control ( P < 0.05), indicating that J s,n was not used for nitrogen uptake. These results suggest that J s,n may act as an oxygen pathway since green tissue has a higher respiration or oxygen demand than non-green tissue. Thus, this study demonstrated the physiological implications of J s,n and the possible benefits of nighttime water use or E by the tree.

  2. An empirical study of the wound effect on sap flux density measured with thermal dissipation probes.

    PubMed

    Wiedemann, Andreas; Marañón-Jiménez, Sara; Rebmann, Corinna; Herbst, Mathias; Cuntz, Matthias

    2016-12-01

    The insertion of thermal dissipation (TD) sensors on tree stems for sap flux density (SFD) measurements can lead to SFD underestimations due to a wound formation close to the drill hole. However, the wound effect has not been assessed experimentally for this method yet. Here, we propose an empirical approach to investigate the effect of the wound healing on measured sap flux with TD probes. The approach was performed for both, diffuse-porous (Fagus sylvatica (Linnaeus)) and ring-porous (Quercus petraea (Lieblein)) species. Thermal dissipation probes were installed on different dates along the growing season to document the effects of the dynamic wound formation. The trees were cut in autumn and additional sensors were installed in the cut stems, therefore, without potential effects of wound development. A range of water pressures was applied to the stem segments and SFDs were simultaneously measured by TD sensors as well as gravimetrically in the laboratory. The formation of wounds around sensors installed in living tree stems led to underestimation of SFD by 21.4 ± 3 and 47.5 ± 3.8% in beech and oak, respectively. The differences between SFD underestimations of diffuse-porous beech and ring-porous oak were, however, not statistically significant. Sensors with 5-, 11- and 22-week-old wounds also showed no significant differences, which implies that the influence of wound formation on SFD estimates was completed within the first few weeks after perforation. These results were confirmed by time courses of SFD measurements in the field. Field SFD values decreased immediately after sensor installation and reached stable values after ~2 weeks with similar underestimations to the ones observed in the laboratory. We therefore propose a feasible approach to correct directly field observations of SFD for potential underestimations due to the wound effect.

  3. Suppression of nighttime sap flux with lower stem photosynthesis in Eucalyptus trees.

    PubMed

    Gao, Jianguo; Zhou, Juan; Sun, Zhenwei; Niu, Junfeng; Zhou, Cuiming; Gu, Daxing; Huang, Yuqing; Zhao, Ping

    2016-04-01

    It is widely accepted that substantial nighttime sap flux (J s,n) or transpiration (E) occurs in most plants, but the physiological implications are poorly known. It has been hypothesized that J s,n or E serves to enhance nitrogen uptake or deliver oxygen; however, no clear evidence is currently available. In this study, sap flux (J s) in Eucalyptus grandis × urophylla with apparent stem photosynthesis was measured, including control trees which were covered by aluminum foil (approximately 1/3 of tree height) to block stem photosynthesis. We hypothesized that the nighttime water flux would be suppressed in trees with lower stem photosynthesis. The results showed that the green tissue degraded after 3 months, demonstrating a decrease in stem photosynthesis. The daytime J s decreased by 21.47%, while J s,n decreased by 12.03% in covered trees as compared to that of control, and the difference was statistically significant (P < 0.01). The linear quantile regression model showed that J s,n decreased for a given daytime transpiration water loss, indicating that J s,n was suppressed by lower stem photosynthesis in covered trees. Predawn (ψ pd) of covered trees was marginally higher than that of control while lower at predawn stomatal conductance (g s), indicating a suppressed water flux in covered trees. There was no difference in leaf carbon content and δ(13)C between the two groups, while leaf nitrogen content and δ(15)N were significantly higher in covered trees than that of the control (P < 0.05), indicating that J s,n was not used for nitrogen uptake. These results suggest that J s,n may act as an oxygen pathway since green tissue has a higher respiration or oxygen demand than non-green tissue. Thus, this study demonstrated the physiological implications of J s,n and the possible benefits of nighttime water use or E by the tree.

  4. Effects of iron deficiency on the composition of the leaf apoplastic fluid and xylem sap in sugar beet. Implications for iron and carbon transport.

    PubMed

    López-Millán, A F; Morales, F; Abadía, A; Abadía, J

    2000-10-01

    The effects of iron deficiency on the composition of the xylem sap and leaf apoplastic fluid have been characterized in sugar beet (Beta vulgaris Monohil hybrid). pH was estimated from direct measurements in apoplastic fluid and xylem sap obtained by centrifugation and by fluorescence of leaves incubated with 5-carboxyfluorescein and fluorescein isothiocyanate-dextran. Iron deficiency caused a slight decrease in the pH of the leaf apoplast (from 6.3 down to 5.9) and xylem sap (from 6.0 down to 5.7) of sugar beet. Major organic acids found in leaf apoplastic fluid and xylem sap were malate and citrate. Total organic acid concentration in control plants was 4.3 mM in apoplastic fluid and 9.4 mM in xylem sap and increased to 12.2 and 50.4 mM, respectively, in iron-deficient plants. Inorganic cation and anion concentrations also changed with iron deficiency both in apoplastic fluid and xylem sap. Iron decreased with iron deficiency from 5.5 to 2.5 microM in apoplastic fluid and xylem sap. Major predicted iron species in both compartments were [FeCitOH](-1) in the controls and [FeCit(2)](-3) in the iron-deficient plants. Data suggest the existence of an influx of organic acids from the roots to the leaves via xylem, probably associated to an anaplerotic carbon dioxide fixation by roots.

  5. Decreased SAP Expression in T Cells from Patients with Systemic Lupus Erythematosus Contributes to Early Signaling Abnormalities and Reduced IL-2 Production.

    PubMed

    Karampetsou, Maria P; Comte, Denis; Kis-Toth, Katalin; Terhorst, Cox; Kyttaris, Vasileios C; Tsokos, George C

    2016-06-15

    T cells from patients with systemic lupus erythematosus (SLE) display a number of abnormalities, including increased early signaling events following engagement of the TCR. Signaling lymphocytic activation molecule family cell surface receptors and the X-chromosome-defined signaling lymphocytic activation molecule-associated protein (SAP) adaptor are important in the development of several immunocyte lineages and modulating the immune response. We present evidence that SAP protein levels are decreased in T cells and in their main subsets isolated from 32 women and three men with SLE, independent of disease activity. In SLE T cells, SAP protein is also subject to increased degradation by caspase-3. Forced expression of SAP in SLE T cells normalized IL-2 production, calcium (Ca(2+)) responses, and tyrosine phosphorylation of a number of proteins. Exposure of normal T cells to SLE serum IgG, known to contain anti-CD3/TCR Abs, resulted in SAP downregulation. We conclude that SLE T cells display reduced levels of the adaptor protein SAP, probably as a result of continuous T cell activation and degradation by caspase-3. Restoration of SAP levels in SLE T cells corrects the overexcitable lupus T cell phenotype.

  6. The adaptor protein SAP directly associates with PECAM-1 and regulates PECAM-1-mediated-cell adhesion in T-like cell lines.

    PubMed

    Proust, Richard; Crouin, Catherine; Gandji, Leslie Yewakon; Bertoglio, Jacques; Gesbert, Franck

    2014-04-01

    SAP is a small cytosolic adaptor protein expressed in hematopoietic lineages whose main function is to regulate intracellular signaling pathways induced by the triggering of members of the SLAM receptor family. In this paper, we have identified the adhesion molecule PECAM-1 as a new partner for SAP in a conditional yeast two-hybrid screen. PECAM-1 is an immunoglobulin-like molecule expressed by endothelial cells and leukocytes, which possesses both pro- and anti-inflammatory properties. However, little is known about PECAM-1 functions in T cells. We show that SAP directly and specifically interacts with the cytosolic tyrosine 686 of PECAM-1. We generated different T-like cell lines in which SAP or PECAM-1 are expressed or down modulated and we demonstrate that a diminished SAP expression correlates with a diminished PECAM-1-mediated adhesion. Although SAP has mainly been shown to associate with SLAM receptors, we evidence here that SAP is a new actor downstream of PECAM-1.

  7. NK cell cytotoxicity mediated by 2B4 and NTB-A is dependent on SAP acting downstream of receptor phosphorylation.

    PubMed

    Meinke, Stephan; Watzl, Carsten

    2013-01-01

    2B4 (CD244) and NK-T-B-antigen (NTB-A, CD352) are activating receptors on human natural killer (NK) cells and belong to the family of signaling lymphocyte activation molecule (SLAM)-related receptors (SRR). Engagement of these receptors leads to phosphorylation of their cytoplasmic tails and recruitment of the adapter proteins SLAM-associated protein (SAP) and Ewing's sarcoma-activated transcript-2 (EAT-2). X-linked lymphoproliferative syndrome (XLP) is a severe immunodeficiency that results from mutations in the SAP gene. 2B4 and NTB-A-mediated cytotoxicity are abrogated in XLP NK cells. To elucidate the molecular basis for this defect we analyzed early signaling events in SAP knockdown cells. Similar to XLP NK cells, knockdown of SAP in primary human NK cells leads to a reduction of 2B4 and NTB-A-mediated cytotoxicity. We found that early signaling events such as raft recruitment and receptor phosphorylation are not affected by the absence of SAP, indicating the defect in the absence of SAP is downstream of these events. In addition, knockdown of EAT-2 does not impair 2B4 or NTB-A-mediated cytotoxicity. Surprisingly, EAT-2 recruitment to both receptors is abrogated in the absence of SAP, revealing a novel cooperativity between these adapters.

  8. Adjuvant-enhanced antibody and cellular responses to inclusion bodies expressing FhSAP2 correlates with protection of mice to Fasciola hepatica.

    PubMed

    Rivera, Francheska; Espino, Ana M

    2016-01-01

    Fasciola hepatica saposin-like protein-2 (FhSAP2) is a protein differentially expressed in various developmental stages of F. hepatica. Recombinant FhSAP2 has demonstrated the induction of partial protection in mice and rabbits when it is administered subcutaneously (SC) in Freund's adjuvant. Because FhSAP2 is overexpressed in bacteria in the form of inclusion bodies (IBs), we isolated IBs expressing FhSAP2 and tested their immunogenicity when administered SC in mice emulsified in two different adjuvants: QS-21 and Montanide TM ISA720. Animals received three injections containing 20 μg of protein two weeks apart and 4 weeks after the third injection, mice were infected with 10 F. hepatica metacercariae by oral route. The percentages of protection induced by FhSAP2-IBs were estimated to be between 60.0 and 62.5% when compared with adjuvant-vaccinated, infected controls. By determining the levels of IgG1 and IgG2a antibodies and IL-4 and IFNγ cytokines in the serum of experimental animals, it was found that both Th1 and Th2 immune responses were significantly increased in the FhSAP2-IBs vaccinated groups compared with the adjuvant-vaccinated, infected control groups. The adjuvant-vaccinated groups had significantly lower IgG1 to IgG2a ratios and lower IL-4 to IFNγ ratios than the FhSAP2-IBs vaccinated animals, which is indicative of higher levels of Th2 immune responses. Irrespective to the adjuvant used, animals vaccinated with FhSAP2-IBs exhibited significantly higher survival percentage and less liver damage than the adjuvant-control groups. This study suggests that FhSAP2 has potential as vaccine against F. hepatica and that the protection elicited by this molecule could be linked to a mechanism driven by the CD4-Th1 cells.

  9. Effects of Xylem-Sap Composition on Glassy-Winged Sharpshooter (Hemiptera: Cicadellidae) Egg Maturation on High- and Low-Quality Host Plants.

    PubMed

    Sisterson, Mark S; Wallis, Christopher M; Stenger, Drake C

    2017-03-06

    Glassy-winged sharpshooters must feed as adults to produce mature eggs. Cowpea and sunflower are both readily accepted by the glassy-winged sharpshooter for feeding, but egg production on sunflower was reported to be lower than egg production on cowpea. To better understand the role of adult diet in egg production, effects of xylem-sap chemistry on glassy-winged sharpshooter egg maturation was compared for females confined to cowpea and sunflower. Females confined to cowpea consumed more xylem-sap than females held on sunflower. In response, females held on cowpea produced more eggs, had heavier bodies, and greater lipid content than females held on sunflower. Analysis of cowpea and sunflower xylem-sap found that 17 of 19 amino acids were more concentrated in cowpea xylem-sap than in sunflower xylem-sap. Thus, decreased consumption of sunflower xylem-sap was likely owing to perceived lower quality, with decreased egg production owing to a combination of decreased feeding and lower return per unit volume of xylem-sap consumed. Examination of pairwise correlation coefficients among amino acids indicated that concentrations of several amino acids within a plant species were correlated. Principal component analyses identified latent variables describing amino acid composition of xylem-sap. For females held on cowpea, egg maturation was affected by test date, volume of excreta produced, and principal components describing amino acid composition of xylem-sap. Principal component analyses aided in identifying amino acids that were positively or negatively associated with egg production, although determining causality with respect to key nutritional requirements for glassy-winged sharpshooter egg production will require additional testing.

  10. [Characteristics of dominant tree species stem sap flow and their relationships with environmental factors in a mixed conifer-broadleaf forest in Dinghushan, Guangdong Province of South China].

    PubMed

    Huang, De-Wei; Zhang, De-Qiang; Zhou, Guo-Yi; Liu, Shi-Zhong; Otieno, Dennis; Li, Yue-Lin

    2012-05-01

    By the method of Granier' s thermal dissipation probe, the stem sap flow density of four dominant tree species (Pinus massoniana, Castanopsis chinensis, Schima superba, and Machilus kwangtungensis) in a mixed conifer-broadleaf forest in Dinghushan Reserve of South China was continuously measured in the dry season (November) and wet season (July) in 2010, and the environmental factors including air temperature, relative humidity, and photosynthetically active radiation (PAR) were measured synchronically, aimed to study the characteristics of the stem sap flow of the tree species in response to environmental factors. During the dry and wet seasons, the diurnal changes of the stem sap flow velocity of the tree species all presented a typical single-peak curve, with high values in the daytime and low values in the nighttime. The average and maximum sap flow velocities and the daily sap flow flux of broad-leaved trees (C. chinensis, S. superba, and M. kwangtungensis) were significantly higher than those of coniferous tree (P. massoniana), and the maximum sap flow velocity of P. massoniana, C. valueschinensis, S. superba, and M. kwangtungensis was 29.48, 38.54, 51.67 and 58.32 g H2O x m(-2) x s(-1), respectively. A time lag was observed between the sap flow velocity and the diurnal variations of PAR, vapor pressure deficiency, and air temperature, and there existed significant positive correlations between the sap flow velocity and the three environmental factors. The PAR in wet season and the air temperature in dry season were the leading factors affecting the stem sap flow velocity of the dominant tree species.

  11. Analysis of the Conformational Behavior and Stability of the SAP and TSAP Isomers of Lanthanide(III) NB-DOTA-Type Chelates

    PubMed Central

    Tircso, Gyula; Webber, Benjamin C.; Kucera, Benjamin E.; Young, Victor G.; Woods, Mark

    2011-01-01

    Controlling the water exchange kinetics of macrocyclic Gd3+ chelates, a key parameter in the design of improved magnetic resonance imaging (MRI) contrast media, may be facilitated by selecting the coordination geometry of the chelate. The water exchange kinetics of the mono- capped twisted square antiprism (TSAP) being much closer to optimal than those of the mono capped square antiprism (SAP) render the TSAP isomer more desirable for high relaxivity applications. Two systems have been developed that allow for selection of the TSAP coordination geometry in 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA)-type Gd3+ chelates, both based upon the macrocycle nitrobenzyl cyclen. In this paper we report investigations into the stability and formation of these chelates. Particular focus is given to the production of two regioisomeric chelates during the chelation reaction. These regioisomers are distinguished by having the nitrobenzyl substituent either on a corner or on the side of the macrocyclic ring. The origin of these two regioisomers appears to stem from a conformation of the ligand in solution in which it is hypothesized that pendant arms lie both above and below the plane of the macrocycle. The conformational changes that then result during the formation of the intermediate H2GdL+ chelate give rise to differing positions of the nitrobenzyl substituent depending upon from which face of the macrocycle the Ln3+ approaches the ligand. PMID:21819053

  12. Effect of ultrafiltration process on physico-chemical, rheological, microstructure and thermal properties of syrups from male and female date palm saps.

    PubMed

    Makhlouf-Gafsi, Ines; Baklouti, Samia; Mokni, Abir; Danthine, Sabine; Attia, Hamadi; Blecker, Christophe; Besbes, Souhail; Masmoudi, Manel

    2016-07-15

    This study investigates the effect of the ultrafiltration process on physicochemical, rheological, microstructure and thermal properties of syrups from male and female date palm sap. All the studied syrups switched from pseudoplastic rheological behaviour (n=0.783) to Newtonian behaviour (n∼1) from 10 to 50 °C respectively and present similar thermal profiles. Results revealed that the ultrafiltration process significantly affects the rheological behaviour of the male and female syrups. These differences on rheological properties are attributed to the variation of chemical composition between sap and sap permeate syrups. Furthermore, the effect of temperature on viscosity of the syrups was investigated during heating and cooling processes at the same shear rate (50s(-1)). This study provides idea of the stability of the syrup by evaluating the area between heating and cooling curves. Actually, the syrup prepared from male sap permeate is the most stable between the four studied syrups.

  13. Semiochemical-mediated flight responses of sap beetle vectors of oak wilt, Ceratocystis fagacearum.

    PubMed

    Kyhl, John F; Bartelt, Robert J; Cossé, Allard; Juzwik, Jennifer; Seybold, Steven J

    2002-08-01

    The sap beetle, Colopterus truncatus (Coleoptera: Nitidulidae), is one of the primary vectors of the oak wilt pathogen, Ceratocystis fagacearum, in the north-central United States. Field behavioral assays utilizing various release rates and blends of three methyl-branched hydrocarbon aggregation pheromone components showed that flight responses of this beetle were similar in Illinois and Minnesota populations. In both locations, both sexes of the beetle responded synergistically to a combination of the three-component pheromone and fermenting whole-wheat bread dough. Further, Colopterus truncatus preferred a high release rate over a low release rate of the three-component blend. In both locations, the response of C. truncatus to a simplified version of the pheromone consisting of (2E,4E,6E)-3,5-dimethyl-2,4,6-octatriene (1) and (2E,4E,6E,8E)-3,5,7-trimethyl-2,4,6,8-decatetraene (3) was not significantly different from the response to the three-component blend. An experiment in Illinois with all possible combinations of the components demonstrated that the decatetraene (3) was the crucial component in the blend; of all treatments, the maximal response was elicited by 3 + dough. Chipped bark, phloem, and xylem from northern pin oak, Quercus ellipsoidalis, was not attractive to C. truncatus in Minnesota. During a weekly survey over two seasons in Minnesota, C. truncatus flew in response to the three-component pheromone between early April and early July, with the maximum responses coming on May 4, 2000 and April 20, 2001. During both years, more than 98% of the beetles were trapped between April 14 and June 1. During the same survey, Glischrochilus spp. (Nitiduildae) flew during longer periods of the summer, particularly in 2001. The sex ratio of C. truncatus responding during all experiments was female-biased (1.8:1, female-male), which is characteristic of other male-produced coleopteran aggregation pheromones. Other sap beetles that play a minor role in the

  14. Elevated CO2 reduces sap flux in mature deciduous forest trees.

    PubMed

    Cech, Patrick G; Pepin, Steeve; Körner, Christian

    2003-10-01

    We enriched in CO2 the canopy of 14 broad-leaved trees in a species-rich, ca. 30-m-tall forest in NW Switzerland to test whether elevated CO2 reduces water use in mature forest trees. Measurements of sap flux density (JS) were made prior to CO2 enrichment (summer 2000) and throughout the first whole growing season of CO2 exposure (2001) using the constant heat-flow technique. The short-term responses of sap flux to brief (1.5-3 h) interruptions of CO2 enrichment were also examined. There were no significant a priori differences in morphological and physiological traits between trees which were later exposed to elevated CO2 (n=14) and trees later used as controls (n=19). Over the entire growing season, CO2 enrichment resulted in an average 10.7% reduction in mean daily JS across all species compared to control trees. Responses were most pronounced in Carpinus, Acer, Prunus and Tilia, smaller in Quercus and close to zero in Fagus trees. The JS of treated trees significantly increased by 7% upon transient exposure to ambient CO2 concentrations at noon. Hence, responses of the different species were, in the short term, similar in magnitude to those observed over the whole season (though opposite because of the reversed treatment). The reductions in mean JS of CO2-enriched trees were high (22%) under conditions of low evaporative demand (vapour pressure deficit, VPD <5 hPa) and small (2%) when mean daily VPD was greater than 10 hPa. During a relatively dry period, the effect of elevated CO2 on JS even appeared to be reversed. These results suggest that daily water savings by CO2-enriched trees may have accumulated to a significantly improved water status by the time when control trees were short of soil moisture. Our data indicate that the magnitude of CO2 effects on stand transpiration will depend on rainfall regimes and the relative abundance of the different species, being more pronounced under humid conditions and in stands dominated by species such as Carpinus and

  15. Patterns of ecosystem metabolism in the Tonle Sap Lake, Cambodia with links to capture fisheries.

    PubMed

    Holtgrieve, Gordon W; Arias, Mauricio E; Irvine, Kim N; Lamberts, Dirk; Ward, Eric J; Kummu, Matti; Koponen, Jorma; Sarkkula, Juha; Richey, Jeffrey E

    2013-01-01

    The Tonle Sap Lake in Cambodia is a dynamic flood-pulsed ecosystem that annually increases its surface area from roughly 2,500 km(2) to over 12,500 km(2) driven by seasonal flooding from the Mekong River. This flooding is thought to structure many of the critical ecological processes, including aquatic primary and secondary productivity. The lake also has a large fishery that supports the livelihoods of nearly 2 million people. We used a state-space oxygen mass balance model and continuous dissolved oxygen measurements from four locations to provide the first estimates of gross primary productivity (GPP) and ecosystem respiration (ER) for the Tonle Sap. GPP averaged 4.1±2.3 g O2 m(-3) d(-1) with minimal differences among sites. There was a negative correlation between monthly GPP and lake level (r = 0.45) and positive correlation with turbidity (r = 0.65). ER averaged 24.9±20.0 g O2 m(-3) d(-1) but had greater than six-fold variation among sites and minimal seasonal change. Repeated hypoxia was observed at most sampling sites along with persistent net heterotrophy (GPP

  16. Progress report for FACETS (Framework Application for Core-Edge Transport Simulations): C.S. SAP

    SciTech Connect

    Epperly, T W

    2008-10-01

    The mission of the Computer Science Scientific Application Partnership (C.S. SAP) at LLNL is to develop and apply leading-edge scientific component technology to FACETS software. Contributions from LLNL's fusion energy program staff towards the underlying physics modules are described in a separate report. FACETS uses component technology to combine selectively multiple physics and solver software modules written in different languages by different institutions together in an tightly-integrated, parallel computing framework for Tokamak reactor modeling. In the past fiscal year, the C.S. SAP has focused on two primary tasks: applying Babel to connect UEDGE into the FACETS framework through UEDGE's existing Python interface and developing a next generation componentization strategy for UEDGE which avoids the use of Python. The FACETS project uses Babel to solve its language interoperability challenges. Specific accomplishments for the year include: (1) Refined SIDL interfaces for UEDGE to meet satisfy the standard interfaces required by FACETS for all physics modules. This required consensus building between framework and UEDGE developers. (2) Wrote prototype C++ driver for UEDGE to demonstrate how UEDGE can be called from C++ using Babel. (3) Supported the FACETS project by adding new features to Babel such as release number tagging, porting to new machines, and adding new configuration options. Babel modifications were delivered to FACETS by testing and publishing development snapshots in the projects software repository. (4) Assisted Tech-X Corporation in testing and debugging of a high level build system for the complete FACETS tool chain--the complete list of third-party software libraries that FACETS depends on directly or indirectly (e.g., MPI, HDF5, PACT, etc.). (5) Designed and implemented a new approach to wrapping UEDGE as a FACETS component without requiring Python. To get simulation results as soon as possible, our initial connection from the FACETS

  17. Pod development and depodding produce parallel effects on xylem sap cytokinin levels and monocarpic leaf senescence in soybean

    SciTech Connect

    Nooden, L.D. ); Singh, S.; Letham, D.S. )

    1989-04-01

    Depodding at full pod extension (prepodfill) prevents the rapid leaf yellowing and death of the soybean plant, whereas pod removal in late podfill does not. Xylem sap was collected from rootstocks under pressure over 50 min, and after purification, the sap CKS were measured by radioimmunoassay. The major CKs (DZR, ZR, DZ and Z) drop from 229 nM to 15 during pod extension. Removal of pods reaching full extension causes a large increase in DZR and ZR levels, less increase in Z and no increase in DZ, DZMP or the O-glucosides. Depodding at the late podfill does not increase the CKs significantly. CKs change independently in response to senescence and pod removal suggesting differences in their metabolism and perhaps their functions. A decline in CK production by the roots and in CK flux into the shoot system appears to be an important factor in monocarpic senescence of soybean.

  18. Elevated CO2 decreases both transpiration flow and concentrations of Ca and Mg in the xylem sap of wheat.

    PubMed

    Houshmandfar, Alireza; Fitzgerald, Glenn J; Tausz, Michael

    2015-02-01

    The impact of elevated atmospheric [CO2] (e[CO2]) on plants often includes a decrease in their nutrient status, including Ca and Mg, but the reasons for this decline have not been clearly identified. One of the proposed hypotheses is a decrease in transpiration-driven mass flow of nutrients due to decreased stomatal conductance. We used glasshouse and Free Air CO2 Enrichment (FACE) experiments with wheat to show that, in addition to decrease in transpiration rate, e[CO2] decreased the concentrations of Ca and Mg in the xylem sap. This result suggests that uptake of nutrients is not only decreased by reduced transpiration-driven mass flow, but also by as yet unidentified mechanisms that lead to reduced concentrations in the xylem sap.

  19. Investigating differences in the root to shoot transfer and xylem sap solubility of organic compounds between zucchini, squash and soybean using a pressure chamber method.

    PubMed

    Garvin, Naho; Doucette, William J; White, Jason C

    2015-07-01

    A pressure chamber method was used to examine differences in the root to shoot transfer and xylem sap solubility of caffeine (log Kow=-0.07), triclocarban (log Kow=3.5-4.2) and endosulfan (log Kow=3.8-4.8) for zucchini (cucurbita pepo ssp pepo), squash (cucurbita pepo ssp ovifera), and soybean (glycine max L.). Transpiration stream concentration factors (TSCF) for caffeine (TSCF=0.8) were statistically equivalent for all plant species. However, for the more hydrophobic endosulfan and triclocarban, the TSCF values for zucchini (TSCF=0.6 and 0.4, respectively) were 3 and 10 times greater than the soybean and squash (TSCF=0.2 and 0.05, respectively). The difference in TSCF values was examined by comparing the measured solubilities of caffeine, endosulfan and triclocarban in deionized water to those in soybean and zucchini xylem saps using a modified shake flask method. The measured solubility of organic contaminants in xylem sap has not previously been reported. Caffeine solubilities in the xylem saps of soybean and zucchini were statistically equal to deionized water (21500mgL(-1)) while endosulfan and triclocarban solubilities in the zucchini xylem sap were significantly greater (0.43 and 0.21mgL(-1), respectively) than that of the soybean xylem sap (0.31 and 0.11mgL(-1), respectively) and deionized water (0.34 and 0.11mgL(-1), respectively). This suggests that the enhanced root to shoot transfer of hydrophobic organics reported for zucchini is partly due to increased solubility in the xylem sap. Further xylem sap characterization is needed to determine the mechanism of solubility enhancement.

  20. Extensive investigation of the sap flow of maize plants in an oasis farmland in the middle reach of the Heihe River, Northwest China.

    PubMed

    Zhao, Liwen; He, Zhibin; Zhao, Wenzhi; Yang, Qiyue

    2016-09-01

    A better understanding of the sap flow characteristics of maize plants is critical for improving irrigation water-use efficiency, especially for regions facing water resource shortages. In this study, sap flow rates, related soil-physics and plant-growth parameters, and meteorological factors, were simultaneously monitored in a maize field in two consecutive years, 2011 and 2012, and the sap flow rates of the maize plants were extensively analyzed based on the monitored data. Seasonal and daily variational characteristics were identified at different growth stages and under different weather conditions, respectively. The analyses on the relationships between sap flow rate and reference evapotranspiration (ET0), as well as several plant-growth parameters, indicate that the irrigation schedule can exert an influence on sap flow, and can consequently affect crop yield. The ranking of the main meteorological factors affecting the sap flow rate was: net radiation > air temperature > vapor pressure deficit > wind speed. For a quick estimation of sap flow rates, an empirical formula based on the two top influencing factors was put forward and verified to be reliable. The sap flow rate appeared to show little response to irrigation when the water content was relatively high, implying that some of the irrigation in recent years may have been wasted. These results may help to reveal the bio-physical processes of maize plants related to plant transpiration, which could be beneficial for establishing an efficient irrigation management system in this region and also for providing a reference for other maize-planting regions.