accept unmethylated dna: Topics by Science.gov

Sample records for accept unmethylated dna

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such
β Cell death and dysfunction during type 1 diabetes development in at-risk individuals

PubMed Central

Herold, Kevan C.; Usmani-Brown, Sahar; Ghazi, Tara; Lebastchi, Jasmin; Beam, Craig A.; Bellin, Melena D.; Ledizet, Michel; Sosenko, Jay M.; Krischer, Jeffrey P.; Palmer, Jerry P.

2015-01-01

Role of the funding source: Funding from the NIH was used for support of the participating clinical centers and the coordinating center. The funding source did not participate in the collection or the analysis of the data. BACKGROUND. The β cell killing that characterizes type 1 diabetes (T1D) is thought to begin years before patients present clinically with metabolic decompensation; however, this primary pathologic process of the disease has not been measured. METHODS. Here, we measured β cell death with an assay that detects β cell–derived unmethylated insulin (INS) DNA. Using this assay, we performed an observational study of 50 participants from 2 cohorts at risk for developing T1D from the TrialNet Pathway to Prevention study and of 4 subjects who received islet autotransplants. RESULTS. In at-risk subjects, those who progressed to T1D had average levels of unmethylated INS DNA that were elevated modestly compared with those of healthy control subjects. In at-risk individuals that progressed to T1D, the observed increases in unmethylated INS DNA were associated with decreases in insulin secretion, indicating that the changes in unmethylated INS DNA are indicative of β cell killing. Subjects at high risk for T1D had levels of unmethylated INS DNA that were higher than those of healthy controls and higher than the levels of unmethylated INS DNA in the at-risk progressor and at-risk nonprogressor groups followed for 4 years. Evaluation of insulin secretory kinetics also distinguished high-risk subjects who progressed to overt disease from those who did not. CONCLUSION. We conclude that a blood test that measures unmethylated INS DNA serves as a marker of active β cell killing as the result of T1D-associated autoimmunity. Together, the data support the concept that β cell killing occurs sporadically during the years prior to diagnosis of T1D and is more intense in the peridiagnosis period. TRIAL REGISTRATION. Clinicaltrials.gov NCT00097292. FUNDING. Funding was from the NIH, the Juvenile Diabetes Research Foundation, and the American Diabetes Association. PMID:25642774
β cell death and dysfunction during type 1 diabetes development in at-risk individuals.

PubMed

Herold, Kevan C; Usmani-Brown, Sahar; Ghazi, Tara; Lebastchi, Jasmin; Beam, Craig A; Bellin, Melena D; Ledizet, Michel; Sosenko, Jay M; Krischer, Jeffrey P; Palmer, Jerry P

2015-03-02

Role of the funding source: Funding from the NIH was used for support of the participating clinical centers and the coordinating center. The funding source did not participate in the collection or the analysis of the data. The β cell killing that characterizes type 1 diabetes (T1D) is thought to begin years before patients present clinically with metabolic decompensation; however, this primary pathologic process of the disease has not been measured. Here, we measured β cell death with an assay that detects β cell-derived unmethylated insulin (INS) DNA. Using this assay, we performed an observational study of 50 participants from 2 cohorts at risk for developing T1D from the TrialNet Pathway to Prevention study and of 4 subjects who received islet autotransplants. In at-risk subjects, those who progressed to T1D had average levels of unmethylated INS DNA that were elevated modestly compared with those of healthy control subjects. In at-risk individuals that progressed to T1D, the observed increases in unmethylated INS DNA were associated with decreases in insulin secretion, indicating that the changes in unmethylated INS DNA are indicative of β cell killing. Subjects at high risk for T1D had levels of unmethylated INS DNA that were higher than those of healthy controls and higher than the levels of unmethylated INS DNA in the at-risk progressor and at-risk nonprogressor groups followed for 4 years. Evaluation of insulin secretory kinetics also distinguished high-risk subjects who progressed to overt disease from those who did not. We conclude that a blood test that measures unmethylated INS DNA serves as a marker of active β cell killing as the result of T1D-associated autoimmunity. Together, the data support the concept that β cell killing occurs sporadically during the years prior to diagnosis of T1D and is more intense in the peridiagnosis period. Clinicaltrials.gov NCT00097292. Funding was from the NIH, the Juvenile Diabetes Research Foundation, and the American Diabetes Association.
Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
High-throughput detection of human papillomavirus-18 L1 gene methylation, a candidate biomarker for the progression of cervical neoplasia.

PubMed

Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich

2007-04-25

The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.
A novel restriction endonuclease GlaI for rapid and highly sensitive detection of DNA methylation coupled with isothermal exponential amplification reaction.

PubMed

Sun, Yueying; Sun, Yuanyuan; Tian, Weimin; Liu, Chenghui; Gao, Kejian; Li, Zhengping

2018-02-07

Sensitive and accurate detection of site-specific DNA methylation is of critical significance for early diagnosis of human diseases, especially cancers. Herein, for the first time we employ a novel methylation-dependent restriction endonuclease GlaI to detect site-specific DNA methylation in a highly specific and sensitive way by coupling with isothermal exponential amplification reaction (EXPAR). GlaI can only cut the methylated target site with excellent selectivity but leave the unmethylated DNA intact. Then the newly exposed end fragments of methylated DNA can trigger EXPAR for highly efficient signal amplification while the intact unmethylated DNA will not initiate EXPAR at all. As such, only the methylated DNA is quantitatively and faithfully reflected by the real-time fluorescence signal of the GlaI-EXPAR system, and the potential false positive interference from unmethylated DNA can be effectively eliminated. Therefore, by integrating the unique features of GlaI for highly specific methylation discrimination and EXPAR for rapid and powerful signal amplification, the elegant GlaI-EXPAR assay allows the direct quantification of methylated DNA with ultrahigh sensitivity and accuracy. The detection limit of methylated DNA target has been pushed down to the aM level and the whole detection process of GlaI-EXPAR can be accomplished within a short time of 2 h. More importantly, ultrahigh specificity is achieved and as low as 0.01% methylated DNA can be clearly identified in the presence of a large excess of unmethylated DNA. This GlaI-EXPAR is also demonstrated to be capable of determining site-specific DNA methylations in real genomic DNA samples. Sharing the distinct advantages of ultrahigh sensitivity, outstanding specificity and facile operation, this new GlaI-EXPAR strategy may provide a robust and reliable platform for the detection of site-specific DNA methylations with low abundances.
Detection of regional DNA methylation using DNA-graphene affinity interactions.

PubMed

Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A

2017-01-15

We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues. Copyright Â© 2016 Elsevier B.V. All rights reserved.
Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979
Frequent MGMT (06-methylguanine-DNA methyltransferase) hypermethylation in long-term survivors of glioblastoma: a single institution experience

PubMed Central

Baur, Martina; Preusser, Matthias; Piribauer, Maria; Elandt, Katarzyna; Hassler, Marco; Hudec, Marcus; Dittrich, Christian; Marosi, Christine

2010-01-01

Background The aim of this retrospective study was to analyse the MGMT (06-methylguanine-DNA methyltransferase) promoter methylation status in long-term surviving (≥ 3 years) patients with glioblastoma multiforme (GBM). Methods The methylation status of the MGMT promoter was determined by bisulfite modification of the DNA and subsequent methylation-specific polymerase-chain-reaction (MSP). DNA was extracted from routinely formalin-fixed and paraffin-embedded tumour tissue samples. Results MSP yielded interpretable results in only 14 of 33 (42%) long-term surviving patients with GBM. A methylated band was seen in 3 of 14, methylated as well as unmethylated bands in 8 of 14 and an only unmethylated band in 3 of 14 patients, thus, yielding MGMT promoter methylation in 11 of 14 patients. The two groups of patients with methylated and unmethylated MGMT promoter status were too small to draw any firm statistical conclusions. Conclusions Long-term surviving patients with GBM have very frequently intratumoural MGMT promoter methylation. This phenomenon discriminates long-term survivors from a non-selected group of patients with GBM. The standardization of the MSP for the determination of the MGMT promoter methylation status seems to be necessary in order to make this methodology a more reliable one. PMID:22933901
Chemotherapeutic Drug-Conjugated Microbeads Demonstrate Preferential Binding to Methylated Plasmid DNA.

PubMed

Lin, Kevin N; Grandhi, Taraka Sai Pavan; Goklany, Sheba; Rege, Kaushal

2018-04-10

Plasmid DNA (pDNA) is an attractive therapeutic biomolecule in several diseases including cancer, AIDS, cystic fibrosis, Parkinson's disease, and Alzheimer's disease. Increasing demand for plasmid DNA as a therapeutic biomolecule for transgene expression or vaccine applications necessitate novel approaches to bioprocessing. The synthesis, characterization and evaluation of aminoglycoside-derived hydrogel microbeads (Amikabeads) for pDNA binding is described previously. Here, the generation and evaluation of novel chemotherapeutic drug-conjugated microbeads for application in pDNA binding and recovery is described. Chemotherapeutic drug-conjugated Amikabeads demonstrate higher binding of methylated pDNA compared to unmethylated pDNA in presence of high salt concentrations. Desorption of plasmids from drug-conjugated microbeads is facilitated by the use of organic modifiers. The observed differences in binding methylated versus unmethylated DNA can make drug-conjugated microbeads useful in diagnostic as well as therapeutic applications. These results demonstrate that anti-cancer drugs represent a diverse set of ligands that may be exploited for molecular engineering of novel DNA binding materials for applications in delivery, diagnostics, and biomanufacturing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Methylation-Sensitive High Resolution Melting (MS-HRM).

PubMed

Hussmann, Dianna; Hansen, Lise Lotte

2018-01-01

Methylation-Sensitive High Resolution Melting (MS-HRM) is an in-tube, PCR-based method to detect methylation levels at specific loci of interest. A unique primer design facilitates a high sensitivity of the assays enabling detection of down to 0.1-1% methylated alleles in an unmethylated background.Primers for MS-HRM assays are designed to be complementary to the methylated allele, and a specific annealing temperature enables these primers to anneal both to the methylated and the unmethylated alleles thereby increasing the sensitivity of the assays. Bisulfite treatment of the DNA prior to performing MS-HRM ensures a different base composition between methylated and unmethylated DNA, which is used to separate the resulting amplicons by high resolution melting.The high sensitivity of MS-HRM has proven useful for detecting cancer biomarkers in a noninvasive manner in urine from bladder cancer patients, in stool from colorectal cancer patients, and in buccal mucosa from breast cancer patients. MS-HRM is a fast method to diagnose imprinted diseases and to clinically validate results from whole-epigenome studies. The ability to detect few copies of methylated DNA makes MS-HRM a key player in the quest for establishing links between environmental exposure, epigenetic changes, and disease.
Alu repeated DNAs are differentially methylated in primate germ cells.

PubMed Central

Rubin, C M; VandeVoort, C A; Teplitz, R L; Schmid, C W

1994-01-01

A significant fraction of Alu repeats in human sperm DNA, previously found to be unmethylated, is nearly completely methylated in DNA from many somatic tissues. A similar fraction of unmethylated Alus is observed here in sperm DNA from rhesus monkey. However, Alus are almost completely methylated at the restriction sites tested in monkey follicular oocyte DNA. The Alu methylation patterns in mature male and female monkey germ cells are consistent with Alu methylation in human germ cell tumors. Alu sequences are hypomethylated in seminoma DNAs and more methylated in a human ovarian dysgerminoma. These results contrast with methylation patterns reported for germ cell single-copy, CpG island, satellite, and L1 sequences. The function of Alu repeats is not known, but differential methylation of Alu repeats in the male and female germ lines suggests that they may serve as markers for genomic imprinting or in maintaining differences in male and female meiosis. Images PMID:7800508
Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

PubMed

Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

2014-01-18

Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.
DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

PubMed Central

Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

2000-01-01

The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262
eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

PubMed

Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

2014-11-07

We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.
DNA methylation detection based on difference of base content

NASA Astrophysics Data System (ADS)

Sato, Shinobu; Ohtsuka, Keiichi; Honda, Satoshi; Sato, Yusuke; Takenaka, Shigeori

2016-04-01

Methylation frequently occurs in cytosines of CpG sites to regulate gene expression. The identification of aberrant methylation of certain genes is important for cancer marker analysis. The aim of this study was to determine the methylation frequency in DNA samples of unknown length and/or concentration. Unmethylated cytosine is known to be converted to thymine following bisulfite treatment and subsequent PCR. For this reason, the AT content in DNA increases with an increasing number of methylation sites. In this study, the fluorescein-carrying bis-acridinyl peptide (FKA) molecule was used for the detection of methylation frequency. FKA contains fluorescein and two acridine moieties, which together allow for the determination of the AT content of double-stranded DNA fragments. Methylated and unmethylated human genomes were subjected to bisulfide treatment and subsequent PCR using primers specific for the CFTR, CDH4, DBC1, and NPY genes. The AT content in the resulting PCR products was estimated by FKA, and AT content estimations were found to be in good agreement with those determined by DNA sequencing. This newly developed method may be useful for determining methylation frequencies of many PCR products by measuring the fluorescence in samples excited at two different wavelengths.
Efficacy of protracted temozolomide dosing is limited in MGMT unmethylated GBM xenograft models.

PubMed

Cen, Ling; Carlson, Brett L; Pokorny, Jenny L; Mladek, Ann C; Grogan, Patrick T; Schroeder, Mark A; Decker, Paul A; Anderson, S Keith; Giannini, Caterina; Wu, Wenting; Ballman, Karla V; Kitange, Gaspar J; Sarkaria, Jann N

2013-06-01

Temozolomide (TMZ) is important chemotherapy for glioblastoma multiforme (GBM), but the optimal dosing schedule is unclear. The efficacies of different clinically relevant dosing regimens were compared in a panel of 7 primary GBM xenografts in an intracranial therapy evaluation model. Protracted TMZ therapy (TMZ daily M-F, 3 wk every 4) provided superior survival to a placebo-treated group in 1 of 4 O(6)-DNA methylguanine-methyltransferase (MGMT) promoter hypermethylated lines (GBM12) and none of the 3 MGMT unmethylated lines, while standard therapy (TMZ daily M-F, 1 wk every 4) provided superior survival to the placebo-treated group in 2 of 3 MGMT unmethylated lines (GBM14 and GBM43) and none of the methylated lines. In comparing GBM12, GBM14, and GBM43 intracranial specimens, both GBM14 and GBM43 mice treated with protracted TMZ had a significant elevation in MGMT levels compared with placebo. Similarly, high MGMT was found in a second model of acquired TMZ resistance in GBM14 flank xenografts, and resistance was reversed in vitro by treatment with the MGMT inhibitor O(6)-benzylguanine, demonstrating a mechanistic link between MGMT overexpression and TMZ resistance in this line. Additionally, in an analysis of gene expression data, comparison of parental and TMZ-resistant GBM14 demonstrated enrichment of functional ontologies for cell cycle control within the S, G2, and M phases of the cell cycle and DNA damage checkpoints. Across the 7 tumor models studied, there was no consistent difference between protracted and standard TMZ regimens. The efficacy of protracted TMZ regimens may be limited in a subset of MGMT unmethylated tumors by induction of MGMT expression.
The Prognostic Roles of Gender and O6-Methylguanine-DNA Methyltransferase Methylation Status in Glioblastoma Patients: The Female Power.

PubMed

Franceschi, Enrico; Tosoni, Alicia; Minichillo, Santino; Depenni, Roberta; Paccapelo, Alexandro; Bartolini, Stefania; Michiara, Maria; Pavesi, Giacomo; Urbini, Benedetta; Crisi, Girolamo; Cavallo, Michele A; Tosatto, Luigino; Dazzi, Claudio; Biasini, Claudia; Pasini, Giuseppe; Balestrini, Damiano; Zanelli, Francesca; Ramponi, Vania; Fioravanti, Antonio; Giombelli, Ermanno; De Biase, Dario; Baruzzi, Agostino; Brandes, Alba A

2018-04-01

Clinical and molecular factors are essential to define the prognosis in patients with glioblastoma (GBM). O6-methylguanine-DNA methyltransferase (MGMT) methylation status, age, Karnofsky Performance Status (KPS), and extent of surgical resection are the most relevant prognostic factors. Our investigation of the role of gender in predicting prognosis shows a slight survival advantage for female patients. We performed a prospective evaluation of the Project of Emilia Romagna on Neuro-Oncology (PERNO) registry to identify prognostic factors in patients with GBM who received standard treatment. A total of 169 patients (99 males [58.6%] and 70 females [41.4%]) were evaluated prospectively. MGMT methylation was evaluable in 140 patients. Among the male patients, 36 were MGMT methylated (25.7%) and 47 were unmethylated (33.6%); among the female patients, 32 were methylated (22.9%) and 25 were unmethylated (17.9%). Survival was longer in the methylated females compared with the methylated males (P = 0.028) but was not significantly different between the unmethylated females and the unmethylated males (P = 0.395). In multivariate analysis, gender and MGMT methylation status considered together (methylated females vs. methylated males; hazard ratio [HR], 0.459; 95% confidence interval [CI], 0.242-0.827; P = 0.017), age (HR, 1.025; 95% CI, 1.002-1.049; P = 0.032), and KPS (HR, 0.965; 95% CI, 0.948-0.982; P < 0.001) were significantly correlated with survival. Survival was consistently longer among MGMT methylated females compared with males. Gender can be considered as a further prognostic factor. Copyright © 2018 Elsevier Inc. All rights reserved.

Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

PubMed Central

Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

1992-01-01

By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343
Authentication of forensic DNA samples.

PubMed

Frumkin, Dan; Wasserstrom, Adam; Davidson, Ariane; Grafit, Arnon

2010-02-01

Over the past twenty years, DNA analysis has revolutionized forensic science, and has become a dominant tool in law enforcement. Today, DNA evidence is key to the conviction or exoneration of suspects of various types of crime, from theft to rape and murder. However, the disturbing possibility that DNA evidence can be faked has been overlooked. It turns out that standard molecular biology techniques such as PCR, molecular cloning, and recently developed whole genome amplification (WGA), enable anyone with basic equipment and know-how to produce practically unlimited amounts of in vitro synthesized (artificial) DNA with any desired genetic profile. This artificial DNA can then be applied to surfaces of objects or incorporated into genuine human tissues and planted in crime scenes. Here we show that the current forensic procedure fails to distinguish between such samples of blood, saliva, and touched surfaces with artificial DNA, and corresponding samples with in vivo generated (natural) DNA. Furthermore, genotyping of both artificial and natural samples with Profiler Plus((R)) yielded full profiles with no anomalies. In order to effectively deal with this problem, we developed an authentication assay, which distinguishes between natural and artificial DNA based on methylation analysis of a set of genomic loci: in natural DNA, some loci are methylated and others are unmethylated, while in artificial DNA all loci are unmethylated. The assay was tested on natural and artificial samples of blood, saliva, and touched surfaces, with complete success. Adopting an authentication assay for casework samples as part of the forensic procedure is necessary for maintaining the high credibility of DNA evidence in the judiciary system.
MMASS: an optimized array-based method for assessing CpG island methylation.

PubMed

Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

2006-01-01

We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.
Unmethylated-maspin DNA in maternal plasma is associated with severe preeclampsia.

PubMed

Qi, Yan-Hua; Teng, Fei; Zhou, Qi; Liu, Yu-Xin; Wu, Jin-Fang; Yu, Shan-Shan; Zhang, Xin; Ma, Miao-Yan; Zhou, Ni; Chen, Li-Juan

2015-09-01

Cell-free fetal DNA in maternal plasma is associated with complications of pregnancy, including preeclampsia. Determination of levels is affected by fetal gender and genetic polymorphisms. Unmethylated maspin (u-maspin) is present in the placenta, and is placental-specific. The purpose of this study was to determine whether u-maspin DNA in maternal blood could serve as a marker of preeclampsia by measuring levels in different trimesters of normal pregnancies and in those complicated by preeclampsia. This case-control study was set in a tertiary care hospital. The population consisted of 45 women with normal pregnancies (15 in the 1st trimester, 15 in the 2nd trimester, 15 in the 3rd trimester), 20 women with mild preeclampsia, 25 women with severe preeclampsia, and six women with gestational trophoblastic disease. Peripheral blood was collected and methylation-specific PCR and fluorescence quantitative PCR were performed to measure the content of u-maspin DNA in maternal blood. U-maspin DNA was 5.5-fold higher in women with severe preeclampsia than in those with a normal 3rd trimester pregnancy (p < 0.05). During normal pregnancy, u-maspin DNA in maternal plasma tended to increase with advancing gestational age (p = 0.06). U-maspin DNA was not detected in healthy non-pregnant women or those with gestational trophoblastic disease. U-maspin DNA in maternal blood is associated with severe preeclampsia. © 2015 Nordic Federation of Societies of Obstetrics and Gynecology.
DNA from Periodontopathogenic Bacteria Is Immunostimulatory for Mouse and Human Immune Cells

PubMed Central

Nonnenmacher, Claudia; Dalpke, Alexander; Zimmermann, Stefan; Flores-de-Jacoby, Lavin; Mutters, Reinier; Heeg, Klaus

2003-01-01

Although bacterial DNA (bDNA) containing unmethylated CpG motifs stimulates innate immune cells through Toll-like receptor 9 (TLR-9), its precise role in the pathophysiology of diseases is still equivocal. Here we examined the immunostimulatory effects of DNA extracted from periodontopathogenic bacteria. A major role in the etiology of periodontal diseases has been attributed to Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, and Peptostreptococcus micros. We therefore isolated DNA from these bacteria and stimulated murine macrophages and human gingival fibroblasts (HGF) in vitro. Furthermore, HEK 293 cells transfected with human TLR-9 were also stimulated with these DNA preparations. We observed that DNA from these pathogens stimulates macrophages and gingival fibroblasts to produce tumor necrosis factor alpha and interleukin-6 in a dose-dependent manner. Methylation of the CpG motifs abolished the observed effects. Activation of HEK 293 cells expressing TLR-9 which were responsive to bDNA but not to lipopolysaccharide confirmed that immunostimulation was achieved by bDNA. In addition, the examined bDNA differed in the ability to stimulate murine macrophages, HGF, and TLR-9-transfected cells. DNA from A. actinomycetemcomitans elicited a potent cytokine response, while DNA from P. gingivalis and P. micros showed lower immunostimulatory activity. Taken together, the results strongly suggest that DNA from A. actinomycetemcomitans, P. gingivalis, and P. micros possesses immunostimulatory properties in regard to cytokine secretion by macrophages and fibroblasts. These stimulatory effects are due to unmethylated CpG motifs within bDNA and differ between distinct periodontopathogenic bacteria strains. Hence, immunostimulation by DNA from A. actinomycetemcomitans, P. gingivalis, and P. micros could contribute to the pathogenesis of periodontal diseases. PMID:12540566
Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection

PubMed Central

Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

2017-01-01

Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were “DNA methylation-sensitive” genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A. The other half were “DNA methylation-resistant” genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site. PMID:28903418
Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection.

PubMed

Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

2017-08-15

Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
Toll-like receptor 9 partially regulates lung inflammation induced following exposure to chicken barn air.

PubMed

Schneberger, David; Aulakh, Gurpreet; Channabasappa, Shankaramurthy; Singh, Baljit

2016-01-01

Exposure to animal barn air is an occupational hazard that causes lung dysfunction in barn workers. Respiratory symptoms experienced by workers are typically associated with endotoxin and TLR4 signalling, but within these environments gram negative bacteria constitute only a portion of the total microbial population. In contrast, unmethylated DNA can be found in all bacteria, some viruses, and mold. We hypothesized that in such environments TLR9, which binds unmethylated DNA, contributes to the overall immune responses in the lung. Using a mouse model, wild-type and TLR9(-/-) mice were exposed to chicken barn air for 1, 5, or 20 days. Blood serum and bronchiolar lavage fluid was tested against a panel of six TLR9-induced cytokines (IL-1β, IL-6, IL-10, IL-12, TNFα, and IFNγ) for changes in expression. Bronchiolar lavage fluid (BAL) was also tested for macrophage as well as monocyte migration. There were significant decreases in serum TNFα after a single day exposure in TLR9(-/-) mice. BAL concentrations of TNFα and IFNγ, as well as TNFα in serum in TLR9(-/-) mice were also reduced after barn exposure for 5 days. After 20 days of exposure IFNγ was significantly reduced in lavage of TLR9(-/-) mice. Myeloperoxidase (MPO) accumulation in the lung was reduced at 20 days of exposure in TLR9(-/-) mice, as was total lavage cell counts. However, Masson's staining revealed no apparent lung histological differences between any of the treatment groups. Taken together our data show TLR9 plays a partial role in lung inflammation induced following exposure to chicken barn air potentially through binding of unmethylated DNA.
Distinctive Klf4 mutants determine preference for DNA methylation status

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less
Profile analysis and prediction of tissue-specific CpG island methylation classes

PubMed Central

2009-01-01

Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes conserving the accuracy provided by leading binary methylation classification methods. PMID:19383127
CpG island methylation of TMS1/ASC and CASP8 genes in cervical cancer

PubMed Central

2009-01-01

Background Gene silencing associated with aberrant methylation of promoter region CpG islands is an acquired epigenetic alteration that serves as an alternative to genetic defects in the inactivation of tumor suppressor and other genes in human cancers. Aims This study describes the methylation status of TMS1/ASC and CASP8 genes in cervical cancer. We also examined the prevalence of TMS1/ASC and CASP8 genes methylation in cervical cancer tissue and none - neo plastic samples in an effort to correlate with smoking habit and clinicopathological features. Method Target DNA was modified by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequently amplified by Methylation Specific (MS) PCR with primers specific for methylated versus unmethylated DNA. The PCR product was detected by gel electrophoresis and combined with the clinical records of patients. Results The methylation pattern of the TMS1/ASC and CASP8 genes in specimens of cervical cancer and adjacent normal tissues were detected [5/80 (6.2%), 3/80 (3.75%)-2/80 (2.5%), 1/80 (1.2%) respectively]. No statistical differences were seen in the extent of differentiation, invasion, pathological type and smoking habit between the methylated and unmethylated tissues (P > 0.05). Conclusion The present study conclude that the frequency of TMS1/ASC and CASP8 genes methylation in cervical cancer are rare (< 6%), and have no any critical role in development of cervical cancer. PMID:19258216
DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

PubMed Central

Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

2017-01-01

The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334
DNA methylation at hepatitis B viral integrants is associated with methylation at flanking human genomic sequences

PubMed Central

Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio

2015-01-01

Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310
Adenine specific DNA chemical sequencing reaction.

PubMed Central

Iverson, B L; Dervan, P B

1987-01-01

Reaction of DNA with K2PdCl4 at pH 2.0 followed by a piperidine workup produces specific cleavage at adenine (A) residues. Product analysis revealed the K2PdCl4 reaction involves selective depurination at adenine, affording an excision reaction analogous to the other chemical DNA sequencing reactions. Adenine residues methylated at the exocyclic amine (N6) react with lower efficiency than unmethylated adenine in an identical sequence. This simple protocol specific for A may be a useful addition to current chemical sequencing reactions. Images PMID:3671067
New strategy to address DNA-methyl transferase activity in ovarian cancer cell cultures by monitoring the formation of 5-methylcytosine using HPLC-UV.

PubMed

Iglesias González, T; Blanco-González, E; Montes-Bayón, M

2016-08-15

Methylation of mammalian genomic DNA is catalyzed by DNA methyltransferases (DNMTs). Aberrant expression and activity of these enzymes has been reported to play an important role in the initiation and progression of tumors and its response to chemotherapy. Therefore, there is a great interest in developing strategies to detect human DNMTs activity. We propose a simple, antibody-free, label-free and non-radioactive analytical strategy in which methyltransferase activity is measured trough the determination of the 5-methylcytosine (5mC) content in DNA by a chromatographic method (HPLC-UV) previously developed. For this aim, a correlation between the enzyme activity and the concentration of 5mC obtained by HPLC-UV is previously obtained under optimized conditions using both, un-methylated and hemi-methylated DNA substrates and the prokaryotic methyltransferase M.SssI as model enzyme. The evaluation of the methylation yield in un-methylated known sequences (a 623bp PCR-amplicon) turned to be quantitative (110%) in experiments conducted in-vitro. Methylation of hemi-methylated and low-methylated sequences could be also detected with the proposed approach. The application of the methodology to the determination of the DNMTs activity in nuclear extracts from human ovarian cancer cells has revealed the presence of matrix effects (also confirmed by standard additions) that hampered quantitative enzyme recovery. The obtained results showed the high importance of adequate sample clean-up steps. Copyright © 2016. Published by Elsevier B.V.
Electroanalytical study of proflavine intercalation in 5-methyl or inosine-containing amplicons.

PubMed

Alexiadou, Despina K; Ioannou, Andrea K; Kouidou-Andreou, Sofia A; Voulgaropoulos, Anastasios N; Girousi, Stella Th

2008-10-01

Amplicons corresponding to the GC-rich p53 exon 5 and its analogues, synthesized by substituting 60% of cytosine by 5-methyl-cytosine, or 60% of guanosine by inosine and GC-poor p53 exon 6 were synthesized and investigated electrochemically, in the presence and absence of proflavine, by differential pulse voltammetry (DPV). Incorporation of base analogues and the thermal stability of the resulting amplicons were tested in the presence of a fluorescent probe (Sybr-Green). Peak current at 1.0 V was lower for methylated than for unmethylated PCR amplicons and was similarly affected by proflavine intercalation. In contrast, considerable peak current differences were observed in the presence of proflavine for unmodified exon 5 v.s. exon 6 or inosine-containing amplicons. Thermal analysis verified the expected shifts in melting temperature (T (m)) due to the base analogue incorporation and GC-content variations. In conclusion, methylated and unmethylated PCR amplicons could be distinguished in model DNA systems using differential pulse voltammetry (DPV) and use of proflavine could serve as an electrochemical probe for identifying different DNA conformations.
Development of Assays for Detecting Significant Prostate Cancer Based on Molecular Alterations Associated with Cancer in Non-Neoplastic Prostate Tissue

DTIC Science & Technology

2014-10-01

in rare cells. Also, we tested several methods for multiplex analyses of transcriptome and DNA methylation changes. Further, we have secured...11 4 Introduction: Each year in the U.S. more than a million men with an elevated serum PSA or abnormal digital rectal exam...selective enrichment of un-methylated DNA, a phenomena which has long been recognized as ‘ PCR bias’ 6. We proposed a simple modification to the RRBS
A framework linkage map of perennial ryegrass based on SSR markers

Treesearch

G.P. Gill; P.L. Wilcox; D.J. Whittaker; R.A. Winz; P. Bickerstaff; Craig E. Echt; J. Kent; M.O. Humphreys; K.M. Elborough; R.C. Gardner

2006-01-01

A moderate-density linkage map for Lolium perenne L. has been constructed based on 376 simple sequence repeat (SSR) markers. Approximately one third ( 124) of the SSR markers were developed from GeneThresher libraries that preferentially select genomic DNA clones from the gene-rich unmethylated portion of the genome. The remaining SSR marker loci...
Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
O6-methylguanine-DNA methyltransferase activity is associated with response to alkylating agent therapy and with MGMT promoter methylation in glioblastoma and anaplastic glioma

PubMed Central

Bobola, Michael S.; Alnoor, Mohammad; Chen, John Y.-S.; Kolstoe, Douglas D.; Silbergeld, Daniel L.; Rostomily, Robert C.; Blank, A.; Chamberlain, Marc C.; Silber, John R.

2014-01-01

Background CpG methylation in the O6-methylguanine-DNA methyltransferase (MGMT) promoter is associated with better outcome following alkylating agent chemotherapy in glioblastoma (GBM) and anaplastic glioma (AG). To what extent improved response reflects low or absent MGMT activity in glioma tissue has not been unequivocally assessed. This information is central to developing anti-resistance therapies. Methods We examined the relationship of MGMT activity in 91 GBMs and 84 AGs with progression-free survival (PFS) following alkylator therapy and with promoter methylation status determined by methylation-specific PCR (MSP). Results Cox regression analysis revealed that GBMs with high activity had a significantly greater risk for progression in dichotomous (P ≤ 0.001) and continuous (P ≤ 0.003) models, an association observed for different alkylator regimens, including concurrent chemo-radiation with temozolomide. Analysis of MGMT promoter methylation status in 47 of the GBMs revealed that methylated tumors had significantly lower activity (P ≤ 0.005) and longer PFS (P ≤ 0.036) compared to unmethylated tumors, despite overlapping activities. PFS was also significantly greater in methylated vs. unmethylated GBMs with comparable activity (P ≤ 0.005), and among unmethylated tumors with less than median activity (P ≤ 0.026), suggesting that mechanisms in addition to MGMT promote alkylator resistance. Similar associations of MGMT activity with PFS and promoter methylation status were observed for AGs. Conclusions Our results provide strong support for the hypotheses that MGMT activity promotes alkylator resistance and reflects promoter methylation status in malignant gliomas. General significance MGMT activity is an attractive target for anti-resistance therapy regardless of methylation status. PMID:25558448

Disturbance of DNA methylation patterns in the early phase of hepatocarcinogenesis induced by a choline-deficient L-amino acid-defined diet in rats.

PubMed

Shimizu, Kyoko; Onishi, Mariko; Sugata, Eriko; Sokuza, Yui; Mori, Chiharu; Nishikawa, Tomoki; Honoki, Kanya; Tsujiuchi, Toshifumi

2007-09-01

The authors investigated the DNA methylation patterns of the E-cadherin, Connexin 26 (Cx26), Rassf1a and c-fos genes in the early phase of rat hepatocarcinogenesis induced by a choline-deficient L-amino acid-defined (CDAA) diet. Six-week-old F344 male rats were continuously fed with the CDAA diet, and three animals were then killed at each of 4 and 8 days and 3 weeks. Genomic DNA was extracted from livers for assessment of methylation status in the 5' upstream regions of E-cadherin, Cx26, Rassf1a and c-fos genes by bisulfite sequencing, compared with normal livers. The livers of rats fed the CDAA diet for 4 and 8 days and 3 weeks were methylated in E-cadherin, Cx26 and Rassf1a genes, while normal livers were all unmethylated. In contrast, normal livers were highly methylated in c-fos gene. Although the livers at 4 days were weakly methylated, those at 8 days and 3 weeks were markedly unmethylated. Methylation patterns of CpG sites in E-cadherin, Cx26 and Rassf1a were sparse and the methylation was not associated with gene repression. These results indicate that gene-specific DNA methylation patterns were found in livers of rats after short-term feeding of the CDAA diet, suggesting gene-specific hypermethylation might be involved in the early phase of rat hepatocarcinogenesis induced by the CDAA diet.
Mapping of Variable DNA Methylation Across Multiple Cell Types Defines a Dynamic Regulatory Landscape of the Human Genome.

PubMed

Gu, Junchen; Stevens, Michael; Xing, Xiaoyun; Li, Daofeng; Zhang, Bo; Payton, Jacqueline E; Oltz, Eugene M; Jarvis, James N; Jiang, Kaiyu; Cicero, Theodore; Costello, Joseph F; Wang, Ting

2016-04-07

DNA methylation is an important epigenetic modification involved in many biological processes and diseases. Many studies have mapped DNA methylation changes associated with embryogenesis, cell differentiation, and cancer at a genome-wide scale. Our understanding of genome-wide DNA methylation changes in a developmental or disease-related context has been steadily growing. However, the investigation of which CpGs are variably methylated in different normal cell or tissue types is still limited. Here, we present an in-depth analysis of 54 single-CpG-resolution DNA methylomes of normal human cell types by integrating high-throughput sequencing-based methylation data. We found that the ratio of methylated to unmethylated CpGs is relatively constant regardless of cell type. However, which CpGs made up the unmethylated complement was cell-type specific. We categorized the 26,000,000 human autosomal CpGs based on their methylation levels across multiple cell types to identify variably methylated CpGs and found that 22.6% exhibited variable DNA methylation. These variably methylated CpGs formed 660,000 variably methylated regions (VMRs), encompassing 11% of the genome. By integrating a multitude of genomic data, we found that VMRs enrich for histone modifications indicative of enhancers, suggesting their role as regulatory elements marking cell type specificity. VMRs enriched for transcription factor binding sites in a tissue-dependent manner. Importantly, they enriched for GWAS variants, suggesting that VMRs could potentially be implicated in disease and complex traits. Taken together, our results highlight the link between CpG methylation variation, genetic variation, and disease risk for many human cell types. Copyright © 2016 Gu et al.
BACTERIAL DNA OR OLIGONUCLEOTIDES CONTAINING UNMETHYLATED CPG MOTIFS CAN MINIMIZE LPS-INDUCED INFLAMMATION IN THE LOWER RESPIRATORY TRACT THROUGH AN IL-12 DEPENDENT PATHWAY. (R826711C001,R826711C002)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
MGMT inactivation and clinical response in newly diagnosed GBM patients treated with Gliadel.

PubMed

Grossman, Rachel; Burger, Peter; Soudry, Ethan; Tyler, Betty; Chaichana, Kaisorn L; Weingart, Jon; Olivi, Alessandro; Gallia, Gary L; Sidransky, David; Quiñones-Hinojosa, Alfredo; Ye, Xiaobu; Brem, Henry

2015-12-01

We examined the relationship between the O(6)-methylguanine-methyltransferase (MGMT) methylation status and clinical outcomes in newly diagnosed glioblastoma multiforme (GBM) patients who were treated with Gliadel wafers (Eisai, Tokyo, Japan). MGMT promoter methylation has been associated with increased survival among patients with GBM who are treated with various alkylating agents. MGMT promoter methylation, in DNA from 122 of 160 newly diagnosed GBM patients treated with Gliadel, was determined by a quantitative methylation-specific polymerase chain reaction, and was correlated with overall survival (OS) and recurrence-free survival (RFS). The MGMT promoter was methylated in 40 (32.7%) of 122 patients. The median OS was 13.5 months (95% confidence interval [CI] 11.0-14.5) and RFS was 9.4 months (95% CI 7.8-10.2). After adjusting for age, Karnofsky performance score, extent of resection, temozolomide (TMZ) and radiation therapy (RT), the newly diagnosed GBM patients with MGMT methylation had a 15% reduced mortality risk, compared to patients with unmethylated MGMT (hazard ratio 0.85; 95% CI 0.56-1.31; p=0.46). The patients aged over 70 years with MGMT methylation had a significantly longer median OS of 13.5 months, compared to 7.6 months in patients with unmethylated MGMT (p=0.027). A significant difference was also found in older patients, with a median RFS of 13.1 versus 7.6 months for methylated and unmethylated MGMT groups, respectively (p=0.01). Methylation of the MGMT promoter in newly diagnosed GBM patients treated with Gliadel, RT and TMZ, was associated with significantly improved OS compared to the unmethylated population. In elderly patients, methylation of the MGMT promoter was associated with significantly better OS and RFS. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing

PubMed Central

Leontiou, Chrysanthia A.; Hadjidaniel, Michael D.; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C.

2015-01-01

Introduction Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Methods Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. Results The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Conclusion Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed. Finally, we showed that bisulfite amplicon sequencing is a suitable approach for methylation analysis of targeted regions. PMID:26247357
Bisulfite Conversion of DNA: Performance Comparison of Different Kits and Methylation Quantitation of Epigenetic Biomarkers that Have the Potential to Be Used in Non-Invasive Prenatal Testing.

PubMed

Leontiou, Chrysanthia A; Hadjidaniel, Michael D; Mina, Petros; Antoniou, Pavlos; Ioannides, Marios; Patsalis, Philippos C

2015-01-01

Epigenetic alterations, including DNA methylation, play an important role in the regulation of gene expression. Several methods exist for evaluating DNA methylation, but bisulfite sequencing remains the gold standard by which base-pair resolution of CpG methylation is achieved. The challenge of the method is that the desired outcome (conversion of unmethylated cytosines) positively correlates with the undesired side effects (DNA degradation and inappropriate conversion), thus several commercial kits try to adjust a balance between the two. The aim of this study was to compare the performance of four bisulfite conversion kits [Premium Bisulfite kit (Diagenode), EpiTect Bisulfite kit (Qiagen), MethylEdge Bisulfite Conversion System (Promega) and BisulFlash DNA Modification kit (Epigentek)] regarding conversion efficiency, DNA degradation and conversion specificity. Performance was tested by combining fully methylated and fully unmethylated λ-DNA controls in a series of spikes by means of Sanger sequencing (0%, 25%, 50% and 100% methylated spikes) and Next-Generation Sequencing (0%, 3%, 5%, 7%, 10%, 25%, 50% and 100% methylated spikes). We also studied the methylation status of two of our previously published differentially methylated regions (DMRs) at base resolution by using spikes of chorionic villus sample in whole blood. The kits studied showed different but comparable results regarding DNA degradation, conversion efficiency and conversion specificity. However, the best performance was observed with the MethylEdge Bisulfite Conversion System (Promega) followed by the Premium Bisulfite kit (Diagenode). The DMRs, EP6 and EP10, were confirmed to be hypermethylated in the CVS and hypomethylated in whole blood. Our findings indicate that the MethylEdge Bisulfite Conversion System (Promega) was shown to have the best performance among the kits. In addition, the methylation level of two of our DMRs, EP6 and EP10, was confirmed. Finally, we showed that bisulfite amplicon sequencing is a suitable approach for methylation analysis of targeted regions.
DNA Methylation of MMP9 Is Associated with High Levels of MMP-9 Messenger RNA in Periapical Inflammatory Lesions.

PubMed

Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago

2016-01-01

Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Non-invasive detection of human cardiomyocyte death using methylation patterns of circulating DNA.

PubMed

Zemmour, Hai; Planer, David; Magenheim, Judith; Moss, Joshua; Neiman, Daniel; Gilon, Dan; Korach, Amit; Glaser, Benjamin; Shemer, Ruth; Landesberg, Giora; Dor, Yuval

2018-04-24

Detection of cardiomyocyte death is crucial for the diagnosis and treatment of heart disease. Here we use comparative methylome analysis to identify genomic loci that are unmethylated specifically in cardiomyocytes, and develop these as biomarkers to quantify cardiomyocyte DNA in circulating cell-free DNA (cfDNA) derived from dying cells. Plasma of healthy individuals contains essentially no cardiomyocyte cfDNA, consistent with minimal cardiac turnover. Patients with acute ST-elevation myocardial infarction show a robust cardiac cfDNA signal that correlates with levels of troponin and creatine phosphokinase (CPK), including the expected elevation-decay dynamics following coronary angioplasty. Patients with sepsis have high cardiac cfDNA concentrations that strongly predict mortality, suggesting a major role of cardiomyocyte death in mortality from sepsis. A cfDNA biomarker for cardiomyocyte death may find utility in diagnosis and monitoring of cardiac pathologies and in the study of normal human cardiac physiology and development.
Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer

PubMed Central

Bosch, Linda J.W.; Coupé, Veerle M.H.; Mongera, Sandra; Haan, Josien C.; Richman, Susan D.; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C.T.; Ylstra, Bauke; Verheul, Henk M.W.; van Engeland, Manon; Nagtegaal, Iris D.; Herman, James G.; Quirke, Philip; Seymour, Matthew T.; Punt, Cornelis J.A.; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A.

2017-01-01

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 (DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p=0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p=0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p=0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p=0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1: HR=0.7 (95%CI 0.5-0.9, p=0.01), unmethylated DCR1: HR=0.8 (95%CI 0.6-1.2, p=0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials. PMID:28968978
Decoy receptor 1 (DCR1) promoter hypermethylation and response to irinotecan in metastatic colorectal cancer.

PubMed

Bosch, Linda J W; Trooskens, Geert; Snaebjornsson, Petur; Coupé, Veerle M H; Mongera, Sandra; Haan, Josien C; Richman, Susan D; Koopman, Miriam; Tol, Jolien; de Meyer, Tim; Louwagie, Joost; Dehaspe, Luc; van Grieken, Nicole C T; Ylstra, Bauke; Verheul, Henk M W; van Engeland, Manon; Nagtegaal, Iris D; Herman, James G; Quirke, Philip; Seymour, Matthew T; Punt, Cornelis J A; van Criekinge, Wim; Carvalho, Beatriz; Meijer, Gerrit A

2017-09-08

Diversity in colorectal cancer biology is associated with variable responses to standard chemotherapy. We aimed to identify and validate DNA hypermethylated genes as predictive biomarkers for irinotecan treatment of metastatic CRC patients. Candidate genes were selected from 389 genes involved in DNA Damage Repair by correlation analyses between gene methylation status and drug response in 32 cell lines. A large series of samples (n=818) from two phase III clinical trials was used to evaluate these candidate genes by correlating methylation status to progression-free survival after treatment with first-line single-agent fluorouracil (Capecitabine or 5-fluorouracil) or combination chemotherapy (Capecitabine or 5-fluorouracil plus irinotecan (CAPIRI/FOLFIRI)). In the discovery (n=185) and initial validation set (n=166), patients with methylated Decoy Receptor 1 ( DCR1) did not benefit from CAPIRI over Capecitabine treatment (discovery set: HR=1.2 (95%CI 0.7-1.9, p =0.6), validation set: HR=0.9 (95%CI 0.6-1.4, p =0.5)), whereas patients with unmethylated DCR1 did (discovery set: HR=0.4 (95%CI 0.3-0.6, p =0.00001), validation set: HR=0.5 (95%CI 0.3-0.7, p =0.0008)). These results could not be replicated in the external data set (n=467), where a similar effect size was found in patients with methylated and unmethylated DCR1 for FOLFIRI over 5FU treatment (methylated DCR1 : HR=0.7 (95%CI 0.5-0.9, p =0.01), unmethylated DCR1 : HR=0.8 (95%CI 0.6-1.2, p =0.4)). In conclusion, DCR1 promoter hypermethylation status is a potential predictive biomarker for response to treatment with irinotecan, when combined with capecitabine. This finding could not be replicated in an external validation set, in which irinotecan was combined with 5FU. These results underline the challenge and importance of extensive clinical evaluation of candidate biomarkers in multiple trials.
Boron neutron capture therapy for newly diagnosed glioblastoma multiforme: an assessment of clinical potential

PubMed Central

Sköld, K; Gorlia, T; Pellettieri, L; Giusti, V; H-Stenstam, B; Hopewell, J W

2010-01-01

The purpose of this study was to assess the potential of boron neutron capture therapy (BNCT), with a 6-h infusion of the boron carrier l-boronophenylalanine as a fructose preparation (BPA-f), as first-line radiotherapy for newly diagnosed glioblastoma multiforme (GBM). Patient survival data from a Phase II study using BNCT were compared with retrospective data from the two arms of a Phase III study using conventional radiotherapy (RT) in the reference arm and using RT plus concomitant and adjuvant medication with temozolomide (TMZ) in the experimental arm, and were also compared with small subgroups of these patients for whom the methylation status of the MGMT (O6-methylguanine–DNA methyltransferase) DNA repair gene was known. Differences in the baseline characteristics, salvage therapy after recurrence and levels of severe adverse events were also considered. The results indicate that BNCT offers a treatment that is at least as effective as conventional RT alone. For patients with an unmethylated MGMT DNA repair gene, a possible clinical advantage of BNCT over RT/TMZ was suggested. BNCT is a single-day treatment, which is of convenience to patients, with mild side effects, which would offer an initial 6 weeks of good-quality life during the time when patients would otherwise be undergoing daily treatments with RT and TMZ. It is suggested that the use of BNCT with a 6-h infusion of BPA-f should be explored in a stratified randomised Phase II trial in which patients with the unmethylated MGMT DNA repair gene are offered BNCT in the experimental arm and RT plus TMZ in the reference arm. PMID:20603410
Effects of cellular differentiation, chromosomal integration and 5-aza-2'-deoxycytidine treatment on human papillomavirus-16 DNA methylation in cultured cell lines.

PubMed

Kalantari, Mina; Lee, Denis; Calleja-Macias, Itzel E; Lambert, Paul F; Bernard, Hans-Ulrich

2008-05-10

Human papillomavirus-16 (HPV-16) genomes in cell culture and in situ are affected by polymorphic methylation patterns, which can repress the viral transcription. In order to understand some of the underlying mechanisms, we investigated changes of the methylation of HPV-16 DNA in cell cultures in response to cellular differentiation, to recombination with cellular DNA, and to an inhibitor of methylation. Undifferentiated W12E cells, derived from a precancerous lesion, contained extrachromosomal HPV-16 DNA with a sporadically methylated enhancer-promoter segment. Upon W12E cell differentiation, the viral DNA was demethylated, suggesting a link between differentiation and the epigenetic state of HPV-16 DNA. The viral genomes present in two W12I clones, in which individual copies of the HPV-16 genome have integrated into cellular DNA (type 1 integrants), were unmethylated, akin to that seen in the cervical carcinoma cell line SiHa (also a type 1 integrant). This finding is consistent with hypomethylation being necessary for continued viral gene expression. In contrast, two of three type 2 integrant W12I clones, containing concatemers of HPV-16 genomes integrated into the cellular DNA contained hypermethylated viral DNA, as observed in the cervical carcinoma cell line CaSki (also a type 2 integrant). A third, type 2, W12I clone, interestingly with fewer copies of the viral genome, contained unmethylated HPV-16 genomes. Epithelial differentiation of W12I clones did not lead to demethylation of chromosomally integrated viral genomes as was seen for extrachromosomal HPV-16 DNA in W12E clones. Hypomethylation of CaSki cells in the presence of the DNA methylation inhibitor 5-aza-2'-deoxycytidine reduced the cellular viability, possibly as a consequence of toxic effects of an excess of HPV-16 gene products. Our data support a model wherein (i) the DNA methylation state of extrachromosomal HPV16 replicons and epithelial differentiation are inversely coupled during the viral life cycle, (ii) integration of the viral genome into the host chromosome events leads to an alteration in methylation patterns on the viral genome that is dependent upon the type of integration event and possibly copy number, and (iii) integration universally results in the viral DNA becoming refractory to changes in methylation state upon cellular differentiation that are observed with extrachromosomal HPV-16 genomes.
Enhanced sampling simulations of DNA step parameters.

PubMed

Karolak, Aleksandra; van der Vaart, Arjan

2014-12-15

A novel approach for the selection of step parameters as reaction coordinates in enhanced sampling simulations of DNA is presented. The method uses three atoms per base and does not require coordinate overlays or idealized base pairs. This allowed for a highly efficient implementation of the calculation of all step parameters and their Cartesian derivatives in molecular dynamics simulations. Good correlation between the calculated and actual twist, roll, tilt, shift, and slide parameters is obtained, while the correlation with rise is modest. The method is illustrated by its application to the methylated and unmethylated 5'-CATGTGACGTCACATG-3' double stranded DNA sequence. One-dimensional umbrella simulations indicate that the flexibility of the central CG step is only marginally affected by methylation. © 2014 Wiley Periodicals, Inc.
Effects of low-dose aspirin on maternal blood pressure and vascular function in an experimental model of gestational hypertension.

PubMed

Osikoya, Oluwatobiloba; Jaini, Paresh A; Nguyen, An; Valdes, Melissa; Goulopoulou, Styliani

2017-06-01

Daily intake of low-dose aspirin after 12weeks of gestation is currently recommended as a preventative intervention in pregnancies in high risk of developing preeclampsia. This recommendation is based on epidemiological evidence, whereas experimental studies investigating the exact mechanisms of aspirin action during pregnancy are lacking. We previously showed that treating pregnant rats with a synthetic mimetic of unmethylated CpG DNA (bacterial DNA) caused preeclampsia-like characteristics such as maternal hypertension and increased cyclooxygenase (COX) expression and activity. In this study, we tested the hypothesis that daily maternal treatment with low-dose aspirin would prevent the development of maternal hypertension, reduce COX activity and thromboxane A 2 (TxA 2 ) production, and improve maternal vascular function in pregnant rats exposed to CpG ODN during gestation. Pregnant rats were treated with ODN2395 (synthetic CpG DNA) or saline (vehicle) on gestational days (GD) 14, 16, 18. Daily low-dose aspirin treatment (1.5mg/kgBW) started on GD10 and continued throughout gestation. Pregnant rats treated with ODN2395 had greater systolic blood pressure compared to controls (120±4mmHg vs. 100±5mmHg, p=0.03) and aspirin did not prevent this increase (p=0.86). Aspirin prevented ODN2395-induced increases of TxB 2 (TxA 2 metabolite) in serum and mesenteric arteries. ODN2395 increased expression of COX-1 and COX-2 in mesenteric and uterine arteries and aspirin abolished these effects. Aspirin reduced contractile responses to phenylephrine and U46619 (TxA 2 mimetic) in mesenteric arteries from control rats but not from ODN2395-treated rats. In conclusion, treatment with low-dose aspirin reduced systemic and vascular COX expression and activity but did not prevent the development of maternal hypertension induced by exposure to unmethylated CpG DNA (bacterial DNA). Copyright © 2017 Elsevier Ltd. All rights reserved.
Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069
A highly efficient transposon mutagenesis system for the tomato pathogen Clavibacter michiganensis subsp. michiganensis.

PubMed

Kirchner, O; Gartemann, K H; Zellermann, E M; Eichenlaub, R; Burger, A

2001-11-01

A transposon mutagenesis system for Clavibacter michiganensis subsp. michiganensis was developed based on antibiotic resistance transposons that were derived from the insertion element IS1409 from Arthrobacter sp. strain TM1 NCIB12013. As a prerequisite, the electroporation efficiency was optimized by using unmethylated DNA and treatment of the cells with glycine such that about 5 x 10(6) transformants per microg of DNA were generally obtained. Electroporation of C. michiganensis subsp. michiganensis with a suicide vector carrying transposon Tn1409C resulted in approximately 1 x 10(3) transposon mutants per pg of DNA and thus is suitable for saturation mutagenesis. Analysis of Tn1409C insertion sites suggests a random mode of transposition. Transposition of Tn1409C was also demonstrated for other subspecies of C. michiganensis.
Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

PubMed

Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

2018-05-01

The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.
Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Predicting Breast Cancer Risk by Assaying Peripheral Blood Methylation. Addendum

DTIC Science & Technology

2007-10-01

tumor suppressor genes such as the cell cycle inhibitor p16INK4a , the DNA repair genes BRCA1, MLH1 , and MGMT , and the p53 regulator p14ARF , has been... MLH1 . Int J Cancer 2007;120:1684–8. Chong S, Youngson NA,Whitelaw E. Heritable germline epimutation is not the same as transgenerational epigenetic...hypermethylation of the MLH1 gene in normal tissue and loss of heterozygosity of the unmethylated allele in the resulting microsatellite instability-high tumor
Cancer Vaccine Composed of Oligonucleotides Conjugated to Apoptotic Tumor Cells | NCI Technology Transfer Center | TTC

Cancer.gov

Synthetic oligodeoxynucleotides (ODN) containing unmethylated Cytosine-Guanine (CpG) motifs mimic the immunostimulatory activity of bacterial DNA. CpG ODN directly stimulate B cells and plasmacytoid dendritic cells (pDC), promote the production of T Helper 1 cells (Th1) and pro-inflammatory cytokines, and trigger the maturation/activation of professional antigen presenting cells. The National Cancer Institute, Laboratory of Experimental Immunology, seeks interested parties to co- develop methods for inducing an immune response to tumors.

Direct detection of methylation in genomic DNA

PubMed Central

Bart, A.; van Passel, M. W. J.; van Amsterdam, K.; van der Ende, A.

2005-01-01

The identification of methylated sites on bacterial genomic DNA would be a useful tool to study the major roles of DNA methylation in prokaryotes: distinction of self and nonself DNA, direction of post-replicative mismatch repair, control of DNA replication and cell cycle, and regulation of gene expression. Three types of methylated nucleobases are known: N6-methyladenine, 5-methylcytosine and N4-methylcytosine. The aim of this study was to develop a method to detect all three types of DNA methylation in complete genomic DNA. It was previously shown that N6-methyladenine and 5-methylcytosine in plasmid and viral DNA can be detected by intersequence trace comparison of methylated and unmethylated DNA. We extended this method to include N4-methylcytosine detection in both in vitro and in vivo methylated DNA. Furthermore, application of intersequence trace comparison was extended to bacterial genomic DNA. Finally, we present evidence that intrasequence comparison suffices to detect methylated sites in genomic DNA. In conclusion, we present a method to detect all three natural types of DNA methylation in bacterial genomic DNA. This provides the possibility to define the complete methylome of any prokaryote. PMID:16091626
CNG site-specific and methyl-sensitive endonuclease WEN1 from wheat seedlings.

PubMed

Fedoreyeva, L I; Vanyushin, B F

2011-06-01

Endonuclease WEN1 with apparent molecular mass about 27 kDa isolated from cytoplasmic vesicular fraction of aging coleoptiles of wheat seedlings has expressed site specificity action. This is a first detection and isolation of a site-specific endonuclease from higher eukaryotes, in general, and higher plants, in particular. The enzyme hydrolyzes deoxyribooligonucleotides of different composition on CNG (N is G, A, C, or T) sites by splitting the phosphodiester bond between C and N nucleotide residues in CNG sequence independent from neighbor nucleotide context except for CCCG. WEN1 prefers to hydrolyze methylated λ phage DNA and double-stranded deoxyribooligonucleotides containing 5-methylcytosine sites (m(5)CAG, m(5)CTG) compared with unmethylated substrates. The enzyme is also able to hydrolyze single-stranded substrates, but in this case it splits unmethylated substrates predominantly. Detection in wheat seedlings of WEN1 endonuclease that is site specific, sensitive to the substrate methylation status, and modulated with S-adenosyl-L-methionine indicates that in higher plants restriction--modification systems or some of their elements, at least, may exist.
Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.
FRAXE mutation analysis in three Spanish families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, P.; Lopez, I.; Gabarron, J.

Very little is known about the phenotype of FRAXE-positive individuals and the relation between the genotype/phenotype and genotype/cytogenetic expression. We describe three families with normal and mildly affected individuals and a severely retarded male expressing fragility at the FRAXE locus or presenting different expansions at the CGG FRAXE triplet. In addition, we analyze the FRAXE mutation in sperm DNA from a retarded male carrier with a handicapped daughter expressing fragility at the FRAXE locus. Mental status in FRAXE individuals is highly variable and, although mild mental retardation is observed in most cases, several carrier males are apparently normal. It seemsmore » that methylation is not as strictly associated with size of CGG triplets in the FRAXE locus as in FRAXA, and it is possible that normal carrier individuals with fully methylated increments in lymphocytes have a certain proportion of unmethylated alleles in the critical (i.e., neural) tissues. FRAXE mutation is apparently similar to FRAXA in that males with somatic large methylated increments are carriers of small unmethylated ones in germinal cells. 12 refs., 2 figs., 1 tab.« less
Predictive value of CHFR and MLH1 methylation in human gastric cancer.

PubMed

Li, Yazhuo; Yang, Yunsheng; Lu, Youyong; Herman, James G; Brock, Malcolm V; Zhao, Po; Guo, Mingzhou

2015-04-01

Gastric carcinoma (GC) has one of the highest mortality rates of cancer diseases and has a high incidence rate in China. Palliative chemotherapy is the main treatment for advanced gastric cancer. It is necessary to compare the effectiveness and toxicities of different regimens. This study explores the possibility of methylation of DNA damage repair genes serving as a prognostic and chemo-sensitive marker in human gastric cancer. The methylation status of five DNA damage repair genes (CHFR, FANCF, MGMT, MLH1, and RASSF1A) was detected by nested methylation-specific PCR in 102 paraffin-embedded gastric cancer samples. Chi-square or Fisher's exact tests were used to evaluate the association of methylation status and clinic-pathological factors. The Kaplan-Meier method and Cox proportional hazards models were employed to analyze the association of methylation status and chemo-sensitivity. The results indicate that CHFR, MLH1, RASSF1A, MGMT, and FANCF were methylated in 34.3% (35/102), 21.6% (22/102), 12.7% (13/102), 9.8% (10/102), and 0% (0/102) of samples, respectively. No association was found between methylation of CHFR, MLH1, RASSF1A, MGMT, or FANCF with gender, age, tumor size, tumor differentiation, lymph node metastasis, and TNM stage. In docetaxel-treated gastric cancer patients, resistance to docetaxel was found in CHFR unmethylated patients by Cox proportional hazards model (HR 0.243, 95% CI, 0.069-0.859, p = 0.028), and overall survival is longer in the CHFR methylated group compared with the CHFR unmethylated group (log-rank, p = 0.036). In oxaliplatin-treated gastric cancer patients, resistance to oxaliplatin was found in MLH1 methylated patients (HR 2.988, 95% CI, 1.064-8.394, p = 0.038), and overall survival was longer in the MLH1 unmethylated group compared with the MLH1 methylated group (log-rank, p = 0.046). CHFR is frequently methylated in human gastric cancer, and CHFR methylation may serve as a docetaxel-sensitive marker. MLH1 methylation was related to oxaliplatin resistance in gastric cancer patients.
Methylation of DNA

PubMed Central

Gold, Marvin; Gefter, Malcolm; Hausmann, Rudolph; Hurwitz, Jerard

1966-01-01

The methylated bases of DNA are formed by the transfer of the methyl group from S-adenosylmethionine to a polynucleotide acceptor. This transfer is catalyzed by highly specific enzymes which recognize a limited number of available sites in the DNA. The mechanism for the recognition is presently unknown. In some instances, there is evidence that other cellular components, such as lipopolysaccharides, can influence the methylation reaction. Certain bacteriophages induce new methylases upon infection of their hosts. Phage T3 is unique in establishing an environment in which methylation of neither the phage nor the host nucleic acid can occur. By superinfecting T3-infected cells with other phages, the latter can be obtained with methyl-deficient DNA. Although a great deal is known about the enzymology of the methylation reaction, and there appears to be a strong correlation between the in vitro and in vivo reactions, studies in which DNA is either supermethylated or totally unmethylated have not yielded any insight as to what the possible function of the methylated bases may be. PMID:5338563
CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.
Sequestration by IFIT1 Impairs Translation of 2′O-unmethylated Capped RNA

PubMed Central

Lacerda, Livia; Benda, Christian; Holze, Cathleen; Eberl, Christian H.; Mann, Angelika; Kindler, Eveline; Gil-Cruz, Cristina; Ziebuhr, John; Thiel, Volker; Pichlmair, Andreas

2013-01-01

Viruses that generate capped RNA lacking 2′O methylation on the first ribose are severely affected by the antiviral activity of Type I interferons. We used proteome-wide affinity purification coupled to mass spectrometry to identify human and mouse proteins specifically binding to capped RNA with different methylation states. This analysis, complemented with functional validation experiments, revealed that IFIT1 is the sole interferon-induced protein displaying higher affinity for unmethylated than for methylated capped RNA. IFIT1 tethers a species-specific protein complex consisting of other IFITs to RNA. Pulsed stable isotope labelling with amino acids in cell culture coupled to mass spectrometry as well as in vitro competition assays indicate that IFIT1 sequesters 2′O-unmethylated capped RNA and thereby impairs binding of eukaryotic translation initiation factors to 2′O-unmethylated RNA template, which results in inhibition of translation. The specificity of IFIT1 for 2′O-unmethylated RNA serves as potent antiviral mechanism against viruses lacking 2′O-methyltransferase activity and at the same time allows unperturbed progression of the antiviral program in infected cells. PMID:24098121
A two-dimensional 1H-NMR study of the dam methylase site: comparison between the hemimethylated GATC sequence, its unmethylated analogue and a hemimethylated CATG sequence. The sequence dependence of methylation upon base-pair lifetimes.

PubMed

Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W

1987-09-15

We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.
Diethylstilbestrol (DES)-stimulated hormonal toxicity is mediated by ERα alteration of target gene methylation patterns and epigenetic modifiers (DNMT3A, MBD2, and HDAC2) in the mouse seminal vesicle.

PubMed

Li, Yin; Hamilton, Katherine J; Lai, Anne Y; Burns, Katherine A; Li, Leping; Wade, Paul A; Korach, Kenneth S

2014-03-01

Diethylstilbestrol (DES) is a synthetic estrogen associated with adverse effects on reproductive organs. DES-induced toxicity of the mouse seminal vesicle (SV) is mediated by estrogen receptor α (ERα), which alters expression of seminal vesicle secretory protein IV (Svs4) and lactoferrin (Ltf) genes. We examined a role for nuclear receptor activity in association with DNA methylation and altered gene expression. We used the neonatal DES exposure mouse model to examine DNA methylation patterns via bisulfite conversion sequencing in SVs of wild-type (WT) and ERα-knockout (αERKO) mice. The DNA methylation status at four specific CpGs (-160, -237, -306, and -367) in the Svs4 gene promoter changed during mouse development from methylated to unmethylated, and DES prevented this change at 10 weeks of age in WT SV. At two specific CpGs (-449 and -459) of the Ltf gene promoter, DES altered the methylation status from methylated to unmethylated. Alterations in DNA methylation of Svs4 and Ltf were not observed in αERKO SVs, suggesting that changes of methylation status at these CpGs are ERα dependent. The methylation status was associated with the level of gene expression. In addition, gene expression of three epigenetic modifiers-DNMT3A, MBD2, and HDAC2-increased in the SV of DES-exposed WT mice. DES-induced hormonal toxicity resulted from altered gene expression of Svs4 and Ltf associated with changes in DNA methylation that were mediated by ERα. Alterations in gene expression of DNMT3A, MBD2, and HDAC2 in DES-exposed male mice may be involved in mediating the changes in methylation status in the SV. Li Y, Hamilton KJ, Lai AY, Burns KA, Li L, Wade PA, Korach KS. 2014. Diethylstilbestrol (DES)-stimulated hormonal toxicity is mediated by ERα alteration of target gene methylation patterns and epigenetic modifiers (DNMT3A, MBD2, and HDAC2) in the mouse seminal vesicle. Environ Health Perspect 122:262-268; http://dx.doi.org/10.1289/ehp.1307351.
Novel Multiplex MethyLight Protocol for Detection of DNA Methylation in Patient Tissues and Bodily Fluids

PubMed Central

Olkhov-Mitsel, Ekaterina; Zdravic, Darko; Kron, Ken; van der Kwast, Theodorus; Fleshner, Neil; Bapat, Bharati

2014-01-01

Aberrant DNA methylation is a hallmark of cancer and is an important potential biomarker. Particularly, combined analysis of a panel of hypermethylated genes shows the most promising clinical performance. Herein, we developed, optimized and standardized a multiplex MethyLight assay to simultaneously detect hypermethylation of APC, HOXD3 and TGFB2 in DNA extracted from prostate cancer (PCa) cell lines, archival tissue specimens, and urine samples. We established that the assay is capable of discriminating between fully methylated and unmethylated alleles with 100% specificity and demonstrated the assay as highly accurate and reproducible as the singleplex approach. For proof of principle, we analyzed the methylation status of these genes in tissue and urine samples of PCa patients as well as PCa-free controls. These data show that the multiplex MethyLight assay offers a significant advantage when working with limited quantities of DNA and has potential applications in research and clinical settings. PMID:24651255
Retardation of Antigen Release from DNA Hydrogel Using Cholesterol-Modified DNA for Increased Antigen-Specific Immune Response.

PubMed

Umeki, Yuka; Saito, Masaaki; Takahashi, Yuki; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-01

Our previous study indicates that cationization of an antigen is effective for sustained release of both immunostimulatory DNA containing unmethylated cytosine-phosphate-guanine (CpG) dinucleotides, or CpG DNA, and antigen from a DNA hydrogel. Another approach to sustained antigen release would increase the applicability and versatility of the system. In this study, a hydrophobic interaction-based sustained release system of ovalbumin (OVA), a model antigen, from immunostimulatory CpG DNA hydrogel is developed by the use of cholesterol-modified DNA and urea-denatured OVA (udOVA). Cholesterol-modified DNA forms a hydrogel, Dgel(chol), and induces IL-6 mRNA expression in mouse skin after intradermal injection, as DNA without cholesterol does. Cholesterol-modified DNA associated with OVA and denaturation of OVA using urea increases the interaction. The release of udOVA from Dgel(chol) is significantly slower than that from DNA hydrogel with no cholesterol, Dgel. Moreover, intratumoral injections of udOVA/Dgel(chol) significantly inhibit the growth of EG7-OVA tumors in mice. These results indicate that sustained release of antigen from Dgel can be achieved by the combination of urea denaturation and cholesterol modification, and retardation of antigen release is effective to induce antigen-specific cancer immunity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Monitoring liver damage using hepatocyte-specific methylation markers in cell-free circulating DNA.

PubMed

Lehmann-Werman, Roni; Magenheim, Judith; Moss, Joshua; Neiman, Daniel; Abraham, Ofri; Piyanzin, Sheina; Zemmour, Hai; Fox, Ilana; Dor, Talya; Grompe, Markus; Landesberg, Giora; Loza, Bao-Li; Shaked, Abraham; Olthoff, Kim; Glaser, Benjamin; Shemer, Ruth; Dor, Yuval

2018-06-21

Liver damage is typically inferred from serum measurements of cytoplasmic liver enzymes. DNA molecules released from dying hepatocytes are an alternative biomarker, unexplored so far, potentially allowing for quantitative assessment of liver cell death. Here we describe a method for detecting acute hepatocyte death, based on quantification of circulating, cell-free DNA (cfDNA) fragments carrying hepatocyte-specific methylation patterns. We identified 3 genomic loci that are unmethylated specifically in hepatocytes, and used bisulfite conversion, PCR, and massively parallel sequencing to quantify the concentration of hepatocyte-derived DNA in mixed samples. Healthy donors had, on average, 30 hepatocyte genomes/ml plasma, reflective of basal cell turnover in the liver. We identified elevations of hepatocyte cfDNA in patients shortly after liver transplantation, during acute rejection of an established liver transplant, and also in healthy individuals after partial hepatectomy. Furthermore, patients with sepsis had high levels of hepatocyte cfDNA, which correlated with levels of liver enzymes aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Duchenne muscular dystrophy patients, in which elevated AST and ALT derive from damaged muscle rather than liver, did not have elevated hepatocyte cfDNA. We conclude that measurements of hepatocyte-derived cfDNA can provide specific and sensitive information on hepatocyte death, for monitoring human liver dynamics, disease, and toxicity.
Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

PubMed Central

Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

2017-01-01

ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978
The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.
Aberrant promoter hypermethylation of PBRM1, BAP1, SETD2, KDM6A and other chromatin-modifying genes is absent or rare in clear cell RCC

PubMed Central

Ibragimova, Ilsiya; Maradeo, Marie E.; Dulaimi, Essel; Cairns, Paul

2013-01-01

Recent sequencing studies of clear cell (conventional) renal cell carcinoma (ccRCC) have identified inactivating point mutations in the chromatin-modifying genes PBRM1, KDM6A/UTX, KDM5C/JARID1C, SETD2, MLL2 and BAP1. To investigate whether aberrant hypermethylation is a mechanism of inactivation of these tumor suppressor genes in ccRCC, we sequenced the promoter region within a bona fide CpG island of PBRM1, KDM6A, SETD2 and BAP1 in bisulfite-modified DNA of a representative series of 50 primary ccRCC, 4 normal renal parenchyma specimens and 5 RCC cell lines. We also interrogated the promoter methylation status of KDM5C and ARID1A in the Cancer Genome Atlas (TCGA) ccRCC Infinium data set. PBRM1, KDM6A, SETD2 and BAP1 were unmethylated in all tumor and normal specimens. KDM5C and ARID1A were unmethylated in the TCGA 219 ccRCC and 119 adjacent normal specimens. Aberrant promoter hypermethylation of PBRM1, BAP1 and the other chromatin-modifying genes examined here is therefore absent or rare in ccRCC. PMID:23644518
Methylation Pattern of Radish (Raphanus sativus) Nuclear Ribosomal RNA Genes 1

PubMed Central

Delseny, Michel; Laroche, Monique; Penon, Paul

1984-01-01

The methylation pattern of radish Raphanus sativus nuclear rDNA has been investigated using the Hpa II, Msp I, and Hha I restriction enzymes. The presence of numerous target sites for these enzymes has been shown using cloned rDNA fragments. A large fraction of the numerous rDNA units are heavily methylated, being completely resistant to Hpa II and Hpa I. However, specific sites are constantly available in another fraction of the units and are therefore unmethylated. The use of different probes allowed us to demonstrate that hypomethylated sites are present in different regions. Major hypomethylated Hha I sites have been mapped in the 5′ portion of 25S rRNA coding sequence. Among the hypomethylated fraction, different methylation patterns coexist. It has been possible to demonstrate that methylation patterns are specific for particular units. The Hha I pattern of rDNA in tissues of different developmental stages was analyzed. Evidence for possible tissue specific differences in the methylation pattern is reported. Images Fig. 2 Fig. 3 Fig. 5 PMID:16663896
Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

PubMed

Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

1997-08-01

Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.

PubMed

Cooper, D N; Errington, L H; Clayton, R M

1983-01-01

Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

PubMed

Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

2006-02-09

Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

PubMed

Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

2017-10-15

Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Type III restriction-modification enzymes: a historical perspective.

PubMed

Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

2014-01-01

Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.
Methylation-dependent DNA discrimination in natural transformation of Campylobacter jejuni

PubMed Central

Leveque, Rhiannon M.; Dawid, Suzanne; DiRita, Victor J.

2017-01-01

Campylobacter jejuni, a leading cause of bacterial gastroenteritis, is naturally competent. Like many competent organisms, C. jejuni restricts the DNA that can be used for transformation to minimize undesirable changes in the chromosome. Although C. jejuni can be transformed by C. jejuni-derived DNA, it is poorly transformed by the same DNA propagated in Escherichia coli or produced with PCR. Our work indicates that methylation plays an important role in marking DNA for transformation. We have identified a highly conserved DNA methyltransferase, which we term Campylobacter transformation system methyltransferase (ctsM), which methylates an overrepresented 6-bp sequence in the chromosome. DNA derived from a ctsM mutant transforms C. jejuni significantly less well than DNA derived from ctsM+ (parental) cells. The ctsM mutation itself does not affect transformation efficiency when parental DNA is used, suggesting that CtsM is important for marking transforming DNA, but not for transformation itself. The mutant has no growth defect, arguing against ongoing restriction of its own DNA. We further show that E. coli plasmid and PCR-derived DNA can efficiently transform C. jejuni when only a subset of the CtsM sites are methylated in vitro. A single methylation event 1 kb upstream of the DNA involved in homologous recombination is sufficient to transform C. jejuni, whereas otherwise identical unmethylated DNA is not. Methylation influences DNA uptake, with a slight effect also seen on DNA binding. This mechanism of DNA discrimination in C. jejuni is distinct from the DNA discrimination described in other competent bacteria. PMID:28855338
DNA methylation in amphioxus: from ancestral functions to new roles in vertebrates.

PubMed

Albalat, Ricard; Martí-Solans, Josep; Cañestro, Cristian

2012-03-01

In vertebrates, DNA methylation is an epigenetic mechanism that modulates gene transcription, and plays crucial roles during development, cell fate maintenance, germ cell pluripotency and inheritable genome imprinting. DNA methylation might also play a role as a genome defense mechanism against the mutational activity derived from transposon mobility. In contrast to the heavily methylated genomes in vertebrates, most genomes in invertebrates are poorly or just moderately methylated, and the function of DNA methylation remains unclear. Here, we review the DNA methylation system in the cephalochordate amphioxus, which belongs to the most basally divergent group of our own phylum, the chordates. First, surveys of the amphioxus genome database reveal the presence of the DNA methylation machinery, DNA methyltransferases and methyl-CpG-binding domain proteins. Second, comparative genomics and analyses of conserved synteny between amphioxus and vertebrates provide robust evidence that the DNA methylation machinery of amphioxus represents the ancestral toolkit of chordates, and that its expansion in vertebrates was originated by the two rounds of whole-genome duplication that occurred in stem vertebrates. Third, in silico analysis of CpGo/e ratios throughout the amphioxus genome suggests a bimodal distribution of DNA methylation, consistent with a mosaic pattern comprising domains of methylated DNA interspersed with domains of unmethylated DNA, similar to the situation described in ascidians, but radically different to the globally methylated vertebrate genomes. Finally, we discuss potential roles of the DNA methylation system in amphioxus in the context of chordate genome evolution and the origin of vertebrates.
Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins

PubMed Central

Kemme, Catherine A.; Marquez, Rolando; Luu, Ross H.

2017-01-01

Abstract Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. PMID:28486614
FXTAS in an unmethylated mosaic male with fragile X syndrome from Chile.

PubMed

Santa María, L; Pugin, A; Alliende, M A; Aliaga, S; Curotto, B; Aravena, T; Tang, H-T; Mendoza-Morales, G; Hagerman, R; Tassone, F

2014-10-01

Carriers of an FMR1 premutation allele (55-200 CGG repeats) often develop the neurodegenerative disorders, fragile X-associated tremor/ataxia syndrome (FXTAS). Neurological signs of FXTAS, parkinsonism and rapid onset of cognitive decline have not been reported in individuals with an unmethylated full mutation (FM). Here, we report a Chilean family affected with FXS, inherited from a parent carrier of an FMR1 unmethylated full mosaic allele, who presented with a fast progressing FXTAS. This case suggests that the definition of FXTAS may need to be broadened to not only include those with a premutation but also those with an expanded allele in FM range with a lack of methylation leading to elevated FMR1-mRNA expression levels and subsequent RNA toxicity. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

PubMed

Meyer, P; Heidmann, I

1994-05-25

We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.
Methylsorb: a simple method for quantifying DNA methylation using DNA-gold affinity interactions.

PubMed

Sina, Abu Ali Ibn; Carrascosa, Laura G; Palanisamy, Ramkumar; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

2014-10-21

The analysis of DNA methylation is becoming increasingly important both in the clinic and also as a research tool to unravel key epigenetic molecular mechanisms in biology. Current methodologies for the quantification of regional DNA methylation (i.e., the average methylation over a region of DNA in the genome) are largely affected by comprehensive DNA sequencing methodologies which tend to be expensive, tedious, and time-consuming for many applications. Herein, we report an alternative DNA methylation detection method referred to as "Methylsorb", which is based on the inherent affinity of DNA bases to the gold surface (i.e., the trend of the affinity interactions is adenine > cytosine ≥ guanine > thymine).1 Since the degree of gold-DNA affinity interaction is highly sequence dependent, it provides a new capability to detect DNA methylation by simply monitoring the relative adsorption of bisulfite treated DNA sequences onto a gold chip. Because the selective physical adsorption of DNA fragments to gold enable a direct read-out of regional DNA methylation, the current requirement for DNA sequencing is obviated. To demonstrate the utility of this method, we present data on the regional methylation status of two CpG clusters located in the EN1 and MIR200B genes in MCF7 and MDA-MB-231 cells. The methylation status of these regions was obtained from the change in relative mass on gold surface with respect to relative adsorption of an unmethylated DNA source and this was detected using surface plasmon resonance (SPR) in a label-free and real-time manner. We anticipate that the simplicity of this method, combined with the high level of accuracy for identifying the methylation status of cytosines in DNA, could find broad application in biology and diagnostics.
MGMT Gene Promoter Methylation as a Potent Prognostic Factor in Glioblastoma Treated With Temozolomide-Based Chemoradiotherapy: A Single-Institution Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Young Suk; Kim, Se Hoon; Cho, Jaeho

2012-11-01

Purpose: Recently, cells deficient in O{sup 6}-methylguanine-DNA methyltransferase (MGMT) were found to show increased sensitivity to temozolomide (TMZ). We evaluated whether hypermethylation of MGMT was associated with survival in patients with glioblastoma multiforme (GBM). Methods and Materials: We retrospectively analyzed 93 patients with histologically confirmed GBM who received involved-field radiotherapy with TMZ from 2001 to 2008. The median age was 58 years (range, 24-78 years). Surgical resection was total in 39 patients (42%), subtotal in 30 patients (32%), and partial in 17 patients (18%); only a biopsy was performed in 7 patients (8%). Postoperative radiotherapy began within 3 weeks ofmore » surgery in 87% of the patients. Radiotherapy doses ranged from 50 to 74 Gy (median, 70 Gy). MGMT gene methylation was determined in 78 patients; MGMT was unmethylated in 43 patients (55%) and methylated in 35 patients (45%). The median follow-up period was 22 months (range, 3-88 months) for all patients. Results: The median overall survival (OS) was 22 months, and progression-free survival (PFS) was 11 months. MGMT gene methylation was an independently significant prognostic factor for both OS (p = 0.002) and PFS (p = 0.008) in multivariate analysis. The median OS was 29 months for the methylated group and 20 months for the unmethylated group. In 35 patients with methylated MGMT genes, the 2-year and 5-year OS rates were 54% and 31%, respectively. Six patients with combined prognostic factors of methylated MGMT genes, age {<=}50 years, and total/subtotal resections are all alive 38 to 77 months after operation, whereas the median OS in 8 patients with unmethylated MGMT genes, age >50 years, and less than subtotal resection was 13.2 months. Conclusion: We confirmed that MGMT gene methylation is a potent prognostic factor in patients with GBM. Our results suggest that early postoperative radiotherapy and a high total/subtotal resection rate might further improve the outcome.« less
Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins.

PubMed

Kemme, Catherine A; Marquez, Rolando; Luu, Ross H; Iwahara, Junji

2017-07-27

Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

PubMed

Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

2011-09-01

Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.
Different expressions and DNA methylation patterns of lysophosphatidic acid receptor genes in mouse tumor cells.

PubMed

Okabe, Kyoko; Hayashi, Mai; Wakabayashi, Naoko; Yamawaki, Yasuna; Teranishi, Miki; Fukushima, Nobuyuki; Tsujiuchi, Toshifumi

2010-01-01

Lysophosphatidic acid (LPA) receptors act as several biological effectors through LPA, which is a bioactive phospholipid. Recently, aberrant expressions of LPA receptor genes due to DNA methylation have been detected in several tumor cells. In this study, we measured expression levels and DNA methylation status of LPA receptor genes in mouse tumor cells, LL/2 lung carcinoma, B16F0 melanoma, FM3A mammary carcinoma and L1210 leukemia cells, compared with normal tissues. Total RNAs were extracted and RT-PCR analysis was performed. For DNA methylation status, bisulfite sequencing analysis was carried out, comparing outcomes with other tumor cells and normal tissues. The expressions of LPA1 gene were shown in LL/2, but not in B16F0, FM3A and L1210 cells. While the LPA2 gene was expressed in all 4 tumor cells, the LPA3 gene was unexpressed in them. The LPA1 and LPA3 unexpressed cells were highly methylated, although normal tissues were all unmethylated. The DNA methylation status was correlated with gene expression levels in cancer cells. The present results demonstrate that DNA methylation patterns of LPA receptor genes are dependent on cancer cell types, suggesting that LPA receptors may be new molecular targets for therapeutic approaches and chemoprevention. Copyright © 2011 S. Karger AG, Basel.
MGMT promoter methylation determined by HRM in comparison to MSP and pyrosequencing for predicting high-grade glioma response.

PubMed

Switzeny, Olivier J; Christmann, Markus; Renovanz, Mirjam; Giese, Alf; Sommer, Clemens; Kaina, Bernd

2016-01-01

The DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) causes resistance of cancer cells to alkylating agents and, therefore, is a well-established predictive marker for high-grade gliomas that are routinely treated with alkylating drugs. Since MGMT is highly epigenetically regulated, the MGMT promoter methylation status is taken as an indicator of MGMT silencing, predicting the outcome of glioma therapy. MGMT promoter methylation is usually determined by methylation specific PCR (MSP), which is a labor intensive and error-prone method often used semi-quantitatively. Searching for alternatives, we used closed-tube high resolution melt (HRM) analysis, which is a quantitative method, and compared it with MSP and pyrosequencing regarding its predictive value. We analyzed glioblastoma cell lines with known MGMT activity and formalin-fixed samples from IDH1 wild-type high-grade glioma patients (WHO grade III/IV) treated with radiation and temozolomide by HRM, MSP, and pyrosequencing. The data were compared as to progression-free survival (PFS) and overall survival (OS) of patients exhibiting the methylated and unmethylated MGMT status. A promoter methylation cut-off level relevant for PFS and OS was determined. In a multivariate Cox regression model, methylation of MGMT promoter of high-grade gliomas analyzed by HRM, but not MSP, was found to be an independent predictive marker for OS. Univariate Kaplan-Meier analyses revealed for PFS and OS a significant and better discrimination between methylated and unmethylated tumors when quantitative HRM was used instead of MSP. Compared to MSP and pyrosequencing, the HRM method is simple, cost effective, highly accurate and fast. HRM is at least equivalent to pyrosequencing in quantifying the methylation level. It is superior in predicting PFS and OS of high-grade glioma patients compared to MSP and, therefore, can be recommended being used routinely for determination of the MGMT status of gliomas.
H4K20me0 marks post-replicative chromatin and recruits the TONSL₋MMS22L DNA repair complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saredi, Giulia; Huang, Hongda; Hammond, Colin M.

Here, we report that after DNA replication, chromosomal processes including DNA repair and transcription take place in the context of sister chromatids. While cell cycle regulation can guide these processes globally, mechanisms to distinguish pre- and post-replicative states locally remain unknown. In this paper we reveal that new histones incorporated during DNA replication provide a signature of post-replicative chromatin, read by the human TONSL–MMS22L 1, 2, 3, 4 homologous recombination complex. We identify the TONSL ankyrin repeat domain (ARD) as a reader of histone H4 tails unmethylated at K20 (H4K20me0), which are specific to new histones incorporated during DNA replicationmore » and mark post-replicative chromatin until the G2/M phase of the cell cycle. Accordingly, TONSL–MMS22L binds new histones H3–H4 both before and after incorporation into nucleosomes, remaining on replicated chromatin until late G2/M. H4K20me0 recognition is required for TONSL–MMS22L binding to chromatin and accumulation at challenged replication forks and DNA lesions. Consequently, TONSL ARD mutants are toxic, compromising genome stability, cell viability and resistance to replication stress. Finally, together, these data reveal a histone-reader-based mechanism for recognizing the post-replicative state, offering a new angle to understand DNA repair with the potential for targeted cancer therapy.« less
Detection of Cytosine methylation in ancient DNA from five native american populations using bisulfite sequencing.

PubMed

Smith, Rick W A; Monroe, Cara; Bolnick, Deborah A

2015-01-01

While cytosine methylation has been widely studied in extant populations, relatively few studies have analyzed methylation in ancient DNA. Most existing studies of epigenetic marks in ancient DNA have inferred patterns of methylation in highly degraded samples using post-mortem damage to cytosines as a proxy for cytosine methylation levels. However, this approach limits the inference of methylation compared with direct bisulfite sequencing, the current gold standard for analyzing cytosine methylation at single nucleotide resolution. In this study, we used direct bisulfite sequencing to assess cytosine methylation in ancient DNA from the skeletal remains of 30 Native Americans ranging in age from approximately 230 to 4500 years before present. Unmethylated cytosines were converted to uracils by treatment with sodium bisulfite, bisulfite products of a CpG-rich retrotransposon were pyrosequenced, and C-to-T ratios were quantified for a single CpG position. We found that cytosine methylation is readily recoverable from most samples, given adequate preservation of endogenous nuclear DNA. In addition, our results indicate that the precision of cytosine methylation estimates is inversely correlated with aDNA preservation, such that samples of low DNA concentration show higher variability in measures of percent methylation than samples of high DNA concentration. In particular, samples in this study with a DNA concentration above 0.015 ng/μL generated the most consistent measures of cytosine methylation. This study presents evidence of cytosine methylation in a large collection of ancient human remains, and indicates that it is possible to analyze epigenetic patterns in ancient populations using direct bisulfite sequencing approaches.
MeDReaders: a database for transcription factors that bind to methylated DNA.

PubMed

Wang, Guohua; Luo, Ximei; Wang, Jianan; Wan, Jun; Xia, Shuli; Zhu, Heng; Qian, Jiang; Wang, Yadong

2018-01-04

Understanding the molecular principles governing interactions between transcription factors (TFs) and DNA targets is one of the main subjects for transcriptional regulation. Recently, emerging evidence demonstrated that some TFs could bind to DNA motifs containing highly methylated CpGs both in vitro and in vivo. Identification of such TFs and elucidation of their physiological roles now become an important stepping-stone toward understanding the mechanisms underlying the methylation-mediated biological processes, which have crucial implications for human disease and disease development. Hence, we constructed a database, named as MeDReaders, to collect information about methylated DNA binding activities. A total of 731 TFs, which could bind to methylated DNA sequences, were manually curated in human and mouse studies reported in the literature. In silico approaches were applied to predict methylated and unmethylated motifs of 292 TFs by integrating whole genome bisulfite sequencing (WGBS) and ChIP-Seq datasets in six human cell lines and one mouse cell line extracted from ENCODE and GEO database. MeDReaders database will provide a comprehensive resource for further studies and aid related experiment designs. The database implemented unified access for users to most TFs involved in such methylation-associated binding actives. The website is available at http://medreader.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Methylation status of the APC and RASSF1A promoter in cell-free circulating DNA and its prognostic role in patients with colorectal cancer.

PubMed

Matthaios, Dimitrios; Balgkouranidou, Ioanna; Karayiannakis, Anastasios; Bolanaki, Helen; Xenidis, Nikolaos; Amarantidis, Kyriakos; Chelis, Leonidas; Romanidis, Konstantinos; Chatzaki, Aikaterini; Lianidou, Evi; Trypsianis, Grigorios; Kakolyris, Stylianos

2016-07-01

DNA methylation is the most frequent epigenetic alteration. Using methylation-specific polymerase chain reaction (MSP), the methylation status of the adenomatous polyposis coli ( APC ) and Ras association domain family 1 isoform A ( RASSF1A ) genes was examined in cell-free circulating DNA from 155 plasma samples obtained from patients with early and advanced colorectal cancer (CRC). APC and RASSF1A hypermethylation was frequently observed in both early and advanced disease, and was significantly associated with a poorer disease outcome. The methylation status of the APC and RASSF1A promoters was investigated in cell-free DNA of patients with CRC. Using MSP, the promoter methylation status of APC and RASSF1A was examined in 155 blood samples obtained from patients with CRC, 88 of whom had operable CRC (oCRC) and 67 had metastatic CRC (mCRC). The frequency of APC methylation in patients with oCRC was 33%. Methylated APC promoter was significantly associated with older age (P=0.012), higher stage (P=0.014) and methylated RASSF1A status (P=0.050). The frequency of APC methylation in patients with mCRC was 53.7%. In these patients, APC methylation was significantly associated with methylated RASSF1A status (P=0.016). The frequency of RASSF1A methylation in patients with oCRC was 25%. Methylated RASSF1A in oCRC was significantly associated with higher stage (P=0.021). The frequency of RASSF1A methylation in mCRC was 44.8%. Methylated RASSF1A in mCRC was associated with moderate differentiation (P=0.012), high levels of carcinoembryonic antigen (P=0.023) and methylated APC status (P=0.016). Patients with an unmethylated APC gene had better survival in both early (81±5 vs. 27±4 months, P<0.001) and advanced disease (37±7 vs. 15±3 months, P<0.001), compared with patients with methylated APC . Patients with an unmethylated RASSF1A gene had better survival in both early (71±6 vs. 46±8 months, P<0.001) and advanced disease (28±4 vs. 16±3 months, P<0.001) than patients with methylated RASSF1A . The observed significant correlations between APC and RASSF1A promoter methylation status and survival may be indicative of a prognostic role for these genes in CRC, which requires additional testing in larger studies.
Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

PubMed Central

Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

2014-01-01

Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517
Mobile small RNAs regulate genome-wide DNA methylation.

PubMed

Lewsey, Mathew G; Hardcastle, Thomas J; Melnyk, Charles W; Molnar, Attila; Valli, Adrián; Urich, Mark A; Nery, Joseph R; Baulcombe, David C; Ecker, Joseph R

2016-02-09

RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21-24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession.
MARCKS Regulates Growth, Radiation Sensitivity and is a Novel Prognostic Factor for Glioma

PubMed Central

Jarboe, John S.; Anderson, Joshua C.; Duarte, Christine W.; Mehta, Tapan; Nowsheen, Somaira; Hicks, Patricia H.; Whitley, Alexander C.; Rohrbach, Timothy D.; McCubrey, Raymond O.; Chiu, Sherard; Burleson, Tamara M.; Bonner, James A.; Gillespie, G. Yancey; Yang, Eddy S.; Willey, Christopher D.

2013-01-01

Purpose This study assessed whether Myristoylated Alanine Rich C-Kinase Substrate (MARCKS) can regulate glioblastoma (GBM) growth, radiation sensitivity and clinical outcome. Experimental Design MARCKS protein levels were analyzed in five GBM explant cell lines and eight patient-derived xenograft tumors by immunoblot, and these levels were correlated to proliferation rates and intracranial growth rates, respectively. Manipulation of MARCKS protein levels was assessed by lentiviral-mediated shRNA knockdown in the U251 cell line and MARCKS over-expression in the U87 cell line. The effect of manipulation of MARCKS on proliferation, radiation sensitivity and senescence was assessed. MARCKS gene expression was correlated with survival outcomes in the Repository of Molecular Brain Neoplasia Data (REMBRANDT) Database and The Cancer Genome Atlas (TCGA). Results MARCKS protein expression was inversely correlated with GBM proliferation and intracranial xenograft growth rates. Genetic silencing of MARCKS promoted GBM proliferation and radiation resistance, while MARCKS overexpression greatly reduced GBM growth potential and induced senescence. We found MARCKS gene expression to be directly correlated with survival in both the REMBRANDT and TCGA databases. Specifically, patients with high MARCKS expressing tumors of the Proneural molecular subtype had significantly increased survival rates. This effect was most pronounced in tumors with unmethylated O6-methylguanine DNA methyltransferase (MGMT) promoters, a traditionally poor prognostic factor. Conclusions MARCKS levels impact GBM growth and radiation sensitivity. High MARCKS expressing GBM tumors are associated with improved survival, particularly with unmethylated MGMT promoters. These findings suggest the use of MARCKS as a novel target and biomarker for prognosis in the Proneural subtype of GBM. PMID:22619307

DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

PubMed

Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

2006-04-01

Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.
Immune activation by nucleic acids: A role in pregnancy complications.

PubMed

Konečná, B; Lauková, L; Vlková, B

2018-04-01

Cell-free self-DNA or RNA may induce an immune response by activating specific sensing receptors. During pregnancy, placental nucleic acids present in the maternal circulation further activate these receptors due to the presence of unmethylated CpG islands. A higher concentration of cell-free foetal DNA is associated with pregnancy complications and a higher risk for foetal rejection. Cell-free foetal DNA originates from placental trophoblasts. It appears in different forms: free, bound to histones in nucleosomes, in neutrophil extracellular traps (NETs) and in extracellular vesicles (EVs). In several pregnancy complications, cell-free foetal DNA triggers the production of proinflammatory cytokines, and this production results in a cellular and humoral immune response. This review discusses preeclampsia, systemic lupus erythematosus, foetal growth restriction, gestational diabetes, rheumatoid arthritis and obesity in pregnancy from an immunological point of view and closely examines the different pathways that result in maternal inflammation. Understanding the role of cell-free nucleic acids, as well as the biogenesis of NETs and EVs, will help us to specify their functions or targets, which seem to be important in pregnancy complications. It is still not clear whether higher concentrations of cell-free nucleic acids in the maternal circulation are the cause or consequence of various complications. Therefore, further clinical studies and, even more importantly, animal experiments that focus on the involved immunological pathways are needed. © 2018 The Foundation for the Scandinavian Journal of Immunology.
DNA methylation pattern of apoptosis-related genes in ameloblastoma.

PubMed

Costa, Sfs; Pereira, N B; Pereira, Kma; Campos, K; de Castro, W H; Diniz, M G; Gomes, C C; Gomez, R S

2017-09-01

DNA methylation is an important mechanism of gene control expression, and it has been poorly addressed in odontogenic tumours. On this basis, we aimed to assess the methylation pattern of 22 apoptosis-related genes in solid ameloblastomas. Ameloblastoma fresh samples (n = 10) and dental follicles (n = 8) were included in the study. The percentage fraction of methylated and unmethylated DNA promoter of 22 apoptosis-related genes was determined using enzymatic restriction digestion and quantitative real-time PCR (qPCR) array. The relative expressions of the genes that showed the most discrepant methylation profile between tumours and controls were analysed by reverse-transcription quantitative PCR (RT-qPCR). Lower methylation percentages of TNFRSF25 (47.2%) and BCL2L11 (33.2%) were observed in ameloblastomas compared with dental follicles (79.3% and 59.5%, respectively). The RT-qPCR analysis showed increased expression of BCL2L11 in ameloblastomas compared with dental follicles, in agreement with the methylation analysis results, while there was no difference between the expression levels of TNFRSF25 between both groups. On the basis of our results, the transcription of the apoptosis-related gene BCL2L11 is possibly regulated by promoter DNA methylation in ameloblastoma. The biological significance of this finding in ameloblastoma pathobiology remains to be clarified. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The Helicobacter pylori HpyAXII restriction–modification system limits exogenous DNA uptake by targeting GTAC sites but shows asymmetric conservation of the DNA methyltransferase and restriction endonuclease components

PubMed Central

Humbert, Olivier; Salama, Nina R.

2008-01-01

The naturally competent organism Helicobacter pylori encodes a large number of restriction–modification (R–M) systems that consist of a restriction endonuclease and a DNA methyltransferase. R–M systems are not only believed to limit DNA exchange among bacteria but may also have other cellular functions. We report a previously uncharacterized H. pylori type II R–M system, M.HpyAXII/R.HpyAXII. We show that this system targets GTAC sites, which are rare in the H. pylori chromosome but numerous in ribosomal RNA genes. As predicted, this type II R–M system showed attributes of a selfish element. Deletion of the methyltransferase M.HpyAXII is lethal when associated with an active endonuclease R.HpyAXII unless compensated by adaptive mutation or gene amplification. R.HpyAXII effectively restricted both unmethylated plasmid and chromosomal DNA during natural transformation and was predicted to belong to the novel ‘half pipe’ structural family of endonucleases. Analysis of a panel of clinical isolates revealed that R.HpyAXII was functional in a small number of H. pylori strains (18.9%, n = 37), whereas the activity of M.HpyAXII was highly conserved (92%, n = 50), suggesting that GTAC methylation confers a selective advantage to H. pylori. However, M.HpyAXII activity did not enhance H. pylori fitness during stomach colonization of a mouse infection model. PMID:18978016
Novel mutation in the replication focus targeting sequence domain of DNMT1 causes hereditary sensory and autonomic neuropathy IE.

PubMed

Yuan, Junhui; Higuchi, Yujiro; Nagado, Tatsui; Nozuma, Satoshi; Nakamura, Tomonori; Matsuura, Eiji; Hashiguchi, Akihiro; Sakiyama, Yusuke; Yoshimura, Akiko; Takashima, Hiroshi

2013-03-01

DNMT1, encoding DNA methyltransferase 1 (Dnmt1), is a critical enzyme which is mainly responsible for conversion of unmethylated DNA into hemimethylated DNA. To date, two phenotypes produced by DNMT1 mutations have been reported, including hereditary sensory and autonomic neuropathy (HSAN) type IE with mutations in exon 20, and autosomal dominant cerebellar ataxia, deafness, and narcolepsy caused by mutations in exon 21. We report a sporadic case in a Japanese patient with loss of pain and vibration sense, chronic osteomyelitis, autonomic system dysfunctions, hearing loss, and mild dementia, but without definite cerebellar ataxia. Electrophysiological studies revealed absent sensory nerve action potential with nearly normal motor nerve conduction studies. Brain magnetic resonance imaging revealed mild diffuse cerebral and cerebellar atrophy. Using a next-generation sequencing system, 16 candidate genes were analyzed and a novel missense mutation, c.1706A>G (p.His569Arg), was identified in exon 21 of DNMT1. Our findings suggest that mutation in exon 21 of DNMT1 may also produce a HSAN phenotype. Because all reported mutations of DNMT1 are concentrated in exons 20 and 21, which encode the replication focus targeting sequence (RFTS) domain of Dnmt1, the RFTS domain could be a mutation hot spot. © 2013 Peripheral Nerve Society.
Quantitative detection of RASSF1A DNA promoter methylation in tumors and serum of patients with serous epithelial ovarian cancer.

PubMed

Bondurant, Amy E; Huang, Zhiqing; Whitaker, Regina S; Simel, Lauren R; Berchuck, Andrew; Murphy, Susan K

2011-12-01

Detection of cell free tumor-specific DNA methylation has been proposed as a potentially useful noninvasive mechanism to detect malignancies, including ovarian cancer, and to monitor response to treatment. However, there are few easily implemented quantitative approaches available for DNA methylation analysis. Our objectives were to develop an absolute quantitative method for detection of DNA methylation using RASSF1A, a known target of promoter methylation in ovarian cancer, and test the ability to detect RASSF1A methylation in tumors and serum specimens of women with ovarian cancer. Bisulfite modified DNAs were subjected to real time PCR using nondiscriminatory PCR primers and a probe with sequence containing a single CpG site, theoretically able to capture the methylation status of that CpG for every allele within a given specimen. Input DNA was normalized to ACTB levels detected simultaneously by assay multiplexing. Methylation levels were established by comparison to results obtained from universally methylated DNA. The assay was able to detect one methylated RASSF1A allele in 100,000 unmethylated alleles. RASSF1A was methylated in 54 of 106 (51%) invasive serous ovarian cancers analyzed and methylation status was concordant in 20/20 matched preoperative serum-tumor pairs. Serial serum specimens taken over the course of treatment for 8 of 9 patients showed fluctuations in RASSF1A methylation concomitant with disease status. This novel assay provides a real-time PCR-based method for absolute quantitation of DNA methylation. Our results support feasibility of monitoring RASSF1A methylation from serum samples taken over the course of treatment from women with ovarian cancer. Copyright © 2011 Elsevier Inc. All rights reserved.
Epigenetic Alteration by DNA Methylation of ESR1, MYOD1 and hTERT Gene Promoters is Useful for Prediction of Response in Patients of Locally Advanced Invasive Cervical Carcinoma Treated by Chemoradiation.

PubMed

Sood, S; Patel, F D; Ghosh, S; Arora, A; Dhaliwal, L K; Srinivasan, R

2015-12-01

Locally advanced invasive cervical cancer [International Federation of Gynecology and Obstetrics (FIGO) IIB/III] is treated by chemoradiation. The response to treatment is variable within a given FIGO stage. Therefore, the aim of the present study was to evaluate the gene promoter methylation profile and corresponding transcript expression of a panel of six genes to identify genes which could predict the response of patients treated by chemoradiation. In total, 100 patients with invasive cervical cancer in FIGO stage IIB/III who underwent chemoradiation treatment were evaluated. Ten patients developed systemic metastases during therapy and were excluded. On the basis of patient follow-up, 69 patients were chemoradiation-sensitive, whereas 21 were chemoradiation-resistant. Gene promoter methylation and gene expression was determined by TaqMan assay and quantitative real-time PCR, respectively, in tissue samples. The methylation frequency of ESR1, BRCA1, RASSF1A, MLH1, MYOD1 and hTERT genes ranged from 40 to 70%. Univariate and hierarchical cluster analysis revealed that gene promoter methylation of MYOD1, ESR1 and hTERT could predict for chemoradiation response. A pattern of unmethylated MYOD1, unmethylated ESR1 and methylated hTERT promoter as well as lower ESR1 transcript levels predicted for chemoradiation resistance. Methylation profiling of a panel of three genes that includes MYOD1, ESR1 and hTERT may be useful to predict the response of invasive cervical carcinoma patients treated with standard chemoradiation therapy. Copyright © 2015 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.
Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013
Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302
Epigenomic and functional analyses reveal roles of epialleles in the loss of photoperiod sensitivity during domestication of allotetraploid cottons.

PubMed

Song, Qingxin; Zhang, Tianzhen; Stelly, David M; Chen, Z Jeffrey

2017-05-31

Polyploidy is a pervasive evolutionary feature of all flowering plants and some animals, leading to genetic and epigenetic changes that affect gene expression and morphology. DNA methylation changes can produce meiotically stable epialleles, which are transmissible through selection and breeding. However, the relationship between DNA methylation and polyploid plant domestication remains elusive. We report comprehensive epigenomic and functional analyses, including ~12 million differentially methylated cytosines in domesticated allotetraploid cottons and their tetraploid and diploid relatives. Methylated genes evolve faster than unmethylated genes; DNA methylation changes between homoeologous loci are associated with homoeolog-expression bias in the allotetraploids. Significantly, methylation changes induced in the interspecific hybrids are largely maintained in the allotetraploids. Among 519 differentially methylated genes identified between wild and cultivated cottons, some contribute to domestication traits, including flowering time and seed dormancy. CONSTANS (CO) and CO-LIKE (COL) genes regulate photoperiodicity in Arabidopsis. COL2 is an epiallele in allotetraploid cottons. COL2A is hypermethylated and silenced, while COL2D is repressed in wild cottons but highly expressed due to methylation loss in all domesticated cottons tested. Inhibiting DNA methylation activates COL2 expression, and repressing COL2 in cultivated cotton delays flowering. We uncover epigenomic signatures of domestication traits during cotton evolution. Demethylation of COL2 increases its expression, inducing photoperiodic flowering, which could have contributed to the suitability of cotton for cultivation worldwide. These resources should facilitate epigenetic engineering, breeding, and improvement of polyploid crops.
Antisilencing role of the RNA-directed DNA methylation pathway and a histone acetyltransferase in Arabidopsis

PubMed Central

Li, Xiaojie; Qian, Weiqiang; Zhao, Yusheng; Wang, Chunlei; Shen, Jie; Zhu, Jian-Kang; Gong, Zhizhong

2012-01-01

REPRESSOR OF SILENCING 1 (ROS1) is a DNA demethylation enzyme that was previously identified during a genetic screen for the silencing of both RD29A-LUC and 35S-NPTII transgenes on a T-DNA construct. Here we performed a genetic screen to identify additional mutants in which the 35S-NPTII transgene is silenced. We identified several alleles of ros1 and of the following components of the RNA-directed DNA methylation (RdDM) pathway: NRPD1 (the largest subunit of polymerase IV), RDR2, NRPE1 (the largest subunit of polymerase V), NRPD2, AGO4, and DMS3. Our results show that the silencing of 35S-NPTII in the RdDM pathway mutants is due to the reduced expression of ROS1 in the mutants. We also identified a putative histone acetyltransferase (ROS4) from the genetic screen. The acetyltransferase contains a PHD-finger domain that binds to unmethylated histone H3K4. The mutation in ROS4 led to reduction of H3K18 and H3K23 acetylation levels. We show that the silencing of 35S-NPTII and some transposable element genes was released by the ddm1 mutation but that this also required ROS4. Our study identifies a unique antisilencing factor, and reveals that the RdDM pathway has an antisilencing function due to its role in maintaining ROS1 expression. PMID:22733760
Programmed Protection of Foreign DNA from Restriction Allows Pathogenicity Island Exchange during Pneumococcal Transformation

PubMed Central

Johnston, Calum; Martin, Bernard; Granadel, Chantal; Polard, Patrice; Claverys, Jean-Pierre

2013-01-01

In bacteria, transformation and restriction-modification (R-M) systems play potentially antagonistic roles. While the former, proposed as a form of sexuality, relies on internalized foreign DNA to create genetic diversity, the latter degrade foreign DNA to protect from bacteriophage attack. The human pathogen Streptococcus pneumoniae is transformable and possesses either of two R-M systems, DpnI and DpnII, which respectively restrict methylated or unmethylated double-stranded (ds) DNA. S. pneumoniae DpnII strains possess DpnM, which methylates dsDNA to protect it from DpnII restriction, and a second methylase, DpnA, which is induced during competence for genetic transformation and is unusual in that it methylates single-stranded (ss) DNA. DpnA was tentatively ascribed the role of protecting internalized plasmids from DpnII restriction, but this seems unlikely in light of recent results establishing that pneumococcal transformation was not evolved to favor plasmid exchange. Here we validate an alternative hypothesis, showing that DpnA plays a crucial role in the protection of internalized foreign DNA, enabling exchange of pathogenicity islands and more generally of variable regions between pneumococcal isolates. We show that transformation of a 21.7 kb heterologous region is reduced by more than 4 logs in dpnA mutant cells and provide evidence that the specific induction of dpnA during competence is critical for full protection. We suggest that the integration of a restrictase/ssDNA-methylase couplet into the competence regulon maintains protection from bacteriophage attack whilst simultaneously enabling exchange of pathogenicicy islands. This protective role of DpnA is likely to be of particular importance for pneumococcal virulence by allowing free variation of capsule serotype in DpnII strains via integration of DpnI capsule loci, contributing to the documented escape of pneumococci from capsule-based vaccines. Generally, this finding is the first evidence for a mechanism that actively promotes genetic diversity of S. pneumoniae through programmed protection and incorporation of foreign DNA. PMID:23459610
Epigenetic analysis leads to identification of HNF1B as a subtype-specific susceptibility gene for ovarian cancer

PubMed Central

Shen, Hui; Fridley, Brooke L.; Song, Honglin; Lawrenson, Kate; Cunningham, Julie M.; Ramus, Susan J.; Cicek, Mine S.; Tyrer, Jonathan; Stram, Douglas; Larson, Melissa C.; Köbel, Martin; Ziogas, Argyrios; Zheng, Wei; Yang, Hannah P.; Wu, Anna H.; Wozniak, Eva L.; Woo, Yin Ling; Winterhoff, Boris; Wik, Elisabeth; Whittemore, Alice S.; Wentzensen, Nicolas; Weber, Rachel Palmieri; Vitonis, Allison F.; Vincent, Daniel; Vierkant, Robert A.; Vergote, Ignace; Van Den Berg, David; Van Altena, Anne M.; Tworoger, Shelley S.; Thompson, Pamela J.; Tessier, Daniel C.; Terry, Kathryn L.; Teo, Soo-Hwang; Templeman, Claire; Stram, Daniel O.; Southey, Melissa C.; Sieh, Weiva; Siddiqui, Nadeem; Shvetsov, Yurii B.; Shu, Xiao-Ou; Shridhar, Viji; Wang-Gohrke, Shan; Severi, Gianluca; Schwaab, Ira; Salvesen, Helga B.; Rzepecka, Iwona K.; Runnebaum, Ingo B.; Rossing, Mary Anne; Rodriguez-Rodriguez, Lorna; Risch, Harvey A.; Renner, Stefan P.; Poole, Elizabeth M.; Pike, Malcolm C.; Phelan, Catherine M.; Pelttari, Liisa M.; Pejovic, Tanja; Paul, James; Orlow, Irene; Omar, Siti Zawiah; Olson, Sara H.; Odunsi, Kunle; Nickels, Stefan; Nevanlinna, Heli; Ness, Roberta B.; Narod, Steven A.; Nakanishi, Toru; Moysich, Kirsten B.; Monteiro, Alvaro N.A.; Moes-Sosnowska, Joanna; Modugno, Francesmary; Menon, Usha; McLaughlin, John R.; McGuire, Valerie; Matsuo, Keitaro; Adenan, Noor Azmi Mat; Massuger, Leon F.A. G.; Lurie, Galina; Lundvall, Lene; Lubiński, Jan; Lissowska, Jolanta; Levine, Douglas A.; Leminen, Arto; Lee, Alice W.; Le, Nhu D.; Lambrechts, Sandrina; Lambrechts, Diether; Kupryjanczyk, Jolanta; Krakstad, Camilla; Konecny, Gottfried E.; Kjaer, Susanne Krüger; Kiemeney, Lambertus A.; Kelemen, Linda E.; Keeney, Gary L.; Karlan, Beth Y.; Karevan, Rod; Kalli, Kimberly R.; Kajiyama, Hiroaki; Ji, Bu-Tian; Jensen, Allan; Jakubowska, Anna; Iversen, Edwin; Hosono, Satoyo; Høgdall, Claus K.; Høgdall, Estrid; Hoatlin, Maureen; Hillemanns, Peter; Heitz, Florian; Hein, Rebecca; Harter, Philipp; Halle, Mari K.; Hall, Per; Gronwald, Jacek; Gore, Martin; Goodman, Marc T.; Giles, Graham G.; Gentry-Maharaj, Aleksandra; Garcia-Closas, Montserrat; Flanagan, James M.; Fasching, Peter A.; Ekici, Arif B.; Edwards, Robert; Eccles, Diana; Easton, Douglas F.; Dürst, Matthias; du Bois, Andreas; Dörk, Thilo; Doherty, Jennifer A.; Despierre, Evelyn; Dansonka-Mieszkowska, Agnieszka; Cybulski, Cezary; Cramer, Daniel W.; Cook, Linda S.; Chen, Xiaoqing; Charbonneau, Bridget; Chang-Claude, Jenny; Campbell, Ian; Butzow, Ralf; Bunker, Clareann H.; Brueggmann, Doerthe; Brown, Robert; Brooks-Wilson, Angela; Brinton, Louise A.; Bogdanova, Natalia; Block, Matthew S.; Benjamin, Elizabeth; Beesley, Jonathan; Beckmann, Matthias W.; Bandera, Elisa V.; Baglietto, Laura; Bacot, François; Armasu, Sebastian M.; Antonenkova, Natalia; Anton-Culver, Hoda; Aben, Katja K.; Liang, Dong; Wu, Xifeng; Lu, Karen; Hildebrandt, Michelle A.T.; Schildkraut, Joellen M.; Sellers, Thomas A.; Huntsman, David; Berchuck, Andrew; Chenevix-Trench, Georgia; Gayther, Simon A.; Pharoah, Paul D.P.; Laird, Peter W.; Goode, Ellen L.; Pearce, Celeste Leigh

2013-01-01

HNF1B is overexpressed in clear cell epithelial ovarian cancer, and we observed epigenetic silencing in serous epithelial ovarian cancer, leading us to hypothesize that variation in this gene differentially associates with epithelial ovarian cancer risk according to histological subtype. Here we comprehensively map variation in HNF1B with respect to epithelial ovarian cancer risk and analyse DNA methylation and expression profiles across histological subtypes. Different single-nucleotide polymorphisms associate with invasive serous (rs7405776 odds ratio (OR) = 1.13, P = 3.1 × 10−10) and clear cell (rs11651755 OR = 0.77, P = 1.6 × 10−8) epithelial ovarian cancer. Risk alleles for the serous subtype associate with higher HNF1B-promoter methylation in these tumours. Unmethylated, expressed HNF1B, primarily present in clear cell tumours, coincides with a CpG island methylator phenotype affecting numerous other promoters throughout the genome. Different variants in HNF1B associate with risk of serous and clear cell epithelial ovarian cancer; DNA methylation and expression patterns are also notably distinct between these subtypes. These findings underscore distinct mechanisms driving different epithelial ovarian cancer histological subtypes. PMID:23535649
Islet cells share promoter hypomethylation independently of expression, but exhibit cell-type-specific methylation in enhancers.

PubMed

Neiman, Daniel; Moss, Joshua; Hecht, Merav; Magenheim, Judith; Piyanzin, Sheina; Shapiro, A M James; de Koning, Eelco J P; Razin, Aharon; Cedar, Howard; Shemer, Ruth; Dor, Yuval

2017-12-19

DNA methylation at promoters is an important determinant of gene expression. Earlier studies suggested that the insulin gene promoter is uniquely unmethylated in insulin-expressing pancreatic β-cells, providing a classic example of this paradigm. Here we show that islet cells expressing insulin, glucagon, or somatostatin share a lack of methylation at the promoters of the insulin and glucagon genes. This is achieved by rapid demethylation of the insulin and glucagon gene promoters during differentiation of Neurogenin3 + embryonic endocrine progenitors, regardless of the specific endocrine cell-type chosen. Similar methylation dynamics were observed in transgenic mice containing a human insulin promoter fragment, pointing to the responsible cis element. Whole-methylome comparison of human α- and β-cells revealed generality of the findings: genes active in one cell type and silent in the other tend to share demethylated promoters, while methylation differences between α- and β-cells are concentrated in enhancers. These findings suggest an epigenetic basis for the observed plastic identity of islet cell types, and have implications for β-cell reprogramming in diabetes and diagnosis of β-cell death using methylation patterns of circulating DNA. Copyright © 2017 the Author(s). Published by PNAS.
ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

PubMed

Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

2016-11-25

CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .
Promoter methylation and expression of MGMT and the DNA mismatch repair genes MLH1, MSH2, MSH6 and PMS2 in paired primary and recurrent glioblastomas.

PubMed

Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C

2011-08-01

Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.
Genome-wide association between DNA methylation and alternative splicing in an invertebrate

PubMed Central

2012-01-01

Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee) and Nasonia vitripennis (jewel wasp) analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq) to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice variants by positively influencing exon inclusion during transcription. The results from our cross-species homology analysis suggest that DNA methylation and alternative splicing are genetic mechanisms whose utilization could contribute to a longer gene length and a slower rate of gene evolution. PMID:22978521
Increased immunostimulatory activity of polypod-like structured DNA by ligation of the terminal loop structures.

PubMed

Mohri, Kohta; Takahashi, Natsuki; Nishikawa, Makiya; Kusuki, Eri; Shiomi, Tomoki; Takahashi, Yuki; Takakura, Yoshinobu

2012-11-10

The immunostimulatory activity of phosphodiester DNA containing unmethylated cytosine-guanine (CpG) dinucleotides can be increased by converting it into branched structures. These structures could be stabilized by ligating the 5'- and 3'-ends to form a closed loop with no terminal ends. To further increase the ability of branched DNA assemblies to induce cytokines, a series of tetrapod-like structured DNA, or tetrapodna, were designed using four 48-base oligodeoxynucleotides (ODNs). All these preparations were designed to have the same sequence except for the nick sites, and all the ODNs of one of the tetrapodna preparations were ligated to obtain circular tetrapodna. The nick site significantly influenced the formation of the structure and melting temperature (Tm), but hardly affected the enzymatic stability of the tetrapodna preparations. Circular tetrapodna exhibited a significantly higher Tm and was more stable in mouse serum than its non-ligated counterparts. The amounts of cytokines released from macrophage-like RAW264.7 cells or dendritic DC2.4 cells after addition of circular tetrapodna were not significantly higher than those after addition of other tetrapodna preparations under conditions when no serum was present. However, when serum was present, circular tetrapodna induced the greatest amount of tumor necrosis factor-α, indicating that circular tetrapodna is effective in inducing cytokines under conditions where DNA-degrading enzymes are present. The cellular association of tetrapodna preparations was almost unaffected by ligation of the terminal ends. These results indicate that circular tetrapodna with no terminal ends is more effective than its non-ligated counterparts in the presence of serum. Copyright © 2012 Elsevier B.V. All rights reserved.
TLR9 Ligands Induce S100A8 in Macrophages via a STAT3-Dependent Pathway which Requires IL-10 and PGE2

PubMed Central

Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L.

2014-01-01

S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a −178 to −34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation. PMID:25098409
TLR9 ligands induce S100A8 in macrophages via a STAT3-dependent pathway which requires IL-10 and PGE2.

PubMed

Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L

2014-01-01

S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a -178 to -34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation.

Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

PubMed Central

2012-01-01

Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem) in the reference tree species black cottonwood (Populus trichocarpa). Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq), we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation") had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation. PMID:22251412
Potentialities of aberrantly methylated circulating DNA for diagnostics and post-treatment follow-up of lung cancer patients.

PubMed

Ponomaryova, Anastasia A; Rykova, Elena Yu; Cherdyntseva, Nadezda V; Skvortsova, Tatiana E; Dobrodeev, Alexey Yu; Zav'yalov, Alexander A; Bryzgalov, Leonid O; Tuzikov, Sergey A; Vlassov, Valentin V; Laktionov, Pavel P

2013-09-01

To date, aberrant DNA methylation has been shown to be one of the most common and early causes of malignant cell transformation and tumors of different localizations, including lung cancer. Cancer cell-specific methylated DNA has been found in the blood of cancer patients, indicating that cell-free DNA circulating in the blood (cirDNA) is a convenient tumor-associated DNA marker that can be used as a minimally invasive diagnostic test. In the current study, we investigated the methylation status in blood samples of 32 healthy donors and 60 lung cancer patients before and after treatment with neoadjuvant chemotherapy followed by total tumor resection. Using quantitative methylation-specific PCR, we found that the index of methylation (IM), calculated as IM = 100 × [copy number of methylated/(copy number of methylated + unmethylated gene)], for the RASSF1A and RARB2 genes in the cirDNA isolated from blood plasma and cell-surface-bound cirDNA was elevated 2- to 3-fold in lung cancer patients compared with healthy donors. Random forest classification tree model based on these variables combined (RARB2 and RASSF1A IM in both plasma and cell-surface-bound cirDNA) lead to NSCLC patients' and healthy subjects' differentiation with 87% sensitivity and 75% specificity. An association of increased IM values with an advanced stage of non-small-cell lung cancer was found for RARB2 but not for RASSF1A. Chemotherapy and total tumor resection resulted in a significant decrease in the IM for RARB2 and RASSF1A, in both cirDNA fractions, comparable to the IM level of healthy subjects. Importantly, a rise in the IM for RARB2 was detected in patients within the follow-up period, which manifested in disease relapse at 9 months, confirmed with instrumental and pathologic methods. Our data indicate that quantitative analysis of the methylation status of the RARB2 and RASSF1A tumor suppressor genes in both cirDNA fractions is a useful tool for lung cancer diagnostics, evaluation of cancer treatment efficiency and post-treatment monitoring. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.
Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

2011-11-04

Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less
Preliminary individualized chemotherapy for malignant astrocytomas based on O6-methylguanine-deoxyribonucleic acid methyltransferase methylation analysis.

PubMed

Watanabe, Takao; Katayama, Yoichi; Ogino, Akiyoshi; Ohta, Takashi; Yoshino, Atsuo; Fukushima, Takao

2006-08-01

O(6)-methylguanine-deoxyribonucleic acid methyltransferase gene (MGMT) methylation is apparently correlated with responsiveness to nitrosourea chemotherapy, suggesting this alkylating agent should be effective against MGMT-methylated tumors. MGMT appears not to be linked to platinum resistance, so platinum chemotherapy should be used for MGMT-unmethylated tumors. This study was a preliminary trial of individualized chemotherapy based on MGMT methylation status in a total of 20 patients with newly diagnosed malignant astrocytomas (9 anaplastic astrocytomas and 11 glioblastomas multiforme). The procarbazine, 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3-2(2-chloroethyl)-3-nitrosourea, and vincristine (PAV) regimen was administered to seven patients with MGMT-methylated tumors, and the carboplatin and etoposide (CE) regimen was administered to 13 patients with MGMT-unmethylated tumors. Objective response to the PAV therapy was noted in all three patients with measurable residual tumor (2 complete responses and 1 partial response). Five of the seven patients continued to be disease-free after initiation of the PAV therapy. Objective response to the CE therapy was seen in only one of seven patients with measurable residual tumor (1 partial response). Three of the 13 patients were free from progression, whereas the remaining 10 patients showed early progression. The PAV regimen is effective against MGMT-methylated malignant astrocytomas, but the CE regimen is not useful at the given dose and schedule in MGMT-unmethylated tumors.
Acceptance of Domestic Cat Mitochondrial DNA in a Criminal Proceeding

PubMed Central

Lyons, Leslie A.; Grahn, Robert A.; Kun, Teri J.; Netzel, Linda R.; Wictum, Elizabeth E.; Halverson, Joy L.

2014-01-01

Shed hair from domestic animals readily adheres to clothing and other contact items, providing a source of transfer evidence for criminal investigations. Mitochondrial DNA is often the only option for DNA analysis of shed hair. Human mitochondrial DNA analysis has been accepted in the US court system since 1996. The murder trial of the State of Missouri versus Henry L. Polk, Jr. represents the first legal proceeding where cat mitochondrial DNA analysis was introduced into evidence. The mitochondrial DNA evidence was initially considered inadmissible due to concerns about the cat dataset and the scientific acceptance of the marker. Those concerns were subsequently addressed, and the evidence was deemed admissible. This report reviews the case in regards to the cat biological evidence and its ultimate admission as generally accepted and reliable. Expansion and saturation analysis of the cat mitochondrial DNA control region dataset supported the initial interpretation of the evidence. PMID:25086413
Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518
Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340
Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
CpG site hypermethylation of E-cadherin and Connexin26 genes in hepatocellular carcinomas induced by a choline-deficient L-Amino Acid-defined diet in rats.

PubMed

Tsujiuchi, Toshifumi; Shimizu, Kyoko; Itsuzaki, Yumi; Onishi, Mariko; Sugata, Eriko; Fujii, Hiromasa; Honoki, Kanya

2007-04-01

We investigated DNA methylation patterns of E-cadherin and Connexin26 (Cx26) genes in rat hepatocellular carcinomas (HCCs) induced by a choline-deficient L-Amino Acid-defined (CDAA) diet. Six-wks-old F344 male rats were continuously fed with a CDAA diet for 75 wks, and were then killed. A total of five HCCs were obtained, and genomic DNA was extracted from each HCC for assessment of methylation status in the 5' upstream regions of E-cadherin and Cx26 genes by bisulfite sequencing, comparing to two normal liver tissues. The five HCCs showed highly methylated E-cadherin and Cx26 genes, while these genes in two normal liver tissues were all unmethylated. For analysis of gene expression, real-time quantitative reverse transcription (RT)-polymerase chain reaction (PCR) was performed. Expressions of E-cadherin and Cx26 genes were significantly reduced in the five HCCs (P < 0.0001 and P < 0.001, respectively) compared to normal liver tissues, correlating with their methylation statuses. These results suggested that hypermethylation of E-cadherin and Cx26 genes may be involved in the development of HCCs induced by a CDAA diet in rats.
Restriction-Modification systems interplay causes avoidance of GATC site in prokaryotic genomes.

PubMed

Ershova, Anna; Rusinov, Ivan; Vasiliev, Mikhail; Spirin, Sergey; Karyagina, Anna

2016-04-01

Palindromes are frequently underrepresented in prokaryotic genomes. Palindromic 5[Formula: see text]-GATC-3[Formula: see text] site is a recognition site of different Restriction-Modification (R-M) systems, as well as solitary methyltransferase Dam. Classical GATC-specific R-M systems methylate GATC and cleave unmethylated GATC. On the contrary, methyl-directed Type II restriction endonucleases cleave methylated GATC. Methylation of GATC by Dam methyltransferase is involved in the regulation of different cellular processes. The diversity of functions of GATC-recognizing proteins makes GATC sequence a good model for studying the reasons of palindrome avoidance in prokaryotic genomes. In this work, the influence of R-M systems and solitary proteins on the GATC site avoidance is described by a mathematical model. GATC avoidance is strongly associated with the presence of alternate (methyl-directed or classical Type II R-M system) genes in different strains of the same species, as we have shown for Streptococcus pneumoniae, Neisseria meningitidis, Eubacterium rectale, and Moraxella catarrhalis. We hypothesize that GATC avoidance can result from a DNA exchange between strains with different methylation status of GATC site within the process of natural transformation. If this hypothesis is correct, the GATC avoidance is a sign of a DNA exchange between bacteria with different methylation status in a mixed population.
DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

PubMed

Gohlke, Jochen; Scholz, Claus-Juergen; Kneitz, Susanne; Weber, Dana; Fuchs, Joerg; Hedrich, Rainer; Deeken, Rosalia

2013-01-01

Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA) in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes regulate gene expression, physiological processes, and the development of crown gall tumors.
Partial bisulfite conversion for unique template sequencing

PubMed Central

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael

2018-01-01

Abstract We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. PMID:29161423
Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors.

PubMed

Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J

2016-01-01

The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.
The multivariate association between genomewide DNA methylation and climate across the range of Arabidopsis thaliana.

PubMed

Keller, Thomas E; Lasky, Jesse R; Yi, Soojin V

2016-04-01

Epigenetic changes can occur due to extracellular environmental conditions. Consequently, epigenetic mechanisms can play an intermediate role to translate environmental signals to intracellular changes. Such a role might be particularly important in plants, which often show strong local adaptation and have the potential for heritable epigenetic states. However, little is currently known about the role of epigenetic variation in the ecological mechanisms of adaptation. Here, we used multivariate redundancy analyses to examine genomewide associations between DNA methylation polymorphisms and climate variation in two independent panels of Arabidopsis accessions, including 122 Eurasian accessions as well as in a regional panel of 148 accessions in Sweden. At the single-nucleotide methylation level, climate and space (geographic spatial structure) explain small yet significant amount of variation in both panels. On the other hand, when viewed in a context of genomic clusters of methylated and unmethylated cytosines, climate and space variables explain much greater amounts of variation in DNA methylation than those explained by variation at the single-nucleotide level. We found that the single-nucleotide methylation polymorphisms with the strongest associations with climate were enriched in transposable elements and in potentially RNA-directed methylation contexts. When viewed in the context of genomic clusters, variation of DNA methylation at different sequence contexts exhibit distinctive segregation along different axes of variation in the redundancy analyses. Genomewide methylation showed much stronger associations with climate within the regional panel (Sweden) compared to the global (Eurasia). Together, these findings indicate that genetic and epigenetic variation across the genome may play a role in response to climate conditions and local adaptation. © 2016 John Wiley & Sons Ltd.
On-Chip Evaluation of DNA Methylation with Electrochemical Combined Bisulfite Restriction Analysis Utilizing a Carbon Film Containing a Nanocrystalline Structure.

PubMed

Kurita, Ryoji; Yanagisawa, Hiroyuki; Kamata, Tomoyuki; Kato, Dai; Niwa, Osamu

2017-06-06

This paper reports an on-chip electrochemical assessment of the DNA methylation status in genomic DNA on a conductive nanocarbon film electrode realized with combined bisulfite restriction analysis (COBRA). The film electrode consists of sp 2 and sp 3 hybrid bonds and is fabricated with an unbalanced magnetron (UBM) sputtering method. First, we studied the effect of the sp 2 /sp 3 ratio of the UBM nanocarbon film electrode with p-aminophenol, which is a major electro-active product of the labeling enzyme from p-aminophenol phosphate. The signal current for p-aminophenol increases as the sp 2 content in the UBM nanocarbon film electrode increases because of the π-π interaction between aromatic p-aminophenol and the graphene-like sp 2 structure. Furthermore, the capacitative current at the UBM nanocarbon film electrode was successfully reduced by about 1 order of magnitude thanks to the angstrom-level surface flatness. Therefore, a high signal-to-noise ratio was achieved compared with that of conventional electrodes. Then, after performing an ELISA-like hybridization assay with a restriction enzyme, we undertook an electrochemical evaluation of the cytosine methylation status in DNA by measuring the oxidation current derived from p-aminophenol. When the target cytosine in the analyte sequence is methylated (unmethylated), the restriction enzyme of HpyCH4IV is able (unable) to cleave the sequence, that is, the detection probe cannot (can) hybridize. We succeeded in estimating the methylation ratio at a site-specific CpG site from the peak current of a cyclic voltammogram obtained from a PCR product solution ranging from 0.01 to 1 nM.
Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors

PubMed Central

Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.

2015-01-01

Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054
DNA methylation analysis in rat kidney epithelial cells exposed to 3-MCPD and glycidol.

PubMed

Senyildiz, Mine; Alpertunga, Buket; Ozden, Sibel

2017-10-01

3-Monochloropropane-1,2-diol (3-MCPD) is a well-known food processing contaminant that has been regarded as a rat carcinogen, which is known to induce Leydig-cell and mammary gland tumors in males, as well as kidney tumors in both genders. 3-MCPD is highly suspected to be a non-genotoxic carcinogen. 2,3-Epoxy-1-propanol (glycidol) can be formed via dehalogenation from 3-MCPD. We aimed to investigate the cytotoxic effects of 3-MCPD and glycidol, then to demonstrate the possible epigenetic mechanisms with global and gene-specific DNA methylation in rat kidney epithelial cells (NRK-52E). IC 50 value of 3-MCPD was determined as 48 mM and 41.39 mM, whereas IC 50 value of glycidol was 1.67 mM and 1.13 mM by MTT and NRU test, respectively. Decreased global DNA methylation at the concentrations of 100 μM and 1000 μM for 3-MCPD and 100 μM and 500 μM for glycidol were observed after 48 h exposure by using 5-methylcytosine (5-mC) ELISA kit. Methylation changes were detected in promoter regions of c-myc and Rassf1a in 3-MCPD and glycidol treated NRK-52E cells by using methylation-specific PCR (MSP), whereas changes on gene expression of c-myc and Rassf1a were observed by using real-time PCR. However, e-cadherin, p16, VHL and p15 genes were unmethylated in their CpG promoter regions in response to treatment with 3-MCPD and glycidol. Alterations in DNA methylation might be key events in the toxicity of 3-MCPD and glycidol.
Partially methylated alleles, microdeletion, and tissue mosaicism in a fragile X male with tremor and ataxia at 30 years of age: A case report.

PubMed

Hwang, Yun Tae; Aliaga, Solange Mabel; Arpone, Marta; Francis, David; Li, Xin; Chong, Belinda; Slater, Howard Robert; Rogers, Carolyn; Bretherton, Lesley; Hunter, Matthew; Heard, Robert; Godler, David Eugeny

2016-12-01

CGG repeat expansion >200 within FMR1, termed full mutation (FM), has been associated with promoter methylation, consequent silencing of gene expression and fragile X syndrome (FXS)-a common cause of intellectual disability and co-morbid autism. Unmethylated premutation (55-199 repeats) and FM alleles have been associated with fragile X related tremor/ataxia syndrome (FXTAS), a late onset neurodegenerative disorder. Here we present a 33-year-old male with FXS, with white matter changes and progressive deterioration in gait with cerebellar signs consistent with probable FXTAS; there was no evidence of any other cerebellar pathology. We show that he has tissue mosaicism in blood, saliva, and buccal samples for the size and methylation of his expanded alleles and a de novo, unmethylated microdeletion. This microdeletion involves a ∼80 bp sequence in the FMR1 promoter as well as complete loss of the CGG repeat in a proportion of cells. Despite FMR1 mRNA levels in blood within the normal range, the methylation and CGG sizing results are consistent with the diagnosis of concurrent FXS and probable FXTAS. The demonstrated presence of unmethylated FM alleles would explain the manifestation of milder than expected cognitive and behavioral impairments and early onset of cerebellar ataxia. Our case suggests that individuals with FXS, who manifest symptoms of FXTAS, may benefit from more detailed laboratory testing. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Improved results of LINE-1 methylation analysis in formalin-fixed, paraffin-embedded tissues with the application of a heating step during the DNA extraction process.

PubMed

Wen, Xianyu; Jeong, Seorin; Kim, Younghoon; Bae, Jeong Mo; Cho, Nam Yun; Kim, Jung Ho; Kang, Gyeong Hoon

2017-01-01

Formalin-fixed, paraffin-embedded (FFPE) tissues are important resources for profiling DNA methylation changes and for studying a variety of diseases. However, formalin fixation introduces inter-strand crosslinking, which might cause incomplete bisulfite conversion of unmethylated cytosines, which might lead to falsely elevated measurements of methylation levels in pyrosequencing assays. Long interspersed nucleotide element-1 (LINE-1) is a major constituent of repetitive transposable DNA elements, and its methylation is referred to correlates with global DNA methylation. To identify whether formalin fixation might impact the measured values of methylation in LINE-1 repetitive elements and whether prolonged heat-induced denaturation of DNA might reduce the artificial increases in measured values caused by formalin fixation, we analyzed paired fresh-frozen (FF) and FFPE xenograft tissue samples for their methylation levels in LINE-1 using a pyrosequencing assay. To further confirm the effect of a heating step in the measurement of LINE-1 or single gene methylation levels, we analyzed FFPE tissue samples of gastric cancer and colorectal cancer for their methylation status in LINE-1 and eight single genes, respectively. Formalin fixation led to an increase in the measured values of LINE-1 methylation regardless of the duration of fixation. Prolonged heating of the DNA at 95 °C for 30 min before bisulfite conversion was found (1) to decrease the discrepancy in the measured values between the paired FF and FFPE tissue samples, (2) to decrease the standard deviation of the measured value of LINE-1 methylation levels in FFPE tissue samples of gastric cancer, and (3) to improve the performance in the measurement of single gene methylation levels in FFPE tissue samples of colorectal cancer. Formalin fixation leads to artificial increases in the measured values of LINE-1 methylation, and the application of prolonged heating of DNA samples decreases the discrepancy in the measured values of LINE-1 methylation between paired FF and FFPE tissue samples. The application of prolonged heating of DNA samples improves bisulfite conversion-based measurement of LINE-1 or single gene methylation levels in FFPE tissue samples.
Epigenetic Differentiation of Natural Populations of Lilium bosniacum Associated with Contrasting Habitat Conditions.

PubMed

Zoldoš, Vlatka; Biruš, Ivan; Muratovic, Edina; Šatovic, Zlatko; Vojta, Aleksandar; Robin, Odile; Pustahija, Fatima; Bogunic, Faruk; Vicic Bockor, Vedrana; Siljak-Yakovlev, Sonja

2018-01-01

Epigenetic variation in natural populations with contrasting habitats might be an important element, in addition to the genetic variation, in plant adaptation to environmental stress. Here, we assessed genetic, epigenetic, and cytogenetic structure of the three Lilium bosniacum populations growing on distinct habitats. One population was growing under habitual ecological conditions for this species and the other two were growing under stress associated with high altitude and serpentine soil. Amplified fragment length polymorphism and methylation-sensitive amplification polymorphism analyses revealed that the three populations did not differentiate genetically, but were clearly separated in three distinct clusters according to DNA methylation profiles. Principal coordinate analysis showed that overall epigenetic variation was closely related to habitat conditions. A new methylation-sensitive amplification polymorphism scoring approach allowed identification of mainly unmethylated (φST = 0.190) and fully CpG methylated (φST = 0.118) subepiloci playing a role in overall population differentiation, in comparison with hemimethylated sites (φST = 0.073). In addition, unusual rDNA repatterning and the presence of B chromosomes bearing 5S rDNA loci were recorded in the population growing on serpentine soil, suggesting dynamic chromosome rearrangements probably linked to global genome demethylation, which might have reactivated some mobile elements. We discuss our results considering our earlier data on morphology and leaf anatomy of several L. bosniacum populations, and suggest a possible role of epigenetics as a key element in population differentiation associated with environmental stress in these particular lily populations. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Rotating night work, lifestyle factors, obesity and promoter methylation in BRCA1 and BRCA2 genes among nurses and midwives

PubMed Central

Bukowska, Agnieszka; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Reszka, Edyta

2017-01-01

Some recent evidence suggests that environmental and lifestyle factors may modify DNA methylation. We hypothesized that rotating night work and several modifiable factors may be associated with the methylation of the promoter regions within two tumor suppressor and DNA repair genes: BRCA1 and BRCA2. The methylation status of BRCA1 and BRCA2 was determined via qMSP reactions using DNA samples derived from blood leucocytes of 347 nurses and midwives working rotating nights and 363 working during the days. The subjects were classified into unmethylated vs methylated BRCA1 and BRCA2 when the methylation index was 0% or >0%, respectively. The adjusted odds ratios with 95% confidence intervals were calculated for night work status, smoking, obesity, physical activity and alcohol drinking. Current night shift work or night work history was not associated with methylation status of the promoter sites within BRCA1 and BRCA2 genes. We observed weak associations between smoking and the methylation status of BRCA1 with OR = 1.50 (95%CI: 0.98–2.29) for current smoking, OR = 1.83, 95CI: 1.08–3.13 for smoking longer than 31 years, and 0.1>p>0.05 for trends for the number of cigarettes per day, smoking duration and packyears. In conclusion, no links between night shift work and methylation of the promoter region within the BRCA1, and BRCA2 genes were observed in this exploratory analysis. The findings of our study weakly support the hypothesis that smoking may contribute to epigenetic events. PMID:28594926
An epigenetic switch regulates de novo DNA methylation at a subset of pluripotency gene enhancers during embryonic stem cell differentiation.

PubMed

Petell, Christopher J; Alabdi, Lama; He, Ming; San Miguel, Phillip; Rose, Richard; Gowher, Humaira

2016-09-19

Coordinated regulation of gene expression that involves activation of lineage specific genes and repression of pluripotency genes drives differentiation of embryonic stem cells (ESC). For complete repression of pluripotency genes during ESC differentiation, chromatin at their enhancers is silenced by the activity of the Lsd1-Mi2/NuRD complex. The mechanism/s that regulate DNA methylation at these enhancers are largely unknown. Here, we investigated the affect of the Lsd1-Mi2/NuRD complex on the dynamic regulatory switch that induces the local interaction of histone tails with the Dnmt3 ATRX-DNMT3-DNMT3L (ADD) domain, thus promoting DNA methylation at the enhancers of a subset of pluripotency genes. This is supported by previous structural studies showing a specific interaction between Dnmt3-ADD domain with H3K4 unmethylated histone tails that is disrupted by histone H3K4 methylation and histone acetylation. Our data suggest that Dnmt3a activity is triggered by Lsd1-Mi2/NuRD-mediated histone deacetylation and demethylation at these pluripotency gene enhancers when they are inactivated during mouse ESC differentiation. Using Dnmt3 knockout ESCs and the inhibitors of Lsd1 and p300 histone modifying enzymes during differentiation of E14Tg2A and ZHBTc4 ESCs, our study systematically reveals this mechanism and establishes that Dnmt3a is both reader and effector of the epigenetic state at these target sites. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
An epigenetic switch regulates de novo DNA methylation at a subset of pluripotency gene enhancers during embryonic stem cell differentiation

PubMed Central

Petell, Christopher J.; Alabdi, Lama; He, Ming; San Miguel, Phillip; Rose, Richard; Gowher, Humaira

2016-01-01

Coordinated regulation of gene expression that involves activation of lineage specific genes and repression of pluripotency genes drives differentiation of embryonic stem cells (ESC). For complete repression of pluripotency genes during ESC differentiation, chromatin at their enhancers is silenced by the activity of the Lsd1-Mi2/NuRD complex. The mechanism/s that regulate DNA methylation at these enhancers are largely unknown. Here, we investigated the affect of the Lsd1-Mi2/NuRD complex on the dynamic regulatory switch that induces the local interaction of histone tails with the Dnmt3 ATRX-DNMT3-DNMT3L (ADD) domain, thus promoting DNA methylation at the enhancers of a subset of pluripotency genes. This is supported by previous structural studies showing a specific interaction between Dnmt3-ADD domain with H3K4 unmethylated histone tails that is disrupted by histone H3K4 methylation and histone acetylation. Our data suggest that Dnmt3a activity is triggered by Lsd1-Mi2/NuRD-mediated histone deacetylation and demethylation at these pluripotency gene enhancers when they are inactivated during mouse ESC differentiation. Using Dnmt3 knockout ESCs and the inhibitors of Lsd1 and p300 histone modifying enzymes during differentiation of E14Tg2A and ZHBTc4 ESCs, our study systematically reveals this mechanism and establishes that Dnmt3a is both reader and effector of the epigenetic state at these target sites. PMID:27179026
Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

PubMed

Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

2001-06-15

Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.
Determination of DNA methylation associated with Acer rubrum (red maple) adaptation to metals: analysis of global DNA modifications and methylation-sensitive amplified polymorphism.

PubMed

Kim, Nam-Soo; Im, Min-Ji; Nkongolo, Kabwe

2016-08-01

Red maple (Acer rubum), a common deciduous tree species in Northern Ontario, has shown resistance to soil metal contamination. Previous reports have indicated that this plant does not accumulate metals in its tissue. However, low level of nickel and copper corresponding to the bioavailable levels in contaminated soils in Northern Ontario causes severe physiological damages. No differentiation between metal-contaminated and uncontaminated populations has been reported based on genetic analyses. The main objective of this study was to assess whether DNA methylation is involved in A. rubrum adaptation to soil metal contamination. Global cytosine and methylation-sensitive amplified polymorphism (MSAP) analyses were carried out in A. rubrum populations from metal-contaminated and uncontaminated sites. The global modified cytosine ratios in genomic DNA revealed a significant decrease in cytosine methylation in genotypes from a metal-contaminated site compared to uncontaminated populations. Other genotypes from a different metal-contaminated site within the same region appear to be recalcitrant to metal-induced DNA alterations even ≥30 years of tree life exposure to nickel and copper. MSAP analysis showed a high level of polymorphisms in both uncontaminated (77%) and metal-contaminated (72%) populations. Overall, 205 CCGG loci were identified in which 127 were methylated in either outer or inner cytosine. No differentiation among populations was established based on several genetic parameters tested. The variations for nonmethylated and methylated loci were compared by analysis of molecular variance (AMOVA). For methylated loci, molecular variance among and within populations was 1.5% and 13.2%, respectively. These values were low (0.6% for among populations and 5.8% for within populations) for unmethylated loci. Metal contamination is seen to affect methylation of cytosine residues in CCGG motifs in the A. rubrum populations that were analyzed.
Cytosine Methylation Effects on the Repair of O6-Methylguanines within CG Dinucleotides*

PubMed Central

Guza, Rebecca; Ma, Linan; Fang, Qingming; Pegg, Anthony E.; Tretyakova, Natalia

2009-01-01

O6-Alkyldeoxyguanine adducts induced by tobacco-specific nitrosamines are repaired by O6-alkylguanine DNA alkyltransferase (AGT), which transfers the O6-alkyl group from the damaged base to a cysteine residue within the protein. In the present study, a mass spectrometry-based approach was used to analyze the effects of cytosine methylation on the kinetics of AGT repair of O6-methyldeoxyguanosine (O6-Me-dG) adducts placed within frequently mutated 5′-CG-3′ dinucleotides of the p53 tumor suppressor gene. O6-Me-dG-containing DNA duplexes were incubated with human recombinant AGT protein, followed by rapid quenching, acid hydrolysis, and isotope dilution high pressure liquid chromatography-electrospray ionization tandem mass spectrometry analysis of unrepaired O6-methylguanine. Second-order rate constants were calculated in the absence or presence of the C-5 methyl group at neighboring cytosine residues. We found that the kinetics of AGT-mediated repair of O6-Me-dG were affected by neighboring 5-methylcytosine (MeC) in a sequence-dependent manner. AGT repair of O6-Me-dG adducts placed within 5′-CG-3′ dinucleotides of p53 codons 245 and 248 was hindered when MeC was present in both DNA strands. In contrast, cytosine methylation within p53 codon 158 slightly increased the rate of O6-Me-dG repair by AGT. The effects of MeC located immediately 5′ and in the base paired position to O6-Me-dG were not additive as revealed by experiments with hypomethylated sequences. Furthermore, differences in dealkylation rates did not correlate with AGT protein affinity for cytosine-methylated and unmethylated DNA duplexes or with the rates of AGT-mediated nucleotide flipping, suggesting that MeC influences other kinetic steps involved in repair, e.g. the rate of alkyl transfer from DNA to AGT. PMID:19531487
Cytosine methylation effects on the repair of O6-methylguanines within CG dinucleotides.

PubMed

Guza, Rebecca; Ma, Linan; Fang, Qingming; Pegg, Anthony E; Tretyakova, Natalia

2009-08-21

O(6)-alkyldeoxyguanine adducts induced by tobacco-specific nitrosamines are repaired by O(6)-alkylguanine DNA alkyltransferase (AGT), which transfers the O(6)-alkyl group from the damaged base to a cysteine residue within the protein. In the present study, a mass spectrometry-based approach was used to analyze the effects of cytosine methylation on the kinetics of AGT repair of O(6)-methyldeoxyguanosine (O(6)-Me-dG) adducts placed within frequently mutated 5'-CG-3' dinucleotides of the p53 tumor suppressor gene. O(6)-Me-dG-containing DNA duplexes were incubated with human recombinant AGT protein, followed by rapid quenching, acid hydrolysis, and isotope dilution high pressure liquid chromatography-electrospray ionization tandem mass spectrometry analysis of unrepaired O(6)-methylguanine. Second-order rate constants were calculated in the absence or presence of the C-5 methyl group at neighboring cytosine residues. We found that the kinetics of AGT-mediated repair of O(6)-Me-dG were affected by neighboring 5-methylcytosine ((Me)C) in a sequence-dependent manner. AGT repair of O(6)-Me-dG adducts placed within 5'-CG-3' dinucleotides of p53 codons 245 and 248 was hindered when (Me)C was present in both DNA strands. In contrast, cytosine methylation within p53 codon 158 slightly increased the rate of O(6)-Me-dG repair by AGT. The effects of (Me)C located immediately 5' and in the base paired position to O(6)-Me-dG were not additive as revealed by experiments with hypomethylated sequences. Furthermore, differences in dealkylation rates did not correlate with AGT protein affinity for cytosine-methylated and unmethylated DNA duplexes or with the rates of AGT-mediated nucleotide flipping, suggesting that (Me)C influences other kinetic steps involved in repair, e.g. the rate of alkyl transfer from DNA to AGT.
Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842
Viral load, integration and methylation of E2BS3 and 4 in human papilloma virus (HPV) 16-positive vaginal and vulvar carcinomas.

PubMed

Lillsunde Larsson, Gabriella; Helenius, Gisela; Sorbe, Bengt; Karlsson, Mats G

2014-01-01

To investigate if viral load, integration and methylation of E2BS3 and 4 represent different ways of tumor transformation in vaginal and vulvar carcinoma and to elucidate its clinical impact. Fifty-seven samples, positive for HPV16, were selected for the study. Detection of viral load was made with realtime-PCR using copy numbers of E6 and integration was calculated from comparing E2 to E6-copies. Methylation of E2BS3 and 4 was analysed using bisulphite treatment of tumor DNA, followed by PCR and pyrosequencing. Vaginal tumors were found to have a higher viral load (p = 0.024) compared to vulvar tumors but a high copy number (> median value, 15,000) as well as high methylation (>50%) was significantly (p = 0.010 and p = 0.045) associated with a worse cancer-specific survival rate in vulvar carcinoma, but not in vaginal carcinoma. Four groups could be defined for the complete series using a Cluster Two step analysis; (1) tumors holding episomal viral DNA, viral load below 150,000 copies not highly methylated (n = 25, 46.3%); (2) tumors harboring episomal viral DNA and being highly methylated (>50%; n = 6, 11.1%); (3) tumors with viral DNA fully integrated (n = 11, 20.4%), and (4) tumors harboring episomal viral DNA and being medium- or unmethylated (<50%) and having a high viral load (> total mean value 150,000; n = 12, 22.2%). The completely integrated tumors were found to be distinct group, whilst some overlap between the groups with high methylation and high viral load was observed. HPV16- related integration, methylation in E2BS3 and 4 and viral load may represent different viral characteristics driving vaginal and vulvar carcinogenesis. HPV16- related parameters were found to be of clinical importance in the vulvar series only.
DNA Methylation Mediated Control of Gene Expression Is Critical for Development of Crown Gall Tumors

PubMed Central

Kneitz, Susanne; Weber, Dana; Fuchs, Joerg; Hedrich, Rainer; Deeken, Rosalia

2013-01-01

Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA–encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA) in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA–mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes regulate gene expression, physiological processes, and the development of crown gall tumors. PMID:23408907
Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway

PubMed Central

Cho, Nam-Yun; Kang, Gyeong Hoon

2016-01-01

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps. PMID:26883113
Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway.

PubMed

Kim, Jung Ho; Bae, Jeong Mo; Cho, Nam-Yun; Kang, Gyeong Hoon

2016-03-22

The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps.
Novel adjuvants & delivery vehicles for vaccines development: a road ahead.

PubMed

Mohan, Teena; Verma, Priyanka; Rao, D Nageswara

2013-11-01

The pure recombinant and synthetic antigens used in modern day vaccines are generally less immunogenic than older style live/attenuated and killed whole organism vaccines. One can improve the quality of vaccine production by incorporating immunomodulators or adjuvants with modified delivery vehicles viz. liposomes, immune stimulating complexes (ISCOMs), micro/nanospheres apart from alum, being used as gold standard. Adjuvants are used to augment the effect of a vaccine by stimulating the immune system to respond to the vaccine, more vigorously, and thus providing increased immunity to a particular disease. Adjuvants accomplish this task by mimicking specific sets of evolutionary conserved molecules which include lipopolysaccharides (LPS), components of bacterial cell wall, endocytosed nucleic acids such as dsRNA, ssDNA and unmethylated CpG dinucleotide containing DNA. This review provides information on various vaccine adjuvants and delivery vehicles being developed to date. From literature, it seems that the humoral immune responses have been observed for most adjuvants and delivery platforms while viral-vector, ISCOMs and Montanides have shown cytotoxic T-cell response in the clinical trials. MF59 and MPL® have elicited Th1 responses, and virus-like particles (VLPs), non-degradable nanoparticle and liposomes have also generated cellular immunity. Such vaccine components have also been evaluated for alternative routes of administration with clinical success reported for intranasal delivery of viral-vectors and proteosomes and oral delivery of VLP vaccines.
Novel adjuvants & delivery vehicles for vaccines development: A road ahead

PubMed Central

Mohan, Teena; Verma, Priyanka; Rao, D. Nageswara

2013-01-01

The pure recombinant and synthetic antigens used in modern day vaccines are generally less immunogenic than older style live/attenuated and killed whole organism vaccines. One can improve the quality of vaccine production by incorporating immunomodulators or adjuvants with modified delivery vehicles viz. liposomes, immune stimulating complexes (ISCOMs), micro/nanospheres apart from alum, being used as gold standard. Adjuvants are used to augment the effect of a vaccine by stimulating the immune system to respond to the vaccine, more vigorously, and thus providing increased immunity to a particular disease. Adjuvants accomplish this task by mimicking specific sets of evolutionary conserved molecules which include lipopolysaccharides (LPS), components of bacterial cell wall, endocytosed nucleic acids such as dsRNA, ssDNA and unmethylated CpG dinucleotide containing DNA. This review provides information on various vaccine adjuvants and delivery vehicles being developed to date. From literature, it seems that the humoral immune responses have been observed for most adjuvants and delivery platforms while viral-vector, ISCOMs and Montanides have shown cytotoxic T-cell response in the clinical trials. MF59 and MPL® have elicited Th1 responses, and virus-like particles (VLPs), non-degradable nanoparticle and liposomes have also generated cellular immunity. Such vaccine components have also been evaluated for alternative routes of administration with clinical success reported for intranasal delivery of viral-vectors and proteosomes and oral delivery of VLP vaccines. PMID:24434331
Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study.

PubMed

Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi

2017-05-01

Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.
Role of innate immunity and the microbiota in liver fibrosis: crosstalk between the liver and gut

PubMed Central

Seki, Ekihiro; Schnabl, Bernd

2012-01-01

Liver fibrosis occurs as a wound-healing scar response following chronic liver inflammation including alcoholic liver disease, non-alcoholic steatohepatitis, viral hepatitis, cholestatic liver disease and autoimmune liver diseases. The liver has a unique vascular system within the gastrointestinal tract, as the majority of the liver's blood supply comes from the intestine through the portal vein. When the intestinal barrier function is disrupted, an increase in intestinal permeability leads to the translocation of intestine-derived bacterial products such as lipopolysaccharide (LPS) and unmethylated CpG containing DNA to the liver via the portal vein. These gut-derived bacterial products stimulate innate immune receptors, namely Toll-like receptors (TLRs), in the liver. TLRs are expressed on Kupffer cells, endothelial cells, dendritic cells, biliary epithelial cells, hepatic stellate cells, and hepatocytes. TLRs activate these cells to contribute to acute and chronic liver diseases. This review summarizes recent studies investigating the role of TLRs, intestinal microbiota and bacterial translocation in liver fibrosis, alcoholic liver disease and non-alcoholic steatohepatitis. PMID:22124143
MGMT promoter methylation in Peruvian patients with glioblastoma

PubMed Central

Belmar-Lopez, Carolina; Castaneda, Carlos A; Castillo, Miluska; García-Corrochano, Pamela; Orrego, Enrique; Meléndez, Barbara; Casavilca, Sandro; Flores, Claudio; Orrego, Enrique

2018-01-01

Purpose O6-methylguanine–DNA methyltransferase (MGMT) promoter methylation predicts the outcome and response to alkylating chemotherapy in glioblastoma. The aim of this study is to evaluate the prevalence of MGMT methylation in Peruvian glioblastoma cases. Patients and methods We evaluated retrospectively 50 cases of resected glioblastoma during the period 2008–2013 at Instituto Nacional de Enfermedades Neoplasicas in Peru. Samples consisted of paraffin embedded and frozen tumour tissue. MGMT-promoter methylation status and the expression level of MGMT gene were evaluated by methylation-specific PCR and real-time PCR, respectively. Results Unmethylated, methylated and partially methylated statuses were found in 54%, 20% and 26% of paraffin-embedded samples, respectively. Methylation status was confirmed in the Virgen de la Salud Hospital and frozen samples. There was an association between the status of MGMT-promoter methylation and the level of gene expression (p = 0.001). Methylation was associated with increased progression-free survival (p = 0.002) and overall survival (OS) (p < 0.001). Conclusion MGMT-promoter methylation frequency in Peruvian glioblastoma is similar to that reported in other populations and the detection test has been standardised. PMID:29515653
Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
CpG methylation of APC promoter 1A in sporadic and familial breast cancer patients.

PubMed

Debouki-Joudi, Saoussen; Trifa, Fatma; Khabir, Abdelmajid; Sellami-Boudawara, Tahia; Frikha, Mounir; Daoud, Jamel; Mokdad-Gargouri, Raja

2017-01-01

Tumour suppressor gene (TSG) silencing through promoter hypermethylation plays an important role in cancer initiation. The aim of this study was to assess the extent of methylation of APC gene promoter in 91 sporadic and 44 familial cases of Tunisian patients with breast cancer (BC) in. The frequency of APC promoter methylation is somewhat similar for sporadic and familial breast cancer cases, (52.1%, and 54.5% respectively). For sporadic breast cancer patients, there was a significant correlation of APC promoter hypermethylation with TNM stage (p = 0.024) and 3-year survival (p = 0.025). Regarding the hormonal status (HR), we found significant association between negativity to PR and unmethylated APC (p= 0.005) while ER and Her2/neu are not correlated. Moreover, unmethylated APC promoter is more frequent in tumours expressing at least one out the 3 proteins compared to triple negative cases (p= 0.053). On the other hand, aberrant methylation of APC was associated with tumour size (p = 0.036), lymph node (p = 0.028), distant metastasis (p = 0.031), and 3-year survival (p = 0.046) in the group of patients with familial breast cancer. Moreover, patients with sporadic breast cancer displaying the unmethylated profile have a significant prolonged overall survival compared to those with the methylated pattern of APC promoter (p log rank = 0.008). Epigenetic change at the CpG islands in the APC promoter was associated with the silence of its transcript and the loss of protein expression suggesting that this event is the main mechanism regulating the APC expression in breast cancer. In conclusion, our data showed that the loss of APC through aberrant methylation is associated with the aggressive behavior of both sporadic and familial breast cancer in Tunisian patients.
Photoelectrochemical biosensor for HEN1 RNA methyltransferase detection using peroxidase mimics PtCu NFs and poly(U) polymerase-mediated RNA extension.

PubMed

Wang, Haiyan; Zhu, Libang; Duan, Junling; Wang, Minghui; Yin, Huanshun; Wang, Po; Ai, Shiyun

2018-04-30

2'-O-methyl group on the 3' terminal nucleotide in plant microRNAs, as one kind of RNA methylations, is caused by HEN1 RNA methyltransferase (HENMT1), which is thought to be crucial for ribosome biogenesis and function. Herein, a simple and label-free PEC biosensing method was proposed for assay of HENMT1 activity and inhibitor screening based on peroxidase mimic PtCu nanoframes (PtCu NFs) catalytic signal amplification. In this work, MoS 2 @Graphene quantum dots/Phosphorus-doped rodlike carbon nitride (MoS 2 @GQDs/P-RCN) heterojunction was used as photoactive materials. With the doping of GQDs and the formation of heterojunction, the photoactivity of MoS 2 is greatly improved. After the double-stranded RNA (dsRNA) with 2 nt 3' overhangs was treated with HENMT1 in the presence of S-adenosyl-L-methionine, the 3' terminal nucleotide of the unmethylated dsRNA could be extended under the catalysis of the poly(U) polymerase in the existence of UTP. Poly(A) nucleotide chain modified with carboxyl group was captured on the electrode surface through hybridization reaction and acted as a bridge for the immobilization of reticular DNA-functionalized PtCu NFs (PtCu@DNA). Under the catalysis effect of peroxidase mimics PtCu@DNA towards hydrogen peroxide, O 2- was in situ generated as electron donor and a strong photocurrent was obtained. The proposed PEC bioassay exhibited high selectivity and low detection limit of 3.36ng/mL for HENMT1 activity assay. Furthermore, the inhibition research indicated that chlorpyrifos could inhibit the HENMT1 activity with the IC 50 value of 48.32nM. Copyright © 2017 Elsevier B.V. All rights reserved.

MethyLight droplet digital PCR for detection and absolute quantification of infrequently methylated alleles.

PubMed

Yu, Ming; Carter, Kelly T; Makar, Karen W; Vickers, Kathy; Ulrich, Cornelia M; Schoen, Robert E; Brenner, Dean; Markowitz, Sanford D; Grady, William M

2015-01-01

Aberrant DNA methylation is a common epigenetic alteration found in colorectal adenomas and cancers and plays a role in cancer initiation and progression. Aberrantly methylated DNA loci can also be found infrequently present in normal colon tissue, where they seem to have potential to be used as colorectal cancer (CRC) risk biomarkers. However, detection and precise quantification of the infrequent methylation events seen in normal colon is likely beyond the capability of commonly used PCR technologies. To determine the potential for methylated DNA loci as CRC risk biomarkers, we developed MethyLight droplet digital PCR (ddPCR) assays and compared their performance to the widely used conventional MethyLight PCR. Our analyses demonstrated the capacity of MethyLight ddPCR to detect a single methylated NTRK3 allele from among more than 3125 unmethylated alleles, 25-fold more sensitive than conventional MethyLight PCR. The MethyLight ddPCR assay detected as little as 19 and 38 haploid genome equivalents of methylated EVL and methylated NTRK3, respectively, which far exceeded conventional MethyLight PCR (379 haploid genome equivalents for both genes). When assessing methylated EVL levels in CRC tissue samples, MethyLight ddPCR reduced coefficients of variation (CV) to 6-65% of CVs seen with conventional MethyLight PCR. Importantly, we showed the ability of MethyLight ddPCR to detect infrequently methylated EVL alleles in normal colon mucosa samples that could not be detected by conventional MethyLight PCR. This study suggests that the sensitivity and precision of methylation detection by MethyLight ddPCR enhances the potential of methylated alleles for use as CRC risk biomarkers.
Heme oxygenase up-regulation under ultraviolet-B radiation is not epigenetically restricted and involves specific stress-related transcriptions factors.

PubMed

Santa-Cruz, Diego; Pacienza, Natalia; Zilli, Carla; Pagano, Eduardo; Balestrasse, Karina; Yannarelli, Gustavo

2017-08-01

Heme oxygenase-1 (HO-1) plays a protective role against oxidative stress in plants. The mechanisms regulating its expression, however, remain unclear. Here we studied the methylation state of a GC rich HO-1 promoter region and the expression of several stress-related transcription factors (TFs) in soybean plants subjected to ultraviolet-B (UV-B) radiation. Genomic DNA and total RNA were isolated from leaves of plants irradiated with 7.5 and 15kJm-2 UV-B. A 304bp HO-1 promoter region was amplified by PCR from sodium bisulfite-treated DNA, cloned into pGEMT plasmid vector and evaluated by DNA sequencing. Bisulfite sequencing analysis showed similar HO-1 promoter methylation levels in control and UV-B-treated plants (C: 3.4±1.3%; 7.5: 2.6±0.5%; 15: 3.1±1.1%). Interestingly, HO-1 promoter was strongly unmethylated in control plants. Quantitative RT-PCR analysis of TFs showed that GmMYB177, GmMYBJ6, GmWRKY21, GmNAC11, GmNAC20 and GmGT2A but not GmWRK13 and GmDREB were induced by UV-B radiation. The expression of several TFs was also enhanced by hemin, a potent and specific HO inducer, inferring that they may mediate HO-1 up-regulation. These results suggest that soybean HO-1 gene expression is not epigenetically regulated. Moreover, the low level of HO-1 promoter methylation suggests that this antioxidant enzyme can rapidly respond to environmental stress. Finally, this study has identified some stress-related TFs involved in HO-1 up-regulation under UV-B radiation. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
B Cell Activation by Outer Membrane Vesicles—A Novel Virulence Mechanism

PubMed Central

Perez Vidakovics, Maria Laura A.; Jendholm, Johan; Mörgelin, Matthias; Månsson, Anne; Larsson, Christer; Cardell, Lars-Olaf; Riesbeck, Kristian

2010-01-01

Secretion of outer membrane vesicles (OMV) is an intriguing phenomenon of Gram-negative bacteria and has been suggested to play a role as virulence factors. The respiratory pathogens Moraxella catarrhalis reside in tonsils adjacent to B cells, and we have previously shown that M. catarrhalis induce a T cell independent B cell response by the immunoglobulin (Ig) D-binding superantigen MID. Here we demonstrate that Moraxella are endocytosed and killed by human tonsillar B cells, whereas OMV have the potential to interact and activate B cells leading to bacterial rescue. The B cell response induced by OMV begins with IgD B cell receptor (BCR) clustering and Ca2+ mobilization followed by BCR internalization. In addition to IgD BCR, TLR9 and TLR2 were found to colocalize in lipid raft motifs after exposure to OMV. Two components of the OMV, i.e., MID and unmethylated CpG-DNA motifs, were found to be critical for B cell activation. OMV containing MID bound to and activated tonsillar CD19+ IgD+ lymphocytes resulting in IL-6 and IgM production in addition to increased surface marker density (HLA-DR, CD45, CD64, and CD86), whereas MID-deficient OMV failed to induce B cell activation. DNA associated with OMV induced full B cell activation by signaling through TLR9. Importantly, this concept was verified in vivo, as OMV equipped with MID and DNA were found in a 9-year old patient suffering from Moraxella sinusitis. In conclusion, Moraxella avoid direct interaction with host B cells by redirecting the adaptive humoral immune response using its superantigen-bearing OMV as decoys. PMID:20090836
DNA demethylation and histone H3K9 acetylation determine the active transcription of the NKG2D gene in human CD8+ T and NK cells

PubMed Central

Fernández-Sánchez, Alba; Baragaño Raneros, Aroa; Carvajal Palao, Reyes; Sanz, Ana B.; Ortiz, Alberto; Ortega, Francisco; Suárez-Álvarez, Beatriz; López-Larrea, Carlos

2013-01-01

The human activating receptor NKG2D is mainly expressed by NK, NKT, γδ T and CD8+ T cells and, under certain conditions, by CD4+ T cells. This receptor recognizes a diverse family of ligands (MICA, MICB and ULBPs 1–6) leading to the activation of effector cells and triggering the lysis of target cells. The NKG2D receptor-ligand system plays an important role in the immune response to infections, tumors, transplanted graft and autoantigens. Elucidation of the regulatory mechanisms of NKG2D is therefore essential for therapeutic purposes. In this study, we speculate whether epigenetic mechanisms, such as DNA methylation and histone acetylation, participate in NKG2D gene regulation in T lymphocytes and NK cells. DNA methylation in the NKG2D gene was observed in CD4+ T lymphocytes and T cell lines (Jurkat and HUT78), while this gene was unmethylated in NKG2D-positive cells (CD8+ T lymphocytes, NK cells and NKL cell line) and associated with high levels of histone H3 lysine 9 acetylation (H3K9Ac). Treatment with the histone acetyltransferase (HAT) inhibitor curcumin reduces H3K9Ac levels in the NKG2D gene, downregulates NKG2D transcription and leads to a marked reduction in the lytic capacity of NKG2D-mediated NKL cells. These findings suggest that differential NKG2D expression in the different cell subsets is regulated by epigenetic mechanisms and that its modulation by epigenetic treatments might provide a new strategy for treating several pathologies. PMID:23235109
Research on DNA methylation of human osteosarcoma cell MGMT and its relationship with cell resistance to alkylating agents.

PubMed

Guo, Jun; Cui, Qiu; Jiang, WeiHao; Liu, Cheng; Li, DingFeng; Zeng, Yanjun

2013-08-01

The objective of this study was to explore the O(6)-methylguanine-DNA methyltransferase (MGMT) gene methylation status and its protein expression, as well as the effects of demethylating agent 5-Aza-2'-deoxycytidine (5-Aza-CdR) on MGMT gene expression and its resistance to alkylating agents, and to elucidate MGMT expression mechanism and significance in osteosarcoma. The human osteosarcoma cell lines Saos-2 and MG-63 were collected and treated with 5-Aza-CdR for 6 days. The cells not treated with 5-Aza-CdR were set as a negative control. The genomic DNA was extracted from the Saos-2 and MG-63 cells using methylation-specific PCR to detect the promoter CpG island methylation status of the MGMT gene. Cell sensitivity to alkylating agents before and after drug administration was detected by the MTT method. The variation in MGMT gene mRNA and protein was detected by reverse transcription PCR (RT-PCR) and Western blotting. The MGMT promoter gene of normal Saos-2 cells was methylated, with reduced MGMT mRNA and protein expression; the MGMT mRNA and protein expression of Saos-2 cells treated with 5-Aza-CdR was obviously enhanced, and its sensitivity to alkylating agents was reversed. Meanwhile, with promoter CpG island unmethylation of the MGMT gene, MGMT protein was expressed in the normal MG-63 cells and the MG-63 cells treated with 5-Aza-CdR, and both showed resistance to alkylating agents. The methylation status of the MGMT gene promoter in human osteosarcoma cells reflected the cells' ability to induce MGMT protein expression and can be used as a molecular marker to project the sensitivity of cancer tissues to alkylating agent drugs.
Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates.

PubMed

Guo, Xiaoge; Jinks-Robertson, Sue

2013-12-01

Gap-repair assays have been an important tool for studying the genetic control of homologous recombination in yeast. Sequence analysis of recombination products derived when a gapped plasmid is diverged relative to the chromosomal repair template additionally has been used to infer structures of strand-exchange intermediates. In the absence of the canonical mismatch repair pathway, mismatches present in these intermediates are expected to persist and segregate at the next round of DNA replication. In a mismatch repair defective (mlh1Δ) background, however, we have observed that recombination-generated mismatches are often corrected to generate gene conversion or restoration events. In the analyses reported here, the source of the aberrant mismatch removal during gap repair was examined. We find that most mismatch removal is linked to the methylation status of the plasmid used in the gap-repair assay. Whereas more than half of Dam-methylated plasmids had patches of gene conversion and/or restoration interspersed with unrepaired mismatches, mismatch removal was observed in less than 10% of products obtained when un-methylated plasmids were used in transformation experiments. The methylation-linked removal of mismatches in recombination intermediates was due specifically to the nucleotide excision repair pathway, with such mismatch removal being partially counteracted by glycosylases of the base excision repair pathway. These data demonstrate that nucleotide excision repair activity is not limited to bulky, helix-distorting DNA lesions, but also targets removal of very modest perturbations in DNA structure. In addition to its effects on mismatch removal, methylation reduced the overall gap-repair efficiency, but this reduction was not affected by the status of excision repair pathways. Finally, gel purification of DNA prior to transformation reduced gap-repair efficiency four-fold in a nucleotide excision repair-defective background, indicating that the collateral introduction of UV damage can potentially compromise genetic interpretations. Copyright © 2013 Elsevier B.V. All rights reserved.
Removal of N-6-methyladenine by the nucleotide excision repair pathway triggers the repair of mismatches in yeast gap-repair intermediates

PubMed Central

Guo, Xiaoge; Jinks-Robertson, Sue

2013-01-01

Gap-repair assays have been an important tool for studying the genetic control of homologous recombination in yeast. Sequence analysis of recombination products derived when a gapped plasmid is diverged relative to the chromosomal repair template additionally has been used to infer structures of strand-exchange intermediates. In the absence of the canonical mismatch repair pathway, mismatches present in these intermediates are expected to persist and segregate at the next round of DNA replication. In a mismatch repair defective (mlh1Δ) background, however, we have observed that recombination-generated mismatches are often corrected to generate gene conversion or restoration events. In the analyses reported here, the source of the aberrant mismatch removal during gap repair was examined. We find that most mismatch removal is linked to the methylation status of the plasmid used in the gap-repair assay. Whereas more than half of Dam-methylated plasmids had patches of gene conversion and/or restoration interspersed with unrepaired mismatches, mismatch removal was observed in less than 10% of products obtained when un-methylated plasmids were used in transformation experiments. The methylation-linked removal of mismatches in recombination intermediates was due specifically to the nucleotide excision repair pathway, with such mismatch removal being partially counteracted by glycosylases of the base excision repair pathway. These data demonstrate that nucleotide excision repair activity is not limited to bulky, helix-distorting DNA lesions, but also targets removal of very modest perturbations in DNA structure. In addition to its effects on mismatch removal, methylation reduced the overall gap-repair efficiency, but this reduction was not affected by the status of excision repair pathways. Finally, gel purification of DNA prior to transformation reduced gap-repair efficiency four-fold in a nucleotide excision repair-defective background, indicating that the cillateral introduction of UV damage can potentially compromise genetic interpretations. PMID:24120148
RUNX3 promoter hypermethylation is frequent in leukaemia cell lines and associated with acute myeloid leukaemia inv(16) subtype.

PubMed

Estécio, Marcos R H; Maddipoti, Sirisha; Bueso-Ramos, Carlos; DiNardo, Courtney D; Yang, Hui; Wei, Yue; Kondo, Kimie; Fang, Zhihong; Stevenson, William; Chang, Kun-Sang; Pierce, Sherry A; Bohannan, Zachary; Borthakur, Gautam; Kantarjian, Hagop; Garcia-Manero, Guillermo

2015-05-01

Correlative and functional studies support the involvement of the RUNX gene family in haematological malignancies. To elucidate the role of epigenetics in RUNX inactivation, we evaluated promoter DNA methylation of RUNX1, 2, and 3 in 23 leukaemia cell lines and samples from acute myeloid leukaemia (AML), acute lymphocytic leukaemia (ALL) and myelodysplatic syndromes (MDS) patients. RUNX1 and RUNX2 gene promoters were mostly unmethylated in cell lines and clinical samples. Hypermethylation of RUNX3 was frequent among cell lines (74%) and highly variable among patient samples, with clear association to cytogenetic status. High frequency of RUNX3 hypermethylation (85% of the 20 studied cases) was found in AML patients with inv(16)(p13.1q22) compared to other AML subtypes (31% of the other 49 cases). RUNX3 hypermethylation was also frequent in ALL (100% of the six cases) but low in MDS (21%). In support of a functional role, hypermethylation of RUNX3 was correlated with low levels of protein, and treatment of cell lines with the DNA demethylating agent, decitabine, resulted in mRNA re-expression. Furthermore, relapse-free survival of non-inv(16)(p13.1q22) AML patients without RUNX3 methylation was significantly better (P = 0·016) than that of methylated cases. These results suggest that RUNX3 silencing is an important event in inv(16)(p13.1q22) leukaemias. © 2015 John Wiley & Sons Ltd.
Parp inhibition prevents ten-eleven translocase enzyme activation and hyperglycemia-induced DNA demethylation.

PubMed

Dhliwayo, Nyembezi; Sarras, Michael P; Luczkowski, Ernest; Mason, Samantha M; Intine, Robert V

2014-09-01

Studies from human cells, rats, and zebrafish have documented that hyperglycemia (HG) induces the demethylation of specific cytosines throughout the genome. We previously documented that a subset of these changes become permanent and may provide, in part, a mechanism for the persistence of complications referred to as the metabolic memory phenomenon. In this report, we present studies aimed at elucidating the molecular machinery that is responsible for the HG-induced DNA demethylation observed. To this end, RNA expression and enzymatic activity assays indicate that the ten-eleven translocation (Tet) family of enzymes are activated by HG. Furthermore, through the detection of intermediates generated via conversion of 5-methyl-cytosine back to the unmethylated form, the data were consistent with the use of the Tet-dependent iterative oxidation pathway. In addition, evidence is provided that the activity of the poly(ADP-ribose) polymerase (Parp) enzyme is required for activation of Tet activity because the use of a Parp inhibitor prevented demethylation of specific loci and the accumulation of Tet-induced intermediates. Remarkably, this inhibition was accompanied by a complete restoration of the tissue regeneration deficit that is also induced by HG. The ultimate goal of this work is to provide potential new avenues for therapeutic discovery. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
High-resolution analysis of CpG methylation and in vivo protein-DNA interactions at the alternative Epstein-Barr virus latency promoters Qp and Cp in the nasopharyngeal carcinoma cell line C666-1.

PubMed

Bakos, Agnes; Banati, Ferenc; Koroknai, Anita; Takacs, Maria; Salamon, Daniel; Minarovits-Kormuta, Susanna; Schwarzmann, Fritz; Wolf, Hans; Niller, Hans Helmut; Minarovits, Janos

2007-10-01

Transcripts for the Epstein-Barr virus (EBV) encoded nuclear antigens (EBNAs) are initiated at alternative promoters (Wp, Cp, for EBNA 1-6 transcripts and Qp, for EBNA 1 transcripts only) located in the BamHI W, C or Q fragment of the viral genome. To understand the host-cell dependent expression of EBNAs in EBV-associated tumors (lymphomas and carcinomas) and in vitro transformed cell lines, it is necessary to analyse the regulatory mechanisms governing the activity of the alternative promoters of EBNA transcripts. Such studies focused mainly on lymphoid cell lines carrying latent EBV genomes, due to the lack of EBV-associated carcinoma cell lines maintaining latent EBV genomes during cultivation in tissue culture. We took advantage of the unique nasopharyngeal carcinoma cell line, C666-1, harboring EBV genomes, and undertook a detailed analysis of CpG methylation patterns and in vivo protein-DNA interactions at the latency promoters Qp and Cp. We found that the active, unmethylated Qp was marked with strong footprints of cellular transcription factors and the viral protein EBNA 1. In contrast, we could not detect binding of relevant transcription factors to the methylated, silent Cp. We concluded that the epigenetic marks at Qp and Cp in C666-1 cells of epithelial origin resemble those of group I Burkitt's lymphoma cell lines.
A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer

PubMed Central

Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav

2017-01-01

Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272
Dam and Dcm methylations prevent gene transfer into Clostridium pasteurianum NRRL B-598: development of methods for electrotransformation, conjugation, and sonoporation.

PubMed

Kolek, Jan; Sedlar, Karel; Provaznik, Ivo; Patakova, Petra

2016-01-01

Butanol is currently one of the most discussed biofuels. Its use provides many benefits in comparison to bio-ethanol, but the price of its fermentative production is still high. Genetic improvements could help solve many problems associated with butanol production during ABE fermentation, such as its toxicity, low concentration achievable in the cultivation medium, the need for a relatively expensive substrate, and many more. Clostridium pasteurianum NRRL B-598 is non-type strain producing butanol, acetone, and a negligible amount of ethanol. Its main benefits are high oxygen tolerance, utilization of a wide range of carbon and nitrogen sources, and the availability of its whole genome sequence. However, there is no established method for the transfer of foreign DNA into this strain; this is the next step necessary for progress in its use for butanol production. We have described functional protocols for conjugation and transformation of the bio-butanol producer C. pasteurianum NRRL B-598 by foreign plasmid DNA. We show that the use of unmethylated plasmid DNA is necessary for efficient transformation or successful conjugation. Genes encoding DNA methylation and those for restriction-modification systems and antibiotic resistance were searched for in the whole genome sequence and their homologies with other clostridial bacteria were determined. Furthermore, activity of described novel type I restriction system was proved experimentally. The described electrotransformation protocol achieved an efficiency 1.2 × 10(2) cfu/μg DNA after step-by-step optimization and an efficiency of 1.6 × 10(2) cfu/μg DNA was achieved by the sonoporation technique using a standard laboratory ultrasound bath. The highest transformation efficiency was achieved using a combination of these approaches; sono/electroporation led to an increase in transformation efficiency, to 5.3 × 10(2) cfu/μg DNA. Both Dam and Dcm methylations are detrimental for transformation of C. pasteurianum NRRL B-598. Methods for conjugation, electroporation, sonoporation, and a combined method for sono/electroporation were established for this strain. The methods described could be used for genetic improvement of this strain, which is suitable for bio-butanol production.
DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

PubMed

Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

2016-09-01

The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Transformable Rhodobacter strains, method for producing transformable Rhodobacter strains

DOEpatents

Laible, Philip D.; Hanson, Deborah K.

2018-05-08

The invention provides an organism for expressing foreign DNA, the organism engineered to accept standard DNA carriers. The genome of the organism codes for intracytoplasmic membranes and features an interruption in at least one of the genes coding for restriction enzymes. Further provided is a system for producing biological materials comprising: selecting a vehicle to carry DNA which codes for the biological materials; determining sites on the vehicle's DNA sequence susceptible to restriction enzyme cleavage; choosing an organism to accept the vehicle based on that organism not acting upon at least one of said vehicle's sites; engineering said vehicle to contain said DNA; thereby creating a synthetic vector; and causing the synthetic vector to enter the organism so as cause expression of said DNA.
Virus-like nanostructures for tuning immune response

NASA Astrophysics Data System (ADS)

Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

2015-11-01

Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.
Silencing and transcriptional properties of the imprinted Airn ncRNA are independent of the endogenous promoter

PubMed Central

Stricker, Stefan H; Steenpass, Laura; Pauler, Florian M; Santoro, Federica; Latos, Paulina A; Huang, Ru; Koerner, Martha V; Sloane, Mathew A; Warczok, Katarzyna E; Barlow, Denise P

2008-01-01

The Airn macro ncRNA is the master regulator of imprinted expression in the Igf2r imprinted gene cluster where it silences three flanking genes in cis. Airn transcription shows unusual features normally viewed as promoter specific, such as impaired post-transcriptional processing and a macro size. The Airn transcript is 108 kb long, predominantly unspliced and nuclear localized, with only a minority being variably spliced and exported. Here, we show by deletion of the Airn ncRNA promoter and replacement with a constitutive strong or weak promoter that splicing suppression and termination, as well as silencing activity, are maintained by strong Airn expression from an exogenous promoter. This indicates that all functional regions are located within the Airn transcript. DNA methylation of the maternal imprint control element (ICE) restricts Airn expression to the paternal allele and we also show that a strong active promoter is required to maintain the unmethylated state of the paternal ICE. Thus, Airn expression not only induces silencing of flanking mRNA genes but also protects the paternal copy of the ICE from de novo methylation. PMID:19008856
Comparison Study of MS-HRM and Pyrosequencing Techniques for Quantification of APC and CDKN2A Gene Methylation

PubMed Central

Migheli, Francesca; Stoccoro, Andrea; Coppedè, Fabio; Wan Omar, Wan Adnan; Failli, Alessandra; Consolini, Rita; Seccia, Massimo; Spisni, Roberto; Miccoli, Paolo; Mathers, John C.; Migliore, Lucia

2013-01-01

There is increasing interest in the development of cost-effective techniques for the quantification of DNA methylation biomarkers. We analyzed 90 samples of surgically resected colorectal cancer tissues for APC and CDKN2A promoter methylation using methylation sensitive-high resolution melting (MS-HRM) and pyrosequencing. MS-HRM is a less expensive technique compared with pyrosequencing but is usually more limited because it gives a range of methylation estimates rather than a single value. Here, we developed a method for deriving single estimates, rather than a range, of methylation using MS-HRM and compared the values obtained in this way with those obtained using the gold standard quantitative method of pyrosequencing. We derived an interpolation curve using standards of known methylated/unmethylated ratio (0%, 12.5%, 25%, 50%, 75%, and 100% of methylation) to obtain the best estimate of the extent of methylation for each of our samples. We observed similar profiles of methylation and a high correlation coefficient between the two techniques. Overall, our new approach allows MS-HRM to be used as a quantitative assay which provides results which are comparable with those obtained by pyrosequencing. PMID:23326336
Probing chromatin structure with nuclease sensitivity assays.

PubMed

Gregory, R I; Khosla, S; Feil, R

2001-01-01

To further our understanding of genomic imprinting it will be essential to identify key control elements, and to investigate their regulation by both epigenetic modifications (such as DNA methylation) and trans-acting factors. So far, sequence elements that regulate parental allele-specific gene expression have been identified in a number of imprinted loci, either because of their differential DNA methylation or through functional studies in transgenic mice (1,2). A systematic search for allele-specific chromatin features constitutes an alternative strategy to identify elements that regulate imprinting. The validity of such an in vivo chromatin approach derives from the fact that in several known imprinting control-elements, a specialized organization of chromatin characterized by nuclease hypersensitivity is present on only one of the two parental chromosome (3). For example, the differentially methylated 5 -portion of the human SNRPN gene-a sequence element that controls imprinting in the Prader-Willi and Angelman syndromes' domain on chromosome 15q11- q13-has strong DNase-I hypersensitive sites on the unmethylated paternal chromosome (4). A differentially methylated region that regulates the imprinting of H19 and that of the neighboring insulin-like growth factor-2 gene on mouse chromosome 7 was also found to have parental chromosome-specific hypersensitive sites (5,6). The precise nature of the allelic nuclease hypersensitivity in these and other imprinted loci remains to be determined in more detail, for example, by applying complementary chromatin methodologies (7,8). However, it is commonly observed that a nuclease hypersensitive site corresponds to a small region where nucleosomes are absent or partially disrupted.
High resolution melt curve analysis based on methylation status for human semen identification.

PubMed

Fachet, Caitlyn; Quarino, Lawrence; Karnas, K Joy

2017-03-01

A high resolution melt curve assay to differentiate semen from blood, saliva, urine, and vaginal fluid based on methylation status at the Dapper Isoform 1 (DACT1) gene was developed. Stains made from blood, saliva, urine, semen, and vaginal fluid were obtained from volunteers and DNA was isolated using either organic extraction (saliva, urine, and vaginal fluid) or Chelex ® 100 extraction (blood and semen). Extracts were then subjected to bisulfite modification in order to convert unmethylated cytosines to uracil, consequently creating sequences whose amplicons have melt curves that vary depending on their initial methylation status. When primers designed to amplify the promoter region of the DACT1 gene were used, DNA from semen samples was distinguishable from other fluids by a having a statistically significant lower melting temperature. The assay was found to be sperm-significant since semen from a vasectomized man produced a melting temperature similar to the non-semen body fluids. Blood and semen stains stored up to 5 months and tested at various intervals showed little variation in melt temperature indicating the methylation status was stable during the course of the study. The assay is a more viable method for forensic science practice than most molecular-based methods for body fluid stain identification since it is time efficient and utilizes instrumentation common to forensic biology laboratories. In addition, the assay is advantageous over traditional presumptive chemical methods for body fluid identification since results are confirmatory and the assay offers the possibility of multiplexing which may test for multiple body fluids simultaneously.

Test performance and acceptability of self- versus provider-collected swabs for high-risk HPV DNA testing in female-to-male trans masculine patients.

PubMed

Reisner, Sari L; Deutsch, Madeline B; Peitzmeier, Sarah M; White Hughto, Jaclyn M; Cavanaugh, Timothy P; Pardee, Dana J; McLean, Sarah A; Panther, Lori A; Gelman, Marcy; Mimiaga, Matthew J; Potter, Jennifer E

2018-01-01

High-risk human papillomavirus (hrHPV) causes virtually all cervical cancers. Trans masculine (TM) people (those assigned female at birth who identify with a gender other than female) have low uptake of conventional cervical cancer screening. Self-collected hrHPV DNA testing has high levels of acceptability among cisgender (non-transgender) females and may support increased cervical cancer screening uptake in TM individuals. To assess the test performance and acceptability of self-collected vaginal specimens in comparison to provider-collected cervical swabs for hrHPV DNA detection in TM individuals ages 21-64 years. Between March 2015-September 2016, 150 TM participants with a cervix (mean age = 27.5 years; SD = 5.7) completed a one-time study visit comprised of a self-report survey, self-collected vaginal HPV DNA swab, clinician-administered cervical HPV swab, and brief interview on acceptability of clinical procedures. Participants were randomized to complete either self- or provider-collection first to minimize ordering effects. Self- and provider-collected samples were tested for 13 hrHPV DNA types using a DNA Hybridization Assay. The primary outcome variable was the concordance (kappa statistic) and performance (sensitivity, specificity) of self-collected vaginal HPV DNA specimens versus provider-collected cervical HPV swabs as the gold standard. Of the 131 participants completing both the self- and provider-collected HPV tests, 21 cases of hrHPV were detected by the provider cervical swab (gold standard; 16.0% hrHPV prevalence); 15 of these cases were accurately detected by the self-collected vaginal swab (71.4% concordance) (Kappa = 0.75, 95% Confidence Interval [CI]: 0.59, 0.92; p<0.001). Compared to the provider-collected cervical hrHPV DNA sample (gold standard), the self-collected vaginal hrHPV DNA test demonstrated a sensitivity of 71.4% (95% CI: 0.52, 0.91; p = 0.0495) and specificity of 98.2% (95% CI: 0.96, 1.00; p<0.0001). Over 90% of participants endorsed a preference for the self-collected vaginal swab over provider-collected cervical swab. Self-collected vaginal swabs are highly acceptable to TM as a means to test for hrHPV DNA. Test performance of this self-collection method for hrHPV detection in TM is consistent with previous studies in cisgender females. Self-collected vaginal swab testing for hrHPV DNA represents a reasonable and patient-centered strategy for primary cervical cancer screening in TM patients unwilling to undergo provider collection of specimens via speculum exam.
Scientific publications about DNA structure-function and PCR technique in Costa Rica: a historic view (1953-2003).

PubMed

Albertazzi, Federico J

2004-09-01

The spreading of knowledge depends on the access to the information and its immediate use. Models are useful to explain specific phenomena. The scientific community accepts some models in Biology after a period of time, once it has evidence to support it. The model of the structure and function of the DNA proposed by Watson & Crick (1953) was not the exception, since a few years later the DNA model was finally accepted. In Costa Rica, DNA function was first mentioned in 1970, in the magazine Biologia Tropical (Tropical Biology Magazine), more than 15 years after its first publication in a scientific journal. An opposite situation occurs with technical innovations. If the efficiency of a new scientific technique is proved in a compelling way, then the acceptance by the community comes swiftly. This was the case of the polymerase chain reaction, or PCR. The first PCR machine in Costa Rica arrived in 1991, only three years after its publication.
Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs

PubMed Central

Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

2014-01-01

Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489
Transcription and chromatin determinants of de novo DNA methylation timing in oocytes.

PubMed

Gahurova, Lenka; Tomizawa, Shin-Ichi; Smallwood, Sébastien A; Stewart-Morgan, Kathleen R; Saadeh, Heba; Kim, Jeesun; Andrews, Simon R; Chen, Taiping; Kelsey, Gavin

2017-01-01

Gametogenesis in mammals entails profound re-patterning of the epigenome. In the female germline, DNA methylation is acquired late in oogenesis from an essentially unmethylated baseline and is established largely as a consequence of transcription events. Molecular and functional studies have shown that imprinted genes become methylated at different times during oocyte growth; however, little is known about the kinetics of methylation gain genome wide and the reasons for asynchrony in methylation at imprinted loci. Given the predominant role of transcription, we sought to investigate whether transcription timing is rate limiting for de novo methylation and determines the asynchrony of methylation events. Therefore, we generated genome-wide methylation and transcriptome maps of size-selected, growing oocytes to capture the onset and progression of methylation. We find that most sequence elements, including most classes of transposable elements, acquire methylation at similar rates overall. However, methylation of CpG islands (CGIs) is delayed compared with the genome average and there are reproducible differences amongst CGIs in onset of methylation. Although more highly transcribed genes acquire methylation earlier, the major transitions in the oocyte transcriptome occur well before the de novo methylation phase, indicating that transcription is generally not rate limiting in conferring permissiveness to DNA methylation. Instead, CGI methylation timing negatively correlates with enrichment for histone 3 lysine 4 (H3K4) methylation and dependence on the H3K4 demethylases KDM1A and KDM1B, implicating chromatin remodelling as a major determinant of methylation timing. We also identified differential enrichment of transcription factor binding motifs in CGIs acquiring methylation early or late in oocyte growth. By combining these parameters into multiple regression models, we were able to account for about a fifth of the variation in methylation timing of CGIs. Finally, we show that establishment of non-CpG methylation, which is prevalent in fully grown oocytes, and methylation over non-transcribed regions, are later events in oogenesis. These results do not support a major role for transcriptional transitions in the time of onset of DNA methylation in the oocyte, but suggest a model in which sequences least dependent on chromatin remodelling are the earliest to become permissive for methylation.
O6-Methylguanine-DNA Methyltransferase (MGMT) mRNA Expression Predicts Outcome in Malignant Glioma Independent of MGMT Promoter Methylation

PubMed Central

Kreth, Simone; Thon, Niklas; Eigenbrod, Sabina; Lutz, Juergen; Ledderose, Carola; Egensperger, Rupert; Tonn, Joerg C.; Kretzschmar, Hans A.; Hinske, Ludwig C.; Kreth, Friedrich W.

2011-01-01

Background We analyzed prospectively whether MGMT (O6-methylguanine-DNA methyltransferase) mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs) are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylation is associated with upregulation of DNMT expression. Methodology/Principal Findings Adult patients with a histologically proven malignant astrocytoma (glioblastoma: N = 53, anaplastic astrocytoma: N = 10) were included. MGMT promoter methylation was determined by methylation-specific PCR (MSP) and sequencing analysis. Expression of MGMT and DNMTs mRNA were analysed by real-time qPCR. Prognostic factors were obtained from proportional hazards models. Correlation between MGMT mRNA expression and MGMT methylation status was validated using data from the Cancer Genome Atlas (TCGA) database (N = 229 glioblastomas). Low MGMT mRNA expression was strongly predictive for prolonged time to progression, treatment response, and length of survival in univariate and multivariate models (p<0.0001); the degree of MGMT mRNA expression was highly correlated with the MGMT promoter methylation status (p<0.0001); however, discordant findings were seen in 12 glioblastoma patients: Patients with methylated tumors with high MGMT mRNA expression (N = 6) did significantly worse than those with low transcriptional activity (p<0.01). Conversely, unmethylated tumors with low MGMT mRNA expression (N = 6) did better than their counterparts. A nearly identical frequency of concordant and discordant findings was obtained by analyzing the TCGA database (p<0.0001). Expression of DNMT1 and DNMT3b was strongly upregulated in tumor tissue, but not correlated with MGMT promoter methylation and MGMT mRNA expression. Conclusions/Significance MGMT mRNA expression plays a direct role for mediating tumor sensitivity to alkylating agents. Discordant findings indicate methylation-independent pathways of MGMT expression regulation. DNMT1 and DNMT3b are likely to be involved in CGI methylation. However, their exact role yet has to be defined. PMID:21365007
Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

PubMed Central

Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

2016-01-01

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners. PMID:27100087
Analysis of the state of posttranslational calmodulin methylation in developing pea plants. [Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oh, Sukheung; Roberts, D.M.

1990-07-01

A specific calmodulin-N-methyltransferase was used in a radiometric assay to analyze the degree of methylation of lysine-115 in pea (Pisum sativum) plants. Calmodulin was isolated from dissected segments of developing roots of young etiolated and green pea plants and was tested for its ability to be methylated by incubation with the calmodulin methyltransferase in the presence of ({sup 3}H)methyl-S-adenosylmethionine. By this approach, the presence of unmethylated calmodulins were demonstrated in pea tissues, and the levels of methylation varied depending on the developmental state of the tissue tested. Calmodulin methylation levels were lower in apical root segments of both etiolated andmore » green plants, and in the young lateral roots compared with the mature, differentiated root tissues. The incorporation of methyl groups into these calmodulin samples appears to be specific for position 115 since site-directed mutants of calmodulin with substitutions at this position competitively inhibited methyl group incorporation. The present findings, combined with previous data showing differences in the ability of methylated and unmethylated calmodulins to activate pea NAD kinase raise the possibility that posttranslational methylation of calmodulin could be another mechanism for regulating calmodulin activity.« less
In vitro evaluation of combined temozolomide and radiotherapy using X rays and high-linear energy transfer radiation for glioblastoma.

PubMed

Barazzuol, Lara; Jena, Raj; Burnet, Neil G; Jeynes, Jonathan C G; Merchant, Michael J; Kirkby, Karen J; Kirkby, Norman F

2012-05-01

High-linear energy transfer radiation offers superior biophysical properties over conventional radiotherapy and may have a great potential for treating radioresistant tumors, such as glioblastoma. However, very little pre-clinical data exists on the effects of high-LET radiation on glioblastoma cell lines and on the concomitant application of chemotherapy. This study investigates the in vitro effects of temozolomide in combination with low-energy protons and α particles. Cell survival, DNA damage and repair, and cell growth were examined in four human glioblastoma cell lines (LN18, T98G, U87 and U373) after treatment with either X rays, protons (LET 12.91 keV/μm), or α particles (LET 99.26 keV/μm) with or without concurrent temozolomide at clinically-relevant doses of 25 and 50 μM. The relative biological effectiveness at 10% survival (RBE(10)) increased as LET increased: 1.17 and 1.06 for protons, and 1.84 and 1.68 for α particles in the LN18 and U87 cell lines, respectively. Temozolomide administration increased cell killing in the O(6)-methylguanine DNA methyltransferase-methylated U87 and U373 cell lines. In contrast, temozolomide provided no therapeutic enhancement in the methylguanine DNA methyltransferase-unmethylated LN18 and T98G cell lines. In addition, the residual number of γ-H2AX foci at 24 h after treatment with radiation and concomitant temozolomide was found to be lower than or equal to that expected by DNA damage with either of the individual treatments. Kinetics of foci disappearance after X-ray and proton irradiation followed similar time courses; whereas, loss of γ-H2AX foci after α particle irradiation occurred at a slower rate than that by low-LET radiation (half-life 12.51-16.87 h). The combination of temozolomide with different radiation types causes additive rather than synergistic cytotoxicity. Nevertheless, particle therapy combined with chemotherapy may offer a promising alternative with the additional benefit of superior biophysical properties. It is also possible that new fractionation schedules could be designed to exploit the change in DNA repair kinetics when MGMT-methylated cells respond to high-LET radiation.
Test performance and acceptability of self- versus provider-collected swabs for high-risk HPV DNA testing in female-to-male trans masculine patients

PubMed Central

Deutsch, Madeline B.; Peitzmeier, Sarah M.; White Hughto, Jaclyn M.; Cavanaugh, Timothy P.; Pardee, Dana J.; McLean, Sarah A.; Panther, Lori A.; Gelman, Marcy; Mimiaga, Matthew J.; Potter, Jennifer E.

2018-01-01

Background High-risk human papillomavirus (hrHPV) causes virtually all cervical cancers. Trans masculine (TM) people (those assigned female at birth who identify with a gender other than female) have low uptake of conventional cervical cancer screening. Self-collected hrHPV DNA testing has high levels of acceptability among cisgender (non-transgender) females and may support increased cervical cancer screening uptake in TM individuals. Objective To assess the test performance and acceptability of self-collected vaginal specimens in comparison to provider-collected cervical swabs for hrHPV DNA detection in TM individuals ages 21–64 years. Methods Between March 2015-September 2016, 150 TM participants with a cervix (mean age = 27.5 years; SD = 5.7) completed a one-time study visit comprised of a self-report survey, self-collected vaginal HPV DNA swab, clinician-administered cervical HPV swab, and brief interview on acceptability of clinical procedures. Participants were randomized to complete either self- or provider-collection first to minimize ordering effects. Self- and provider-collected samples were tested for 13 hrHPV DNA types using a DNA Hybridization Assay. The primary outcome variable was the concordance (kappa statistic) and performance (sensitivity, specificity) of self-collected vaginal HPV DNA specimens versus provider-collected cervical HPV swabs as the gold standard. Results Of the 131 participants completing both the self- and provider-collected HPV tests, 21 cases of hrHPV were detected by the provider cervical swab (gold standard; 16.0% hrHPV prevalence); 15 of these cases were accurately detected by the self-collected vaginal swab (71.4% concordance) (Kappa = 0.75, 95% Confidence Interval [CI]: 0.59, 0.92; p<0.001). Compared to the provider-collected cervical hrHPV DNA sample (gold standard), the self-collected vaginal hrHPV DNA test demonstrated a sensitivity of 71.4% (95% CI: 0.52, 0.91; p = 0.0495) and specificity of 98.2% (95% CI: 0.96, 1.00; p<0.0001). Over 90% of participants endorsed a preference for the self-collected vaginal swab over provider-collected cervical swab. Conclusion Self-collected vaginal swabs are highly acceptable to TM as a means to test for hrHPV DNA. Test performance of this self-collection method for hrHPV detection in TM is consistent with previous studies in cisgender females. Self-collected vaginal swab testing for hrHPV DNA represents a reasonable and patient-centered strategy for primary cervical cancer screening in TM patients unwilling to undergo provider collection of specimens via speculum exam. PMID:29538411
Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.

2009-12-23

BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells.« less
Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

PubMed

Nam, Jutaek; Son, Sejin; Moon, James J

2017-10-01

Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.
Effects of emodin on the demethylation of tumor-suppressor genes in pancreatic cancer PANC-1 cells.

PubMed

Zhang, Hao; Chen, Liang; Bu, He-Qi; Yu, Qing-Jiang; Jiang, Dan-Dan; Pan, Feng-Ping; Wang, Yu; Liu, Dian-Lei; Lin, Sheng-Zhang

2015-06-01

Emodin, a natural anthraquinone derivative isolated from Rheum palmatum, has been reported to inhibit the growth of pancreatic cancer cells through different modes of action; yet, the detailed mechanism remains unclear. In the present study, we hypothesized that emodin exerts its antitumor effect by participating in the regulation of the DNA methylation level. Our research showed that emodin inhibited the growth of pancreatic cancer PANC-1 cells in a dose- and time-dependent manner. Dot-blot results showed that 40 µM emodin significantly inhibited genomic 5 mC expression in the PANC-1 cells, and mRNA-Seq showed that different concentrations of emodin could alter the gene expression profile in the PANC-1 cells. BSP confirmed that the methylation levels of P16, RASSF1A and ppENK were decreased, while concomitantly the unmethylated status was increased. RT-PCR and western blotting results confirmed that the low expression or absence of expression of mRNA and protein in the PANC-1 cells was re-expressed following treatment with emodin. In conclusion, our study for the first time suggests that emodin inhibits pancreatic cancer cell growth, which may be related to the demethylation of tumor-suppressor genes. The related mechanism may be through the inhibition of methyltransferase expression.
Genetic markers predictive of chemosensitivity and outcome in gliomatosis cerebri.

PubMed

Kaloshi, G; Everhard, S; Laigle-Donadey, F; Marie, Y; Navarro, S; Mokhtari, K; Idbaih, A; Ducray, F; Thillet, J; Hoang-Xuan, K; Delattre, J-Y; Sanson, M

2008-02-19

Up-front temozolomide (TMZ) has been recently proposed as a treatment for gliomatosis cerebri (GC), but no predictive or prognostic markers have been identified so far. Because 1p19q codeletion and methylguanine methyl transferase promoter (MGMTP) methylation have been correlated with chemosensitivity of gliomas, their value was investigated in a cohort of patients with GC treated with TMZ. A cohort of 25 GC patients who were treated with TMZ was investigated for 1p19q codeletion and O6-methylguanine DNA. Patients with a 1p/19q codeletion had a higher response rate (88% [8/9] vs 25% [4/16], p = 0.002), higher progression-free survival (24.5 vs 13.7 months, p = 0.017), and higher overall survival (66.8 vs 15.2 months, p = 0.011) than patients without 1p/19q codeletion. Fourteen of 19 evaluable tumors for MGMTP status were methylated. MGMTP methylation was associated with 1p/19q codeletion (p = 0.045). Patients with unmethylated MGMTP tended to have a shorter progression-free survival and a higher rate of progressive disease. Response rate to temozolomide and prognosis seem tightly correlated to 1p19q loss. The impact of methylguanine methyl transferase promoter methylation status on gliomatosis cerebri is still unsettled in this population.
Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

PubMed Central

Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

2016-01-01

Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751
Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less
DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.
Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients

PubMed Central

Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P.; Iacobuzio-Donahue, Christine A.; Kerner, Zachary; Baylin, Stephen B.; Wolfgang, Christopher L.; Ahuja, Nita

2016-01-01

We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP−/MLH1-U, or CIMP−/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes. PMID:27880934
Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients.

PubMed

Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P; Iacobuzio-Donahue, Christine A; Kerner, Zachary; Baylin, Stephen B; Wolfgang, Christopher L; Ahuja, Nita

2016-12-27

We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP-/MLH1-U, or CIMP-/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes.
In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.
Data Acceptance Criteria for Standardized Human-Associated Fecal Source Identification Quantitative Real-Time PCR Methods.

PubMed

Shanks, Orin C; Kelty, Catherine A; Oshiro, Robin; Haugland, Richard A; Madi, Tania; Brooks, Lauren; Field, Katharine G; Sivaganesan, Mano

2016-05-01

There is growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data quality across laboratories. Data quality is typically determined through a series of specifications that ensure good experimental practice and the absence of bias in the results due to DNA isolation and amplification interferences. However, there is currently a lack of consensus on how best to evaluate and interpret human fecal source identification qPCR experiments. This is, in part, due to the lack of standardized protocols and information on interlaboratory variability under conditions for data acceptance. The aim of this study is to provide users and reviewers with a complete series of conditions for data acceptance derived from a multiple laboratory data set using standardized procedures. To establish these benchmarks, data from HF183/BacR287 and HumM2 human-associated qPCR methods were generated across 14 laboratories. Each laboratory followed a standardized protocol utilizing the same lot of reference DNA materials, DNA isolation kits, amplification reagents, and test samples to generate comparable data. After removal of outliers, a nested analysis of variance (ANOVA) was used to establish proficiency metrics that include lab-to-lab, replicate testing within a lab, and random error for amplification inhibition and sample processing controls. Other data acceptance measurements included extraneous DNA contamination assessments (no-template and extraction blank controls) and calibration model performance (correlation coefficient, amplification efficiency, and lower limit of quantification). To demonstrate the implementation of the proposed standardized protocols and data acceptance criteria, comparable data from two additional laboratories were reviewed. The data acceptance criteria proposed in this study should help scientists, managers, reviewers, and the public evaluate the technical quality of future findings against an established benchmark. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

"Would you accept having your DNA profile inserted in the National Forensic DNA database? Why?" Results of a questionnaire applied in Portugal.

PubMed

Machado, Helena; Silva, Susana

2014-01-01

The creation and expansion of forensic DNA databases might involve potential threats to the protection of a range of human rights. At the same time, such databases have social benefits. Based on data collected through an online questionnaire applied to 628 individuals in Portugal, this paper aims to analyze the citizens' willingness to donate voluntarily a sample for profiling and inclusion in the National Forensic DNA Database and the views underpinning such a decision. Nearly one-quarter of the respondents would indicate 'no', and this negative response increased significantly with age and education. The overriding willingness to accept the inclusion of the individual genetic profile indicates an acknowledgement of the investigative potential of forensic DNA technologies and a relegation of civil liberties and human rights to the background, owing to the perceived benefits of protecting both society and the individual from crime. This rationale is mostly expressed by the idea that all citizens should contribute to the expansion of the National Forensic DNA Database for reasons that range from the more abstract assumption that donating a sample for profiling would be helpful in fighting crime to the more concrete suggestion that everyone (criminals and non-criminals) should be in the database. The concerns with the risks of accepting the donation of a sample for genetic profiling and inclusion in the National Forensic DNA Database are mostly related to lack of control and insufficient or unclear regulations concerning safeguarding individuals' data and supervising the access and uses of genetic data. By providing an empirically-grounded understanding of the attitudes regarding willingness to donate voluntary a sample for profiling and inclusion in a National Forensic DNA Database, this study also considers the citizens' perceived benefits and risks of operating forensic DNA databases. These collective views might be useful for the formation of international common ethical standards for the development and governance of DNA databases in a framework in which the citizens' perspectives are taken into consideration. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Quantitative analysis of genomic DNA degradation in whole blood under various storage conditions for molecular diagnostic testing.

PubMed

Permenter, Jessalyn; Ishwar, Arjun; Rounsavall, Angie; Smith, Maddie; Faske, Jennifer; Sailey, Charles J; Alfaro, Maria P

2015-12-01

Proper storage of whole blood is crucial for isolating nucleic acids from leukocytes and to ensure adequate performance of downstream assays in the molecular diagnostic laboratory. Short-term and long-term storage recommendations are lacking for successful isolation of genomic DNA (gDNA). Container type (EDTA or heparin), temperature (4 °C and room temperature) and time (1-130 days) were assessed as criterion for sample acceptance policies. The percentage of integrated area (%Ti) between 150 and 10,000 bp from the 2200 TapeStation electropherogram was calculated to measure gDNA degradation. Refrigerated EDTA samples yielded gDNA with low %Ti (high quality). Heparinized samples stored at room temperature yielded gDNA of worst quality. Downstream analysis demonstrated that the quality of the gDNA correlated with the quality of the data; samples with high %Ti generated significantly lower levels of high molecular weight amplicons. Recommendations from these analyses include storing blood samples intended for nucleic acid isolation in EDTA tubes at 4 °C for long term storage (>10 days). gDNA should be extracted within 3 days when blood is stored at room temperature regardless of the container. Finally, refrigerated heparinized samples should not be stored longer than 9 days if expecting high quality gDNA isolates. Laboratories should consider many factors, in addition to the results obtained herein, to update their policies for sample acceptance for gDNA extraction intended for molecular genetic testing. Copyright © 2015 Elsevier Ltd. All rights reserved.
Effect of 5-methylcytosine on the stability of triple-stranded DNA--a thermodynamic study.

PubMed Central

Xodo, L E; Manzini, G; Quadrifoglio, F; van der Marel, G A; van Boom, J H

1991-01-01

We have previously shown that the pyrimidine oligonucleotide 5'CTTCCTCCTCT (Y11) recognizes the double-helical stem of hairpin 5'GAAGGAGGAGA-T4-TCTCCTCCTTC (h26) by triple-helix formation (1). In this paper, we report the effect on triplex formation of substituting the cytosine residues of Y11 with 5-methylcytosines (5meY11). In addition, we have studied the thermodynamics of the interaction between h26 and 5meY11. The results can be summarised as follows: (i) gel electrophoresis shows that at T = 5 degrees C and pH 5, both Y11 and 5meY11 form DNA triple helices with h26, whereas at pH 6.8 only the methylated strand binds to h26; (ii) pH-stability curves of the DNA triplexes formed from h26 + Y11 and h26 + 5meY11 show that Y11 and 5meY11 are semi-protonated at pH 5.7 and 6.7, respectively. Thus, it is concluded that cytosine methylation expands the pH range compatible with triplex formation by one pH unit; (iii) as the unmethylated triplex (h26:Y11), the methylated one (h26:5meY11) denatures in a biphasic manner, in which the low temperature transition results from the dissociation of 5meY11 from h26. The Tm of the triplex to h26 plus 5meY11 transition is strongly enhanced (about 10 degrees C) by cytosine methylation. A van 't Hoff analysis of denaturation curves is presented; (iv) DSC experiments show that triplex formation between 5meY11 and h26 is characterized by delta H = -237 +/- 25 kJ/mol and delta S = -758 +/- 75 J/Kmol, corresponding to an average delta H of -21 kJ/mol and delta S of -69 J/Kmol per Hoogsteen base pair; (v) the thermodynamic analysis indicates that the extra stability imparted to the triplex by methylcytosine is entropic in origin. Images PMID:1945840
EG-11DYSREGULATION OF MGMT IN GLIOBLASTOMA: FRIEND OR FOE?

PubMed Central

Rapkins, Robert W.; Hitchins, Megan P.; McDonald, Kerrie L.

2014-01-01

Glioblastoma (GBM) is the most common and lethal form of brain cancer (median survival <15 months). The DNA alkylating agent, temozolomide, is used as the standard chemotherapeutic agent, resulting in mispairing of guanine with thymidine that leads to cellular arrest. However, in GBM patients the O6-methylguanine-DNA methyltransferase (MGMT) protein protects DNA from damage induced by temozolomide. Nevertheless, loss of MGMT expression is a frequent event in human malignancies and typically the result of MGMT promoter methylation. MGMT methylation has been strongly associated with the T-allele of the rs16906252 SNP (C/T) in colorectal carcinoma, pleural mesothelioma, and lung cancers. We therefore examined the T-allele and MGMT methylation in temozolmide-treated GBM patients. In 255 temozolomide-treated GBM patients, we found that the T-allele was significantly more frequent in patients with a methylated MGMT promoter. The unadjusted hazard ratio for death in carriers of the T-allele compared to wild-type, irrespective of methylation status, was 0.39 (95%CI:0.21-0.73; p = 0.003), indicating a 61% relative reduction in the risk for death of T-allele carriers. Surprisingly, GBM patients harboring the T-allele in the absence of MGMT methylation showed a survival benefit comparable to those with MGMT methylation (median survival: 15.5 months) and significantly better than the median survival of wild-type, unmethylated patients (median survival: 10.3 months). This suggests that the T-allele may reduce MGMT activity by mechanisms independent of methylation. Genotyping of 451 healthy controls indicated the frequency of carriage of the T-allele was 13% (MAF 0.065). In contrast, carriage of the T-allele in 160 GBM patients was 17%. Significantly, elevated risks were associated with carriage of the T-allele and development of GBM (odds ratio of 2.62 [95%CI:1.7-4.2]). We report that the T-allele (rs16906252) has predictive (response to temozolomide) and prognostic value (MGMT methylation and longer survival), but conversely may be a predisposing factor for the development of GBM.
Non-specific filtering of beta-distributed data.

PubMed

Wang, Xinhui; Laird, Peter W; Hinoue, Toshinori; Groshen, Susan; Siegmund, Kimberly D

2014-06-19

Non-specific feature selection is a dimension reduction procedure performed prior to cluster analysis of high dimensional molecular data. Not all measured features are expected to show biological variation, so only the most varying are selected for analysis. In DNA methylation studies, DNA methylation is measured as a proportion, bounded between 0 and 1, with variance a function of the mean. Filtering on standard deviation biases the selection of probes to those with mean values near 0.5. We explore the effect this has on clustering, and develop alternate filter methods that utilize a variance stabilizing transformation for Beta distributed data and do not share this bias. We compared results for 11 different non-specific filters on eight Infinium HumanMethylation data sets, selected to span a variety of biological conditions. We found that for data sets having a small fraction of samples showing abnormal methylation of a subset of normally unmethylated CpGs, a characteristic of the CpG island methylator phenotype in cancer, a novel filter statistic that utilized a variance-stabilizing transformation for Beta distributed data outperformed the common filter of using standard deviation of the DNA methylation proportion, or its log-transformed M-value, in its ability to detect the cancer subtype in a cluster analysis. However, the standard deviation filter always performed among the best for distinguishing subgroups of normal tissue. The novel filter and standard deviation filter tended to favour features in different genome contexts; for the same data set, the novel filter always selected more features from CpG island promoters and the standard deviation filter always selected more features from non-CpG island intergenic regions. Interestingly, despite selecting largely non-overlapping sets of features, the two filters did find sample subsets that overlapped for some real data sets. We found two different filter statistics that tended to prioritize features with different characteristics, each performed well for identifying clusters of cancer and non-cancer tissue, and identifying a cancer CpG island hypermethylation phenotype. Since cluster analysis is for discovery, we would suggest trying both filters on any new data sets, evaluating the overlap of features selected and clusters discovered.
Methylome reorganization during in vitro dedifferentiation and regeneration of Populus trichocarpa

PubMed Central

2013-01-01

Background Cytosine DNA methylation (5mC) is an epigenetic modification that is important to genome stability and regulation of gene expression. Perturbations of 5mC have been implicated as a cause of phenotypic variation among plants regenerated through in vitro culture systems. However, the pattern of change in 5mC and its functional role with respect to gene expression, are poorly understood at the genome scale. A fuller understanding of how 5mC changes during in vitro manipulation may aid the development of methods for reducing or amplifying the mutagenic and epigenetic effects of in vitro culture and plant transformation. Results We investigated the in vitro methylome of the model tree species Populus trichocarpa in a system that mimics routine methods for regeneration and plant transformation in the genus Populus (poplar). Using methylated DNA immunoprecipitation followed by high-throughput sequencing (MeDIP-seq), we compared the methylomes of internode stem segments from micropropagated explants, dedifferentiated calli, and internodes from regenerated plants. We found that more than half (56%) of the methylated portion of the genome appeared to be differentially methylated among the three tissue types. Surprisingly, gene promoter methylation varied little among tissues, however, the percentage of body-methylated genes increased from 9% to 14% between explants and callus tissue, then decreased to 8% in regenerated internodes. Forty-five percent of differentially-methylated genes underwent transient methylation, becoming methylated in calli, and demethylated in regenerants. These genes were more frequent in chromosomal regions with higher gene density. Comparisons with an expression microarray dataset showed that genes methylated at both promoters and gene bodies had lower expression than genes that were unmethylated or only promoter-methylated in all three tissues. Four types of abundant transposable elements showed their highest levels of 5mC in regenerated internodes. Conclusions DNA methylation varies in a highly gene- and chromosome-differential manner during in vitro differentiation and regeneration. 5mC in redifferentiated tissues was not reset to that in original explants during the study period. Hypermethylation of gene bodies in dedifferentiated cells did not interfere with transcription, and may serve a protective role against activation of abundant transposable elements. PMID:23799904
DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f
MGMT methylation: a marker of response to temozolomide in low-grade gliomas.

PubMed

Everhard, Sibille; Kaloshi, Gentian; Crinière, Emmanuelle; Benouaich-Amiel, Alexandra; Lejeune, Julie; Marie, Yannick; Sanson, Marc; Kujas, Michèle; Mokhtari, Karima; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2006-12-01

The methylation status of the O6-methylguanine-methyltransferase promoter (MGMTP) was evaluated in 68 low-grade gliomas treated by neoadjuvant temozolomide. Methylated MGMTP was detected in 63 of 68 (92.6 %) patients and was a favorable predictor of progression-free survival as compared with unmethylated MGMTP tumors (p < 0.0001). Assessment of MGMTP status could help identifying low-grade gliomas patients more likely to respond to chemotherapy or to benefit from MGMT depletion strategies.
Epigenetic regulation of matrix metalloproteinase expression in ameloblastoma

PubMed Central

2012-01-01

Background An ameloblastoma is a benign odontogenic neoplasm with aggressive behaviour and high recurrence rates. The increased expression of matrix metalloproteinases (MMPs) has been reported in ameloblastomas. In the present study, we hypothesised that epigenetic alterations may regulate MMP expression in ameloblastomas. Methods We investigated the methylation status of the genes MMP-2 and MMP-9 in addition to mRNA transcription and protein expression in ameloblastomas. Methylation analysis was performed by both methylation-specific polymerase chain reaction (MSP-PCR) and restriction enzyme digestion to evaluate the methylation profile of MMP-2 and MMP-9 in 12 ameloblastoma samples and 12 healthy gingiva fragments, which were included as controls. Furthermore, we investigated the transcription levels of the genes by quantitative reverse-transcription PCR (qRT-PCR). Zymography was performed to verify protein expression in ameloblastomas. Results The ameloblastomas showed a high frequency of unmethylated MMP-2 and MMP-9, whereas the healthy gingival samples presented a sharp prevalence of methylated MMPs. Higher expression levels of MMP-9 were found in ameloblastomas compared to healthy gingiva. However, no significant differences in the MMP-2 mRNA expression between groups was found. All ameloblastomas showed positive expression of MMP-2 and MMP-9 proteins. Conclusions Our findings suggest that expression of MMP-9 is increased in ameloblastomas and is possibly modulated by unmethylation of the gene. PMID:22866959
Moving Genetic Biomonitoring from a Concept to a Tool

EPA Science Inventory

Molecular genetic techniques like DNA barcoding and environmental DNA have been proposed as tools for aquatic biomonitoring for nearly a decade, but have yet to break through into widespread acceptance. The potential benefits of these methods, such as quicker, cheaper, more detai...
The TERT promoter SNP rs2853669 decreases E2F1 transcription factor binding and increases mortality and recurrence risks in liver cancer.

PubMed

Ko, Eunkyong; Seo, Hyun-Wook; Jung, Eun Sun; Kim, Baek-hui; Jung, Guhung

2016-01-05

A common single-nucleotide polymorphism in the telomerase reverse transcriptase (TERT) promoter, rs2853669 influences patient survival rates and the risk of developing cancer. Recently, several lines of evidence suggest that the rs2853669 suppresses TERT promoter mutation-mediated TERT expression levels and cancer mortality as well as recurrence rates. However, no reports are available on the impact of rs2853669 on TERT expression in hepatocellular carcinoma (HCC) and its association with patient survival. Here, we found that HCC-related overall and recurrence-free survival rates were not associated with TERT promoter mutation individually, but rs2853669 and the TERT promoter mutation in combination were associated with poor survival rates. TERT mRNA expression and telomere fluorescence levels were greater in patients with HCC who had both the combination. The combination caused TERT promoter methylation through regulating the binding of DNA methyltransferase 1 and histone deacetylase 1 to the TERT promoter in HCC cell lines. The TERT expression level was significantly higher in HCC tumor with a methylated promoter than in that with an unmethylated promoter. In conclusion, we demonstrate a substantial role for the rs2853669 in HCC with TERT promoter mutation, which suggests that the combination of the rs2853669 and the mutation indicate poor prognoses in liver cancer.
Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

Treesearch

Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

2013-01-01

The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...
Hypermethylation of AP-2Alpha as a Prognostic Marker for DCIS

DTIC Science & Technology

2008-05-01

Unfortunately, among the methylation status of the AP2, CYCLIN D, ECAD , GSTP, and SSOCS genes, either as individual genes, or in combinations, no...0.61 to 4.10) 1.00 (referent) 0.35 ECAD M UM 0 100 3 97 GSTP M UM 40 60 24 76 2.02 (0.72 to 5.64) 1.00...Missing data: 1.4% for AP2, CYCLIN D, ECAD , GSTP; 4.2% for SSOCS; 2.8% for nuclear grade. §M=methylated; UM=unmethylated; +Two-sided
Elucidation of Chromatin Remodeling Machinery Involved in Regulation of Estrogen Receptor Alpha Expression in Human Breast Cancer Cells

DTIC Science & Technology

2005-08-01

encoded by different genes (26, 27)), can act as transcriptional repressors by using their ATRX domain to recruit HDAC1 (28, 29). Heterochromatic...ER-positive MCF-7 cells with an unmethylated ER promoter were used as our model system. Using antibodies against acetylated H4, acetylated H3...MBD1, and anti MBD2 antibodies revealed that these proteins are associated with the silenced ER promoter in MDA-MB-231 cells whereas the active ER
Patient acceptance of non-invasive testing for fetal aneuploidy via cell-free fetal DNA.

PubMed

Vahanian, Sevan A; Baraa Allaf, M; Yeh, Corinne; Chavez, Martin R; Kinzler, Wendy L; Vintzileos, Anthony M

2014-01-01

To evaluate factors associated with patient acceptance of noninvasive prenatal testing for trisomy 21, 18 and 13 via cell-free fetal DNA. This was a retrospective study of all patients who were offered noninvasive prenatal testing at a single institution from 1 March 2012 to 2 July 2012. Patients were identified through our perinatal ultrasound database; demographic information, testing indication and insurance coverage were compared between patients who accepted the test and those who declined. Parametric and nonparametric tests were used as appropriate. Significant variables were assessed using multivariate logistic regression. The value p < 0.05 was considered significant. Two hundred thirty-five patients were offered noninvasive prenatal testing. Ninety-three patients (40%) accepted testing and 142 (60%) declined. Women who accepted noninvasive prenatal testing were more commonly white, had private insurance and had more than one testing indication. There was no statistical difference in the number or the type of testing indications. Multivariable logistic regression analysis was then used to assess individual variables. After controlling for race, patients with public insurance were 83% less likely to accept noninvasive prenatal testing than those with private insurance (3% vs. 97%, adjusted RR 0.17, 95% CI 0.05-0.62). In our population, having public insurance was the factor most strongly associated with declining noninvasive prenatal testing.
The Role of Particle-Mediated DNA Vaccines in Biodefense Preparedness

DTIC Science & Technology

2005-06-17

vaccines in biodefense preparedness Hansi J. Deana,T, Joel Haynesa, Connie Schmaljohnb aPowderJect Vaccines , Inc. 8551 Research Way, Middleton, WI 53562...accepted 25 January 2005 Available online 12 April 2005Abstract Particle-mediated epidermal delivery (PMED) of DNA vaccines is based on the acceleration...recent years, data have accumulated on the utility of PMED for delivery of DNA vaccines against a number of viral pathogens, including filoviruses
Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

PubMed

Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

2014-12-01

Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

PubMed

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.
Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Association of the hypermethylation status of PTEN tumor suppressor gene with the risk of breast cancer among Kurdish population from Western Iran.

PubMed

Yari, Kheirollah; Payandeh, Mehrdad; Rahimi, Zohreh

2016-06-01

Breast cancer is the most common cancer with high morbidity and mortality among women worldwide. Aberrant hypermethylation in promoter regions of the tumor suppressor genes such as PTEN gene is a key event in the progression and development of breast cancer. The aim of the present study was to evaluate an association between PTEN gene methylation status with the risk of breast cancer in an Iranian population. We studied 255 individuals, including 103 patients with breast cancer, 102 first-degree female relatives of patients (mother, sister, or daughter of patients), and 50 healthy individuals as a control group. Genomic DNA was extracted from peripheral blood leukocytes, and the PTEN promoter methylation status was detected using methylation-specific PCR (MSP) method with specific methylated and unmethylated primers. In some samples, direct DNA sequencing was used to confirm the results obtained by the MSP method. The frequency of PTEN-methylated (MM) genotype was 6 % in the healthy control group, 23.3 % in relatives of patients, and 41.7 % in patients (χ (2) = 24.62, p < 0.001). There were significant differences in the frequency of PTEN-methylated genotype between healthy control compared to that in patients (χ (2) = 15.1, p < 0.001) and also compared to that in relatives of patients (χ (2) = 6.9, p = 0.009). In the presence of PTEN MM genotype, there was a 3.1-fold susceptibility to breast cancer compared to the UU genotype (p < 0.001). Also, in the presence of PTEN M allele, the risk of breast cancer was 2.71-fold compared to the presence of U allele (p < 0.001). Our findings indicated increased frequency of hypermethylation of PTEN promoter in the studied patients and their relatives that could be considered as one of the epigenetic factors affecting the risk of breast cancer in Iranians.

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.
Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

PubMed Central

Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-01-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515
Improvement of DNA transfer frequency and transposon mutagenesis of Erwinia carotovora subsp. betavasculorum.

PubMed Central

Rella, M; Axelrood, P E; Weinhold, A R; Schroth, M N

1989-01-01

The production of antibiotics and their role in microbial competition under natural conditions can be readily studied by the use of transposon mutants. Several antibiotic-producing strains of Erwinia carotovora subsp. betavasculorum were unable to accept foreign DNA. A plasmid delivery system was developed, using ethyl methanesulfonate mutagenesis, which entailed isolating E. carotovora subsp. betavasculorum mutants able to accept foreign DNA and transfer it to other strains. This enabled transposon mutagenesis of a wild-type antibiotic-producing strain of E. carotovora subsp. betavasculorum. Twelve antibiotic-negative mutants were isolated, and one of these showed a reduction in antibiotic production in vitro. Many of these mutants also showed a reduction in their ability to macerate potato tissue. The mutants were classified into four genetic groups on the basis of their genetic and phenotypic characteristics, indicating that several genes are involved in antibiotic biosynthesis by E. carotovora subsp. betavasculorum. PMID:2543291
The contribution of co-transcriptional RNA:DNA hybrid structures to DNA damage and genome instability

PubMed Central

Hamperl, Stephan; Cimprich, Karlene A.

2014-01-01

Accurate DNA replication and DNA repair are crucial for the maintenance of genome stability, and it is generally accepted that failure of these processes is a major source of DNA damage in cells. Intriguingly, recent evidence suggests that DNA damage is more likely to occur at genomic loci with high transcriptional activity. Furthermore, loss of certain RNA processing factors in eukaryotic cells is associated with increased formation of co-transcriptional RNA:DNA hybrid structures known as R-loops, resulting in double-strand breaks (DSBs) and DNA damage. However, the molecular mechanisms by which R-loop structures ultimately lead to DNA breaks and genome instability is not well understood. In this review, we summarize the current knowledge about the formation, recognition and processing of RNA:DNA hybrids, and discuss possible mechanisms by which these structures contribute to DNA damage and genome instability in the cell. PMID:24746923
Extreme-Depth Re-sequencing of Mitochondrial DNA Finds No Evidence of Paternal Transmission in Humans.

PubMed

Pyle, Angela; Hudson, Gavin; Wilson, Ian J; Coxhead, Jonathan; Smertenko, Tania; Herbert, Mary; Santibanez-Koref, Mauro; Chinnery, Patrick F

2015-05-01

Recent reports have questioned the accepted dogma that mammalian mitochondrial DNA (mtDNA) is strictly maternally inherited. In humans, the argument hinges on detecting a signature of inter-molecular recombination in mtDNA sequences sampled at the population level, inferring a paternal source for the mixed haplotypes. However, interpreting these data is fraught with difficulty, and direct experimental evidence is lacking. Using extreme-high depth mtDNA re-sequencing up to ~1.2 million-fold coverage, we find no evidence that paternal mtDNA haplotypes are transmitted to offspring in humans, thus excluding a simple dilution mechanism for uniparental transmission of mtDNA present in all healthy individuals. Our findings indicate that an active mechanism eliminates paternal mtDNA which likely acts at the molecular level.
Extreme-Depth Re-sequencing of Mitochondrial DNA Finds No Evidence of Paternal Transmission in Humans

PubMed Central

Pyle, Angela; Hudson, Gavin; Wilson, Ian J.; Coxhead, Jonathan; Smertenko, Tania; Herbert, Mary; Santibanez-Koref, Mauro; Chinnery, Patrick F.

2015-01-01

Recent reports have questioned the accepted dogma that mammalian mitochondrial DNA (mtDNA) is strictly maternally inherited. In humans, the argument hinges on detecting a signature of inter-molecular recombination in mtDNA sequences sampled at the population level, inferring a paternal source for the mixed haplotypes. However, interpreting these data is fraught with difficulty, and direct experimental evidence is lacking. Using extreme-high depth mtDNA re-sequencing up to ~1.2 million-fold coverage, we find no evidence that paternal mtDNA haplotypes are transmitted to offspring in humans, thus excluding a simple dilution mechanism for uniparental transmission of mtDNA present in all healthy individuals. Our findings indicate that an active mechanism eliminates paternal mtDNA which likely acts at the molecular level. PMID:25973765
Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

PubMed

Kojima, Kenji K; Kobayashi, Ichizo

2015-10-19

R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East Asia and the Americas. In Malaysia, hrgC was horizontally transferred from hspEAsia to hpAsia2 strains. The PabI family of RM system behaves as a mobile, selfish genetic element, similar to the other families of Type II RM systems. Our analysis additionally revealed some cases of long-term inheritance. The distribution of the hrgC gene replacing the PabI family in the subpopulations of H. pylori, hspAmerind, hspEAsia and hpAsia2, corresponds to the two human migration events, one from East Asia to Americas and the other from China to Malaysia.
Novel methyl transfer during chemotaxis in Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thoelke, M.S.; Kirby, J.R.; Ordal, G.W.

1989-06-27

If Bacillus subtilis is incubated in radioactive methionine in the absence of protein synthesis, the methyl-accepting chemotaxis proteins (MCPs) become radioactively methylated. If the bacteria are further incubated in excess nonradioactive methionine (cold-chased) and then given the attractant aspartate, the MCPs lose about half of their radioactivity due to turnover, in which lower specific activity methyl groups from S-adenosylmethionine (AdoMet) replace higher specific activity ones. Due to the cold-chase, the specific activity of the AdoMet pool is reduced at least 2-fold. If, later, the attractant is removed, higher specific activity methyl groups return to the MCPs. Thus, there must existmore » an unidentified methyl carrier than can reversibly receive methyl groups from the MCPs. In a similar experiment, labeled cells were transferred to a flow cell and exposed to addition and removal of attractant and of repellent. All four kinds of stimuli were found to cause methanol production. Bacterial with maximally labeled MCPs were exposed to many cycles of addition and removal of attractant; the maximum amount of radioactive methanol was evolved on the third, not the first, cycle. This result suggests that there is a precursor-product relationship between methyl groups on the MCPs and on the unidentified carrier, which might be the direct source of methanol. However, since no methanol was produced when a methyltransferase mutant, whose MCPs were unmethylated, was exposed to addition and removal of attractant or repellent, the methanol must ultimately derive from methylated MCPs.« less
Immunization of Aged Mice with a Pneumococcal Conjugate Vaccine Combined with an Unmethylated CpG-Containing Oligodeoxynucleotide Restores Defective Immunoglobulin G Antipolysaccharide Responses and Specific CD4+-T-Cell Priming to Young Adult Levels

DTIC Science & Technology

2006-04-01

aged and young adult mice made comparable levels of proinflammatory cytokines in response to CpG-ODN, although cells from aged mice secreted higher...sepsis, is significantly elevated in the elderly relative to young adults (37, 60). Defective innate immunity including diminished neutrophil and...young adult recipients (15). Exposure to inflammatory cy- tokines in vivo could restore the defective CD4-T-cell function in aged mice (20). Pn
Possible Involvement of Standardized Bacopa monniera Extract (CDRI-08) in Epigenetic Regulation of reelin and Brain-Derived Neurotrophic Factor to Enhance Memory

PubMed Central

Preethi, Jayakumar; Singh, Hemant K.; Rajan, Koilmani E.

2016-01-01

Bacopa monniera extract (CDRI-08; BME) has been known to improve learning and memory, and understanding the molecular mechanisms may help to know its specificity. We investigated whether the BME treatment alters the methylation status of reelin and brain-derived neurotropic factor (BDNF) to enhance the memory through the interaction of N-methyl-D-aspartate receptor (NMDAR) with synaptic proteins. Rat pups were subjected to novel object recognition test following daily oral administration of BME (80 mg/kg) in 0.5% gum acacia (per-orally, p.o.; PND 15–29)/three doses of 5-azacytidine (5-azaC; 3.2 mg/kg) in 0.9% saline (intraperitoneally, i.p.) on PND-30. After the behavioral test, methylation status of reelin, BDNF and activation of NMDAR, and its interactions with synaptic proteins were tested. Rat pups treated with BME/5-azaC showed higher discrimination towards novel objects than with old objects during testing. Further, we observed an elevated level of unmethylated DNA in reelin and BDNF promoter region. Up-regulated reelin along with the splice variant of apolipoprotein E receptor 2 (ApoER 2, ex 19) form a cluster and activate NMDAR through disabled adopter protein-1 (DAB1) to enhance BDNF. Observed results suggest that BME regulate reelin epigenetically, which might enhance NMDAR interactions with synaptic proteins and induction of BDNF. These changes may be linked with improved novel object recognition memory. PMID:27445807
Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

PubMed Central

Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

2013-01-01

Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145
Silencing of TESTIN by dense biallelic promoter methylation is the most common molecular event in childhood acute lymphoblastic leukaemia

PubMed Central

2010-01-01

Background Aberrant promoter DNA methylation has been reported in childhood acute lymphoblastic leukaemia (ALL) and has the potential to contribute to its onset and outcome. However, few reports demonstrate consistent, prevalent and dense promoter methylation, associated with tumour-specific gene silencing. By screening candidate genes, we have detected frequent and dense methylation of the TESTIN (TES) promoter. Results Bisulfite sequencing showed that 100% of the ALL samples (n = 20) were methylated at the TES promoter, whereas the matched remission (n = 5), normal bone marrow (n = 6) and normal PBL (n = 5) samples were unmethylated. Expression of TES in hyperdiploid, TEL-AML+, BCR-ABL+, and E2A-PBX+ subtypes of B lineage ALL was markedly reduced compared to that in normal bone marrow progenitor cells and in B cells. In addition TES methylation and silencing was demonstrated in nine out of ten independent B ALL propagated as xenografts in NOD/SCID mice. Conclusion In total, 93% of B ALL samples (93 of 100) demonstrated methylation with silencing or reduced expression of the TES gene. Thus, TES is the most frequently methylated and silenced gene yet reported in ALL. TES, a LIM domain-containing tumour suppressor gene and component of the focal adhesion complex, is involved in adhesion, motility, cell-to-cell interactions and cell signalling. Our data implicate TES methylation in ALL and provide additional evidence for the involvement of LIM domain proteins in leukaemogenesis. PMID:20573277
A modified MS-PCR approach to diagnose patients with Prader-Willi and Angelman syndrome.

PubMed

Dos Santos, Jéssica Fernandes; Mota, Laís R; Rocha, Pedro Henrique Silva Andrade; Ferreira de Lima, Renata Lúcia L

2016-11-01

Prader-Willi (PWS) and Angelman (AS) syndromes are clinically distinct neurodevelopmental genetic diseases with multiple phenotypic manifestations. They are one of the most common genetic syndromes caused by non-Mendelian inheritance in the form of genomic imprinting, and can be attributable to the loss of gene expression due to imprinting within the chromosomal region 15q11-q13. Clinical diagnosis of PWS and AS is challenging, and the use of molecular and cytomolecular studies is recommended to help in determining the diagnosis of these conditions. The methylation analysis is a sensible approach; however there are several techniques for this purpose, such as the methylation-sensitive polymerase chain reaction (MS-PCR). This study aims to optimize the MS-PCR assay for the diagnosis of potential PWS and AS patients using DNA modified by sodium bisulfite. We used the MS-PCR technique of PCR described by Kosaki et al. (1997) adapted with betaine. All different concentrations of betaine used to amplify the methylated and unmethylated chromosomal region 15q11-q13 on the gene SNRPN showed amplification results, which increased proportionally to the concentration of betaine. The methylation analysis is a technically robust and reproducible screening method for PWS and AS. The MS-PCR assures a faster, cheaper and more efficient method for the primary diagnosis of the SNRPN gene in cases with PWS and AS, and may detect all of the three associated genetic abnormalities: deletion, uniparental disomy or imprinting errors.
Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412
Bacterial Stimulation of Toll-Like Receptor 4 Drives Macrophages To Hemophagocytose

PubMed Central

McDonald, Erin M.; Pilonieta, M. Carolina; Nick, Heidi J.

2015-01-01

During acute infection with bacteria, viruses or parasites, a fraction of macrophages engulf large numbers of red and white blood cells, a process called hemophagocytosis. Hemophagocytes persist into the chronic stage of infection and have an anti-inflammatory phenotype. Salmonella enterica serovar Typhimurium infection of immunocompetent mice results in acute followed by chronic infection, with the accumulation of hemophagocytes. The mechanism(s) that triggers a macrophage to become hemophagocytic is unknown, but it has been reported that the proinflammatory cytokine gamma interferon (IFN-γ) is responsible. We show that primary macrophages become hemophagocytic in the absence or presence of IFN-γ upon infection with Gram-negative bacterial pathogens or prolonged exposure to heat-killed Salmonella enterica, the Gram-positive bacterium Bacillus subtilis, or Mycobacterium marinum. Moreover, conserved microbe-associated molecular patterns are sufficient to stimulate macrophages to hemophagocytose. Purified bacterial lipopolysaccharide (LPS) induced hemophagocytosis in resting and IFN-γ-pretreated macrophages, whereas lipoteichoic acid and synthetic unmethylated deoxycytidine-deoxyguanosine dinucleotides, which mimic bacterial DNA, induced hemophagocytosis only in IFN-γ-pretreated macrophages. Chemical inhibition or genetic deletion of Toll-like receptor 4, a pattern recognition receptor responsive to LPS, prevented both Salmonella- and LPS-stimulated hemophagocytosis. Inhibition of NF-κB also prevented hemophagocytosis. These results indicate that recognition of microbial products by Toll-like receptors stimulates hemophagocytosis, a novel outcome of prolonged Toll-like receptor signaling, suggesting hemophagocytosis is a highly conserved innate immune response. PMID:26459510
Global DNA methylation in fetal human germ cells and germ cell tumours: association with differentiation and cisplatin resistance.

PubMed

Wermann, Hendrik; Stoop, Hans; Gillis, Ad J M; Honecker, Friedemann; van Gurp, Ruud J H L M; Ammerpohl, Ole; Richter, Julia; Oosterhuis, J Wolter; Bokemeyer, Carsten; Looijenga, Leendert H J

2010-08-01

Differences in the global methylation pattern, ie hyper- as well as hypo-methylation, are observed in cancers including germ cell tumours (GCTs). Related to their precursor cells, GCT methylation status differs according to histology. We investigated the methylation pattern of normal fetal, infantile, and adult germ cells (n = 103) and GCTs (n = 251) by immunohistochemical staining for 5-(m)cytidine. The global methylation pattern of male germ cells changes from hypomethylation to hypermethylation, whereas female germ cells remain unmethylated at all stages. Undifferentiated GCTs (seminomas, intratubular germ cell neoplasia unclassified, and gonadoblastomas) are hypomethylated, whereas more differentiated GCTs (teratomas, yolk sac tumours, and choriocarcinomas) show a higher degree of methylation. Embryonal carcinomas show an intermediate pattern. Resistance to cisplatin was assessed in the seminomatous cell line TCam-2 before and after demethylation using 5-azacytidine. Exposure to 5-azacytidine resulted in decreased resistance to cisplatin. Furthermore, after demethylation, the stem cell markers NANOG and POU5F1 (OCT3/4), as well as the germ cell-specific marker VASA, showed increased expression. Following treatment with 5-azacytidine, TCam-2 cells were analysed using a high-throughput methylation screen for changes in the methylation sites of 14,000 genes. Among the genes revealing changes, interesting targets were identified: ie demethylation of KLF11, a putative tumour suppressor gene, and hypermethylation of CFLAR, a gene previously described in treatment resistance in GCTs.
Method for rapid base sequencing in DNA and RNA with two base labeling

DOEpatents

Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

1995-04-11

A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.
Method for rapid base sequencing in DNA and RNA with two base labeling

DOEpatents

Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

1995-01-01

Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.
A statistical approach to determining criticality of residual host cell DNA.

PubMed

Yang, Harry; Wei, Ziping; Schenerman, Mark

2015-01-01

We propose a method for determining the criticality of residual host cell DNA, which is characterized through two attributes, namely the size and amount of residual DNA in biopharmaceutical product. By applying a mechanistic modeling approach to the problem, we establish the linkage between residual DNA and product safety measured in terms of immunogenicity, oncogenicity, and infectivity. Such a link makes it possible to establish acceptable ranges of residual DNA size and amount. Application of the method is illustrated through two real-life examples related to a vaccine manufactured in Madin Darby Canine Kidney cell line and a monoclonal antibody using Chinese hamster ovary (CHO) cell line as host cells.
Alteration of lysine 178 in the hinge region of the Escherichia coli ada protein interferes with activation of ada, but not alkA, transcription.

PubMed

Saget, B M; Shevell, D E; Walker, G C

1995-03-01

The ada gene of Escherichia coli K-12 encodes the 39-kDa Ada protein, which consists of two domains joined by a hinge region that is sensitive to proteolytic cleavage in vitro. The amino-terminal domain has a DNA methyltransferase activity that repairs the S-diastereoisomer of methylphosphotriesters while the carboxyl-terminal domain has a DNA methyltransferase activity that repairs O6-methylguanine and O4-methylthymine lesions. Transfer of a methyl group to Cys-69 by repair of a methylphosphotriester lesion converts Ada into a transcriptional activator of the ada and alkA genes. Activation of ada, but not alkA, requires elements contained within the carboxyl-terminal domain of Ada. In addition, physiologically relevant concentrations of the unmethylated form of Ada specifically inhibit methylated Ada-promoted ada transcription both in vitro and in vivo and it has been suggested that this phenomenon plays a pivotal role in the down-regulation of the adaptive response. A set of site-directed mutations were generated within the hinge region, changing the lysine residue at position 178 to leucine, valine, glycine, tyrosine, arginine, cysteine, proline, and serine. All eight mutant proteins have deficiencies in their ability to activate ada transcription in the presence or absence of a methylating agent but are proficient in alkA activation. AdaK178P (lysine 178 changed to proline) is completely defective for the transcriptional activation function of ada while it is completely proficient for transcriptional activation of alkA. In addition, AdaK178P possesses both classes of DNA repair activities both in vitro and in vivo. Transcriptional activation of ada does not occur if both the amino- and carboxyl-terminal domains are produced separately within the same cell. The mutation at position 178 might interfere with activation of ada transcription by changing a critical contact with RNA polymerase, by causing a conformational change of Ada, or by interfering with the communication of conformational information between the amino- and the carboxyl-terminal domains. These results indicate that the hinge region of Ada is important for ada but not alkA transcription and further support the notion that the mechanism(s) by which Ada activates ada transcription differs from that by which it activates transcription at alkA.

Application of forensic DNA testing in the legal system.

PubMed

Primorac, D; Schanfield, M S

2000-03-01

DNA technology has taken an irreplaceable position in the field of the forensic sciences. Since 1985, when Peter Gill and Alex Jeffreys first applied DNA technology to forensic problems, to the present, more than 50,000 cases worldwide have been solved through the use of DNA based technology. Although the development of DNA typing in forensic science has been extremely rapid, today we are witnessing a new era of DNA technology including automation and miniaturization. In forensic science, DNA analysis has become "the new form of scientific evidence" and has come under public scrutiny and the demand to show competence. More and more courts admit the DNA based evidence. We believe that in the near future this technology will be generally accepted in the legal system. There are two main applications of DNA analysis in forensic medicine: criminal investigation and paternity testing. In this article we present background information on DNA, human genetics, and the application of DNA analysis to legal problems, as well as the commonly applied respective mathematics.
Improved access to life insurance after genetic diagnosis of familial hypercholesterolaemia: cross-sectional postal questionnaire study

PubMed Central

Huijgen, Roeland; Homsma, Sietske JM; Hutten, Barbara A; Kindt, Iris; Vissers, Maud N; Kastelein, John JP; van Rijckevorsel, Jan LA

2012-01-01

A decade ago, in the initial stage of genetic testing for familial hypercholesterolaemia (FH) in The Netherlands, it was reported that such screening decreased access to affordable life insurance for mutation carriers. In 2003, in order to improve access to insurance for FH mutation carriers, insurers agreed to underwrite according to a set of guidelines. In this cross-sectional study, we assessed whether access to insurance has improved since the advent of these guidelines. We approached 2825 subjects that had participated in the genetic testing for FH between 1998 and 2003. We compared unconditional acceptance rates before and after FH diagnosis and before and after the guidelines were issued by means of logistic regression analysis. Our study outcome pertains to 414 FH patients who applied for life insurance. Unconditional acceptance of a policy before DNA diagnosis and before the issue of guidelines occurred in 182 out of 255 (71%) cases, versus 27 out of 35 (77%) cases after DNA diagnosis, but before the issue of guidelines. De facto, 107 out of 124 (86%) patients received unconditional acceptance after DNA diagnosis and after the issue of guidelines (P for trend=0.002). Access to life insurance improved for FH patients after molecular diagnosis and it improved even further after the guidelines were issued. Therefore, we argue that limited access to life insurance on the basis of ‘DNA discrimination' is no longer a valid argument against genetic cascade testing for FH, at least not in our country. PMID:22293687
Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

PubMed Central

Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

2016-01-01

Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570
p300 expression repression by hypermethylation associated with tumour invasion and metastasis in oesophageal squamous cell carcinoma

PubMed Central

Zhang, Changsong; Li, Ke; Wei, Lixin; Li, Zhengyou; Yu, Ping; Teng, Lijuan; Wu, Kusheng; Zhu, Jin

2007-01-01

Background Aberrant promoter methylation is an important mechanism for gene silencing. Aims To evaluate the promoter methylation status of p300 gene in patients with oesophageal squamous cell carcinoma (OSCC). Methods The methylation status of p300 promoter was analysed by methylation‐specific PCR (MSP) in 50 OSCC tissues and the matching non‐cancerous tissues. Oesophageal cancer cell lines (ECa‐109 and TE‐10) were treated with the demethylation agent 5‐aza‐2′‐deoxycytidine (5‐Aza‐CdR), and p300 mRNA expression was detected by RT‐PCR. Results p300 methylation was found in 42% (21/50) of the OSCC tissues, but in only 20% (10/50) of the corresponding non‐cancerous tissues (p = 0.017). In OSCC samples, 65% of those with deep tumour invasion (adventitia) and 63% samples with metastasis revealed p300 promoter methylation (p<0.05). p300 mRNA expression was observed in 19.0% (4/21) of methylated tumours and 58.6% (17/29) of unmethylated tumours (p = 0.005). In addition, p300 mRNA expression was observed in 40% (4/10) of methylated non‐neoplastic tissues and 87.5% (35/40) of unmethylated non‐tumours (p = 0.001). The demethylation caused by 5‐Aza‐CdR increased the p300 mRNA expression levels in oesophageal cancer cell lines. Conclusions p300 transcription silenced by promoter hypermethylation could play a role in the pathogenesis of oesophageal squamous cell carcinoma. PMID:17965222
Testing the utility of matK and ITS DNA regions for discrimination of Allium species

USDA-ARS?s Scientific Manuscript database

Molecular phylogenetic analysis of the genus Allium L. has been mainly based on the nucleotide sequences of ITS region. In 2009 matK and rbcL were accepted as a two-locus DNA barcode to classify plant species by the Consortium for the Barcode of Life (CBOL) Plant Working Group. MatK region has been ...
DNA gyrase with a single catalytic tyrosine can catalyze DNA supercoiling by a nicking-closing mechanism

PubMed Central

Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar

2016-01-01

The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712
Capstan Friction Model for DNA Ejection from Bacteriophages

NASA Astrophysics Data System (ADS)

Ghosal, Sandip

2012-12-01

Bacteriophages infect cells by attaching to the outer membrane and injecting their DNA into the cell. The phage DNA is then transcribed by the cell’s transcription machinery. A number of physical mechanisms by which DNA can be translocated from the phage capsid into the cell have been identified. A fast ejection driven by the elastic and electrostatic potential energy of the compacted DNA within the viral capsid appears to be used by most phages, at least to initiate infection. In recent in vitro experiments, the speed of DNA translocation from a λ phage capsid has been measured as a function of ejected length over the entire duration of the event. Here, a mechanical model is proposed that is able to explain the observed dependence of exit velocity on ejected length, and that is also consistent with the accepted picture of the geometric arrangement of DNA within the viral capsid.
The Cucurbitaceae of India: Accepted names, synonyms, geographic distribution, and information on images and DNA sequences

PubMed Central

Renner, Susanne S.; Pandey, Arun K.

2013-01-01

Abstract The most recent critical checklists of the Cucurbitaceae of India are 30 years old. Since then, botanical exploration, online availability of specimen images and taxonomic literature, and molecular-phylogenetic studies have led to modified taxon boundaries and geographic ranges. We present a checklist of the Cucurbitaceae of India that treats 400 relevant names and provides information on the collecting locations and herbaria for all types. We accept 94 species (10 of them endemic) in 31 genera. For accepted species, we provide their geographic distribution inside and outside India, links to online images of herbarium or living specimens, and information on publicly available DNA sequences to highlight gaps in the current understanding of Indian cucurbit diversity. Of the 94 species, 79% have DNA sequences in GenBank, albeit rarely from Indian material. The most species-rich genera are Trichosanthes with 22 species, Cucumis with 11 (all but two wild), Momordica with 8, and Zehneria with 5. From an evolutionary point of view, India is of special interest because it harbors a wide range of lineages, many of them relatively old and phylogenetically isolated. Phytogeographically, the north eastern and peninsular regions are richest in species, while the Jammu Kashmir and Himachal regions have few Cucurbitaceae. Our checklist probably underestimates the true diversity of Indian Cucurbitaceae, but should help focus efforts towards the least known species and regions. PMID:23717193
Comparing self- and provider-collected swabbing for HPV DNA testing in female-to-male transgender adult patients: a mixed-methods biobehavioral study protocol.

PubMed

Reisner, Sari L; Deutsch, Madeline B; Peitzmeier, Sarah M; White Hughto, Jaclyn M; Cavanaugh, Timothy; Pardee, Dana J; McLean, Sarah; Marrow, Elliot J; Mimiaga, Matthew J; Panther, Lori; Gelman, Marcy; Green, Jamison; Potter, Jennifer

2017-06-23

Cervical cancer, nearly all cases of which are caused by one of several high-risk strains of the human papillomavirus (hr-HPV), leads to significant morbidity and mortality in individuals with a cervix. Trans masculine (TM) individuals were born with female reproductive organs and identify as male, man, transgender man, or another diverse gender identity different from their female assigned sex at birth. Routine preventive sexual health screening of TM patients is recommended, including screening for cervical cancer and other sexually transmitted infections (STIs); however, as many as one in three TM patients are not up-to-date per recommended U.S. Among cisgender (non-transgender) women, self-swab hr.-HPV DNA testing as a primary cervical cancer screening method and self-swab specimen collection for other STIs have high levels of acceptability. No study has yet been conducted to compare the performance and acceptability of self- and provider-collected swabs for hr.-HPV DNA testing and other STIs in TM patients. This article describes the study protocol for a mixed-methods biobehavioral investigation enrolling 150 sexually active TM to (1) assess the clinical performance and acceptability of a vaginal self-swab for hr.-HPV DNA testing compared to provider cervical swab and cervical cytology, and (2) gather acceptability data on self-collected specimens for other STIs. Study participation entails a one-time clinical visit at Fenway Health in Boston, MA comprised of informed consent, quantitative assessment, venipuncture for syphilis testing and HIV (Rapid OraQuick) testing, randomization, collection of biological specimens/biomarkers, participant and provider satisfaction survey, and qualitative exit interview. Participants are compensated $100. The primary study outcomes are concordance (kappa statistic) and performance (sensitivity and specificity) of self-collected vaginal HPV DNA specimens vs provider-collected cervical HPV swabs as a gold standard. This study addresses critical gaps in current clinical knowledge of sexual health in TM patients, including comparing alternative strategies for screening and diagnosis of cervical cancer, hr.-HPV, and other STIs. Findings have implications for improving the delivery of sexual health screening to this often overlooked and underserved patient population. Less-invasive patient-centered strategies may also generalize to other at-risk cisgender female populations that face barriers to timely and needed STI and cervical cancer screening. ClinicalTrials.gov ID: NCT02401867.
Clinical application of the Quantiplex HCV RNA 2.0 and Amplicor HCV Monitor assays for quantifying serum hepatitis C virus RNA.

PubMed

Yu, M L; Chuang, W L; Chen, S C; Lin, Z Y; Hsieh, M Y; Wang, L Y; Chang, W Y

1999-11-01

To compare the performance characteristics and clinical application of two different technologies for quantifying serum hepatitis C virus (HCV) RNA levels. HCV RNA was quantified by Amplicor HCV Monitor assay (Amplicor) and Quantiplex HCV RNA 2.0 assay (bDNA-2) in 119 sera from 107 HCV infected patients. Both assays had similar sensitivity (79.4% for Amplicor; 86.0% for bDNA-2), acceptable coefficients of variation (5.3% in Amplicor; 2.6% in bDNA-2), and good linearity (r2 > or = 0.98). There was a positive correlation between quantification values of both methods (r = 0.683, p < 0.001). The Amplicor values were on an average 1.76 log lower than bDNA-2 results. Male subjects and HCV genotype 1b were significantly associated with higher viral load determined by Amplicor, but not with viral load measured by bDNA-2. In 70 chronic HCV infected patients treated with interferon alfa, mean (SD) pretreatment viral load in 27 complete responders (3.47 (0.84) logs for Amplicor, 5.63 (0.58) for bDNA-2) was significantly lower than in non-responders (4.43 (1.01) logs for Amplicor, 6.10 (0.67) logs for bDNA-2; p < 0.001). Cut off points of 3.9 logs for Amplicor and 5.8 logs for bDNA-2 were determined to be the best for predicting response to interferon alfa, giving acceptable sensitivity (70.4%, 74.1%), specificity (72.1%, 65.1%), and accuracy (71.4%, 68.6%), respectively. Both the Amplicor and bDNA-2 assays are clinically useful methods for HCV RNA quantification and are reliable for predicting the outcome of treatment, despite differences in absolute quantification values and in the correlation between HCV genotypes and viral load.
[Variation of long-chain 3-hydroxyacyl-CoA dehydrogenase DNA methylation in placenta of different preeclampsia-like mouse models].

PubMed

Han, Yiwei; Yang, Zi; Ding, Xiaoyan; Yu, Huan; Yi, Yanhong

2015-10-01

By detecting the variation of long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) DNA methylation in preeclampsia-like mouse models generated by different ways, to explore the roles of multifactor and multiple pathways in preeclampsia pathogenesis on molecular basis. Established preeclampsia-like mouse models in different ways and divided into groups as follows: (1) Nw-nitro-L-arginine-methyl ester (L-NAME) group: wild-type pregnant mouse received subcutaneous injection of L-NAME; (2) lipopolysaccharide (LPS) group: wild-type pregnant mouse received intraperitoneal injection of LPS; (3) apolipoprotein C-III (ApoC3) group: ApoC3 transgenic pregnant mouse with dysregulated lipid metabolism received subcutaneous injection of L-NAME; (4) β2 glycoprotein I (β-2GPI) group: wild-type pregnant mouse received subcutaneous injection of β-2GPI. According to the first injection time (on day 3, 11, 16 respectively), the L-NAME, LPS and ApoC3 groups were further subdivided into: pre-implantation (PI) experimental stage, early gestation (EG) experimental stage, and late gestation (LG) experimental stage. β-2GPI group was only injected before implantation. LCHAD gene methylation levels in placental were detected in different experimental stage. Normal saline control groups were set within wild-type and ApoC3 transgenic pregnant mice simultaneously. (1) CG sites in LCHAD DNA: 45 CG sites were detected in the range of 728 bp before LCHAD gene transcription start site, the 5, 12, 13, 14, 15, 16, 19, 24, 25, 27, 28, 29, 30, 31, 32, 34, 35, 43 CG sites were complex sites which contained two or more CG sequences, others were single site which contained one CG sequence. The 3, 5, 6, 11, 13, 14, 18, 28 sites in L-NAME, LPS, ApoC3 and β-2GPI groups showed different high levels of methylation; the 16, 25, 31, 42, 44 sites showed different low levels of methylation; other 32 sites were unmethylated. (2) Comparison of LCHAD gene methylation between different groups: the methylation levels of LCAHD gene at 3, 11, 13, 14, 18 sites in L-NAME, LPS, ApoC3 and β-2GPI groups were significantly higher than those in the normal saline control group (P < 0.05); and the methylation levels of 42, 44 sites in these groups were significantly lower than those in the normal saline control group (P < 0.05). (3) Methylation of LCHAD gene at the same site between different experimental stages: ① The 3, 11, 18 sites of EG experimental stage was significantly lower than PI and LG experimental stage in L-NAME group (P < 0.05); the 3, 11, 18 sites of PI experimental stage was significantly lower than EG and LG experimental stage in LPS group (P < 0.05); these sites of PI experimental stage was significantly higher than EG and LG experimental stages in ApoC3 group (P < 0.05). ② The methylation of site 5 in L-NAME and LPS groups were significantly higher than that of the normal saline control group (P < 0.05), and the LG experimental stages were significantly higher than other stages, but in ApoC3 group, only PI and EG stages were significantly higher than the normal saline control group (P < 0.05). ③ At site 6 in L-NAME group which showed high methylation level was significantly higher than the same site in other groups which showed low methylation level (P < 0.05). ④ At 13, 14 sites, earlier preeclampsia onset caused a lower methylation level in L-NAME group, but PI experimental stage was significantly higher than EG and LG experimental stages in LPS group (P < 0.05), EG experimental stage was significantly higher than PI and LG experimental stages in ApoC3 group (P < 0.05). ⑤ At site 28, earlier preeclampsia onset caused a higher methylation level in L-NAME group, but PI experimental stage was significantly lower than EG and LG experimental stages in LPS group (P < 0.05), EG experimental stage was significantly higher than PI and LG experimental stages in ApoC3 group (P < 0.05). ⑥ The 16, 25, 31 sites in ApoC3 group were significantly higher than other groups (P < 0.05). ⑦ At site 42 in β-2GPI group was unmethylated, but it in other groups showed low methylation level, the methylation level of site 42 in β-2GPI group was significantly lower than that in other groups (P < 0.05). The methylation of 6 and 42 CG sites may be related to LCHAD gene expression in placenta of L-NAME and β-2GPI induced preeclampsia-like models respectively; LCHAD gene expression and DNA methylation may not have obvious correlation in LPS and ApoC3 induced preeclampsia-like models. Differences exist in LCHAD DNA methylation in preeclampsia-like models generated by different ways, revealed a molecular basis to expand our understanding of the multi-factorial pathogenesis of preeclampsia.
Enhancing DNA electro-transformation efficiency on a clinical Staphylococcus capitis isolate.

PubMed

Cui, Bintao; Smooker, Peter M; Rouch, Duncan A; Deighton, Margaret A

2015-02-01

Clinical staphylococcus isolates possess a stronger restriction-modification (RM) barrier than laboratory strains. Clinical isolates are therefore more resistant to acceptance of foreign genetic material than laboratory strains, as their restriction systems more readily recognize and destroy foreign DNA. This stronger barrier consequently restricts genetic studies to a small number of domestic strains that are capable of accepting foreign DNA. In this study, an isolate of Staphylococcus capitis, obtained from the blood of a very low birth-weight baby, was transformed with a shuttle vector, pBT2. Optimal conditions for electro-transformation were as follows: cells were harvested at mid-log phase, electro-competent cells were prepared; cells were pre-treated at 55°C for 1min; 3μg of plasmid DNA was mixed with 70-80μL of competent cells (3-4×10(10)cells/mL) at 20°C in 0.5M sucrose, 10% glycerol; and electroporation was conducted using 2.1kV/cm field strength with a 0.1cm gap. Compared to the conventional method, which involves DNA electroporation of Staphylococcus aureus RN4220 as an intermediate strain to overcome the restriction barrier, our proposed approach exhibits a higher level (3 log10 units) of transformation efficiency. Heat treatment was used to temporarily inactivate the recipient RM barrier. Other important parameters contributing to improved electro-transformation efficiency were growth stage for cell harvesting, the quantity of DNA, the transformation temperature and field strength. The approach described here may facilitate genetic manipulations of this opportunistic pathogen. Copyright © 2014 Elsevier B.V. All rights reserved.
Disaster victim investigation recommendations from two simulated mass disaster scenarios utilized for user acceptance testing CODIS 6.0.

PubMed

Bradford, Laurie; Heal, Jennifer; Anderson, Jeff; Faragher, Nichole; Duval, Kristin; Lalonde, Sylvain

2011-08-01

Members of the National DNA Data Bank (NDDB) of Canada designed and searched two simulated mass disaster (MD) scenarios for User Acceptance Testing (UAT) of the Combined DNA Index System (CODIS) 6.0, developed by the Federal Bureau of Investigation (FBI) and the US Department of Justice. A simulated airplane MD and inland Tsunami MD were designed representing a closed and open environment respectively. An in-house software program was written to randomly generate DNA profiles from a mock Caucasian population database. As part of the UAT, these two MDs were searched separately using CODIS 6.0. The new options available for identity and pedigree searching in addition to the inclusion of mitochondrial DNA (mtDNA) and Y-STR (short tandem repeat) information in CODIS 6.0, led to rapid identification of all victims. A Joint Pedigree Likelihood Ratio (JPLR) was calculated from the pedigree searches and ranks were stored in Rank Manager providing confidence to the user in assigning an Unidentified Human Remain (UHR) to a pedigree tree. Analyses of the results indicated that primary relatives were more useful in Disaster Victim Identification (DVI) compared to secondary or tertiary relatives and that inclusion of mtDNA and/or Y-STR technologies helped to link family units together as shown by the software searches. It is recommended that UHRs have as many informative loci possible to assist with their identification. CODIS 6.0 is a valuable technological tool for rapidly and confidently identifying victims of mass disasters. Crown Copyright © 2010. Published by Elsevier Ireland Ltd. All rights reserved.
Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.

PubMed

Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki

2017-05-16

The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.
A new building block for DNA network formation by self-assembly and polymerase chain reaction.

PubMed

Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas

2014-01-01

The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Evaluation of Skin Surface as an Alternative Source of Reference DNA Samples: A Pilot Study.

PubMed

Albujja, Mohammed H; Bin Dukhyil, Abdul Aziz; Chaudhary, Abdul Rauf; Kassab, Ahmed Ch; Refaat, Ahmed M; Babu, Saranya Ramesh; Okla, Mohammad K; Kumar, Sachil

2018-01-01

An acceptable area for collecting DNA reference sample is a part of the forensic DNA analysis development. The aim of this study was to evaluate skin surface cells (SSC) as an alternate source of reference DNA sample. From each volunteer (n = 10), six samples from skin surface areas (forearm and fingertips) and two traditional samples (blood and buccal cells) were collected. Genomic DNA was extracted and quantified then genotyped using standard techniques. The highest DNA concentration of SSC samples was collected using the tape/forearm method of collection (2.1 ng/μL). Cotton swabs moistened with ethanol yielded higher quantities of DNA than swabs moistened with salicylic acid, and it gave the highest percentage of full STR profiles (97%). This study supports the use of SSC as a noninvasive sampling technique and as a extremely useful source of DNA reference samples among certain cultures where the use of buccal swabs can be considered socially unacceptable. © 2017 American Academy of Forensic Sciences.
Are all GMOs the same? Consumer acceptance of cisgenic rice in India.

PubMed

Shew, Aaron M; Nalley, Lawton L; Danforth, Diana M; Dixon, Bruce L; Nayga, Rodolfo M; Delwaide, Anne-Cecile; Valent, Barbara

2016-01-01

India has more than 215 million food-insecure people, many of whom are farmers. Genetically modified (GM) crops have the potential to alleviate this problem by increasing food supplies and strengthening farmer livelihoods. For this to occur, two factors are critical: (i) a change in the regulatory status of GM crops, and (ii) consumer acceptance of GM foods. There are generally two classifications of GM crops based on how they are bred: cisgenically bred, containing only DNA sequences from sexually compatible organisms; and transgenically bred, including DNA sequences from sexually incompatible organisms. Consumers may view cisgenic foods as more natural than those produced via transgenesis, thus influencing consumer acceptance. This premise was the catalyst for our study--would Indian consumers accept cisgenically bred rice and if so, how would they value cisgenics compared to conventionally bred rice, GM-labelled rice and 'no fungicide' rice? In this willingness-to-pay study, respondents did not view cisgenic and GM rice differently. However, participants were willing-to-pay a premium for any aforementioned rice with a 'no fungicide' attribute, which cisgenics and GM could provide. Although not significantly different (P = 0.16), 76% and 73% of respondents stated a willingness-to-consume GM and cisgenic foods, respectively. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
The Roads to and from the RNA World

NASA Technical Reports Server (NTRS)

Dworkin, Jason P.; Lazcano, Antonio; Miller, Stanley L.

2003-01-01

The historical existence of the RNA world, in which early life used RNA for both genetic information and catalytic ability, is widely accepted. However, there has been little discussion of whether protein synthesis arose before DNA or what preceded the RNA world (i.e. the pre-RNA world). We outline arguments of what route life may have taken out of the RNA world: whether DNA or protein followed. The metabolic arguments favor the possibility that RNA genomes preceded the use of DNA as the informational macromolecule. However, the opposite can also be argued based on the enhanced stability, reactivity, and solubility of 2-deoxyribose as compared to ribose. The possibility that DNA may have come before RNA is discussed, although it is a less parsimonious explanation than DNA following RNA.
Sperm mitochondria in reproduction: good or bad and where do they go?

PubMed

Luo, Shi-Ming; Schatten, Heide; Sun, Qing-Yuan

2013-11-20

The mitochondrion is the major energy provider to power sperm motility. In mammals, aside from the nuclear genome, mitochondrial DNA (mtDNA) also contributes to oxidative phosphorylation to impact production of ATP by coding 13 polypeptides. However, the role of sperm mitochondria in fertilization and its final fate after fertilization are still controversial. The viewpoints that sperm bearing more mtDNA will have a better fertilizing capability and that sperm mtDNA is actively eliminated during early embryogenesis are widely accepted. However, this may be not true for several mammalian species, including mice and humans. Here, we review the sperm mitochondria and their mtDNA in sperm functions, and the mechanisms of maternal mitochondrial inheritance in mammals. Copyright © 2013. Published by Elsevier Ltd.
Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.
Treatment of recurrent malignant gliomas with fotemustine monotherapy: impact of dose and correlation with MGMT promoter methylation.

PubMed

Fabi, Alessandra; Metro, Giulio; Russillo, Michelangelo; Vidiri, Antonello; Carapella, Carmine Maria; Maschio, Marta; Cognetti, Francesco; Jandolo, Bruno; Mirri, Maria Alessandra; Sperduti, Isabella; Telera, Stefano; Carosi, Mariantonia; Pace, Andrea

2009-03-31

In recurrent malignant gliomas (MGs), a high rate of haematological toxicity is observed with the use of fotemustine at the conventional schedule (100 mg/m(2) weekly for 3 consecutive weeks followed by triweekly administration after a 5-week rest period). Also, the impact of O6-methylguanine-DNA methyltransferase (MGMT) promoter methylation status on fotemustine activity has never been explored in the clinical setting. 40 patients with recurrent pretreated MG were identified as being treated with fotemustine at doses ranging from 65 mg/m(2) to 100 mg/m(2). Patients were classified into 3 groups according to the dose of fotemustine received, from the lowest dosage received in group A, to the highest in group C. Analysis of MGMT promoter methylation in tumor tissue was successfully performed in 19 patients. Overall, 20% of patients responded to treatment, for a disease control rate (DCR, responses plus stabilizations) of 47.5%. Groups A and B experienced a response rate of 40% and 26.5% respectively, while the corresponding value for group C was 10%. Out of 19 patients, MGMT promoter was found methylated in 12 cases among which a DCR of 66.5% was observed. All 7 patients with unmethylated MGMT promoter were progressive to fotemustine. Low-dose fotemustine at 65-75 mg/m(2) (induction phase) followed by 75-85 mg/m(2) (maintenance phase) has an activity comparable to that of the conventional schedule. By determination of the MGMT promoter methylation status patients might be identified who are more likely to benefit from fotemustine chemotherapy.
Statistical method evaluation for differentially methylated CpGs in base resolution next-generation DNA sequencing data.

PubMed

Zhang, Yun; Baheti, Saurabh; Sun, Zhifu

2018-05-01

High-throughput bisulfite methylation sequencing such as reduced representation bisulfite sequencing (RRBS), Agilent SureSelect Human Methyl-Seq (Methyl-seq) or whole-genome bisulfite sequencing is commonly used for base resolution methylome research. These data are represented either by the ratio of methylated cytosine versus total coverage at a CpG site or numbers of methylated and unmethylated cytosines. Multiple statistical methods can be used to detect differentially methylated CpGs (DMCs) between conditions, and these methods are often the base for the next step of differentially methylated region identification. The ratio data have a flexibility of fitting to many linear models, but the raw count data take consideration of coverage information. There is an array of options in each datatype for DMC detection; however, it is not clear which is an optimal statistical method. In this study, we systematically evaluated four statistic methods on methylation ratio data and four methods on count-based data and compared their performances with regard to type I error control, sensitivity and specificity of DMC detection and computational resource demands using real RRBS data along with simulation. Our results show that the ratio-based tests are generally more conservative (less sensitive) than the count-based tests. However, some count-based methods have high false-positive rates and should be avoided. The beta-binomial model gives a good balance between sensitivity and specificity and is preferred method. Selection of methods in different settings, signal versus noise and sample size estimation are also discussed.
Phase 1 Study of Preoperative Chemoradiation Therapy With Temozolomide and Capecitabine in Patients With Locally Advanced Rectal Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Jae Ho; Hong, Yong Sang; Park, Yangsoon

Purpose: Preoperative chemoradiation therapy (CRT) with capecitabine is a standard treatment strategy in patients with locally advanced rectal cancer (LARC). Temozolomide improves the survival of patients with glioblastoma with hypermethylated O{sup 6}-methylguanine DNA methyltransferase (MGMT); MGMT hypermethylation is one of the colorectal carcinogenesis pathways. We aimed to determine the dose-limiting toxicity (DLT) and recommended dose (RD) of temolozomide in combination with capecitabine-based preoperative CRT for LARC. Methods and Materials: Radiation therapy was delivered with 45 Gy/25 daily fractions with coned-down boost of 5.4 Gy/3 fractions. Concurrent chemotherapy comprised fixed and escalated doses of capecitabine and temozolomide, respectively. The MGMT hypermethylation was evaluatedmore » in pretreatment tumor samples. This trial is registered with (ClinicalTrials.gov) with the number (NCT01781403). Results: Twenty-two patients with LARC of cT3-4N0 or cT{sub any}N1-2 were accrued. Dose level 3 was chosen as the RD because DLT was noticeably absent in 10 patients treated up to dose level 3. An additional 12 patients were recruited in this group. Grade III adverse events were noted, and pathologic complete response (pCR) was observed in 7 patients (31.8%); MGMT hypermethylation was detected in 16. The pCR rate was 37.5% and 16.7% in the hypermethylated and unmethylated MGMT groups, respectively (P=.616). Conclusions: There was a tendency toward higher pCR rates in patients with hypermethylated MGMT. Future randomized studies are therefore warranted.« less
An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

PubMed Central

Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

2015-01-01

Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280
Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

PubMed Central

Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

2012-01-01

The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396
Arabidopsis homologs of retinoblastoma-associated protein 46/48 associate with a histone deacetylase to act redundantly in chromatin silencing.

PubMed

Gu, Xiaofeng; Jiang, Danhua; Yang, Wannian; Jacob, Yannick; Michaels, Scott D; He, Yuehui

2011-11-01

RNA molecules such as small-interfering RNAs (siRNAs) and antisense RNAs (asRNAs) trigger chromatin silencing of target loci. In the model plant Arabidopsis, RNA-triggered chromatin silencing involves repressive histone modifications such as histone deacetylation, histone H3 lysine-9 methylation, and H3 lysine-27 monomethylation. Here, we report that two Arabidopsis homologs of the human histone-binding proteins Retinoblastoma-Associated Protein 46/48 (RbAp46/48), known as MSI4 (or FVE) and MSI5, function in partial redundancy in chromatin silencing of various loci targeted by siRNAs or asRNAs. We show that MSI5 acts in partial redundancy with FVE to silence FLOWERING LOCUS C (FLC), which is a crucial floral repressor subject to asRNA-mediated silencing, FLC homologs, and other loci including transposable and repetitive elements which are targets of siRNA-directed DNA Methylation (RdDM). Both FVE and MSI5 associate with HISTONE DEACETYLASE 6 (HDA6) to form complexes and directly interact with the target loci, leading to histone deacetylation and transcriptional silencing. In addition, these two genes function in de novo CHH (H = A, T, or C) methylation and maintenance of symmetric cytosine methylation (mainly CHG methylation) at endogenous RdDM target loci, and they are also required for establishment of cytosine methylation in the previously unmethylated sequences directed by the RdDM pathway. This reveals an important functional divergence of the plant RbAp46/48 relatives from animal counterparts.
Fotemustine as second-line treatment for recurrent or progressive glioblastoma after concomitant and/or adjuvant temozolomide: a phase II trial of Gruppo Italiano Cooperativo di Neuro-Oncologia (GICNO).

PubMed

Brandes, Alba A; Tosoni, A; Franceschi, E; Blatt, V; Santoro, A; Faedi, M; Amistà, P; Gardiman, M; Labianca, R; Bianchini, C; Ermani, M; Reni, M

2009-09-01

Standardized salvage treatment has not yet proved effective in glioblastoma multiforme (GBM) patients who receive prior standard radiotherapy plus concomitant and adjuvant temozolomide. Patients with progressive GBM after radiotherapy plus concomitant and/or adjuvant temozolomide received three-weekly doses (100-75 mg m(2)) of fotemustine followed, after a 5-week rest, by fotemustine (100 mg m(2)) every 3 weeks for < or =1 year. Forty-three patients (29 M, 14 F; median age 51 years, range 34-68; median KPS 90) were enrolled. Progression-free survival at 6 months (PFS-6) was 20.9% (95% CI: 9-33%); three patients (7.1%) had partial response (PR); 15 (34.9%), disease stabilization (SD). The median survival was 6 months (95% CI: 5-7). MGMT promoter status was methylated in 8 (18.6%) and unmethylated in 26 (60.5%) and not assessable in 9 (20.9%) patients, respectively. Disease control was 75% versus 34.6% in methylated and unmethylated MGMT patients (P = 0.044); no significant difference was found between groups for PFS-6 and survival. Grade 3 and 4 thrombocytopenia and neutropenia were observed in 20.9 and 16.3% of patients, during the induction phase, and in 0 and 9.5% patients during the maintenance phase, respectively. The findings of the present trial, that evaluate fotemustine in a homogeneous population, may represent a new benchmark for nitrosourea activity. Moreover, this is the first study to evaluate correlation between MGMT promoter status and outcome of fotemustine for relapsing GBM previously treated with radiotherapy and temozolomide.
Inheritance of Trans Chromosomal Methylation patterns from Arabidopsis F1 hybrids

PubMed Central

Greaves, Ian K.; Groszmann, Michael; Wang, Aihua; Peacock, W. James; Dennis, Elizabeth S.

2014-01-01

Hybridization in plants leads to transinteractions between the parental genomes and epigenomes that can result in changes to both 24 nt siRNA and cytosine methylation (mC) levels in the hybrid. In Arabidopsis the principle processes altering the hybrid methylome are Trans Chromosomal Methylation (TCM) and Trans Chromosomal deMethylation (TCdM) in which the mC pattern of a genomic segment attains the same mC pattern of the corresponding segment on the other parental chromosome. We examined two loci that undergo TCM/TCdM in the Arabidopsis C24/Landsberg erecta (Ler) F1 hybrids, which show patterns of inheritance dependent on the properties of the particular donor and recipient chromosomal segments. At At1g64790 the TCM- and TCdM-derived mC patterns are maintained in the F2 generation but are transmitted in outcrosses or backcrosses only by the C24 genomic segment. At a region between and adjacent to At3g43340 and At3g43350, the originally unmethylated Ler genomic segment receives the C24 mC pattern in the F1, which is then maintained in backcross plants independent of the presence of the parental C24 segment. In backcrosses to an unmethylated Ler allele, the newly methylated F1 Ler segment may act as a TCM source in a process comparable to paramutation in maize. TCM-derived mC patterns are associated with reduced expression of both At3g43340 and At3g43350 in F1 and F2 plants, providing support for such events influencing the transcriptome. The inheritance of the F1 mC patterns and the segregation of other genetic and epigenetic determinants may contribute to the reduced hybrid vigor in the F2 and subsequent generations. PMID:24449910
Inheritance of Trans Chromosomal Methylation patterns from Arabidopsis F1 hybrids.

PubMed

Greaves, Ian K; Groszmann, Michael; Wang, Aihua; Peacock, W James; Dennis, Elizabeth S

2014-02-04

Hybridization in plants leads to transinteractions between the parental genomes and epigenomes that can result in changes to both 24 nt siRNA and cytosine methylation ((m)C) levels in the hybrid. In Arabidopsis the principle processes altering the hybrid methylome are Trans Chromosomal Methylation (TCM) and Trans Chromosomal deMethylation (TCdM) in which the (m)C pattern of a genomic segment attains the same (m)C pattern of the corresponding segment on the other parental chromosome. We examined two loci that undergo TCM/TCdM in the Arabidopsis C24/Landsberg erecta (Ler) F1 hybrids, which show patterns of inheritance dependent on the properties of the particular donor and recipient chromosomal segments. At At1g64790 the TCM- and TCdM-derived (m)C patterns are maintained in the F2 generation but are transmitted in outcrosses or backcrosses only by the C24 genomic segment. At a region between and adjacent to At3g43340 and At3g43350, the originally unmethylated Ler genomic segment receives the C24 (m)C pattern in the F1, which is then maintained in backcross plants independent of the presence of the parental C24 segment. In backcrosses to an unmethylated Ler allele, the newly methylated F1 Ler segment may act as a TCM source in a process comparable to paramutation in maize. TCM-derived (m)C patterns are associated with reduced expression of both At3g43340 and At3g43350 in F1 and F2 plants, providing support for such events influencing the transcriptome. The inheritance of the F1 (m)C patterns and the segregation of other genetic and epigenetic determinants may contribute to the reduced hybrid vigor in the F2 and subsequent generations.
Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903
DNA barcoding the floras of biodiversity hotspots.

PubMed

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G; Savolainen, Vincent

2008-02-26

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a "DNA barcoding gap" is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes.
DNA barcoding the floras of biodiversity hotspots

PubMed Central

Lahaye, Renaud; van der Bank, Michelle; Bogarin, Diego; Warner, Jorge; Pupulin, Franco; Gigot, Guillaume; Maurin, Olivier; Duthoit, Sylvie; Barraclough, Timothy G.; Savolainen, Vincent

2008-01-01

DNA barcoding is a technique in which species identification is performed by using DNA sequences from a small fragment of the genome, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical. DNA barcoding is well established in animals, but there is not yet any universally accepted barcode for plants. Here, we undertook intensive field collections in two biodiversity hotspots (Mesoamerica and southern Africa). Using >1,600 samples, we compared eight potential barcodes. Going beyond previous plant studies, we assessed to what extent a “DNA barcoding gap” is present between intra- and interspecific variations, using multiple accessions per species. Given its adequate rate of variation, easy amplification, and alignment, we identified a portion of the plastid matK gene as a universal DNA barcode for flowering plants. Critically, we further demonstrate the applicability of DNA barcoding for biodiversity inventories. In addition, analyzing >1,000 species of Mesoamerican orchids, DNA barcoding with matK alone reveals cryptic species and proves useful in identifying species listed in Convention on International Trade of Endangered Species (CITES) appendixes. PMID:18258745
Protocol for the use of light upon extension real-time PCR for the determination of viral load in HBV infection.

PubMed

Li, Guimin; Li, Wangfeng; Liu, Lixia

2012-01-01

Real-time PCR has engendered wide acceptance for quantitation of hepatitis B virus (HBV) DNA in the blood due to its improved rapidity, sensitivity, reproducibility, and reduced contamination. Here we describe a cost-effective and highly sensitive HBV real-time quantitative assay based on the light upon extension real-time PCR platform and a simple and reliable HBV DNA preparation method using silica-coated magnetic beads.
Phylogeny of the gymnosperm genus Cycas L. (Cycadaceae) as inferred from plastid and nuclear loci based on a large-scale sampling: Evolutionary relationships and taxonomical implications.

PubMed

Liu, Jian; Zhang, Shouzhou; Nagalingum, Nathalie S; Chiang, Yu-Chung; Lindstrom, Anders J; Gong, Xun

2018-05-18

The gymnosperm genus Cycas is the sole member of Cycadaceae, and is the largest genus of extant cycads. There are about 115 accepted Cycas species mainly distributed in the paleotropics. Based on morphology, the genus has been divided into six sections and eight subsections, but this taxonomy has not yet been tested in a molecular phylogenetic framework. Although the monophyly of Cycas is broadly accepted, the intrageneric relationships inferred from previous molecular phylogenetic analyses are unclear due to insufficient sampling or uninformative DNA sequence data. In this study, we reconstructed a phylogeny of Cycas using four chloroplast intergenic spacers and seven low-copy nuclear genes and sampling 90% of extant Cycas species. The maximum likelihood and Bayesian inference phylogenies suggest: (1) matrices of either concatenated cpDNA markers or of concatenated nDNA lack sufficient informative sites to resolve the phylogeny alone, however, the phylogeny from the combined cpDNA-nDNA dataset suggests the genus can be roughly divided into 13 clades and six sections that are in agreement with the current classification of the genus; (2) although with partial support, a clade combining sections Panzhihuaenses + Asiorientales is resolved as the earliest diverging branch; (3) section Stangerioides is not monophyletic because the species resolve as a grade; (4) section Indosinenses is not monophyletic as it includes Cycas macrocarpa and C. pranburiensis from section Cycas; (5) section Cycas is the most derived group and its subgroups correspond with geography. Copyright © 2018 Elsevier Inc. All rights reserved.
Application of DNA-based methods in forensic entomology.

PubMed

Wells, Jeffrey D; Stevens, Jamie R

2008-01-01

A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.
A sensitive immunosorbent bio-barcode assay based on real-time immuno-PCR for detecting 3,4,3',4'-tetrachlorobiphenyl.

PubMed

Yang, Guang-Xin; Zhuang, Hui-Sheng; Chen, Han-Yu; Ping, Xian-Yin; Bu, Dan

2014-02-01

A functionalized gold-nanoparticle bio-barcode assay, based on real-time immuno-PCR (IPCR), was designed for the determination of 3,4,3',4'-tetrachlorobiphenyl (PCB77). 15 nm gold nanoparticles were synthesized, and modified with thiol-capped DNA and goat anti-rabbit IgG. The nanoparticle probes were used to replace antibody-DNA conjugate in the IPCR, and were fixed on the PCR tube wall via the immune reaction. Real-time PCR was performed to quantify the DNA signal directly. Under optimized conditions, the new method was used to detect PCB77 with a linearity range from 5 pg L(-1) to 10 ng L(-1), and the limit of detection (LOD) was 1.72 pg L(-1). Real samples of Larimichthys polyactis, collected from the East China Sea, were analyzed. Recovery was from 82 % to 112 %, and the coefficient of variation (CV) was acceptable. The results were compared with GC-ECD, revealing that the method would be acceptable for providing rapid, semi-quantitative, and reliable test results for making environmental decisions.
Encoded Library Synthesis Using Chemical Ligation and the Discovery of sEH Inhibitors from a 334-Million Member Library

NASA Astrophysics Data System (ADS)

Litovchick, Alexander; Dumelin, Christoph E.; Habeshian, Sevan; Gikunju, Diana; Guié, Marie-Aude; Centrella, Paolo; Zhang, Ying; Sigel, Eric A.; Cuozzo, John W.; Keefe, Anthony D.; Clark, Matthew A.

2015-06-01

A chemical ligation method for construction of DNA-encoded small-molecule libraries has been developed. Taking advantage of the ability of the Klenow fragment of DNA polymerase to accept templates with triazole linkages in place of phosphodiesters, we have designed a strategy for chemically ligating oligonucleotide tags using cycloaddition chemistry. We have utilized this strategy in the construction and selection of a small molecule library, and successfully identified inhibitors of the enzyme soluble epoxide hydrolase.
Is DNA Alive? A Study of Conceptual Change Through Targeted Instruction

NASA Astrophysics Data System (ADS)

Witzig, Stephen B.; Freyermuth, Sharyn K.; Siegel, Marcelle A.; Izci, Kemal; Pires, J. Chris

2013-08-01

We are involved in a project to incorporate innovative assessments within a reform-based large-lecture biochemistry course for nonmajors. We not only assessed misconceptions but purposefully changed instruction throughout the semester to confront student ideas. Our research questions targeted student conceptions of deoxyribonucleic acid (DNA) along with understanding in what ways classroom discussions/activities influence student conceptions. Data sources included pre-/post-assessments, semi-structured interviews, and student work on exams/assessments. We found that students held misconceptions about the chemical nature of DNA, with 63 % of students claiming that DNA is alive prior to instruction. The chemical nature of DNA is an important fundamental concept in science fields. We confronted this misconception throughout the semester collecting data from several instructional interventions. Case studies of individual students revealed how various instructional strategies/assessments allowed students to construct and demonstrate the scientifically accepted understanding of the chemical nature of DNA. However, the post-assessment exposed that 40 % of students still held misconceptions about DNA, indicating the persistent nature of this misconception. Implications for teaching and learning are discussed.
Epigenetic mechanisms of peptidergic regulation of gene expression during aging of human cells.

PubMed

Ashapkin, V V; Linkova, N S; Khavinson, V Kh; Vanyushin, B F

2015-03-01

Expression levels of genes encoding specific transcription factors and other functionally important proteins vary upon aging of pancreatic and bronchial epithelium cell cultures. The peptides KEDW and AEDL tissue-specifically affect gene expression in pancreatic and bronchial cell cultures, respectively. It is established in this work that the DNA methylation patterns of the PDX1, PAX6, NGN3, NKX2-1, and SCGB1A1 gene promoter regions change upon aging in pancreatic and bronchial cell cultures in correlation with variations in their expression levels. Thus, stable changes in gene expression upon aging of cell cultures could be caused by changes in their promoter methylation patterns. The methylation patterns of the PAX4 gene in pancreatic cells as well as those of the FOXA1, SCGB3A2, and SFTPA1 genes in bronchial cells do not change upon aging and are unaffected by peptides, whereas their expression levels change in both cases. The promoter region of the FOXA2 gene in pancreatic cells contains a small number of methylated CpG sites, their methylation levels being affected by cell culture aging and KEDW, though without any correlation with gene expression levels. The promoter region of the FOXA2 gene is completely unmethylated in bronchial cells irrespective of cell culture age and AEDL action. Changes in promoter methylation might be the cause of age- and peptide-induced variations in expression levels of the PDX1, PAX6, and NGN3 genes in pancreatic cells and NKX2-1 and SCGB1A1 genes in bronchial cells. Expression levels of the PAX4 and FOXA2 genes in pancreatic cells and FOXA1, FOXA2, SCGB3A2, and SFTPA1 genes in bronchial cells seem to be controlled by some other mechanisms.

Microenvironmental agonists generate de novo phenotypic resistance to combined ibrutinib plus venetoclax in CLL and MCL

PubMed Central

Portell, Craig A.; Gordon, Vicki L.; Capaldo, Brian J.; Bekiranov, Stefan; Axelrod, Mark J.; Brett, L. Kyle; Wulfkuhle, Julia D.; Gallagher, Rosa I.; Petricoin, Emanuel F.; Bender, Timothy P.; Williams, Michael E.

2017-01-01

De novo resistance and rapid recurrence often characterize responses of B-cell malignancies to ibrutinib (IBR), indicating a need to develop drug combinations that block compensatory survival signaling and give deeper, more durable responses. To identify such combinations, we previously performed a combinatorial drug screen and identified the Bcl-2 inhibitor venetoclax (VEN) as a promising partner for combination with IBR in mantle cell lymphoma (MCL). We have opened a multi-institutional clinical trial to test this combination. However, analysis of primary samples from patients with MCL as well as chronic lymphocytic leukemia (CLL) revealed unexpected heterogeneous de novo resistance even to the IBR+VEN combination. In the current study, we demonstrate that resistance to the combination can be generated by microenvironmental agonists: interleukin-10 (IL-10), CD40L and, most potently, cytosine guanine dinucleotide–oligodeoxynucleotides (CpG-ODNs), which is a surrogate for unmethylated DNA and a specific agonist for Toll-like receptor 9 (TLR9) signaling. Incubation with these agonists caused robust activation of NF-κB signaling, especially alternative NF-κB, which led to enhanced expression of the antiapoptotic proteins Mcl-1, Bcl-xL, and survivin, thus decreasing dependence on Bcl-2. Inhibitors of NF-κB signaling blocked overexpression of these antiapoptotic proteins and overcame resistance. Inhibitors of Mcl-1, Bcl-xL, or survivin also overcame this resistance, and showed synergistic benefit with the IBR+VEN combination. We conclude that microenvironmental factors, particularly the TLR9 agonist, can generate de novo resistance to the IBR+VEN combination in CLL and MCL cells. This signaling pathway presents targets for overcoming drug resistance induced by extrinsic microenvironmental factors in diverse B-cell malignancies. PMID:29034364
Promoter hypermethylation of mismatch repair gene hMLH1 predicts the clinical response of malignant astrocytomas to nitrosourea.

PubMed

Fukushima, Takao; Katayama, Yoichi; Watanabe, Takao; Yoshino, Atsuo; Ogino, Akiyoshi; Ohta, Takashi; Komine, Chiaki

2005-02-15

In certain types of human cancers, transcriptional inactivation of hMLH1 by promoter hypermethylation plays a causal role in the loss of mismatch repair functions that modulate cytotoxic pathways in response to DNA-damaging agents. The aim of the present study was to investigate the role of promoter methylation of the hMLH1 gene in malignant astrocytomas. We examined the hMLH1 promoter methylation in a homogeneous cohort of patients with 41 malignant astrocytomas treated by 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3-2(2-chloroethyl)-3-nitrosourea chemotherapy in combination with radiation and interferon therapy, and assessed the correlation of such methylation with clinical outcome. hMLH1 promoter methylation was found in 6 (15%) of the 41 newly diagnosed malignant astrocytomas. Hypermethylation of the hMLH1 promoter corresponded closely with a loss of immunohistochemical staining for hMLH1 protein (P = 0.0013). Patients with hMLH1-methylated tumors displayed a greater chance of responding to adjuvant therapy as compared with those with hMLH1-unmethylated tumors (P = 0.0150). The presence of hMLH1 hypermethylation was significantly associated with a longer progression-free survival on both univariate analysis (P = 0.0340) and multivariate analysis (P = 0.0161). The present study identified hMLH1 methylation status as a predictor of the clinical response of malignant astrocytomas to chloroethylnitrosourea-based adjuvant therapy. The findings obtained suggest that determination of the methylation status of hMLH1 could provide a potential basis for designing rational chemotherapeutic strategies, as well as for predicting prognosis.
Microenvironmental agonists generate de novo phenotypic resistance to combined ibrutinib plus venetoclax in CLL and MCL.

PubMed

Jayappa, Kallesh D; Portell, Craig A; Gordon, Vicki L; Capaldo, Brian J; Bekiranov, Stefan; Axelrod, Mark J; Brett, L Kyle; Wulfkuhle, Julia D; Gallagher, Rosa I; Petricoin, Emanuel F; Bender, Timothy P; Williams, Michael E; Weber, Michael J

2017-06-13

De novo resistance and rapid recurrence often characterize responses of B-cell malignancies to ibrutinib (IBR), indicating a need to develop drug combinations that block compensatory survival signaling and give deeper, more durable responses. To identify such combinations, we previously performed a combinatorial drug screen and identified the Bcl-2 inhibitor venetoclax (VEN) as a promising partner for combination with IBR in Mantle Cell Lymphoma (MCL). We have opened a multi-institutional clinical trial to test this combination. However, analysis of primary samples from patients with MCL as well as chronic lymphocytic leukemia (CLL) revealed unexpected heterogeneous de novo resistance even to the IBR+VEN combination. In the current study, we demonstrate that resistance to the combination can be generated by microenvironmental agonists: IL-10, CD40L and, most potently, CpG-oligodeoxynucleotides (CpG-ODN), which is a surrogate for unmethylated DNA and a specific agonist for TLR9 signaling. Incubation with these agonists caused robust activation of NF-κB signaling, especially alternative NF-κB, which led to enhanced expression of the anti-apoptotic proteins Mcl-1, Bcl-xL, and survivin, thus decreasing dependence on Bcl-2. Inhibitors of NF-κB signaling blocked overexpression of these anti-apoptotic proteins and overcame resistance. Inhibitors of Mcl-1, Bcl-xL, or survivin also overcame this resistance, and showed synergistic benefit with the IBR+VEN combination. We conclude that microenvironmental factors, particularly the TLR9 agonist, can generate de novo resistance to the IBR+VEN combination in CLL and MCL cells. This signaling pathway presents targets for overcoming drug resistance induced by extrinsic microenvironmental factors in diverse B-cell malignancies.
AIM1 and LINE-1 Epigenetic Aberrations In Tumor and Serum Relate to Melanoma Progression and Disease Outcome

PubMed Central

Hoshimoto, Sojun; Kuo, Christine; Chong, Kelly; Takeshima, Ling; Takei, Yoshiki; Li, Michelle; Huang, Sharon; Sim, Myung-Shin; Morton, Donald L.; Hoon, Dave S.B.

2012-01-01

Aberrations in the methylation status of non-coding genomic repeat DNA sequences and specific gene promoter region are important epigenetic events in melanoma progression. Promoter methylation status in LINE-1 and Absent in melanoma-1(AIM1;6q21) associated with melanoma progression and disease outcome was assessed. LINE-1 and AIM1 methylation status was assessed in paraffin-embedded archival tissues(PEAT)(n=133) and melanoma patients’ serum(n=56). LINE-1 U-Index(hypomethylation) and AIM1 were analyzed in microdissected melanoma PEAT sections. The LINE-1 U-Index of melanoma(n=100) was significantly higher than that of normal skin(n=14) and nevi(n=12)(P=0.0004). LINE-1 U-Index level was elevated with increasing AJCC stage(P<0.0001). AIM1 promoter hypermethylation was found in higher frequency(P=0.005) in metastatic melanoma(65%) than in primary melanomas(38%). When analyzed, high LINE-1 U-Index and/or AIM1 methylation in melanomas were associated with disease-free survival(DFS) and overall survival(OS) in Stage I/II patients (P=0.017, 0.027; respectively). In multivariate analysis, melanoma AIM1 methylation status was a significant prognostic factor of OS(P=0.032). Furthermore, serum unmethylated LINE-1 was at higher levels in both stage III(n=20) and stage IV(n=36) patients compared to healthy donors(n=14)(P=0.022). Circulating methylated AIM1 was detected in patients’ serum and was predictive of OS in Stage IV patients (P=0.009). LINE-1 hypomethylation and AIM1 hypermethylation have prognostic utility in both melanoma patients’ tumors and serum. PMID:22402438
CpG Island Methylator Phenotype Positive Tumors in the Absence of MLH1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis

PubMed Central

Fu, Tao; Pappou, Emmanouil P.; Guzzetta, Angela A.; Jeschke, Jana; Kwak, Ruby; Dave, Pujan; Hooker, Craig M.; Morgan, Richard; Baylin, Stephen B.; Iacobuzio-Donahue, Christine A.; Wolfgang, Christopher L.; Ahuja, Nita

2012-01-01

Purpose Little information is available on genetic and epigenetic changes in duodenal adenocarcinomas. The purpose was to identify possible subsets of duodenal adenocarcinomas based on microsatellite instability (MSI), DNA methylation, mutations in the KRAS and BRAF genes, clinicopathologic features, and prognosis. Experimental Design Demographics, tumor characteristics and survival were available for 99 duodenal adenocarcinoma patients. Testing for KRAS and BRAF mutations, MSI, MLH1 methylation and CpG island methylator phenotype (CIMP) status was performed. A Cox proportional hazard model was built to predict survival. Results CIMP+ was detected in 27 of 99 (27.3%) duodenal adenocarcinomas, and was associated with MSI (P = 0.011) and MLH1 methylation (P < 0.001), but not with KRAS mutations (P = 0.114), as compared to CIMP− tumors. No BRAF V600E mutation was detected. Among the CIMP+ tumors, 15 (55.6%) were CIMP+/MLH1-unmethylated (MLH1-U). Kaplan-Meier analysis showed tumors classified by CIMP, CIMP/MLH1 methylation status or CIMP/MSI status could predict overall survival (OS; P = 0.047, 0.002, and 0.002, respectively), while CIMP/MLH1 methylation status could also predict time-to-recurrence (TTR; P = 0.016). In multivariate analysis, CIMP/MLH1 methylation status showed a significant prognostic value regarding both OS (P < 0.001) and TTR (P = 0.023). Patients with CIMP+/MLH1-U tumors had the worst OS and TTR. Conclusions Our results demonstrate existence of CIMP in duodenal adenocarcinomas. The combination of CIMP+/MLH1-U appears to be independently associated with poor prognosis in patients with duodenal adenocarcinomas. This study also suggests that BRAF mutations are not involved in duodenal tumorigenesis, MSI or CIMP development. PMID:22825585
Inactivation of parkin by promoter methylation correlated with lymph node metastasis and genomic instability in nasopharyngeal carcinoma.

PubMed

Ni, Haifeng; Zhou, Zhen; Jiang, Bo; Yuan, Xiaoyang; Cao, Xiaolin; Huang, Guangwu; Li, Yong

2017-03-01

This study aimed to investigate the inactivation of the parkin gene by promoter methylation and its relationship with genome instability in nasopharyngeal carcinoma. Parkin was considered as a tumor suppressor gene in various types of cancers. However, its role in nasopharyngeal carcinoma is unexplored. Genomic instabilities were detected in nasopharyngeal carcinoma tissues by the random amplified polymorphic DNA. The methylation-specific polymerase chain reaction, semi-quantitative reverse transcription polymerase chain reaction, and immunohistochemical analysis were used to detect methylation and mRNA and protein expression of parkin in 54 cases of nasopharyngeal carcinoma tissues and 16 cases of normal nasopharyngeal epithelia tissues, and in 5 nasopharyngeal carcinoma cell lines (CNE1, CNE2, TWO3, C666, and HONE1) and 1 normal nasopharyngeal epithelia cell line (NP69). mRNA expression of parkin in CNE1 and CNE2 was analyzed before and after methyltransferase inhibitor 5-aza-2-deoxycytidine treatment. The relationship between promoter methylation and mRNA expression, demethylation and mRNA expression, and mRNA and protein expression of the gene and clinical factors and genomic instabilities were analyzed. The mRNA and protein expression levels were significantly reduced in 54 cases of human nasopharyngeal carcinoma compared with 16 cases of normal nasopharyngeal epithelia. Parkin-methylated cases showed significantly lower mRNA and protein expression levels compared with unmethylated cases. After 5-aza-2-deoxycytidine treatment, parkin mRNA expression was restored in CNE1 and CNE2; 92.59% (50/54) of nasopharyngeal carcinoma demonstrated genomic instability. Parkin is frequently inactivated by promoter methylation, and its mRNA and protein expression correlate with lymph node metastasis and genomic instability. Parkin deficiency probably promotes tumorigenesis in nasopharyngeal carcinoma.
Methylation of Epstein-Barr virus Rta promoter in EBV primary infection, reactivation and lymphoproliferation.

PubMed

Germi, Raphaële; Guigue, Nicolas; Lupo, Julien; Semenova, Touyana; Grossi, Laurence; Vermeulen, Odile; Epaulard, Olivier; de Fraipont, Florence; Morand, Patrice

2016-10-01

During Epstein-Barr virus (EBV) latency, the EBV genome is largely silenced by methylation. This silencing is overturned during the switch to the lytic cycle. A key event is the production of the viral protein Zta which binds to three Zta-response elements (ZRE) from the Rta promoter (Rp), two of which (ZRE2 and ZRE3) include three CpG motifs methylated in the latent genome. The bisulphite pyrosequencing reaction was used to quantify the methylation of ZRE2, ZRE3a, and ZRE3b in EBV-positive cell lines and in ex vivo samples of EBV-related diseases, in order to assess whether the level of methylation in these ZREs could provide additional information to viral DNA load and serology in the characterization of EBV-associated diseases. In PBMC from two patients with infectious mononucleosis, over time Rp became increasingly methylated whereas EBV load decreased. In tonsil from patients with chronic tonsillitis, the methylation was less than in EBV-associated tumors, regardless of the viral load. This was even more striking when only the ZRE3a and ZRE3b were considered since some samples presented unbalanced profiles on ZRE2. EBV reactivation in cell culture showed that the reduction in the overall level of methylation was closely related to the production of unmethylated virions. Thus, an assessment of the level of methylation may help to better characterize EBV replication in PBMC and in biopsies with high EBV load, during infectious mononucleosis and EBV-associated cancers. J. Med. Virol. 88:1814-1820, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Gemcitabine and oxaliplatin or alkylating agents for neuroendocrine tumors: Comparison of efficacy and search for predictive factors guiding treatment choice.

PubMed

Dussol, Anne-Sophie; Joly, Marie-Odile; Vercherat, Cecile; Forestier, Julien; Hervieu, Valérie; Scoazec, Jean-Yves; Lombard-Bohas, Catherine; Walter, Thomas

2015-10-01

The alkylating agents (ALKYs) streptozotocin, dacarbazine, and temozolomide currently are the main drugs used in systemic chemotherapy for neuroendocrine tumors (NETs). The promising activity shown by gemcitabine and oxaliplatin (GEMOX) in previous studies prompted this study 1) to confirm the use of GEMOX in a larger population of NET patients, 2) to compare its efficacy with that of ALKYs, and 3) to explore whether the O(6) -methylguanine-DNA methyltransferase (MGMT) status could help in selecting the chemotherapy regimen. One hundred four patients with metastatic NETs (37 pancreatic NETs, 33 gastrointestinal NETs, 23 bronchial NETs, and 11 NETs of other/unknown origin) were treated with GEMOX between 2004 and 2014. Among these patients, 63 also received ALKYs. MGMT promoter gene methylation was assessed via pyrosequencing in 42 patients. Patients received a median of 6 courses of GEMOX. Twenty-four (23%) had an objective response (OR). The median progression-free survival (PFS) and overall survival were 7.8 and 31.6 months, respectively. In the 63 patients treated with both ALKYs and GEMOX, the ORs (22% and 22%) and the PFSs (7.5 and 7.3 months) were similar. The response was concordant in 53% of the patients. Promoter gene methylation of MGMT was associated with better outcomes with ALKYs (P = .03 for OR and P = .04 for PFS) but not GEMOX. GEMOX is effective against NETs; its activity is comparable to that of ALKYs, and it is not influenced by the MGMT status. Our data suggest that GEMOX might be preferred for patients with unmethylated MGMT tumors. Cancer 2015;121:3435-43. © 2015 American Cancer Society. © 2015 American Cancer Society.
TESTIN Induces Rapid Death and Suppresses Proliferation in Childhood B Acute Lymphoblastic Leukaemia Cells

PubMed Central

Weeks, Robert J.; Ludgate, Jackie L.; LeMée, Gwenn; Morison, Ian M.

2016-01-01

Background Childhood acute lymphoblastic leukaemia (ALL) is the most common malignancy in children. Despite high cure rates, side effects and late consequences of the intensive treatments are common. Unquestionably, the identification of new therapeutic targets will lead to safer, more effective treatments. We identified TES promoter methylation and transcriptional silencing as a very common molecular abnormality in childhood ALL, irrespective of molecular subtype. The aims of the present study were to demonstrate that TES promoter methylation is aberrant, to determine the effects of TES re-expression in ALL, and to determine if those effects are mediated via TP53 activity. Methods Normal fetal and adult tissue DNA was isolated and TES promoter methylation determined by Sequenom MassARRAY. Quantitative RT-PCR and immunoblot were used to confirm re-expression of TES in ALL cell lines after 5’-aza-2’-deoxycytidine (decitabine) exposure or transfection with TES expression plasmids. The effects of TES re-expression on ALL cells were investigated using standard cell proliferation, cell death and cell cycle assays. Results In this study, we confirm that the TES promoter is unmethylated in normal adult and fetal tissues. We report that decitabine treatment of ALL cell lines results in demethylation of the TES promoter and attendant expression of TES mRNA. Re-expression of TESTIN protein in ALL cells using expression plasmid transfection results in rapid cell death or cell cycle arrest independent of TP53 activity. Conclusions These results suggest that TES is aberrantly methylated in ALL and that re-expression of TESTIN has anti-leukaemia effects which point to novel therapeutic opportunities for childhood ALL. PMID:26985820
Evaluation and optimization of microbial DNA extraction from fecal samples of wild Antarctic bird species

PubMed Central

Eriksson, Per; Mourkas, Evangelos; González-Acuna, Daniel; Olsen, Björn; Ellström, Patrik

2017-01-01

ABSTRACT Introduction: Advances in the development of nucleic acid-based methods have dramatically facilitated studies of host–microbial interactions. Fecal DNA analysis can provide information about the host’s microbiota and gastrointestinal pathogen burden. Numerous studies have been conducted in mammals, yet birds are less well studied. Avian fecal DNA extraction has proved challenging, partly due to the mixture of fecal and urinary excretions and the deficiency of optimized protocols. This study presents an evaluation of the performance in avian fecal DNA extraction of six commercial kits from different bird species, focusing on penguins. Material and methods: Six DNA extraction kits were first tested according to the manufacturers’ instructions using mallard feces. The kit giving the highest DNA yield was selected for further optimization and evaluation using Antarctic bird feces. Results: Penguin feces constitute a challenging sample type: most of the DNA extraction kits failed to yield acceptable amounts of DNA. The QIAamp cador Pathogen kit (Qiagen) performed the best in the initial investigation. Further optimization of the protocol resulted in good yields of high-quality DNA from seven bird species of different avian orders. Conclusion: This study presents an optimized approach to DNA extraction from challenging avian fecal samples. PMID:29152162
Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812
gyrB as a phylogenetic discriminator for members of the Bacillus anthracis-cereus-thuringiensis group

NASA Technical Reports Server (NTRS)

La Duc, Myron T.; Satomi, Masataka; Agata, Norio; Venkateswaran, Kasthuri

2004-01-01

Bacillus anthracis, the causative agent of the human disease anthrax, Bacillus cereus, a food-borne pathogen capable of causing human illness, and Bacillus thuringiensis, a well-characterized insecticidal toxin producer, all cluster together within a very tight clade (B. cereus group) phylogenetically and are indistinguishable from one another via 16S rDNA sequence analysis. As new pathogens are continually emerging, it is imperative to devise a system capable of rapidly and accurately differentiating closely related, yet phenotypically distinct species. Although the gyrB gene has proven useful in discriminating closely related species, its sequence analysis has not yet been validated by DNA:DNA hybridization, the taxonomically accepted "gold standard". We phylogenetically characterized the gyrB sequences of various species and serotypes encompassed in the "B. cereus group," including lab strains and environmental isolates. Results were compared to those obtained from analyses of phenotypic characteristics, 16S rDNA sequence, DNA:DNA hybridization, and virulence factors. The gyrB gene proved more highly differential than 16S, while, at the same time, as analytical as costly and laborious DNA:DNA hybridization techniques in differentiating species within the B. cereus group.
A Brownian dynamics program for the simulation of linear and circular DNA and other wormlike chain polyelectrolytes.

PubMed Central

Klenin, K; Merlitz, H; Langowski, J

1998-01-01

For the interpretation of solution structural and dynamic data of linear and circular DNA molecules in the kb range, and for the prediction of the effect of local structural changes on the global conformation of such DNAs, we have developed an efficient and easy way to set up a program based on a second-order explicit Brownian dynamics algorithm. The DNA is modeled by a chain of rigid segments interacting through harmonic spring potentials for bending, torsion, and stretching. The electrostatics are handled using precalculated energy tables for the interactions between DNA segments as a function of relative orientation and distance. Hydrodynamic interactions are treated using the Rotne-Prager tensor. While maintaining acceptable precision, the simulation can be accelerated by recalculating this tensor only once in a certain number of steps. PMID:9533691
Seeing believes: Watching entangled sculpted branched DNA in real time

NASA Astrophysics Data System (ADS)

Jee, Ah-Young; Guan, Juan; Chen, Kejia; Granick, Steve

2015-03-01

The importance of branching in polymer physics is universally accepted but the details are disputed. We have sculpted DNA to various degrees of branching and used single-molecule tracking to image its diffusion in real time when entangled. By ligating three identical or varying length DNA segments, we construct symmetric and asymmetric ?Y? branches from elements of lambda-DNA with 16 um contour length, allowing for single-molecule visualization of equilibrium dynamics. Using home-written software, a full statistical distribution based on at least hundreds of trajectories is quantified with focus on discriminating arm-retraction from branch point motion. Some part of our observations is consistent with the anticipated ?relaxation through arm retraction? mechanism but other observations do not appear to be anticipated theoretically. Currently working as a researcher in Institute for Basic Science.
Stress-induced DNA Damage biomarkers: Applications and limitations

NASA Astrophysics Data System (ADS)

Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

2015-06-01

A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.
Quality Assurance of Samples and Processes in the Spanish Renal Research Network (REDinREN) Biobank.

PubMed

Calleros-Basilio, Laura; Cortés, María Alicia; García-Jerez, Andrea; Luengo-Rodríguez, Alicia; Orozco-Agudo, Ana; Valdivielso, José Manuel; Rodríguez-Puyol, Diego; Rodríguez-Puyol, Manuel

2016-12-01

Biobanks are useful platforms to build bridges between basic, translational, and clinical research and clinical care. They are repositories of high-quality human biological samples ideal for evaluating their histological characteristics and also their genome, transcriptome, and proteome. The Spanish Renal Research Network Biobank contains more than 76,500 well-preserved frozen samples of a wide variety of kidney diseases, collected from 5450 patients seen by over 70 nephrology services throughout the Spanish territory. To determine and to report the results of the quality control of samples and processes conducted in our biobank, implemented in accordance with the requirements of the ISO 9001:2008 international standard. Two types of quality controls were performed: (1) systematic, that is, measurement of viable peripheral blood mononuclear cells (PBMCs) obtained and purity of nucleic acids and (2) ad-hoc, that is, viability of thawed PBMC, DNA extraction process reproducibility, and the integrity and functionality of nucleic acids, implemented on a routine basis. PBMC isolation by Ficoll yielded reproducible results and its cryopreserved viability was >90%. Acceptable A260/A280 ratios were obtained for the vast majority of the DNA (n = 2328) and RNA (n = 78) samples analyzed. DNA integrity was demonstrated by agarose gels and by β-globulin gene polymerase chain reaction (PCR) amplification of 1327 and 989 bp fragments. DNA of acceptable quality had at least three bands of β-globulin amplified obtained (n = 26/30). RNA integrity number (RIN) determinations obtained RIN numbers ≥7 (n = 87/96). The amplifiability of nucleic acids was confirmed by qPCR and RT-qPCR of β-actin and GAPDH genes. Long storage or delayed processing time did not affect the quality of the samples analyzed. The processes of DNA extraction also yielded reproducible results. These results clearly indicate that our PBMC, DNA, and RNA stored samples meet the required quality standards to be used for biomedical research, ensuring their long-term preservation.
The unholy trinity: taxonomy, species delimitation and DNA barcoding

PubMed Central

DeSalle, Rob; Egan, Mary G; Siddall, Mark

2005-01-01

Recent excitement over the development of an initiative to generate DNA sequences for all named species on the planet has in our opinion generated two major areas of contention as to how this ‘DNA barcoding’ initiative should proceed. It is critical that these two issues are clarified and resolved, before the use of DNA as a tool for taxonomy and species delimitation can be universalized. The first issue concerns how DNA data are to be used in the context of this initiative; this is the DNA barcode reader problem (or barcoder problem). Currently, many of the published studies under this initiative have used tree building methods and more precisely distance approaches to the construction of the trees that are used to place certain DNA sequences into a taxonomic context. The second problem involves the reaction of the taxonomic community to the directives of the ‘DNA barcoding’ initiative. This issue is extremely important in that the classical taxonomic approach and the DNA approach will need to be reconciled in order for the ‘DNA barcoding’ initiative to proceed with any kind of community acceptance. In fact, we feel that DNA barcoding is a misnomer. Our preference is for the title of the London meetings—Barcoding Life. In this paper we discuss these two concerns generated around the DNA barcoding initiative and attempt to present a phylogenetic systematic framework for an improved barcoder as well as a taxonomic framework for interweaving classical taxonomy with the goals of ‘DNA barcoding’. PMID:16214748
Comparison of the anti-cancer effect of Disulfiram and 5-Aza-CdR on pancreatic cancer cell line PANC-1.

PubMed

Dastjerdi, Mehdi Nikbakht; Babazadeh, Zahra; Salehi, Mansour; Hashemibeni, Batool; Kazemi, Mohammad

2014-01-01

Pancreatic cancer has poor prognosis by surgical and chemotherapy when it is diagnosed, so other anti-cancerous assistant therapeutic drugs are suggested e.g. epigenetic reversal of tumor-suppressor genes on promoter hypermethylation. 5-Aza-CdR is a nucleoside analog of DNMTi but it has long-term cytotoxicity effects. This study compares the anticancer effect of 5-Aza-CdR and Disulfiram potencies on PANC-1 cell line and up-regulation of p21. PANC-1 cell line was cultured in DMEM high glucose and treated by 5-Aza-CdR with 5 and 10 μM concentration for four days and 13 μM DSF (Diulfiram) for 24 hours. MS-PCR and RT-PCR were carried out to detect the methylation pattern and estimate the mRNA expression of RASSF1A and p21 in PANC-1. MS-PCR demonstrated partial unmethylation after treatment with 5-Aza-CdR while there was no unmethylated band after DSF treatment. RT-PCR showed significant differences between re-expression of RASSF1A before and after treatment with 10 μM 5-Aza-CdR (P < 0.01) but not after treatment with 13 μM DSF (P > 0.05). The significant correlation was observed between RASSF1A re-expression and p21 up-regulation before and after treatment with 10 μM 5-Aza-CdR (P < 0.01) but not after treatment with 13 μM DSF (P > 0.05), while p21 up-regulation was significantly higher after DSF treatment (P < 0.01). Our findings indicated that 5-Aza-CdR induces the re-expression of RASSF1A and p21 up-regulation in PANC-1. DSF showed no epigenetic reversion while it affected p21 up-regulation.
MGMT-STP27 methylation status as predictive marker for response to PCV in anaplastic Oligodendrogliomas and Oligoastrocytomas. A report from EORTC study 26951.

PubMed

van den Bent, Martin J; Erdem-Eraslan, Lale; Idbaih, Ahmed; de Rooi, Johan; Eilers, Paul H C; Spliet, Wim G M; den Dunnen, Wilfred F A; Tijssen, Cees; Wesseling, Pieter; Sillevis Smitt, Peter A E; Kros, Johan M; Gorlia, Thierry; French, Pim J

2013-10-01

The long-term follow-up results from the EORTC-26951 trial showed that the addition of procarbazine, CCNU, and vincristine (PCV) after radiotherapy increases survival in anaplastic oligodendrogliomas/oligoastrocytomas (AOD/AOA). However, some patients appeared to benefit more from PCV treatment than others. We conducted genome-wide methylation profiling of 115 samples included in the EORTC-26951 trial and extracted the CpG island hypermethylated phenotype (CIMP) and MGMT promoter methylation (MGMT-STP27) status. We first show that methylation profiling can be conducted on archival tissues with a performance that is similar to snap-frozen tissue samples. We then conducted methylation profiling on EORTC-26951 clinical trial samples. Univariate analysis indicated that CIMP+ or MGMT-STP27 methylated tumors had an improved survival compared with CIMP- and/or MGMT-STP27 unmethylated tumors [median overall survival (OS), 1.05 vs. 6.46 years and 1.06 vs. 3.8 years, both P < 0.0001 for CIMP and MGMT-STP27 status, respectively]. Multivariable analysis indicates that CIMP and MGMT-STP27 are significant prognostic factors for survival in presence of age, sex, performance score, and review diagnosis in the model. CIMP+ and MGMT-STP27 methylated tumors showed a clear benefit from adjuvant PCV chemotherapy: the median OS of CIMP+ samples in the RT and RT-PCV arms was 3.27 and 9.51 years, respectively (P = 0.0033); for MGMT-STP27 methylated samples, it was 1.98 and 8.65 years. There was no such benefit for CIMP- or for MGMT-STP27 unmethylated tumors. MGMT-STP27 status remained significant in an interaction test (P = 0.003). Statistical analysis of microarray (SAM) identified 259 novel CpGs associated with treatment response. MGMT-STP27 may be used to guide treatment decisions in this tumor type. ©2013 AACR.
Isolation and bioinformatics analysis of differentially methylated genomic fragments in human gastric cancer

PubMed Central

Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei

2008-01-01

AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944

Potential of DNA barcoding for detecting quarantine fungi.

PubMed

Gao, Ruifang; Zhang, Guiming

2013-11-01

The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.
A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies.

PubMed

Utturkar, Sagar M; Klingeman, Dawn M; Hurt, Richard A; Brown, Steven D

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.
Encoded Library Synthesis Using Chemical Ligation and the Discovery of sEH Inhibitors from a 334-Million Member Library

PubMed Central

Litovchick, Alexander; Dumelin, Christoph E.; Habeshian, Sevan; Gikunju, Diana; Guié, Marie-Aude; Centrella, Paolo; Zhang, Ying; Sigel, Eric A.; Cuozzo, John W.; Keefe, Anthony D.; Clark, Matthew A.

2015-01-01

A chemical ligation method for construction of DNA-encoded small-molecule libraries has been developed. Taking advantage of the ability of the Klenow fragment of DNA polymerase to accept templates with triazole linkages in place of phosphodiesters, we have designed a strategy for chemically ligating oligonucleotide tags using cycloaddition chemistry. We have utilized this strategy in the construction and selection of a small molecule library, and successfully identified inhibitors of the enzyme soluble epoxide hydrolase. PMID:26061191
Mitochondrial transcription: Lessons from mouse models

PubMed Central

Peralta, Susana; Wang, Xiao; Moraes, Carlos T.

2012-01-01

Mammalian mitochondrial DNA (mtDNA) is a circular double-stranded DNA genome of ∼ 16.5 kilobase pairs (kb) that encodes 13 catalytic proteins of the ATP-producing oxidative phosphorylation system (OXPHOS), and the rRNAs and tRNAs required for the translation of the mtDNA transcripts. All the components needed for transcription and replication of the mtDNA are, therefore, encoded in the nuclear genome, as are the remaining components of the OXPHOS system and the mitochondrial translation machinery. Regulation of mtDNA gene expression is very important for modulating the OXPHOS capacity in response to metabolic requirements and in pathological processes. The combination of in vitro and in vivo studies has allowed the identification of the core machinery required for basal mtDNA transcription in mammals and a few proteins that regulate mtDNA transcription. Specifically, the generation of knockout mouse strains in the last several years, has been key to understanding the basis of mtDNA transcription in vivo. However, it is well accepted that many components of the transcription machinery are still unknown and little is known about mtDNA gene expression regulation under different metabolic requirements or disease processes. In this review we will focus on how the creation of knockout mouse models and the study of their phenotypes have contributed to the understanding of mitochondrial transcription in mammals. PMID:22120174
Logical Framework of Forensic Identification: Ability to Resist Fabricated DNA.

PubMed

Wang, Zheng; Zhou, Di; Zhang, Suhua; Bian, Yingnan; Hu, Zhen; Zhu, Ruxin; Lu, Daru; Li, Chengtao

2015-12-01

Over the past 30 years, DNA analysis has revolutionized forensic science and has become the most useful single tool in the multifaceted fight against crime. Today, DNA profiling with sets of highly polymorphic autosomal short tandem repeat markers is widely employed and accepted in the courts due to its high discriminating power and reliability. However, an artificial bloodstain purposefully created using molecular biology techniques succeeded in tricking a leading forensic DNA laboratory. The disturbing possibility that a forensic DNA profile can be faked shocked the general public and the mass media, and generated serious discussion about the credibility of DNA evidence. Herein, we present two exemplary assays based on tissue-specific methylation patterns and cell-specific mRNA expression, respectively. These two assays can be integrated into the DNA analysis pipelines without consumption of additional samples. We show that the two assays can not only distinguish between artificial and genuine samples, but also provide information on tissue origin. The two assays were tested on natural and artificial bloodstains (generated by polymerase chain reaction and whole genome amplification technique) and the results illustrated that the logical framework of forensic identification is still useful for forensic identification with the high credibility.
Population genetics inside a cell: Mutations and mitochondrial genome maintenance

NASA Astrophysics Data System (ADS)

Goyal, Sidhartha; Shraiman, Boris; Gottschling, Dan

2012-02-01

In realistic ecological and evolutionary systems natural selection acts on multiple levels, i.e. it acts on individuals as well as on collection of individuals. An understanding of evolutionary dynamics of such systems is limited in large part due to the lack of experimental systems that can challenge theoretical models. Mitochondrial genomes (mtDNA) are subjected to selection acting on cellular as well as organelle levels. It is well accepted that mtDNA in yeast Saccharomyces cerevisiae is unstable and can degrade over time scales comparable to yeast cell division time. We utilize a recent technology designed in Gottschling lab to extract DNA from populations of aged yeast cells and deep sequencing to characterize mtDNA variation in a population of young and old cells. In tandem, we developed a stochastic model that includes the essential features of mitochondrial biology that provides a null model for expected mtDNA variation. Overall, we find approximately 2% of the polymorphic loci that show significant increase in frequency as cells age providing direct evidence for organelle level selection. Such quantitative study of mtDNA dynamics is absolutely essential to understand the propagation of mtDNA mutations linked to a spectrum of age-related diseases in humans.
Structural characterization of a new lipid/DNA complex showing a selective transfection efficiency in ovarian cancer cells

NASA Astrophysics Data System (ADS)

Caracciolo, G.; Pozzi, D.; Caminiti, R.; Congiu Castellano, A.

2003-04-01

We investigated, for the first time, by using Energy Dispersive X-ray Diffraction, the structure of a new ternary cationic liposome formulated with dioleoyl trimethylammonium propane (DOTAP), 1,2-dioleoyl-3-phosphatidylethanolamine (DOPE) and cholesterol (Chol) (DDC) which has been recently found to have a selective high gene transfer ability in ovarian cancer cells. Our structural results provide a further experimental support to the widely accepted statement that there is not a simple and direct correlation between structure and transfection efficiency and that the factors controlling cationic lipid/DNA (CL-DNA) complexes-mediated gene transfer depend not only on the formulations of the cationic liposomes and their thermodynamic phase, but also significantly on the cell properties.
Nuclear DNA Content Variation and Species Relationships in the Genus Lupinus (Fabaceae)

PubMed Central

NAGANOWSKA, BARBARA; WOLKO, BOGDAN; ŚLIWIŃSKA, ELWIRA; KACZMAREK, ZYGMUNT

2003-01-01

The 2C nuclear DNA content has been estimated by flow cytometry in 18 species and botanical forms of the genus Lupinus (family Fabaceae), using propidium iodide as a fluorescent dye. They represented distinct infrageneric taxonomic groups and differed in somatic chromosome numbers. Estimated 2C DNA values ranged from 0·97 pg in L. princei to 2·44 pg in L. luteus, which gives a more than 2·5-fold variation. Statistical analysis of the data obtained resulted in a grouping that supports the generally accepted taxonomic classification of the Old World lupins. The rough-seeded L. princei turned out to be an interesting exception, getting closer to smooth-seeded species. Results of DNA content analyses are discussed with regards to the phylogenetic relationships among the Old World lupins and some aspects of the evolution of the genus. PMID:12853281
Transcending epithelial and intracellular biological barriers; a prototype DNA delivery device.

PubMed

McCaffrey, Joanne; McCrudden, Cian M; Ali, Ahlam A; Massey, Ashley S; McBride, John W; McCrudden, Maelíosa T C; Vicente-Perez, Eva M; Coulter, Jonathan A; Robson, Tracy; Donnelly, Ryan F; McCarthy, Helen O

2016-03-28

Microneedle technology provides the opportunity for the delivery of DNA therapeutics by a non-invasive, patient acceptable route. To deliver DNA successfully requires consideration of both extra and intracellular biological barriers. In this study we present a novel two tier platform; i) a peptide delivery system, termed RALA, that is able to wrap the DNA into nanoparticles, protect the DNA from degradation, enter cells, disrupt endosomes and deliver the DNA to the nucleus of cells ii) a microneedle (MN) patch that will house the nanoparticles within the polymer matrix, breach the skin's stratum corneum barrier and dissolve upon contact with skin interstitial fluid thus releasing the nanoparticles into the skin. Our data demonstrates that the RALA is essential for preventing DNA degradation within the poly(vinylpyrrolidone) (PVP) polymer matrix. In fact the RALA/DNA nanoparticles (NPs) retained functionality when in the MN arrays after 28days and over a range of temperatures. Furthermore the physical strength and structure of the MNs was not compromised when loaded with the NPs. Finally we demonstrated the effectiveness of our MN-NP platform in vitro and in vivo, with systemic gene expression in highly vascularised regions. Taken together this 'smart-system' technology could be applied to a wide range of genetic therapies. Copyright © 2016. Published by Elsevier B.V.
Clinical evaluation of the COBAS Amplicor HBV monitor test for measuring serum HBV DNA and comparison with the Quantiplex branched DNA signal amplification assay in Taiwan.

PubMed

Dai, C-Y; Yu, M-L; Chen, S-C; Lin, Z-Y; Hsieh, M-Y; Wang, L-Y; Tsai, J-F; Chuang, W-L; Chang, W-Y

2004-02-01

To evaluate the performance characteristics and clinical usefulness of the COBAS Amplicor HBV monitor (COBAS-AM) test in Taiwan and to examine its correlation with the Quantiplex branched DNA signal amplification (bDNA) assay for measuring serum hepatitis B virus (HBV) DNA concentrations. HBV DNA was measured by the COBAS-AM test in 149 sera from chronic HBV infected patients that had previously been analysed by the bDNA assay. The COBAS-AM test showed good reproducibility, with acceptable intra-assay and interassay coefficients of variation (1.6% and 0.9%, respectively) and good linearity (r2=0.98). The overall sensitivity of the COBAS-AM test was significantly higher than that of the bDNA assay (95.3% v 83.2%): 69.6% of samples with HBV DNA below the detection limit of the bDNA assay could be measured by the COBAS-AM test. There was a significant correlation between the results of the two assays (r=0.901; p<0.0001). On average, the results derived from the COBAS-AM test were 0.55 log lower than those of the bDNA assay. HBV DNA concentrations were significantly higher among HBV e antigen (HBeAg) positive patients than negative ones, and higher among patients with abnormal alanine aminotransferase (ALT) concentrations than those with normal ALT concentrations (p=0.0003). The COBAS-AM assay, more sensitive in HBeAg negative samples than the bDNA assay, can effectively measure HBV DNA concentrations in Taiwanese patients. HBV DNA values measured by the COBAS-AM test and bDNA assay correlate significantly.
My Father's Ears

ERIC Educational Resources Information Center

Jones, Bridget

2005-01-01

Each new baby is scrutinised and their facial features and other characteristics catalogued against known family members. This is essentially a social process: the new family member is recognised and accepted into the tribe. However, people's genetic inheritance--the information in their DNA--is also a serious matter with the potential to…
Combined radiotherapy and chemotherapy for high-grade brain tumours

NASA Astrophysics Data System (ADS)

Barazzuol, Lara

Glioblastoma (GBM) is the most common primary brain tumour in adults and among the most aggressive of all tumours. For several decades, the standard care of GBM was surgical resection followed by radiotherapy alone. In 2005, a landmark phase III clinical trial coordinated by the European Organization for Research and Treatment of Cancer (EORTC) and the National Cancer Institute of Canada (NCIC) demonstrated the benefit of radiotherapy with concomitant and adjuvant temozolomide (TMZ) chemotherapy. With TMZ, the median life expectancy in optimally managed patients is still only 12-14 months, with only 25% surviving 24 months. There is an urgent need for new therapies in particular in those patients whose tumour has an unmethylated methylguanine methyltransferase gene (MGMT) promoter, which is a predictive factor of benefit from TMZ. In this dissertation, the nature of the interaction between TMZ and radiation is investigated using both a mathematical model, based on in vivo population statistics of survival, and in vitro experimentation on a panel of human GBM cell lines. The results show that TMZ has an additive effect in vitro and that the population-based model may be insufficient in predicting TMZ response. The combination of TMZ with particle therapy is also investigated. Very little preclinical data exists on the effects of charged particles on GBM cell lines as well as on the concomitant application of chemotherapy. In this study, human GBM cells are exposed to 3 MeV protons and 6 MeV alpha particles in concomitance with TMZ. The results suggest that the radiation quality does not affect the nature of the interaction between TMZ and radiation, showing reproducible additive cytotoxicity. Since TMZ and radiation cause DNA damage in cancer cells, there has been increased attention to the use of poly(ADP-ribose) polymerase (PARP) inhibitors. PARP is a family of enzymes that play a key role in the repair of DNA breaks. In this study, a novel PARP inhibitor, ABT-888, is used in combination with both TMZ and radiation. The results show that ABT-888 significantly enhances TMZ and radiation cell killing, regardless of the MGMT status. In summary, the findings of this research demonstrate that the use of particle therapy and PARP inhibitors are particularly promising and might improve the treatment outcome in patients with GBM.
Evolution of hierarchical cytoplasmic inheritance in the plasmodial slime mold Physarum polycephalum.

PubMed

Iwanaga, Akiko; Sasaki, Akira

2004-04-01

A striking linear dominance relationship for uniparental mitochondrial transmission is known between many mating types of plasmodial slime mold Physarum polycephalum. We herein examine how such hierarchical cytoplasmic inheritance evolves in isogamous organisms with many self-incompatible mating types. We assume that a nuclear locus determines the mating type of gametes and that another nuclear locus controls the digestion of mitochondria DNAs (mtDNAs) of the recipient gamete after fusion. We then examine the coupled genetic dynamics for the evolution of self-incompatible mating types and biased mitochondrial transmission between them. In Physarum, a multiallelic nuclear locus matA controls both the mating type of the gametes and the selective elimination of the mtDNA in the zygotes. We theoretically examine two potential mechanisms that might be responsible for the preferential digestion of mitochondria in the zygote. In the first model, the preferential digestion of mitochondria is assumed to be the outcome of differential expression levels of a suppressor gene carried by each gamete (suppression-power model). In the second model (site-specific nuclease model), the digestion of mtDNAs is assumed to be due to their cleavage by a site-specific nuclease that cuts the mtDNA at unmethylated recognition sites. Also assumed is that the mtDNAs are methylated at the same recognition site prior to the fusion, thereby being protected against the nuclease of the same gamete, and that the suppressor alleles convey information for the recognition sequences of nuclease and methylase. In both models, we found that a linear dominance hierarchy evolves as a consequence of the buildup of a strong linkage disequilibrium between the mating-type locus and the suppressor locus, though it fails to evolve if the recombination rate between the two loci is larger than a threshold. This threshold recombination rate depends on the number of mating types and the degree of fitness reduction in the heteroplasmic zygotes. If the recombination rate is above the threshold, suppressor alleles are equally distributed in each mating type at evolutionary equilibrium. Based on the theoretical results of the site-specific nuclease model, we propose that a nested subsequence structure in the recognition sequence should underlie the linear dominance hierarchy of mitochondrial transmission.
Attitudes toward genetic testing in childhood and reproductive decision-making for familial adenomatous polyposis.

PubMed

Douma, Kirsten F L; Aaronson, Neil K; Vasen, Hans F A; Verhoef, Senno; Gundy, Chad M; Bleiker, Eveline M A

2010-02-01

Childhood DNA testing, prenatal diagnosis (PND) and preimplantation genetic diagnosis (PGD) are available for familial adenomatous polyposis (FAP). However, the use of PND and PGD is controversial. The purpose of this study was to investigate attitudes toward, and experiences with, childhood DNA testing, PND and PGD among members of families at high risk for FAP. In this nationwide, cross-sectional study, questionnaires were sent to individuals from families at high risk for FAP assessing attitudes toward and experiences with childhood testing, PND and PGD, as well as several sociodemographic, clinical and psychosocial variables. Of the individuals from FAP families invited to participate in the study, 525 members participated (response rate=64%). Most parents who had children who were minors (n=93) (82%) were satisfied with the DNA testing procedure. One-third of all individuals wanted DNA testing for their children before age 12. Forty percent of FAP patients indicated that the disease influenced their desire to have children. Only 15% considered termination of pregnancy for FAP acceptable. Approximately 30% of individuals with a FAP diagnosis and their partners considered PND and PGD as acceptable for themselves. A positive attitude was associated with higher levels of guilt and a positive attitude toward termination of pregnancy. Importantly, of those with FAP at childbearing age, 84% had had no previous information at all about either PND or PGD. Future efforts should be aimed at educating FAP family members about reproductive options, allowing them to make an informed choice about family planning. Routine discussion of all reproductive options with a medical specialist should be encouraged.
Pederin-type pathways of uncultivated bacterial symbionts: analysis of o-methyltransferases and generation of a biosynthetic hybrid.

PubMed

Zimmermann, Katrin; Engeser, Marianne; Blunt, John W; Munro, Murray H G; Piel, Jörn

2009-03-04

The complex polyketide pederin is a potent antitumor agent isolated from Paederus spp. rove beetles. We have previously isolated a set of genes from a bacterial endosymbiont that are good candidates for pederin biosynthesis. To biochemically study this pathway, we expressed three methyltransferases from the putative pederin pathway and used the partially unmethylated analogue mycalamide A from the marine sponge Mycale hentscheli as test substrate. Analysis by high-resolution MS/MS and NMR revealed that PedO regiospecifically methylates the marine compound to generate the nonnatural hybrid compound 18-O-methylmycalamide A with increased cytotoxicity. To our knowledge, this is the first biochemical evidence that invertebrates can obtain defensive complex polyketides from bacterial symbionts.
Efficient Production of Retroviruses Using PLGA/bPEI-DNA Nanoparticles and Application for Reprogramming Somatic Cells

PubMed Central

Do, Eun Kyoung; Cheon, Hyo Cheon; Heo, Soon Chul; Kwon, Yang Woo; Jeong, Geun Ok; Kim, Ba Reun; Kim, Jae Ho

2013-01-01

Reprogramming of somatic cells to pluripotent cells requires the introduction of factors driving fate switches. Viral delivery has been the most efficient method for generation of induced pluripotent stem cells. Transfection, which precedes virus production, is a commonly-used process for delivery of nucleic acids into cells. The aim of this study is to evaluate the efficiency of PLGA/ bPEI nanoparticles in transfection and virus production. Using a modified method of producing PLGA nanoparticles, PLGA/bPEI-DNA nanoparticles were examined for transfection efficiency and virus production yield in comparison with PLGA-DNA, bPEI-DNA nanoparticles or liposome-DNA complexes. After testing various ratios of PLGA, bPEI, and DNA, the ratio of 6:3:1 (PLGA:bPEI:DNA, w/w/w) was determined to be optimal, with acceptable cellular toxicity. PLGA/bPEI-DNA (6:3:1) nanoparticles showed superior transfection efficiency, especially in multiple gene transfection, and viral yield when compared with liposome-DNA complexes. The culture supernatants of HEK293FT cells transfected with PLGA/bPEI-DNA of viral constructs containing reprogramming factors (Oct4, Sox2, Klf4, or c-Myc) successfully and more efficiently generated induced pluripotent stem cell colonies from mouse embryonic fibroblasts. These results strongly suggest that PLGA/bPEI-DNA nanoparticles can provide significant advantages in studying the effect of multiple factor delivery such as in reprogramming or direct conversion of cell fate. PMID:24098810
DNA Commission of the International Society for Forensic Genetics: revised and extended guidelines for mitochondrial DNA typing.

PubMed

Parson, W; Gusmão, L; Hares, D R; Irwin, J A; Mayr, W R; Morling, N; Pokorak, E; Prinz, M; Salas, A; Schneider, P M; Parsons, T J

2014-11-01

The DNA Commission of the International Society of Forensic Genetics (ISFG) regularly publishes guidelines and recommendations concerning the application of DNA polymorphisms to the question of human identification. Previous recommendations published in 2000 addressed the analysis and interpretation of mitochondrial DNA (mtDNA) in forensic casework. While the foundations set forth in the earlier recommendations still apply, new approaches to the quality control, alignment and nomenclature of mitochondrial sequences, as well as the establishment of mtDNA reference population databases, have been developed. Here, we describe these developments and discuss their application to both mtDNA casework and mtDNA reference population databasing applications. While the generation of mtDNA for forensic casework has always been guided by specific standards, it is now well-established that data of the same quality are required for the mtDNA reference population data used to assess the statistical weight of the evidence. As a result, we introduce guidelines regarding sequence generation, as well as quality control measures based on the known worldwide mtDNA phylogeny, that can be applied to ensure the highest quality population data possible. For both casework and reference population databasing applications, the alignment and nomenclature of haplotypes is revised here and the phylogenetic alignment proffered as acceptable standard. In addition, the interpretation of heteroplasmy in the forensic context is updated, and the utility of alignment-free database searches for unbiased probability estimates is highlighted. Finally, we discuss statistical issues and define minimal standards for mtDNA database searches. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Target-regulated proximity hybridization with three-way DNA junction for in situ enhanced electronic detection of marine biotoxin based on isothermal cycling signal amplification strategy.

PubMed

Liu, Bingqian; Chen, Jinfeng; Wei, Qiaohua; Zhang, Bing; Zhang, Lan; Tang, Dianping

2015-07-15

A new signal amplification strategy based on target-regulated DNA proximity hybridization (TRPH) reaction accompanying formation of three-way DNA junction was designed for electronic detection of Microcystin-LR (MC-LR used in this case), coupling with junction-induced isothermal cycling signal amplification. Initially, a sandwiched-type immunoreaction was carried out in a low-cost PCR tube between anti-MC-LR mAb1 antibody-labeled DNA1 (mAb1-DNA1) and anti-MC-LR mAb2-labeled DNA2 (mAb2-DNA2) in the presence of target to form a three-way DNA junction. Then, the junction could undergo an unbiased strand displacement reaction on an h-like DNA nanostructure-modified electrode (labeled with methylene blue redox tag on the short DNA strand), thereby resulting in the dissociation of methylene blue-labeled signal DNA from the electrode. The newly formed double-stranded DNA could be cleaved again by exonuclease III, and the released three-way DNA junction retriggered the strand-displacement reaction with h-like DNA nanostructures for junction recycling. During the strand-displacement reaction, numerous methylene blue-labeled DNA strands were far away from the electrode, thus decreasing the detectable electrochemical signal within the applied potentials. Under optimal conditions, the TRPH-based immunosensing system exhibited good electrochemical responses for detecting target MC-LR at a concentration as low as 1.0ngkg(-1) (1.0ppt). Additionally, the precision, reproducibility, specificity and method accuracy were also investigated with acceptable results. Copyright © 2015 Elsevier B.V. All rights reserved.

A cautionary note on the evaluation of genetic evidence from uniparentally transmitted markers.

PubMed

Amorim, António

2008-09-01

The combination of the information obtained from lineage genetic markers, such as mitochondrial DNA (mtDNA) and the non-homologous region of Y-chromosome, with data resulting from meiotically recombining loci (diploid/autosomal or haplodiploid/X chromosome) into a single likelihood ratio has been recently proposed. In this work we challenge this proposal and demonstrate that while the genetic evidence obtained from loci which reshuffle at meiosis is appropriate for individual probability calculations, mtDNA and Y-chromosome data are not and, consequently, that joining the evidential value of the two types of markers is generally inconsistent and should be avoided. The assumption of non-involvement of relatives must be clearly and explicitly stated and its acceptance must be left to the court decision.
Packaging double-helical DNA into viral capsids.

PubMed

LaMarque, Jaclyn C; Le, Thuc-Vy L; Harvey, Stephen C

2004-02-15

DNA packaging in bacteriophage P4 has been examined using a molecular mechanics model with a reduced representation containing one pseudoatom per turn of the double helix. The model is a discretized version of an elastic continuum model. The DNA is inserted piecewise into the model capsid, with the structure being reoptimized after each piece is inserted. Various optimization protocols were investigated, and it was found that molecular dynamics at a very low temperature (0.3 K) produces the optimal packaged structure. This structure is a concentric spool, rather than the coaxial spool that has been commonly accepted for so many years. This geometry, which was originally suggested by Hall and Schellman in 1982 (Biopolymers Vol. 21, pp. 2011-2031), produces a lower overall elastic energy than coaxial spooling. Copyright 2003 Wiley Periodicals, Inc.
16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes.

PubMed

Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

2014-08-01

Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships.
16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

PubMed Central

Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

2014-01-01

Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672
A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less
A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

DOE PAGES

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.; ...

2017-07-18

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less
A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

PubMed Central

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Richard A.; Brown, Steven D.

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences. PMID:28769883
Development of a human live attenuated West Nile infectious DNA vaccine: Identification of a minimal mutation set conferring the attenuation level acceptable for a human vaccine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamshchikov, Vladimir, E-mail: yaximik@gmail.com

ABSTRACT: For the development of a human West Nile (WN) infectious DNA (iDNA) vaccine, we created highly attenuated chimeric virus W1806 with the serological identity of highly virulent WN-NY99. Earlier, we attempted to utilize mutations found in the E protein of the SA14-14-2 vaccine to bring safety of W1806 to the level acceptable for human use (). Here, we analyzed effects of the SA14-14-2 changes on growth properties and neurovirulence of W1806. A set including the E138K, K279M, K439R and G447D changes was identified as the perspective subset for satisfying the target safety profile without compromising immunogenicity of the vaccinemore » candidate. The genetic stability of the attenuated phenotype was found to be unsatisfactory being dependent on a subset of attenuating changes incorporated in W1806. Elucidation of underlying mechanisms influencing selection of pathways for restoration of the envelope protein functionality will facilitate resolution of the emerged genetic stability issue. - Highlights: •Effect of mutations in E on properties of WN1806 is determined. •A subset of attenuating mutations suitable for a human vaccine is defined. •Mechanism of attenuation is proposed and illustrated. •Underlying mechanisms of neurovirulence reversion are suggested.« less
Action of CMG with strand-specific DNA blocks supports an internal unwinding mode for the eukaryotic replicative helicase

PubMed Central

Langston, Lance; O’Donnell, Mike

2017-01-01

Replicative helicases are ring-shaped hexamers that encircle DNA for duplex unwinding. The currently accepted view of hexameric helicase function is by steric exclusion, where the helicase encircles one DNA strand and excludes the other, acting as a wedge with an external DNA unwinding point during translocation. Accordingly, strand-specific blocks only affect these helicases when placed on the tracking strand, not the excluded strand. We examined the effect of blocks on the eukaryotic CMG and, contrary to expectations, blocks on either strand inhibit CMG unwinding. A recent cryoEM structure of yeast CMG shows that duplex DNA enters the helicase and unwinding occurs in the central channel. The results of this report inform important aspects of the structure, and we propose that CMG functions by a modified steric exclusion process in which both strands enter the helicase and the duplex unwinding point is internal, followed by exclusion of the non-tracking strand. DOI: http://dx.doi.org/10.7554/eLife.23449.001 PMID:28346143
A detailed experimental study of a DNA computer with two endonucleases.

PubMed

Sakowski, Sebastian; Krasiński, Tadeusz; Sarnik, Joanna; Blasiak, Janusz; Waldmajer, Jacek; Poplawski, Tomasz

2017-07-14

Great advances in biotechnology have allowed the construction of a computer from DNA. One of the proposed solutions is a biomolecular finite automaton, a simple two-state DNA computer without memory, which was presented by Ehud Shapiro's group at the Weizmann Institute of Science. The main problem with this computer, in which biomolecules carry out logical operations, is its complexity - increasing the number of states of biomolecular automata. In this study, we constructed (in laboratory conditions) a six-state DNA computer that uses two endonucleases (e.g. AcuI and BbvI) and a ligase. We have presented a detailed experimental verification of its feasibility. We described the effect of the number of states, the length of input data, and the nondeterminism on the computing process. We also tested different automata (with three, four, and six states) running on various accepted input words of different lengths such as ab, aab, aaab, ababa, and of an unaccepted word ba. Moreover, this article presents the reaction optimization and the methods of eliminating certain biochemical problems occurring in the implementation of a biomolecular DNA automaton based on two endonucleases.
A major role of DNA polymerase δ in replication of both the leading and lagging DNA strands

PubMed Central

Prakash, Louise; Prakash, Satya

2015-01-01

SUMMARY Genetic studies with S. cerevisiae Polδ (pol3-L612M) and Polε (pol2-M644G) mutant alleles, each of which display a higher rate for the generation of a specific mismatch, have led to the conclusion that Polε is the primary leading strand replicase and that Polδ is restricted to replicating the lagging strand template. Contrary to this widely accepted view, here we show that Polδ plays a major role in the replication of both DNA strands, and that the paucity of pol3-L612M generated errors on the leading strand results from their more proficient removal. Thus, the apparent lack of Polδ contribution to leading strand replication is due to differential mismatch removal rather than differential mismatch generation. Altogether, our genetic studies with Pol3 and Pol2 mutator alleles support the conclusion that Polδ, and not Polε, is the major DNA polymerase for carrying out both leading and lagging DNA synthesis. PMID:26145172
Measurement of plasma cell-free DNA concentrations in dogs with sepsis, trauma, and neoplasia.

PubMed

Letendre, Jo-Annie; Goggs, Robert

2017-05-01

To determine if cell-free DNA (cfDNA) was identifiable in canine plasma, to evaluate 3 techniques for the measurement of plasma cfDNA concentrations in dogs presented to an emergency service, and to compare the plasma cfDNA concentrations of healthy dogs to those with sepsis, trauma, and neoplasia. Retrospective study of banked canine plasma samples collected between May 2014 and December 2014. Dogs presented to the emergency service of a university veterinary teaching hospital. Plasma cfDNA was measured on residual plasma samples obtained from 15 dogs with sepsis, 15 dogs with moderate-severe trauma, 15 dogs diagnosed with a sarcoma. Plasma cfDNA was also measured in 15 healthy dogs. None. Assay linearity, repeatability, and reproducibility were evaluated. Quantification of cfDNA was performed in duplicate on diluted citrated plasma and following DNA purification using 2 fluorescence assays (SYBR-Gold; Quant-iT) and by ultraviolet absorbance spectroscopy. Fluorescence intensities (FIs) were converted to cfDNA concentrations using standard curves. Median FI values and cfDNA concentrations were compared to healthy controls using the Kruskal-Wallis test, with adjustment for multiple comparisons. Alpha was set at 0.05. Both assays had excellent linearity, and acceptable repeatability and reproducibility. Compared to controls, plasma cfDNA concentrations were significantly increased in dogs with sepsis or moderate-severe trauma with both assays (P ≤ 0.003). Dogs with neoplasia had significantly increased cfDNA concentrations with the Quant-iT assay only (P = 0.003). When measurements were performed on purified DNA, only dogs with moderate-severe trauma had significantly increased cfDNA concentrations (P < 0.001; SYBR-Gold assay). cfDNA can be readily identified in canine plasma using 2 fluorescence assays. DNA extraction offers no advantage over direct measurement. Compared to healthy controls, dogs with sepsis or moderate-severe trauma have significantly increased plasma cfDNA concentrations. © Veterinary Emergency and Critical Care Society 2017.
Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

PubMed

Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

2012-08-01

The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.
7-Deazapurine containing DNA: efficiency of c7GdTP, c7AdTP and c7IdTP incorporation during PCR-amplification and protection from endodeoxyribonuclease hydrolysis.

PubMed Central

Seela, F; Röling, A

1992-01-01

The enzymatic synthesis of 7-deazapurine nucleoside containing DNA (501 bp) is performed by PCR-amplification (Taq polymerase) using a pUC18 plasmid DNA as template and the triphosphates of 7-deaza-2'-deoxyguanosine (c7Gd), -adenosine (c7Ad) and -inosine (c7Id). c7GdTP can fully replace dGTP resulting in a completely modified DNA-fragment of defined size and sequence. The other two 7-deazapurine triphosphates (c7AdTP) and (c7IdTP) require the presence of the parent purine 2'-deoxyribonucleotides. In purine/7-deazapurine nucleotide mixtures Taq polymerase prefers purine over 7-deazapurine nucleotides but accepts c7GdTP much better than c7AdTP or c7IdTP. As incorporation of 7-deazapurine nucleotides represents a modification of the major groove of DNA it can be used to probe DNA/protein interaction. Regioselective phosphodiester hydrolysis of the modified DNA-fragments was studied with 28 endodeoxyribonucleases. c7Gd is able to protect the DNA from the phosphodiester hydrolysis in more than 20 cases, only a few enzymes (Mae III, Rsa I, Hind III, Pvu II or Taq I) do still hydrolyze the modified DNA. c7Ad protects DNA less efficiently, as this DNA could only be modified in part. The absence of N-7 as potential binding position or a geometric distortion of the recognition duplex caused by the 7-deazapurine base can account for protection of hydrolysis. Images PMID:1738604
A Region on BTA6 Is Associated with Feed Intake and Gain in Beef Cattle

USDA-ARS?s Scientific Manuscript database

Genetic selection for animals that require less feed while still achieving acceptable levels of production could result in substantial cost savings for cattle producers. The purpose of this study was to identify DNA markers with predictive merit for differences among cattle in feed intake and BW gai...
A class-wide phylogenetic assessment of Dothideomycetes

USDA-ARS?s Scientific Manuscript database

We present a comprehensive phylogeny derived from 5 genes, nucSSU, nucLSU rDNA, TEF1, RPB1 and RPB2, for 355 isolates and 41 families (6 newly described in this volume) in Dothideomycetes. All currently accepted orders in the class is represented for the first time. Subclass Pleosporomycetidae is ex...
A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis

PubMed Central

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338
A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis.

PubMed

Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

PubMed

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Single-molecule visualization of fast polymerase turnover in the bacterial replisome

PubMed Central

Lewis, Jacob S; Spenkelink, Lisanne M; Jergic, Slobodan; Wood, Elizabeth A; Monachino, Enrico; Horan, Nicholas P; Duderstadt, Karl E; Cox, Michael M; Robinson, Andrew; Dixon, Nicholas E; van Oijen, Antoine M

2017-01-01

The Escherichia coli DNA replication machinery has been used as a road map to uncover design rules that enable DNA duplication with high efficiency and fidelity. Although the enzymatic activities of the replicative DNA Pol III are well understood, its dynamics within the replisome are not. Here, we test the accepted view that the Pol III holoenzyme remains stably associated within the replisome. We use in vitro single-molecule assays with fluorescently labeled polymerases to demonstrate that the Pol III* complex (holoenzyme lacking the β2 sliding clamp), is rapidly exchanged during processive DNA replication. Nevertheless, the replisome is highly resistant to dilution in the absence of Pol III* in solution. We further show similar exchange in live cells containing labeled clamp loader and polymerase. These observations suggest a concentration-dependent exchange mechanism providing a balance between stability and plasticity, facilitating replacement of replisomal components dependent on their availability in the environment. DOI: http://dx.doi.org/10.7554/eLife.23932.001 PMID:28432790

Carbon Ion Radiotherapy: A Review of Clinical Experiences and Preclinical Research, with an Emphasis on DNA Damage/Repair.

PubMed

Mohamad, Osama; Sishc, Brock J; Saha, Janapriya; Pompos, Arnold; Rahimi, Asal; Story, Michael D; Davis, Anthony J; Kim, D W Nathan

2017-06-09

Compared to conventional photon-based external beam radiation (PhXRT), carbon ion radiotherapy (CIRT) has superior dose distribution, higher linear energy transfer (LET), and a higher relative biological effectiveness (RBE). This enhanced RBE is driven by a unique DNA damage signature characterized by clustered lesions that overwhelm the DNA repair capacity of malignant cells. These physical and radiobiological characteristics imbue heavy ions with potent tumoricidal capacity, while having the potential for simultaneously maximally sparing normal tissues. Thus, CIRT could potentially be used to treat some of the most difficult to treat tumors, including those that are hypoxic, radio-resistant, or deep-seated. Clinical data, mostly from Japan and Germany, are promising, with favorable oncologic outcomes and acceptable toxicity. In this manuscript, we review the physical and biological rationales for CIRT, with an emphasis on DNA damage and repair, as well as providing a comprehensive overview of the translational and clinical data using CIRT.
An active fluorescent probe based on aggregation-induced emission for intracellular bioimaging of Zn2+ and tracking of interactions with single-stranded DNA.

PubMed

Wen, Xiaoye; Wang, Qi; Fan, Zhefeng

2018-07-12

A novel dual-sensing fluorescence probe L was designed and synthesized for highly selective and sensitive detection of Zn 2+ and DNA. The probe L achieved a detection limit of 3.8 nM for Zn 2+ , which is lower than the acceptable level of Zn 2+ in living cells. The probe L displayed high selectivity toward Zn 2+ over other interference metal ions and amino acids. Moreover, the probe L displayed low cytotoxicity and good cell permeability, indicating its potential for detecting and bio-imaging of Zn 2+ . In addition, the probe L-Zn 2+ exhibited enhanced fluorescence signal for DNA detection through the metal-coordination interaction between Zn 2+ and DNA. The enhanced signal is higher than that of the classical ethidium bromide probe. The experiments in aqueous media verified the feasibility of applying probe L in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Carbon Ion Radiotherapy: A Review of Clinical Experiences and Preclinical Research, with an Emphasis on DNA Damage/Repair

PubMed Central

Mohamad, Osama; Sishc, Brock J.; Saha, Janapriya; Pompos, Arnold; Rahimi, Asal; Story, Michael D.; Davis, Anthony J.; Kim, D.W. Nathan

2017-01-01

Compared to conventional photon-based external beam radiation (PhXRT), carbon ion radiotherapy (CIRT) has superior dose distribution, higher linear energy transfer (LET), and a higher relative biological effectiveness (RBE). This enhanced RBE is driven by a unique DNA damage signature characterized by clustered lesions that overwhelm the DNA repair capacity of malignant cells. These physical and radiobiological characteristics imbue heavy ions with potent tumoricidal capacity, while having the potential for simultaneously maximally sparing normal tissues. Thus, CIRT could potentially be used to treat some of the most difficult to treat tumors, including those that are hypoxic, radio-resistant, or deep-seated. Clinical data, mostly from Japan and Germany, are promising, with favorable oncologic outcomes and acceptable toxicity. In this manuscript, we review the physical and biological rationales for CIRT, with an emphasis on DNA damage and repair, as well as providing a comprehensive overview of the translational and clinical data using CIRT. PMID:28598362
Non-B DB v2.0: a database of predicted non-B DNA-forming motifs and its associated tools.

PubMed

Cer, Regina Z; Donohue, Duncan E; Mudunuri, Uma S; Temiz, Nuri A; Loss, Michael A; Starner, Nathan J; Halusa, Goran N; Volfovsky, Natalia; Yi, Ming; Luke, Brian T; Bacolla, Albino; Collins, Jack R; Stephens, Robert M

2013-01-01

The non-B DB, available at http://nonb.abcc.ncifcrf.gov, catalogs predicted non-B DNA-forming sequence motifs, including Z-DNA, G-quadruplex, A-phased repeats, inverted repeats, mirror repeats, direct repeats and their corresponding subsets: cruciforms, triplexes and slipped structures, in several genomes. Version 2.0 of the database revises and re-implements the motif discovery algorithms to better align with accepted definitions and thresholds for motifs, expands the non-B DNA-forming motifs coverage by including short tandem repeats and adds key visualization tools to compare motif locations relative to other genomic annotations. Non-B DB v2.0 extends the ability for comparative genomics by including re-annotation of the five organisms reported in non-B DB v1.0, human, chimpanzee, dog, macaque and mouse, and adds seven additional organisms: orangutan, rat, cow, pig, horse, platypus and Arabidopsis thaliana. Additionally, the non-B DB v2.0 provides an overall improved graphical user interface and faster query performance.
Site-specific DNA excision in transgenic rice with a cell-permeable cre recombinase.

PubMed

Cao, Ming-Xia; Huang, Jian-Qiu; Yao, Quan-Hong; Liu, Sheng-Jun; Wang, Cheng-Long; Wei, Zhi-Ming

2006-01-01

The removal of selected marker genes from transgenic plants is necessary to address biosafety concerns and to carry out further experiments with transgenic organisms. In the present study, the 12-amino-acid membrane translocation sequence (MTS) from the Kaposi fibroblast growth factor (FGF)-4 was used as a carrier to deliver enzymatically active Cre proteins into living plant cells, and to produce a site-specific DNA excision in transgenic rice plants. The process, which made cells permeable to Cre recombinase-mediated DNA recombination, circumvented the need to express Cre under spatiotemporal control and was proved to be a simple and efficient system to achieve marker-free transgenic plants. The ultimate aim of the present study is to develop commercial rice cultivars free from selected marker genes to hasten public acceptance of transgenic crops.
Transcription and Recombination: When RNA Meets DNA

PubMed Central

Aguilera, Andrés; Gaillard, Hélène

2014-01-01

A particularly relevant phenomenon in cell physiology and proliferation is the fact that spontaneous mitotic recombination is strongly enhanced by transcription. The most accepted view is that transcription increases the occurrence of double-strand breaks and/or single-stranded DNA gaps that are repaired by recombination. Most breaks would arise as a consequence of the impact that transcription has on replication fork progression, provoking its stalling and/or breakage. Here, we discuss the mechanisms responsible for the cross talk between transcription and recombination, with emphasis on (1) the transcription–replication conflicts as the main source of recombinogenic DNA breaks, and (2) the formation of cotranscriptional R-loops as a major cause of such breaks. The new emerging questions and perspectives are discussed on the basis of the interference between transcription and replication, as well as the way RNA influences genome dynamics. PMID:25085910
Effects of disciplinary cultures of researchers and research trainees on the acceptability of nanocarriers for drug delivery in different contexts of use: a mixed-methods study

NASA Astrophysics Data System (ADS)

Chenel, Vanessa; Boissy, Patrick; Cloarec, Jean-Pierre; Patenaude, Johane

2015-04-01

The acceptability of nanomedical applications, which have the potential to generate ethical and societal impacts, is a significant factor in the deployment of nanomedicine. A lack of fit between nanomedical applications and society's values may result from a partial consideration of such impacts. New approaches for technological evaluation focused on impact perception, acceptance, and acceptability are needed to go beyond traditional technology assessment approaches used with nanotechnology, which focus mainly on toxicological and safety criteria. Using a new evaluative approach based on perceived impacts of nanotechnology, the objective of this study was to assess perceptions among researchers and research trainees familiar with emergent technologies and from different disciplinary background the scope of acceptability judgments made towards the use of nanocarriers. This mixed-methods study was based on scenarios presenting two types of drug-delivery nanocarriers (carbon, synthetic DNA) in two contexts of use (lung cancer treatment, seasonal flu treatment). Researchers and research trainees in the natural sciences and engineering, and the social sciences and the humanities were invited by email to take part in this project. An online questionnaire followed by semi-directed interviews allowed characterization of disciplinary divergences regarding to impact perception, acceptance, and acceptability of the scenarios. The results suggest that impact perception is influenced by disciplinary culture. Also, trends can be seen between respondents' profiles and variables of acceptance and acceptability, and certain components of the acceptability judgement are specific to each disciplinary culture. The acknowledgment and consideration of these disciplinary divergences could allow, among others, for opening up interdisciplinary dialogue on matters related to the acceptability of nanomedical applications and their developments.
Effects of disciplinary cultures of researchers and research trainees on the acceptability of nanocarriers for drug delivery in different contexts of use: a mixed-methods study.

PubMed

Chenel, Vanessa; Boissy, Patrick; Cloarec, Jean-Pierre; Patenaude, Johane

The acceptability of nanomedical applications, which have the potential to generate ethical and societal impacts, is a significant factor in the deployment of nanomedicine. A lack of fit between nanomedical applications and society's values may result from a partial consideration of such impacts. New approaches for technological evaluation focused on impact perception, acceptance, and acceptability are needed to go beyond traditional technology assessment approaches used with nanotechnology, which focus mainly on toxicological and safety criteria. Using a new evaluative approach based on perceived impacts of nanotechnology, the objective of this study was to assess perceptions among researchers and research trainees familiar with emergent technologies and from different disciplinary background the scope of acceptability judgments made towards the use of nanocarriers. This mixed-methods study was based on scenarios presenting two types of drug-delivery nanocarriers (carbon, synthetic DNA) in two contexts of use (lung cancer treatment, seasonal flu treatment). Researchers and research trainees in the natural sciences and engineering, and the social sciences and the humanities were invited by email to take part in this project. An online questionnaire followed by semi-directed interviews allowed characterization of disciplinary divergences regarding to impact perception, acceptance, and acceptability of the scenarios. The results suggest that impact perception is influenced by disciplinary culture. Also, trends can be seen between respondents' profiles and variables of acceptance and acceptability, and certain components of the acceptability judgement are specific to each disciplinary culture. The acknowledgment and consideration of these disciplinary divergences could allow, among others, for opening up interdisciplinary dialogue on matters related to the acceptability of nanomedical applications and their developments.
Maurice Hugh Frederick Wilkins CBE: 15 December 1916 - 5 October 2004.

PubMed

Arnott, Struther; Kibble, T W B; Shallice, Tim

2006-01-01

Maurice Hugh Frederick Wilkins was the 'Third man of the double helix; according to the publishers who were allowed to foist this title on his late-written autobiography. Certainly it is for his role in the discover of the duplex secondary structure of DNA that he will be remembered. It might be argued that he was the first man, rather than the third, for it was his successful revival of X-ray diffraction studies of DNA and his earliest result in 1950, a pattern of a well-oriented and polycrystalline DNA of unprecedented quality, that allowed him to conclude almost immediately that the basic framework of the genetical material was simple and symmetrical, and that the symmetrical structure took the form of a helix. This same pattern, displayed at a conference in Naples six months later, was the major inspiration for the involvement of J. D. Watson (ForMemRS 1981) in modelling DNA structure in collaboration with F. H. C. Crick (FRS 1959). Crick was a personal friend of Maurice's and was more involved with studies of proteins until the progress of Maurice's research programme and Watson's enthusiastic presence in Cambridge convinced him to put nucleic acids first. The carefully crafted citation for the 1960 Lasker Award, which these three men shared in 1960, put Maurice's name first and accurately referred to '...the painstaking x-ray diffraction studies of Wilkins that provided a most important clue that was pursued in a ingenious fashion and to a logical conclusion by Crick and Watson...'. Maurice's diffraction studies of DNA were not only the alpha but also the omega of the double helix because it left to him to remedy a major flaw in the original (1953) Watson-Crick conjecture. Maurice Wilkin's early acceptance of DNA as the genetic material and his recognition that it had structures that could and should be tackled by X-ray diffraction analyses, not necessarily under his exclusive control, was important in ensuring that the essence of DNA's structure was discovered as early as it was. His success in resolving patiently and successfully all the technical problems, great and small, that arose unpredictably in the course of his work on DNA and RNA was substantial. He was less successful in defending himself against the slings and arrows that unjustly assail those involved in momentous exercises. His pacific acceptance of these misfortunes was typical of a life that had priorities beyond the laboratory and required him to do as one would be done by.
The impact of chimerism in DNA-based forensic sex determination analysis.

PubMed

George, Renjith; Donald, Preethy Mary; Nagraj, Sumanth Kumbargere; Idiculla, Jose Joy; Hj Ismail, Rashid

2013-01-01

Sex determination is the most important step in personal identification in forensic investigations. DNA-based sex determination analysis is comparatively more reliable than the other conventional methods of sex determination analysis. Advanced technology like real-time polymerase chain reaction (PCR) offers accurate and reproducible results and is at the level of legal acceptance. But still there are situations like chimerism where an individual possess both male and female specific factors together in their body. Sex determination analysis in such cases can give erroneous results. This paper discusses the phenomenon of chimerism and its impact on sex determination analysis in forensic investigations.
Traceability of Plant Diet Contents in Raw Cow Milk Samples

PubMed Central

Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

2009-01-01

The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982
Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

PubMed Central

El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

2014-01-01

Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790
Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

PubMed

Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

2014-10-01

Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.
Review: DNA Barcoding and Chromatography Fingerprints for the Authentication of Botanicals in Herbal Medicinal Products

PubMed Central

2017-01-01

In the last two decades, there has been a tremendous increase in the global use of herbal medicinal products (HMPs) due to their claimed health benefits. This has led to increase in their demand and consequently, also, resulted in massive adulteration. This is due to the fact that most of the traditional methods cannot identify closely related species in a process product form. Therefore the urgent need for simple and rapid identification methods resulted in the discovery of a novel technique. DNA barcoding is a process that uses short DNA sequence from the standard genome for species identification. This technique is reliable and is not affected by external factors such as climates, age, or plant part. The difficulties in isolation of DNA of high quality in addition to other factors are among the challenges encountered using the DNA barcoding in the authentication of HMP. These limitations indicated that using DNA barcoding alone may ineffectively authenticate the HMP. Therefore, the combination of DNA barcoding with chromatographic fingerprint, a popular and generally accepted technique for the assessment and quality control of HMP, will offer an efficient solution to effectively evaluate the authenticity and quality consistency of HMP. Detailed and quality information about the main composition of the HMPs will help to ascertain their efficacy and safety as these are very important for quality control. PMID:28536641
Fully automated, internally controlled quantification of hepatitis B Virus DNA by real-time PCR by use of the MagNA Pure LC and LightCycler instruments.

PubMed

Leb, Victoria; Stöcher, Markus; Valentine-Thon, Elizabeth; Hölzl, Gabriele; Kessler, Harald; Stekel, Herbert; Berg, Jörg

2004-02-01

We report on the development of a fully automated real-time PCR assay for the quantitative detection of hepatitis B virus (HBV) DNA in plasma with EDTA (EDTA plasma). The MagNA Pure LC instrument was used for automated DNA purification and automated preparation of PCR mixtures. Real-time PCR was performed on the LightCycler instrument. An internal amplification control was devised as a PCR competitor and was introduced into the assay at the stage of DNA purification to permit monitoring for sample adequacy. The detection limit of the assay was found to be 200 HBV DNA copies/ml, with a linear dynamic range of 8 orders of magnitude. When samples from the European Union Quality Control Concerted Action HBV Proficiency Panel 1999 were examined, the results were found to be in acceptable agreement with the HBV DNA concentrations of the panel members. In a clinical laboratory evaluation of 123 EDTA plasma samples, a significant correlation was found with the results obtained by the Roche HBV Monitor test on the Cobas Amplicor analyzer within the dynamic range of that system. In conclusion, the newly developed assay has a markedly reduced hands-on time, permits monitoring for sample adequacy, and is suitable for the quantitative detection of HBV DNA in plasma in a routine clinical laboratory.
Novel approach for deriving genome wide SNP analysis data from archived blood spots

PubMed Central

2012-01-01

Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252
Homochirality through Photon-Induced Denaturing of RNA/DNA at the Origin of Life.

PubMed

Michaelian, Karo

2018-06-06

Since a racemic mixture of chiral nucleotides frustrates the enzymeless extension of RNA and DNA, the origin of homochirality must be intimately connected with the origin of life. Homochirality theories have elected to presume abiotic mechanisms for prebiotic enantiomer enrichment and post amplification, but none, so far, has been generally accepted. Here I present a novel hypothesis for the procurement of homochirality from an asymmetry in right- over left-circularly polarized photon-induced denaturing of RNA and DNA at the Archean ocean surface as temperatures descended below that of RNA and DNA melting. This asymmetry is attributed to the small excess of right-handed circularly polarized submarine light during the afternoon, when surface water temperatures were highest and thus most conducive to photon-induced denaturing, and to a negative circular dichroism band extending from 230 to 270 nm for small oligos of RNA and DNA. Because D-nucleic acids have greater affinity for L-tryptophan due to stereochemistry, and because D-RNA/DNA+L-tryptophan complexes have an increased negative circular dichroism band between 230 and 270 nm, the homochirality of tryptophan can also be explained by this hypothesis. A numerical model is presented, demonstrating the efficacy of such a mechanism in procuring homochirality of RNA or DNA from an original racemic solution in as little as 270 Archean years.
Nuclear transfer to prevent mitochondrial DNA disorders: revisiting the debate on reproductive cloning.

PubMed

Bredenoord, A L; Dondorp, W; Pennings, G; De Wert, G

2011-02-01

Preclinical experiments are currently performed to examine the feasibility of several types of nuclear transfer to prevent mitochondrial DNA (mtDNA) disorders. Whereas the two most promising types of nuclear transfer to prevent mtDNA disorders, spindle transfer and pronuclear transfer, do not amount to reproductive cloning, one theoretical variant, blastomere transfer does. This seems the most challenging both technically and ethically. It is prohibited by many jurisdictions and also the scientific community seems to avoid it. Nevertheless, this paper examines the moral acceptability of blastomere transfer as a method to prevent mtDNA disorders. The reason for doing so is that most objections against reproductive cloning refer to reproductive adult cloning, while blastomere transfer would amount to reproductive embryo cloning. After clarifying this conceptual difference, this paper examines whether the main non-safety objections brought forward against reproductive cloning also apply in the context of blastomere transfer. The conclusion is that if this variant were to become safe and effective, dismissing it because it would involve reproductive cloning is unjustified. Nevertheless, as it may lead to more complex ethical appraisals than the other variants, researchers should initially focus on the development of the other types of nuclear transfer to prevent mtDNA disorders. Copyright © 2010 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
HIV RNA testing in the context of nonoccupational postexposure prophylaxis.

PubMed

Roland, Michelle E; Elbeik, Tarek A; Kahn, James O; Bamberger, Joshua D; Coates, Thomas J; Krone, Melissa R; Katz, Mitchell H; Busch, Michael P; Martin, Jeffrey N

2004-08-01

The specificity and positive predictive value of human immunodeficiency virus (HIV) RNA assays have not been evaluated in the setting of postexposure prophylaxis (PEP). Plasma from subjects enrolled in a nonoccupational PEP study was tested with 2 branched-chain DNA (bDNA) assays, 2 polymerase chain reaction (PCR) assays, and a transcription-mediated amplification (TMA) assay. Assay specificity and positive predictive value were determined for subjects who remained negative for HIV antibody for >or=3 months. In 329 subjects examined, the lowest specificities (90.1%-93.7%) were seen for bDNA testing performed in real time. The highest specificities were seen with batched bDNA version 3.0 (99.1%), standard PCR (99.4%), ultrasensitive PCR (100%), and TMA (99.6%) testing. Only the 2 assays with the highest specificities had positive predictive values >40%. For the bDNA assays, increasing the cutoff point at which a test is called positive (e.g., from 50 copies/mL to 500 copies/mL for version 3.0) increased both specificity and positive predictive values to 100%. The positive predictive value of HIV RNA assays in individuals presenting for PEP is unacceptably low for bDNA-based testing and possibly acceptable for PCR- and TMA-based testing. Routine use of HIV RNA assays in such individuals is not recommended.
[DNA prints instead of plantar prints in neonatal identification].

PubMed

Rodríguez-Alarcón Gómez, J; Martińez de Pancorbo Gómez, M; Santillana Ferrer, L; Castro Espido, A; Melchor Maros, J C; Linares Uribe, M A; Fernández-Llebrez del Rey, L; Aranguren Dúo, G

1996-06-22

To check the possible usefulness in studying DNA in dried blood spots taken on filter paper blotters for newborn identification. It set out to establish: 1. The validity of the method for analysis; 2. The validity of all stored samples (such as those kept in clinical records); 3. Guarantee of non-intrusion in the genetic code; 4. Acceptable price and execution time. Forty (40) anonymous 13-year-old samples of 20 subjects (2 per subject) were studied. DNA was extracted using Chelex resin and the STR ("small tandem repeat") of microsatellite DNA was studies using the "polimerase chain reaction method" (PCR). Three non coding DNA loci (CSF1PO, TPOX and THO1) were analyzed by Multiplex amplification. It was possible to type 39 samples, making it possible to match the 20 cases (one by exclusion). The complete procedure yielded the results within 24 hours in all cases. The estimated final cost was found to be a fifth of that conventional maternity/paternity tests. The study carried out made matching possible in all 20 cases (directly in 19 cases). It was not necessary to study DNA coding areas. The validity of the method for analyzing samples stored for 13 years without any special care was also demonstrated. The technic was fast, producing the results within 24 hours, and at reasonable cost.

High resolution melting analysis for epidermal growth factor receptor mutations in formalin-fixed paraffin-embedded tissue and plasma free DNA from non-small cell lung cancer patients.

PubMed

Jing, Chang-Wen; Wang, Zhuo; Cao, Hai-Xia; Ma, Rong; Wu, Jian-Zhong

2014-01-01

The aim of the research was to explore a cost effective, fast, easy to perform, and sensitive method for epidermal growth factor receptor (EGFR) mutation testing. High resolution melting analysis (HRM) was introduced to evaluate the efficacy of the analysis for dectecting EGFR mutations in exons 18 to 21 using formalin-fixed paraffin-embedded (FFPE) tissues and plasma free DNA from 120 patients. The total EGFR mutation rate was 37.5% (45/120) detected by direct sequencing. There were 48 mutations in 120 FFPE tissues assessed by HRM. For plasma free DNA, the EGFR mutation rate was 25.8% (31/120). The sensitivity of HRM assays in FFPE samples was 100% by HRM. There was a low false-positive mutation rate but a high false-negative rate in plasma free DNA detected by HRM. Our results show that HRM analysis has the advantage of small tumor sample need. HRM applied with plasma free DNA showed a high false-negative rate but a low false-positive rate. Further research into appropriate methods and analysis needs to be performed before HRM for plasma free DNA could be accepted as an option in diagnostic or screening settings.
Hereditary hemochromatosis: awareness and genetic testing acceptability in Western Romania.

PubMed

Neghina, Adriana Maria; Anghel, Andrei

2010-12-01

a public health strategy to promote early diagnosis of hemochromatosis gene (HFE)-related hemochromatosis (HFE-HH) largely depends on people's acceptance of available screening tests. The present study aimed at evaluating patient awareness of HFE-HH and their acceptance of DNA testing in western Romania. a total of 221 participants were randomly recruited from the ambulatory unit of the Emergency County Hospital in Timisoara, Romania. They received brief information on HFE-HH and were assessed for the signs and symptoms of hemochromatosis. HFE genotyping was offered to all of them. Only two cases (0.9%) had previous knowledge of HFE-HH. Twenty-one cases (9.5%) underwent genetic testing. Characteristics associated with test acceptance were age <45 years, male gender, and educational attainment. Acceptance was associated with a desire to know if they had HFE-HH (85.7%). The most prevalent refusal reason was a desire for more information (41%). larger educational programs are required to increase people's awareness about HFE-HH in western Romania. Nevertheless, within health care settings, the importance of disease detection and patient's educational background appear to be essential for achieving high rates of participation in the genetic test.
40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

Code of Federal Regulations, 2010 CFR

2010-07-01

... should be documented and should be adequate for the experimental design. (5) Metabolic activation... 40 Protection of Environment 31 2010-07-01 2010-07-01 true Differential growth inhibition of... titers (cells per ml). Transformed data alone in the absence of experimental data are not acceptable (i.e...
Identification of Novel Cryptosporidium Genotypes from the Czech Republic

PubMed Central

Ryan, Una; Xiao, Lihua; Read, Carolyn; Zhou, Ling; Lal, Altaf A.; Pavlasek, Ivan

2003-01-01

Isolates of Cryptosporidium from the Czech Republic were characterized from a variety of different hosts using sequence and phylogenetic analysis of the 18S ribosomal DNA and the heat-shock (HSP-70) gene. Analysis expanded the host range of accepted species and identified several novel genotypes, including horse, Eurasian woodcock, rabbit, and cervid genotypes. PMID:12839819
[Novel Approaches in DNA Methylation Studies - MS-HRM Analysis and Electrochemistry].

PubMed

Bartošík, M; Ondroušková, E

Cytosine methylation in DNA is an epigenetic mechanism regulating gene expression and plays a vital role in cell differentiation or proliferation. Tumor cells often exhibit aberrant DNA methylation, e.g. hypermethylation of tumor suppressor gene promoters. New methods, capable of determining methylation status of specific DNA sequences, are thus being developed. Among them, MS-HRM (methylation-specific high resolution melting) and electrochemistry offer relatively inexpensive instrumentation, fast assay times and possibility of screening multiple samples/DNA regions simultaneously. MS-HRM is due to its sensitivity and simplicity an interesting alternative to already established techniques, including methylation-specific PCR or bisulfite sequencing. Electrochemistry, when combined with suitable electroactive labels and electrode surfaces, has been applied in several unique strategies for discrimination of cytosines and methylcytosines. Both techniques were successfully tested in analysis of DNA methylation within promoters of important tumor suppressor genes and could thus help in achieving more precise diagnostics and prognostics of cancer. Aberrant methylation of promoters has already been described in hundreds of genes associated with tumorigenesis and could serve as important biomarker if new methods applicable into clinical practice are sufficiently advanced.Key words: DNA methylation - 5-methylcytosine - HRM analysis - melting temperature - DNA duplex - electrochemistry - nucleic acid hybridizationThis work was supported by MEYS - NPS I - LO1413.The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study.The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 6. 5. 2016Accepted: 16. 5. 2016.
Molecular fragil X screening in normal populations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spence, W.C.; Black, S.H.; Fallon, L.

In December, 1993, we initiated a pilot project in which DNA fragile X (fraX) testing was offered during routine prenatal or genetic counseling to all pregnant women seen at the Genetics & IVF Institute, most of whom were referred for the indication of advanced maternal age. A brochure on fragile X syndrome was sent to each patient prior to her appointment and was reviewed by a counselor or physician during the counseling session. As of June 1995, 3,345 patients were offered testing; 474 women with no identified family history of mental retardation or learning disability and 214 women with amore » positive family history accepted the test on a self-pay basis. The second population screened was 271 potential donors in our anonymous egg donor program. DNA from blood was tested by Southern blot using EcoRI/EagI and StB12.3. If an expansion was detected, CGG repeat number was determined by PCR-based analysis. Among the 474 patients with unremarkable family histories, three fraX carriers were identified (repeat sizes = 60+), whereas none were found in the 214 patients with a positive family history. Among the potential egg donors, two high borderline patients were identified (repeat sizes = between 50 and 59). Our ongoing study indicates that screening of pregnant or preconceptual populations for fraX carrier status using DNA testing is accepted by many patients and is an important addition to current medical practice. 12 refs., 1 tab.« less
DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase*

PubMed Central

Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.

2016-01-01

The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751
The Molecular Origin of the MMR-dependent Apoptosis Pathway from Dynamics Analysis of MutSα-DNA Complexes

PubMed Central

Negureanu, Lacramioara; Salsbury, Freddie R.

2012-01-01

The cellular response to DNA damage signaling by MMR proteins is incompletely understood. It is generally accepted that MMR-dependent apoptosis pathway in response to DNA damage detection is independent of MMR's DNA repair function. In this study we investigate correlated motions in response to the binding of mismatched and PCL DNA fragments by MutSα, as derived from 50 ns molecular dynamics simulations. The protein dynamics in response to the mismatched and damaged DNA recognition suggests that MutSα signals their recognition through independent pathways providing evidence for the molecular origin of the MMR-dependent apoptosis. MSH2 subunit is indicated to play a key role in signaling both mismatched and damaged DNA recognition; localized and collective motions within the protein allow identifying sites on the MSH2 surface possible involved in recruiting proteins responsible for downstream events. Unlike in the mismatch complex, predicted key communication sites specific for the damage recognition are on the list of known cancer causing mutations or deletions. This confirms MSH2's role in signaling DNA-damage induced apoptosis and suggests that defects in MMR alone is sufficient to trigger tumorigenesis, supporting the experimental evidence that MMR-damage response function could protect from the early occurrence of tumors. Identifying these particular communication sites may have implications for the treatment of cancers that are not defective for MMR, but are unable to function optimally for MMR-dependent responses following DNA damage such as the case of resistance to cisplatin. PMID:22712459
Chromatin associated mechanisms in base excision repair - nucleosome remodeling and DNA transcription, two key players.

PubMed

Menoni, Hervé; Di Mascio, Paolo; Cadet, Jean; Dimitrov, Stefan; Angelov, Dimitar

2017-06-01

Genomic DNA is prone to a large number of insults by a myriad of endogenous and exogenous agents. The base excision repair (BER) is the major mechanism used by cells for the removal of various DNA lesions spontaneously or environmentally induced and the maintenance of genome integrity. The presence of persistent DNA damage is not compatible with life, since abrogation of BER leads to early embryonic lethality in mice. There are several lines of evidences showing existence of a link between deficient BER, cancer proneness and ageing, thus illustrating the importance of this DNA repair pathway in human health. Although the enzymology of BER mechanisms has been largely elucidated using chemically defined DNA damage substrates and purified proteins, the complex interplay of BER with another vital process like transcription or when DNA is in its natural state (i.e. wrapped in nucleosome and assembled in chromatin fiber is largely unexplored. Cells use chromatin remodeling factors to overcome the general repression associated with the nucleosomal organization. It is broadly accepted that energy-dependent nucleosome remodeling factors disrupt histones-DNA interactions at the expense of ATP hydrolysis to favor transcription as well as DNA repair. Importantly, unlike transcription, BER is not part of a regulated developmental process but represents a maintenance system that should be efficient anytime and anywhere in the genome. In this review we will discuss how BER can deal with chromatin organization to maintain genetic information. Emphasis will be placed on the following challenging question: how BER is initiated within chromatin? Copyright © 2017 Elsevier Inc. All rights reserved.
Homogeneous electrochemical immunoassay of aflatoxin B1 in foodstuff using proximity-hybridization-induced omega-like DNA junctions and exonuclease III-triggered isothermal cycling signal amplification.

PubMed

Tang, Juan; Huang, Yapei; Liu, Huiqiong; Zhang, Cengceng; Tang, Dianping

2016-12-01

A new homogeneous electrochemical immunosensing platform was designed for sensitive detection of aflatoxin B 1 (AFB 1 ) in foodstuff. The system consisted of anti-AFB 1 antibody labeled DNA 1 (Ab-DNA 1 ), AFB 1 -bovine serum albumin (BSA)-conjugated DNA 2 (AFB 1 -DNA 2 ), and methylene blue functionalized hairpin DNA. Owing to a specific antigen-antibody reaction between anti-AFB 1 and AFB 1 -BSA, the immunocomplex formed assisted the proximity hybridization of DNA 1 with DNA 2 , thus resulting in the formation of an omega-like DNA junction. Thereafter, the junction opened the hairpin DNA to construct a new double-stranded DNA, which could be readily cleaved by exonuclease III to release the omega-like DNA junction and methylene blue. The dissociated DNA junction could repeatedly hybridize with residual hairpin DNA molecules with exonuclease III-based isothermal cycling amplification, thereby releasing numerous free methylene blue molecules into the detection solution. The as-produced free methylene blue molecules could be captured by a negatively charged indium tin oxide electrode, each of which could produce an electronic signal within the applied potentials. On introduction of target AFB 1 , the analyte competed with AFB 1 -DNA 2 for the conjugated anti-AFB 1 on the Ab-DNA 1 , subsequently decreasing the amount of omega-like DNA junctions formed, hence causing methylene blue labeled hairpin DNA to move far away from the electrode surface. Under optimal conditions the detectable electrochemical signal decreased with increasing amount of target AFB 1 in a dynamic working range of 0.01-30 ng mL -1 with a detection limit of 4.8 pg mL -1 . In addition, the precision and reproducibility of this system were acceptable. Finally, the method was further evaluated for analysis of naturally contaminated or AFB 1 -spiked peanut samples, giving results that matched well with those obtained with a commercial AFB 1 ELISA kit.
Determination of the methylation status of MGMT in different regions within glioblastoma multiforme.

PubMed

Hamilton, Mark G; Roldán, Gloria; Magliocco, Anthony; McIntyre, John B; Parney, Ian; Easaw, Jacob C

2011-04-01

Epigenetic silencing of the MGMT gene through promoter methylation correlates with improved survival in Glioblastoma Multiforme (GBM) patients receiving concurrent chemoradiotherapy. Although the clinical benefit is primarily seen in patients with methylated MGMT promoter, some unmethylated patients also respond to Temozolomide. One possible explanation may be intratumoral heterogeneity. This study was designed to assess the methylation status of the MGMT promoter in different areas of GBM and determine if methylation status varied depending on the fixation technique (paraffin-embedding versus fresh frozen) used to store tissue. Using intraoperative navigation, biopsies were obtained from three distinct regions: the enhancing outer area, the non-enhancing inner core, and an area immediately outside the enhancing region. Only patients with GBM were included for evaluation and analysis. Samples taken from each area were divided with half stored by flash freezing and the other half stored using paraffin fixation. Methylation Specific-PCR (MS-PCR) was used for analysis of MGMT promoter methylation. Thirteen patients were included. Ten were male with a median age of 62 years. In each patient, samples were taken from the enhancing rim and the necrotic centre. However, it was not considered safe or feasible to obtain samples from the area immediately adjacent to the enhancing tumor rim in one case. All patients were homogeneous for methylation status throughout their tumor and tissue taken adjacent to it when frozen tissue was used. However, four patients had discrepancies in the MGMT promoter status between the frozen and paraffin-embedded blocks and one patient was not homogeneous within the tumor when paraffin-embedded tissue was used. MGMT promoter methylation status was homogeneous in all GBM tumors. Our observation that methylation status varied depending if the DNA was extracted from paraffin-embedded versus frozen tissue is concerning. Although the reason for this is unclear, we postulate that the timing from resection to fixation or the process of fixation itself may potentially alter methylation status in paraffin-embedded tumors.
Traffic of antibody-secreting cells after immunization with a liposome-associated, CpG-ODN-adjuvanted oral cholera vaccine.

PubMed

Somroop, Srinuan; Tongtawe, Pongsri; Chaisri, Urai; Tapchaisri, Pramuan; Chongsa-nguan, Manas; Srimanote, Potjanee; Chaicumpa, Wanpen

2006-12-01

An oral cholera vaccine made up of heat-treated recombinant cholera toxin (rCT), V. cholerae lipopolysaccharide (LPS), and recombinant toxin-co-regulated pili subunit A (rTcpA), entrapped in liposomes in the presence of unmethylated bacterial CpG-DNA (ODN#1826) was used to orally immunize a group of eight week old rats. A booster dose was given 14 days later. Control rats received placebo (vaccine diluent). The kinetics of the immune response were investigated by enumerating the antigen specific-antibody secreting cells (ASC) in the blood circulation and intestinal lamina propria using the ELISPOT assay and a histo-immunofluorescence assay (IFA), respectively. ASC of all antigenic specificities were detected in the blood of the vaccinated rats as early as two days after the booster dose. The numbers of LPS-ASC and TcpA-ASC in the blood were at their peak at day 3 post booster while the number of CT-ASC was highest at day 4 after the booster immunization. At day 13 post immunization, no ASC were detected in the blood. A several fold increase in the number of ASC of all antigenic specificities in the lamina propria above the background numbers of the control animals were found in all vaccinated rats at days 6 and 13 post booster (earlier and later time points were not studied). Vibriocidal antibody and specific antibodies to CT, LPS and TcpA were detected in 57.1% and 52.4%, 14.3%, and 19.0% of the orally vaccinated rats, respectively. The data indicated that rats orally primed with the vaccine could produce a rapid anamnestic response after re-exposure to the V. cholerae antigens. Thus, a single dose of the vaccine is expected to elicit a similar anamnestic immune response in people from cholera endemic areas who have been naturally primed to V. cholerae antigens, while two doses at a 14 day interval should be adequate for a traveler to a disease endemicarea.
TLR9 expression is required for the development of cigarette smoke-induced emphysema in mice

PubMed Central

Foronjy, Robert F.; Salathe, Matthias A.; Dabo, Abdoulaye J.; Baumlin, Nathalie; Cummins, Neville; Eden, Edward

2016-01-01

The expression of Toll-like receptor (TLR)-9, a pathogen recognition receptor that recognizes unmethylated CpG sequences in microbial DNA molecules, is linked to the pathogenesis of several lung diseases. TLR9 expression and signaling was investigated in animal and cell models of chronic obstructive pulmonary disease (COPD). We observed enhanced TLR9 expression in mouse lungs following exposure to cigarette smoke. Tlr9−/− mice were resistant to cigarette smoke-induced loss of lung function as determined by mean linear intercept, total lung capacity, lung compliance, and tissue elastance analysis. Tlr9 expression also regulated smoke-mediated immune cell recruitment to the lung; apoptosis; expression of granulocyte-colony stimulating factor (G-CSF), the CXCL5 protein, and matrix metalloproteinase-2 (MMP-2); and protein tyrosine phosphatase 1B (PTP1B) activity in the lung. PTP1B, a phosphatase with anti-inflammatory abilities, was identified as binding to TLR9. In vivo delivery of a TLR9 agonist enhanced TLR9 binding to PTP1B, which inactivated PTP1B. Ptp1b−/− mice had elevated lung concentrations of G-CSF, CXCL5, and MMP-2, and tissue expression of type-1 interferon following TLR9 agonist administration, compared with wild-type mice. TLR9 responses were further determined in fully differentiated normal human bronchial epithelial (NHBE) cells isolated from nonsmoker, smoker, and COPD donors, and then cultured at air liquid interface. NHBE cells from smokers and patients with COPD expressed more TLR9 and secreted greater levels of G-CSF, IL-6, CXCL5, IL-1β, and MMP-2 upon TLR9 ligand stimulation compared with cells from nonsmoker donors. Although TLR9 combats infection, our results indicate that TLR9 induction can affect lung function by inactivating PTP1B and upregulating expression of proinflammatory cytokines. PMID:27288485
Aberrant EPHB4 gene methylation and childhood acute lymphoblastic leukemia

PubMed Central

Li, Yuhua; Wang, Huihui; Chen, Xiaowen; Mai, Huirong; Li, Changgang; Wen, Feiqiu

2017-01-01

The present study aimed to investigate the association between aberrant DNA methylation of the promoter region of the ephrin type-B receptor 4 (EPHB4) gene and the development of childhood acute lymphoblastic leukemia (ALL). Bisulfite sequencing polymerase chain reaction (BSP) was performed to determine the methylation density of cytosine-guanine pair islands in the promoter region of EPHB4, in bone marrow samples from 40 children with ALL. The mRNA and protein expression levels of EPHB4 were detected using reverse transcription-quantitative polymerase chain reaction and western blot analysis. A total of 10 children with idiopathic thrombocytopenic purpura (ITP) were recruited as controls. The results revealed that the average methylation density of the bone marrow samples from the patients with ALL was significantly higher, compared with the patients with ITP (P=0.046). The relative mRNA expression levels of EPHB4 in the patients with ITP (25.08±4.03) and the patients with ALL without methylation (12.33±2.16) were significantly higher, compared with that observed in the patients with ALL with methylation (6.48±2.73; P<0.01). Pearson analysis revealed a significant negative linear correlation between EPHB4 gene methylation and its expression levels (r=−0.957; P<0.01). Western blot analysis indicated that EPHB4 protein expression levels were low in the methylated ALL samples. An evaluation of the two-year disease-free survival (DFS) of the patients with ALL was performed, which revealed that the patients with unmethylated ALL exhibited a significantly higher two-year DFS rate, as compared with patients with methylated ALL (P=0.036). These results suggest that the methylation of the EPHB4 gene is prevalent in childhood ALL and may result in expressional inactivation, which consequently promotes ALL pathogenesis and is associated with an unfavorable prognosis. Therefore, the EPHB4 gene may function as a potential tumor suppressor in childhood ALL. PMID:29085439
Concurrent Chemoradiotherapy with Temozolomide Followed by Adjuvant Temozolomide for Newly Diagnosed Glioblastoma Patients: A Retrospective Multicenter Observation Study in Korea.

PubMed

Kim, Byung Sup; Seol, Ho Jun; Nam, Do-Hyun; Park, Chul-Kee; Kim, Il Han; Kim, Tae Min; Kim, Jeong Hoon; Cho, Young Hyun; Yoon, Sang Min; Chang, Jong Hee; Kang, Seok-Gu; Kim, Eui Hyun; Suh, Chang-Ok; Jung, Tae-Young; Lee, Kyung-Hwa; Kim, Chae-Yong; Kim, In Ah; Hong, Chang-Ki; Yoo, Heon; Kim, Jin Hee; Kang, Shin-Hyuk; Kang, Min Kyu; Kim, Eun-Young; Kim, Sun-Hwan; Chung, Dong-Sup; Hwang, Sun-Chul; Song, Joon-Ho; Cho, Sung Jin; Lee, Sun-Il; Lee, Youn-Soo; Ahn, Kook-Jin; Kim, Se Hoon; Lim, Do Hun; Gwak, Ho-Shin; Lee, Se-Hoon; Hong, Yong-Kil

2017-01-01

The purpose of this study was to investigate the feasibility and survival benefits of combined treatment with radiotherapy and adjuvant temozolomide (TMZ) in a Korean sample. A total of 750 Korean patients with histologically confirmed glioblastoma multiforme, who received concurrent chemoradiotherapy with TMZ (CCRT) and adjuvant TMZ from January 2006 until June 2011, were analyzed retrospectively. After the first operation, a gross total resection (GTR), subtotal resection (STR), partial resection (PR), biopsy alone were achieved in 388 (51.7%), 159 (21.2%), 96 (12.8%), and 107 (14.3%) patients, respectively. The methylation status of O 6 -methylguanine-DNA methyltransferase (MGMT) was reviewed retrospectively in 217 patients. The median follow-up period was 16.3 months and the median overall survival (OS) was 17.5 months. The actuarial survival rates at the 1-, 3-, and 5-year OS were 72.1%, 21.0%, and 9.0%, respectively. The median progression-free survival (PFS) was 10.1 months, and the actuarial PFS at 1-, 3-, and 5-year PFS were 42.2%, 13.0%, and 7.8%, respectively. The patients who received GTR showed a significantly longer OS and PFS than those who received STR, PR, or biopsy alone, regardless of the methylation status of the MGMT promoter. Patients with a methylated MGMT promoter also showed a significantly longer OS and PFS than those with an unmethylated MGMT promoter. Patients who received more than six cycles of adjuvant TMZ had a longer OS and PFS than those who received six or fewer cycles. Hematologic toxicity of grade 3 or 4 was observed in 8.4% of patients during the CCRT period and in 10.2% during the adjuvant TMZ period. Patients treated with CCRT followed by adjuvant TMZ had more favorable survival rates and tolerable toxicity than those who did not undergo this treatment.
Methylation, expression, and mutation analysis of the cell cycle control genes in human brain tumors.

PubMed

Yin, Dong; Xie, Dong; Hofmann, Wolf-Karsten; Miller, Carl W; Black, Keith L; Koeffler, H Phillip

2002-11-28

Methylation status of the p15(INK4B), p16(INK4A), p14(ARF) and retinoblastoma (RB) genes was studied using methylation specific polymerase chain reaction (MSP) in 85 human brain tumors of various subtypes and four normal brain samples. These genes play an important role in the control of the cell cycle. Twenty-four out of 85 cases (28%) had at least one of these genes methylated. The frequency of p14(ARF) methylation was 15 out of 85 (18%) cases, and the expression of p14(ARF) in methylated gliomas was significantly lower than in unmethylated gliomas. The incidence of methylation of p15(INK4B), p16(INK4A) and RB gene was 4%, 7%, and 4%, respectively. Samples with p14(ARF) methylation did not have p16(INK4A) methylation even though both genes physically overlap. None of the target genes was methylated in the normal brain samples. In addition, the p53 gene was mutated in 19 out of 85 (22%) samples as determined by single strand conformation polymorphism (SSCP) analysis and DNA sequencing. Thirty out of 85 (35%) brain tumors had either a p53 mutation or methylation of p14(ARF). Also, the p14(ARF) expression in p53 wild-type gliomas was lower than levels in p53 mutated gliomas. This finding is consistent with wild-type p53 being able to autoregulate its levels by down-regulating expression of p14(ARF). In summary, inactivation of the apoptosis pathway that included the p14(ARF) and p53 genes by hypermethylation and mutation, respectively, occurred frequently in human brain tumors. Down-regulation of p14(ARF) in gliomas was associated with hypermethylation of its promoter and the presence of a wild-type p53 in these samples.
The effects of tumor treating fields and temozolomide in MGMT expressing and non-expressing patient-derived glioblastoma cells.

PubMed

Clark, Paul A; Gaal, Jordan T; Strebe, Joslyn K; Pasch, Cheri A; Deming, Dustin A; Kuo, John S; Robins, H Ian

2017-02-01

A recent Phase 3 study of newly diagnosed glioblastoma (GBM) demonstrated the addition of tumor treating fields (TTFields) to temozolomide (TMZ) after combined radiation/TMZ significantly increased survival and progression free survival. Preliminary data suggested benefit with both methylated and unmethylated O-6-methylguanine-DNA methyl-transferase (MGMT) promoter status. To date, however, there have been no studies to address the potential interactions of TTFields and TMZ. Thus, the effects of TTFields and TMZ were studied in vitro using patient-derived GBM stem-like cells (GSCs) including MGMT expressing (TMZ resistant: 12.1 and 22GSC) and non-MGMT expressing (TMZ sensitive: 33 and 114GSC) lines. Dose-response curves were constructed using cell proliferation and sphere-forming assays. Results demonstrated a ⩾10-fold increase in TMZ resistance of MGMT-expressing (12.1GSCs: IC 50 =160μM; 22GSCs: IC 50 =44μM) compared to MGMT non-expressing (33GSCs: IC 50 =1.5μM; 114GSCs: IC 50 =5.2μM) lines. TTFields inhibited 12.1 GSC proliferation at all tested doses (50-500kHz) with an optimal frequency of 200kHz. At 200kHz, TTFields inhibited proliferation and tumor sphere formation of both MGMT GSC subtypes at comparable levels (12.1GSC: 74±2.9% and 38±3.2%, respectively; 22GSC: 61±11% and 38±2.6%, respectively; 33GSC: 56±9.5% and 60±7.1%, respectively; 114 GSC: 79±3.5% and 41±4.3%, respectively). In combination, TTFields (200kHz) and TMZ showed an additive anti-neoplastic effect with equal efficacy for TTFields in both cell types (i.e., ± MGMT expression) with no effect on TMZ resistance. This is the first demonstration of the effects of TTFields on cancer stem cells. The expansion of such studies may have clinical implications. Copyright © 2016 Elsevier Ltd. All rights reserved.
The Effects of Tumor Treating Fields and Temozolomide in MGMT Expressing and Non-Expressing Patient-Derived Glioblastoma Cells

PubMed Central

Clark, Paul A.; Gaal, Jordan T; Strebe, Joslyn K.; Pasch, Cheri A; Deming, Dustin A; Kuo, John S.; Robins, H. Ian

2016-01-01

A recent Phase 3 study of newly diagnosed glioblastoma (GBM) demonstrated the addition of Tumor Treating Fields (TTFields) to temozolomide (TMZ) after combined radiation/TMZ significantly increased survival and progression free survival. Preliminary data suggested benefit with both methylated and unmethylated O-6-methylguanine-DNA methyl-transferase (MGMT) promoter status. To date, however, there have been no studies to address the potential interactions of TTFields and TMZ. Thus, the effects of TTFields and TMZ were studied in vitro using patient-derived GBM stem-like cells (GSCs) including MGMT expressing (TMZ resistant:12.1 and 22 GSC) and non-MGMT expressing (TMZ sensitive:33 and 114 GSC) lines. Dose-response curves were constructed using cell proliferation and sphere-forming assays. Results demonstrated a ≥10-fold increase in TMZ resistance of MGMT-expressing (12.1 GSCs: IC50=160 μM; 22 GSCs: IC50=44 μM) compared to MGMT non-expressing (33 GSCs: IC50=1.5 μM; 114 GSCs: IC50=5.2 μM) lines. TTFields inhibited 12.1 GSC proliferation at all tested doses (50-500 kHz) with an optimal frequency of 200 kHz. At 200 kHz, TTFields inhibited proliferation and tumor sphere formation of both MGMT GSC subtypes at comparable levels (12.1 GSC: 74±2.9% and 38±3.2%, respectively; 22 GSC: 61±11% and 38±2.6%, respectively; 33 GSC: 56±9.5% and 60±7.1%, respectively; 114 GSC: 79± 3.5% and 41±4.3%, respectively). In combination, TTFields (200 kHz) and TMZ showed an additive anti-neoplastic effect with equal efficacy for TTFields in both cell types (i.e., +/- MGMT expression) with no effect on TMZ resistance. This is the first demonstration of the effects of TTFields on cancer stem cells. The expansion of such studies may have clinical implications. PMID:27865821
The Role of Dust Mites in Allergy.

PubMed

Miller, Jeffrey D

2018-06-23

House dust mites are an unsurpassed cause of atopic sensitization and allergic illness throughout the world. The major allergenic dust mites Dermatophagoides pteronyssinus, Dermatophagoides farinae, Euroglyphus maynei, and Blomia tropicalis are eight-legged members of the Arachnid class. Their approximately 3-month lifespan comprises egg, larval, protonymph, tritonymph, and adult stages, with adults, about one fourth to one third of a millimeter in size, being at the threshold of visibility. The geographic and seasonal distributions of dust mites are determined by their need for adequate humidity, while their distribution within substrates is further determined by their avoidance of light. By contacting the epithelium of the eyes, nose, lower airways, skin, and gut, the allergen-containing particles of dust mites can induce sensitization and atopic symptoms in those organs. Various mite allergens, contained primarily in mite fecal particles but also in shed mite exoskeletons and decaying mite body fragments, have properties that include proteolytic activity, homology with the lipopolysaccharide-binding component of Toll-like receptor 4, homology with other invertebrate tropomyosins, and chitin-cleaving and chitin-binding activity. Mite proteases have direct epithelial effects including the breaching of tight junctions and the stimulation of protease-activated receptors, the latter inducing pruritus, epithelial dysfunction, and cytokine release. Other components, including chitin, unmethylated mite and bacterial DNA, and endotoxin, activate pattern recognition receptors of the innate immune system and act as adjuvants promoting sensitization to mite and other allergens. Clinical conditions resulting from mite sensitization and exposure include rhinitis, sinusitis, conjunctivitis, asthma, and atopic dermatitis. Systemic allergy symptoms can also occur from the ingestion of cross-reacting invertebrates, such as shrimp or snail, or from the accidental ingestion of mite-contaminated foods. Beyond their direct importance as a major allergen source, an understanding of dust mites leads to insights into the nature of atopy and of allergic sensitization in general.
Transcription and recombination: when RNA meets DNA.

PubMed

Aguilera, Andrés; Gaillard, Hélène

2014-08-01

A particularly relevant phenomenon in cell physiology and proliferation is the fact that spontaneous mitotic recombination is strongly enhanced by transcription. The most accepted view is that transcription increases the occurrence of double-strand breaks and/or single-stranded DNA gaps that are repaired by recombination. Most breaks would arise as a consequence of the impact that transcription has on replication fork progression, provoking its stalling and/or breakage. Here, we discuss the mechanisms responsible for the cross talk between transcription and recombination, with emphasis on (1) the transcription-replication conflicts as the main source of recombinogenic DNA breaks, and (2) the formation of cotranscriptional R-loops as a major cause of such breaks. The new emerging questions and perspectives are discussed on the basis of the interference between transcription and replication, as well as the way RNA influences genome dynamics. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

Fabrication of microfluidic integrated biosensor

NASA Astrophysics Data System (ADS)

Adam, Tijjani; Dhahi, Th S.; Mohammed, Mohammed; Hashim, U.; Noriman, N. Z.; Dahham, Omar S.

2017-09-01

An event of miniaturizing for sensor systems to carry out biological diagnostics are gaining wade spread acceptance. The system may contain several different sensor units for the detection of specific analyte, the analyte to be detected might be any kind of biological molecules (DNA, mRNA or proteins) or chemical substances. In most cases, the detection is based on receptor-ligand binding like DNA hybridization or antibody-antigen interaction, achieving this on a nanostructure. DNA or protein must be attached to certain locations within the structure. Critical for this is to have a robust binding chemistry to the surface in the microstructure. Here we successfully designed and fabricated microfluidics element for passive fluid delivery into polysilicon Nanowire sensing domain, we further demonstrated a very simple and effective way of integrating the two devices to give full functionalities of laboratory on a single chip. The sensing element was successfully surface modified and tested on real biomedical clinical sample for evaluation and validation.
Wild-type H- and N-Ras promote mutant K-Ras driven tumorigenesis by modulating the DNA damage response

PubMed Central

Grabocka, Elda; Pylayeva-Gupta, Yuliya; Jones, Mathew JK; Lubkov, Veronica; Yemanaberhan, Eyoel; Taylor, Laura; Jeng, Hao Hsuan; Bar-Sagi, Dafna

2014-01-01

SUMMARY Mutations in KRAS are prevalent in human cancers and universally predictive of resistance to anti-cancer therapeutics. Although it is widely accepted that acquisition of an activating mutation endows RAS genes with functional autonomy, recent studies suggest that the wild-type forms of Ras may contribute to mutant Ras-driven tumorigenesis. Here we show that downregulation of wild-type H-Ras or N-Ras in mutant K-Ras cancer cells leads to hyperactivation of the Erk/p90RSK and PI3K/Akt pathways, and consequently, the phosphorylation of Chk1 at an inhibitory site, Ser 280. The resulting inhibition of ATR/Chk1 signaling abrogates the activation of the G2 DNA damage checkpoint and confers specific sensitization of mutant K-Ras cancer cells to DNA damage chemotherapeutic agents in vitro and in vivo. PMID:24525237
How good are indirect tests at detecting recombination in human mtDNA?

PubMed

White, Daniel James; Bryant, David; Gemmell, Neil John

2013-07-08

Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D' and r(2), Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ(2)) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7-70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed.
The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

PubMed

Kasu, Mohaimin; Shires, Karen

2015-07-01

The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DNA-PK assay

DOEpatents

Anderson, Carl W.; Connelly, Margery A.

2004-10-12

The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.
How Good Are Indirect Tests at Detecting Recombination in Human mtDNA?

PubMed Central

White, Daniel James; Bryant, David; Gemmell, Neil John

2013-01-01

Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D′ and r2, Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ2) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7−70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed. PMID:23665874
MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.
MUC1-specific immune therapy generates a strong anti-tumor response in a MUC1-tolerant colon cancer model

PubMed Central

Mukherjee, P.; Pathangey, L.B.; Bradley, J.B.; Tinder, T.L.; Basu, G.D.; Akporiaye, E.T.; Gendler, S.J.

2007-01-01

A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan helper peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-γ-producing CD4+ helper and CD8+ cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced. PMID:17166639
MUC1-specific immune therapy generates a strong anti-tumor response in a MUC1-tolerant colon cancer model.

PubMed

Mukherjee, P; Pathangey, L B; Bradley, J B; Tinder, T L; Basu, G D; Akporiaye, E T; Gendler, S J

2007-02-19

A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan-helper-peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-gamma-producing CD4(+) helper and CD8(+) cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced.
Launching the Greek forensic DNA database. The legal framework and arising ethical issues.

PubMed

Voultsos, Polychronis; Njau, Samuel; Tairis, Nikolaos; Psaroulis, Dimitrios; Kovatsi, Leda

2011-11-01

Since the creation of the first national DNA database in Europe in 1995, many European countries have legislated laws for initiating and regulating their own databases. The Greek government legislated a law in 2008, by which the National DNA Database of Greece was founded and regulated. According to this law, only DNA profiles from convicted criminals were recorded. Nevertheless, a year later, in 2009, the law was amended to permit the creation of an expanded database including innocent people and children. Unfortunately, the new law is very vague in many aspects and does not respect the principle of proportionality. Therefore, according to our opinion, it will soon need to be re-amended. Furthermore, prior to legislating the new law, there was no debate with the community itself in order to clarify what system would best suit Greece and what the citizens would be willing to accept. We present the current legal framework in Greece, we highlight issues that need to be clarified and we discuss possible ethical issues that may arise. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Assessment of the stability of DNA in specimens collected under conditions for drug testing-A pilot study.

PubMed

White, Robert M; Mitchell, John M; Hart, E Dale; Evans, Amy; Meaders, Meredith; Norsworthy, Sarah E; Hayes, Eugene D; Flegel, Ron; Maha, George C; Shaffer, Megan D; Hall, Erin M; Rogers, Kelley

2018-02-01

For forensic biological sample collections, the specimen donor is linked solidly to his or her specimen through a chain of custody (CoC) sometimes referenced as a chain of evidence. Rarely, a donor may deny that a urine or oral fluid (OF) specimen is his or her specimen even with a patent CoC. The goal of this pilot study was to determine the potential effects of short-term storage on the quality and quantity of DNA in both types of specimen under conditions that may be encountered with employment-related drug testing specimens. Fresh urine and freshly collected oral fluid all produced complete STR profiles. For the "pad" type OF collectors, acceptable DNA was extractable both from the buffer/preservative and the pad. Although fresh urine and OF produced complete STR profiles, partial profiles were obtained after storage for most samples. An exception was the DNA in the Quantisal OF collector, from which a complete profile was obtained for both freshly collected OF and stored OF. Copyright © 2017 Elsevier B.V. All rights reserved.
The effects of genetic markers on BTA6 significant for steer feed intake and gain traits on carcass and meat traits

USDA-ARS?s Scientific Manuscript database

Genetic selection for animals that require less feed while still achieving acceptable levels of production could result in substantial cost savings for cattle producers. We have identified DNA markers on bovine chromosome 6 located between 38.16 - 38.38 Mb that were significant for both feed intake ...
Methylation in promoter regions of PITX2 and RASSF1A genes in association with clinicopathological features in breast cancer patients.

PubMed

Jezkova, Eva; Kajo, Karol; Zubor, Pavol; Grendar, Marian; Malicherova, Bibiana; Mendelova, Andrea; Dokus, Karol; Lasabova, Zora; Plank, Lukas; Danko, Jan

2016-10-15

Breast cancer is a heterogeneous disease with very different responses to therapy and different length of survival. In many cases, however, the determination of the stage and histopathological characteristics of breast cancer is insufficient to predict prognosis and response to treatment for the vast heterogeneity of the disease. To understand the molecular signature of subtypes of breast cancer, we attempted to identify the methylation status of key tumour suppressor gene Ras association (RalGDS/AF-6) domain family member 1 isoform a (RASSF1A) and a member of the paired-like homeodomain transcription factor family which functions in left-right asymmetry development (PITX2) and to correlate results with known clinicopathological features of breast cancer. Formalin-fixed, paraffin-embedded (FFPE) tissues of breast carcinomas (n = 149) were used for DNA extraction. DNA was modified by bisulphite conversion. Detection of the methylation level of the genes mentioned above was performed by methylation-sensitive high-resolution melting assay (MS-HRM). Based on MS-HRM results for RASSF1A and PITX2, we subdivided the samples into four groups according to methylation level (≤50 % methylated, >50 % methylated, 100 % methylated and completely unmethylated alleles). All degrees of methylation status for both genes underwent analysis of dependence with known clinicopathological features, and we found significant associations. In 134 of 149 (89.9 %) primary breast carcinomas, the RASSF1A promoter was methylated. Total hypermethylation of PITX2 was observed in 60 of 135 (44.4 %) breast cancer cases. RASSF1A hypermethylation had significant association with increased age (p < 0.05), tumour grade (p < 0.0001) and stage (p < 0.0001) in the 100 % methylated group. There was significant association of PITX2 hypermethylation with tumour grade (p < 0.0001) and stage (p < 0.0001). Association between the methylation level of both investigated genes and tumour type was significant for ductal invasive carcinoma cases only (p < 0.0001). This study shows different levels of heterogeneous methylation acquired by MS-HRM assay of the promoter region of RASSF1A and PITX2 and its relationship with clinicopathological features of 149 breast cancer patients. We noticed that immunohistopathological subtypes of breast cancer contain distinct promoter methylation patterns. All these data suggest that hypermethylation of the CpG island promoters of RASSF1A and PITX2 might play an essential role in the very early stages of breast cancer pathogenesis.
Use of capture-based next-generation sequencing to detect ALK fusion in plasma cell-free DNA of patients with non-small-cell lung cancer.

PubMed

Cui, Shaohua; Zhang, Wei; Xiong, Liwen; Pan, Feng; Niu, Yanjie; Chu, Tianqing; Wang, Huimin; Zhao, Yizhuo; Jiang, Liyan

2017-01-10

Capture-based next-generation sequencing (NGS) is a potentially useful diagnostic method to measure tumor tissue DNA in blood as it can identify concordant mutations between cell-free DNA (cfDNA) and primary tumor DNA in lung cancer patients. In this study, the sensitivity, specificity and accuracy of capture-based NGS for detecting ALK fusion in plasma cfDNA was assessed. 24 patients with tissue ALK-positivity and 15 who did not harbor ALK fusion were enrolled. 13 ALK-positive samples were identified by capture-based NGS among the 24 samples with tissue ALK-positivity. In addition to EML4-ALK, 2 rare fusion types (FAM179A-ALK and COL25A1-ALK) were also identified. The overall sensitivity, specificity and accuracy for all cases were 54.2%, 100% and 71.8%, respectively. For patients without distant metastasis (M0-M1a) and patients with distant metastasis (M1b), the sensitivities were 28.6% and 64.7%, respectively. In the 15 patients who received crizotinib, the estimated median PFS was 9.93 months. Thus, captured-based NGS has acceptable sensitivity and excellent specificity for the detection of ALK fusion in plasma cfDNA, especially for patients with distant metastasis. This non-invasive method is clinically feasible for detecting ALK fusion in patients with advanced-stage NSCLC who cannot undergo traumatic examinations or have insufficient tissue samples for molecular tests.
Localization of DNA and RNA in eosinophil secretory granules.

PubMed

Behzad, Ali R; Walker, David C; Abraham, Thomas; McDonough, John; Mahmudi-Azer, Salahadin; Chu, Fanny; Shaheen, Furquan; Hogg, James C; Paré, Peter D

2010-01-01

Although the accepted paradigm is that the proteins stored in eosinophil crystalloid granules are translated from messenger RNA transcribed in the cell nucleus, recent ultrastructural evidence suggests that protein synthesis may also take place within eosinophilic granules. We used 2 different methods to detect the presence of DNA and RNA in eosinophil secretory granules. Using bromodeoxyuridine, a thymidine analogue, and bromouridine, a uracil analogue, we labeled the DNA and RNA in eosinophils in vivo in rabbits. Immunoelectron microscopy to localize these molecules was performed on ultrathin sections of blood and bone marrow eosinophils using monoclonal anti-bromodeoxyuridine antibody with IgG as a control. The immunogold grain density was measured in each subcellular compartment within the eosinophils and analyzed using image analysis software. A combination of DNA/CD63 immunofluorescence staining and a fluorescently labeled molecular probe that stains RNA was used to examine the presence of DNA and RNA in the secretory granules of human blood eosinophils. The mean density of bromodeoxyuridine-labeled DNA and bromouridine-labeled RNA immunogold grains in the secretory granules of blood and bone marrow eosinophils were significantly higher (p < 0.0005) than cytoplasmic or background staining. We also demonstrated the existence of DNA and RNA in the CD63-positive secretory granules of human peripheral blood eosinophils by means of immunofluorescent staining and a fluorescently labeled molecular probe. These results provide evidence that eosinophil granules are the site of DNA and RNA synthesis and suggest the potential for a new role(s) for eosinophil-secretory granules. Copyright 2009 S. Karger AG, Basel.
Induced DNA demethylation by targeting Ten-Eleven Translocation 2 to the human ICAM-1 promoter

PubMed Central

Chen, Hui; Kazemier, Hinke G; de Groote, Marloes L.; Ruiters, Marcel H. J.; Xu, Guo-Liang; Rots, Marianne G.

2014-01-01

Increasing evidence indicates that active DNA demethylation is involved in several processes in mammals, resulting in developmental stage-specificity and cell lineage-specificity. The recently discovered Ten-Eleven Translocation (TET) dioxygenases are accepted to be involved in DNA demethylation by initiating 5-mC oxidation. Aberrant DNA methylation profiles are associated with many diseases. For example in cancer, hypermethylation results in silencing of tumor suppressor genes. Such silenced genes can be re-expressed by epigenetic drugs, but this approach has genome-wide effects. In this study, fusions of designer DNA binding domains to TET dioxygenase family members (TET1, -2 or -3) were engineered to target epigenetically silenced genes (ICAM-1, EpCAM). The effects on targeted CpGs’ methylation and on expression levels of the target genes were assessed. The results indicated demethylation of targeted CpG sites in both promoters for targeted TET2 and to a lesser extent for TET1, but not for TET3. Interestingly, we observed re-activation of transcription of ICAM-1. Thus, our work suggests that we provided a mechanism to induce targeted DNA demethylation, which facilitates re-activation of expression of the target genes. Furthermore, this Epigenetic Editing approach is a powerful tool to investigate functions of epigenetic writers and erasers and to elucidate consequences of epigenetic marks. PMID:24194590
A new way to contemplate Darwin's tangled bank: how DNA barcodes are reconnecting biodiversity science and biomonitoring.

PubMed

Hajibabaei, Mehrdad; Baird, Donald J; Fahner, Nicole A; Beiko, Robert; Golding, G Brian

2016-09-05

Encompassing the breadth of biodiversity in biomonitoring programmes has been frustrated by an inability to simultaneously identify large numbers of species accurately and in a timely fashion. Biomonitoring infers the state of an ecosystem from samples collected and identified using the best available taxonomic knowledge. The advent of DNA barcoding has now given way to the extraction of bulk DNA from mixed samples of organisms in environmental samples through the development of high-throughput sequencing (HTS). This DNA metabarcoding approach allows an unprecedented view of the true breadth and depth of biodiversity, but its adoption poses two important challenges. First, bioinformatics techniques must simultaneously perform complex analyses of large datasets and translate the results of these analyses to a range of users. Second, the insights gained from HTS need to be amalgamated with concepts such as Linnaean taxonomy and indicator species, which are less comprehensive but more intuitive. It is clear that we are moving beyond proof-of-concept studies to address the challenge of implementation of this new approach for environmental monitoring and regulation. Interpreting Darwin's 'tangled bank' through a DNA lens is now a reality, but the question remains: how can this information be generated and used reliably, and how does it relate to accepted norms in ecosystem study?This article is part of the themed issue 'From DNA barcodes to biomes'. © 2016 The Authors.
Testing the interaction between analytical modules: an example with Roundup Ready® soybean line GTS 40-3-2

PubMed Central

2010-01-01

Background The modular approach to analysis of genetically modified organisms (GMOs) relies on the independence of the modules combined (i.e. DNA extraction and GM quantification). The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR) module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS). Different DNA extraction modules (CTAB, Wizard and Dellaporta), were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%]) containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition) were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT) PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts), the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit) with a magnetic-beads system (i.e. Wizard). PMID:20687918
Non-B DB: a database of predicted non-B DNA-forming motifs in mammalian genomes.

PubMed

Cer, Regina Z; Bruce, Kevin H; Mudunuri, Uma S; Yi, Ming; Volfovsky, Natalia; Luke, Brian T; Bacolla, Albino; Collins, Jack R; Stephens, Robert M

2011-01-01

Although the capability of DNA to form a variety of non-canonical (non-B) structures has long been recognized, the overall significance of these alternate conformations in biology has only recently become accepted en masse. In order to provide access to genome-wide locations of these classes of predicted structures, we have developed non-B DB, a database integrating annotations and analysis of non-B DNA-forming sequence motifs. The database provides the most complete list of alternative DNA structure predictions available, including Z-DNA motifs, quadruplex-forming motifs, inverted repeats, mirror repeats and direct repeats and their associated subsets of cruciforms, triplex and slipped structures, respectively. The database also contains motifs predicted to form static DNA bends, short tandem repeats and homo(purine•pyrimidine) tracts that have been associated with disease. The database has been built using the latest releases of the human, chimp, dog, macaque and mouse genomes, so that the results can be compared directly with other data sources. In order to make the data interpretable in a genomic context, features such as genes, single-nucleotide polymorphisms and repetitive elements (SINE, LINE, etc.) have also been incorporated. The database is accessed through query pages that produce results with links to the UCSC browser and a GBrowse-based genomic viewer. It is freely accessible at http://nonb.abcc.ncifcrf.gov.
A new way to contemplate Darwin's tangled bank: how DNA barcodes are reconnecting biodiversity science and biomonitoring

PubMed Central

Baird, Donald J.; Fahner, Nicole A.; Beiko, Robert; Golding, G. Brian

2016-01-01

Encompassing the breadth of biodiversity in biomonitoring programmes has been frustrated by an inability to simultaneously identify large numbers of species accurately and in a timely fashion. Biomonitoring infers the state of an ecosystem from samples collected and identified using the best available taxonomic knowledge. The advent of DNA barcoding has now given way to the extraction of bulk DNA from mixed samples of organisms in environmental samples through the development of high-throughput sequencing (HTS). This DNA metabarcoding approach allows an unprecedented view of the true breadth and depth of biodiversity, but its adoption poses two important challenges. First, bioinformatics techniques must simultaneously perform complex analyses of large datasets and translate the results of these analyses to a range of users. Second, the insights gained from HTS need to be amalgamated with concepts such as Linnaean taxonomy and indicator species, which are less comprehensive but more intuitive. It is clear that we are moving beyond proof-of-concept studies to address the challenge of implementation of this new approach for environmental monitoring and regulation. Interpreting Darwin's ‘tangled bank’ through a DNA lens is now a reality, but the question remains: how can this information be generated and used reliably, and how does it relate to accepted norms in ecosystem study? This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481782

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

PubMed

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Radiation physics and chemistry of biomolecules. Recent developments

NASA Astrophysics Data System (ADS)

Spotheim-Maurizot, Melanie

2016-11-01

A chapter of the book ;Radiation chemistry. From basics to application in materials and life sciences (EDP Science, Paris, France, 2008); was devoted to the state-of-the-art in the research on ionizing radiation (IR) effects on biomolecules. An update, eight years later, seemed pertinent enough to the editors of this journal who accepted to dedicate a Special Issue to the latest developments in this area of high interest for cancer radiotherapy, nuclear workers' radioprotection and food radiosterilisation. We sincerely thank them and the authors who accepted to present reviews of their most recent work. Obviously, only a small part of the research in the fascinating domain of molecular radiobiology can be covered here. Some articles are presenting the contribution of biophysical models and computational techniques to the understanding of IR effects on molecules such as DNA and proteins, or on larger systems such as chromatin, chromosomes and even cells (Nikjoo et al., Štěpán & Davídková, Ballarini & Carante, and Nikitaki et al.). In these papers, as well as in many others, several qualities of IR are compared in order to explain the observed differences of effects. The damages induced by the low energy electrons and new techniques involved in their study are discussed in great detail (Sanche and Fromm & Boulanouar). The chemistry behind the IR induced damages (single or clustered), studied in many laboratories around the world is presented in several papers (Cadet & Wagner, Sevilla et al., Chatgilialoglu et al., and Greenberg). One of them addresses a very useful comparison between the effects of IR and UV exposure on DNA (Ravanat & Douki). The majority of the papers in this Special Issue is dealing with DNA and this reflects the real situation: damages of DNA are more studied than those of other biomolecules. This is due to the role of DNA as main support of hereditary information. Nevertheless, more and more studies are outlining the influence of epigenetic factors on mutagenesis and cell death. Therefore the development of research on effects of IR on partners of DNA such as proteins is necessary. Some papers presented here are already discussing the IR effects on some proteins and protein-DNA complexes (Scuderi et al., Rodacka et al., and Bury et al.). Concerning the damages of DNA, the enzyme-driven repair processes taking place in the cell are of crucial importance for cell faith. New techniques such as the single molecule fluorescence imaging (Lee & Wallace) are applied to the study of repair process. The possible use of nanoparticles as radiomodifiers is discussed in two papers (Krokosz et al. and Brun & Sicard-Roselli).
DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase.

PubMed

Graham, Brian W; Tao, Yeqing; Dodge, Katie L; Thaxton, Carly T; Olaso, Danae; Young, Nicolas L; Marshall, Alan G; Trakselis, Michael A

2016-06-10

The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5-30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Mitochondrial DNA: An Endogenous Trigger for Immune Paralysis.

PubMed

Schäfer, Simon T; Franken, Lars; Adamzik, Michael; Schumak, Beatrix; Scherag, André; Engler, Andrea; Schönborn, Niels; Walden, Jennifer; Koch, Susanne; Baba, Hideo A; Steinmann, Jörg; Westendorf, Astrid M; Fandrey, Joachim; Bieber, Thomas; Kurts, Christian; Frede, Stilla; Peters, Jürgen; Limmer, Andreas

2016-04-01

Critically ill patients are at high risk to suffer from sepsis, even in the absence of an initial infectious source, but the molecular mechanisms for their increased sepsis susceptibility, including a suppressed immune system, remain unclear. Although microbes and pathogen-associated molecular pattern are accepted inducers of sepsis and septic immunosuppression, the role of endogenous Toll-like receptor (TLR) ligands, such as mitochondrial DNA (mtDNA), in altering the immune response is unknown. Mitochondrial DNA serum concentrations of the mitochondrial genes D-Loop and adenosine triphosphatase 6 were determined (quantitative polymerase chain reaction) in 165 septic patients and 50 healthy volunteers. Furthermore, cytotoxic T-cell activity was analyzed in wild-type and TLR9 knockout mice, with/without previous mtDNA administration, followed by injection of an ovalbumin-expressing adenoviral vector. Mitochondrial DNA serum concentrations were increased in septic patients (adenosine triphosphatase 6, 123-fold; D-Loop, 76-fold, P < 0.0001) compared with volunteers. Furthermore, a single mtDNA injection caused profound, TLR9-dependent immunosuppression of adaptive T-cell cytotoxicity in wild-type but not in TLR9 knockout mice and evoked various immunosuppressive mechanisms including the destruction of the splenic microstructure, deletion of cross-presenting dendritic cells, and up-regulation of programmed cell death ligand 1 and indoleamine 2,3-dioxygenase. Several of these findings in mice were mirrored in septic patients, and mtDNA concentrations were associated with an increased 30-day mortality. The findings of this study imply that mtDNA, an endogenous danger associated molecular pattern, is a hitherto unknown inducer of septic immunoparalysis and one possible link between initial inflammation and subsequent immunosuppression in critically ill patients.
Pro-oxidant Induced DNA Damage in Human Lymphoblastoid Cells: Homeostatic Mechanisms of Genotoxic Tolerance

PubMed Central

Seager, Anna L.

2012-01-01

Oxidative stress contributes to many disease etiologies including ageing, neurodegeneration, and cancer, partly through DNA damage induction (genotoxicity). Understanding the i nteractions of free radicals with DNA is fundamental to discern mutation risks. In genetic toxicology, regulatory authorities consider that most genotoxins exhibit a linear relationship between dose and mutagenic response. Yet, homeostatic mechanisms, including DNA repair, that allow cells to tolerate low levels of genotoxic exposure exist. Acceptance of thresholds for genotoxicity has widespread consequences in terms of understanding cancer risk and regulating human exposure to chemicals/drugs. Three pro-oxidant chemicals, hydrogen peroxide (H2O2), potassium bromate (KBrO3), and menadione, were examined for low dose-response curves in human lymphoblastoid cells. DNA repair and antioxidant capacity were assessed as possible threshold mechanisms. H2O2 and KBrO3, but not menadione, exhibited thresholded responses, containing a range of nongenotoxic low doses. Levels of the DNA glycosylase 8-oxoguanine glycosylase were unchanged in response to pro- oxidant stress. DNA repair–focused gene expression arrays reported changes in ATM and BRCA1, involved in double-strand break repair, in response to low-dose pro-oxidant exposure; however, these alterations were not substantiated at the protein level. Determination of oxidatively induced DNA damage in H2O2-treated AHH-1 cells reported accumulation of thymine glycol above the genotoxic threshold. Further, the H2O2 dose-response curve was shifted by modulating the antioxidant glutathione. Hence, observed pro- oxidant thresholds were due to protective capacities of base excision repair enzymes and antioxidants against DNA damage, highlighting the importance of homeostatic mechanisms in “genotoxic tolerance.” PMID:22539617
DNA-testing for BRCA1/2 prior to genetic counselling in patients with breast cancer: design of an intervention study, DNA-direct.

PubMed

Sie, Aisha S; Spruijt, Liesbeth; van Zelst-Stams, Wendy A G; Mensenkamp, Arjen R; Ligtenberg, Marjolijn J; Brunner, Han G; Prins, Judith B; Hoogerbrugge, Nicoline

2012-05-08

Current practice for patients with breast cancer referred for genetic counseling, includes face-to-face consultations with a genetic counselor prior to and following DNA-testing. This is based on guidelines regarding Huntington's disease in anticipation of high psychosocial impact of DNA-testing for mutations in BRCA1/2 genes. The initial consultation covers generic information regarding hereditary breast cancer and the (im)possibilities of DNA-testing, prior to such testing. Patients with breast cancer may see this information as irrelevant or unnecessary because individual genetic advice depends on DNA-test results. Also, verbal information is not always remembered well by patients. A different format for this information prior to DNA-testing is possible: replacing initial face-to-face genetic counseling (DNA-intake procedure) by telephone, written and digital information sent to patients' homes (DNA-direct procedure). In this intervention study, 150 patients with breast cancer referred to the department of Clinical Genetics of the Radboud University Nijmegen Medical Centre are given the choice between two procedures, DNA-direct (intervention group) or DNA-intake (usual care, control group). During a triage telephone call, patients are excluded if they have problems with Dutch text, family communication, or of psychological or psychiatric nature. Primary outcome measures are satisfaction and psychological distress. Secondary outcome measures are determinants for the participant's choice of procedure, waiting and processing times, and family characteristics. Data are collected by self-report questionnaires at baseline and following completion of genetic counseling. A minority of participants will receive an invitation for a 30 min semi-structured telephone interview, e.g. confirmed carriers of a BRCA1/2 mutation, and those who report problems with the procedure. This study compares current practice of an intake consultation (DNA-intake) to a home informational package of telephone, written and digital information (DNA-direct) prior to DNA-testing in patients with breast cancer. The aim is to determine whether DNA-direct is an acceptable procedure for BRCA1/2 testing, in order to provide customized care to patients with breast cancer, cutting down on the period of uncertainty during this diagnostic process.
Acceptability of self-collection sampling for HPV-DNA testing in low-resource settings: a mixed methods approach.

PubMed

Bansil, Pooja; Wittet, Scott; Lim, Jeanette L; Winkler, Jennifer L; Paul, Proma; Jeronimo, Jose

2014-06-12

Vaginal self-sampling with HPV-DNA tests is a promising primary screening method for cervical cancer. However, women's experiences, concerns and the acceptability of such tests in low-resource settings remain unknown. In India, Nicaragua, and Uganda, a mixed-method design was used to collect data from surveys (N = 3,863), qualitative interviews (N = 72; 20 providers and 52 women) and focus groups (N = 30 women) on women's and providers' experiences with self-sampling, women's opinions of sampling at home, and their future needs. Among surveyed women, 90% provided a self- collected sample. Of these, 75% reported it was easy, although 52% were initially concerned about hurting themselves and 24% were worried about not getting a good sample. Most surveyed women preferred self-sampling (78%). However it was not clear if they responded to the privacy of self-sampling or the convenience of avoiding a pelvic examination, or both. In follow-up interviews, most women reported that they didn't mind self-sampling, but many preferred to have a provider collect the vaginal sample. Most women also preferred clinic-based screening (as opposed to home-based self-sampling), because the sample could be collected by a provider, women could receive treatment if needed, and the clinic was sanitary and provided privacy. Self-sampling acceptability was higher when providers prepared women through education, allowed women to examine the collection brush, and were present during the self-collection process. Among survey respondents, aids that would facilitate self-sampling in the future were: staff help (53%), additional images in the illustrated instructions (31%), and a chance to practice beforehand with a doll/model (26%). Self-and vaginal-sampling are widely acceptable among women in low-resource settings. Providers have a unique opportunity to educate and prepare women for self-sampling and be flexible in accommodating women's preference for self-sampling.
mtDNA variation in the Yanomami: evidence for additional New World founding lineages.

PubMed

Easton, R D; Merriwether, D A; Crews, D E; Ferrell, R E

1996-07-01

Native Americans have been classified into four founding haplogroups with as many as seven founding lineages based on mtDNA RFLPs and DNA sequence data. mtDNA analysis was completed for 83 Yanomami from eight villages in the Surucucu and Catrimani Plateau regions of Roraima in northwestern Brazil. Samples were typed for 15 polymorphic mtDNA sites (14 RFLP sites and 1 deletion site), and a subset was sequenced for both hypervariable regions of the mitochondrial D-loop. Substantial mitochondrial diversity was detected among the Yanomami, five of seven accepted founding haplotypes and three others were observed. Of the 83 samples, 4 (4.8%) were lineage B1, 1 (1.2%) was lineage B2, 31 (37.4%) were lineage C1, 29 (34.9%) were lineage C2, 2 (2.4%) were lineage D1, 6 (7.2%) were lineage D2, 7 (8.4%) were a haplotype we designated "X6," and 3 (3.6%) were a haplotype we designated "X7." Sequence analysis found 43 haplotypes in 50 samples. B2, X6, and X7 are previously unrecognized mitochondrial founding lineage types of Native Americans. The widespread distribution of these haplotypes in the New World and Asia provides support for declaring these lineages to be New World founding types.
mtDNA variation in the Yanomami: evidence for additional New World founding lineages.

PubMed Central

Easton, R. D.; Merriwether, D. A.; Crews, D. E.; Ferrell, R. E.

1996-01-01

Native Americans have been classified into four founding haplogroups with as many as seven founding lineages based on mtDNA RFLPs and DNA sequence data. mtDNA analysis was completed for 83 Yanomami from eight villages in the Surucucu and Catrimani Plateau regions of Roraima in northwestern Brazil. Samples were typed for 15 polymorphic mtDNA sites (14 RFLP sites and 1 deletion site), and a subset was sequenced for both hypervariable regions of the mitochondrial D-loop. Substantial mitochondrial diversity was detected among the Yanomami, five of seven accepted founding haplotypes and three others were observed. Of the 83 samples, 4 (4.8%) were lineage B1, 1 (1.2%) was lineage B2, 31 (37.4%) were lineage C1, 29 (34.9%) were lineage C2, 2 (2.4%) were lineage D1, 6 (7.2%) were lineage D2, 7 (8.4%) were a haplotype we designated "X6," and 3 (3.6%) were a haplotype we designated "X7." Sequence analysis found 43 haplotypes in 50 samples. B2, X6, and X7 are previously unrecognized mitochondrial founding lineage types of Native Americans. The widespread distribution of these haplotypes in the New World and Asia provides support for declaring these lineages to be New World founding types. PMID:8659527
Genomic instability in human cancer: Molecular insights and opportunities for therapeutic attack and prevention through diet and nutrition

PubMed Central

Ferguson, Lynnette R.; Chen, Helen; Collins, Andrew R.; Connell, Marisa; Damia, Giovanna; Dasgupta, Santanu; Malhotra, Meenakshi; Meeker, Alan K.; Amedei, Amedeo; Amin, Amr; Ashraf, S. Salman; Aquilano, Katia; Azmi, Asfar S.; Bhakta, Dipita; Bilsland, Alan; Boosani, Chandra S.; Chen, Sophie; Ciriolo, Maria Rosa; Fujii, Hiromasa; Guha, Gunjan; Halicka, Dorota; Helferich, William G.; Keith, W. Nicol; Mohammed, Sulma I.; Niccolai, Elena; Yang, Xujuan; Honoki, Kanya; Parslow, Virginia R.; Prakash, Satya; Rezazadeh, Sarallah; Shackelford, Rodney E.; Sidransky, David; Tran, Phuoc T.; Yang, Eddy S.; Maxwell, Christopher A.

2015-01-01

Genomic instability can initiate cancer, augment progression, and influence the overall prognosis of the affected patient. Genomic instability arises from many different pathways, such as telomere damage, centrosome amplification, epigenetic modifications, and DNA damage from endogenous and exogenous sources, and can be perpetuating, or limiting, through the induction of mutations or aneuploidy, both enabling and catastrophic. Many cancer treatments induce DNA damage to impair cell division on a global scale but it is accepted that personalized treatments, those that are tailored to the particular patient and type of cancer, must also be developed. In this review, we detail the mechanisms from which genomic instability arises and can lead to cancer, as well as treatments and measures that prevent genomic instability or take advantage of the cellular defects caused by genomic instability. In particular, we identify and discuss five priority targets against genomic instability: (1) prevention of DNA damage; (2) enhancement of DNA repair; (3) targeting deficient DNA repair; (4) impairing centrosome clustering; and, (5) inhibition of telomerase activity. Moreover, we highlight vitamin D and B, selenium, carotenoids, PARP inhibitors, resveratrol, and isothiocyanates as priority approaches against genomic instability. The prioritized target sites and approaches were cross validated to identify potential synergistic effects on a number of important areas of cancer biology. PMID:25869442
Evolutionary history of continental southeast Asians: "early train" hypothesis based on genetic analysis of mitochondrial and autosomal DNA data.

PubMed

Jinam, Timothy A; Hong, Lih-Chun; Phipps, Maude E; Stoneking, Mark; Ameen, Mahmood; Edo, Juli; Saitou, Naruya

2012-11-01

The population history of the indigenous populations in island Southeast Asia is generally accepted to have been shaped by two major migrations: the ancient "Out of Africa" migration ∼50,000 years before present (YBP) and the relatively recent "Out of Taiwan" expansion of Austronesian agriculturalists approximately 5,000 YBP. The Negritos are believed to have originated from the ancient migration, whereas the majority of island Southeast Asians are associated with the Austronesian expansion. We determined 86 mitochondrial DNA (mtDNA) complete genome sequences in four indigenous Malaysian populations, together with a reanalysis of published autosomal single-nucleotide polymorphism (SNP) data of Southeast Asians to test the plausibility and impact of those migration models. The three Austronesian groups (Bidayuh, Selatar, and Temuan) showed high frequencies of mtDNA haplogroups, which originated from the Asian mainland ∼30,000-10,000 YBP, but low frequencies of "Out of Taiwan" markers. Principal component analysis and phylogenetic analysis using autosomal SNP data indicate a dichotomy between continental and island Austronesian groups. We argue that both the mtDNA and autosomal data suggest an "Early Train" migration originating from Indochina or South China around the late-Pleistocene to early-Holocene period, which predates, but may not necessarily exclude, the Austronesian expansion.
Canadian women's attitudes toward noninvasive prenatal testing of fetal DNA in maternal plasma (.).

PubMed

Pariente, Gali; Hasan, Lara; Gadot, Yifat; De Souza, Leanne R; Lebovic, Gerald; Berger, Howard

2016-12-01

To determine the perceptions and attitudes of Canadian women to Noninvasive Prenatal Testing of fetal DNA. A designed questionnaire was administered to women attending the outpatient antenatal clinic at a tertiary urban hospital. Attitudes to current and new prenatal screening modalities were assessed using a five-point Likert scale. Bowker's test of symmetry was used to compare individual responses regarding the two screening modalities. Changes in women's responses pre- and post-delivery were also compared. One hundred and twenty-nine women were enrolled in this study. 88% of women state that they would perform prenatal screening via fetal DNA in the maternal plasma if available. When compared to conventional screening, significantly less women believe that the NIPT should be available upon request for non-medical traits (36.4% versus 60.4%, p < 0.001). When compared to their answer before delivery, more women agreed that screening with fetal DNA in maternal plasma could be used in a negative way to select for desired non-medical traits such as gender. The use of fetal DNA in the maternal plasma is widely accepted in our Canadian population as a future method of noninvasive prenatal screening despite recognition of certain ethical concerns. This information can be used when implementing new genetic screening programs.
A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.

PubMed

Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A

2001-02-01

Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.
National Marrow Donor Program

DTIC Science & Technology

2008-11-17

Accepted for oral presentation. o Bojesen SE, Malkki M, Gooley T, Zhao LP, Selvakumar A, Spellman S, Petersdorf E, Hansen JA and Dupont B. Genetic allelic...Oudshoorn M, Petersdorf E, Setterholm M, Champlin R and de Lima M. The clinical significance of matching for alleles at the low expression HLA loci...Reaction DMSO Dimethylsulphoxide PSA Public Service Announcement DNA Deoxyribonucleic Acid QC Quality control D/ R Donor/Recipient RCC Renal Cell
Human DNA extraction from whole saliva that was fresh or stored for 3, 6 or 12 months using five different protocols

PubMed Central

GARBIERI, Thais Francini; BROZOSKI, Daniel Thomas; DIONÍSIO, Thiago José; SANTOS, Carlos Ferreira; NEVES, Lucimara Teixeira das

2017-01-01

Abstract Saliva when compared to blood collection has the following advantages: it requires no specialized personnel for collection, allows for remote collection by the patient, is painless, well accepted by participants, has decreased risks of disease transmission, does not clot, can be frozen before DNA extraction and possibly has a longer storage time. Objective and Material and Methods This study aimed to compare the quantity and quality of human DNA extracted from saliva that was fresh or frozen for three, six and twelve months using five different DNA extraction protocols: protocol 1 – Oragene™ commercial kit, protocol 2 – QIAamp DNA mini kit, protocol 3 – DNA extraction using ammonium acetate, protocol 4 – Instagene™ Matrix and protocol 5 – Instagene™ Matrix diluted 1:1 using proteinase K and 1% SDS. Briefly, DNA was analyzed using spectrophotometry, electrophoresis and PCR. Results Results indicated that time spent in storage typically decreased the DNA quantity with the exception of protocol 1. The purity of DNA was generally not affected by storage times for the commercial based protocols, while the purity of the DNA samples extracted by the noncommercial protocols typically decreased when the saliva was stored longer. Only protocol 1 consistently extracted unfragmented DNA samples. In general, DNA samples extracted through protocols 1, 2, 3 and 4, regardless of storage time, were amplified by human specific primers whereas protocol 5 produced almost no samples that were able to be amplified by human specific primers. Depending on the protocol used, it was possible to extract DNA in high quantities and of good quality using whole saliva, and furthermore, for the purposes of DNA extraction, saliva can be reliably stored for relatively long time periods. Conclusions In summary, a complicated picture emerges when taking into account the extracted DNA’s quantity, purity and quality; depending on a given researchers needs, one protocol’s particular strengths and costs might be the deciding factor for its employment. PMID:28403355
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

PubMed

Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

2004-09-01

Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Gliomatosis cerebri type II: two case reports

PubMed Central

D’Urso, Pietro Ivo; Marsigliante, Santo; Storelli, Carlo; Distante, Alessandro; Sanguedolce, Francesca; Cimmino, Antonia; Luzi, Giuseppe; Gianfreda, Cosimo Damiano; Montinaro, Antonio; Ciappetta, Pasqualino

2009-01-01

Introduction Two types of gliomatosis cerebri exist: Type I and Type II. We report the results of a histological and genetic study of two cases of gliomatosis cerebri Type II, correlating these results with therapy and prognosis. Case presentation Two patients, a 52-year-old man (Patient 1) and a 76-year-old man (Patient 2) with gliomatosis cerebri II were admitted to our institution; they underwent surgical treatment and received radiotherapy and chemotherapy. At the 24-month follow-up, Patient 1 was still alive, while Patient 2 had died. The poor prognosis of Patient 2 was underlined by molecular analysis which showed that the angiogenesis related genes VCAM1 and VEGF were overexpressed, reflecting the high degree of neovascularization. Conclusion Genes involved in drug resistance and metallothioneins were highly expressed in Patient 2 and this, associated with unmethylated O6-methylguanine methyltransferase, can explain the lack of response to chemotherapy. PMID:19830138
DNA barcoding: an efficient tool to overcome authentication challenges in the herbal market.

PubMed

Mishra, Priyanka; Kumar, Amit; Nagireddy, Akshitha; Mani, Daya N; Shukla, Ashutosh K; Tiwari, Rakesh; Sundaresan, Velusamy

2016-01-01

The past couple of decades have witnessed global resurgence of herbal-based health care. As a result, the trade of raw drugs has surged globally. Accurate and fast scientific identification of the plant(s) is the key to success for the herbal drug industry. The conventional approach is to engage an expert taxonomist, who uses a mix of traditional and modern techniques for precise plant identification. However, for bulk identification at industrial scale, the process is protracted and time-consuming. DNA barcoding, on the other hand, offers an alternative and feasible taxonomic tool box for rapid and robust species identification. For the success of DNA barcode, the barcode loci must have sufficient information to differentiate unambiguously between closely related plant species and discover new cryptic species. For herbal plant identification, matK, rbcL, trnH-psbA, ITS, trnL-F, 5S-rRNA and 18S-rRNA have been used as successful DNA barcodes. Emerging advances in DNA barcoding coupled with next-generation sequencing and high-resolution melting curve analysis have paved the way for successful species-level resolution recovered from finished herbal products. Further, development of multilocus strategy and its application has provided new vistas to the DNA barcode-based plant identification for herbal drug industry. For successful and acceptable identification of herbal ingredients and a holistic quality control of the drug, DNA barcoding needs to work harmoniously with other components of the systems biology approach. We suggest that for effectively resolving authentication challenges associated with the herbal market, DNA barcoding must be used in conjunction with metabolomics along with need-based transcriptomics and proteomics. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Novel quantitative real-time LCR for the sensitive detection of SNP frequencies in pooled DNA: method development, evaluation and application.

PubMed

Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

2011-01-19

Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.
Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

PubMed Central

Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

2011-01-01

Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

Positive view and increased likely uptake of follow-up testing with analysis of cell-free fetal DNA as alternative to invasive testing among Danish pregnant women.

PubMed

Miltoft, Caroline B; Rode, Line; Tabor, Ann

2018-05-01

The aim of this study was to investigate the attitude (view, likely uptake and preferred strategy) towards cell-free fetal DNA (cfDNA) testing among pregnant women before a first-trimester risk assessment for trisomy 21 (unselected women) and after obtaining a high risk. Unselected and high-risk women attending first-trimester screening (Rigshospitalet, Copenhagen University Hospital) were invited to fill out the questionnaire Antenatal testing for Down syndrome as an online survey. The survey included 203 unselected and 50 high-risk women (response rates of 74.8% and 84.7%, respectively). Nearly all considered cfDNA testing a positive development in antenatal care, and 97.2% would like it to be offered. Offering cfDNA testing as an alternative to invasive testing would increase the uptake of follow-up testing compared with invasive testing alone (98.8% vs. 90.7%, p < 0.001). Women who would only accept follow up by cfDNA testing were more likely to continue an affected pregnancy (30.0% vs. 3.6%, p < 0.001) or have doubts about termination (50.0% vs. 32.1%, p < 0.001). Offering cfDNA testing would likely increase the uptake of follow-up testing without a corresponding rise in the termination rate of affected fetuses as some women test for information only. However, both unselected and high-risk women had overwhelmingly positive views underlining attention to avoid routinization. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
Defiant: (DMRs: easy, fast, identification and ANnoTation) identifies differentially Methylated regions from iron-deficient rat hippocampus.

PubMed

Condon, David E; Tran, Phu V; Lien, Yu-Chin; Schug, Jonathan; Georgieff, Michael K; Simmons, Rebecca A; Won, Kyoung-Jae

2018-02-05

Identification of differentially methylated regions (DMRs) is the initial step towards the study of DNA methylation-mediated gene regulation. Previous approaches to call DMRs suffer from false prediction, use extreme resources, and/or require library installation and input conversion. We developed a new approach called Defiant to identify DMRs. Employing Weighted Welch Expansion (WWE), Defiant showed superior performance to other predictors in the series of benchmarking tests on artificial and real data. Defiant was subsequently used to investigate DNA methylation changes in iron-deficient rat hippocampus. Defiant identified DMRs close to genes associated with neuronal development and plasticity, which were not identified by its competitor. Importantly, Defiant runs between 5 to 479 times faster than currently available software packages. Also, Defiant accepts 10 different input formats widely used for DNA methylation data. Defiant effectively identifies DMRs for whole-genome bisulfite sequencing (WGBS), reduced-representation bisulfite sequencing (RRBS), Tet-assisted bisulfite sequencing (TAB-seq), and HpaII tiny fragment enrichment by ligation-mediated PCR-tag (HELP) assays.
New arylated benzo[h]quinolines induce anti-cancer activity by oxidative stress-mediated DNA damage.

PubMed

Yadav, Dharmendra K; Rai, Reeta; Kumar, Naresh; Singh, Surjeet; Misra, Sanjeev; Sharma, Praveen; Shaw, Priyanka; Pérez-Sánchez, Horacio; Mancera, Ricardo L; Choi, Eun Ha; Kim, Mi-Hyun; Pratap, Ramendra

2016-12-06

The anti-cancer activity of the benzo[h]quinolines was evaluated on cultured human skin cancer (G361), lung cancer (H460), breast cancer (MCF7) and colon cancer (HCT116) cell lines. The inhibitory effect of these compounds on the cell growth was determined by the MTT assay. The compounds 3e, 3f, 3h and 3j showed potential cytotoxicity against these human cancer cell lines. Effect of active compounds on DNA oxidation and expression of apoptosis related gene was studied. We also developed a quantitative method to measure the activity of cyclin-dependent kinases-2 (CDK2) by western blotting in the presence of active compound. In addition, molecular docking revealed that benzo[h]quinolines can correctly dock into the hydrophobic pocket of the targets receptor protein aromatase and CDK2, while their bioavailability/drug-likeness was predicted to be acceptable but requires future optimization. These findings reveal that benzo[h]quinolines act as anti-cancer agents by inducing oxidative stress-mediated DNA damage.
Focus on Fotemustine.

PubMed

De Rossi, A; Rossi, L; Laudisi, A; Sini, V; Toppo, L; Marchesi, F; Tortorelli, G; Leti, M; Turriziani, M; Aquino, A; Bonmassar, E; De Vecchis, L; Torino, F

2006-12-01

Fotemustine is a cytotoxic alkylating agent, belonging to the group of nitrosourea family. Its mechanism of action is similar to that of other nitrosoureas, characterized by a mono-functional/bi-functional alkylating activity. Worth of consideration is the finding that the presence of high levels of the DNA repair enzyme O6-methylguanine-DNA-methyltransferase (MGMT) in cancer cells confers drug resistance. In different clinical trials Fotemustine showed a remarkable antitumor activity as single agent, and in association with other antineoplastic compounds or treatment modalities. Moreover, its toxicity is generally considered acceptable. The drug has been employed in the treatment of metastatic melanoma, and, on the basis of its pharmacokinetic properties, in brain tumors, either primitive or metastatic. Moreover, Fotemustine shows pharmacodynamic properties similar to those of mono-functional alkylating compounds (e.g. DNA methylating drugs, such as Temozolomide), that have been recently considered for the management of acute refractory leukaemia. Therefore, it is reasonable to assume that this agent could be a good candidate to play a potential role in haematological malignancies.
Curriculum and course materials for a forensic DNA biology course.

PubMed

Elkins, Kelly M

2014-01-01

The Forensic Science Education Programs Accreditation Commission (FEPAC) requires accredited programs offer a "coherent curriculum" to ensure each student gains a "thorough grounding of the natural…sciences." Part of this curriculum includes completion of a minimum of 15 semester-hours forensic science coursework, nine of which can involve a class in forensic DNA biology. Departments that have obtained or are pursuing FEPAC accreditation can meet this requirement by offering a stand-alone forensic DNA biology course; however, materials necessary to instruct students are often homegrown and not standardized; in addition, until recently, the community lacked commercially available books, lab manuals, and teaching materials, and many of the best pedagogical resources were scattered across various peer-reviewed journals. The curriculum discussed below is an attempt to synthesize this disparate information, and although certainly not the only acceptable methodology, the below discussion represents "a way" for synthesizing and aggregating this information into a cohesive, comprehensive whole. Copyright © 2013 by The International Union of Biochemistry and Molecular Biology.
On the Prevalence of M. avium Subspecies paratuberculosis DNA in the Blood of Healthy Individuals and Patients with Inflammatory Bowel Disease

PubMed Central

Juste, Ramon A.; Elguezabal, Natalia; Garrido, Joseba M.; Pavon, Andres; Geijo, Maria V.; Sevilla, Iker; Cabriada, Jose-Luis; Tejada, Angel; García-Campos, Francisco; Casado, Roberto; Ochotorena, Itziar; Izeta, Ander; Greenstein, Robert J.

2008-01-01

Background Mycobacteria, such as M. leprae and M. tuberculosis infect billions of humans. However, because of appropriate immune responses and antibiotic therapy, overt mycobacterial diseases occur far less frequently. M. avium subspecies paratuberculosis (MAP) causes Johne's disease in ruminants, an affliction evocative of inflammatory bowel disease (IBD). Several agents used to treat IBD (5-ASA, methotrexate, azathioprine and its metabolite 6-MP) have recently been shown to be antiMAP antibiotics. We herein evaluate the prevalence of MAP DNA in healthy individuals and compare them with IBD patients on antiMAP antibiotics. Methods We studied 100 healthy individuals (90 blood donors) and 246 patients with IBD. IS900 MAP DNA was identified using a nested primer PCR in the buffy coat of blood. Positive signal was confirmed as MAP by DNA sequence analysis. PCR positive results frequencies were compared according to medications used. Significance was accepted at p<0.05. Results 47% (47/100) healthy controls and 16% (40/246) IBD patients were IS900 positive (p<0.0001). MAP DNA was identified in 17% of 143 patients receiving mesalamine and 6% of 16 receiving sulfasalazine. None of the IBD patients receiving methotrexate (n = 9), 6-MP (n = 3), ciprofloxacin (n = 5) or Tacrolimus® (n = 3) had MAP DNA detectable in their blood. Discussion We found a disquietingly large percentage of healthy individuals have MAP DNA in their blood, the significance of which remains to be determined. Counter-intuitively, the incidence of MAP DNA was significantly lower in patients with IBD. Agents with the most potent in vitro antiMAP activity were associated with clearance of blood MAP DNA. We posit that the use antiMAP antibiotics was responsible for the decreased prevalence of MAP DNA in patients with IBD. PMID:18596984
The comet assay in human biomonitoring.

PubMed

Anderson, Diana; Dhawan, Alok; Laubenthal, Julian

2013-01-01

Human biomonitoring studies aim to identify potential exposures to environmental, occupational, or lifestyle toxicants in human populations and are commonly used by public health decision makers to predict disease risk. The Comet assay measures changes in genomic stability and is one of the most reliable biomarkers to indicate early biological effects, and therefore accepted by various governmental regulatory agencies. The appeal of the Comet assay lies in its relative simplicity, rapidity, sensitivity, and economic efficiency. Furthermore, the assay is known for its broad versatility, as it can be applied to virtually any human cell and easily adapted in order to detect particular biomarkers of interest, such as DNA repair capacity or single- and double-strand breaks. In a standard experiment, isolated single cells are first embedded in agarose, and then lysed in high-salt solutions in order to remove all cellular contents except the DNA attached to a nuclear scaffold. Subsequent electrophoresis results in accumulation of undamaged DNA sequences at the proximity of the nuclear scaffold, while damaged sequences migrate towards the anode. When visualized with fluorochromes, these migrated DNA fragments resemble a comet tail and can be quantified for their intensity and shape according to internationally drafted guidelines.
Kinetics of large-scale chromosomal movement during asymmetric cell division in Escherichia coli

PubMed Central

Männik, Jaana; O’Neill, Jordan C.

2017-01-01

Coordination between cell division and chromosome replication is essential for a cell to produce viable progeny. In the commonly accepted view, Escherichia coli realize this coordination via the accurate positioning of its cell division apparatus relative to the nucleoids. However, E. coli lacking proper positioning of its cell division planes can still successfully propagate. Here, we characterize how these cells partition their chromosomes into daughters during such asymmetric divisions. Using quantitative time-lapse imaging, we show that DNA translocase, FtsK, can pump as much as 80% (3.7 Mb) of the chromosome between daughters at an average rate of 1700±800 bp/s. Pauses in DNA translocation are rare, and in no occasions did we observe reversals at experimental time scales of a few minutes. The majority of DNA movement occurs at the latest stages of cell division when the cell division protein ZipA has already dissociated from the septum, and the septum has closed to a narrow channel with a diameter much smaller than the resolution limit of the microscope (~250 nm). Our data suggest that the narrow constriction is necessary for effective translocation of DNA by FtsK. PMID:28234902
Searching for statistically significant regulatory modules.

PubMed

Bailey, Timothy L; Noble, William Stafford

2003-10-01

The regulatory machinery controlling gene expression is complex, frequently requiring multiple, simultaneous DNA-protein interactions. The rate at which a gene is transcribed may depend upon the presence or absence of a collection of transcription factors bound to the DNA near the gene. Locating transcription factor binding sites in genomic DNA is difficult because the individual sites are small and tend to occur frequently by chance. True binding sites may be identified by their tendency to occur in clusters, sometimes known as regulatory modules. We describe an algorithm for detecting occurrences of regulatory modules in genomic DNA. The algorithm, called mcast, takes as input a DNA database and a collection of binding site motifs that are known to operate in concert. mcast uses a motif-based hidden Markov model with several novel features. The model incorporates motif-specific p-values, thereby allowing scores from motifs of different widths and specificities to be compared directly. The p-value scoring also allows mcast to only accept motif occurrences with significance below a user-specified threshold, while still assigning better scores to motif occurrences with lower p-values. mcast can search long DNA sequences, modeling length distributions between motifs within a regulatory module, but ignoring length distributions between modules. The algorithm produces a list of predicted regulatory modules, ranked by E-value. We validate the algorithm using simulated data as well as real data sets from fruitfly and human. http://meme.sdsc.edu/MCAST/paper
Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli.

PubMed

Kalmárová, Markéta; Smirnov, Evgeny; Masata, Martin; Koberna, Karel; Ligasová, Anna; Popov, Alexey; Raska, Ivan

2007-10-01

It is widely accepted that chromosomes occupy more or less fixed positions in mammalian interphase nucleus. However, relation between large-scale order of chromosome positioning and gene activity remains unclear. We used the model of the human ribosomal genes to address specific aspects of this problem. Ribosomal genes are organized at particular chromosomal sites in clusters termed nucleolus organizer regions (NORs). Only some NORs, called competent are generally accepted to be transcriptionally active during interphase. Importantly in this respect, the regularities in distribution of competent, and non-competent NORs among the specific chromosomes were already established in two human-derived cell lines: transformed HeLa and primary LEP cells. In the present study, using FISH and immunocytochemistry, we found that in HeLa and LEP cells the large-scale positioning of the NOR-bearing chromosomes with regard to nucleoli is linked to the transcription activity of rDNA. Namely, the tendency of rDNA-bearing chromosomes to associate with nucleoli correlates with the number of transcriptionally competent NORs in the respective chromosome homologs. Regarding the position of NORs, we found that not only competent but also most of the non-competent NORs are included in the nucleoli. Some intranucleolar NORs (supposedly non-competent) are situated on elongated chromatin protrusions connecting nucleoli with respective chromosome territories spatially distanced from nucleoli.
Quantitative PCR and disaccharide profiling to characterize the animal origin of low-molecular-weight heparins.

PubMed

Houiste, Céline; Auguste, Cécile; Macrez, Céline; Dereux, Stéphanie; Derouet, Angélique; Anger, Pascal

2009-02-01

Low-molecular-weight heparins (LMWHs) are widely used in the management of thrombosis and acute coronary syndromes. They are obtained by the enzymatic or chemical depolymerization of porcine intestinal heparin. Enoxaparin sodium, a widely used LMWH, has a unique and reproducible oligosaccharide profile which is determined by the origin of the starting material and a tightly controlled manufacturing process. Although other enoxaparin-like LMWHs do exist, specific release criteria including the origin of the crude heparin utilized for their production, have not been established. A quantitative polymerase chain reaction method has been developed to ensure the purity of the porcine origin of crude heparin, with a DNA detection limit as low as 1 ppm for bovine, or 10 ppm for ovine contaminants. This method is routinely used as the release acceptance criterion during enoxaparin sodium manufacturing. Furthermore, when the process removes DNA, other analytical techniques can be used to assess any contamination. Disaccharide profiling after exhaustive depolymerization can determine the presence of at least 10% bovine or 20% ovine material; multivariate analysis is useful to perform the data analysis. Consistent with the availability of newer technology, these methods should be required as acceptance criteria for crude heparins used in the manufacture of LMWHs to ensure their safety, quality, and immunologic profile.
Individual variations in the correlation between erythemal threshold, UV-induced DNA damage and sun-burn cell formation.

PubMed

Heenen, M; Giacomoni, P U; Golstein, P

2001-10-01

A linear correlation between erythema intensity and DNA damage upon exposure to UV has not been firmly established. Many of the deleterious effects of UV exposure do occur after exposure to suberythemal doses. After DNA damage, cells undergo DNA repair. It is commonly accepted that when the burden of damage is beyond the repair capacities, the cell undergoes programmed cell death or apoptosis. The aim of this study is to quantify the amount of UV-induced DNA damage (estimated via the measurement of DNA repair or unscheduled DNA synthesis or UDS) and cellular damage (estimated via the determination of the density of sunburn cells or SBC). If DNA damage and erythema are correlated, similar intensity of UDS and similar density of SBC should be found in volunteers irradiated with a UV dose equal to two minimal erythema doses (MED). Our results show that in 15 different individuals the same relative dose (2 MEDs) provokes UDS values, which vary within a factor of 4. An even larger variability affects SBC counts after the same relative dose. When DNA damage or SBC are plotted versus the absolute dose (i.e. the dose expressed in J/m(2)), there is a rough correlation (with several exceptions) between dose and extent of UDS and SBC counts. It seems possible to divide the volunteers into two subpopulations with different susceptibilities to UV damage. It is well known that UDS and SBC measurements are often affected by large experimental indeterminacy, yet, the analysis of our results makes it plausible to suggest that for the triggering of erythema, a common threshold value for DNA damage or for SBC count are not to be found. In conclusion, the erythema response seems to be loosely correlated with DNA damage. This suggests that the protection offered by the sunscreens against DNA damage, the molecular basis of UV-induced mutagenesis, might not be related to the sun protection factor (SPF) indicated on the label of sunscreens, which is evaluated using the erythema as an endpoint.
Genetic Fingerprinting Using Microsatellite Markers in a Multiplex PCR Reaction: A Compilation of Methodological Approaches from Primer Design to Detection Systems.

PubMed

Krüger, Jacqueline; Schleinitz, Dorit

2017-01-01

Microsatellites are polymorphic DNA loci comprising repeated sequence motifs of two to five base pairs which are dispersed throughout the genome. Genotyping of microsatellites is a widely accepted tool for diagnostic and research purposes such as forensic investigations and parentage testing, but also in clinics (e.g. monitoring of bone marrow transplantation), as well as for the agriculture and food industries. The co-amplification of several short tandem repeat (STR) systems in a multiplex reaction with simultaneous detection helps to obtain more information from a DNA sample where its availability may be limited. Here, we introduce and describe this commonly used genotyping technique, providing an overview on available resources on STRs, multiplex design, and analysis.
Authentication of Herbal Supplements Using Next-Generation Sequencing

PubMed Central

Braukmann, Thomas W. A.; Borisenko, Alex V.; Zakharov, Evgeny V.

2016-01-01

Background DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious. Methods We utilized Sanger and Next-Generation Sequencing (NGS) for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components. Results All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven–by NGS). NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components. Conclusion Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should involve an interdisciplinary approach taking into account the processes involved in production of herbal supplements, as well as biocomplexity of plant-plant and plant-fungal biological interactions. PMID:27227830
Authentication of Herbal Supplements Using Next-Generation Sequencing.

PubMed

Ivanova, Natalia V; Kuzmina, Maria L; Braukmann, Thomas W A; Borisenko, Alex V; Zakharov, Evgeny V

2016-01-01

DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious. We utilized Sanger and Next-Generation Sequencing (NGS) for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components. All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven-by NGS). NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components. Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should involve an interdisciplinary approach taking into account the processes involved in production of herbal supplements, as well as biocomplexity of plant-plant and plant-fungal biological interactions.
Likelihood ratio and posterior odds in forensic genetics: Two sides of the same coin.

PubMed

Caliebe, Amke; Walsh, Susan; Liu, Fan; Kayser, Manfred; Krawczak, Michael

2017-05-01

It has become widely accepted in forensics that, owing to a lack of sensible priors, the evidential value of matching DNA profiles in trace donor identification or kinship analysis is most sensibly communicated in the form of a likelihood ratio (LR). This restraint does not abate the fact that the posterior odds (PO) would be the preferred basis for returning a verdict. A completely different situation holds for Forensic DNA Phenotyping (FDP), which is aimed at predicting externally visible characteristics (EVCs) of a trace donor from DNA left behind at the crime scene. FDP is intended to provide leads to the police investigation helping them to find unknown trace donors that are unidentifiable by DNA profiling. The statistical models underlying FDP typically yield posterior odds (PO) for an individual possessing a certain EVC. This apparent discrepancy has led to confusion as to when LR or PO is the appropriate outcome of forensic DNA analysis to be communicated to the investigating authorities. We thus set out to clarify the distinction between LR and PO in the context of forensic DNA profiling and FDP from a statistical point of view. In so doing, we also addressed the influence of population affiliation on LR and PO. In contrast to the well-known population dependency of the LR in DNA profiling, the PO as obtained in FDP may be widely population-independent. The actual degree of independence, however, is a matter of (i) how much of the causality of the respective EVC is captured by the genetic markers used for FDP and (ii) by the extent to which non-genetic such as environmental causal factors of the same EVC are distributed equally throughout populations. The fact that an LR should be communicated in cases of DNA profiling whereas the PO are suitable for FDP does not conflict with theory, but rather reflects the immanent differences between these two forensic applications of DNA information. Copyright © 2017 Elsevier B.V. All rights reserved.
Evidence of authentic DNA from Danish Viking Age skeletons untouched by humans for 1,000 years.

PubMed

Melchior, Linea; Kivisild, Toomas; Lynnerup, Niels; Dissing, Jørgen

2008-05-28

Given the relative abundance of modern human DNA and the inherent impossibility for incontestable proof of authenticity, results obtained on ancient human DNA have often been questioned. The widely accepted rules regarding ancient DNA work mainly affect laboratory procedures, however, pre-laboratory contamination occurring during excavation and archaeological-/anthropological handling of human remains as well as rapid degradation of authentic DNA after excavation are major obstacles. We avoided some of these obstacles by analyzing DNA from ten Viking Age subjects that at the time of sampling were untouched by humans for 1,000 years. We removed teeth from the subjects prior to handling by archaeologists and anthropologists using protective equipment. An additional tooth was removed after standard archaeological and anthropological handling. All pre-PCR work was carried out in a "clean- laboratory" dedicated solely to ancient DNA work. Mitochondrial DNA was extracted and overlapping fragments spanning the HVR-1 region as well as diagnostic sites in the coding region were PCR amplified, cloned and sequenced. Consistent results were obtained with the "unhandled" teeth and there was no indication of contamination, while the latter was the case with half of the "handled" teeth. The results allowed the unequivocal assignment of a specific haplotype to each of the subjects, all haplotypes being compatible in their character states with a phylogenetic tree drawn from present day European populations. Several of the haplotypes are either infrequent or have not been observed in modern Scandinavians. The observation of haplogroup I in the present study (<2% in modern Scandinavians) supports our previous findings of a pronounced frequency of this haplogroup in Viking and Iron Age Danes. The present work provides further evidence that retrieval of ancient human DNA is a possible task provided adequate precautions are taken and well-considered sampling is applied.
Evidence of Authentic DNA from Danish Viking Age Skeletons Untouched by Humans for 1,000 Years

PubMed Central

Melchior, Linea; Kivisild, Toomas; Lynnerup, Niels; Dissing, Jørgen

2008-01-01

Background Given the relative abundance of modern human DNA and the inherent impossibility for incontestable proof of authenticity, results obtained on ancient human DNA have often been questioned. The widely accepted rules regarding ancient DNA work mainly affect laboratory procedures, however, pre-laboratory contamination occurring during excavation and archaeological-/anthropological handling of human remains as well as rapid degradation of authentic DNA after excavation are major obstacles. Methodology/Principal Findings We avoided some of these obstacles by analyzing DNA from ten Viking Age subjects that at the time of sampling were untouched by humans for 1,000 years. We removed teeth from the subjects prior to handling by archaeologists and anthropologists using protective equipment. An additional tooth was removed after standard archaeological and anthropological handling. All pre-PCR work was carried out in a “clean- laboratory” dedicated solely to ancient DNA work. Mitochondrial DNA was extracted and overlapping fragments spanning the HVR-1 region as well as diagnostic sites in the coding region were PCR amplified, cloned and sequenced. Consistent results were obtained with the “unhandled” teeth and there was no indication of contamination, while the latter was the case with half of the “handled” teeth. The results allowed the unequivocal assignment of a specific haplotype to each of the subjects, all haplotypes being compatible in their character states with a phylogenetic tree drawn from present day European populations. Several of the haplotypes are either infrequent or have not been observed in modern Scandinavians. The observation of haplogroup I in the present study (<2% in modern Scandinavians) supports our previous findings of a pronounced frequency of this haplogroup in Viking and Iron Age Danes. Conclusion The present work provides further evidence that retrieval of ancient human DNA is a possible task provided adequate precautions are taken and well-considered sampling is applied. PMID:18509537
Genomic Diversity and the Microenvironment as Drivers of Progression in DCIS

DTIC Science & Technology

2016-10-01

been acquiring new skills in medical image analysis and learning about the complexities of breast cancer diagnosis. How were the results...database and medical record searching at Duke, 2) Development of methods for isolating DNA from archival DCIS lesions, 3) Deep and comprehensive...on the Aim 3 results to the SPIE Medical Imaging Conference to be held in February 2017. If accepted, those will each be published in the form of a
Evaluation of the in vitro antioxidant activity of Mangifera indica L. extract (Vimang).

PubMed

Martínez, G; Delgado, R; Pérez, G; Garrido, G; Núñez Sellés, A J; León, O S

2000-09-01

An extract of Mangifera indica L. (Vimang) was tested in vitro for its antioxidant activity using commonly accepted assays. It showed a powerful scavenger activity of hydroxyl radicals and hypochlorous acid and acted as an iron chelator. The extract also showed a significant inhibitory effect on the peroxidation of rat-brain phospholipid and inhibited DNA damage by bleomycin or copper-phenanthroline systems. Copyright 2000 John Wiley & Sons, Ltd.

An assessment of scientific and technical aspects of closed investigations of canine forensics DNA – case series from the University of California, Davis, USA

PubMed Central

Scharnhorst, Günther; Kanthaswamy, Sree

2011-01-01

Aim To describe and assess the scientific and technical aspects of animal forensic testing at the University of California, Davis. The findings and recommendations contained in this report are designed to assess the past, evaluate the present, and recommend reforms that will assist the animal forensic science community in providing the best possible services that comply with court standards and bear judicial scrutiny. Methods A batch of 32 closed files of domestic dog DNA cases processed at the University of California, Davis, between August 2003 and July 2005 were reviewed in this study. The case files comprised copies of all original paperwork, copies of the cover letter or final report, laboratory notes, notes on analyses, submission forms, internal chains of custody, printed images and photocopies of evidence, as well as the administrative and technical reviews of those cases. Results While the fundamental aspects of animal DNA testing may be reliable and acceptable, the scientific basis for forensic testing animal DNA needs to be improved substantially. In addition to a lack of standardized and validated genetic testing protocols, improvements are needed in a wide range of topics including quality assurance and quality control measures, sample handling, evidence testing, statistical analysis, and reporting. Conclusion This review implies that although a standardized panel of short tandem repeat and mitochondrial DNA markers and publicly accessible genetic databases for canine forensic DNA analysis are already available, the persistent lack of supporting resources, including standardized quality assurance and quality control programs, still plagues the animal forensic community. This report focuses on closed cases from the period 2003-2005, but extends its scope more widely to include other animal DNA forensic testing services. PMID:21674824
An assessment of scientific and technical aspects of closed investigations of canine forensics DNA--case series from the University of California, Davis, USA.

PubMed

Scharnhorst, Günther; Kanthaswamy, Sree

2011-06-01

To describe and assess the scientific and technical aspects of animal forensic testing at the University of California, Davis. The findings and recommendations contained in this report are designed to assess the past, evaluate the present, and recommend reforms that will assist the animal forensic science community in providing the best possible services that comply with court standards and bear judicial scrutiny. A batch of 32 closed files of domestic dog DNA cases processed at the University of California, Davis, between August 2003 and July 2005 were reviewed in this study. The case files comprised copies of all original paperwork, copies of the cover letter or final report, laboratory notes, notes on analyses, submission forms, internal chains of custody, printed images and photocopies of evidence, as well as the administrative and technical reviews of those cases. While the fundamental aspects of animal DNA testing may be reliable and acceptable, the scientific basis for forensic testing animal DNA needs to be improved substantially. In addition to a lack of standardized and validated genetic testing protocols, improvements are needed in a wide range of topics including quality assurance and quality control measures, sample handling, evidence testing, statistical analysis, and reporting. This review implies that although a standardized panel of short tandem repeat and mitochondrial DNA markers and publicly accessible genetic databases for canine forensic DNA analysis are already available, the persistent lack of supporting resources, including standardized quality assurance and quality control programs, still plagues the animal forensic community. This report focuses on closed cases from the period 2003-2005, but extends its scope more widely to include other animal DNA forensic testing services.
Glutathione modified CdTe quantum dots as a label for studying DNA interactions with platinum based cytostatics.

PubMed

Ryvolova, Marketa; Smerkova, Kristyna; Chomoucka, Jana; Hubalek, Jaromir; Adam, Vojtech; Kizek, Rene

2013-03-01

Cisplatin, carboplatin, and oxaliplatin represent three generations of platinum based drugs applied successfully for cancer treatment. As a consequence of the employment of platinum based cytostatics in the cancer treatment, it became necessary to study the mechanism of their action. Current accepted opinion is the formation of Pt-DNA adducts, but the mechanism of their formation is still unclear. Nanomaterials, as a progressively developing branch, can offer a tool for studying the interactions of these drugs with DNA. In this study, fluorescent CdTe quantum dots (QDs, λem = 525 nm) were employed to investigate the interactions of platinum cytostatics (cisplatin, carboplatin, and oxaliplatin) with DNA fragment (500 bp, c = 25 μg/mL). Primarily, the fluorescent behavior of QDs in the presence of platinum cytostatics was monitored and major differences in the interaction of QDs with tested drugs were observed. It was found that the presence of carboplatin (c = 0.25 mg/mL) had no significant influence on QDs fluorescence; however cisplatin and oxaliplatin quenched the fluorescence significantly (average decrease of 20%) at the same concentration. Subsequently, the amount of platinum incorporated in DNA was determined by QDs fluorescence quenching. Best results were reached using oxaliplatin (9.4% quenching). Linear trend (R(2) = 0.9811) was observed for DNA platinated by three different concentrations of oxaliplatin (0.250, 0.125, and 0.063 mg/mL). Correlation with differential pulse voltammetric measurements provided linear trend (R(2) = 0.9511). As a conclusion, especially in the case of oxaliplatin-DNA adducts, the quenching was the most significant compared to cisplatin and nonquenching carboplatin. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography.

PubMed

Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali

2016-09-01

Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Site-Specific Integration of Foreign DNA into Minimal Bacterial and Human Target Sequences Mediated by a Conjugative Relaxase

PubMed Central

Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen

2012-01-01

Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089
Where is DNA preserved in soil organic matter?

NASA Astrophysics Data System (ADS)

Zaccone, Claudio; Beneduce, Luciano; Plaza, César

2015-04-01

Deoxyribonucleic acid (DNA) consists of long chains of alternating sugar and phosphate residues twisted in the form of a helix. Upon decomposition of plant and animal debris, this nucleic acid is released into the soil, where its fate is still not completely understood. In fact, although DNA is one of the organic compounds from living cells that is apparently broken down rapidly in soils, it is also potentially capable of being incorporated in (or interact with) the precursors of humic molecules. In order to track DNA occurrence in soil organic matter (SOM) fractions, an experiment was set up as a randomized complete block design with two factors, namely biochar addition and organic amendment. In particular, biochar (BC), applied at a rate of 20 t/ha, was combined with municipal solid waste compost (BC+MC) at a rate equivalent to 75 kg/ha of potentially available N, and with sewage sludge (BC+SS) at a rate equivalent to 75 kg/ha of potentially available N. Using a physical fractionation method, free SOM located between aggregates (unprotected C pool; FR), SOM occluded within macroaggregates (C pool weakly protected by physical mechanisms; MA), SOM occluded within microaggregates (C pool strongly protected by physical mechanisms; MI), and SOM associated with the mineral fractions (chemically-protected C pool; MIN) were separated from soil samples. DNA was then isolated from each fraction of the two series, as well as from the unamended soil (C) and from the bulk soils (WS), using Powersoil DNA isolation kit (MoBio, CA, USA) with a modified protocol. Data clearly show that the DNA survived the SOM fractionation, thus suggesting that physical fractionation methods create less artifacts compared to the chemical ones. Moreover, in both BC+MC and BC+SS series, most of the isolated DNA was present in the FR fraction, followed by the MA and the MI fractions. No DNA was recovered from the MIN fraction. This finding supports the idea that most of the DNA occurring in the SOM is unprotected or physically protected, with a short-to-medium mean residence time. Finally, the DNA isolated showed, in all cases, an acceptable level of degradation that makes it suitable for further analyses by PCR.
Potential Noncutaneous Sites of Chelonid Herpesvirus 5 Persistence and Shedding in Green Sea Turtles Chelonia mydas.

PubMed

Page-Karjian, Annie; Gottdenker, Nicole L; Whitfield, Jordyn; Herbst, Lawrence; Norton, Terry M; Ritchie, Branson

2017-09-01

Chelonid herpesvirus 5 (ChHV5), the likely etiologic agent of sea turtle fibropapillomatosis (FP), is predicted to be unevenly distributed within an infected turtle, in which productive virus replication and virion shedding occurs in cutaneous tumor keratinocytes. In this study, we measured and compared ChHV5 DNA quantities in tumors, skin, urine, major organs, and nervous tissue samples from green turtles Chelonia mydas. These samples were taken from the carcasses of 10 juvenile green turtles with and without clinical signs of FP that stranded in Florida during 2014. Quantitative PCR for ChHV5 UL30 was used to identify ChHV5 DNA in tumors, skin, heart, kidney, nerves, and urine sampled from five out of five FP-positive and three out of five FP-free turtles. The most frequently co-occurring sites were cutaneous tumor and kidney (n = 4). Novel data presented here include the identification of ChHV5 DNA in kidney, heart, and nerve samples from three FP-free turtles. These data support candidate nontumored anatomic sites of ChHV5 DNA localization and mobilization during two different disease states that may be involved in the ChHV5 infection cycle. Received September 8, 2016; accepted April 17, 2017.
Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

PubMed Central

Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

1995-01-01

Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723
DNA analysis in the case of Kaspar Hauser.

PubMed

Weichhold, G M; Bark, J E; Korte, W; Eisenmenger, W; Sullivan, K M

1998-01-01

In 1828 a mysterious young man appeared in Nürnberg, Germany, who was barely able to speak or walk but could write down his name, Kaspar Hauser. He quickly became the centre of social interest but also the victim of intrigue. His appearance, his origin and assassination in 1833 were, and still are, the source of much debate. The most widely accepted theory postulates that Kaspar Hauser was the son of Grand Duke Carl von Baden and his wife Stephanie de Beauharnais, an adopted daughter of Napoleon Bonaparte. To check this theory, DNA analysis was performed on the clothes most likely worn by Kaspar Hauser when he was stabbed on December 14th, 1833. A suitable bloodstain from the underpants was divided and analysed independently by the Institute of Legal Medicine, University of Munich (ILM) and the Forensic Science Service Laboratory, Birmingham (FSS). Mitochondrial DNA (mtDNA) was sequenced from the bloodstain and from blood samples obtained from two living maternal relatives of Stephanie de Beauharnais. The sequence from the bloodstained clothing differed from the sequence found in both reference blood samples at seven confirmed positions. This proves that the bloodstain does not originate from a son of Stephanie de Beauharnais. Thus, it is becoming clear that Kaspar Hauser was not the Prince of Baden.
Brain effect of insulin and clonazepam in diabetic rats under depressive-like behavior.

PubMed

Wayhs, Carlos Alberto Yasin; Mescka, Caroline Paula; Vanzin, Camila Simioni; Ribas, Graziela Schmitt; Guerreiro, Gilian; Nin, Maurício Schüler; Manfredini, Vanusa; Barros, Helena Maria Tannhauser; Vargas, Carmen Regla

2013-12-01

Diabetes mellitus is characterized by hyperglycemia resulting from defects on insulin secretion, insulin action, or both. It has recently become clear that the central nervous system is not spared from the deleterious effects of diabetes, since diabetic encephalopathy was recognized as a complication of this heterogeneous metabolic disorder. There is a well recognized association between depression and diabetes, once prevalence of depression in diabetic patients is higher than in general population, and clonazepam is being used to treat this complication. Oxidative stress is widely accepted as playing a key mediatory role in the development and progression of diabetes and its complications. In this work we analyzed DNA damage by comet assay and lipid damage in prefrontal cortex, hippocampus and striatum of streptozotocin-induced diabetic rats submitted to the forced swimming test. It was verified that the diabetic group presented DNA and lipid damage in the brain areas evaluated, when compared to the control groups. Additionally, a significant reduction of the DNA and lipid damage in animals treated with insulin and/or clonazepam was observed. These data suggest that the association of these two drugs could protect against DNA and lipid damage in diabetic rats submitted to the forced swimming test, an animal model of depression.
Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

PubMed

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Liver function and DNA integrity in hepatocytes of rats evaluated after treatments with strawberry tree (Arbutus unedo L.) water leaf extract and arbutin.

PubMed

Jurica, Karlo; Benković, Vesna; Sikirić, Sunčana; Kopjar, Nevenka; Brčić Karačonji, Irena

2018-06-07

Due to their beneficial health effects, strawberry tree (Arbutus unedo L.) leaves have for decades been used as herbal remedy in countries of the Mediterranean region. This pilot study is the first to investigate the liver function and DNA integrity in rat hepatocytes evaluated after 14 and 28 day treatments with strawberry tree water leaf extract and arbutin, administered per os to Lewis rats of both genders at a daily dose 200 mg/kg b.w. We focused on two types of biomarkers: enzyme serum markers of liver function (AST, ALT, and LDH), and primary DNA damage in the liver cells, which was estimated using the alkaline comet assay. At the tested dose, strawberry tree water leaf extract showed acceptable biocompatibility with liver tissue both in male and female rats, especially after shorter exposure. Our results also suggest that oral administration of single arbutin to rats was not associated with significant impairments either in the liver function or DNA integrity in hepatocytes. Considering that prolonged exposure to the tested compounds revealed minor changes in the studied biomarkers, future in vivo studies have to further clarify the biological and physiological relevance of these findings.
[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

PubMed

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Thalassospira povalilytica sp. nov., a polyvinyl-alcohol-degrading marine bacterium.

PubMed

Nogi, Yuichi; Yoshizumi, Masaki; Miyazaki, Masayuki

2014-04-01

A polyvinyl-alcohol-degrading marine bacterium was isolated from plastic rope litter found in Tokyo Bay, Japan. The isolated strain, Zumi 95(T), was a Gram-reaction-negative, non-spore-forming and facultatively anaerobic chemo-organotroph. The major respiratory quinone was Q-10. The predominant fatty acids were C18 : 1ω7c and C16 : 0. On the basis of 16S rRNA gene sequence analysis, the isolated strain was closely affiliated with members of the genus Thalassospira in the class Alphaproteobacteria. The DNA G+C content of the novel strain was 55.1 mol%. The hybridization values for DNA-DNA relatedness between this strain and four reference strains representing species of the genus Thalassospira were significantly lower than that accepted as the phylogenetic definition of a species. On the basis of differences in taxonomic characteristics, the isolated strain represents a novel species of the genus Thalassospira for which the name Thalassospira povalilytica sp. nov. (type strain Zumi 95(T) = JCM 18746(T) = DSM 26719(T)) is proposed.
Minors or suspects? A discussion of the legal and ethical issues surrounding the indefinite storage of DNA collected from children aged 10-18 years on the National DNA Database in England and Wales.

PubMed

Mansel, Charlotte; Davies, Sharon

2012-10-01

There are currently over 250,000 children between the ages of 10 and 18 years who have their genetic information stored on the National DNA Database. This paper explores the legal and ethical issues surrounding this controversial subject, with particular focus on juvenile capacity and the potential results of criminalizing young children and adolescents. The implications of the adverse legal judgement of the European Court of Human Rights in S and Marper v UK (2008) and the violation of Article 8 of the Convention are discussed. The authors have considered the requirement to balance the rights of the individual, particularly those of minors, against the need to protect the public and have compared the position in Scotland to that of the rest of the UK. The authors conclude that a more ethically acceptable alternative could be the creation of a separate forensic database for children aged 10-18 years, set up to safeguard the interests of those who have not been convicted of any crime.
Phylogeography of Arenaria balearica L. (Caryophyllaceae): evolutionary history of a disjunct endemic from the Western Mediterranean continental islands.

PubMed

Bobo-Pinilla, Javier; Barrios de León, Sara B; Seguí Colomar, Jaume; Fenu, Giuseppe; Bacchetta, Gianluigi; Peñas de Giles, Julio; Martínez-Ortega, María Montserrat

2016-01-01

Although it has been traditionally accepted that Arenaria balearica (Caryophyllaceae) could be a relict Tertiary plant species, this has never been experimentally tested. Nor have the palaeohistorical reasons underlying the highly fragmented distribution of the species in the Western Mediterranean region been investigated. We have analysed AFLP data (213) and plastid DNA sequences (226) from a total of 250 plants from 29 populations sampled throughout the entire distribution range of the species in Majorca, Corsica, Sardinia, and the Tuscan Archipelago. The AFLP data analyses indicate very low geographic structure and population differentiation. Based on plastid DNA data, six alternative phylogeographic hypotheses were tested using Approximate Bayesian Computation (ABC). These analyses revealed ancient area fragmentation as the most probable scenario, which is in accordance with the star-like topology of the parsimony network that suggests a pattern of long term survival and subsequent in situ differentiation. Overall low levels of genetic diversity and plastid DNA variation were found, reflecting evolutionary stasis of a species preserved in locally long-term stable habitats.
Linking Specific Heterotrophic Bacterial Populations to Bioreduction of Uranium and Nitrate in Contaminated Subsurface Sediments by Using Stable Isotope Probing▿†

PubMed Central

Akob, Denise M.; Kerkhof, Lee; Küsel, Kirsten; Watson, David B.; Palumbo, Anthony V.; Kostka, Joel E.

2011-01-01

Shifts in terminal electron-accepting processes during biostimulation of uranium-contaminated sediments were linked to the composition of stimulated microbial populations using DNA-based stable isotope probing. Nitrate reduction preceded U(VI) and Fe(III) reduction in [13C]ethanol-amended microcosms. The predominant, active denitrifying microbial groups were identified as members of the Betaproteobacteria, whereas Actinobacteria dominated under metal-reducing conditions. PMID:21948831
DNA Microarray-Based Identification of Genes Controlled by Autoinducer 2-Stimulated Quorum Sensing in Escherichia Coli

DTIC Science & Technology

2001-09-01

and pathogenicity in Erwinia carotovora (rsmA) (12). Additionally, csrA has been documented to affect cell size and surface properties, which is in...machinery to cell wall 13.1 b1502 Putative adhesin; similar to FimH protein 13.0 tap Methyl-accepting chemotaxis protein IV, peptide sensor receptor...oxohexanoyl)-L-homoserine lactone 5246 DELISA ET AL. J. BACTERIOL. regulates carbapenem antibiotic production in Erwinia carotovora . Biochem. J. 288:997
A molecular model for proflavine-DNA intercalation.

PubMed Central

Neidle, S; Pearl, L H; Herzyk, P; Berman, H M

1988-01-01

A molecular model has been derived for the intercalation of proflavine into the CpG site of the decamer duplex of d(GATACGATAC). The starting geometry of the intercalation site was taken from previous crystallographic studies on the d(CpG)-proflavine complex, and molecular mechanics used to obtain a stereochemically acceptable structure. This has widened grooves compared to standard A- or B- double helices, as well as distinct conformational, roll, twist and tilt features. PMID:3174439
Molecular Biological Studies on the Biogenesis of Human Cholinesterases In Vivo and as Directed by Cloned Cholinesterase DNA Sequences

DTIC Science & Technology

1989-04-01

serves as an accepted marker for developing mouse megakaryocytes (89). Furthermore, adminis- tration of ACh analogues as well as ChE inhibitors has...induction of megakaryocytopoiesis and production of platelets in the mouse , we further searched for such phenomena in non-leukemic patients with platelet...as hepatocytes , muscle fibers, endothelial cells and lymphocytes (16). The role of this enzyme _n all of these sites is completely unknown. In

Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli

PubMed Central

Kalmárová, Markéta; Smirnov, Evgeny; Mašata, Martin; Koberna, Karel; Ligasová, Anna; Popov, Alexey; Raška, Ivan

2007-01-01

It is widely accepted that chromosomes occupy more or less fixed positions in mammalian interphase nucleus. However, relation between large-scale order of chromosome positioning and gene activity remains unclear. We used the model of the human ribosomal genes to address specific aspects of this problem. Ribosomal genes are organized at particular chromosomal sites in clusters termed nucleolus organizer regions (NORs). Only some NORs, called competent are generally accepted to be transcriptionally active during interphase. Importantly in this respect, the regularities in distribution of competent, and non-competent NORs among the specific chromosomes were already established in two human-derived cell lines: transformed HeLa and primary LEP cells. In the present study, using FISH and immunocytochemistry, we found that in HeLa and LEP cells the large-scale positioning of the NOR-bearing chromosomes with regard to nucleoli is linked to the transcription activity of rDNA. Namely, the tendency of rDNA-bearing chromosomes to associate with nucleoli correlates with the number of transcriptionally competent NORs in the respective chromosome homologs. Regarding the position of NORs, we found that not only competent but also most of the non-competent NORs are included in the nucleoli. Some intranucleolar NORs (supposedly non-competent) are situated on elongated chromatin protrusions connecting nucleoli with respective chromosome territories spatially distanced from nucleoli. PMID:17698369
Complete Biallelic Insulation at the H19/Igf2 Imprinting Control Region Position Results in Fetal Growth Retardation and Perinatal Lethality

PubMed Central

Lee, Dong-Hoon; Singh, Purnima; Tsark, Walter M. K.; Szabó, Piroska E.

2010-01-01

Background The H19/Igf2 imprinting control region (ICR) functions as an insulator exclusively in the unmethylated maternal allele, where enhancer-blocking by CTCF protein prevents the interaction between the Igf2 promoter and the distant enhancers. DNA methylation inhibits CTCF binding in the paternal ICR allele. Two copies of the chicken β-globin insulator (ChβGI)2 are capable of substituting for the enhancer blocking function of the ICR. Insulation, however, now also occurs upon paternal inheritance, because unlike the H19 ICR, the (ChβGI)2 does not become methylated in fetal male germ cells. The (ChβGI)2 is a composite insulator, exhibiting enhancer blocking by CTCF and chromatin barrier functions by USF1 and VEZF1. We asked the question whether these barrier proteins protected the (ChβGI)2 sequences from methylation in the male germ line. Methodology/Principal Findings We genetically dissected the ChβGI in the mouse by deleting the binding sites USF1 and VEZF1. The methylation of the mutant versus normal (ChβGI)2 significantly increased from 11% to 32% in perinatal male germ cells, suggesting that the barrier proteins did have a role in protecting the (ChβGI)2 from methylation in the male germ line. Contrary to the H19 ICR, however, the mutant (mChβGI)2 lacked the potential to attain full de novo methylation in the germ line and to maintain methylation in the paternal allele in the soma, where it consequently functioned as a biallelic insulator. Unexpectedly, a stricter enhancer blocking was achieved by CTCF alone than by a combination of the CTCF, USF1 and VEZF1 sites, illustrated by undetectable Igf2 expression upon paternal transmission. Conclusions/Significance In this in vivo model, hypomethylation at the ICR position together with fetal growth retardation mimicked the human Silver-Russell syndrome. Importantly, late fetal/perinatal death occurred arguing that strict biallelic insulation at the H19/Igf2 ICR position is not tolerated in development. PMID:20838620
Promoter CpG island methylation in ion transport mechanisms and associated dietary intakes jointly influence the risk of clear-cell renal cell cancer.

PubMed

Deckers, Ivette Ag; van Engeland, Manon; van den Brandt, Piet A; Van Neste, Leander; Soetekouw, Patricia Mmb; Aarts, Maureen Jb; Baldewijns, Marcella Mll; Keszei, András P; Schouten, Leo J

2017-04-01

Sodium intake, but not potassium or fluid intake, has been associated with higher renal cell cancer (RCC) risk. However, risk factors may differ by molecular subtypes of the tumour. In renal physiology, electrolyte and water homeostasis is facilitated by ion transport mechanisms (ITM). Aberrant regulation of ITM genes, for example by promoter CpG island methylation, may modify associations between sodium, potassium and fluid intake and RCC risk. We identified ARHGDIG , ATP1A1 , SCNN1B and SLC8A3 as ITM genes exhibiting RCC-specific promoter methylation and down-regulation. Methylation-specific polymerase chain reaction (PCR) was used to analyse promoter CpG island methylation in tumour DNA of 453 RCC cases from the Netherlands Cohort Study ( n = 120 852) after 20.3 years of follow-up. Diet was measured at baseline using food-frequency questionnaires. Cox regression analyses were restricted to clear-cell (cc)RCC ( n = 306) and stratified by tumours with no, low (1 gene) and high (≥ 2 genes) methylation. Sodium intake (high vs low) increased ccRCC risk particularly in tumours with a high methylation index: hazard ratio (HR) [95% confidence interval (CI)]: 2.04 (1.16-3.58), whereas heterogeneity across the methylation index was not significant ( P -heterogeneity = 0.26). Potassium intake was differentially associated with ccRCC risk ( P -heterogeneity = 0.008); the risk for high (vs low) potassium intake was low for unmethylated tumours [HR (95% CI): 0.60 (0.36-1.01)], but high for tumours with a high methylation index [HR (95% CI): 1.60 (0.96-2.65)]. Risks similarly differed for fluid intake, though not significantly ( P -heterogeneity = 0.54). Our findings suggest for the first time that dietary intakes are differentially associated with ccRCC risk according to molecular subtypes defined by ITM gene-specific promoter methylation. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association
Human TERT promoter mutation enables survival advantage from MGMT promoter methylation in IDH1 wild-type primary glioblastoma treated by standard chemoradiotherapy.

PubMed

Nguyen, HuyTram N; Lie, Amy; Li, Tie; Chowdhury, Reshmi; Liu, Fei; Ozer, Byram; Wei, Bowen; Green, Richard M; Ellingson, Benjamin M; Wang, He-Jing; Elashoff, Robert; Liau, Linda M; Yong, William H; Nghiemphu, Phioanh L; Cloughesy, Timothy; Lai, Albert

2017-03-01

Promoter mutation in the human telomerase reverse transcriptase gene (hTERT) occurs in ~75% of primary glioblastoma (GBM). Although the mutation appears to upregulate telomerase expression and contributes to the maintenance of telomere length, its clinical significance remains unclear. We performed hTERT promoter genotyping on 303 isocitrate dehydrogenase 1 wild-type GBM tumors treated with standard chemoradiotherapy. We also stratified 190 GBM patients from the database of The Cancer Genome Atlas (TCGA) by hTERT gene expression. We analyzed overall and progression-free survival by Kaplan-Meier and Cox regression. We detected hTERT promoter mutation in 75% of the patients. When included as the only biomarker, hTERT mutation was not prognostic in our patient cohort by Cox regression analysis. However, when hTERT and O6-DNA methylguanine-methyltransferase (MGMT) were included together, we observed an interaction between these 2 factors. To further investigate this interaction, we performed pairwise comparison of the 4 patient subcohorts grouped by hTERT-MGMT status (MUT-M, WT-M, MUT-U, and WT-U). MGMT methylated patients showed improved survival only in the presence of hTERT promoter mutation: MUT-M versus MUT-U (overall survival of 28.3 vs 15.9 mos, log-rank P < .0001 and progression-free survival of 15.4 vs 7.86 mo, log-rank P < .0001). These results were confirmed by Cox analyses. Analogously, the cohort from TCGA demonstrated survival benefit of MGMT promoter methylation only in patients with high hTERT expression. In addition, hTERT mutation was negatively prognostic in our MGMT unmethylated patients, while the analogous association with high expression was not observed in the cohort from TCGA. The prognostic influence of MGMT promoter methylation depends on hTERT promoter mutation. This interaction warrants further mechanistic investigation. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

PubMed

Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

2003-06-01

The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.
Cotton Leaf Curl Multan Betasatellite DNA as a Tool to Deliver and Express the Human B-Cell Lymphoma 2 (Bcl-2) Gene in Plants.

PubMed

Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar

2016-05-01

The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.
Forensic DNA evidence and the death penalty in the Philippines.

PubMed

De Ungria, M C A; Sagum, M S; Calacal, G C; Delfin, F C; Tabbada, K A; Dalet, M R M; Te, T O; Diokno, J I; Diokno, M S I; Asplen, C A

2008-09-01

The death penalty remains a contentious issue even though it has been abolished in countries such as Australia, New Zealand, Canada, European Union member nations and some Asian countries such as Cambodia, East Timor and Nepal. Many argue that the irrevocability of the death penalty, in the face of potential erroneous convictions, can never justify its imposition. The Philippines, the first Asian country that abolished the death penalty in 1987, held the record for the most number of mandatory death offenses (30 offenses) and death eligible offenses (22 offenses) after it was re-imposed in 1994. Majority of death penalty convictions were decided based on testimonial evidence. While such cases undergo automatic review by the Supreme Court, the appellate process in the Philippines is not structured to accept post-conviction evidence, including DNA evidence. Because of the compelling nature of post-conviction DNA evidence in overturning death penalty convictions in the United States, different groups advocated its use in the Philippines. In one such case, People v Reynaldo de Villa, the defendant was charged with raping his 13-year-old niece that supposedly led to birth of a female child, a situation commonly known as 'criminal paternity'. This paper reports the results of the first post-conviction DNA test using 16 Short Tandem Repeat (STR) DNA markers in a criminal paternity case (People v Reynaldo de Villa) and discusses the implications of these results in the Philippine criminal justice system.
Precision genome engineering and agriculture: opportunities and regulatory challenges.

PubMed

Voytas, Daniel F; Gao, Caixia

2014-06-01

Plant agriculture is poised at a technological inflection point. Recent advances in genome engineering make it possible to precisely alter DNA sequences in living cells, providing unprecedented control over a plant's genetic material. Potential future crops derived through genome engineering include those that better withstand pests, that have enhanced nutritional value, and that are able to grow on marginal lands. In many instances, crops with such traits will be created by altering only a few nucleotides among the billions that comprise plant genomes. As such, and with the appropriate regulatory structures in place, crops created through genome engineering might prove to be more acceptable to the public than plants that carry foreign DNA in their genomes. Public perception and the performance of the engineered crop varieties will determine the extent to which this powerful technology contributes towards securing the world's food supply.
Topologically non-linked circular duplex DNA.

PubMed

Biegeleisen, Ken

2002-05-01

The discovery of circular DNA, over 30 years ago, introduced an element of uneasiness in what had been, up to that point, the almost picture-perfect story of the elucidation of the molecular biology of heredity. If DNA indeed has the Watson-Crick right-handed helical secondary structure, then in circular DNA, thousands, or perhaps even millions of twists must be removed in each generation, and re-wound in the next generation. Although enzyme systems adequate for this task have long since been found and characterized, there have nevertheless arisen a number of proposals for alternative DNA structures in which the strands are topologically non-linked, so that they might separate during replication without having to be unwound. These structures have generally been put forth as theory only, and have been largely unaccompanied by experimental evidence to support their applicability to native DNA from living systems. Recently, however, a report has emerged suggesting that it might be possible to separate, intact, the individual single-stranded circular half-chromosomes which constitute the double-stranded circular chromosomes of certain plasmids. This would not be possible unless the chromosomes had one of the alternative, topologically non-linked structures. It is widely believed that after a half-century of worldwide DNA research, any significant change to the Watson-Crick structure is unlikely to stand up to scrutiny. Nevertheless, the present author has found that in many instances in which the behavior of circular duplex DNA is considered to be explicable only in terms of the topologically linked helical model, it is also possible to explain that same behavior in terms of a topologically non-linked model. It is necessary, in these instances, to make certain logical assumptions which cannot be conclusively proven at the present time. The author herein offers an example of one such instance, namely an examination of the behavior of circular duplex DNA in an alkaline titration experiment, where conformational changes in DNA are deduced from changes in its buoyant density at pH's between 7 and 14. These data have been explained in terms of topological linkage between the DNA strands, but they can also be explained without invoking any such topological linkage, provided that the above-mentioned logical assumptions can be accepted. The principles which emerge from this are applicable to other settings in which knowledge of the topology of DNA is critical to the understanding of observed phenomena.
Isolation of human genomic DNA for genetic analysis from premature neonates: a comparison between newborn dried blood spots, whole blood and umbilical cord tissue

PubMed Central

2013-01-01

Background Genotyping requires biological sample collection that must be reliable, convenient and acceptable for patients and clinicians. Finding the most optimal procedure of sample collection for premature neonates who have a very limited blood volume is a particular challenge. The aim of the current study was to evaluate the use of umbilical cord (UC) tissue and newborn dried blood spot (DBS)-extracted genomic DNA (gDNA) as an alternative to venous blood-derived gDNA from premature neonates for molecular genetic analysis. All samples were obtained from premature newborn infants between 24-32 weeks of gestation. Paired blood and UC samples were collected from 31 study participants. gDNA was extracted from ethylenediaminetetraacetic acid (EDTA) anticoagulant-treated blood samples (~500 μl) and newborn DBSs (n = 723) using QIAamp DNA Micro kit (Qiagen Ltd., Crawley, UK); and from UC using Qiagen DNAeasy Blood and Tissue kit (Qiagen Ltd., Crawley, UK). gDNA was quantified and purity confirmed by measuring the A260:A280 ratio. PCR amplification and pyrosequencing was carried out to determine suitability of the gDNA for molecular genetic analysis. Minor allele frequency of two unrelated single nucleotide polymorphisms (SNPs) was calculated using the entire cohort. Results Both whole blood samples and UC tissue provided good quality and yield of gDNA, which was considerably less from newborn DBS. The gDNA purity was also reduced after 3 years of storage of the newborn DBS. PCR amplification of three unrelated genes resulted in clear products in all whole blood and UC samples and 86%-100% of newborn DBS. Genotyping using pyrosequencing showed 100% concordance in the paired UC and whole blood samples. Minor allele frequencies of the two SNPs indicated that no maternal gDNA contamination occurred in the genotyping of the UC samples. Conclusions gDNAs from all three sources are suitable for standard PCR and pyrosequencing assays. Given that UC provide good quality and quantity gDNA with 100% concordance in the genetic analysis with whole blood, it can replace blood sampling from premature infants. This is likely to reduce the stress and potential side effects associated with invasive sample collection and thus, greatly facilitate participant recruitment for genetic studies. PMID:24168095
Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.
Methylation-regulated decommissioning of multimeric PP2A complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Cheng-Guo; Zheng, Aiping; Jiang, Li

2017-12-01

Dynamic assembly/disassembly of signaling complexes are crucial for cellular functions. Specialized latency and activation chaperones control the biogenesis of protein phosphatase 2A (PP2A) holoenzymes that contain a common scaffold and catalytic subunits and a variable regulatory subunit. Here we show that the butterfly-shaped TIPRL (TOR signaling pathway regulator) makes highly integrative multibranching contacts with the PP2A catalytic subunit, selective for the unmethylated tail and perturbing/inactivating the phosphatase active site. TIPRL also makes unusual wobble contacts with the scaffold subunit, allowing TIPRL, but not the overlapping regulatory subunits, to tolerate disease-associated PP2A mutations, resulting in reduced holoenzyme assembly and enhanced inactivationmore » of mutant PP2A. Strikingly, TIPRL and the latency chaperone, α4, coordinate to disassemble active holoenzymes into latent PP2A, strictly controlled by methylation. Our study reveals a mechanism for methylation-responsive inactivation and holoenzyme disassembly, illustrating the complexity of regulation/signaling, dynamic complex disassembly, and disease mutations in cancer and intellectual disability.« less
Understanding the degree of condensation of phenolic and etherified C-9 units of in situ lignins.

PubMed

Nanayakkara, Bernadette; Manley-Harris, Merilyn; Suckling, Ian D

2011-12-14

A novel approach for the quantification of the degree of condensation at the C(5) position of etherified and phenolic phenylpropane (C-9) units of in situ lignin is described. This is achieved by degrading unmethylated and methylated wood by thioacidolysis and analyzing the resultant product mixtures by quantitative (31)P NMR spectroscopy. Applying this new method to compression wood and normal wood from Pinus radiata showed that, whereas 41-47% of etherified guaiacyl C-9 units are condensed at the C(5) position, almost all phenolic guaiacyl C-9 units exist as uncondensed moieties. Analysis of milled wood lignin (MWL) isolated from the same wood by (31)P NMR spectroscopy before and after thioacidolysis showed that the phenolic guaiacyl C-9 units were more condensed than those in the in situ lignin. This is likely due to partial cleavage of the more condensed etherified linkages during the lignin isolation, leading to a relative increase in condensed phenolic guaiacyl C-9 units.
[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

PubMed

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Long-Term Follow-up of HPV Infection Using Urine and Cervical Quantitative HPV DNA Testing

PubMed Central

Vorsters, Alex; Van Keer, Severien; Biesmans, Samantha; Hens, Annick; De Coster, Ilse; Goossens, Herman; Ieven, Margareta; Van Damme, Pierre

2016-01-01

The link between infection with high-risk human papillomavirus (hrHPV) and cervical cancer has been clearly demonstrated. Virological end-points showing the absence of persistent HPV infection are now accepted as a way of monitoring the impact of prophylactic vaccination programs and therapeutic vaccine trials. This study investigated the use of urine samples, which can be collected by self-sampling at home, instead of cervical samples for follow-up of an HPV intervention trial. Eighteen initially HPV DNA-positive women participating in an HPV therapeutic vaccine trial were monitored during a three-year follow-up period. A total of 172 urine samples and 85 cervical samples were collected. We obtained a paired urine sample for each of the 85 cervical samples by recovering urine samples from six monthly gynaecological examinations. We performed a small pilot study in which the participating women used a urine collection device at home and returned their urine sample to the laboratory by mail. All samples were analyzed using quantitative real-time HPV DNA PCR. A good association (κ value of 0.65) was found between the presence of HPV DNA in urine and a subsequent cervical sample. Comparisons of the number of HPV DNA copies in urine and paired cervical samples revealed a significant Spearman rho of 0.676. This correlation was superior in women with severe lesions. The HPV DNA results of the small pilot study based on self-collected urine samples at home are consistent with previous and subsequent urine and/or cervical results. We demonstrated that urine sampling may be a valid alternative to cervical samples for the follow-up of HPV intervention trials or programs. The potential clinical value of urine viral load monitoring should be further investigated. PMID:27196899
Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

PubMed Central

Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

2015-01-01

The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601
Investigation of a regulatory agency enquiry into potential porcine circovirus type 1 contamination of the human rotavirus vaccine, Rotarix: approach and outcome.

PubMed

Dubin, Gary; Toussaint, Jean-François; Cassart, Jean-Pol; Howe, Barbara; Boyce, Donna; Friedland, Leonard; Abu-Elyazeed, Remon; Poncelet, Sylviane; Han, Htay Htay; Debrus, Serge

2013-11-01

In January 2010, porcine circovirus type 1 (PCV1) DNA was unexpectedly detected in the oral live-attenuated human rotavirus vaccine, Rotarix (GlaxoSmithKline [GSK] Vaccines) by an academic research team investigating a novel, highly sensitive analysis not routinely used for adventitious agent screening. GSK rapidly initiated an investigation to confirm the source, nature and amount of PCV1 in the vaccine manufacturing process and to assess potential clinical implications of this finding. The investigation also considered the manufacturer's inactivated poliovirus (IPV)-containing vaccines, since poliovirus vaccine strains are propagated using the same cell line as the rotavirus vaccine strain. Results confirmed the presence of PCV1 DNA and low levels of PCV1 viral particles at all stages of the Rotarix manufacturing process. PCV type 2 DNA was not detected at any stage. When tested in human cell lines, productive PCV1 infection was not observed. There was no immunological or clinical evidence of PCV1 infection in infants who had received Rotarix in clinical trials. PCV1 DNA was not detected in the IPV-containing vaccine manufacturing process beyond the purification stage. Retrospective testing confirmed the presence of PCV1 DNA in Rotarix since the initial stages of its development and in vaccine lots used in clinical studies conducted pre- and post-licensure. The acceptable safety profile observed in clinical trials of Rotarix therefore reflects exposure to PCV1 DNA. The investigation into the presence of PCV1 in Rotarix could serve as a model for risk assessment in the event of new technologies identifying adventitious agents in the manufacturing of other vaccines and biological products.
Investigation of a regulatory agency enquiry into potential porcine circovirus type 1 contamination of the human rotavirus vaccine, Rotarix™

PubMed Central

Dubin, Gary; Toussaint, Jean-François; Cassart, Jean-Pol; Howe, Barbara; Boyce, Donna; Friedland, Leonard; Abu-Elyazeed, Remon; Poncelet, Sylviane; Han, Htay Htay; Debrus, Serge

2013-01-01

In January 2010, porcine circovirus type 1 (PCV1) DNA was unexpectedly detected in the oral live-attenuated human rotavirus vaccine, Rotarix™ (GlaxoSmithKline [GSK] Vaccines) by an academic research team investigating a novel, highly sensitive analysis not routinely used for adventitious agent screening. GSK rapidly initiated an investigation to confirm the source, nature and amount of PCV1 in the vaccine manufacturing process and to assess potential clinical implications of this finding. The investigation also considered the manufacturer’s inactivated poliovirus (IPV)-containing vaccines, since poliovirus vaccine strains are propagated using the same cell line as the rotavirus vaccine strain. Results confirmed the presence of PCV1 DNA and low levels of PCV1 viral particles at all stages of the Rotarix™ manufacturing process. PCV type 2 DNA was not detected at any stage. When tested in human cell lines, productive PCV1 infection was not observed. There was no immunological or clinical evidence of PCV1 infection in infants who had received Rotarix™ in clinical trials. PCV1 DNA was not detected in the IPV-containing vaccine manufacturing process beyond the purification stage. Retrospective testing confirmed the presence of PCV1 DNA in Rotarix™ since the initial stages of its development and in vaccine lots used in clinical studies conducted pre- and post-licensure. The acceptable safety profile observed in clinical trials of Rotarix™ therefore reflects exposure to PCV1 DNA. The investigation into the presence of PCV1 in Rotarix™ could serve as a model for risk assessment in the event of new technologies identifying adventitious agents in the manufacturing of other vaccines and biological products. PMID:24056737
Long-Term Follow-up of HPV Infection Using Urine and Cervical Quantitative HPV DNA Testing.

PubMed

Vorsters, Alex; Van Keer, Severien; Biesmans, Samantha; Hens, Annick; De Coster, Ilse; Goossens, Herman; Ieven, Margareta; Van Damme, Pierre

2016-05-17

The link between infection with high-risk human papillomavirus (hrHPV) and cervical cancer has been clearly demonstrated. Virological end-points showing the absence of persistent HPV infection are now accepted as a way of monitoring the impact of prophylactic vaccination programs and therapeutic vaccine trials. This study investigated the use of urine samples, which can be collected by self-sampling at home, instead of cervical samples for follow-up of an HPV intervention trial. Eighteen initially HPV DNA-positive women participating in an HPV therapeutic vaccine trial were monitored during a three-year follow-up period. A total of 172 urine samples and 85 cervical samples were collected. We obtained a paired urine sample for each of the 85 cervical samples by recovering urine samples from six monthly gynaecological examinations. We performed a small pilot study in which the participating women used a urine collection device at home and returned their urine sample to the laboratory by mail. All samples were analyzed using quantitative real-time HPV DNA PCR. A good association (κ value of 0.65) was found between the presence of HPV DNA in urine and a subsequent cervical sample. Comparisons of the number of HPV DNA copies in urine and paired cervical samples revealed a significant Spearman rho of 0.676. This correlation was superior in women with severe lesions. The HPV DNA results of the small pilot study based on self-collected urine samples at home are consistent with previous and subsequent urine and/or cervical results. We demonstrated that urine sampling may be a valid alternative to cervical samples for the follow-up of HPV intervention trials or programs. The potential clinical value of urine viral load monitoring should be further investigated.
Real-Time Study of the Interaction between G-Rich DNA Oligonucleotides and Lead Ion on DNA Tetrahedron-Functionalized Sensing Platform by Dual Polarization Interferometry.

PubMed

Wang, Shuang; Lu, Shasha; Zhao, Jiahui; Huang, Jianshe; Yang, Xiurong

2017-11-29

G-quadruplex plays roles in numerous physiological and pathological processes of organisms. Due to the unique properties of G-quadruplex (e.g., forming G4/hemin complexes with catalytic activity and electron acceptability, binding with metal ions, proteins, fluorescent ligands, and so on), it has been widely applied in biosensing. But the formation process of G-quadruplex is not yet fully understood. Here, a DNA tetrahedron platform with higher reproducibility, regenerative ability, and time-saving building process was coupled with dual polarization interferometry technique for the real-time and label-free investigation of the specific interaction process of guanine-rich singled-stranded DNA (G-rich ssDNA) and Pb 2+ . The oriented immobilization of probes greatly decreased the spatial hindrance effect and improved the accessibility of the probes to the Pb 2+ ions. Through real-time monitoring of the whole formation process of the G-quadruplex, we speculated that the probes on the tetrahedron platform initially stood on the sensing surface with a random coil conformation, then the G-rich ssDNA preliminarily formed unstable G-quartets by H-bonding and cation binding, subsequently forming a completely folded and stable quadruplex structure through relatively slow strand rearrangements. On the basis of these studies, we also developed a novel sensing platform for the specific and sensitive determination of Pb 2+ and its chelating agent ethylenediaminetetraacetic acid. This study not only provides a proof-of-concept for conformational dynamics of G-quadruplex-related drugs and pathogenes, but also enriches the biosensor tools by combining nanomaterial with interfaces technique.

The effects of strawberry tree water leaf extract, arbutin and hydroquinone on haematological parameters and levels of primary DNA damage in white blood cells of rats.

PubMed

Jurica, Karlo; Brčić Karačonji, Irena; Kopjar, Nevenka; Shek-Vugrovečki, Ana; Cikač, Tihana; Benković, Vesna

2018-04-06

Strawberry tree (Arbutus unedo L., Ericaceae) leaves represent a potent source of biologically active compounds and have been used for a long to relieve symptoms of various health impairments and diseases. Two major compounds related to their beneficial activities in animals and humans are arbutin and hydroquinone. To establish potential benefit/risk ratio associated with daily oral administration of strawberry tree water leaf extract, arbutin and hydroquinone in doses expected to be non-toxic. We performed a 14-day and a 28-day study on male and female Lewis rats and evaluated main haematological parameters and the effects of treatments on the levels of primary DNA damage in white blood cells (WBC) using the alkaline comet assay. Our findings suggest no significant changes in the haematological parameters following prolonged exposure to strawberry tree water leaf extract, arbutin, and hydroquinone. However, hydroquinone causes increased, and extract as well as arbutin decreased WBC count in male rats compared to control after 14 days of treatment. DNA damage measured in WBC of rats treated with all compounds was below 10% of the DNA in the comet tail, which indicates low genotoxicity. The genotoxic potential of strawberry water leaf extract was within acceptable limits and reflected effects of a complex chemical composition upon DNA. We also observed slight gender- and exposure time- related differences in primary DNA damage in the leucocytes of control and treated rats. Future studies should investigate which doses of strawberry tree water leaf extract would be most promising for the potential use as a substitute for bearberry leaves for treatment of urinary infection. Copyright © 2017 Elsevier B.V. All rights reserved.
The Role of Fanconi/BRCA DNA Repair Pathway in Epithelial Ovarian Carcinogenesis

DTIC Science & Technology

2015-01-01

kit from Millipore. Chromatin was precleared with Magna ChIP Protien A/G Magnetic Beads and then incubated overnight at 4oC with 5 ug ChIP...Gynecology, 2014, accepted. Wright JW, Engel S, Kellar M, Bean Y, Hays L, Mhawech-Fauceglia P, Lim YJ, Pejovic T: Subcellular localization of FANCD2is...associated with survival in serous carcinoma of the ovary. Manuscript submitted. 2014 Meeting abstracts: Kellar M, Bean Y, Wright J, Pejovic T
Automated design of genomic Southern blot probes

PubMed Central

2010-01-01

Background Sothern blotting is a DNA analysis technique that has found widespread application in molecular biology. It has been used for gene discovery and mapping and has diagnostic and forensic applications, including mutation detection in patient samples and DNA fingerprinting in criminal investigations. Southern blotting has been employed as the definitive method for detecting transgene integration, and successful homologous recombination in gene targeting experiments. The technique employs a labeled DNA probe to detect a specific DNA sequence in a complex DNA sample that has been separated by restriction-digest and gel electrophoresis. Critically for the technique to succeed the probe must be unique to the target locus so as not to cross-hybridize to other endogenous DNA within the sample. Investigators routinely employ a manual approach to probe design. A genome browser is used to extract DNA sequence from the locus of interest, which is searched against the target genome using a BLAST-like tool. Ideally a single perfect match is obtained to the target, with little cross-reactivity caused by homologous DNA sequence present in the genome and/or repetitive and low-complexity elements in the candidate probe. This is a labor intensive process often requiring several attempts to find a suitable probe for laboratory testing. Results We have written an informatic pipeline to automatically design genomic Sothern blot probes that specifically attempts to optimize the resultant probe, employing a brute-force strategy of generating many candidate probes of acceptable length in the user-specified design window, searching all against the target genome, then scoring and ranking the candidates by uniqueness and repetitive DNA element content. Using these in silico measures we can automatically design probes that we predict to perform as well, or better, than our previous manual designs, while considerably reducing design time. We went on to experimentally validate a number of these automated designs by Southern blotting. The majority of probes we tested performed well confirming our in silico prediction methodology and the general usefulness of the software for automated genomic Southern probe design. Conclusions Software and supplementary information are freely available at: http://www.genes2cognition.org/software/southern_blot PMID:20113467
Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

PubMed Central

Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

2016-01-01

Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil−1) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g−1 soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g−1 soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g−1 soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of disease spread by cleaning of farm equipment, footwear, etc. PMID:27135241
Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production.

PubMed

Wallenhammar, Ann-Charlotte; Gunnarson, Albin; Hansson, Fredrik; Jonsson, Anders

2016-04-22

Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR) in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil(-1)) in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g(-1) soil) in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20%) showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g(-1) soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g(-1) soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of prevention of disease spread by cleaning of farm equipment, footwear, etc.
Basal jawed vertebrate phylogeny inferred from multiple nuclear DNA-coded genes

PubMed Central

Kikugawa, Kanae; Katoh, Kazutaka; Kuraku, Shigehiro; Sakurai, Hiroshi; Ishida, Osamu; Iwabe, Naoyuki; Miyata, Takashi

2004-01-01

Background Phylogenetic analyses of jawed vertebrates based on mitochondrial sequences often result in confusing inferences which are obviously inconsistent with generally accepted trees. In particular, in a hypothesis by Rasmussen and Arnason based on mitochondrial trees, cartilaginous fishes have a terminal position in a paraphyletic cluster of bony fishes. No previous analysis based on nuclear DNA-coded genes could significantly reject the mitochondrial trees of jawed vertebrates. Results We have cloned and sequenced seven nuclear DNA-coded genes from 13 vertebrate species. These sequences, together with sequences available from databases including 13 jawed vertebrates from eight major groups (cartilaginous fishes, bichir, chondrosteans, gar, bowfin, teleost fishes, lungfishes and tetrapods) and an outgroup (a cyclostome and a lancelet), have been subjected to phylogenetic analyses based on the maximum likelihood method. Conclusion Cartilaginous fishes have been inferred to be basal to other jawed vertebrates, which is consistent with the generally accepted view. The minimum log-likelihood difference between the maximum likelihood tree and trees not supporting the basal position of cartilaginous fishes is 18.3 ± 13.1. The hypothesis by Rasmussen and Arnason has been significantly rejected with the minimum log-likelihood difference of 123 ± 23.3. Our tree has also shown that living holosteans, comprising bowfin and gar, form a monophyletic group which is the sister group to teleost fishes. This is consistent with a formerly prevalent view of vertebrate classification, although inconsistent with both of the current morphology-based and mitochondrial sequence-based trees. Furthermore, the bichir has been shown to be the basal ray-finned fish. Tetrapods and lungfish have formed a monophyletic cluster in the tree inferred from the concatenated alignment, being consistent with the currently prevalent view. It also remains possible that tetrapods are more closely related to ray-finned fishes than to lungfishes. PMID:15070407
Critical issues with the in vivo comet assay: A report of the comet assay working group in the 6th International Workshop on Genotoxicity Testing (IWGT).

PubMed

Speit, Günter; Kojima, Hajime; Burlinson, Brian; Collins, Andrew R; Kasper, Peter; Plappert-Helbig, Ulla; Uno, Yoshifumi; Vasquez, Marie; Beevers, Carol; De Boeck, Marlies; Escobar, Patricia A; Kitamoto, Sachiko; Pant, Kamala; Pfuhler, Stefan; Tanaka, Jin; Levy, Dan D

2015-05-01

As a part of the 6th IWGT, an expert working group on the comet assay evaluated critical topics related to the use of the in vivo comet assay in regulatory genotoxicity testing. The areas covered were: identification of the domain of applicability and regulatory acceptance, identification of critical parameters of the protocol and attempts to standardize the assay, experience with combination and integration with other in vivo studies, demonstration of laboratory proficiency, sensitivity and power of the protocol used, use of different tissues, freezing of samples, and choice of appropriate measures of cytotoxicity. The standard protocol detects various types of DNA lesions but it does not detect all types of DNA damage. Modifications of the standard protocol may be used to detect additional types of specific DNA damage (e.g., cross-links, bulky adducts, oxidized bases). In addition, the working group identified critical parameters that should be carefully controlled and described in detail in every published study protocol. In vivo comet assay results are more reliable if they were obtained in laboratories that have demonstrated proficiency. This includes demonstration of adequate response to vehicle controls and an adequate response to a positive control for each tissue being examined. There was a general agreement that freezing of samples is an option but more data are needed in order to establish generally accepted protocols. With regard to tissue toxicity, the working group concluded that cytotoxicity could be a confounder of comet results. It is recommended to look at multiple parameters such as histopathological observations, organ-specific clinical chemistry as well as indicators of tissue inflammation to decide whether compound-specific toxicity might influence the result. The expert working group concluded that the alkaline in vivo comet assay is a mature test for the evaluation of genotoxicity and can be recommended to regulatory agencies for use. Copyright © 2014 Elsevier B.V. All rights reserved.
Review: domestic animal forensic genetics - biological evidence, genetic markers, analytical approaches and challenges.

PubMed

Kanthaswamy, S

2015-10-01

This review highlights the importance of domestic animal genetic evidence sources, genetic testing, markers and analytical approaches as well as the challenges this field is facing in view of the de facto 'gold standard' human DNA identification. Because of the genetic similarity between humans and domestic animals, genetic analysis of domestic animal hair, saliva, urine, blood and other biological material has generated vital investigative leads that have been admitted into a variety of court proceedings, including criminal and civil litigation. Information on validated short tandem repeat, single nucleotide polymorphism and mitochondrial DNA markers and public access to genetic databases for forensic DNA analysis is becoming readily available. Although the fundamental aspects of animal forensic genetic testing may be reliable and acceptable, animal forensic testing still lacks the standardized testing protocols that human genetic profiling requires, probably because of the absence of monetary support from government agencies and the difficulty in promoting cooperation among competing laboratories. Moreover, there is a lack in consensus about how to best present the results and expert opinion to comply with court standards and bear judicial scrutiny. This has been the single most persistent challenge ever since the earliest use of domestic animal forensic genetic testing in a criminal case in the mid-1990s. Crime laboratory accreditation ensures that genetic test results have the courts' confidence. Because accreditation requires significant commitments of effort, time and resources, the vast majority of animal forensic genetic laboratories are not accredited nor are their analysts certified forensic examiners. The relevance of domestic animal forensic genetics in the criminal justice system is undeniable. However, further improvements are needed in a wide range of supporting resources, including standardized quality assurance and control protocols for sample handling, evidence testing, statistical analysis and reporting that meet the rules of scientific acceptance, reliability and human forensic identification standards. © 2015 Stichting International Foundation for Animal Genetics.
Aberrant Hypermethylation of SALL3 with HPV Involvement Contributes to the Carcinogenesis of Cervical Cancer.

PubMed

Wei, Xing; Zhang, Shaohua; Cao, Di; Zhao, Minyi; Zhang, Qian; Zhao, Juan; Yang, Ting; Pei, Meili; Wang, Li; Li, Yang; Yang, Xiaofeng

2015-01-01

This study aimed to investigate the methylation status of the promoter region of spalt-like transcription factor 3 (SALL3) and the expression of SALL3 in cervical cancer to explore the function of this gene in cervical cancer carcinogenesis. The methylation status of SALL3 was detected by methylation-specific PCR, and SALL3 gene expression was assessed by real-time quantitative PCR in the cervical cancer cell lines, SiHa, HeLa and C33A, as well as in cervical cancer tissue samples (n = 23), matched pericarcinomatous tissue samples (n = 23) and normal cervix tissue samples (n = 17). MTT was used to measure the cell viability and proliferation capacity of SiHa and HeLa cells. The SALL3 promoter was completely methylated in SiHa cells, unmethylated in C33A cells and partially methylated in HeLa cells. After treatment of SiHa and HeLa cells with 5 μM and 10 μM of 5-Azacytidine (5-Aza), respectively, the methylation level of the SALL3 promoter decreased and observed increase in the degree of unmethylation in a dose-dependent manner. Moreover, the relative expression of SALL3 mRNA increased as the concentration of 5-Aza increased in SiHa (p<0.05) and HeLa (p<0.05) cells. This above-mentioned increase in SALL3 mRNA in SiHa cells was more remarkable than that observed in HeLa cells. Cell proliferation capacity also decreased after administration of 5-Aza to SiHa and HeLa cells (p<0.05). Methylation of the SALL3 promoter was observed in 15 of 23 (65.21%) cervical cancer tissue samples, 15 of 23 (65.21%) matched pericarcinomatous tissue samples and 5 of 17 (29.41%) normal cervical tissue samples (p<0.05). SALL3 mRNA expression was significantly lower in cervical cancer and pericarcinomatous tissues compared with normal cervical tissues (p<0.05). In all cervix tissue samples, HPV infection was positively associated with hypermethylation of the promoter region of SALL3 (p<0.05, r = 0.408), and the expression of SALL3 mRNA in HPV-positive tissues was lower than that in HPV-negative tissues (p<0.05). The aberrant hypermethylation of SALL3 together with HPV involvement inactivated its function as a tumor suppressor and contributed to carcinogenesis in cervical cancer.
Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

PubMed

Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

2010-07-01

We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Altered DNA methylation profile in Norwegian patients with Autoimmune Addison's Disease.

PubMed

Bjanesoy, Trine E; Andreassen, Bettina Kulle; Bratland, Eirik; Reiner, Andrew; Islam, Shahinul; Husebye, Eystein S; Bakke, Marit

2014-06-01

Autoimmune Addison's Disease (AAD) is an endocrine and immunological disease of uncertain pathogenesis resulting from the immune system's destruction of the hormone producing cells of the adrenal cortex. The underlying molecular mechanisms are largely unknown, but it is commonly accepted that a combination of genetic susceptibility and environmental impact is critical. In the present study, we identified multiple hypomethylated gene promoter regions in patients with isolated AAD using DNA isolated from CD4+ T cells. The identified differentially methylated regions were distributed evenly across the 10.5-kb-promoter regions covered by the array, and a substantial number localized to promoters of genes involved in immune regulation and autoimmunity. This study reveals a hypomethylated status in CD4+ T cells from AAD patients and indicates differential methylation of promoters of key genes involved in immune responses. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Applications and challenges of multivalent recombinant vaccines

PubMed Central

Naim, Hussein Y.

2013-01-01

The exceptional discoveries of antigen/gene delivery systems have allowed the development of novel prophylactic and therapeutic vaccine candidates. The vaccine candidates employ various antigen-delivery systems, particularly recombinant viral vectors. Recombinant viral vectors are experimental vaccines similar to DNA vaccines, but they use attenuated viruses or bacterium as a carrier “vector” to introduce microbial DNA to cells of the body. They closely mimic a natural infection and therefore can efficiently stimulate the immune system. Although such recombinant vectors may face extensive preclinical testing and will possibly have to meet stringent regulatory requirements, some of these vectors (e.g. measles virus vectors) may benefit from the profound industrial and clinical experience of the parent vaccine. Most notably, novel vaccines based on live attenuated viruses combine the induction of broad, strong and persistent immune responses with acceptable safety profiles. We assess certain technologies in light of their use against human immunodeficiency virus (HIV). PMID:23249651
Ancient DNA analysis affirms the canid from Altai as a primitive dog.

PubMed

Druzhkova, Anna S; Thalmann, Olaf; Trifonov, Vladimir A; Leonard, Jennifer A; Vorobieva, Nadezhda V; Ovodov, Nikolai D; Graphodatsky, Alexander S; Wayne, Robert K

2013-01-01

The origin of domestic dogs remains controversial, with genetic data indicating a separation between modern dogs and wolves in the Late Pleistocene. However, only a few dog-like fossils are found prior to the Last Glacial Maximum, and it is widely accepted that the dog domestication predates the beginning of agriculture about 10,000 years ago. In order to evaluate the genetic relationship of one of the oldest dogs, we have isolated ancient DNA from the recently described putative 33,000-year old Pleistocene dog from Altai and analysed 413 nucleotides of the mitochondrial control region. Our analyses reveal that the unique haplotype of the Altai dog is more closely related to modern dogs and prehistoric New World canids than it is to contemporary wolves. Further genetic analyses of ancient canids may reveal a more exact date and centre of domestication.
Baseball Bats and Chocolate Chip Cookies: The Judicial Treatment of DNA in the Myriad Genetics Litigation

PubMed Central

Binnie, Ian; Park-Thompson, Vanessa

2015-01-01

In June 2013, the U.S. Supreme Court rendered a controversial ruling that naturally occurring DNA segments are “products of nature” and therefore not patentable subject matter. At this intersection between science and law, in litigation of crucial importance to patients, science, and multibillion-dollar biotech enterprises, the appellate judges sidestepped genetics and engaged in a war of metaphors from diamonds to chocolate chip cookies. This case is not an outlier. Apprehensive judges and juries in both Canada and the United States find many convenient excuses to avoid coming to grips with the underlying science in patent cases. But this is simply not acceptable. Legal rulings must be, and must seem to be, well grounded, as a matter of both law and science. The legitimacy of court decisions in the eyes of the stakeholders and the broader public depends on it. PMID:25524722
Molecular analyses of oral polio vaccine samples.

PubMed

Poinar, H; Kuch, M; Pääbo, S

2001-04-27

It has been suggested that the human immunodeficiency virus (HIV), and thus the acquired immunodeficiency syndrome (AIDS) it causes, was inadvertently introduced to humans by the use of an oral polio vaccine (OPV) during a vaccination campaign launched by the Wistar Institute, Philadelphia, PA, USA, in the Belgian Congo in 1958 and 1959. The "OPV/AIDS hypothesis" suggests that the OPV used in this campaign was produced in chimpanzee kidney epithelial cell cultures rather than in monkey kidney cell cultures, as stated by H. Koprowski and co-workers, who produced the OPV. If chimpanzee cells were indeed used, this would lend support to the OPV/AIDS hypothesis, since chimpanzees harbor a simian immunodeficiency virus, widely accepted to be the origin of HIV-1. We analyzed several early OPV pools and found no evidence for the presence of chimpanzee DNA; by contrast, monkey DNA is present.
Evaluation of the Potential Risk of Hepatitis B Virus Transmission in Skin Allografting.

PubMed

Wang, D; Xie, W; Chen, T; Dong, C; Zhao, C; Tan, H; Tian, H; Xie, Q

2015-01-01

Skin transplantation is associated with potential risk of infectious disease transmission; however, the exclusion of donors owing to hepatitis B virus (HBV) infection will worsen the shortage of allograft skin supply. We report a paired study to evaluate the potential risk of HBV transmission in skin allografting. The presence of HBV DNA in the serum and skin from 37 burn patients with chronic HBV infection (CHB) was monitored by a HBV polymerase chain reaction (PCR) and the positive rates were compared by Fisher's exact probability test. There was a high consistency in the HBV serology profile between HBV DNA PCR (83.78%) and the clinical HBV test. Only 2 patients who were positive for hepatitis B surface antigen, hepatitis B e antigen, and hepatitis B core antibody had detectable HBV DNA in the skin tissue; however, no hepatitis B surface antigen was detected as examined by immunohistochemistry staining. There was a significant difference between the positive rates of HBV DNA in the serum and skin (χc(2) = 27.03; P < .001). The potential risk for HBV transmission by skin allografting is very low. Given that China has a large population of patients with HBV, the acceptance of skin from donors with CHB to the skin bank would increase the number of tissue donations to meet the urgent medical need for skin transplantation. Copyright © 2015 Elsevier Inc. All rights reserved.
Significant genetic boundaries and spatial dynamics of giant pandas occupying fragmented habitat across southwest China.

PubMed

Zhu, Lifeng; Zhang, Shanning; Gu, Xiaodong; Wei, Fuwen

2011-03-01

Understanding population history and genetic structure are key drivers of ecological research. Here, we studied two highly fragmented and isolated populations (Xiaoxiangling and Daxiangling) of giant pandas (Ailuropoda melanoleuca) at the extreme southwestern edge of their distribution. This area also contains the Dadu River, national road 108 and various human infrastructure and development, providing an ideal region in which we can identify the effects of different barriers on animal movements. We used partial mitochondrial control region (mtDNA) and nine microsatellite loci (nuclear DNA) data derived from 192 faecal and one blood sample collected from the wild. We found 136 genotypes corresponding to 53 unique multilocus genotypes and eight unique control region haplotypes (653 bp). Significant genetic boundaries correlated spatially with the Dadu River (K = 2). We estimate that a major divergence took place between these populations 26,000 years bp, at around the similar time the rock surface of valley bottom formed in Dadu River. The national road has resulted in further recent population differentiation (Pairwise F(S) on mtDNA and nuclear DNA) so that in effect, four smaller sub-populations now exist. Promisingly, we identified two possible first-generation migrants and their migration paths, and recommended the immediate construction of a number of corridors. Fortunately, the Chinese government has accepted our advice and is now planning corridor construction. © 2011 Blackwell Publishing Ltd.
High throughput gene expression profiling: a molecular approach to integrative physiology

PubMed Central

Liang, Mingyu; Cowley, Allen W; Greene, Andrew S

2004-01-01

Integrative physiology emphasizes the importance of understanding multiple pathways with overlapping, complementary, or opposing effects and their interactions in the context of intact organisms. The DNA microarray technology, the most commonly used method for high-throughput gene expression profiling, has been touted as an integrative tool that provides insights into regulatory pathways. However, the physiology community has been slow in acceptance of these techniques because of early failure in generating useful data and the lack of a cohesive theoretical framework in which experiments can be analysed. With recent advances in both technology and analysis, we propose a concept of multidimensional integration of physiology that incorporates data generated by DNA microarray and other functional, genomic, and proteomic approaches to achieve a truly integrative understanding of physiology. Analysis of several studies performed in simpler organisms or in mammalian model animals supports the feasibility of such multidimensional integration and demonstrates the power of DNA microarray as an indispensable molecular tool for such integration. Evaluation of DNA microarray techniques indicates that these techniques, despite limitations, have advanced to a point where the question-driven profiling research has become a feasible complement to the conventional, hypothesis-driven research. With a keen sense of homeostasis, global regulation, and quantitative analysis, integrative physiologists are uniquely positioned to apply these techniques to enhance the understanding of complex physiological functions. PMID:14678487
Ancient DNA clarifies the evolutionary history of American Late Pleistocene equids.

PubMed

Orlando, Ludovic; Male, Dean; Alberdi, Maria Teresa; Prado, Jose Luis; Prieto, Alfredo; Cooper, Alan; Hänni, Catherine

2008-05-01

Hippidions are past members of the equid lineage which appeared in the South American fossil record around 2.5 Ma but then became extinct during the great late Pleistocene megafaunal extinction. According to fossil records and numerous dental, cranial, and postcranial characters, Hippidion and Equus lineages were expected to cluster in two distinct phylogenetic groups that diverged at least 10 MY, long before the emergence of the first Equus. However, the first DNA sequence information retrieved from Hippidion fossils supported a striking different phylogeny, with hippidions nesting inside a paraphyletic group of Equus. This result indicated either that the currently accepted phylogenetic tree of equids was incorrect regarding the timing of the evolutionary split between Hippidion and Equus or that the taxonomic identification of the hippidion fossils used for DNA analysis needed to be reexamined (and attributed to another extinct South American member of the equid lineage). The most likely candidate for the latter explanation is Equus (Amerhippus) neogeus. Here, we show by retrieving new ancient mtDNA sequences that hippidions and Equus (Amerhippus) neogeus were members of two distinct lineages. Furthermore, using a rigorous phylogenetic approach, we demonstrate that while formerly the largest equid from Southern America, Equus (Amerhippus) was just a member of the species Equus caballus. This new data increases the known phenotypic plasticity of horses and consequently casts doubt on the taxonomic validity of the subgenus Equus (Amerhippus).
Lable-free quadruple signal amplification strategy for sensitive electrochemical p53 gene biosensing.

PubMed

Wang, Zonghua; Xia, Jianfei; Song, Daimin; Zhang, Feifei; Yang, Min; Gui, Rijun; Xia, Lin; Bi, Sai; Xia, Yanzhi

2016-03-15

A versatile label-free quadruple signal amplification biosensing platform for p53 gene (target DNA) detection was proposed. The chitosan-graphene (CS-GR) modified electrode with excellent electron transfer ability could provide a large specific surface for high levels of AuNPs-DNA attachment. The large amount of AuNPs could immobilize more capture probes and enhance the electrochemical signal with the excellent electrocatalytic activity. Furthermore, with the assist of N.BstNB I (the nicking endonuclease), target DNA could be reused and more G-quadruplex-hemin DNAzyme could be formed, allowing significant signal amplification in the presence of H2O2. Such strategy can enhance the oxidation-reduction reaction of adsorbed methylene blue (MB) and efficiently improve the sensitivity of the proposed biosensor. The morphologies of materials and the stepwise biosensor were characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM) and cyclic voltammetry (CV). Differential pulse voltammetry (DPV) signals of MB provided quantitative measures of the concentrations of target DNA, with a linear calibration range of 1.0 × 10(-15)-1.0 × 10(-9)M and a detection limit of 3.0 × 10(-16)M. Moreover, the resulting biosensor also exhibited good specificity, acceptable reproducibility and stability, indicating that the present strategy was promising for broad potential application in clinic assay. Copyright © 2015 Elsevier B.V. All rights reserved.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.