2008 Stability, Security, Transition and Reconstruction Operations Conference
2008-09-04
Facilitator Power of Public-Private Partnerships • Health Professional Education • Greater Access to Care China Diabetes Education Program Dominican Republic...Argentina Canada Chile Colombia Ecuador Peru Uruguay Interagency, multinational, inter-institutional partnerships State Department Homeland Security...Disaster Preparedness Disaster Response Regional Response Capacity OFDA-LAC / MDROs Regional Security System (RSS) UNCLASSIFIED ECUADOR / KY PERU / WV
Slechta, E Susan; Liu, Jing; Andersson, Dan I; Roth, John R
2002-01-01
In the genetic system of Cairns and Foster, a nongrowing population of an E. coli lac frameshift mutant appears to specifically accumulate Lac(+) revertants when starved on medium including lactose (adaptive mutation). This behavior has been attributed to stress-induced general mutagenesis in a subpopulation of starved cells (the hypermutable state model). We have suggested that, on the contrary, stress has no direct effect on mutability but favors only growth of cells that amplify their leaky mutant lac region (the amplification mutagenesis model). Selection enhances reversion primarily by increasing the mutant lac copy number within each developing clone on the selection plate. The observed general mutagenesis is attributed to a side effect of growth with an amplification-induction of SOS by DNA fragments released from a tandem array of lac copies. Here we show that the S. enterica version of the Cairns system shows SOS-dependent general mutagenesis and behaves in every way like the original E. coli system. In both systems, lac revertants are mutagenized during selection. Eliminating the 35-fold increase in mutation rate reduces revertant number only 2- to 4-fold. This discrepancy is due to continued growth of amplification cells until some clones manage to revert without mutagenesis solely by increasing their lac copy number. Reversion in the absence of mutagenesis is still dependent on RecA function, as expected if it depends on lac amplification (a recombination-dependent process). These observations support the amplification mutagenesis model. PMID:12136002
McMahon, Alex D; Elliott, Lawrie; Macpherson, Lorna Md; Sharpe, Katharine H; Connelly, Graham; Milligan, Ian; Wilson, Philip; Clark, David; King, Albert; Wood, Rachael; Conway, David I
2018-01-01
There is limited evidence on the health needs and service access among children and young people who are looked after by the state. The aim of this study was to compare dental treatment needs and access to dental services (as an exemplar of wider health and well-being concerns) among children and young people who are looked after with the general child population. Population data linkage study utilising national datasets of social work referrals for 'looked after' placements, the Scottish census of children in local authority schools, and national health service's dental health and service datasets. 633 204 children in publicly funded schools in Scotland during the academic year 2011/2012, of whom 10 927 (1.7%) were known to be looked after during that or a previous year (from 2007-2008). The children in the looked after children (LAC) group were more likely to have urgent dental treatment need at 5 years of age: 23%vs10% (n=209/16533), adjusted (for age, sex and area socioeconomic deprivation) OR 2.65 (95% CI 2.30 to 3.05); were less likely to attend a dentist regularly: 51%vs63% (n=5519/388934), 0.55 (0.53 to 0.58) and more likely to have teeth extracted under general anaesthesia: 9%vs5% (n=967/30253), 1.91 (1.78 to 2.04). LAC are more likely to have dental treatment needs and less likely to access dental services even when accounting for sociodemographic factors. Greater efforts are required to integrate child social and healthcare for LAC and to develop preventive care pathways on entering and throughout their time in the care system. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)
Maisnier-Patin, Sophie; Roth, John R.
2015-01-01
Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Intelligent Local Avoided Collision (iLAC) MAC Protocol for Very High Speed Wireless Network
NASA Astrophysics Data System (ADS)
Hieu, Dinh Chi; Masuda, Akeo; Rabarijaona, Verotiana Hanitriniala; Shimamoto, Shigeru
Future wireless communication systems aim at very high data rates. As the medium access control (MAC) protocol plays the central role in determining the overall performance of the wireless system, designing a suitable MAC protocol is critical to fully exploit the benefit of high speed transmission that the physical layer (PHY) offers. In the latest 802.11n standard [2], the problem of long overhead has been addressed adequately but the issue of excessive colliding transmissions, especially in congested situation, remains untouched. The procedure of setting the backoff value is the heart of the 802.11 distributed coordination function (DCF) to avoid collision in which each station makes its own decision on how to avoid collision in the next transmission. However, collision avoidance is a problem that can not be solved by a single station. In this paper, we introduce a new MAC protocol called Intelligent Local Avoided Collision (iLAC) that redefines individual rationality in choosing the backoff counter value to avoid a colliding transmission. The distinguishing feature of iLAC is that it fundamentally changes this decision making process from collision avoidance to collaborative collision prevention. As a result, stations can avoid colliding transmissions with much greater precision. Analytical solution confirms the validity of this proposal and simulation results show that the proposed algorithm outperforms the conventional algorithms by a large margin.
Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho
2017-09-15
Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.
Genome sequences of two closely related strains of Escherichia coli K-12 GM4792.
Zhang, Yan-Cong; Zhang, Yan; Zhu, Bi-Ru; Zhang, Bo-Wen; Ni, Chuan; Zhang, Da-Yong; Huang, Ying; Pang, Erli; Lin, Kui
2015-01-01
Escherichia coli lab strains K-12 GM4792 Lac(+) and GM4792 Lac(-) carry opposite lactose markers, which are useful for distinguishing evolved lines as they produce different colored colonies. The two closely related strains are chosen as ancestors for our ongoing studies of experimental evolution. Here, we describe the genome sequences, annotation, and features of GM4792 Lac(+) and GM4792 Lac(-). GM4792 Lac(+) has a 4,622,342-bp long chromosome with 4,061 protein-coding genes and 83 RNA genes. Similarly, the genome of GM4792 Lac(-) consists of a 4,621,656-bp chromosome containing 4,043 protein-coding genes and 74 RNA genes. Genome comparison analysis reveals that the differences between GM4792 Lac(+) and GM4792 Lac(-) are minimal and limited to only the targeted lac region. Moreover, a previous study on competitive experimentation indicates the two strains are identical or nearly identical in survivability except for lactose utilization in a nitrogen-limited environment. Therefore, at both a genetic and a phenotypic level, GM4792 Lac(+) and GM4792 Lac(-), with opposite neutral markers, are ideal systems for future experimental evolution studies.
Sarabia-Sainz, Andre-I; Sarabia-Sainz, Hector Manuel; Montfort, Gabriela Ramos-Clamont; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz
2015-09-16
The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10-17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.
Sarabia-Sainz, Andre-i; Sarabia-Sainz, Hector Manuel; Ramos-Clamont Montfort, Gabriela; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz
2015-01-01
The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896
Yuan, Shaoxin; Gao, Yusong; Ji, Wenqing; Song, Junshuai; Mei, Xue
2018-05-01
The aim of this study was to assess the ability of acute physiology and chronic health evaluation II (APACHE II) score, poisoning severity score (PSS) as well as sequential organ failure assessment (SOFA) score combining with lactate (Lac) to predict mortality in the Emergency Department (ED) patients who were poisoned with organophosphate.A retrospective review of 59 stands-compliant patients was carried out. Receiver operating characteristic (ROC) curves were constructed based on the APACHE II score, PSS, SOFA score with or without Lac, respectively, and the areas under the ROC curve (AUCs) were determined to assess predictive value. According to SOFA-Lac (a combination of SOFA and Lac) classification standard, acute organophosphate pesticide poisoning (AOPP) patients were divided into low-risk and high-risk groups. Then mortality rates were compared between risk levels.Between survivors and non-survivors, there were significant differences in the APACHE II score, PSS, SOFA score, and Lac (all P < .05). The AUCs of the APACHE II score, PSS, and SOFA score were 0.876, 0.811, and 0.837, respectively. However, after combining with Lac, the AUCs were 0.922, 0.878, and 0.956, respectively. According to SOFA-Lac, the mortality of high-risk group was significantly higher than low-risk group (P < .05) and the patients of the non-survival group were all at high risk.These data suggest the APACHE II score, PSS, SOFA score can all predict the prognosis of AOPP patients. For its simplicity and objectivity, the SOFA score is a superior predictor. Lac significantly improved the predictive abilities of the 3 scoring systems, especially for the SOFA score. The SOFA-Lac system effectively distinguished the high-risk group from the low-risk group. Therefore, the SOFA-Lac system is significantly better at predicting mortality in AOPP patients.
2004-12-01
were primarily responsible for the organic chemistry and the analytical chemistry, and to Dr. F . Bikker, Mrs. Roos Mars and Mrs. Helma van Dijk for...study as hosts for bacteriophages: TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36proA+ B+ laclq lacZ AM 15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B...TG1 [K-12 A(lac-pro) supE thi hsdD5/ F ’ traD36 proA+ B+ lacPq lacZ AM15] and HB2151 [K-12 ara A(lac-pro) thi/ F ’ proA+ B+ laclq Z AM15]. Both strains were
NASA Astrophysics Data System (ADS)
Willaarts, Barbara; Garrido, Alberto; Soriano, Barbara; De Stefano, Lucia; López Gunn, Elena; Aldaya, Maite; Martínez-Santos, Pedro; Llamas, Ramon
2014-05-01
Latin American and the Caribbean (LAC) is a water and land abundant region, and plays a key role in meeting global food and water security. During the last decade, LAC has experience a rapid socio-economic growth, largely sustained by its competitive advantage in the production and exports of agricultural and mining products and by the high commodity prices in the global market. This study seeks to quantify the contribution of LAC's agriculture to global food and water security, i.e. virtual water trade, and evaluate the environmental and societal implications for regional development. Results show that between 2000 and 2011, LAC has increase its agricultural production 27%, and it now accounts for nearly 18% of the global agricultural market. As a result, the agricultural water footprint (WF) of LAC was augmented 65%; and yet, nearly 19% to 44% of the actual agricultural WF - depending on the countries - is virtual water exported to third countries. In fact, almost 50% of the increase in global virtual water trade during the last decade, corresponds to LAC. Such global contribution has significant implications for regional water and food security. From an environmental perspective, crop expansion (mostly rain-fed) resulted in the deforestation of nearly 1 million km2, turning this region into the second most important deforestation hotspots worldwide. This land clearing is having large impacts of ecosystem services, e.g. carbon sequestration, water quality or biodiversity conservation. From a socio-economic perspective, increasing agricultural production has improved regional food security indicators, although one every seven children is still stunted in LAC and nearly 10% of the population remains undernourished. Dietary shifts and socio-cultural factors also lag behind the growing problem of malnutrition in the region, i.e. overweight and obesity. Improvements of water access and sanitation, have had a positive impact on food security indicators, especially among the high-income LAC countries. We conclude that despite the large contribution of LAC's agriculture to global water and food security, this goal is at present intensively tapping into LAC's natural capital. Also, regional improvements in water security have improved, but important goals remain and new challenges are emerging. Water governance in LAC is evolving to address the challenges posed by rapid socio-economic changes, however, as is often the case, the implementation of reforms lags behind.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iyer, Sukanya; Karig, David K; Norred, Sarah E
Engineered gene circuits offer an opportunity to harness biological systems for biotechnological and biomedical applications. However, reliance on host E. coli promoters for the construction of circuit elements, such as logic gates, makes implementation of predictable, independently functioning circuits difficult. In contrast, T7 promoters offer a simple orthogonal expression system for use in a variety of cellular backgrounds and even in cell free systems. Here we develop a T7 promoter system that can be regulated by two different transcriptional repressors for the construction of a logic gate that functions in cells and in cell free systems. We first present LacImore » repressible T7lacO promoters that are regulated from a distal lac operator site for repression. We next explore the positioning of a tet operator site within the T7lacO framework to create T7 promoters that respond to tet and lac repressors and realize an IMPLIES gate. Finally, we demonstrate that these dual input sensitive promoters function in a commercially available E. coli cell-free protein expression system. Together, our results contribute to the first demonstration of multi-input regulation of T7 promoters and expand the utility of T7 promoters in cell based as well as cell-free gene circuits.« less
Lactation induces increases in the RANK/RANKL/OPG system in maxillary bone.
Macari, Soraia; Sharma, Lavanya A; Wyatt, Amanda; da Silva, Janine Maíra; Dias, George J; Silva, Tarcília A; Szawka, Raphael E; Grattan, David R
2018-05-01
The underlying causes of maxillary bone loss during lactation remain poorly understood. We evaluated the impact of lactation on physiological and mechanically-induced alveolar bone remodeling. Nulliparous non-lactating (N-LAC) and 21-day lactating (LAC) mice underwent mechanically-induced bone remodeling by orthodontic tooth movement (OTM). Micro-computed tomography (microCT) was performed in the maxilla, femur and vertebra. Tartrate-resistant-acid phosphatase (TRAP) and Masson's trichrome labelling was performed in the maxillary bone and gene expression was determined in the periodontal ligament. The effect of prolactin on osteoclast (OCL) and osteoblast (OBL) differentiation was also investigated in N-LAC and LAC mice. Lactation increased alveolar bone loss in the maxilla, femur and vertebra, while OTM was enhanced. The number of OCL and OBL was higher in the maxilla of LAC mice. OTM increased OCL in both groups; while OBL was increased only in N-LAC but not in LAC mice, in which cell numbers were already elevated. The alveolar bone loss during lactation was associated with increased expression of receptor activator of nuclear factor-KappaB (RANK), RANK ligand (RANKL), and osteoprotegerin (OPG) in the maxilla. OTM induced the same responses in N-LAC mice, whereas it had no further effect in LAC mice. Lactation enhanced differentiation of OCL and OBL from bone marrow cells, and prolactin recapitulated OCL differentiation in N-LAC mice. Thus, lactation increases physiological maxillary bone remodeling and OTM, and both require activation of RANK/RANKL/OPG system. These findings expand our knowledge of lactation-induced osteopenia and have possible impact on clinical practice regarding orthodontic treatments and dental implants in lactating women. Copyright © 2018 Elsevier Inc. All rights reserved.
Crow, V L; Davey, G P; Pearce, L E; Thomas, T D
1983-01-01
The three enzymes of the D-tagatose 6-phosphate pathway (galactose 6-phosphate isomerase, D-tagatose 6-phosphate kinase, and tagatose 1,6-diphosphate aldolase) were absent in lactose-negative (Lac-) derivatives of Streptococcus lactis C10, H1, and 133 grown on galactose. The lactose phosphoenolpyruvate-dependent phosphotransferase system and phospho-beta-galactosidase activities were also absent in Lac- derivatives of strains H1 and 133 and were low (possibly absent) in C10 Lac-. In all three Lac- derivatives, low galactose phosphotransferase system activity was found. On galactose, Lac- derivatives grew more slowly (presumably using the Leloir pathway) than the wild-type strains and accumulated high intracellular concentrations of galactose 6-phosphate (up to 49 mM); no intracellular tagatose 1,6-diphosphate was detected. The data suggest that the Lac phenotype is plasmid linked in the three strains studied, with the evidence being more substantial for strain H1. A Lac- derivative of H1 contained a single plasmid (33 megadaltons) which was absent from the Lac- mutant. We suggest that the genes linked to the lactose plasmid in S. lactis are more numerous than previously envisaged, coding for all of the enzymes involved in lactose metabolism from initial transport to the formation of triose phosphates via the D-tagatose 6-phosphate pathway. Images PMID:6294064
Period Variations of the Eclipsing Binary Systems T LMi and VX Lac
NASA Astrophysics Data System (ADS)
Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.
2015-07-01
We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.
Application of Zoning and ``Limits of Acceptable Change'' to Manage Snorkelling Tourism
NASA Astrophysics Data System (ADS)
Roman, George S. J.; Dearden, Philip; Rollins, Rick
2007-06-01
Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and “Limits of Acceptable Change” (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.
Application of zoning and "limits of acceptable change" to manage snorkelling tourism.
Roman, George S J; Dearden, Philip; Rollins, Rick
2007-06-01
Zoning and applying Limits of Acceptable Change (LAC) are two promising strategies for managing tourism in Marine Protected Areas (MPAs). Typically, these management strategies require the collection and integration of ecological and socioeconomic data. This problem is illustrated by a case study of Koh Chang National Marine Park, Thailand. Biophysical surveys assessed coral communities in the MPA to derive indices of reef diversity and vulnerability. Social surveys assessed visitor perceptions and satisfaction with conditions encountered on snorkelling tours. Notably, increased coral mortality caused a significant decrease in visitor satisfaction. The two studies were integrated to prescribe zoning and "Limits of Acceptable Change" (LAC). As a biophysical indicator, the data suggest a LAC value of 0.35 for the coral mortality index. As a social indicator, the data suggest that a significant fraction of visitors would find a LAC value of under 30 snorkellers per site as acceptable. The draft zoning plan prescribed four different types of zones: (I) a Conservation Zone with no access apart from monitoring or research; (II) Tourism Zones with high tourism intensities at less vulnerable reefs; (III) Ecotourism zones with a social LAC standard of <30 snorkellers per site, and (IV) General Use Zones to meet local artisanal fishery needs. This study illustrates how ecological and socioeconomic field studies in MPAs can be integrated to craft zoning plans addressing multiple objectives.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.
2013-06-01
Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.
Enhanced phenol removal in an innovative lignite activated coke-assisted biological process.
Zhang, Chen; Li, Jianfeng; Cheng, Fangqin; Liu, Yu
2018-07-01
In this study, a lignite activated coke (LAC)-assisted activated sludge (AS) process was developed for enhancing biodegradation of phenol, while the effects of LAC on sludge properties and microbial community structure were investigated. It was found that more than 90% of phenol was removed within 1 h in the LAC/AS, which was 3 times higher than the conventional AS process. Moreover, the floc size and settleability were also significantly improved in the LAC/AS. These results suggested that LAC could serve as the nucleating agent to promote the formation of compact floc, which was beneficial for toxicity mitigation and system stability. The microbial community analysis by 16S high-throughput pyrosequencing technology further revealed a more abundant bacterial richness and diversity in the LAC/AS process loaded with phenol, while some phenol degraders, such as Propionibacteriaceae were enriched. Engineering implications further suggests the LAC-assisted AS process is technically sound and economically viable. Copyright © 2018 Elsevier Ltd. All rights reserved.
Schwartz, Michal; Travesa, Anna; Martell, Steven W; Forbes, Douglass J
2015-01-01
Nuclear pore complexes (NPCs) form the gateway to the nucleus, mediating virtually all nucleocytoplasmic trafficking. Assembly of a nuclear pore complex requires the organization of many soluble sub-complexes into a final massive structure embedded in the nuclear envelope. By use of a LacI/LacO reporter system, we were able to assess nucleoporin (Nup) interactions, show that they occur with a high level of specificity, and identify nucleoporins sufficient for initiation of the complex process of NPC assembly in vivo. Eleven nucleoporins from different sub-complexes were fused to LacI-CFP and transfected separately into a human cell line containing a stably integrated LacO DNA array. The LacI-Nup fusion proteins, which bound to the array, were examined for their ability to recruit endogenous nucleoporins to the intranuclear LacO site. Many could recruit nucleoporins of the same sub-complex and a number could also recruit other sub-complexes. Strikingly, Nup133 and Nup107 of the Nup107/160 subcomplex and Nup153 and Nup50 of the nuclear pore basket recruited a near full complement of nucleoporins to the LacO array. Furthermore, Nup133 and Nup153 efficiently targeted the LacO array to the nuclear periphery. Our data support a hierarchical, seeded assembly pathway and identify Nup133 and Nup153 as effective “seeds” for NPC assembly. In addition, we show that this system can be applied to functional studies of individual nucleoporin domains as well as to specific nucleoporin disease mutations. We find that the R391H cardiac arrhythmia/sudden death mutation of Nup155 prevents both its subcomplex assembly and nuclear rim targeting of the LacO array. PMID:25602437
Teste, Bruno; Vial, Jérôme; Descroix, Stéphanie; Georgelin, Thomas; Siaugue, Jean-Michel; Petr, Jan; Varenne, Anne; Hennion, Marie-Claire
2010-06-15
A chemometric approach was developed to optimize the grafting of a bovine milk allergen: alpha-Lactalbumin (alpha-Lac) on colloidal functionalized magnetic core-shell nanoparticles (MCSNP). Such nanoparticles, functionalized with polyethyleneglycol and amino groups, exhibit a 30nm physical diameter and behave as a quasi-homogeneous system. The alpha-Lac immobilization was achieved through the covalent binding between MCSNP amino groups and alpha-Lac carboxylic moieties using the well-known tandem carbodiimide (EDC) and hydroxysulfosuccinimide (NHS). In this study, a chemometric approach was employed to highlight the parameters influencing the number of grafted proteins on the MCSNP. Three factors were evaluated: the ratio in concentration between EDC and alpha-Lac, between NHS and EDC and the concentration of alpha-Lac. After a first full factorial design to delimit the region of the space where the optimum could be located, a central composite design was then carried out to predict the best grafting conditions. It was established and experimentally confirmed that the optimum parameters are [EDC]/[alpha-Lac]=25; [NHS]/[EDC]=1.55 and alpha-Lac=24.85nmolmL(-1). In these optimal conditions, MCSNP surface was successfully saturated with alpha-Lac (34 alpha-Lac/MCSNP) with a high reproducibility (RSD=2%). The colloidal stability of MCSNP grafted with alpha-Lac as well as the immunological interactions using anti alpha-Lac antibody were then investigated in different buffers. The results emphasized that a 50mM MES buffer (pH 6) allows an efficient immune capture and a satisfying colloidal stability which provide an immunological interaction in homogeneous liquid phase.
de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Xu, H Howard; Chen, Wangxue
2014-05-01
Bacteremia caused by Acinetobacter baumannii is a highly lethal complication of hospital-acquired pneumonia. In the present study, we investigated the serum resistance, gallium nitrate tolerance and heme consumption of A. baumannii strain LAC-4 which was recently reported to display high virulence in a mouse pneumonia model with extrapulmonary dissemination leading to fatal bacteremia. This strain showed enhanced growth in mouse and fetal bovine serum that was independent of complement and was not observed with regular growth media. The LAC-4 strain was found to possess a high tolerance to gallium nitrate (GaN), whereas serum synergized with GaN in inhibiting A. baumannii strain ATCC 17978. We found that LAC-4 contains a heme oxygenase gene and expresses a highly efficient heme consumption system. This system can be fully blocked in vitro and in vivo by gallium protoporphyrin IX (GaPPIX). Inhibition of heme consumption by GaPPIX completely abrogated the growth advantage of LAC-4 in serum as well as its tolerance to GaN. More importantly, GaPPIX treatment of mice intranasally infected with LAC-4 prevented extrapulmonary dissemination and death. Thus, we propose that heme provides an additional source of iron for LAC-4 to bypass iron restriction caused by serum transferrin, lactoferrin or free gallium salts. Heme consumption systems in A. baumannii may constitute major virulence factors for lethal bacteremic isolates. Copyright © 2014 Crown Copyright and Elsevier Inc. Published by Elsevier GmbH.. All rights reserved.
Solving a discrete model of the lac operon using Z3
NASA Astrophysics Data System (ADS)
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Design of the lac gene circuit revisited
Savageau, Michael A.
2011-01-01
The lactose (lac) operon of Escherichia coli serves as the paradigm for gene regulation, not only for bacteria, but also for all biological systems from simple phage to humans. The details of the systems may differ, but the key conceptual framework remains, and the original system continues to reveal deeper insights with continued experimental and theoretical study. Nearly as long lasting in impact as the pivotal work of Jacob and Monod is the classic experiment of Novick and Weiner in which they demonstrated all-or-none gene expression in response to an artificial inducer. These results are often cited in claims that normal gene expression is in fact a discontinuous bistable phenomenon. In this paper, I review several levels of analysis of the lac system and introduce another perspective based on the construction of the system design space. These represent variations on a theme, based on a simply stated design principle, that captures the key qualitative features of the system in a largely mechanism-independent fashion. Moreover, this principle can be readily interpreted in terms of specific mechanisms to make predictions regarding monostable vs. bistable behavior. The regions of design space representing bifurcations are compared with the corresponding regions identified through bifurcation analysis. I present evidence based on biological considerations as well as modeling and analysis to suggest that induction of the lac system in its natural setting is a monostable continuously graded phenomenon. Nevertheless, it must be acknowledged that the lac stability question remains unsettled, and it undoubtedly will remain so until there are definitive experimental results. PMID:21414326
Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A
2017-01-01
The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.
Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii
Zeng, Lin; Martino, Nicole C.
2012-01-01
Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715
Identification of a Dehydrogenase Required for Lactose Metabolism in Caulobacter crescentus▿ †‡
Arellano, Benjamin H.; Ortiz, Janett D.; Manzano, Janet; Chen, Joseph C.
2010-01-01
Caulobacter crescentus, which thrives in freshwater environments with low nutrient levels, serves as a model system for studying bacterial cell cycle regulation and organelle development. We examined its ability to utilize lactose (i) to gain insight into the metabolic capacities of oligotrophic bacteria and (ii) to obtain an additional genetic tool for studying this model organism, aiming to eliminate the basal enzymatic activity that hydrolyzes the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal). Using a previously isolated transposon mutant, we identified a gene, lacA, that is required for growth on lactose as the sole carbon source and for turning colonies blue in the presence of X-gal. LacA, which contains a glucose-methanol-choline (GMC) oxidoreductase domain, has homology to the flavin subunit of Pectobacterium cypripedii's gluconate dehydrogenase. Sequence comparisons indicated that two genes near lacA, lacB and lacC, encode the other subunits of the membrane-bound dehydrogenase. In addition to lactose, all three lac genes are involved in the catabolism of three other β-galactosides (lactulose, lactitol, and methyl-β-d-galactoside) and two glucosides (salicin and trehalose). Dehydrogenase assays confirmed that the lac gene products oxidize lactose, salicin, and trehalose. This enzymatic activity is inducible, and increased lac expression in the presence of lactose and salicin likely contributes to the induction. Expression of lacA also depends on the presence of the lac genes, implying that the dehydrogenase participates in induction. The involvement of a dehydrogenase suggests that degradation of lactose and other sugars in C. crescentus may resemble a proposed pathway in Agrobacterium tumefaciens. PMID:20190087
DOT National Transportation Integrated Search
2014-07-01
Street networks designed to support Transit Oriented Development (TOD) increase accessibility for non-motorized traffic. However, the implications of TOD supportive networks for still dominant vehicular : traffic are rarely addressed. Due to this lac...
NASA Astrophysics Data System (ADS)
Master, Sharad
2010-11-01
Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location over neotectonically reactivated regional lineaments, which are also seismically active. Lac Télé and other similar hydrologic systems may be biodiversity hotspots because they acted as refugia following neotectonic hydrological re-organization of the Congo Basin.
Afzal, Muhammad; Shafeeq, Sulman
2014-01-01
Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into two operons, i.e., lac operon I (lacABCD) and lac operon II (lacTFEG). Deletion of the DeoR family transcriptional regulator lacR that is present downstream of the lac gene cluster revealed elevated expression of lac operon I even in the absence of lactose. This suggests a function of LacR as a transcriptional repressor of lac operon I, which encodes enzymes involved in the phosphorylated tagatose pathway in the absence of lactose or galactose. Deletion of lacR did not affect the expression of lac operon II, which encodes a lactose-specific phosphotransferase. This finding was further confirmed by β-galactosidase assays with PlacA-lacZ and PlacT-lacZ in the presence of either lactose or glucose as the sole carbon source in the medium. This suggests the involvement of another transcriptional regulator in the regulation of lac operon II, which is the BglG-family transcriptional antiterminator LacT. We demonstrate the role of LacT as a transcriptional activator of lac operon II in the presence of lactose and CcpA-independent regulation of the lac gene cluster in S. pneumoniae. PMID:24951784
Broder, Anna; Putterman, Chaim
2013-01-01
Antiphospholipid antibodies (aPL) play an active role in the pathogenesis of the antiphospholipid syndrome (APS). Primary prevention in APS may be aimed at decreasing existing elevated aPL levels, or preventing high aPL titers and/or lupus anticoagulant (LAC) from developing in the first place. Hydroxychloroquine (HCQ) has been shown in retrospective studies to decrease aPL titers in laboratory studies, and to decrease thrombosis risk in patients with systemic lupus erythematosus (SLE). We investigated an association between HCQ use and persistent aPL and/or LAC in SLE. We identified all patients over 21 years old with SLE from an urban tertiary care center who had aPL and LAC measured on at least 2 occasions at least 12 weeks apart. We defined the presence of persistent LAC+ and/or at least 1 aPL ≥ 40 U [immunoglobulin A (IgA), IgG, or IgM] as the main outcome variable. Among 90 patients included in the study, 17 (19%) had persistent LAC+ and/or at least 1 aPL ≥ 40 U. HCQ use was associated with significantly lower odds of having persistent LAC+ and/or aPL ≥ 40 U (OR 0.21, 95% CI 0.05, 0.79, p = 0.02), adjusted for age, ethnicity, and sex. This is the first study to show that HCQ use is associated with lower odds of having persistently positive LAC and/or aPL. Data from this study provide a basis for the design of future prospective studies investigating the role of HCQ in primary and secondary prevention of APS.
Genome engineering using a synthetic gene circuit in Bacillus subtilis.
Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun
2015-03-31
Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mou, Quanbing; Ma, Yuan; Zhu, Xinyuan; Yan, Deyue
2016-05-28
Targeted drug delivery is a broadly applicable approach for cancer therapy. However, the nanocarrier-based targeted delivery system suffers from batch-to-batch variation, quality concerns and carrier-related toxicity issues. Thus, to develop a carrier-free targeted delivery system with nanoscale characteristics is very attractive. Here, a novel targeting small molecule nanodrug self-delivery system consisting of targeting ligand and chemotherapy drug was constructed, which combined the advantages of small molecules and nano-assemblies together and showed excellent targeting ability and long blood circulation time with well-defined structure, high drug loading ratio and on-demand drug release behavior. As a proof-of-concept, lactose (Lac) and doxorubicin (DOX) were chosen as the targeting ligand and chemotherapy drug, respectively. Lac and DOX were conjugated through a pH-responsive hydrazone group. For its intrinsic amphiphilic property, Lac-DOX conjugate could self-assemble into nanoparticles in water. Both in vitro and in vivo assays indicated that Lac-DOX nanoparticles exhibited enhanced anticancer activity and weak side effects. This novel active targeting nanodrug delivery system shows great potential in cancer therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Structural dynamics of the lac repressor-DNA complex revealed by a multiscale simulation.
Villa, Elizabeth; Balaeff, Alexander; Schulten, Klaus
2005-05-10
A multiscale simulation of a complex between the lac repressor protein (LacI) and a 107-bp-long DNA segment is reported. The complex between the repressor and two operator DNA segments is described by all-atom molecular dynamics; the size of the simulated system comprises either 226,000 or 314,000 atoms. The DNA loop connecting the operators is modeled as a continuous elastic ribbon, described mathematically by the nonlinear Kirchhoff differential equations with boundary conditions obtained from the coordinates of the terminal base pairs of each operator. The forces stemming from the looped DNA are included in the molecular dynamics simulations; the loop structure and the forces are continuously recomputed because the protein motions during the simulations shift the operators and the presumed termini of the loop. The simulations reveal the structural dynamics of the LacI-DNA complex in unprecedented detail. The multiple domains of LacI exhibit remarkable structural stability during the simulation, moving much like rigid bodies. LacI is shown to absorb the strain from the looped DNA mainly through its mobile DNA-binding head groups. Even with large fluctuating forces applied, the head groups tilt strongly and keep their grip on the operator DNA, while the remainder of the protein retains its V-shaped structure. A simulated opening of the cleft of LacI by 500-pN forces revealed the interactions responsible for locking LacI in the V-conformation.
32 CFR 154.8 - Types and scope of personnel security investigations.
Code of Federal Regulations, 2011 CFR
2011-07-01
... interview, NAC, LACs, credit checks, developed character references (3), employment records checks... interview. While the kind of coverage provided for by the SBI determines eligibility for access to SCI, DoD... requiring resolution in the case concerned and generally consist of record checks and/or interviews with...
32 CFR 154.8 - Types and scope of personnel security investigations.
Code of Federal Regulations, 2010 CFR
2010-07-01
... interview, NAC, LACs, credit checks, developed character references (3), employment records checks... interview. While the kind of coverage provided for by the SBI determines eligibility for access to SCI, DoD... requiring resolution in the case concerned and generally consist of record checks and/or interviews with...
Lee, Ji-Yeong; Kwak, Mi-Sun; Roh, Jong-Bok; Kim, Kwang; Sung, Moon-Hee
2017-03-28
Pediococcus pentosaceus ID-7 was isolated from kimchi, a Korean fermented food, and it showed high activity for lactose hydrolysis. The β-galactosidase of P. pentosaceus ID-7 belongs to the GH2 group, which is composed of two distinct proteins. The heterodimeric LacLM type of β-galactosidase found in P. pentosaceus ID-7 consists of two genes partially overlapped, lacL and lacM encoding LacL (72.2 kDa) and LacM (35.4 kDa). In this study, Escherichia coli MM294 was used for the production of LacL, LacM, and LacLM. These three types of recombinant proteins were expressed, purified, and characterized. The specific activities of LacLM and LacL were 339 and 31 U/mg, respectively. However, activity was not detected with LacM alone. The optimal pH of LacLM and LacL was pH 7.5 and pH 7.0, and the optimal temperature of LacLM and LacL was 40°C and 50°C, respectively. The optimal temperature changes indicate that LacLM is able to achieve higher activity at a relatively lower temperature. LacLM was strongly activated by Mg 2+ , Mn 2+ , and Zn 2+ , which was not true for LacL. Consistent with this, EDTA strongly inactivated LacLM and LacL, but the presence of reducing agents did not dramatically alter the activity. Taken together, multiple alignment of amino acid sequences and phylogenetic analysis results of LacL and LacM of P. pentosaceus ID-7 suggest the evolution of LacL into LacLM and that the use of divalent metal ions results in higher activity.
Casas-Zamora, Juan Antonio
2002-01-01
The issue of the reciprocal relationship between health and development has recently taken on greater importance in Latin America and the Caribbean (LAC), given the persistence of extreme poverty and the political and social difficulties due to macroeconomic imbalances and crises of governance. This piece reviews concepts of sustainable human development, social determinants of health in general and of health inequities in particular (gender, ethnic group, income level), and the relationship between health and economic growth in the medium term and the long term. An analysis is made of how persistent poverty in countries of LAC relates to disparities in health conditions, access to health services, and health care financing, as well as to such health determinants as nutrition and environmental sanitation. Health inequities most strongly affect the most excluded and vulnerable sectors of the population. In the face of this situation, the author stresses that putting a priority on health inequities is vital to safeguarding the governability and the social and political stability of countries in LAC in the next decade.
Louisiana SIP: LAC 33:III Ch. 5 Section 509. Prevention of Significant Deterioration; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) and 1991-07-01 (LAc57) and 1996-12-16 (LAc69) to 2011-08-17 (LAd36 - Revised)
Regulatory Circuitry of the CsrA/CsrB and BarA/UvrY Systems of Escherichia coli
Suzuki, Kazushi; Wang, Xin; Weilbacher, Thomas; Pernestig, Anna-Karin; Melefors, Öjar; Georgellis, Dimitris; Babitzke, Paul; Romeo, Tony
2002-01-01
The global regulator CsrA (carbon storage regulator) is an RNA binding protein that coordinates central carbon metabolism, activates flagellum biosynthesis and motility, and represses biofilm formation in Escherichia coli. CsrA activity is antagonized by the untranslated RNA CsrB, to which it binds and forms a globular ribonucleoprotein complex. CsrA indirectly activates csrB transcription, in an apparent autoregulatory mechanism. In the present study, we elucidate the intermediate regulatory circuitry of this system. Mutations affecting the BarA/UvrY two-component signal transduction system decreased csrB transcription but did not affect csrA′-′lacZ expression. The uvrY defect was severalfold more severe than that of barA. Both csrA and uvrY were required for optimal barA expression. The latter observation suggests an autoregulatory loop for UvrY. Ectopic expression of uvrY suppressed the csrB-lacZ expression defects caused by uvrY, csrA, or barA mutations; csrA suppressed csrA or barA defects; and barA complemented only the barA mutation. Purified UvrY protein stimulated csrB-lacZ expression approximately sixfold in S-30 transcription-translation reactions, revealing a direct effect of UvrY on csrB transcription. Disruption of sdiA, which encodes a LuxR homologue, decreased the expression of uvrY′-′lacZ and csrB-lacZ fusions but did not affect csrA′-′lacZ. The BarA/UvrY system activated biofilm formation. Ectopic expression of uvrY stimulated biofilm formation by a csrB-null mutant, indicative of a CsrB-independent role for UvrY in biofilm development. Collectively, these results demonstrate that uvrY resides downstream from csrA in a signaling pathway for csrB and that CsrA stimulates UvrY-dependent activation of csrB expression by BarA-dependent and -independent mechanisms. PMID:12193630
Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise
2011-01-01
Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792
Galactose transport in Kluyveromyces lactis: major role of the glucose permease Hgt1.
Baruffini, Enrico; Goffrini, Paola; Donnini, Claudia; Lodi, Tiziana
2006-12-01
In Kluyveromyces lactis, galactose transport has been thought to be mediated by the lactose permease encoded by LAC12. In fact, a lac12 mutant unable to grow on lactose did not grow on galactose either and showed low and uninducible galactose uptake activity. The existence of other galactose transport systems, at low and at high affinity, had, however, been hypothesized on the basis of galactose uptake kinetics studies. Here we confirmed the existence of a second galactose transporter and we isolated its structural gene. It turned out to be HGT1, previously identified as encoding the high-affinity glucose carrier. Analysis of galactose transporter mutants, hgt1 and lac12, and the double mutant hgt1lac12, suggested that Hgt1 was the high-affinity and Lac12 was the low-affinity galactose transporter. HGT1 expression was strongly induced by galactose and insensitive to glucose repression. This could explain the rapid adaptation to galactose observed in K. lactis after a shift from glucose to galactose medium.
Investigating Self-Perceptions and Resilience in Looked after Children
ERIC Educational Resources Information Center
Honey, Kyla L.; Rees, Paul; Griffey, Simon
2011-01-01
The perceptions of Looked After Children (LAC; n = 51), their Designated Teachers (DTs), and a sample of non-LAC (n = 99) were elicited. LAC held more positive self-perceptions than the non-LAC, and similarly positive ratings were given for the LAC by their DTs; but LAC held lower career aspirations than the non-LAC. LAC differed in their levels…
Jans, Christoph; Follador, Rainer; Hochstrasser, Mira; Lacroix, Christophe; Meile, Leo; Stevens, Marc J A
2013-03-22
Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC.We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ.Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations.
2013-01-01
Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and investigation of the unclear association of dairy and clinical Sii with human diseases. Conclusions The genome of the African dairy isolate Sii CJ18 clearly differs from the human isolate ATCC BAA-102T. CJ18 possesses a high natural competence predisposition likely explaining the enlarged genome. Metabolic adaptations to the dairy environment are evident and especially lactose uptake corresponds to S. thermophilus. Genome decay is not as advanced as in S. thermophilus (10-19%) possibly due to a shorter history in dairy fermentations. PMID:23521820
NASA Astrophysics Data System (ADS)
Zasche, P.
2016-01-01
The available photometry from the online databases were used for the first light curve analysis of eight eclipsing binary systems EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri. All these stars are of Algol-type, having the detached components and the orbital periods from 0.92 to 6.8 days. For the systems EI Aur and BP Dra the large amount of the third light was detected during the light curve solution. Moreover, 468 new times of minima for these binaries were derived, trying to identify the period variations. For the systems XY Dra and VX Lac the third bodies were detected with the periods 17.7, and 49.3 years, respectively.
Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.
Santillán, Moisés; Mackey, Michael C
2008-08-06
In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.
Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27
Family Planning in the Context of Latin America's Universal Health Coverage Agenda.
Fagan, Thomas; Dutta, Arin; Rosen, James; Olivetti, Agathe; Klein, Kate
2017-09-27
Countries in Latin America and the Caribbean (LAC) have substantially improved access to family planning over the past 50 years. Many have also recently adopted explicit declarations of universal rights to health and universal health coverage (UHC) and have begun implementing UHC-oriented health financing schemes. These schemes will have important implications for the sustainability and further growth of family planning programs throughout the region. We examined the status of contraceptive methods in major health delivery and financing schemes in 9 LAC countries. Using a set of 37 indicators on family planning coverage, family planning financing, health financing, and family planning inclusion in UHC-oriented schemes, we conducted a desk review of secondary sources, including population surveys, health financing assessments, insurance enrollment reports, and unit cost estimates, and interviewed in-country experts. Findings: Although the modern contraceptive prevalence rate (mCPR) has continued to increase in the majority of LAC countries, substantial disparities in access for marginalized groups remain. On average, mCPR is 20% lower among indigenous women than the general population, 5% lower among uninsured women than insured, and 7% lower among the poorest women than the wealthiest. Among the poorest quintile of women, insured women had an mCPR 16.5 percentage points higher than that of uninsured women, suggesting that expansion of insurance coverage is associated with increased family planning access and use. In the high- and upper-middle-income countries we reviewed, all modern contraceptive methods are typically available through the social health insurance schemes that cover a majority of the population. However, in low- and lower-middle-income countries, despite free provision of most family planning services in public health facilities, stock-outs and implicit rationing present substantial barriers that prevent clients from accessing their preferred method or force them to pay out of pocket. Leveraging UHC-oriented schemes to sustain and further increase family planning progress will require that governments take deliberate steps to (1) target poor and informal sector populations, (2) include family planning in benefits packages, (3) ensure sufficient financing for family planning, and (4) reduce nonfinancial barriers to access. Through these steps, countries can increase financial protection for family planning and better ensure the right to health of poor and marginalized populations. © Fagan et al.
Family Planning in the Context of Latin America's Universal Health Coverage Agenda
Fagan, Thomas; Dutta, Arin; Rosen, James; Olivetti, Agathe; Klein, Kate
2017-01-01
ABSTRACT Background: Countries in Latin America and the Caribbean (LAC) have substantially improved access to family planning over the past 50 years. Many have also recently adopted explicit declarations of universal rights to health and universal health coverage (UHC) and have begun implementing UHC-oriented health financing schemes. These schemes will have important implications for the sustainability and further growth of family planning programs throughout the region. Methods: We examined the status of contraceptive methods in major health delivery and financing schemes in 9 LAC countries. Using a set of 37 indicators on family planning coverage, family planning financing, health financing, and family planning inclusion in UHC-oriented schemes, we conducted a desk review of secondary sources, including population surveys, health financing assessments, insurance enrollment reports, and unit cost estimates, and interviewed in-country experts. Findings: Although the modern contraceptive prevalence rate (mCPR) has continued to increase in the majority of LAC countries, substantial disparities in access for marginalized groups remain. On average, mCPR is 20% lower among indigenous women than the general population, 5% lower among uninsured women than insured, and 7% lower among the poorest women than the wealthiest. Among the poorest quintile of women, insured women had an mCPR 16.5 percentage points higher than that of uninsured women, suggesting that expansion of insurance coverage is associated with increased family planning access and use. In the high- and upper-middle-income countries we reviewed, all modern contraceptive methods are typically available through the social health insurance schemes that cover a majority of the population. However, in low- and lower-middle-income countries, despite free provision of most family planning services in public health facilities, stock-outs and implicit rationing present substantial barriers that prevent clients from accessing their preferred method or force them to pay out of pocket. Conclusion: Leveraging UHC-oriented schemes to sustain and further increase family planning progress will require that governments take deliberate steps to (1) target poor and informal sector populations, (2) include family planning in benefits packages, (3) ensure sufficient financing for family planning, and (4) reduce nonfinancial barriers to access. Through these steps, countries can increase financial protection for family planning and better ensure the right to health of poor and marginalized populations. PMID:28765156
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Lightning Arrestor Connectors Production Readiness
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marten, Steve; Linder, Kim; Emmons, Jim
2008-10-20
The Lightning Arrestor Connector (LAC), part “M”, presented opportunities to improve the processes used to fabricate LACs. The A## LACs were the first production LACs produced at the KCP, after the product was transferred from Pinnellas. The new LAC relied on the lessons learned from the A## LACs; however, additional improvements were needed to meet the required budget, yield, and schedule requirements. Improvement projects completed since 2001 include Hermetic Connector Sealing Improvement, Contact Assembly molding Improvement, development of a second vendor for LAC shells, general process improvement, tooling improvement, reduction of the LAC production cycle time, and documention of themore » LAC granule fabrication process. This report summarizes the accomplishments achieved in improving the LAC Production Readiness.« less
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-08-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).
Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun
2016-01-01
Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563
Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies
NASA Astrophysics Data System (ADS)
Beckmann, V.
2000-12-01
The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects which contribute to the BL Lac phenomenon. I also suggest an extension of the BL Lac definition to objects with a calcium break up to 40%, but do not support for the HBL the idea of allowing emission lines in the spectra of BL Lac galaxies. A way to find high redshift BL Lac objects might be the identification of faint X-ray sources (e.g. from the ROSAT All-Sky Survey) with neither optical nor radio counterpart in prominent databases (e.g. POSS plates for the optical, and NVSS/FIRST radio catalogues). The Seyfert II survey on the southern hemisphere derived a sample of 29 galaxies with 22 in a complete sample. The selection procedure developed in this work is able to select Seyfert II candidates with a success rate of ~40%. The Seyfert II galaxies outnumber the Seyfert I by a factor of 3...4 when comparing the total flux of the objects, but are less numerous than the type I objects when studying the core luminosity function. This luminosity function of the Seyfert II cores is the first one presented up to now. Hence it is possible to estimate the number of luminous Type II AGN, and the conclusion is drawn that absorbed AGN with MV < -28 mag might not exist within the universe. In 25 % of the Seyfert II galaxies I find evidence for merging events. In collaboration with Roberto Della Ceca I also showed that it is possible to find Type II AGN by selecting "hard" X-ray sources. I present a prototype of a Type II AGN found within this project. This work might be the basis to explore the universe for rare objects like BL Lacs and Seyfert II galaxies at higher redshifts. This could give an answer to the question: Whether there are BL Lac objects at redshifts z >> 1 and Type II Quasars or not. In summary the AGN phenomenon appears to be linked closely to merging and interacting events. For the BL Lac phenomenon the merging area seems to form the progenitor, while the Seyfert II phenomenon could be triggered by merging events. The role of star burst activity in terms of activity of the central engine remains illusive.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Zieg, J; Maples, V F; Kushner, S R
1978-01-01
Escherichia coli strains containing mutations in lexA, rep, uvrA, uvrD, uvrE, lig, polA, dam, or xthA were constructed and tested for conjugation and transduction proficiencies and ability to form Lac+ recombinants in an assay system utilizing a nontandem duplication of two partially deleted lactose operons (lacMS286phi80dIIlacBK1). lexA and rep mutants were as deficient (20% of wild type) as recB and recC strains in their ability to produce Lac+ progeny. All the other strains exhibited increased frequencies of Lac+ recombinant formation, compared with wild type, ranging from 2- to 13-fold. Some strains showed markedly increased conjugation proficiency (dam uvrD) compared to wild type, while others appeared deficient (polA107). Some differences in transduction proficiency were also observed. Analysis of the Lac+ recombinants formed by the various mutants indicated that they were identical to the recombinants formed by a wild-type strain. The results indicate that genetic recombination in E. coli is a highly regulated process involving multiple gene products. PMID:350859
NASA Astrophysics Data System (ADS)
Shi, Shukai; Wang, Xin; Chen, Weimin; Chen, Minzhi; Zhou, Xiaoyan
2018-05-01
The as-prepared lignin-based activated carbon (LAC) was post-treated by urea and radio-frequency cold plasma separately. The obtained results demonstrated that the BET surface and total volumes of the LAC and plasma-treated LACs were greater than the urea-modified sample. The analysis of surface elemental composition showed that the nitrogen content of urea-modified LAC and nitrogen plasma-treated LAC are 3.79% and 2.62% higher than that of original LAC respectively, while the oxygen content of air plasma-treated LAC is 10.23% higher than that of original LAC. The Fe(III) ions adsorbed studies with pseudo-second order kinetic model revealed that urea-modified LAC had faster chemisorption rates while air plasma-treated LAC had larger adsorption capacity within 3 h. Moreover, the adsorption capacity and chemisorption rates of LAC post-treated by nitrogen plasma are inferior to the air plasma-treated LAC.
Li, Qiao; Hoffmann, Benjamin D.; Zhang, Wei
2014-01-01
This study investigated the effects of ant attendance on the parasitoid community and parasitism of lac insect Kerria yunnanensis aggregations in Yunnan province, China. We manipulated ant attendance to establish three treatments: (1) ant exclusion; (2) low ant attendance by several ant species; and (3) high ant attendance by Crematogaster macaoensis. Five parasitoid species were collected, with two species contributing 82.7 and 13.2% of total abundance respectively. Total parasitoid abundance was lowest in the February sample when K. yunnanensis was in its younger life stage, being significantly lower in the ant exclusion treatment. In April, all three treatments had significantly different parasitoid abundances, being highest in the ant exclusion treatment and the lowest in the high ant attendance treatment. When ants were present, there were strong negative relationships between total parasitoid abundance and ant abundance, with the relationships being dependent upon the ant species composition and abundance. The patterns of total parasitoid abundance were driven by the two most abundant parasitoid species. Parasitoid species richness did not differ among treatments or between sample times, however, multivariate analysis confirmed that overall parasitoid community structure differed significantly among treatments and between sample times, with the high ant attendance treatment differing most from the other two treatments. Interestingly the absence of ants did not result in increased parasitism from four of the five parasitoids. Ants in lac insect farming systems have a clear role for agricultural pest management. A full understanding of the asymmetric abilities of ants to influence parasitoid communities, and affect parasitism of hosts will require further experimental manipulation to assess the relative roles of 1) the abundance of each individual ant species on parasitoid access to hosts, 2) competition among parasitoids, and 3) the interaction between the first two factors. PMID:24887398
Poverty and Policy in Latin America and the Caribbean. World Bank Technical Paper No. 467.
ERIC Educational Resources Information Center
Wodon, Quentin T.
Although the progress toward poverty reduction remains sluggish, other dimensions of social welfare in the Latin American and Caribbean (LAC) region show signs of improvement. Adult literacy and school enrollment rates, life expectancy at birth, access to safe water, and nutrition indicators are improving. However, other factors demonstrate that…
Hoffmann, Stefan A.; Kruse, Sabrina M.; Arndt, Katja M.
2016-01-01
Abstract We have investigated transcriptional interference between convergent genes in E. coli and demonstrate substantial interference for inter-promoter distances of as far as 3 kb. Interference can be elicited by both strong σ70 dependent and T7 promoters. In the presented design, a strong promoter driving gene expression of a ‘forward’ gene interferes with the expression of a ‘reverse’ gene by a weak promoter. This arrangement allows inversely correlated gene expression without requiring further regulatory components. Thus, modulation of the activity of the strong promoter alters expression of both the forward and the reverse gene. We used this design to develop a dual selection system for conditional operator site binding, allowing positive selection both for binding and for non-binding to DNA. This study demonstrates the utility of this novel system using the Lac repressor as a model protein for conditional DNA binding, and spectinomycin and chloramphenicol resistance genes as positive selection markers in liquid culture. Randomized LacI libraries were created and subjected to subsequent dual selection, but mispairing IPTG and selection cues in respect to the wild-type LacI response, allowing the isolation of a LacI variant with a reversed IPTG response within three rounds of library generation and dual selection. PMID:26932362
NASA Astrophysics Data System (ADS)
Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka; Lorenz, Ralph; Yair, Yoav; Aplin, Karen; Fischer, Georg; Nakamura, Masato; Ishii, Nobuaki; Abe, Takumi; Satoh, Takehiko; Imamura, Takeshi; Hirose, Chikako; Suzuki, Makoto; Hashimoto, George L.; Hirata, Naru; Yamazaki, Atsushi; Sato, Takao M.; Yamada, Manabu; Murakami, Shin-ya; Yamamoto, Yukio; Fukuhara, Tetsuya; Ogohara, Kazunori; Ando, Hiroki; Sugiyama, Ko-ichiro; Kashimura, Hiroki; Ohtsuki, Shoko
2018-05-01
The existence of lightning discharges in the Venus atmosphere has been controversial for more than 30 years, with many positive and negative reports published. The lightning and airglow camera (LAC) onboard the Venus orbiter, Akatsuki, was designed to observe the light curve of possible flashes at a sufficiently high sampling rate to discriminate lightning from other sources and can thereby perform a more definitive search for optical emissions. Akatsuki arrived at Venus during December 2016, 5 years following its launch. The initial operations of LAC through November 2016 have included a progressive increase in the high voltage applied to the avalanche photodiode detector. LAC began lightning survey observations in December 2016. It was confirmed that the operational high voltage was achieved and that the triggering system functions correctly. LAC lightning search observations are planned to continue for several years.
Johnson, Philip L; Fitz, Stephanie D; Engleman, Eric A; Svensson, Kjell A; Schkeryantz, Jeffrey M; Shekhar, Anantha
2015-01-01
Rats with chronic inhibition of GABA synthesis by infusion of l-allyglycine, a glutamic acid decarboxylase inhibitor, into their dorsomedial/perifornical hypothalamus are anxious and exhibit panic-like cardio-respiratory responses to treatment with intravenous (i.v.) sodium lactate (NaLac) infusions, in a manner similar to what occurs in patients with panic disorder. We previously showed that either NMDA receptor antagonists or metabotropic glutamate receptor type 2/3 receptor agonists can block such a NaLac response, suggesting that a glutamate mechanism is contributing to this panic-like state. Using this animal model of panic, we tested the efficacy of CBiPES and THIIC, which are selective group II metabotropic glutamate type 2 receptor allosteric potentiators (at 10–30mg/kg i.p.), in preventing NaLac-induced panic-like behavioral and cardiovascular responses. The positive control was alprazolam (3mg/kg i.p.), a clinically effective anti-panic benzodiazepine. As predicted, panic-prone rats given a NaLac challenge displayed NaLac-induced panic-like cardiovascular (i.e. tachycardia and hypertensive) responses and “anxiety” (i.e. decreased social interaction time) and “flight” (i.e. increased locomotion) -associated behaviors; however, systemic injection of the panic-prone rats with CBiPES, THIIC or alprazolam prior to the NaLac dose blocked all NaLac-induced panic-like behaviors and cardiovascular responses. These data suggested that in a rat animal model, selective group II metabotropic glutamate type 2 receptor allosteric potentiators show an anti-panic efficacy similar to alprazolam. PMID:22914798
Rosey, E L; Oskouian, B; Stewart, G C
1991-01-01
The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695
Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon
Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier
2008-01-01
Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364
Kadam, Avinash A; Jang, Jiseon; Lee, Dae Sung
2017-05-10
Halloysite nanotubes (HNTs) were tuned with supermagnetic Fe 3 O 4 (M-HNTs) and functionalized with γ-aminopropyltriethoxysilane (APTES) (A-M-HNTs). Gluteraldehyde (GTA) was linked to A-M-HNTs (A-M-HNTs-GTA) and explored for covalent laccase immobilization. The structural characterization of M-HNTs, A-M-HNTs, and A-M-HNTs-GTA-immobilized laccase (A-M-HNTs-GTA-Lac) was determined by X-ray photoelectron spectroscopy, field-emission high-resolution transmission electron microscopy, a magnetic property measurement system, and thermogavimetric analyses. A-M-HNTs-GTA-Lac gave 90.20% activity recovery and a loading capability of 84.26 mg/g, with highly improved temperature and storage stabilities. Repeated usage of A-M-HNTs-GTA-Lac revealed a remarkably consistent relative activity of 80.49% until the ninth cycle. The A-M-HNTs-GTA-Lac gave consistent redox-mediated sulfamethoxazole (SMX) degradation up to the eighth cycle. In the presence of guaiacol, A-M-HNTs-GTA-Lac gave elevated SMX degradation compared with 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) and syrinialdehyde. Therefore, the A-M-HNTs can serve as supermagnetic amino-functionalized nanoreactors for biomacromolecule immobilization. The obtained A-M-HNTs-GTA-Lac is an environmentally friendly biocatalyst for effective degradation of micropollutants, such as SMX, and can be easily retrieved from an aqueous solution by a magnet after decontamination of pollutants in water and wastewater.
Standardized emergency management system and response to a smallpox emergency.
Kim-Farley, Robert J; Celentano, John T; Gunter, Carol; Jones, Jessica W; Stone, Rogelio A; Aller, Raymond D; Mascola, Laurene; Grigsby, Sharon F; Fielding, Jonathan E
2003-01-01
The smallpox virus is a high-priority, Category-A agent that poses a global, terrorism security risk because it: (1) easily can be disseminated and transmitted from person to person; (2) results in high mortality rates and has the potential for a major public health impact; (3) might cause public panic and social disruption; and (4) requires special action for public health preparedness. In recognition of this risk, the Los Angeles County Department of Health Services (LAC-DHS) developed the Smallpox Preparedness, Response, and Recovery Plan for LAC to prepare for the possibility of an outbreak of smallpox. A unique feature of the LAC-DHS plan is its explicit use of the Standardized Emergency Management System (SEMS) framework for detailing the functions needed to respond to a smallpox emergency. The SEMS includes the Incident Command System (ICS) structure (management, operations, planning/intelligence, logistics, and finance/administration), the mutual-aid system, and the multi/interagency coordination required during a smallpox emergency. Management for incident command includes setting objectives and priorities, information (risk communications), safety, and liaison. Operations includes control and containment of a smallpox outbreak including ring vaccination, mass vaccination, adverse events monitoring and assessment, management of confirmed and suspected smallpox cases, contact tracing, active surveillance teams and enhanced hospital-based surveillance, and decontamination. Planning/intelligence functions include developing the incident action plan, epidemiological investigation and analysis of smallpox cases, and epidemiological assessment of the vaccination coverage status of populations at risk. Logistics functions include receiving, handling, inventorying, and distributing smallpox vaccine and vaccination clinic supplies; personnel; transportation; communications; and health care of personnel. Finally, finance/administration functions include monitoring costs related to the smallpox emergency, procurement, and administrative aspects that are not handled by other functional divisions of incident command systems. The plan was developed and is under frequent review by the LAC-DHS Smallpox Planning Working Group, and is reviewed periodically by the LAC Bioterrorism Advisory Committee, and draws upon the Smallpox Response Plan and Guidelines of the Centers for Disease Control and Prevention (CDC) and recommendations of the Advisory Committee on Immunization Practices (ACIP). The Smallpox Preparedness, Response, and Recovery Plan, with its SEMS framework and ICS structure, now is serving as a model for the development of LAC-DHS plans for responses to other terrorist or natural-outbreak responses.
Kim, Hong-Il; Kwon, O-Chul; Kong, Won-Sik; Lee, Chang-Soo
2014-01-01
The aim of this study was to identify and characterize new Flammulina velutipes laccases from its whole-genome sequence. Of the 15 putative laccase genes detected in the F. velutipes genome, four new laccase genes (fvLac-1, fvLac-2, fvLac3, and fvLac-4) were found to contain four complete copper-binding regions (ten histidine residues and one cysteine residue) and four cysteine residues involved in forming disulfide bridges, fvLac-1, fvLac-2, fvLac3, and fvLac-4, encoding proteins consisting of 516, 518, 515, and 533 amino acid residues, respectively. Potential N-glycosylation sites (Asn-Xaa-Ser/Thr) were identified in the cDNA sequence of fvLac-1 (Asn-454), fvLac-2 (Asn-437 and Asn-455), fvLac-3 (Asn-111 and Asn-237), and fvLac4 (Asn-402 and Asn-457). In addition, the first 19~20 amino acid residues of these proteins were predicted to comprise signal peptides. Laccase activity assays and reverse transcription polymerase chain reaction analyses clearly reveal that CuSO4 affects the induction and the transcription level of these laccase genes. PMID:25606003
Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A
2009-08-01
Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.
Experiencing limits of acceptable change: some thoughts after a decade of implementation
Stephen F. McCool; David N. Cole
1997-01-01
Wilderness managers and researchers have experienced implementation of the Limits of Acceptable Change planning system for over a decade. In a sense, implementation of LAC has been a broad scale experiment in planning, with the hypothesis being that LAC processes are more effective approaches to deal with questions of recreation management in protected areas than the...
Artim-Esen, Bahar; Çene, Erhan; Şahinkaya, Yasemin; Ertan, Semra; Pehlivan, Özlem; Kamali, Sevil; Gül, Ahmet; Öcal, Lale; Aral, Orhan; Inanç, Murat
2014-07-01
Associations between autoantibodies and clinical features have been described in systemic lupus erythematosus (SLE). Herein, we aimed to define autoantibody clusters and their clinical correlations in a large cohort of patients with SLE. We analyzed 852 patients with SLE who attended our clinic. Seven autoantibodies were selected for cluster analysis: anti-DNA, anti-Sm, anti-RNP, anticardiolipin (aCL) immunoglobulin (Ig)G or IgM, lupus anticoagulant (LAC), anti-Ro, and anti-La. Two-step clustering and Kaplan-Meier survival analyses were used. Five clusters were identified. A cluster consisted of patients with only anti-dsDNA antibodies, a cluster of anti-Sm and anti-RNP, a cluster of aCL IgG/M and LAC, and a cluster of anti-Ro and anti-La antibodies. Analysis revealed 1 more cluster that consisted of patients who did not belong to any of the clusters formed by antibodies chosen for cluster analysis. Sm/RNP cluster had significantly higher incidence of pulmonary hypertension and Raynaud phenomenon. DsDNA cluster had the highest incidence of renal involvement. In the aCL/LAC cluster, there were significantly more patients with neuropsychiatric involvement, antiphospholipid syndrome, autoimmune hemolytic anemia, and thrombocytopenia. According to the Systemic Lupus International Collaborating Clinics damage index, the highest frequency of damage was in the aCL/LAC cluster. Comparison of 10 and 20 years survival showed reduced survival in the aCL/LAC cluster. This study supports the existence of autoantibody clusters with distinct clinical features in SLE and shows that forming clinical subsets according to autoantibody clusters may be useful in predicting the outcome of the disease. Autoantibody clusters in SLE may exhibit differences according to the clinical setting or population.
Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.
Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C
2017-01-01
The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.
Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)
Light Curve and Orbital Period Analysis of VX Lac
NASA Astrophysics Data System (ADS)
Yılmaz, M.; Nelson, R. H.; Şenavcı, H. V.; İzci, D.; Özavcı, İ.; Gümüş, D.
2017-04-01
In this study, we performed simultaneously light curve and radial velocity, and also period analyses of the eclipsing binary system VX Lac. Four color (BVRI) light curves of the system were analysed using the W-D code. The results imply that VX Lac is a classic Algol-type binary with a mass ratio of q=0.27, of which the less massive secondary component fills its Roche lobe. The orbital period behaviour of the system was analysed by assuming the light time effect (LITE) from a third body. The O-C analysis yielded a mass transfer rate of dM/dt=1.86×10-8M⊙yr-1 and the minimal mass of the third body to be M3=0.31M⊙. The residuals from mass transfer and the third body were also analysed because another cyclic variation is seen in O-C diagram. This periodic variation was examined under the hypotheses of stellar magnetic activity and fourth body.
Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364
Lee, Jung-Kul; Pan, Cheol-Ho
2013-01-01
D-Galactose-6-phosphate isomerase from Lactobacillus rhamnosus (LacAB; EC 5.3.1.26), which is encoded by the tagatose-6-phosphate pathway gene cluster (lacABCD), catalyzes the isomerization of D-galactose-6-phosphate to D-tagatose-6-phosphate during lactose catabolism and is used to produce rare sugars as low-calorie natural sweeteners. The crystal structures of LacAB and its complex with D-tagatose-6-phosphate revealed that LacAB is a homotetramer of LacA and LacB subunits, with a structure similar to that of ribose-5-phosphate isomerase (Rpi). Structurally, LacAB belongs to the RpiB/LacAB superfamily, having a Rossmann-like αβα sandwich fold as has been identified in pentose phosphate isomerase and hexose phosphate isomerase. In contrast to other family members, the LacB subunit also has a unique α7 helix in its C-terminus. One active site is distinctly located at the interface between LacA and LacB, whereas two active sites are present in RpiB. In the structure of the product complex, the phosphate group of D-tagatose-6-phosphate is bound to three arginine residues, including Arg-39, producing a different substrate orientation than that in RpiB, where the substrate binds at Asp-43. Due to the proximity of the Arg-134 residue and backbone Cα of the α6 helix in LacA to the last Asp-172 residue of LacB with a hydrogen bond, a six-carbon sugar-phosphate can bind in the larger pocket of LacAB, compared with RpiB. His-96 in the active site is important for ring opening and substrate orientation, and Cys-65 is essential for the isomerization activity of the enzyme. Two rare sugar substrates, D-psicose and D-ribulose, show optimal binding in the LacAB-substrate complex. These findings were supported by the results of LacA activity assays. PMID:24015281
Lebrun, Jérémie D; Demont-Caulet, Nathalie; Cheviron, Nathalie; Laval, Karine; Trinsoutrot-Gattin, Isabelle; Mougin, Christian
2011-01-01
The relationship between the expression of extracellular enzymatic system and a metal stress is scarce in fungi, hence limiting the possible use of secretion profiles as tools for metal ecotoxicity assessment. In the present study, we investigated the effect of Zn, Cu, Pb and Cd, tested alone or in equimolar cocktail, on the secretion profiles at enzymatic and protein levels in Trametesversicolor. For that purpose, extracellular hydrolases (acid phosphatase, β-glucosidase, β-galactosidase and N-acetyl-β-glucosaminidase) and ligninolytic oxidases (laccase, Mn-peroxidase) were monitored in liquid cultures. Fungal secretome was analyzed by electrophoresis and laccase secretion was characterized by western-blot and mass spectrometry analyses. Our results showed that all hydrolase activities were inhibited by the metals tested alone or in cocktail, whereas oxidase activities were specifically stimulated by Cu, Cd and metal cocktail. At protein level, metal exposure modified the electrophoretic profiles of fungal secretome and affected the diversity of secreted proteins. Two laccase isoenzymes, LacA and LacB, identified by mass spectrometry were differentially glycosylated according to the metal exposure. The amount of secreted LacA and LacB was strongly correlated with the stimulation of laccase activity by Cu, Cd and metal cocktail. These modifications of extracellular enzymatic system suggest that fungal oxidases could be used as biomarkers of metal exposure. Copyright © 2010 Elsevier Ltd. All rights reserved.
Extraction of organic materials from red water by metal-impregnated lignite activated carbon.
Wei, Fangfang; Zhang, Yihe; Lv, Fengzhu; Chu, Paul K; Ye, Zhengfang
2011-12-15
Extraction of organic materials from 2,4,6-trinitrotoluene (TNT) red water by lignite activated carbon (LAC) impregnated with Cu(2+), Ba(2+), Sn(2+), Fe(3+), Ca(2+) and Ag(+) was investigated. The affinity to organic materials in red water was found to follow the order: Cu/LAC>Sn/LAC>Ag/LAC>Ba/LAC>Fe/LAC>Ca/LAC, which was explained by the hard and soft acid base (HSAB) theory. Cu(2+) showed the best performance and several parameters were further studied. X-ray photoelectron spectroscopy (XPS) verified effective loading of Cu(2+) on the LAC surface. The water quality before and after treated by Cu/LAC was evaluated using high performance liquid chromatograph, Gas Chromatography/Mass Spectroscopy (GC/MS), UV-vis spectroscopy and other analyses. The extraction performances and mechanism of organic materials on Cu/LAC were investigated through static methods. The experimental results showed that Cu/LAC possessed stronger extraction ability for the sulfonated nitrotoluenes than the non-sulfonated nitrotoluenes, the kinetic data fitted the pseudo-second-order kinetic model well. In addition, the leaching out of Cu(2+) from Cu/LAC was found much lower in the 100 times diluted red water (0.074%) than in the raw water (10.201%). Column adsorptions with more concentrated red water were also studied. Finally, Cu/LAC was observed to possess excellent reusability as well. Copyright © 2011 Elsevier B.V. All rights reserved.
A Search for Low-Luminosity BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.; Perlman, Eric S.
1999-05-01
Many properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis, whereby BL Lacs are FR 1 radio galaxies viewed nearly along the jet axis. However, a possible problem with this model is that a transition population between beamed BL Lacs and unbeamed FR 1 galaxies has not been detected. A transition population of ``low-luminosity BL Lacs'' was predicted to exist in abundance in X-ray-selected samples such as the Einstein Extended Medium Sensitivity Survey (EMSS) by Browne & Marcha. However, these BL Lacs may have been misidentified as clusters of galaxies. We have conducted a search for such objects in the EMSS with the ROSAT High-Resolution Imager (HRI) here we present ROSAT HRI images, optical spectra, and VLA radio maps for a small number of BL Lacs that were previously misidentified in the EMSS catalog as clusters of galaxies. While these objects are slightly lower in luminosity than other EMSS BL Lacs, their properties are too similar to the other BL Lacs in the EMSS sample to ``bridge the gap'' between BL Lacs and FR 1 radio galaxies. Also, the number of new BL Lacs found is too low to alter significantly the X-ray luminosity function or
Andersen, Joakim M.; Barrangou, Rodolphe; Abou Hachem, Maher; Lahtinen, Sampo; Goh, Yong Jun; Svensson, Birte; Klaenhammer, Todd R.
2011-01-01
Probiotic microbes rely on their ability to survive in the gastrointestinal tract, adhere to mucosal surfaces, and metabolize available energy sources from dietary compounds, including prebiotics. Genome sequencing projects have proposed models for understanding prebiotic catabolism, but mechanisms remain to be elucidated for many prebiotic substrates. Although β-galactooligosaccharides (GOS) are documented prebiotic compounds, little is known about their utilization by lactobacilli. This study aimed to identify genetic loci in Lactobacillus acidophilus NCFM responsible for the transport and catabolism of GOS. Whole-genome oligonucleotide microarrays were used to survey the differential global transcriptome during logarithmic growth of L. acidophilus NCFM using GOS or glucose as a sole source of carbohydrate. Within the 16.6-kbp gal-lac gene cluster, lacS, a galactoside-pentose-hexuronide permease-encoding gene, was up-regulated 5.1-fold in the presence of GOS. In addition, two β-galactosidases, LacA and LacLM, and enzymes in the Leloir pathway were also encoded by genes within this locus and up-regulated by GOS stimulation. Generation of a lacS-deficient mutant enabled phenotypic confirmation of the functional LacS permease not only for the utilization of lactose and GOS but also lactitol, suggesting a prominent role of LacS in the metabolism of a broad range of prebiotic β-galactosides, known to selectively modulate the beneficial gut microbiota. PMID:22006318
Roc, Anne C; Ances, Beau M; Chawla, Sanjeev; Korczykowski, Marc; Wolf, Ronald L; Kolson, Dennis L; Detre, John A; Poptani, Harish
2007-09-01
Single-voxel magnetic resonance spectroscopy measurements of N-acetyl aspartate, choline, and creatine (Cr) are affected in patients with human immunodeficiency virus (HIV) and neurocognitive impairment. However, these metabolic markers are often normalized in affected central nervous system regions, such as the lenticular nuclei, after initiation of highly active antiretroviral therapy (HAART). To examine whether lactate (Lac), a marker of inflammation and anaerobic glycolysis, and lipid, an indicator of cell membrane turnover resulting from oxidative stress, could serve as surrogate biomarkers within the lenticular nuclei of HIV-positive patients with different degrees of neurocognitive impairment. Three-tesla 2-dimensional-chemical shift imaging magnetic resonance spectroscopy at echo times of 30 milliseconds and 135 milliseconds was performed in voxels overlapping the lenticular nuclei of seronegative controls and a spectrum of HIV-positive patients (neurocognitively normal, mildly impaired, or moderately to severely impaired). University of Pennsylvania, Philadelphia. Ten seronegative controls and 45 HIV-positive patients with different degrees of neurocognitive impairment (15 neurocognitively normal patients, 12 mildly impaired patients, and 18 moderately to severely impaired patients). In vivo 2-dimensional-chemical shift imaging magnetic resonance spectroscopy analysis of N-acetyl aspartate:Cr, choline:Cr, Lac:Cr, and (lipid + Lac):Cr ratios among the various groups. In addition, the effect of the degree of HAART central nervous system penetration (high vs low) on these ratios was studied. No significant lenticular nuclei atrophy was detected with volumes similar across all of the groups. Both N-acetyl aspartate:Cr and choline:Cr ratios were similar across all of the groups at either echo time. In contrast, the Lac:Cr ratio was significantly greater in HIV-positive patients with moderate to severe impairment compared with seronegative controls. The (lipid + Lac):Cr ratio was significantly elevated within each HIV-positive subgroup compared with seronegative controls. Within HIV-positive patients receiving HAART, the degree of central nervous system penetration (high vs low) did not affect metabolic ratios. As seen with 2-dimensional-chemical shift imaging magnetic resonance spectroscopy, HIV induces inflammation and oxidative stress in HIV-positive patients despite HAART. Lipid and Lac are more sensitive inflammatory biomarkers that may be used to differentiate HIV-positive subgroups. However, no significant difference in efficacy, as measured by metabolic ratios, exists for high- vs low-central nervous system-penetrating HAART.
Sousa, Filipa L; Parente, Daniel J; Hessman, Jacob A; Chazelle, Allen; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-09-01
The AlloRep database (www.AlloRep.org) (Sousa et al., 2016) [1] compiles extensive sequence, mutagenesis, and structural information for the LacI/GalR family of transcription regulators. Sequence alignments are presented for >3000 proteins in 45 paralog subfamilies and as a subsampled alignment of the whole family. Phenotypic and biochemical data on almost 6000 mutants have been compiled from an exhaustive search of the literature; citations for these data are included herein. These data include information about oligomerization state, stability, DNA binding and allosteric regulation. Protein structural data for 65 proteins are presented as easily-accessible, residue-contact networks. Finally, this article includes example queries to enable the use of the AlloRep database. See the related article, "AlloRep: a repository of sequence, structural and mutagenesis data for the LacI/GalR transcription regulators" (Sousa et al., 2016) [1].
Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])
Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most likely to be fixed as a mutation if it allows the cell to immediately exit the nondividing state. PMID:15020459
Elliott, T
1992-01-01
This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.
Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj
2012-10-23
Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L(-1) in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation.
2012-01-01
Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200 U L-1 in P. pastoris under the control of the AOX1 promoter and purified by a simple three-step procedure to homogeneity. The kinetic parameters against ABTS, Guaiacol and Pyrogallol were similar with the nLac and the rLac. Tryptic finger print analysis of the nLac and the rLac indicated altered glycosylation patterns. Increased thermo-stability and salt tolerance of the rLac was attributed to this changed pattern of glycosylation. PMID:23092193
A structural model for the osmosensor, transporter, and osmoregulator ProP of Escherichia coli.
Wood, Janet M; Culham, Doreen E; Hillar, Alexander; Vernikovska, Yaroslava I; Liu, Feng; Boggs, Joan M; Keates, Robert A B
2005-04-19
Transporter ProP of Escherichia coli, a member of the major facilitator superfamily (MFS), acts as an osmosensor and an osmoregulator in cells and after purification and reconstitution in proteoliposomes. H(+)-osmoprotectant symport via ProP is activated when medium osmolality is elevated with membrane impermeant osmolytes. The three-dimensional structure of ProP was modeled with the crystal structure of MFS member GlpT as a template. This GlpT structure represents the inward (or cytoplasm)-facing conformation predicted by the alternating access model for transport. LacZ-PhoA fusion analysis and site-directed fluorescence labeling substantiated the membrane topology and orientation predicted by this model and most hydropathy analyses. The model predicts the presence of a proton pathway within the N-terminal six-helix bundle of ProP (as opposed to the corresponding pathway found within the C-terminal helix bundle of its paralogue, LacY). Replacement of residues within the N-terminal helix bundle impaired the osmotic activation of ProP, providing the first indication that residues outside the C-terminal domain are involved in osmosensing. Some residues that were accessible from the periplasmic side, as predicted by the structural model, were more susceptible to covalent labeling in permeabilized membrane fractions than in intact bacteria. These residues may be accessible from the cytoplasmic side in structures not represented by our current model, or their limited exposure in vivo may reflect constraints on transporter structure that are related to its osmosensory mechanism.
Bao, Lei; Zhang, Min; Yan, Peixia; Wu, Xiaoyan; Shao, Jun; Zheng, Ruiqiang
2015-01-01
To explore the prognostic value of arterial blood lactate ( Lac ) levels and lactate clearance rate ( LCR ) in the patients with septic shock. A retrospective study was conducted. Clinical data of 94 septic patients admitted in the Department of Critical Care Medicine in Subei People's Hospital from January 2011 to June 2014 were analyzed. The arterial blood Lac levels at the moment of diagnosis of septic shock ( incipient value, 0 hour ) and early-stage after treatment ( 3, 6 and 24 hours ) were reviewed, and individual LCR was calculated at 3, 6, 24 hours for each patient. According to the outcome in intensive care unit ( ICU ), patients were divided into survival group ( n = 48 ) and death group ( n = 46 ). The Lac and LCR at different time points in two groups were analyzed, and the relationships between them and outcome were analyzed. The receiver-operating characteristic ( ROC ) curve was plotted to assess the value of Lac and LCR at different time points for predicting the outcome. Lac level after treatment in survival group was significantly lower than incipient value, but there was no obvious change in death group. Compared with death group, early Lac levels ( mmol/L ) in survival group were significantly reduced ( 0 hour: 3.80±2.14 vs. 5.75±3.21, 3 hours: 2.05±1.04 vs. 5.03±2.53, 6 hours: 1.80±0.77 vs. 4.40±2.02, 24 hours: 1.35±0.43 vs. 4.90±2.72, P<0.05 or P<0.01 ), the LCR was significantly increased [ 3 hours: 50.00 ( 72.35 )% vs. 13.51 ( 20.67 )%, 6 hours: 41.43 ( 58.42 )% vs. 22.00 ( 22.31 )%, 24 hours: 58.73 ( 29.94 )% vs. 18.92 ( 47.28 )%, P<0.05 or P<0.01 ]. The Lac levels at all time points were positively correlated with the outcome, and 6-hour and 24-hour LCR were negatively correlated with the outcome. According to the incipient Lac level, patients were divided into low Lac group ( Lac<2 mmol/L ), mild Lac group ( Lac 2-3 mmol/L ) and high Lac group ( Lac ≥ 4 mmol/L ). The mortality in low Lac group, mild Lac group, high Lac group was gradually increased [ 23.07% ( 6/26 ), 50.00% ( 8/16 ), 61.54% ( 32/52 ), χ(2) = 10.270, P = 0.006 ]. ROC curves demonstrated that the area under ROC curve ( AUC ) of 24-hour Lac was the largest, 0.944, and it was more sensitive and specific in the prognosis evaluation ( 100% and 78.3%, respectively ). According to the cut-off value of 24-hour Lac as 2.35 mmol/L, patients were divided into high Lac and low Lac groups, and mortality rate in high Lac group was significantly higher than that in low Lac group [ 100.0% ( 36/36 ) vs. 17.24% ( 10/58 ), χ(2) = 30.441,P = 0.000 ]. The AUC of 24-hour LCR was the largest, 0.865, and it was more sensitive and specific for the prognosis evaluation ( 83.3% and 91.3%, respectively ). According to the cut-off value of 24-hour LCR as 36.8%, patients were divided into high LCR group and low LCR group, and mortality rate in low LCR group was significantly higher than that in high LCR group [ 84.00% ( 42/50 ) vs. 9.09% ( 4/44 ), χ(2) = 26.278, P = 0.000 ]. Early high Lac in patients with septic shock prompts a poor prognosis, and 24-hour Lac levels and LCR are indicators of assessment of clinical therapeutic effect and prognosis of patients with septic shock.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
L'Huillier, P J; Davis, S R; Bellamy, A R
1992-01-01
Ribozymes targeted to five sites along the alpha-lactalbumin (alpha-lac) mRNA were delivered to the cytoplasm of mouse C127I mammary cells using the T7-vaccinia virus delivery system and the amount of alpha-lac mRNA was monitored 24-48 h post-transfection. Three target sites were selected in the alpha-lac coding region (nucleotides 15, 145 and 361) and two were located in the 3' non-coding region (nucleotides 442 and 694). Acting in trans and at a target:ribozyme ratio of 1:1000, ribozymes targeting sites 361 and 694 reduced alpha-lac mRNA by > 80%; another two ribozymes (targeting nucleotides 442 and 145) reduced mRNA levels by 80 and 60% respectively; the fifth ribozyme (targeting nucleotide 15, near the AUG) was largely ineffective. The kinetic activity (kcat) of each ribozyme in vitro was somewhat predictive of the activity of the two ribozymes that targeted nucleotides 361 and 694, but was not predictive of the in vivo activity of the other three ribozymes. Down-regulation of the intracellular levels of alpha-lac paralleled the ribozyme-dependent reduction achieved for mRNA. For site 442, the reduction in both mRNA and protein was attributed to the catalytic activity of the ribozyme rather than to the antisense effects of the flanking arms, because delivery of an engineered (catalytically-inactive) variant had no effect on mRNA levels and a minimal effect on the level of alpha-lac present in the cell. Images PMID:1425576
Arm-Gal4 inheritance influences development and lifespan in Drosophila melanogaster.
Slade, F A; Staveley, B E
2015-10-19
The UAS-Gal4 ectopic expression system is a widely used and highly valued tool that allows specific gene expression in Drosophila melanogaster. Yeast transcription factor Gal4 can be directed using D. melanogaster transcriptional control elements, and is often assumed to have little effect on the organism. By evaluation of the consequences of maternal and paternal inheritance of a Gal4 transgene under the transcriptional regulation of armadillo control elements (arm-Gal4), we demonstrated that Gal4 expression could be detrimental to development and longevity. Male progeny expressing arm-Gal4 in the presence of UAS-lacZ transgene had reduced numbers and size of ommatidia, compared to flies expressing UAS-lacZ transgene under the control of other Gal4 transgenes. Aged at 25°C, the median life span of male flies with maternally inherited elav-Gal4 was 70 days, without a responding transgene or with UAS-lacZ. The median life span of maternally inherited arm-Gal4 male flies without a responding transgene was 48 days, and 40 days with the UAS-lacZ transgene. A partial rescue of this phenotype was observed with the expression of UAS-lacZ under paternal arm-Gal4 control, having an average median lifespan of 60 days. This data suggests that arm-Gal4 has detrimental effects on Drosophila development and lifespan that are directly dependent upon parental inheritance, and that the benign responder and reporter gene UAS-lacZ may influence D. melanogaster development. These findings should be taken into consideration during the design and execution of UAS-Gal4 expression experiments.
Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid
2012-01-01
Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570
Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping
2018-04-11
Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .
The Impact of Developmental Education at Triton College.
ERIC Educational Resources Information Center
Chand, Sunil
1985-01-01
Describes the following aspects of the Developmental Education Program at Triton College: student placement, courses, faculty selection, reading and writing instruction, mathematics instruction, the Learning Assistance Center (LAC), LAC tutoring, LAC special projects, LAC management, special needs assistance program for disabled students, and…
Zammaretti, Francesca; Panzica, Giancarlo; Eva, Carola
2007-01-01
In this study we investigated whether long-term consumption of a moderate/high fat (MHF), high-energy diet can affect the gene expression of the Y1 receptor (Y1R) for neuropeptide Y (NPY) in the dorsomedial (DMH), ventromedial (VMH), arcuate (ARC) and paraventricular (PVN) hypothalamic nuclei of male and female Y1R/LacZ transgenic mice, carrying the murine Y1R promoter linked to the LacZ gene. MHF diet-fed male mice showed an increased consumption of metabolizable energy that was associated with a significant increase in body weight as compared with chow-fed controls. In parallel, consumption of a MHF diet for 8 weeks significantly decreased Y1R/LacZ transgene expression in the DMH and VMH of male mice whereas no changes were found in the ARC and PVN. Leptin treatment reduced body weight of both MHF diet- and chow-fed male mice but failed to prevent the decrease in Y1R/LacZ transgene expression apparent in the DMH and VMH of male mice after 8 weeks of MHF diet intake. Conversely, no significant changes of metabolizable energy intake, body weight or hypothalamic β-galactosidase expression were found in MHF diet-fed female Y1R/LacZ transgenic mice. A gender-related difference of Y1R/LacZ transgenic mice was also observed in response to leptin treatment that failed to decrease body weight of both MHF diet- and chow-fed female mice. Results herein demonstrate that Y1R/LacZ FVB mice show a sexual dimorphism both on energy intake and on nucleus-specific regulation of the NPY Y1R system in the hypothalamus. Overall, these results provide new insights into the mechanism by which diet composition affects the hypothalamic circuit that controls energy homeostasis. PMID:17584829
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
A Modified Consumer Inkjet for Spatiotemporal Control of Gene Expression
Cohen, Daniel J.; Morfino, Roberto C.; Maharbiz, Michel M.
2009-01-01
This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 µm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer) and glucose (inhibitor), can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity. PMID:19763256
Complex genomic rearrangement in CCS-LacZ transgenic mice.
Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I
2007-02-01
The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.
Le, Thao Thanh; Murugesan, Kumarasamy; Lee, Chung-Seop; Vu, Chi Huong; Chang, Yoon-Seok; Jeon, Jong-Rok
2016-09-01
Immobilization of laccase has been highlighted to enhance their stability and reusability in bioremediation. In this study, we provide a novel immobilization technique that is very suitable to real wastewater treatment. A perfect core-shell system composing copper alginate for the immobilization of laccase (Lac-beads) was produced. Additionally, nFe2O3 was incorporated for the bead recycling through magnetic force. The beads were proven to immobilize 85.5% of total laccase treated and also to be structurally stable in water, acetate buffer, and real wastewater. To test the Lac-beads reactivity, triclosan (TCS) and Remazol Brilliant Blue R (RBBR) were employed. The Lac-beads showed a high percentage of TCS removal (89.6%) after 8h and RBBR decolonization at a range from 54.2% to 75.8% after 4h. Remarkably, the pollutants removal efficacy of the Lac-beads was significantly maintained in real wastewater with the bead recyclability, whereas that of the corresponding free laccase was severely deteriorated. Copyright © 2016 Elsevier Ltd. All rights reserved.
The Discovery of Low-Luminosity BL Lacs
NASA Astrophysics Data System (ADS)
Rector, Travis A.; Stocke, John T.
1995-12-01
Many of the properties of BL Lacs have become explicable in terms of the ``relativistic beaming'' hypothesis whereby BL Lacs are ``highly beamed'' FR-I radio galaxies (i.e. our line of sight to these objects is nearly along the jet axis). Further, radio-selected BL Lacs (RBLs) are believed to be seen nearly ``on-axis'' (the line-of-sight angle theta ~ 8deg ) while X-ray selected BL Lacs (XBLs) are seen at larger angles (theta ~ 30deg ; the X-ray emitting jet is believed to be less collimated). However, a major problem with this model was that a transition population between beamed BL Lacs and unbeamed FR-Is had not been detected. Low-luminosity BL Lacs may be such a transition population, and were predicted to exist by Browne and Marcha (1993). We present ROSAT HRI images, VLA radio maps and optical spectra which confirm the existence of low-luminosity BL Lacs, objects which were previously mis-identified in the EMSS catalog as clusters of galaxies. Thus our results strengthen the relativistic beaming hypothesis.
Physical Parameters of Components in Close Binary Systems: IV
NASA Astrophysics Data System (ADS)
Gazeas, K. D.; Baran, A.; Niarchos, P.; Zola, S.; Kreiner, J. M.; Ogloza, W.; Rucinski, S. M.; Zakrzewski, B.; Siwak, M.; Pigulski, A.; Drozdz, M.
2005-03-01
The paper presents new geometric, photometric and absolute parameters, derived from combined spectroscopic and photometric solutions, for ten contact binary systems. The analysis shows that three systems (EF Boo, GM Dra and SW Lac) are of W-type with shallow to moderate contact. Seven systems (V417 Aql, AH Aur, YY CrB, UX Eri, DZ Psc, GR Vir and NN Vir) are of A-type in a deep contact configuration. For six systems (V417 Aql, YY CrB, GM Dra, UX Eri, SW Lac and GR Vir) a spot model is introduced to explain the O'Connell effect in their light curves. The photometric and geometric elements of the systems are combined with the spectroscopic data taken at David Dunlap Observatory to yield the absolute parameters of the components.
Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua
2015-11-01
Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.
Swigon, David; Coleman, Bernard D.; Olson, Wilma K.
2006-01-01
Repression of transcription of the Escherichia coli Lac operon by the Lac repressor (LacR) is accompanied by the simultaneous binding of LacR to two operators and the formation of a DNA loop. A recently developed theory of sequence-dependent DNA elasticity enables one to relate the fine structure of the LacR–DNA complex to a wide range of heretofore-unconnected experimental observations. Here, that theory is used to calculate the configuration and free energy of the DNA loop as a function of its length and base-pair sequence, its linking number, and the end conditions imposed by the LacR tetramer. The tetramer can assume two types of conformations. Whereas a rigid V-shaped structure is observed in the crystal, EM images show extended forms in which two dimer subunits are flexibly joined. Upon comparing our computed loop configurations with published experimental observations of permanganate sensitivities, DNase I cutting patterns, and loop stabilities, we conclude that linear DNA segments of short-to-medium chain length (50–180 bp) give rise to loops with the extended form of LacR and that loops formed within negatively supercoiled plasmids induce the V-shaped structure. PMID:16785444
Bio Computing and Information Systems: A Quest
2003-06-01
on Security and Privacy, 1996 4) Dawkins , R. The Selfish Gene . Oxford University Press, 1989 5) Dumpert, K. The Social Biology of Ants...mechanisms of genetic control, which switch genes on and off. The archetypal example of genetic regulation in bacteria is the lac operon of E. coli...first studied in the 1950s by Jacques Monod and François Jacob. The lac operon is a set of genes and regulatory sequences involved in the metabolism of
NASA Astrophysics Data System (ADS)
Bondi, M.; Marchã, M. J. M.; Dallacasa, D.; Stanghellini, C.
2001-08-01
The 200-mJy sample, defined by Marchã et al., contains about 60 nearby, northern, flat-spectrum radio sources. In particular, the sample has proved effective at finding nearby radio-selected BL Lac objects with radio luminosities comparable to those of X-ray-selected objects, and low-luminosity flat-spectrum weak emission-line radio galaxies (WLRGs). The 200-mJy sample contains 23 BL Lac objects (including 6 BL Lac candidates) and 19 WLRGs. We will refer to these subsamples as the 200-mJy BL Lac sample and the 200-mJy WLRG sample, respectively. We have started a systematic analysis of the morphological pc-scale properties of the 200-mJy radio sources using VLBI observations. This paper presents VLBI observations at 5 and 1.6GHz of 14 BL Lac objects and WLRGs selected from the 200-mJy sample. The pc-scale morphology of these objects is briefly discussed. We derive the radio beaming parameters of the 200-mJy BL Lac objects and WLRGs and compare them with those of other BL Lac samples and with a sample of FR I radio galaxies. The overall broad-band radio, optical and X-ray properties of the 200-mJy BL Lac sample are discussed and compared with those of other BL Lac samples, radio- and X-ray-selected. We find that the 200-mJy BL Lac objects fill the gap between HBL and LBL objects in the colour-colour plot, and have intermediate αXOX as expected in the spectral energy distribution unification scenario. Finally, we briefly discuss the role of the WLRGs.
Adaptive Evolution of the Streptococcus pyogenes Regulatory Aldolase LacD.1
Cusumano, Zachary
2013-01-01
In the human-pathogenic bacterium Streptococcus pyogenes, the tagatose bisphosphate aldolase LacD.1 likely originated through a gene duplication event and was adapted to a role as a metabolic sensor for regulation of virulence gene transcription. Although LacD.1 retains enzymatic activity, its ancestral metabolic function resides in the LacD.2 aldolase, which is required for the catabolism of galactose. In this study, we compared these paralogous proteins to identify characteristics correlated with divergence and novel function. Surprisingly, despite the fact that these proteins have identical active sites and 82% similarity in amino acid sequence, LacD.1 was less efficient at cleaving both fructose and tagatose bisphosphates. Analysis of kinetic properties revealed that LacD.1's adaptation was associated with a decrease in kcat and an increase in Km. Construction and analysis of enzyme chimeras indicated that non-active-site residues previously associated with the variable activities of human aldolase isoenzymes modulated LacD.1's affinity for substrate. Mutant LacD.1 proteins engineered to have LacD.2-like levels of enzymatic efficiency lost the ability to function as regulators, suggesting that an alteration in efficiency was required for adaptation. In competition under growth conditions that mimic a deep-tissue environment, LacD.1 conferred a significant gain in fitness that was associated with its regulatory activity. Taken together, these data suggest that LacD.1's adaptation represents a form of neofunctionalization in which duplication facilitated the gain of regulatory function important for growth in tissue and pathogenesis. PMID:23316044
Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A
1998-06-01
We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.
Shinkai, Yoichi; Kuramochi, Masahiro; Doi, Motomichi
2018-05-03
Recently, advances in next-generation sequencing technologies have enabled genome-wide analyses of epigenetic modifications; however, it remains difficult to analyze the states of histone modifications at a single-cell resolution in living multicellular organisms because of the heterogeneity within cellular populations. Here we describe a simple method to visualize histone modifications on the specific sequence of target locus at a single-cell resolution in living Caenorhabditis elegans , by combining the LacO/LacI system and a genetically-encoded H4K20me1-specific probe, "mintbody". We demonstrate that Venus-labeled mintbody and mTurquoise2-labeled LacI can co-localize on an artificial chromosome carrying both the target locus and LacO sequences, where H4K20me1 marks the target locus. We demonstrate that our visualization method can precisely detect H4K20me1 depositions on the her-1 gene sequences on the artificial chromosome, to which the dosage compensation complex binds to regulate sex determination. The degree of H4K20me1 deposition on the her-1 sequences on the artificial chromosome correlated strongly with sex, suggesting that, using the artificial chromosome, this method can reflect context-dependent changes of H4K20me1 on endogenous genomes. Furthermore, we demonstrate live imaging of H4K20me1 depositions on the artificial chromosome. Combined with ChIP assays, this mintbody-LacO/LacI visualization method will enable analysis of developmental and context-dependent alterations of locus-specific histone modifications in specific cells and elucidation of the underlying molecular mechanisms. Copyright © 2018, G3: Genes, Genomes, Genetics.
Bersani, Giuseppe; Meco, Giuseppe; Denaro, Alessandro; Liberati, Damien; Colletti, Chiara; Nicolai, Raffaella; Bersani, Francesco Saverio; Koverech, Aleardo
2013-10-01
L-Acetylcarnitine (LAC), the acetyl ester of carnitine naturally present in the central nervous system and involved in several neural pathways, has been demonstrated to be active in various animal experimental models resembling some features of human depression. The aim of the study is to verify whether LAC can have an antidepressant action in a population of elderly patients with dysthymic disorder in comparison with a traditional antidepressant such as fluoxetine. Multicentric, double-blind, double-dummy, controlled, randomized study based on a observation period of 7 weeks. 80 patients with DSM-IV diagnosis of dysthymic disorder were enrolled in the study and subdivided into 2 groups. Group A patients received LAC plus placebo; group B patients received fluoxetine 20 mg/die plus placebo. Clinical assessment was performed through several psychometric scales at 6 different moments. Group A patients showed a statistically significant improvement in the following scales: HAM-D, HAM-A, BDI and Touluse Pieron Test. Comparison between the two groups, A and B, generally showed very similar clinical progression. The results obtained with LAC and fluoxetine were equivalent. As the subjects in this study were of senile age, it is possible to hypothesize that the LAC positive effect on mood could be associated with improvement in subjective cognitive symptomatology. The difference in the latency time of clinical response (1 week of LAC treatment, compared with the 2 weeks' latency time with fluoxetine) suggests the existence of different mechanisms of action possibly in relation to the activation of rapid support processes of neuronal activity. Copyright © 2012 Elsevier B.V. and ECNP. All rights reserved.
The REX survey as a Tool to Test the Beaming Model for BL Lacs
NASA Astrophysics Data System (ADS)
Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.
We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.
Design and application of a lactulose biosensor.
Wu, Jieyuan; Jiang, Peixia; Chen, Wei; Xiong, Dandan; Huang, Linglan; Jia, Junying; Chen, Yuanyuan; Jin, Jian-Ming; Tang, Shuang-Yan
2017-04-07
In this study the repressor of Escherichia coli lac operon, LacI, has been engineered for altered effector specificity. A LacI saturation mutagenesis library was subjected to Fluorescence Activated Cell Sorting (FACS) dual screening. Mutant LacI-L5 was selected and it is specifically induced by lactulose but not by other disaccharides tested (lactose, epilactose, maltose, sucrose, cellobiose and melibiose). LacI-L5 has been successfully used to construct a whole-cell lactulose biosensor which was then applied in directed evolution of cellobiose 2-epimerase (C2E) for elevated lactulose production. The mutant C2E enzyme with ~32-fold enhanced expression level was selected, demonstrating the high efficiency of the lactulose biosensor. LacI-L5 can also be used as a novel regulatory tool. This work explores the potential of engineering LacI for customized molecular biosensors which can be applied in practice.
Evaluation of coloring efficacy of lac dye in comminuted meat product.
Divya; Singh, R P; Baboo, B; Prasad, K M
2011-06-01
Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.
The business of refractive laser assisted cataract surgery (ReLACS).
Berdahl, John P; Jensen, Matthew P
2014-01-01
Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.
Andrade, Laura Helena; Viana, Maria Carmen; Tófoli, Luis Fernando Farah; Wang, Yuan-Pang
2008-01-01
Recent population-based studies in Latin American and the Caribbean (LAC) countries brought evidence of the growing burden of mental illness in this region. The objective of this study is to examine determinants of health service utilization by individuals with psychiatric disorders in a defined area in the city of São Paulo, Brazil. Data were derived from São Paulo Catchment Area Study (SP-ECA), a cross-sectional household prevalence survey, based on a representative adult sample (N=1,464) living in two defined boroughs. The psychiatric diagnosis was assessed through the CIDI 1.1 interview, yielding ICD-10 diagnoses. The past-month use of health services--for general medical (GM) care and mental health (MH) care sectors--was investigated in their relationship with sociodemographic features, insurance coverage, GM conditions, and psychiatric morbidity. Nearly one-third (32.2%) of the total sample used health services in the last month: 29.0% attended GM care and 7.8% used MH care. Logistic regression models showed that being female, older than 60 years, having private insurance coverage, and presence of psychiatric morbidity increased the level GM care seeking in the total sample. For those with 12-month psychiatric disorders, the determinants for GM sector use were female gender, age 45-59 years old, and private insurance coverage, whereas separated, divorced, or widowed women had the highest odds (OR 9.9; 95% CI: 2.7-36.5) for using MH service. Low-income people were less likely to seek MH services. The major contribution of this article is to underscore the impact of MH on health care systems, in a LAC country where service use information is scarce. The main finding is that inequalities in the access to MH care occurred, with low-income people having less likelihood of receiving treatment for their mental disorder. Access to health service in this catchment area reflected the great degree of deregulation and lack of integration. Additional efforts should address the barriers to the utilization of MH services in Brazil, including social inequities in the access to care.
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S
1989-01-01
A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.
Proteins mediating DNA loops effectively block transcription.
Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David
2017-07-01
Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Kraatz, Mareike; Wallace, R John; Svensson, Liselott
2011-04-01
Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T) = DSM 22620(T) = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212 = DSM 22619 = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.
2007-10-01
colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly used reporter system.[34] However, the well-established...Figure 7 Moreover, we are deeply encouraged by the success on the synthesis of the target molecule M7, as shown in Figure 8. f e d cba OH N
Weaver, T.L.; Neff, B.P.; Ellis, J.M.
2005-01-01
Lac Vieux Desert is a prominent 6.6 square-mile lake that straddles the Michigan-Wisconsin border and forms the headwaters of the Wisconsin River. For generations, the Lac Vieux Desert Band of Lake Superior Chippewa Indians have used Lac Vieux Desert and the surrounding area for growing and harvesting wild rice, and hunting and fishing. The Lac Vieux Desert Band is concerned about the impact of lake-stage regulation on hydrology and ecology, and the impact on water quality of development along and near the shore, and recreational watercraft use and sport fishing. In 2005, the U.S. Geological Survey completed a water-resources investigation of the Lac Vieux Desert watershed in cooperation with the Lac Vieux Desert Band of Lake Superior Chippewa Indians.Water quality of Lac Vieux Desert is typical of many lakes in the northern United States. Trophic State Index calculations classify Lac Vieux Desert as a highly productive eutrophic lake. The pH of water in Lac Vieux Desert ranged from 6.5 to 9.5, and specific conductance ranged from 62 to 114 µs/cm. Chloride concentration was less than 1.5 mg/L, indicating little effect from septic-tank or road-salt input. Results indicate that the water can be classified as soft, with hardness concentrations reported as calcium carbonate ranging from 29 to 49 mg/L. Concentrations of calcium, magnesium, chloride, and other dissolved solids ranged from 47 to 77 mg/L. Alkalinity of Lac Vieux Desert ranged from 27 to 38 mg/L.Pervasive aquatic blooms, including a bloom noted during the September 2003 sampling, are apparently common in late summer. Biological productivity at Lac Vieux Desert does not appear to have changed appreciably between 1973 and 2004. In the current study, total phosphorus concentrations ranged from 0.01 to 0.064 mg/L and dissolved nitrite plus nitrate nitrogen concentrations ranged from at, or below detection limit to 0.052 mg/L. Overabundance of nutrients in Lac Vieux Desert, particularly nitrogen and phosphorus, could result in considerable degradation in lake-water quality.The estimated water balance includes the following inputs from the surrounding watershed: direct precipitation (35 percent); runoff, composed of streamflow and overland flow (50 percent); and ground-water flow (15 percent). Outputs from Lac Vieux Desert include streamflow into the Wisconsin River (68 percent) and evaporation from the lake surface (32 percent). Seasonal regulation of Lac Vieux Desert outflow results in an artificially high lake stage throughout the year, except from late winter to very early spring, prior to snowmelt and runoff. Regulation of Lac Vieux Desert outflow causes Wisconsin River streamflow to be artificially low during spring and summer and artificially high in fall and winter.Recent studies indicate that lake-level regulation over the past century may have affected wild rice growth and propagation in Lac Vieux Desert. As per licensing agreement between the Federal Energy Regulatory Commission and the Wisconsin Valley Improvement Company (operators of the dam at the outlet), the maximum lake level of Lac Vieux Desert was lowered about 0.8 feet to investigate the relation between lake-level regulation and propagation of wild rice from 2003 through 2012. Recent plantings of wild rice by the Lac Vieux Desert Band have been successful, indicating that suitable habitat and hydrologic regime were present in 2004-05.
Purified reconstituted lac carrier protein from Escherichia coli is fully functional.
Viitanen, P; Garcia, M L; Kaback, H R
1984-03-01
Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.
Glaser, Tina; Dickel, Nina; Liersch, Benjamin; Rees, Jonas; Süssenbach, Philipp; Bohner, Gerd
2015-08-01
The authors propose a framework distinguishing two types of lateral attitude change (LAC): (a) generalization effects, where attitude change toward a focal object transfers to related objects, and (b) displacement effects, where only related attitudes change but the focal attitude does not change. They bring together examples of LAC from various domains of research, outline the conditions and underlying processes of each type of LAC, and develop a theoretical framework that enables researchers to study LAC more systematically in the future. Compared with established theories of attitude change, the LAC framework focuses on lateral instead of focal attitude change and encompasses both generalization and displacement. Novel predictions and designs for studying LAC are presented. © 2014 by the Society for Personality and Social Psychology, Inc.
Chen, Bin; Liu, Da-Lie; Pan, Wen-Yan; Yang, Xiao-Hui; Shou, Jia-Bao; Wu, Ju-Hua; Mao, Qing-Long; Wang, Jia
2014-08-01
The transdermal delivery system (TDS) is able to obtain a systemic therapeutic effect by administration through the skin, which has low side effects and is able to maintain a sustained blood concentration. However, due to the barrier presented by the stratum corneum, numerous drugs have poor percutaneous permeability. Therefore, the improvement of skin permeability is key to TDS. The main method of promoting transdermal absorption is through the usage of penetration enhancers. Dimethyl sulfoxide (DMSO) is a commonly used penetration enhancer, which has anti‑inflammatory analgesic effects and is able to penetrate the skin. Retinoic acid (RA) and lipolanthionine peptide (LP) may also benefit the permeation efficiency of TDS. Therefore, the present study examined the function of DMSO, RA and LP as penetration enhancers in TDS. Firstly, the optimum concentration of DMSO was confirmed by detecting the expression of the LacZ gene in vitro. Secondly, different combinations of LP, RA and DMSO were applied to mouse skin to analyze the penetration enhancer combination with the greatest efficacy. All the animals were divided into five groups: The RA + LP + DMSO + pORF‑LacZ group, the RA + DMSO + pORF‑LacZ group, the LP + DMSO + pORF‑LacZ group, the DMSO + pORF-LacZ group and the control group. Skin was soaked in combinations of LP, RA and DMSO for seven days and then the pORF‑LacZ plasmids were daubed onto the skin once daily three days. On the 11th day, all the animals were sacrificed by cervical dislocation and the skin and blood samples were collected. The blood samples were used to detect the expression of the LacZ gene by quantitative polymerase chain reaction and the skin samples were used to detect the expression of claudin‑4 and zonula occluden‑1 (ZO‑1) proteins by immunohistochemistry and western blot analysis. The results demonstrated that the combination of LP, RA and DMSO exhibited the greatest transdermal delivery efficiency, which verified that RA and LP were able to increase the penetration effects. Following treatment with LP, the symptoms of dermal edema were relieved and the capillaries contracted, which suggested that LP was a safe and effective penetration enhancer able to reduce the side‑effects caused by DMSO. The present study provides a guideline for the synthesis of novel penetration enhancers.
Shekhar, Anantha; Johnson, Philip L; Fitz, Stephanie D; Nakazato, Atsuro; Chaki, Shigeyuki; Steckler, Thomas; Schmidt, Mark
2011-04-01
Corticotropin releasing factor (CRF) is implicated in a variety of stress-related disorders such as depression and anxiety, and blocking CRF receptors is a putative strategy for treating such disorders. Using a well-studied animal model of panic, we tested the efficacy of JNJ19567470/CRA5626, a selective, non-peptidergic CRF type 1 receptor (CRF1) antagonist (3, 10 and 40 mg/kg intraperitoneal injection), in preventing the sodium lactate (NaLac)-induced panic-like behavioural and cardiovascular responses. Adult male rats with chronic reduction of GABA levels (by inhibition of GABA synthesis with l-allyglycine, a glutamic acid decarboxylase inhibitor) in the dorsomedial/perifornical hypothalamus are highly anxious and exhibit physiological and behavioural responses to intravenous NaLac infusions similar to patients with panic disorder. These 'panic-prone' rats pre-treated with vehicle injections displayed NaLac-induced increases in autonomic responses (i.e. tachycardia and hypertensive responses), anxiety-like behaviour in the social interaction test, and flight-like increases in locomotor activity. However, systemically injecting such panic-prone rats with the highest dose of CRF1 receptor antagonist prior to NaLac infusions blocked all NaLac-induced behaviour and cardiovascular responses. These data suggest that selective CRF1 receptor antagonists could be a novel target for developing anti-panic drugs that are as effective as benzodiazepines in acute treatment of a panic attack without the deleterious side-effects (e.g. sedation and cognitive impairment) associated with benzodiazepines.
Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression
Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.
1978-01-01
The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424
Effect of electron spin-spin interaction on level crossings and spin flips in a spin-triplet system
NASA Astrophysics Data System (ADS)
Jia, Wei; Hu, Fang-Qi; Wu, Ning; Zhao, Qing
2017-12-01
We study level crossings and spin flips in a system consisting of a spin-1 (an electron spin triplet) coupled to a nuclear spin of arbitrary size K , in the presence of a uniform magnetic field and the electron spin-spin interaction within the triplet. Through an analytical diagonalization based on the SU (3 ) Lie algebra, we find that the electron spin-spin interaction not only removes the curious degeneracy which appears in the absence of the interaction, but also produces some level anticrossings (LACs) for strong interactions. The real-time dynamics of the system shows that periodic spin flips occur at the LACs for arbitrary K , which might provide an option for nuclear or electron spin polarization.
Data Collection: A Cybernetic Aspect of a Learning Assistance Center.
ERIC Educational Resources Information Center
Devirian, Margaret Coda
Data collection and analysis as a cybernetic aspect of a Learning Assistance Center (LAC) is discussed. Using the LAC at California State University Long Beach (CSULB) as a model, the LAC is defined as a support, delivery, and referral service for the entire campus community. A LAC is held accountable to itself and its users through a cybernetics…
The Health Role of Local Area Coordinators in Scotland: A Mixed Methods Study
ERIC Educational Resources Information Center
Brown, Michael; Karatzias, Thanos; O'Leary, Lisa
2013-01-01
The study set out to explore whether local area coordinators (LACs) and their managers view the health role of LACs as an essential component of their work and identify the health-related activities undertaken by LACs in Scotland. A mixed methods cross-sectional phenomenological study involving local authority service managers (n = 25) and LACs (n…
Azeredo, Thiago Botelho; Luiza, Vera Lucia; Oliveira, Maria Auxiliadora; Emmerick, Isabel Cristina Martins; Bigdeli, Maryam
2014-06-25
This study aims to rank policy concerns and policy-related research issues in order to identify policy and research gaps on access to medicines (ATM) in low- and middle-income countries in Latin America and the Caribbean (LAC), as perceived by policy makers, researchers, NGO and international organization representatives, as part of a global prioritization exercise. Data collection, conducted between January and May 2011, involved face-to-face interviews in El Salvador, Colombia, Dominican Republic, and Suriname, and an e-mail survey with key-stakeholders. Respondents were asked to choose the five most relevant criteria for research prioritization and to score policy/research items according to the degree to which they represented current policies, desired policies, current research topics, and/or desired research topics. Mean scores and summary rankings were obtained. Linear regressions were performed to contrast rankings concerning current and desired policies (policy gaps), and current and desired research (research gaps). Relevance, feasibility, and research utilization were the top ranked criteria for prioritizing research. Technical capacity, research and development for new drugs, and responsiveness, were the main policy gaps. Quality assurance, staff technical capacity, price regulation, out-of-pocket payments, and cost containment policies, were the main research gaps. There was high level of coherence between current and desired policies: coefficients of determination (R2) varied from 0.46 (Health system structure; r = 0.68, P <0.01) to 0.86 (Sustainable financing; r = 0.93, P <0.01). There was also high coherence between current and desired research on Rational selection and use of medicines (r = 0.71, P <0.05, R2 = 0.51), Pricing/affordability (r = 0.82, P <0.01, R2 = 0.67), and Sustainable financing (r = 0.76, P <0.01, R2 = 0.58). Coherence was less for Health system structure (r = 0.61, P <0.01, R2 = 0.38). This study combines metrics approaches, contributing to priority setting methodology development, with country and regional level stakeholder participation. Stakeholders received feedback with the results, and we hope to have contributed to the discussion and implementation of ATM research and policy priorities in LAC.
Constitutive expression of Botrytis aclada laccase in Pichia pastoris
Kittl, Roman; Gonaus, Christoph; Pillei, Christian; Haltrich, Dietmar; Ludwig, Roland
2012-01-01
The heterologous expression of laccases is important for their large-scale production and genetic engineering—a prerequisite for industrial application. Pichia pastoris is the preferred expression host for fungal laccases. The recently cloned laccase from the ascomycete Botrytis aclada (BaLac) has been efficiently expressed in P. pastoris under the control of the inducible alcohol oxidase (AOX1) promoter. In this study, we compare these results to the constitutive expression in the same organism using the glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. The results show that the amounts of BaLac produced with the GAP system (517 mgL-1) and the AOX1 system (495 mgL-1) are comparable. The constitutive expression is, however, faster, and the specific activity of BaLac in the culture supernatant is higher (41.3 Umg-1 GAP, 14.2 Umg-1 AOX1). In microtiter plates, the constitutive expression provides a clear advantage due to easy manipulation (simple medium, no methanol feeding) and fast enzyme production (high-throughput screening assays can already be performed after 48 h). PMID:22705842
Wang, Xiyong; Zhu, Xiaoli; Zhang, Hongming; Wei, Shuzhen; Chen, Yan; Chen, Yang; Wang, Fei; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu
2018-02-19
Recent reports have indicated that circular RNA (circRNA) may regulate Lung adenocarcinoma (LAC) development. Our previous studies showed that hsa_circ_0012673 was up-regulated in a circRNA microarray. However, its expression level in LAC has not been verified, and the underlying molecular mechanisms in LAC are unknown. In this study, we found that the expression of hsa_circ_0012673 was up-regulated in LAC tissues compared to pair-matched adjacent non-tumor tissues (P = 0.0079), and that the expression level was associated with tumour size (P = 0.015). Furthermore, hsa_circ_0012673 was primarily localized in the cytoplasm and promoted cell proliferation of LAC cells by sponging miR-22, which targeted erb-b2 receptor tyrosine kinase 3 (ErbB3) in LAC. Hsa_circ_0012673 promotes LAC proliferation by suppressing miR-22, which targets ErbB3. Copyright © 2018 Elsevier Inc. All rights reserved.
Light absorbing carbon emissions from commercial shipping
NASA Astrophysics Data System (ADS)
Lack, Daniel; Lerner, Brian; Granier, Claire; Baynard, Tahllee; Lovejoy, Edward; Massoli, Paola; Ravishankara, A. R.; Williams, Eric
2008-07-01
Extensive measurements of the emission of light absorbing carbon aerosol (LAC) from commercial shipping are presented. Vessel emissions were sampled using a photoacoustic spectrometer in the Gulf of Mexico region. The highest emitters (per unit fuel burnt) are tug boats, thus making significant contributions to local air quality in ports. Emission of LAC from cargo and non cargo vessels in this study appears to be independent of engine load. Shipping fuel consumption data (2001) was used to calculate a global LAC contribution of 133(+/-27) Ggyr-1, or ~1.7% of global LAC. This small fraction could have disproportionate effects on both air quality near port areas and climate in the Arctic if direct emissions of LAC occur in that region due to opening Arctic sea routes. The global contribution of this LAC burden was investigated using the MOZART model. Increases of 20-50 ng m-3 LAC (relative increases up to 40%) due to shipping occur in the tropical Atlantic, Indonesia, central America and the southern regions of South America and Africa.
Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.
Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M
1999-09-01
Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint using the adenovirus vector is feasible as an effective in vivo method.
Louisiana SIP: LAC 33:III Ch 21 Subchap J, 2147--Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 1998-02-02 (LAc74) more...
Vashishtha, Amit; Rathi, Brijesh; Kaushik, Sandeep; Sharma, K K; Lakhanpaul, Suman
2013-10-01
Females of lac insects especially of Kerria lacca (Kerr) secret a resin known as lac for their own protection, which has tremendous applications. Lac insect completes its lifecycle on several host taxa where it exclusively feeds on phloem sap but Schleichera oleosa (Lour.) Oken, Butea monosperma (Lam.) and Ziziphus mauritiana (Lam.) are its major hosts. Analysis of phloem sap constituents as well as hemolymph of lac insect is important because it ultimately gets converted into lac by insect intervention. Main phloem sap constituent's viz. sugars and free amino acids and hemolymph of lac insect were analyzed using HPLC and tandem mass spectrometry, respectively. The results were transformed to relative percentage of the total sugars and free amino acids analyzed in each sample for comparison among lac insect hemolymph and the phloem sap of the three different host taxa. Sucrose (58.9 ± 3.6-85.6 ± 0.9) and trehalose (62.3 ± 0.4) were the predominant sugars in phloem sap of three taxa and hemolymph of lac insect, respectively. Glutamic acid (33.1 ± 1.4-39.8 ± 1.4) was found to be main amino acid among the phloem sap of three taxa while tyrosine (61 ± 2.6) was the major amino acid in hemolymph of lac insect. The relative percentage of non-essential amino acids (60.8 %-69.9 %) was found to be more in all the three host taxa while essential amino acids (30.1 %-35.4 %) were present at a lower relative percentage. In contrast to this, the relative percentage of essential amino acids (81.9 %) was observed to be higher as compared to non-essential amino acids (17.7 %) in lac insect hemolymph. These results led to the detection of lac insect's endosymbionts. Moreover, this study revealed a clue regarding the importance of development of a synthetic diet for this insect so that a precise pathway of lac biosynthesis could be investigated for thorough understanding.
Halbmayr, Elisabeth; Mathiesen, Geir; Nguyen, Thu-Ha; Maischberger, Thomas; Peterbauer, Clemens K; Eijsink, Vincent G H; Haltrich, Dietmar
2008-06-25
This work presents the cloning and expression of the genes encoding heterodimeric beta-galactosidases from Lactobacillus reuteri L103, Lactobacillus acidophilus R22, Lactobacillus plantarum WCFS1, and Lactobacillus sakei Lb790. These enzymes consist of two subunits of approximately 73 and 35 kDa, which are encoded by two overlapping genes, lacL and lacM, respectively. We have cloned these genes into the lactobacillal expression vectors pSIP403 and pSIP409, which are based on the sakacin P operon of L. sakei ( Sørvig et al. Microbiology 2005, 151, 2439- 2449 ), and expressed them in the host strains L. plantarum WCFS1 and L. sakei Lb790. Results varied considerably, ranging from 2.23 to 61.1 U/mg of beta-galactosidase activity, depending on the origin of the lacLM genes, the host strain, and the expression vector used. Highest expression levels were obtained in a laboratory cultivation of L. plantarum WCFS1 harboring the plasmid pEH3R containing the lacLM gene from L. reuteri L103. These cultivations yielded approximately 23 000 U of beta-galactosidase activity per liter, corresponding to the formation of roughly 100 mg of recombinant protein per liter of fermentation medium, and beta-galactosidase levels amounted to 55% of the total intracellular protein of the host organism. To further verify the suitability of this expression system, recombinant beta-galactosidase from L. reuteri was purified to apparent homogeneity. The properties of the purified enzyme were essentially identical with the properties of purified native beta-galactosidase from L. reuteri L103. The presented results lead the way to efficient overproduction of beta-galactosidase in a food-grade expression system, which is of high interest for applications in food industry.
Galicia, Luis; Grajeda, Rubén; de Romaña, Daniel López
2016-08-01
To determine the current nutritional status in Latin America and the Caribbean (LAC) and identify data gaps and trends in nutrition surveillance. A systematic Internet search was conducted to identify official sources that allowed for monitoring of LAC countries' nutritional status, including progress toward World Health Organization Global Nutrition Targets 2025. Reports from national nutrition surveillance systems and reports on nationally representative surveys were collected and collated to 1) analyze nutritional status, based on life-course anthropometric indicators and biomarkers, and 2) identify gaps in data availability and trends in nutritional deficiencies. Information on iron, vitamin A, iodine, folate, and vitamin B12 deficiency was also collected and collated. Twenty-two of the 46 LAC countries/territories (48%) had information on undernutrition (stunting, underweight, and wasting) in children under 5 years old and women of reproductive age (WRA). Seventeen countries (38%) had information on anemia in children under 5 years old and WRA, and 12 (27%) had information on anemia in pregnant women. Although overall nutritional status has improved in the past few decades in all countries in the region, some LAC countries still had a high prevalence of stunting and anemia in children and WRA. Overweight affected at least 50% of WRA in nine countries with available data, and was increasing in children. Data for school-age children, adolescents, adult males, and older adults were scarce in the region. Overall nutritional status has improved in the LAC countries with available information, but more efforts are needed to scale up nutrition-sensitive and nutrition-specific interventions to tackle malnutrition in all its forms, as stunting, anemia, and vitamin A deficiency are still a public health problem in many countries, and overweight is an epidemic. Nutrition information systems are weak in the region, and countries need to strengthen their capacity to monitor nutritional status indicators.
Depreter, Barbara; Devreese, Katrien M J
2016-09-01
Lupus anticoagulant (LAC) testing includes a screening, mixing and confirmation step. Although recently published guidelines on LAC testing are a useful step towards standardization, a lack of consensus remains whether to express mixing tests in clotting time (CT) or index of circulating anticoagulant (ICA). The influence of anticoagulant therapy, e.g. vitamin K antagonists (VKA) or direct oral anticoagulants (DOAC) on both methods of interpretation remains to be investigated. The objective of this study was to contribute to a simplification and standardization of the LAC three-step interpretation on the level of the mixing test. Samples from 148 consecutive patients with LAC request and prolonged screening step, and 77 samples from patients non-suspicious for LAC treated with VKA (n=37) or DOAC (n=30) were retrospectively evaluated. An activated partial thromboplastin time (aPTT) and dilute Russell's viper venom time (dRVVT) were used for routine LAC testing. The supplemental anticoagulant samples were tested with dRVVT only. We focused on the interpretation differences for mixing tests expressed as CT or ICA and compared the final LAC conclusion within each distinct group of concordant and discordant mixing test results. Mixing test interpretation by CT resulted in 10 (dRVVT) and 16 (aPTT) more LAC positive patients compared to interpretation with ICA. Isolated prolonged dRVVT screen mix ICA results were exclusively observed in samples from VKA-treated patients without suspicion for LAC. We recommend using CT in respect to the 99th percentile cut-off for interpretation of mixing steps in order to reach the highest sensitivity and specificity in LAC detection.
Ugaz, Jorge I; Chatterji, Minki; Gribble, James N; Mitchell, Susan
2015-08-01
To examine trends in the source of modern contraception (public versus private sector); method choice (long-acting or permanent methods versus short-acting methods); and method and source combined. A retrospective analysis was conducted using data collected by national Demographic and Health Surveys and Reproductive Health Surveys during the period 1992-2012. The dataset included 18 low-income countries in Sub-Saharan Africa, 10 from Latin America and the Caribbean (LAC), and 8 from Asia. A substantial proportion-between 40% and 49%-of modern contraceptive users relied on the private sector in Asia and LAC in the last 20years, yet the proportion has been smaller in Sub-Saharan Africa, between 27% and 30%. Increased use of short-acting methods from both public and private sectors has driven the rise in contraceptive prevalence in Asia and LAC. Similarly, increased contraceptive prevalence in Sub-Saharan Africa reflected the increased use of short-acting methods obtained mainly through the public sector, with only limited use of long-acting or permanent methods through the private sector. The private sector has played a key role in the increase of modern CPR and the provision of modern contraceptives around the world, providing almost half of them in low-income countries. Yet, such increase was driven primarily by a more substantial role in the provision of short-acting methods than long acting and permanent methods. Crown Copyright © 2015. Published by Elsevier Ireland Ltd. All rights reserved.
Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah
2015-10-01
Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. Three local authorities (LAs) in England. LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. pregnancy in LAC aged 14-18 years. sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information.
Aguila, Sergio A; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I; Romo-Herrera, José; Contreras, Oscar E; Farías, Mario H; Alonso-Núñez, Gabriel
2015-01-01
The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL−1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L−1 activity was 9326 U mL−1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L−1 was 9 234 U mL−1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10−8 mol L−1 by measuring the electric current responses. PMID:27877839
NASA Astrophysics Data System (ADS)
Aguila, Sergio A.; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I.; Romo-Herrera, José; Contreras, Oscar E.; Farías, Mario H.; Alonso-Núñez, Gabriel
2015-10-01
The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CNx-MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CNx-MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CNx-MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL-1. With Lac/CNx-MWCNT at concentrations of 6.4 mmol L-1 activity was 9326 U mL-1, while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L-1 was 9 234 U mL-1. The Lac/CNx-MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CNx-MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10-8 mol L-1 by measuring the electric current responses.
Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)
Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.
2013-01-01
Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045
NASA Astrophysics Data System (ADS)
Landt, H.; Padovani, P.
1999-12-01
In the optical wavelength range the distinction between a radio galaxy and a BL Lac object is mainly based on the Ca II H and K break observed in the optical spectrum. Marchã et al. (1996, MNRAS, 281, 425) have expanded on the previously used division by suggesting objects with Ca II break values lower than 0.4 to be classified as BL Lacs and sources with values higher than 0.4 to be classified as galaxies. We present new evidence that there is a smooth transition between BL Lac objects and Fanaroff-Riley type I radio galaxies. We find an increase in X-ray and radio core luminosity as the Ca II break gets more and more diluted. This suggests that the only difference between BL Lac objects and their parent population lies in orientation. The closer the jet of the radio galaxy to the observer's line of sight, the more its luminosity gets amplified and the object becomes BL Lac-like. We will address the question of the BL Lac parent population and will propose to unify the beamed and unbeamed objects in nomenclature.
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
Sousa, Filipa L; Parente, Daniel J; Shis, David L; Hessman, Jacob A; Chazelle, Allen; Bennett, Matthew R; Teichmann, Sarah A; Swint-Kruse, Liskin
2016-02-22
Protein families evolve functional variation by accumulating point mutations at functionally important amino acid positions. Homologs in the LacI/GalR family of transcription regulators have evolved to bind diverse DNA sequences and allosteric regulatory molecules. In addition to playing key roles in bacterial metabolism, these proteins have been widely used as a model family for benchmarking structural and functional prediction algorithms. We have collected manually curated sequence alignments for >3000 sequences, in vivo phenotypic and biochemical data for >5750 LacI/GalR mutational variants, and noncovalent residue contact networks for 65 LacI/GalR homolog structures. Using this rich data resource, we compared the noncovalent residue contact networks of the LacI/GalR subfamilies to design and experimentally validate an allosteric mutant of a synthetic LacI/GalR repressor for use in biotechnology. The AlloRep database (freely available at www.AlloRep.org) is a key resource for future evolutionary studies of LacI/GalR homologs and for benchmarking computational predictions of functional change. Copyright © 2015 Elsevier Ltd. All rights reserved.
Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.
Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G
2011-12-23
Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.
Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.
Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko
2016-01-01
Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.
Community-Acquired Pneumonia in Latin America.
Iannella, Hernán A; Luna, Carlos M
2016-12-01
Community-acquired pneumonia (CAP) is associated with significant morbidity and mortality in Latin America and the Caribbean (LAC) region. Poverty, socioeconomic factors, and malnutrition influence the incidence and outcome of CAP in LAC. In LAC, Streptococcus pneumoniae is the most frequent microorganism responsible for CAP, (incidence: 24-78%); the incidence of atypical microorganisms is similar to other regions of the world. Human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) is a growing problem in the LAC region, with the Caribbean being the second most affected area worldwide after Sub-Saharan Africa. Pneumococcal pneumonia remains the most common cause of CAP in HIV-infected patients, but Pneumocystis jirovecii and tuberculosis (TB) are also common in this population. The heterogeneity of the health care systems and social inequity between different countries in LAC, and even between different settings inside the same country, is a difficult issue. TB, including multidrug-resistant TB, is several times more common in South American and Central American countries compared with North America. Furthermore, hantaviruses circulating in the Americas (new world hantaviruses) generate a severe respiratory disease called hantavirus pulmonary syndrome, with an associated mortality as high as 50%. More than 30 hantaviruses have been reported in the Western Hemisphere, with more frequent cases registered in the southern cone (Argentina, Chile, Uruguay, Paraguay, Bolivia, and Brazil). Respiratory viruses (particularly influenza) remain an important cause of morbidity and mortality, particularly in the elderly. Low rates of vaccination (against influenza as well as pneumococcus) may heighten the risk of these infections in low- and middle-income countries. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a Lighting Automatic Control System (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane’s surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design. PMID:22164114
Mohamaddoust, Reza; Haghighat, Abolfazl Toroghi; Sharif, Mohamad Javad Motahari; Capanni, Niccolo
2011-01-01
Wireless sensor networks (WSN) are currently being applied to energy conservation applications such as light control. We propose a design for such a system called a lighting automatic control system (LACS). The LACS system contains a centralized or distributed architecture determined by application requirements and space usage. The system optimizes the calculations and communications for lighting intensity, incorporates user illumination requirements according to their activities and performs adjustments based on external lighting effects in external sensor and external sensor-less architectures. Methods are proposed for reducing the number of sensors required and increasing the lifetime of those used, for considerably reduced energy consumption. Additionally we suggest methods for improving uniformity of illuminance distribution on a workplane's surface, which improves user satisfaction. Finally simulation results are presented to verify the effectiveness of our design.
Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)
agr-Dependent Interactions of Staphylococcus aureus USA300 with Human Polymorphonuclear Neutrophils
Pang, Yun Yun; Schwartz, Jamie; Thoendel, Matthew; Ackermann, Laynez W.; Horswill, Alexander R.; Nauseef, William M.
2010-01-01
The emergence of serious infections due to community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has fueled interest in the contributions of specific staphylococcal virulence factors to clinical disease. To assess the contributions of agr-dependent factors to the fate of organisms in polymorphonuclear neutrophils (PMN), we examined the consequences for organism and host cells of feeding PMN with wild-type CA-MRSA (LAC) or CA-MRSA (LAC agr KO) at different multiplicities of infection (MOIs). Phagocytosed organisms rapidly increased the transcription of RNAIII in a time- and MOI-dependent fashion; extracellular USA300 (LAC) did not increase RNAIII expression despite having the capacity to respond to autoinducing peptide-enriched culture medium. HOCl-mediated damage and intracellular survival were the same in the wild-type and USA300 (LAC agr KO). PMN lysis by ingested USA300 (LAC) was time- and MOI-dependent and, at MOIs >1, required α-hemolysin (hla) as USA300 (LAC agr KO) and USA300 (LAC hla KO) promoted PMN lysis only at high MOIs. Taken together, these data demonstrate activation of the agr operon in human PMN with the subsequent production of α-hemolysin and PMN lysis. The extent to which these events in the phagosomes of human PMN contribute to the increased morbidity and mortality of infections with USA300 (LAC) merits further study. PMID:20829608
Zhao, Qiao; Nakashima, Jin; Chen, Fang; Yin, Yanbin; Fu, Chunxiang; Yun, Jianfei; Shao, Hui; Wang, Xiaoqiang; Wang, Zeng-Yu; Dixon, Richard A.
2013-01-01
The evolution of lignin biosynthesis was critical in the transition of plants from an aquatic to an upright terrestrial lifestyle. Lignin is assembled by oxidative polymerization of two major monomers, coniferyl alcohol and sinapyl alcohol. Although two recently discovered laccases, LAC4 and LAC17, have been shown to play a role in lignin polymerization in Arabidopsis thaliana, disruption of both genes only leads to a relatively small change in lignin content and only under continuous illumination. Simultaneous disruption of LAC11 along with LAC4 and LAC17 causes severe plant growth arrest, narrower root diameter, indehiscent anthers, and vascular development arrest with lack of lignification. Genome-wide transcript analysis revealed that all the putative lignin peroxidase genes are expressed at normal levels or even higher in the laccase triple mutant, suggesting that lignin laccase activity is necessary and nonredundant with peroxidase activity for monolignol polymerization during plant vascular development. Interestingly, even though lignin deposition in roots is almost completely abolished in the lac11 lac4 lac17 triple mutant, the Casparian strip, which is lignified through the activity of peroxidase, is still functional. Phylogenetic analysis revealed that lignin laccase genes have no orthologs in lower plant species, suggesting that the monolignol laccase genes diverged after the evolution of seed plants. PMID:24143805
Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants
Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi
2013-01-01
Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290
Frederiksen, Rikki F; Yoshimura, Yayoi; Storgaard, Birgit G; Paspaliari, Dafni K; Petersen, Bent O; Chen, Kowa; Larsen, Tanja; Duus, Jens Ø; Ingmer, Hanne; Bovin, Nicolai V; Westerlind, Ulrika; Blixt, Ola; Palcic, Monica M; Leisner, Jørgen J
2015-02-27
There is emerging evidence that chitinases have additional functions beyond degrading environmental chitin, such as involvement in innate and acquired immune responses, tissue remodeling, fibrosis, and serving as virulence factors of bacterial pathogens. We have recently shown that both the human chitotriosidase and a chitinase from Salmonella enterica serovar Typhimurium hydrolyze LacNAc from Galβ1-4GlcNAcβ-tetramethylrhodamine (LacNAc-TMR (Galβ1-4GlcNAcβ(CH2)8CONH(CH2)2NHCO-TMR)), a fluorescently labeled model substrate for glycans found in mammals. In this study we have examined the binding affinities of the Salmonella chitinase by carbohydrate microarray screening and found that it binds to a range of compounds, including five that contain LacNAc structures. We have further examined the hydrolytic specificity of this enzyme and chitinases from Sodalis glossinidius and Polysphondylium pallidum, which are phylogenetically related to the Salmonella chitinase, as well as unrelated chitinases from Listeria monocytogenes using the fluorescently labeled substrate analogs LacdiNAc-TMR (GalNAcβ1-4GlcNAcβ-TMR), LacNAc-TMR, and LacNAcβ1-6LacNAcβ-TMR. We found that all chitinases examined hydrolyzed LacdiNAc from the TMR aglycone to various degrees, whereas they were less active toward LacNAc-TMR conjugates. LacdiNAc is found in the mammalian glycome and is a common motif in invertebrate glycans. This substrate specificity was evident for chitinases of different phylogenetic origins. Three of the chitinases also hydrolyzed the β1-6 bond in LacNAcβ1-6LacNAcβ-TMR, an activity that is of potential importance in relation to mammalian glycans. The enzymatic affinities for these mammalian-like structures suggest additional functional roles of chitinases beyond chitin hydrolysis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Hong, Gil-Sun; Goo, Hyun Woo; Song, Jae-Woo
2012-06-01
To investigate the prevalence of ligamentum arteriosum calcification (LAC) on multi-section spiral CT and digital radiography. Five hundred and eight children and 232 adults who performed multi-section chest CT were included in this study and were divided into nine age groups: A (0-5 years), B (6-10 years), C (11-15 years), D (16-20 years), E (21-30 years), F (31-40 years), G (41-50 years), H (51-60 years), and I (61-70 years). Two radiologists assessed the presence of LAC on axial and coronal CT images, defined as focal calcific density on both or on one plane with attenuation >100 Hounsfield unit. The prevalence of LAC on CT was compared between children and adults, and between unenhanced and enhanced CT in children. The prevalence of LAC on digital radiography was evaluated in 476 children. The prevalence of definite LAC on unenhanced multi-section CT was significantly higher in children (37.8 %) than in adults (11.2 %) (P < 0.001), with prevalences in groups: A through I of 35.8, 48.7, 35.1, 28.6, 25.0, 10.2, 15.5, 7.8, and 5.6 %, respectively. The prevalences of indeterminate LAC in age groups A-I on unenhanced multi-section CT were 4.5, 12.8, 8.1, 19.0, 0.0, 0.0, 0.0, 2.0, and 1.9 %. In children, the prevalence of LAC was significantly higher on unenhanced than on enhanced CT (37.8 vs. 16.4 %, P < 0.001). The prevalence of LAC on digital radiography was 3.6 % in children. LAC is frequently observed in children and adults on multi-section spiral CT, more frequently than previously reported. Compared with that on multi-section spiral CT, the prevalence of LAC on digital radiography is substantially low.
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
Optical and radio properties of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Stocke, J. T.; Liebert, J.; Schmidt, G.; Gioia, I. M.; Maccacaro, T.
1985-01-01
The eight BL Lac objects from the HEAO 1 A-2 all-sky survey and from the Einstein medium-sensitivity survey (MSS) form a flux-limited complete X-ray selected sample. The optical and radio properties of the MSS BL Lac objects are presented and compared with those of the HEAO 1 A-2 sample and with those of radio-selected BL Lac objects. The X-ray selected BL Lac objects possess smaller polarized fractions and less violent optical variability than radio-selected BL Lac objects. These properties are consistent with the substantial starlight fraction seen in the optical spectra of a majority of these objects. This starlight allows a determination of definite redshifts for two of four MSS BL Lac objects and a probable redshift for a third. These redshifts are 0.2, 0.3, and 0.6. Despite the differences in characteristics between the X-ray selected and radio-selected samples, it is concluded that these eight objects possess most of the basic qualities of BL Lac objects and should be considered members of that class. Moreover, as a class, these X-ray selected objects have the largest ratio of X-ray to optical flux of any active galactic nuclei yet discovered.
He, Xi; Han, Ning; Wang, Yan-Ping
2016-01-01
Lactobacillus kefiranofaciens ZW3 was obtained from kefir grains, which have high lactose hydrolytic activity. In this study, a heterodimeric LacLM-type β-galactosidase gene (lacLM) from ZW3 was isolated, which was composed of two overlapping genes, lacL (1,884 bp) and lacM (960 bp) encoding large and small subunits with calculated molecular masses of 73,620 and 35,682 Da, respectively. LacLM, LacL, and LacM were expressed in Escherichia coli BL21(DE3) and these recombinant proteins were purified and characterized. The results showed that, compared with the recombinant holoenzyme, the recombinant large subunit exhibits obviously lower thermostability and hydrolytic activity. Moreover, the optimal temperature and pH of the holoenzyme and large subunit are 60°C and 7.0, and 50°C and 8.0, respectively. However, the recombinant small subunit alone has no activity. Interestingly, the activity and thermostability of the large subunit were greatly improved after mixing it with the recombinant small subunit. Therefore, the results suggest that the small subunit might play an important role in maintaining the stability of the structure of the catalytic center located in the large subunit.
Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)
Chirinos, Julio A.; Gómez, Luis F.; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R.; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M.; Suárez, Erick; Ortiz, Ana P.; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P.
2013-01-01
Background Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Methods and Findings Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998–2007, n = 31,009) from eight LAC countries and from a national survey of the United States (US) population (1999–2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region’s average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Conclusions Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained. PMID:23349785
Miranda, J Jaime; Herrera, Victor M; Chirinos, Julio A; Gómez, Luis F; Perel, Pablo; Pichardo, Rafael; González, Angel; Sánchez, José R; Ferreccio, Catterina; Aguilera, Ximena; Silva, Eglé; Oróstegui, Myriam; Medina-Lezama, Josefina; Pérez, Cynthia M; Suárez, Erick; Ortiz, Ana P; Rosero, Luis; Schapochnik, Noberto; Ortiz, Zulma; Ferrante, Daniel; Casas, Juan P; Bautista, Leonelo E
2013-01-01
Limited knowledge on the prevalence and distribution of risk factors impairs the planning and implementation of cardiovascular prevention programs in the Latin American and Caribbean (LAC) region. Prevalence of hypertension, diabetes mellitus, abnormal lipoprotein levels, obesity, and smoking were estimated from individual-level patient data pooled from population-based surveys (1998-2007, n=31,009) from eight LAC countries and from a national survey of the United States (US) population (1999-2004) Age and gender specific prevalence were estimated and age-gender adjusted comparisons between both populations were conducted. Prevalence of diabetes mellitus, hypertension, and low high-density lipoprotein (HDL)-cholesterol in LAC were 5% (95% confidence interval [95% CI]: 3.4, 7.9), 20.2% (95% CI: 12.5, 31), and 53.3% (95% CI: 47, 63.4), respectively. Compared to LAC region's average, the prevalence of each risk factor tended to be lower in Peru and higher in Chile. LAC women had higher prevalence of obesity and low HDL-cholesterol than men. Obesity, hypercholesterolemia, and hypertriglyceridemia were more prevalent in the US population than in LAC population (31 vs. 16.1%, 16.8 vs. 8.9%, and 36.2 vs. 26.5%, respectively). However, the prevalence of low HDL-cholesterol was higher in LAC than in the US (53.3 vs. 33.7%). Major cardiovascular risk factors are highly prevalent in LAC region, in particular low HDL-cholesterol. In addition, marked differences do exist in this prevalence profile between LAC and the US. The observed patterns of obesity-related risk factors and their current and future impact on the burden of cardiovascular diseases remain to be explained.
Laser-Assisted Cold-Sprayed Corrosion- and Wear-Resistant Coatings: A Review
NASA Astrophysics Data System (ADS)
Olakanmi, E. O.; Doyoyo, M.
2014-06-01
Laser-assisted cold spray (LACS) process will be increasingly employed for depositing coatings because of its unique advantages: solid-state deposition of dense, homogeneous, and pore-free coatings onto a range of substrates; and high build rate at reduced operating costs without the use of expensive heating and process inert gases. Depositing coatings with excellent performance indicators via LACS demands an accurate knowledge and control of processing and materials' variables. By varying the LACS process parameters and their interactions, the functional properties of coatings can be manipulated. Moreover, thermal effect due to laser irradiation and microstructural evolution complicate the interpretation of LACS mechanical deformation mechanism which is essential for elucidating its physical phenomena. In order to provide a basis for follow-on-research that leads to the development of high-productivity LACS processing of coatings, this review focuses on the latest developments in depositing corrosion- and wear-resistant coatings with the emphasis on the composition, structure, and mechanical and functional properties. Historical developments and fundamentals of LACS are addressed in an attempt to describe the physics behind the process. Typical technological applications of LACS coatings are also identified. The investigations of all process sequences, from laser irradiation of the powder-laden gas stream and the substrate, to the impingement of thermally softened particles on the deposition site, and subsequent further processes, are described. Existing gaps in the literature relating to LACS-dependent microstructural evolution, mechanical deformation mechanisms, correlation between functional properties and process parameters, processing challenges, and industrial applications have been identified in order to provide insights for further investigations and innovation in LACS deposition of wear- and corrosion-resistant coatings.
The Cosmic Evolution of Fermi BL Lacertae Objects
NASA Astrophysics Data System (ADS)
Ajello, Marco; Gasparrini, Dario; Romani, Roger W.; Shaw, Michael S.
2014-06-01
It has been notoriously difficult in the past to measure the cosmological evolution of BL Lacs because of the challenges related to measure their redshift. Extensive optical follow-up observations of a sample of ~200 Fermi-detected BL Lac objects have provided much-needed redshift information for many of them. This stands as the largest and most complete sample of BL Lacs available in the literature and was used to determine the cosmological properties of this elusive source class. This talk will review the cosmic evolution of BL Lacs and discuss the link to their siblings flat-spectrum radio quasars (FSRQs). Evidence suggests that BL Lacs of the high-synchrotron peaked class might be an accretion-starved end-state of an earlier merger-driven gas-rich phase.
Li, Juan; Tao, Shujuan; Orlando, Ron; Murtaugh, Michael P.
2015-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) is a positive-sense ssRNA virus whose envelope contains four glycoproteins and three nonglycosylated proteins. Glycans of major envelope glycoprotein 5 (GP5) are proposed as important for virus assembly and entry into permissive cells. Structural characterization of GP5 glycans would facilitate the mechanistic understanding of these processes. Thus, we purified the PRRSV type 2 prototype strain, VR2332, and analyzed the virion-associated glycans by both biochemical and mass spectrometric methods. Endoglycosidase digestion showed that GP5 was the primary protein substrate, and that the carbohydrate moieties were primarily complex-type N-glycans. Mass spectrometric analysis (HPLC-ESI-MS/MS) of GP5 N-glycans revealed an abundance of N-acetylglucosamine (GlcNAc) and N-acetyllactosamine (LacNAc) oligomers in addition to sialic acids. GlcNAc and LacNAc accessibility to ligands was confirmed by lectin co-precipitation. Our findings help to explain PRRSV infection of cells lacking sialoadhesin and provide a glycan database to facilitate molecular structural studies of PRRSV. PMID:25726973
Genome Engineering of the 2,3-Butanediol Biosynthetic Pathway for Tight Regulation in Cyanobacteria.
Nozzi, Nicole E; Atsumi, Shota
2015-11-20
Cyanobacteria have gained popularity among the metabolic engineering community as a tractable photosynthetic host for renewable chemical production. However, though a number of successfully engineered production systems have been reported, long-term genetic stability remains an issue for cyanobacterial systems. The genetic engineering toolbox for cyanobacteria is largely lacking inducible systems for expression control. The characterization of tight regulation systems for use in cyanobacteria may help to alleviate this problem. In this work we explore the function of the IPTG inducible promoter P(L)lacO1 in the model cyanobacterium Synechococcus elongatus PCC 7942 as well as the effect of gene order within an operon on pathway expression. According to our experiments, P(L)lacO1 functions well as an inducible promoter in S. elongatus. Additionally, we found that gene order within an operon can strongly influence control of expression of each gene.
Mezey, Gillian; Meyer, Deborah; Robinson, Fiona; Bonell, Chris; Campbell, Rona; Gillard, Steve; Jordan, Peter; Mantovani, Nadia; Wellings, Kaye; White, Sarah
2015-01-01
BACKGROUND: Looked-after children (LAC) are at greater risk of teenage pregnancy than non-LAC, which is associated with adverse health and social consequences. Existing interventions have failed to reduce rates of teenage pregnancy in LAC. Peer mentoring is proposed as a means of addressing many of the factors associated with the increased risk of teenage pregnancy in this group. OBJECTIVE: To develop a peer mentoring intervention to reduce teenage pregnancy in LAC. DESIGN: Phase I and II randomised controlled trial of a peer mentoring intervention for LAC; scoping exercise and literature search; national surveys of social care professionals and LAC; and focus groups and interviews with social care professionals, mentors and mentees. SETTING: Three local authorities (LAs) in England. PARTICIPANTS: LAC aged 14-18 years (mentees/care as usual) and 19-25 years (mentors). INTERVENTION: Recruitment and training of mentors; randomisation and matching of mentors to mentees; and 1-year individual peer mentoring. MAIN OUTCOME MEASURES: PRIMARY OUTCOME: pregnancy in LAC aged 14-18 years. SECONDARY OUTCOMES: sexual attitudes, behaviour and knowledge; psychological health; help-seeking behaviour; locus of control; and attachment style. A health economic evaluation was also carried out. RESULTS: In total, 54% of target recruitment was reached for the exploratory trial and 13 out of 20 mentors (65%) and 19 out of 30 LAC aged 14-18 years (63%) (recruited during Phases I and II) were retained in the research. The training programme was acceptable and could be manualised and replicated. Recruitment and retention difficulties were attributed to systemic problems and LA lack of research infrastructure and lack of additional funding to support and sustain such an intervention. Mentees appeared to value the intervention but had difficulty in meeting weekly as required. Only one in four of the relationships continued for the full year. A future Phase III trial would require the intervention to be modified to include provision of group and individual peer mentoring; internal management of the project, with support from an external agency such as a charity or the voluntary sector; funds to cover LA research costs, including the appointment of a dedicated project co-ordinator; a reduction in the lower age for mentee recruitment and an increase in the mentor recruitment age to 21 years; and the introduction of a more formal recruitment and support structure for mentors. CONCLUSIONS: Given the problems identified and described in mounting this intervention, a new development phase followed by a small-scale exploratory trial incorporating these changes would be necessary before proceeding to a Phase III trial. FUNDING: This project was funded by the NIHR Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 19, No. 85. See the NIHR Journals Library website for further project information. PMID:26497730
Hiblot, Julien; Bzdrenga, Janek; Champion, Charlotte; Chabriere, Eric; Elias, Mikael
2015-01-01
A new representative of the Phosphotriesterase-Like Lactonases (PLLs) family from the hyperthermophilic crenarchaeon Vulcanisaeta moutnovskia has been characterized and crystallized. VmoLac is a native, proficient lactonase with promiscuous, low phosphotriesterase activity. VmoLac therefore represents an interesting candidate for engineering studies, with the aim of developing an efficient bacterial quorum-quenching agent. Here, we provide an extensive biochemical and kinetic characterization of VmoLac and describe the X-ray structures of the enzyme bound to a fatty acid and to its cognate substrate 3-oxo-C10 AHL (Acyl-Homoserine Lactone). The structures highlight possible structural determinants that may be involved in its extreme thermal stability (Tm = 128°C). Moreover, the structure reveals that the substrate binding mode of VmoLac significantly differs from those of its close homologues, possibly explaining the substrate specificity of the enzyme. Finally, we describe the specific interactions between the enzyme and its substrate, and discuss the possible lactone hydrolysis mechanism of VmoLac. PMID:25670483
Plasticity of laccase generated by homeologous recombination in yeast.
Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry
2009-10-01
Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.
Radio constraints on the nature of BL Lacertae objects and their parent population
NASA Technical Reports Server (NTRS)
Kollgaard, R. I.; Wardle, J. F. C.; Roberts, D. H.; Gabuzda, D. C.
1992-01-01
5 GHz VLA observations of 17 BL Lac objects with bright radio cores at both high and low resolution are reported. Extended emission is detected around most objects. None of the sources observed at low resolution show evidence of giant halos on the scale of tens of arcmin. In general, the sources with the most luminous extended emission exhibit FR II characteristics in both morphology and polarization, and less luminous sources exhibit FR I characteristics. Thus, the parent population of the BL Lac objects contains both FR I and FR II radio sources. No BL Lac objects are found that clearly exhibit quasarlike polarization at milliarcsec resolution. This argues against the view that the more luminous BL Lac objects are simply an extension of the quasar/OVV population, or that most BL Lac objects are gravitationally microlensed images of distant quasars. Other properties are generally consistent with the view the BL Lac objects are normal radio galaxies whose jets make a small angle to the line of sight.
Inabu, Y; Saegusa, A; Inouchi, K; Koike, S; Oba, M; Sugino, T
2017-11-01
The objective of this study was to evaluate the effects of lactose inclusion in calf starters on plasma glucagon-like peptide (GLP)-1 and GLP-2 concentrations and gastrointestinal tract development in calves. Holstein bull calves (n = 45) were raised on an intensified nursing program using milk replacer containing 28.0% CP and 15.0% fat, and were fed a texturized calf starter containing 0 (control), 5.0 (LAC5), or 10.0% (LAC10; n = 15 for each treatment) lactose on a DM basis. Lactose was included in the starter by partially replacing dry ground corn in pelleted portion of the starter. All calf starters were formulated with 23.1% CP. The ethanol-soluble carbohydrate concentrations of the control, LAC5, and LAC10 starters were 7.3, 12.3, and 16.8% on a DM basis, respectively. Starch concentrations of the control, LAC5, and LAC10 starters were 29.7, 27.0, and 21.4% on a DM basis, respectively. All calves were fed treatment calf starters ad libitum. Blood samples were obtained weekly from 1 to 11 wk of age, and used to measure plasma GLP-1, GLP-2, and insulin concentrations, serum β-hydroxybutyrate (BHB) concentration, and blood glucose concentration. At 80 d of age, calves were euthanized, and weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine tissue were measured. Serum BHB concentration was higher for calves fed the LAC10 (171 μmol/L) starter than for those fed the control (151 μmol/L) and LAC5 (145 μmol/L) starters. Plasma GLP-1 and GLP-2 concentrations did not differ between treatments. However, relative to the baseline (1 wk of age), the plasma GLP-1 concentration was higher for the LAC10 (125.9%) than for the LAC5 (68.2%) and control (36.8%), and for the LAC5 than for the control (36.8%). Moreover, similar differences between treatments were observed for GLP-2 concentration relative to the baseline (88.2, 76.9, and 74.9% for LAC10, LAC5, and control treatments, respectively). The serum BHB concentration was positively correlated with the plasma GLP-1 concentration (r = 0.428). Furthermore, the plasma GLP-1 concentration was positively correlated with the insulin concentration (r = 0.793). The weights of the reticulorumen, omasum, abomasum, small intestine, and large intestine were not affected by the treatments. In conclusion, inclusion of lactose in calf starters resulted in higher plasma GLP-1 and GLP-2 concentrations, and BHB might be associated with higher plasma GLP-1 concentration. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Laccase Down-Regulation Causes Alterations in Phenolic Metabolism and Cell Wall Structure in Poplar1
Ranocha, Philippe; Chabannes, Matthieu; Chamayou, Simon; Danoun, Saïda; Jauneau, Alain; Boudet, Alain-M.; Goffner, Deborah
2002-01-01
Laccases are encoded by multigene families in plants. Previously, we reported the cloning and characterization of five divergent laccase genes from poplar (Populus trichocarpa) xylem. To investigate the role of individual laccase genes in plant development, and more particularly in lignification, three independent populations of antisense poplar plants, lac3AS, lac90AS, and lac110AS with significantly reduced levels of laccase expression were generated. A repression of laccase gene expression had no effect on overall growth and development. Moreover, neither lignin content nor composition was significantly altered as a result of laccase suppression. However, one of the transgenic populations, lac3AS, exhibited a 2- to 3-fold increase in total soluble phenolic content. As indicated by toluidine blue staining, these phenolics preferentially accumulate in xylem ray parenchyma cells. In addition, light and electron microscopic observations of lac3AS stems indicated that lac3 gene suppression led to a dramatic alteration of xylem fiber cell walls. Individual fiber cells were severely deformed, exhibiting modifications in fluorescence emission at the primary wall/middle lamella region and frequent sites of cell wall detachment. Although a direct correlation between laccase gene expression and lignification could not be assigned, we show that the gene product of lac3 is essential for normal cell wall structure and integrity in xylem fibers. lac3AS plants provide a unique opportunity to explore laccase function in plants. PMID:12011346
The cosmic evolution of Fermi BL lacertae objects
Ajello, M.; Romani, R. W.; Gasparrini, D.; ...
2013-12-13
Fermi has provided the largest sample of γ-ray-selected blazars to date. We use a uniformly selected set of 211 BL Lacertae (BL Lac) objects detected by Fermi during its first year of operation. We obtained redshift constraints for 206 out of the 211 BL Lac objects in our sample, making it the largest and most complete sample of BL Lac objects available in the literature. We use this sample to determine the luminosity function of BL Lac objects and its evolution with cosmic time. Here, we find that for most BL Lac classes the evolution is positive, with a space density peaking at modest redshift (z ≈ 1.2). Low-luminosity, high-synchrotron-peaked (HSP) BL Lac objects are an exception, showing strong negative evolution, with number density increasing for z lesssim 0.5. Since this rise corresponds to a drop-off in the density of flat-spectrum radio quasars (FSRQs), a possible interpretation is that these HSPs represent an accretion-starved end state of an earlier merger-driven gas-rich phase. Additionally, we find that the known BL Lac correlation between luminosity and photon spectral index persists after correction for the substantial observational selection effects with implications for the so-called "blazar sequence." Finally, by estimating the beaming corrections to the luminosity function, we find that BL Lac objects have an average Lorentz factor ofmore » $$\\gamma =6.1^{+1.1}_{-0.8}$$, and that most are seen within 10° of the jet axis.« less
Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M
2013-09-01
The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.
Cunha, M N M; Felgueiras, H P; Gouveia, I; Zille, A
2017-06-01
Silver nanoparticles (AgNPs) were synthesized by citrate reduction method in the presence of polymers, poly(ethylene glycol) (PEG), poly(vinyl alcohol) (PVA) and chitosan, used as stabilizing agents, and an oxidoreductase enzyme, laccase (Lac), with the goal of expanding the NPs antimicrobial action. AgNPs were characterized by UV-vis spectrometry, dynamic light scattering and transmission electron microscopy. As protecting agents, PEG and PVA promoted the formation of spherical uniformly-shaped, small-sized, monodispersed AgNPs (≈20nm). High Mw polymers were established as most effective in producing small-sized NPs. Chitosan's viscosity led to the formation of aggregates. Despite the decrease in Lac activity registered for the hybrid formulation, AgNPs-polymer-Lac, a significant augment in stability over time (up to 13days, at 50°C) was observed. This novel formulation displays improved synergistic performance over AgNPs-Lac or polymer-Lac conjugates, since in the former the Lac activity becomes residual at the end of 3days. By enabling many ionic interactions, chitosan restricted the mass transfer between Lac and substrate and, thus, inhibited the enzymatic activity. These hybrid nanocomposites made up of inorganic NPs, organic polymers and immobilized antimicrobial oxidoreductive enzymes represent a new class of materials with improved synergistic performance. Moreover, the Lac and the AgNPs different antimicrobial action, both in time and mechanism, may also constitute a new alternative to reduce the probability of developing resistance-associated mutations. Copyright © 2017 Elsevier B.V. All rights reserved.
Lorenzo, José M; Franco, Daniel; Carballo, Javier
2014-01-01
The effect of the finishing diet on the volatile compounds throughout the manufacture of dry-cured "lacón" (a Spanish traditional meat product), from the Celta pig breed was studied. Thirty-six pigs were separated into three groups according to the type of feeding during the finish-fattening period of three months (concentrate, mixed diet and chestnut). From the pigs of each diet, four batches of dry-cured "lacón" were manufactured. From each batch, samples of fresh meat, meat after salting, after post-salting, and after 14, 28, 56 and 84 days of drying-ripening were taken. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry (GC/MS). Seventy-six volatile compounds were identified and quantified from dry-cured "lacón" samples in pigs finished with chestnut, eighty-two for concentrate fed pigs and eighty in pigs fed with the mixed diet. The number of identified volatile compounds increased during the manufacturing process; at 84 days of drying-ripening, in the dry-cured "lacón" samples from pigs finished with concentrate, mixed diet and chestnut, 54, 58 and 62 volatile compounds were detected, respectively. The most abundant group of flavour compounds at the end of the manufacturing process was hydrocarbons in the three feeding systems, followed by aldehydes, ketones and alcohols. Discriminant analysis selected six variables (dodecane, butadienol, pentenol, 2-pentenal, decen-3-ona and pyridine-2-methyl) and calculated two discriminating functions which allowed verification of chestnut in the finishing diet. © 2013.
Zhang, Yijia; Chu, Mi; Yang, Lu; Tan, Yueming; Deng, Wenfang; Ma, Ming; Su, Xiaoli; Xie, Qingji
2014-08-13
We report here three-dimensional graphene networks (3D-GNs) as a novel substrate for the immobilization of laccase (Lac) and dopamine (DA) and its application in glucose/O2 biofuel cell. 3D-GNs were synthesized with an Ni(2+)-exchange/KOH activation combination method using a 732-type sulfonic acid ion-exchange resin as the carbon precursor. The 3D-GNs exhibited an interconnected network structure and a high specific surface area. DA was noncovalently functionalized on the surface of 3D-GNs with 3,4,9,10-perylene tetracarboxylic acid (PTCA) as a bridge and used as a novel immobilized mediating system for Lac-based bioelectrocatalytic reduction of oxygen. The 3D-GNs-PTCA-DA nanocomposite modified glassy carbon electrode (GCE) showed stable and well-defined redox current peaks for the catechol/o-quinone redox couple. Due to the mediated electron transfer by the 3D-GNs-PTCA-DA nanocomposite, the Nafion/Lac/3D-GNs-PTCA-DA/GCE exhibited high catalytic activity for oxygen reduction. The 3D-GNs are proven to be a better substrate for Lac and its mediator immobilization than 2D graphene nanosheets (2D-GNs) due to the interconnected network structure and high specific surface area of 3D-GNs. A glucose/O2 fuel cell using Nafion/Lac/3D-GNs-PTCA-DA/GCE as the cathode and Nafion/glucose oxidase/ferrocence/3D-GNs/GCE as the anode can output a maximum power density of 112 μW cm(-2) and a short-circuit current density of 0.96 mA cm(-2). This work may be helpful for exploiting the popular 3D-GNs as an efficient electrode material for many other biotechnology applications.
Croxatto, Antony; Chalker, Victoria J.; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L.
2002-01-01
Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum ΔvanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the ΔvanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an l-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum ΔvanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production. PMID:11872713
Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L
2002-03-01
Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.
A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement
Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.
2013-01-01
A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700
Policy for Research and Innovation in Latin America
NASA Astrophysics Data System (ADS)
Aguirre-Bastos, Carlos
2010-02-01
Latin America (LAC) is renewing efforts to build-up research and innovation (R&I) capacities, guided by policies that consider the need to transform the traditional science system into a more dynamic entity. Policies permitted the generation of new spaces to develop science, strengthen scientific communities, improve university-enterprise linkages, establish common agendas between public and private sectors, earmark special budgets, build new infrastructure, and improve the number and quality of scientific publications. In spite of much progress, LAC lags much behind developed countries, their universities rank lower than their international counterparts, the number of researchers is small and funding is below an appropriate threshold. Some countries have innovated in few economic sectors, while others remain technologically underdeveloped and much of the countries' innovative capacities remain untapped. It is believed that policies still have little influence on social and economic development and there exists dissatisfaction in the academic and entrepreneurial sectors with their quality and relevance or with the political will of governments to execute them. On the other hand, in the past decades, the complexity of innovation systems has increased considerably, and has yet to be taken fully into account in LAC policy definitions. The situation calls for decision makers to shape new framework conditions for R&I in a way that both processes co-evolve and are stimulated and guided on solutions to the major problems of society. Considering the main features of complex systems, self- organization, emergence and non-linearity, R&I policy measures need to be seen as interventions in such a system, as the use of traditional leverage effects used in the past for policy decisions are more and more obsolete. Policies must now use ``weak coordination mechanisms,'' foresight, mission statements, and visions. It is obvious that due to nonlinearities in the system, adaptive political requirements and governance have to replace master plans and long term fixed targets. Policies must include incentives for networking, pilot projects, simulation models, etc. International cooperation is absolutely necessary to generate the new policy framework needed by LAC. )
Ronchel, M C; Ramos, J L
2001-06-01
Active biological containment (ABC) systems have been designed to control at will the survival or death of a bacterial population. These systems are based on the use of a killing gene, e.g., a porin-inducing protein such as the one encoded by the Escherichia coli gef gene, and a regulatory circuit that controls expression of the killing gene in response to the presence or absence of environmental signals. An ABC system for recombinant microorganisms that degrade a model pollutant was designed on the basis of the Pseudomonas putida TOL plasmid meta-cleavage regulatory circuit. The system consists of a fusion of the Pm promoter to lacI, whose expression is controlled by XylS with 3-methylbenzoate, and a fusion of a synthetic P(lac) promoter to gef. In the presence of the model pollutant, bacterial cells survived and degraded the target compound, whereas in the absence of the aromatic carboxylic acid cell death was induced. The system had two main drawbacks: (i) the slow death of the bacterial cells in soil versus the fast killing rate in liquid cultures in laboratory assays, and (ii) the appearance of mutants, at a rate of about 10(-8) per cell and generation, that did not die after the pollutant had been exhausted. We reinforced the ABC system by including it in a Deltaasd P. putida background. A P. putida Deltaasd mutant is viable only in complex medium supplemented with diaminopimelic acid, methionine, lysine, and threonine. We constructed a P. putida Deltaasd strain, called MCR7, with a Pm::asd fusion in the host chromosome. This strain was viable in the presence of 3-methylbenzoate because synthesis of the essential metabolites was achieved through XylS-dependent induction. In the P. putida MCR7 strain, an ABC system (Pm::lacI, xylS, P(lac)::gef) was incorporated into the host chromosome to yield strain MCR8. The number of MCR8 mutants that escaped killing was below our detection limit (<10(-9) mutants per cell and generation). The MCR8 strain survived and colonized rhizosphere soil with 3-methylbenzoate at a level similar to that of the wild-type strain. However, it disappeared in less than 20 to 25 days in soils without the pollutant, whereas an asd(+), biologically contained counterpart such as P. putida CMC4 was still detectable in soils after 100 days.
Latin America: A Development Pole for Phenomics
Camargo, Anyela V.; Lobos, Gustavo A.
2016-01-01
Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC. PMID:27999577
Latin America: A Development Pole for Phenomics.
Camargo, Anyela V; Lobos, Gustavo A
2016-01-01
Latin America and the Caribbean (LAC) has long been associated with the production and export of a diverse range of agricultural commodities. Due to its strategic geographic location, which encompasses a wide range of climates, it is possible to produce almost any crop. The climate diversity in LAC is a major factor in its agricultural potential but this also means climate change represents a real threat to the region. Therefore, LAC farming must prepare and quickly adapt to an environment that is likely to feature long periods of drought, excessive rainfall and extreme temperatures. With the aim of moving toward a more resilient agriculture, LAC scientists have created the Latin American Plant Phenomics Network (LatPPN) which focuses on LAC's economically important crops. LatPPN's key strategies to achieve its main goal are: (1) training of LAC members on plant phenomics and phenotyping, (2) establish international and multidisciplinary collaborations, (3) develop standards for data exchange and research protocols, (4) share equipment and infrastructure, (5) disseminate data and research results, (6) identify funding opportunities and (7) develop strategies to guarantee LatPPN's relevance and sustainability across time. Despite the challenges ahead, LatPPN represents a big step forward toward the consolidation of a common mind-set in the field of plant phenotyping and phenomics in LAC.
Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization
Foster, P. L.
1994-01-01
During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809
Yu, Xiaodan; Kawakami, Hiroko; Tahara, Naoyuki; Olmer, Merissa; Hayashi, Shinichi; Akiyama, Ryutaro; Bagchi, Anindya; Lotz, Martin; Kawakami, Yasuhiko
2017-08-01
Increasing evidence supports the idea that bone morphogenetic proteins (BMPs) regulate cartilage maintenance in the adult skeleton. The aim of this study is to obtain insight into the regulation of BMP activities in the adult skeletal system. We analyzed expression of Noggin and Gremlin1, BMP antagonists that are known to regulate embryonic skeletal development, in the adult skeletal system by Noggin-LacZ and Gremlin1-LacZ knockin reporter mouse lines. Both reporters are expressed in the adult skeleton in a largely overlapping manner with some distinct patterns. Both are detected in the articular cartilage, pubic symphysis, facet joint in the vertebrae, and intervertebral disk, suggesting that they regulate BMP activities in these tissues. In a surgically induced knee osteoarthritis model in mice, expression of Noggin mRNA was lost from the articular cartilage, which correlated with loss of BMP2/4 and pSMAD1/5/8, an indicator of active BMP signaling. Both reporters are also expressed in the sterna and rib cartilage, suggesting an extensive role of BMP antagonism in adult cartilage tissue. Moreover, Noggin-LacZ was detected in sutures in the skull and broadly in the nasal cartilage, while Gremlin1-LacZ exhibits a weaker and more restricted expression domain in the nasal cartilage. These results suggest broad regulation of BMP activities by Noggin and Gremlin1 in cartilage tissues in the adult skeleton, and that BMP signaling and its antagonism by NOGGIN play a role in osteoarthritis development. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1671-1682, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
[Role of the sweet taste receptor in glucose metabolism: no sweets for diabetes?].
Nomura, Masatoshi; Kawahara, Yuta
2015-01-01
Type 2 diabetes is closely associated with our daily diets and has become a global health problem with increasing number of patients. Maintaining energy homeostasis is essentially required for the treatment of diabetes. Energy metabolism starts with taking in a meal. Nutrients including amino acids, fatty acids and glucose in the digest have been shown to act on the neuroendocrine cells in the gastrointestinal (GI) tract, and thereby play important roles in energy homeostasis. Therefore, the GI tract is now recognized as a sensor system for nutrient signals. Taste receptor type 1 member 2 (T1R2) is known to function as a co-receptor with T1R3 to detect sweet chemicals in the taste buds. It has been proposed that the T1R2/T1R3 receptor complex acts as sweet sensor in the intestine, and plays a pivotal role in sensing sugars and maintaining glucose homeostasis through incretin secretion. To clarify the physiological roles of T1R2 in glucose homeostasis, T1r2-lacZ knock-in/knock-out mice were generated. We found lacZ gene expression in the GI tract where T1r3 expression has been reported. Interestingly, the T1r2-lacZ knock-in mice showed impaired glucose tolerance on oral glucose challenge but not on intraperitoneal injection. However, the fasting glucose level in T1r2-lacZ knock-in mice was comparable to that in wild type mice. These results suggest an important role of the sweet taste receptor system in the intestine when stimulated by glucose. Therefore, the roles of T1R2 will be presented and the mechanism for metabolic homeostasis will be discussed.
Multi-centennial upper-ocean heat content reconstruction using online data assimilation
NASA Astrophysics Data System (ADS)
Perkins, W. A.; Hakim, G. J.
2017-12-01
The Last Millennium Reanalysis (LMR) provides an advanced paleoclimate ensemble data assimilation framework for multi-variate climate field reconstructions over the Common Era. Although reconstructions in this framework with full Earth system models remain prohibitively expensive, recent work has shown improved ensemble reconstruction validation using computationally inexpensive linear inverse models (LIMs). Here we leverage these techniques in pursuit of a new multi-centennial field reconstruction of upper-ocean heat content (OHC), synthesizing model dynamics with observational constraints from proxy records. OHC is an important indicator of internal climate variability and responds to planetary energy imbalances. Therefore, a consistent extension of the OHC record in time will help inform aspects of low-frequency climate variability. We use the Community Climate System Model version 4 (CCSM4) and Max Planck Institute (MPI) last millennium simulations to derive the LIMs, and the PAGES2K v.2.0 proxy database to perform annually resolved reconstructions of upper-OHC, surface air temperature, and wind stress over the last 500 years. Annual OHC reconstructions and uncertainties for both the global mean and regional basins are compared against observational and reanalysis data. We then investigate differences in dynamical behavior at decadal and longer time scales between the reconstruction and simulations in the last-millennium Coupled Model Intercomparison Project version 5 (CMIP5). Preliminary investigation of 1-year forecast skill for an OHC-only LIM shows largely positive spatial grid point local anomaly correlations (LAC) with a global average LAC of 0.37. Compared to 1-year OHC persistence forecast LAC (global average LAC of 0.30), the LIM outperforms the persistence forecasts in the tropical Indo-Pacific region, the equatorial Atlantic, and in certain regions near the Antarctic Circumpolar Current. In other regions, the forecast correlations are less than the persistence case but still positive overall.
Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.
Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng
2007-11-01
This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may involve endocytosis and particle size dependent paracellular transport. 2007 John Wiley & Sons, Ltd
Tan, Yueming; Deng, Wenfang; Li, Yunyong; Huang, Zhao; Meng, Yue; Xie, Qingji; Ma, Ming; Yao, Shouzhuo
2010-04-22
We report here on the facile preparation of polymer-enzyme-multiwalled carbon nanotubes (MWCNTs) cast films accompanying in situ laccase (Lac)-catalyzed polymerization for electrochemical biosensing and biofuel cell applications. Lac-catalyzed polymerization of dopamine (DA) as a new substrate was examined in detail by UV-vis spectroscopy, cyclic voltammetry, quartz crystal microbalance, and scanning electron microscopy. Casting the aqueous mixture of DA, Lac and MWCNTs on a glassy carbon electrode (GCE) yielded a robust polydopamine (PDA)-Lac-MWCNTs/GCE that can sense hydroquinone with 643 microA mM(-1) cm(-2) sensitivity and 20-nM detection limit (S/N = 3). The DA substrate yielded the best biosensing performance, as compared with aniline, o-phenylenediamine, or o-aminophenol as the substrate for similar Lac-catalyzed polymerization. Casting the aqueous mixture of DA, glucose oxidase (GOx), Lac, and MWCNTs on a Pt electrode yielded a robust PDA-GOx-Lac-MWCNTs/Pt electrode that exhibits glucose-detection sensitivity of 68.6 microA mM(-1) cm(-2). In addition, 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) was also coimmobilized to yield a PDA-Lac-MWCNTs-ABTS/GCE that can effectively catalyze the reduction of O(2), and it was successfully used as the biocathode of a membraneless glucose/O(2) biofuel cell (BFC) in pH 5.0 Britton-Robinson buffer. The proposed biomacromolecule-immobilization platform based on enzyme-catalyzed polymerization may be useful for preparing many other multifunctional polymeric bionanocomposites for wide applications.
Photometric monitoring of three BL Lacertae objects in 1993-1998
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1999-05-01
The results of optical photometric (BVRI) monitoring of three BL Lac objects over a time interval of about four years are presented. The sources are three classical radio-selected BL Lac objects, BL Lac, OJ 287 and PKS 0735+178. During our observation OJ 287 was in the stage of a large periodic outburst which consisted of at least two peaks. Almost all the observations obtained over consecutive nights detected intranight variations. In 1995 and 1996 BL Lac kept in faint states, with fewer and smaller rapid flares and fluctuations. On the contrary, in late 1997 BL Lac was at the stage of a large outburst, accompanied with much more large amplitude rapid flares and fluctuations. PKS 0735+178 was almost at its faint end from 1994 to early 1998. Over this time interval, the intraday variations and microvariations in PKS 0735+178 were rare and the amplitude was very small, except a rapid darkening of ~ 0.4 mag on 24 January 1995. Previous work by \\cite[Webb et al. (1988);]{web88} \\cite[Wagner et al. (1996);]{wag96} \\cite[Pian et al. (1997)]{pia97} also showed the same behaviour of variability as BL Lac and PKS 0735+178 in BL Lac, S5 0716+714, PKS 2155-304, respectively. We propose that the motion of orientation of the relativistic jet in a BL Lac object be responsible for these variability behaviours. Table~1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html
Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina
2016-08-23
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.
Lupus anticoagulant: a multicenter study for a standardized and harmonized reporting.
Poz, Alessandra; Pradella, Paola; Azzarini, Gabriella; Santarossa, Liliana; Bardin, Cristina; Zardo, Lorena; Giacomello, Roberta
2016-03-01
Laboratory assessment of Lupus anticoagulant (LAC) is very challenging because of inter and intralaboratory variability, which makes it difficult to standardize and harmonize results expression. Five hospital laboratories in North-eastern Italy shared their efforts and their experience in a cross-laboratory study, conducting the diagnostic process as homogeneously as possible and providing a better interpretation for LAC positivity. Hundred normal samples from healthy subjects (20 from each center) were processed to confirm negative upper limits and calculate positivity cutoffs of LAC integrated assays, that is dilute Russell's viper venom time (dRVVT) and silica clotting time (SCT). Moreover, 311 samples previously diagnosed by the laboratories as positive for LAC were analyzed to characterize different positivity levels for each assay. As far as the analysis of healthy subjects is concerned, negative upper limits are set at 1.17 and 1.19 for dRVVT and SCT screen ratio, respectively. Positivity cutoffs are set at 1.20 for dRVVT and 1.23 for SCT, expressed as Test Ratio calculated on screen and confirm integrated tests. Positive results for each integrated assay are subsequently divided into three subgroups: weak, moderate and strong; the results obtained are presented as a score proposal that can provide LAC interpretation. The combined use of both dRVVT and SCT assays and the definition of different positivity levels may lead to clearer, more objective LAC reporting. An interpretative table for LAC-proposed score provides LAC-positive results and it is now adopted by all centers involved in the study.
Sand, Daniel; She, Rosemary; Shulman, Ira A; Chen, David S; Schur, Mathew; Hsu, Hugo Y
2015-05-01
To evaluate the spectrum and antibiotic susceptibility panel of infectious keratitis at a major tertiary care referral eye center and a major county hospital in Southern California. Retrospective case series. All cultured infectious keratitis cases from July 1, 2008, through December 31, 2012, from the Doheny Eye Institute (DEI) and the Los Angeles County + University of Southern California Medical Center (LAC+USC) were evaluated. Microbiology records were reviewed retrospectively. Microbial isolates as well as antibiotic susceptibility patterns were analyzed. One hundred eighty-four (63%) of 290 cases showed positive culture results at DEI and 152 (82%) of 186 cases showed positive culture results at LAC+USC. Gram-positive pathogens were found to be the most common at both DEI (70%) and LAC+USC (68%), with coagulase-negative Staphylococcus being the most common gram-positive organism (58% at DEI and 44% at LAC+USC). Pseudomonas aeruginosa was the most common gram-negative organism (57% at DEI and 43% at LAC+USC). Ciprofloxacin and levofloxacin susceptibility for all tested pathogens was 73% at DEI and 81% at LAC+USC (P = 0.16). Oxacillin-resistant Staphylococcus aureus (ORSA) was found in 42% of cases at DEI and in 45% of cases at LAC+USC (P = 1.00). There is no significant difference in the spectrum of pathogens or antibiotic susceptibility of pathogens at DEI versus LAC+USC, and ORSA was found in approximately half of all S. aureus samples. Copyright © 2015 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.
Rabies in the Americas: 1998-2014
Vigilato, Marco A. N.; Pompei, Julio A.; Rocha, Felipe; Vokaty, Alexandra; Molina-Flores, Baldomero; Cosivi, Ottorino; Del Rio Vilas, Victor J.
2018-01-01
Through national efforts and regional cooperation under the umbrella of the Regional Program for the Elimination of Rabies, dog and human rabies have decreased significantly in Latin America and Caribbean (LAC) countries over the last three decades. To achieve this decline, LAC countries had to develop national plans, and consolidate capabilities such as regular mass dog vaccination, opportune post-exposure prophylaxis and sensitive surveillance. This paper presents longitudinal data for 21 LAC countries on dog vaccination, PEP and rabies surveillance collected from the biannual regional meeting for rabies directors from 1998–2014 and from the Regional Epidemiologic Surveillance System for Rabies (SIRVERA). Differences in human and dog rabies incidence rates and dog vaccination rates were shown between low, middle and high-income countries. At the peak, over 50 million dogs were vaccinated annually in national campaigns in the countries represented. The reported number of animal exposures remained fairly stable during the study period with an incidence rate ranging from 123 to 191 reported exposures per 100,000 people. On average, over 2 million doses of human vaccine were applied annually. In the most recent survey, only 37% of countries reported that they had sufficient financial resources to meet the program objectives. The data show a sufficient and sustained effort of the LAC countries in the area of dog vaccination and provide understanding of the baseline effort required to reduce dog-mediated rabies incidence. PMID:29558465
Rabies in the Americas: 1998-2014.
Freire de Carvalho, Mary; Vigilato, Marco A N; Pompei, Julio A; Rocha, Felipe; Vokaty, Alexandra; Molina-Flores, Baldomero; Cosivi, Ottorino; Del Rio Vilas, Victor J
2018-03-01
Through national efforts and regional cooperation under the umbrella of the Regional Program for the Elimination of Rabies, dog and human rabies have decreased significantly in Latin America and Caribbean (LAC) countries over the last three decades. To achieve this decline, LAC countries had to develop national plans, and consolidate capabilities such as regular mass dog vaccination, opportune post-exposure prophylaxis and sensitive surveillance. This paper presents longitudinal data for 21 LAC countries on dog vaccination, PEP and rabies surveillance collected from the biannual regional meeting for rabies directors from 1998-2014 and from the Regional Epidemiologic Surveillance System for Rabies (SIRVERA). Differences in human and dog rabies incidence rates and dog vaccination rates were shown between low, middle and high-income countries. At the peak, over 50 million dogs were vaccinated annually in national campaigns in the countries represented. The reported number of animal exposures remained fairly stable during the study period with an incidence rate ranging from 123 to 191 reported exposures per 100,000 people. On average, over 2 million doses of human vaccine were applied annually. In the most recent survey, only 37% of countries reported that they had sufficient financial resources to meet the program objectives. The data show a sufficient and sustained effort of the LAC countries in the area of dog vaccination and provide understanding of the baseline effort required to reduce dog-mediated rabies incidence.
Indian Americans at Mille Lacs.
ERIC Educational Resources Information Center
Holbert, Victoria L.; And Others
The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…
Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?
ERIC Educational Resources Information Center
Franklin, Doug; Blankenberger, Bob
2016-01-01
Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…
Lactose-induced cell death of beta-galactosidase mutants in Kluyveromyces lactis.
Lodi, Tiziana; Donnini, Claudia
2005-05-01
The Kluyveromyces lactis lac4 mutants, lacking the beta-galactosidase gene, cannot assimilate lactose, but grow normally on many other carbon sources. However, when these carbon sources and lactose were simultaneously present in the growth media, the mutants were unable to grow. The effect of lactose was cytotoxic since the addition of lactose to an exponentially-growing culture resulted in 90% loss of viability of the lac4 cells. An osmotic stabilizing agent prevented cells killing, supporting the hypothesis that the lactose toxicity could be mainly due to intracellular osmotic pressure. Deletion of the lactose permease gene, LAC12, abolished the inhibitory effect of lactose and allowed the cell to assimilate other carbon substrates. The lac4 strains gave rise, with unusually high frequency, to spontaneous mutants tolerant to lactose (lar1 mutation: lactose resistant). These mutants were unable to take up lactose. Indeed, lar1 mutation turned out to be allelic to LAC12. The high mutability of the LAC12 locus may be an advantage for survival of K. lactis whose main habitat is lactose-containing niches.
NASA Astrophysics Data System (ADS)
Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng
2018-05-01
La atom reaction with isoprene is carried out in a laser-vaporization molecular beam source. The reaction yields an adduct as the major product and C—C cleaved and dehydrogenated species as the minor ones. La(C5H8), La(C2H2), and La(C3H4) are characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectra of all three species exhibit a strong origin band and several weak vibronic bands corresponding to La-ligand stretch and ligand-based bend excitations. La(C5H8) is a five-membered metallacycle, whereas La(C2H2) and La(C3H4) are three-membered rings. All three metallacycles prefer a doublet ground state with a La 6s1-based valence electron configuration and a singlet ion. The five-membered metallacycle is formed through La addition and isoprene isomerization, whereas the two three-membered rings are produced by La addition and insertion, hydrogen migration, and carbon-carbon bond cleavage.
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F. William; Dubendorff, John W.
1998-01-01
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.
Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages
Studier, F. William; Dubendorff, John W.
1998-01-01
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sosnovsky, Denis V.; Ivanov, Konstantin L., E-mail: ivanov@tomo.nsc.ru; Novosibirsk State University, Pirogova 2, 630090, Novosibirsk
Chemically Induced Dynamic Nuclear Polarization (CIDNP) is an efficient method of creating non-equilibrium polarization of nuclear spins by using chemical reactions, which have radical pairs as intermediates. The CIDNP effect originates from (i) electron spin-selective recombination of radical pairs and (ii) the dependence of the inter-system crossing rate in radical pairs on the state of magnetic nuclei. The CIDNP effect can be investigated by using Nuclear Magnetic Resonance (NMR) methods. The gain from CIDNP is then two-fold: it allows one to obtain considerable amplification of NMR signals; in addition, it provides a very useful tool for investigating elusive radicals andmore » radical pairs. While the mechanisms of the CIDNP effect in liquids are well established and understood, detailed analysis of solid-state CIDNP mechanisms still remains challenging; likewise a common theoretical frame for the description of CIDNP in both solids and liquids is missing. Difficulties in understanding the spin dynamics that lead to the CIDNP effect in the solid-state case are caused by the anisotropy of spin interactions, which increase the complexity of spin evolution. In this work, we propose to analyze CIDNP in terms of level crossing phenomena, namely, to attribute features in the CIDNP magnetic field dependence to Level Crossings (LCs) and Level Anti-Crossings (LACs) in a radical pair. This approach allows one to describe liquid-state CIDNP; the same holds for the solid-state case where anisotropic interactions play a significant role in CIDNP formation. In solids, features arise predominantly from LACs, since in most cases anisotropic couplings result in perturbations, which turn LCs into LACs. We have interpreted the CIDNP mechanisms in terms of the LC/LAC concept. This consideration allows one to find analytical expressions for a wide magnetic field range, where several different mechanisms are operative; furthermore, the LAC description gives a way to determine CIDNP sign rules. Thus, LCs/LACs provide a consistent description of CIDNP in both liquids and solids with the prospect of exploiting it for the analysis of short-lived radicals and for optimizing the polarization level.« less
An Easy Method to Eliminate the Effect of Lupus Anticoagulants in the Coagulation Factor Assay.
Tang, Ning; Yin, Shiyu
2016-07-01
To build and evaluate intrinsic coagulation factor assays which can eliminate the effect of lupus anticoagulants (LAC). Commercial silica clotting time confirmatory (SCT-C) reagent containing sufficient synthetic phospholipid and routine activated partial thromboplastin time (APTT) reagent were each used for one-stage detection of FVIII, FIX, and FXI activities, in samples with or without LAC, and the results were compared. For samples without LAC, consistent results of FVIII, FIX, and FXI using both SCT-C reagent and APTT reagent were obtained. For samples with LAC, the assays with SCT-C reagent not only could eliminate the effect of strong lupus anticoagulants but also needed fewer dilutions than that with routine APTT reagent. The intrinsic factor detections by SCT-C reagent are credible and convenient to be used for samples with LAC.
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie
2010-07-15
The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.
Magnesium for treatment of acute lacunar stroke syndromes: further analysis of the IMAGES trial.
Aslanyan, Stella; Weir, Christopher J; Muir, Keith W; Lees, Kennedy R
2007-04-01
A prespecified interaction analysis of the neutral Intravenous Magnesium Efficacy in Stroke (IMAGES) trial revealed significant benefit from magnesium (Mg) in patients with noncortical stroke. Post hoc analysis indicated that this effect was seen in lacunar clinical syndromes (LACS), interaction P=0.005. We have now examined whether this interaction could be explained by confounding baseline factors. LACS was defined on the basis of neurological signs and did not include imaging. We investigated the interaction between baseline variables and Mg treatment on global outcome. We used logistic-regression models to test whether the Mg-LACS interaction remained significant after adjusting for stratification variables, sex, a novel stroke severity score, and baseline variables that had an interaction with treatment (P<0.1). The Mg (n=383) and placebo (n=382) groups of LACS patients were well matched on baseline factors. In addition to LACS, we found an interaction between beneficial Mg treatment effect and younger age (P=0.003), higher baseline diastolic blood pressure (P=0.02), higher mean blood pressure (P=0.02), and absence of ischemic heart disease (P=0.07). Even so, the adjusted Mg-LACS interaction remained significant (odds ratio [OR] 0.57; 95% CI, 0.39 to 0.83; P=0.003). In the LACS subgroup, Mg improved Barthel Index <95 (OR 0.73; 95% CI, 0.55 to 0.98), modified Rankin Scale >1 (OR 0.67; 95% CI, 0.50 to 0.91), and global outcome (OR 0.70; 95% CI, 0.53 to 0.92) but not Barthel Index <60 or mortality. The positive treatment effect of Mg in LACS cannot be ascribed to general issues of severity, time to treatment, blood pressure, or other baseline factors; equally, this finding may be due to chance. A large trial of Mg treatment in LACS appears justified.
Liu, Wan-Ting; Wang, Yang; Zhang, Jing; Ye, Fei; Huang, Xiao-Hui; Li, Bin; He, Qing-Yu
2018-07-01
Lung adenocarcinoma (LAC) is the most lethal cancer and the leading cause of cancer-related death worldwide. The identification of meaningful clusters of co-expressed genes or representative biomarkers may help improve the accuracy of LAC diagnoses. Public databases, such as the Gene Expression Omnibus (GEO), provide rich resources of valuable information for clinics, however, the integration of multiple microarray datasets from various platforms and institutes remained a challenge. To determine potential indicators of LAC, we performed genome-wide relative significance (GWRS), genome-wide global significance (GWGS) and support vector machine (SVM) analyses progressively to identify robust gene biomarker signatures from 5 different microarray datasets that included 330 samples. The top 200 genes with robust signatures were selected for integrative analysis according to "guilt-by-association" methods, including protein-protein interaction (PPI) analysis and gene co-expression analysis. Of these 200 genes, only 10 genes showed both intensive PPI network and high gene co-expression correlation (r > 0.8). IPA analysis of this regulatory networks suggested that the cell cycle process is a crucial determinant of LAC. CENPA, as well as two linked hub genes CDK1 and CDC20, are determined to be potential indicators of LAC. Immunohistochemical staining showed that CENPA, CDK1 and CDC20 were highly expressed in LAC cancer tissue with co-expression patterns. A Cox regression model indicated that LAC patients with CENPA + /CDK1 + and CENPA + /CDC20 + were high-risk groups in terms of overall survival. In conclusion, our integrated microarray analysis demonstrated that CENPA, CDK1 and CDC20 might serve as novel cluster of prognostic biomarkers for LAC, and the cooperative unit of three genes provides a technically simple approach for identification of LAC patients. Copyright © 2018 Elsevier B.V. All rights reserved.
Tong, Kun; Lin, Aiguo; Ji, Guodong; Wang, Dong; Wang, Xinghui
2016-05-05
The adsorption of organic pollutants from super heavy oil wastewater (SHOW) by lignite activated coke (LAC) was investigated. Specifically, the effects of LAC adsorption on pH, BOD5/COD(Cr)(B/C), and the main pollutants before and after adsorption were examined. The removed organic pollutants were characterized by Fourier transform infrared spectroscopy (FTIR), Boehm titrations, gas chromatography-mass spectrometry (GC-MS), and liquid chromatography with organic carbon detection (LC-OCD). FTIR spectra indicated that organic pollutants containing -COOH and -NH2 functional groups were adsorbed from the SHOW. Boehm titrations further demonstrated that carboxyl, phenolic hydroxyl, and lactonic groups on the surface of the LAC increased. GC-MS showed that the removed main organic compounds are difficult to be degraded or extremely toxics to aquatic organisms. According to the results of LC-OCD, 30.37 mg/L of dissolved organic carbons were removed by LAC adsorption. Among these, hydrophobic organic contaminants accounted for 25.03 mg/L. Furthermore, LAC adsorption was found to increase pH and B/C ratio of the SHOW. The mechanisms of adsorption were found to involve between the hydrogen bonding and the functional groups of carboxylic, phenolic, and lactonic on the LAC surface. In summary, all these results demonstrated that LAC adsorption can remove bio-refractory DOCs, which is beneficial for biodegradation. Copyright © 2016. Published by Elsevier B.V.
Modification of natural matrix lac-bagasse for matrix composite films
NASA Astrophysics Data System (ADS)
Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono
2016-02-01
Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe
2014-06-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.
2014-01-01
Background This study aims to rank policy concerns and policy-related research issues in order to identify policy and research gaps on access to medicines (ATM) in low- and middle-income countries in Latin America and the Caribbean (LAC), as perceived by policy makers, researchers, NGO and international organization representatives, as part of a global prioritization exercise. Methods Data collection, conducted between January and May 2011, involved face-to-face interviews in El Salvador, Colombia, Dominican Republic, and Suriname, and an e-mail survey with key-stakeholders. Respondents were asked to choose the five most relevant criteria for research prioritization and to score policy/research items according to the degree to which they represented current policies, desired policies, current research topics, and/or desired research topics. Mean scores and summary rankings were obtained. Linear regressions were performed to contrast rankings concerning current and desired policies (policy gaps), and current and desired research (research gaps). Results Relevance, feasibility, and research utilization were the top ranked criteria for prioritizing research. Technical capacity, research and development for new drugs, and responsiveness, were the main policy gaps. Quality assurance, staff technical capacity, price regulation, out-of-pocket payments, and cost containment policies, were the main research gaps. There was high level of coherence between current and desired policies: coefficients of determination (R2) varied from 0.46 (Health system structure; r = 0.68, P <0.01) to 0.86 (Sustainable financing; r = 0.93, P <0.01). There was also high coherence between current and desired research on Rational selection and use of medicines (r = 0.71, P <0.05, R2 = 0.51), Pricing/affordability (r = 0.82, P <0.01, R2 = 0.67), and Sustainable financing (r = 0.76, P <0.01, R2 = 0.58). Coherence was less for Health system structure (r = 0.61, P <0.01, R2 = 0.38). Conclusions This study combines metrics approaches, contributing to priority setting methodology development, with country and regional level stakeholder participation. Stakeholders received feedback with the results, and we hope to have contributed to the discussion and implementation of ATM research and policy priorities in LAC. PMID:24965383
Evaluating the Outcomes of a School Based Theraplay® Project for Looked after Children
ERIC Educational Resources Information Center
Francis, Yvonne J.; Bennion, Kim; Humrich, Sarah
2017-01-01
Research shows that Looked After Children (LAC) may experience emotional instability which can reduce their capacity to engage with education. This study evaluates an attachment based therapeutic Theraplay® intervention designed to bridge the gap between the emotional well-being of LAC and their engagement in education. Twenty LAC between the ages…
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.
Liu, Huiping; Cheng, Yu; Du, Bing; Tong, Chaofan; Liang, Shuli; Han, Shuangyan; Zheng, Suiping; Lin, Ying
2015-01-01
Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT) from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), guaiacol, and 2,6-dimethoxyphenol (2,6-DMP) as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0–11.0 and thermostable at 40°C–90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters. PMID:25790466
Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators
Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina
2016-01-01
Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923
The third catalog of active galactic nuclei detected by the Fermi large area telescope
Ackermann, M.; Ajello, M.; Atwood, W. B.; ...
2015-08-25
We present the third catalog of active galactic nuclei (AGNs) detected by the Fermi-LAT (3LAC). It is based on the third Fermi-LAT catalog (3FGL) of sources detected between 100 MeV and 300 GeV with a Test Statistic greater than 25, between 2008 August 4 and 2012 July 31. The 3LAC includes 1591 AGNs located at high Galactic latitudes (more » $$| b| \\gt 10^\\circ $$), a 71% increase over the second catalog based on 2 years of data. There are 28 duplicate associations, thus 1563 of the 2192 high-latitude gamma-ray sources of the 3FGL catalog are AGNs. Most of them (98%) are blazars. About half of the newly detected blazars are of unknown type, i.e., they lack spectroscopic information of sufficient quality to determine the strength of their emission lines. Based on their gamma-ray spectral properties, these sources are evenly split between flat-spectrum radio quasars (FSRQs) and BL Lacs. The most abundant detected BL Lacs are of the high-synchrotron-peaked (HSP) type. There were about 50% of the BL Lacs that had no measured redshifts. A few new rare outliers (HSP-FSRQs and high-luminosity HSP BL Lacs) are reported. The general properties of the 3LAC sample confirm previous findings from earlier catalogs. The fraction of 3LAC blazars in the total population of blazars listed in BZCAT remains non-negligible even at the faint ends of the BZCAT-blazar radio, optical, and X-ray flux distributions, which hints that even the faintest known blazars could eventually shine in gamma-rays at LAT-detection levels. Furthermore, the energy-flux distributions of the different blazar populations are in good agreement with extrapolation from earlier catalogs.« less
The intraday variability in the radio-selected and X-ray-selected BL Lacertae objects
NASA Astrophysics Data System (ADS)
Bai, J. M.; Xie, G. Z.; Li, K. H.; Zhang, X.; Liu, W. W.
1998-10-01
Seven BL Lac objects have been photometrically observed in an effort to study the difference of optical intraday variability between the radio-selected BL Lac objects (RBLs) and X-ray-selected BL Lac objects (XBLs). The objects we observed are selected arbitrarily. They are four RBLs, PKS 0735+178, PKS 0754+101, OJ 287 and BL Lac, and three XBLs, H 0323+022, H 0548-322 and H 2154-304. During the observation all of them exhibited microvariation, and H 0323+022 and H 0548-322 sometimes showed brightness oscillation. PKS 0735+178 and BL Lac were in their faint states and not very active. It seems that RBLs do not show microvariability more frequently than XBLs. Table 2 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5)
Barcelo, Alberto; Arredondo, Armando; Gordillo-Tobar, Amparo; Segovia, Johanna; Qiang, Anthony
2017-12-01
The financial implications of the increase in the prevalence of diabetes in middle-income countries represents one of the main challenges to health system financing and to the society as a whole. The objective of this study was to estimate the economic cost of diabetes in Latin America and the Caribbean (LAC) in 2015. The study used a prevalence-based approach to estimate the direct and indirect costs related to diabetes in 29 LAC countries in 2015. Direct costs included health care expenditures such as medications (insulin and oral hypoglycemic agents), tests, consultations, hospitalizations, emergency visits and treating complications. Two different scenarios (S1 and S2) were used to analyze direct cost. S1 assumed conservative estimates while S2 assumed broader coverage of medication and services. Indirect costs included lost resources due to premature mortality, temporary and permanent disabilities. In 2015 over 41 million adults (20 years of age and more) were estimated to have Diabetes Mellitus in LAC. The total indirect cost attributed to Diabetes was US$ 57.1 billion, of which US$ 27.5 billion was due to premature mortality, US$16.2 billion to permanent disability, and US$ 13.3 billion to temporary disability. The total direct cost was estimated between US$ 45 and US$ 66 billion, of which the highest estimated cost was due to treatment of complications (US$ 1 616 to US$ 26 billion). Other estimates indicated the cost of insulin between US$ 6 and US$ 11 billion; oral medication US$ 4 to US$ 6 billion; consultations between US$ 5 and US$ 6 billion; hospitalization US$ 10 billion; emergency visits US$ 1 billion; test and laboratory exams between US$ 1 and US$ 3 million. The total cost of diabetes in 2015 in LAC was estimated to be between US$ 102 and US$ 123 billion. On average, the annual cost of treating one case of diabetes mellitus (DM) in LAC was estimated between US$ 1088 and US$ 1818. Per capita National Health Expenditures averaged US$ 1061 in LAC. Diabetes represented a major economic burden to the countries of Latin America and the Caribbean in 2015. The estimates presented here are key information for decision-making that can be used in the formulation of policies and programs to achieve greater efficiency and effectiveness in the use of resources for diabetes prevention in the 29 countries of LAC.
Barcelo, Alberto; Arredondo, Armando; Gordillo–Tobar, Amparo; Segovia, Johanna; Qiang, Anthony
2017-01-01
BACKGROUND The financial implications of the increase in the prevalence of diabetes in middle–income countries represents one of the main challenges to health system financing and to the society as a whole. The objective of this study was to estimate the economic cost of diabetes in Latin America and the Caribbean (LAC) in 2015. METHODS The study used a prevalence–based approach to estimate the direct and indirect costs related to diabetes in 29 LAC countries in 2015. Direct costs included health care expenditures such as medications (insulin and oral hypoglycemic agents), tests, consultations, hospitalizations, emergency visits and treating complications. Two different scenarios (S1 and S2) were used to analyze direct cost. S1 assumed conservative estimates while S2 assumed broader coverage of medication and services. Indirect costs included lost resources due to premature mortality, temporary and permanent disabilities. RESULTS In 2015 over 41 million adults (20 years of age and more) were estimated to have Diabetes Mellitus in LAC. The total indirect cost attributed to Diabetes was US$ 57.1 billion, of which US$ 27.5 billion was due to premature mortality, US$16.2 billion to permanent disability, and US$ 13.3 billion to temporary disability. The total direct cost was estimated between US$ 45 and US$ 66 billion, of which the highest estimated cost was due to treatment of complications (US$ 1 616 to US$ 26 billion). Other estimates indicated the cost of insulin between US$ 6 and US$ 11 billion; oral medication US$ 4 to US$ 6 billion; consultations between US$ 5 and US$ 6 billion; hospitalization US$ 10 billion; emergency visits US$ 1 billion; test and laboratory exams between US$ 1 and US$ 3 million. The total cost of diabetes in 2015 in LAC was estimated to be between US$ 102 and US$ 123 billion. On average, the annual cost of treating one case of diabetes mellitus (DM) in LAC was estimated between US$ 1088 and US$ 1818. Per capita National Health Expenditures averaged US$ 1061 in LAC. CONCLUSIONS Diabetes represented a major economic burden to the countries of Latin America and the Caribbean in 2015. The estimates presented here are key information for decision–making that can be used in the formulation of policies and programs to achieve greater efficiency and effectiveness in the use of resources for diabetes prevention in the 29 countries of LAC. PMID:29163935
LAC indicators: an evaluation of progress and list of proposed indicators
Alan E. Watson; David N. Cole
1992-01-01
One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...
David N. Cole; George H. Stankey
1997-01-01
The Limits of Acceptable Change (LAC) process was developed to deal with the issue of recreational carrying capacity. For that purpose, the LAC process sought to explicitly define a compromise between resource/visitor experience protection and recreation use goals. The most critical and unique element of the process is the specification of LAC standards that define...
An Actor-Network Theory Reading of Change for Children in Public Care
ERIC Educational Resources Information Center
Parker, Elisabeth
2017-01-01
The education of children in public, or Local Authority (LA), care, known in the United Kingdom (UK) as looked-after children (LAC), is supported by government initiatives to reduce the attainment gap that exists between LAC and their non-LAC peers. These children often find remaining in education a challenge, are twice as likely to be permanently…
Salty taste deficits in CALHM1 knockout mice.
Tordoff, Michael G; Ellis, Hillary T; Aleman, Tiffany R; Downing, Arnelle; Marambaud, Philippe; Foskett, J Kevin; Dana, Rachel M; McCaughey, Stuart A
2014-07-01
Genetic ablation of calcium homeostasis modulator 1 (CALHM1), which releases adenosine triphosphate from Type 2 taste cells, severely compromises the behavioral and electrophysiological responses to tastes detected by G protein-coupled receptors, such as sweet and bitter. However, the contribution of CALHM1 to salty taste perception is less clear. Here, we evaluated several salty taste-related phenotypes of CALHM1 knockout (KO) mice and their wild-type (WT) controls: 1) In a conditioned aversion test, CALHM1 WT and KO mice had similar NaCl avoidance thresholds. 2) In two-bottle choice tests, CALHM1 WT mice showed the classic inverted U-shaped NaCl concentration-preference function but CALHM1 KO mice had a blunted peak response. 3) In brief-access tests, CALHM1 KO mice showed less avoidance than did WT mice of high concentrations of NaCl, KCl, NH(4)Cl, and sodium lactate (NaLac). Amiloride further ameliorated the NaCl avoidance of CALHM1 KO mice, so that lick rates to a mixture of 1000 mM NaCl + 10 µM amiloride were statistically indistinguishable from those to water. 4) Relative to WT mice, CALHM1 KO mice had reduced chorda tympani nerve activity elicited by oral application of NaCl, NaLac, and sucrose but normal responses to HCl and NH(4)Cl. Chorda tympani responses to NaCl and NaLac were amiloride sensitive in WT but not KO mice. These results reinforce others demonstrating that multiple transduction pathways make complex, concentration-dependent contributions to salty taste perception. One of these pathways depends on CALHM1 to detect hypertonic NaCl in the mouth and signal the aversive taste of concentrated salt. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Salty Taste Deficits in CALHM1 Knockout Mice
Ellis, Hillary T.; Aleman, Tiffany R.; Downing, Arnelle; Marambaud, Philippe; Foskett, J. Kevin; Dana, Rachel M.; McCaughey, Stuart A.
2014-01-01
Genetic ablation of calcium homeostasis modulator 1 (CALHM1), which releases adenosine triphosphate from Type 2 taste cells, severely compromises the behavioral and electrophysiological responses to tastes detected by G protein–coupled receptors, such as sweet and bitter. However, the contribution of CALHM1 to salty taste perception is less clear. Here, we evaluated several salty taste–related phenotypes of CALHM1 knockout (KO) mice and their wild-type (WT) controls: 1) In a conditioned aversion test, CALHM1 WT and KO mice had similar NaCl avoidance thresholds. 2) In two-bottle choice tests, CALHM1 WT mice showed the classic inverted U-shaped NaCl concentration-preference function but CALHM1 KO mice had a blunted peak response. 3) In brief-access tests, CALHM1 KO mice showed less avoidance than did WT mice of high concentrations of NaCl, KCl, NH4Cl, and sodium lactate (NaLac). Amiloride further ameliorated the NaCl avoidance of CALHM1 KO mice, so that lick rates to a mixture of 1000mM NaCl + 10 µM amiloride were statistically indistinguishable from those to water. 4) Relative to WT mice, CALHM1 KO mice had reduced chorda tympani nerve activity elicited by oral application of NaCl, NaLac, and sucrose but normal responses to HCl and NH4Cl. Chorda tympani responses to NaCl and NaLac were amiloride sensitive in WT but not KO mice. These results reinforce others demonstrating that multiple transduction pathways make complex, concentration-dependent contributions to salty taste perception. One of these pathways depends on CALHM1 to detect hypertonic NaCl in the mouth and signal the aversive taste of concentrated salt. PMID:24846212
Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J
2014-03-01
Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.
Cigarette smoke induces the expression of Notch3, not Notch1, protein in lung adenocarcinoma.
Cheng, Zhenshun; Tan, Qiuyue; Tan, Weijun; Zhang, L I
2015-08-01
The aim of the present study was to determine the effect of cigarette smoke on the expression of Notch proteins in lung adenocarcinoma (LAC). Protein expression levels of Notch1 and Notch3 were analyzed using immunohistochemistry in 102 human LAC specimens. Of these, 52 were obtained from smokers and 50 from non-smokers. In addition, cigarette smoke extract (CSE) at varying concentrations (1, 2.5 and 5%) was administered to A549 cells. The expression of Notch1 and Notch3 protein was then detected by western blot analysis at different time points (0, 8, 24 and 48 h). Of the 102 LAC specimens, 42 (41.2%) were positive for Notch1 and 63 (61.8%) were positive for Notch3. There was no significant difference in the level of Notch1 expression between smokers and non-smokers with LAC (P>0.05). The positive rate and staining intensity of Notch3 expression were increased in the smokers compared with the non-smokers (P<0.05). The expression of Notch3 protein in A549 cells increased in a time- and dose-dependent manner following treatment with CSE, whilst the expression of Notch1 protein appeared stable. The results suggested that cigarette smoke was able to induce the expression of Notch3, not Notch1, protein in LAC. The data revealed an upregulation of Notch3 in LAC following cigarette smoke exposure. Such findings may provide a novel therapeutic target for the treatment of LAC.
Nguyen, Tien-Thanh; Nguyen, Hoang-Minh; Geiger, Barbara; Mathiesen, Geir; Eijsink, Vincent G H; Peterbauer, Clemens K; Haltrich, Dietmar; Nguyen, Thu-Ha
2015-03-07
Two overlapping genes lacL and lacM (lacLM) encoding for heterodimeric β-galactosidase from Lactobacillus reuteri were previously cloned and over-expressed in the food-grade host strain Lactobacillus plantarum WCFS1, using the inducible lactobacillal pSIP expression system. In this study, we analyzed different factors that affect the production of recombinant L. reuteri β-galactosidase. Various factors related to the cultivation, i.e. culture pH, growth temperature, glucose concentration, as well as the induction conditions, including cell concentration at induction point and inducer concentration, were tested. Under optimal fermentation conditions, the maximum β-galactosidase levels obtained were 130 U/mg protein and 35-40 U/ml of fermentation broth corresponding to the formation of approximately 200 mg of recombinant protein per litre of fermentation medium. As calculated from the specific activity of the purified enzyme (190 U/mg), β-galactosidase yield amounted to roughly 70% of the total soluble intracellular protein of the host organism. It was observed that pH and substrate (glucose) concentration are the most prominent factors affecting the production of recombinant β-galactosidase. The over-expression of recombinant L. reuteri β-galactosidase in a food-grade host strain was optimized, which is of interest for applications of this enzyme in the food industry. The results provide more detailed insight into these lactobacillal expression systems and confirm the potential of the pSIP system for efficient, tightly controlled expression of enzymes and proteins in lactobacilli.
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F.W.; Dubendorff, J.W.
1998-10-20
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.
Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages
Studier, F.W.; Dubendorff, J.W.
1998-11-03
This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.
40 CFR 272.951 - Louisiana State-administered program: Final authorization.
Code of Federal Regulations, 2010 CFR
2010-07-01
..., 1997. Copies of the document can be obtained from EPA Region 6, 1445 Ross Avenue, Dallas, Texas 75202... November 20, 1988 LR 18:1375 December 20, 1992. LAC § 303.K.1 (previously LHWR § 3.2(k)(1)) July 20, 1984 LR 14:790 November 20, 1988. LAC § 901 (LHWR § 6.1) March 20, 1984 LR 20:1000 September 20, 1994. LAC...
Two modes of control of pilA, the gene encoding type 1 pilin in Escherichia coli.
Orndorff, P E; Spears, P A; Schauer, D; Falkow, S
1985-01-01
Type 1 piliation in Escherichia coli is subject to metastable regulation at the transcriptional level (B. I. Eisenstein, Science 214:337-339, 1981). However, the genes controlling in this fashion are not known. We present evidence that the pilA gene, encoding the structural subunit of type 1 pili, is subject to metastable transcriptional regulation. A pilA'-lacZ fusion, constructed in vitro on a recombinant plasmid, was used in conjunction with a recBC sbcB mutant of E. coli K-12 to introduce the fusion into the chromosomal region encoding Pil. This fusion was found to be subject to metastable transcriptional control. The rate of switching from the Lac+ to the Lac- phenotype was 4 X 10(-4) per cell per generation and 6.2 X 10(-4) in the opposite direction. A ca. 10-fold difference in beta-galactosidase activity was observed between phenotypically "ON" (Lac+) and "OFF" (Lac-) populations. P1 transduction experiments showed that the element determining the ON or OFF phenotype was tightly linked to pilA. In addition to the metastable regulation of pilA, a second type of transcriptional regulation was effected by the product of a gene, hyp, adjacent to pilA. By using a recombinant plasmid containing just a pilA'-lacZ fusion and the putative pilA promoter, we found that a lesion in hyp conferred a beta-galactosidase activity about fivefold higher than that of a strain possessing the parental hyp gene. Mutants constructed to have a pilA'-lacZ fusion and a hyp::Tn5-132 mutation in the chromosome exhibited a frequency of switching from Lac+ to Lac- and vice versa indistinguishable from that of the parental strain. However, in the ON mode, hyp::Tn5-132 mutants showed a twofold-higher beta-galactosidase activity. Thus, hyp does not appear to affect metastable variation but does affect the level of transcription of the pilA gene in the ON (transcribed) mode. Images PMID:3930469
Husser, Oliver; Fujita, Buntaro; Hengstenberg, Christian; Frerker, Christian; Beckmann, Andreas; Möllmann, Helge; Walther, Thomas; Bekeredjian, Raffi; Böhm, Michael; Pellegrini, Costanza; Bleiziffer, Sabine; Lange, Rüdiger; Mohr, Friedrich; Hamm, Christian W; Bauer, Timm; Ensminger, Stephan
2018-03-26
The aims of this study were to report on the use of local anesthesia or conscious sedation (LACS) and general anesthesia in transcatheter aortic valve replacement and to analyze the impact on outcome. Transcatheter aortic valve replacement can be performed in LACS or general anesthesia. Potential benefits of LACS, such as faster procedures and shorter hospital stays, need to be balanced with safety. A total of 16,543 patients from the German Aortic Valve Registry from 2011 to 2014 were analyzed, and propensity-matched analyses were performed to correct for potential selection bias. LACS was used in 49% of patients (8,121 of 16,543). In hospital, LACS was associated with lower rates of low-output syndrome, respiratory failure, delirium, cardiopulmonary resuscitation, and death. There was no difference in paravalvular leakage (II+) between LACS and general anesthesia in the entire population (5% vs. 4.8%; p = 0.76) or in the matched population (3.9% vs. 4.9%, p = 0.13). The risk for prolonged intensive care unit stay (≥3 days) was significantly reduced with LACS (odds ratio: 0.82; 95% confidence interval [CI]: 0.73 to 0.92; p = 0.001). Thirty-day mortality was lower with LACS in the entire population (3.5% vs. 4.9%; hazard ratio [HR]: 0.72; 95% CI: 0.60 to 0.86; p < 0.001) and in the matched population (2.8% vs. 4.6%; HR: 0.6; 95% CI: 0.45 to 0.8; p < 0.001). However, no differences in 1-year mortality between both groups in the entire population (16.5% vs. 16.9%; HR: 0.93; 95% CI: 0.85 to 1.02; p = 0.140) and in the propensity-matched population (14.1% vs. 15.5%; HR: 0.90; 95% CI: 0.78 to 1.03; p = 0.130) were observed. Use of LACS in transcatheter aortic valve replacement is safe, with fewer post-procedural complications and lower early mortality, suggesting its broad application. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
Zhang, Shizhu; Zheng, Hailin; Long, Nanbiao; Carbó, Natalia; Chen, Peiying; Aguilar, Pablo S; Lu, Ling
2014-02-01
Calcium-mediated signaling pathways are widely employed in eukaryotes and are implicated in the regulation of diverse biological processes. In Saccharomyces cerevisiae, at least two different calcium uptake systems have been identified: the high-affinity calcium influx system (HACS) and the low-affinity calcium influx system (LACS). Compared to the HACS, the LACS in fungi is not well known. In this study, FigA, a homolog of the LACS member Fig1 from S. cerevisiae, was functionally characterized in the filamentous fungus Aspergillus nidulans. Loss of figA resulted in retardant hyphal growth and a sharp reduction of conidial production. Most importantly, FigA is essential for the homothallic mating (self-fertilization) process; further, FigA is required for heterothallic mating (outcrossing) in the absence of HACS midA. Interestingly, in a figA deletion mutant, adding extracellular Ca(2+) rescued the hyphal growth defects but could not restore asexual and sexual reproduction. Furthermore, quantitative PCR results revealed that figA deletion sharply decreased the expression of brlA and nsdD, which are known as key regulators during asexual and sexual development, respectively. In addition, green fluorescent protein (GFP) tagging at the C terminus of FigA (FigA::GFP) showed that FigA localized to the center of the septum in mature hyphal cells, to the location between vesicles and metulae, and between the junctions of metulae and phialides in conidiophores. Thus, our findings suggest that FigA, apart from being a member of a calcium uptake system in A. nidulans, may play multiple unexplored roles during hyphal growth and asexual and sexual development.
Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A
1999-01-01
LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).
High density growth of T7 expression strains with auto-induction option
Studier, F. William
2010-07-20
A bacterial growth medium for promoting auto-induction of transcription of cloned DNA in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a lac repressor. Also disclosed is a bacterial growth medium for improving the production of a selenomethionine-containing protein or polypeptide in a bacterial cell, the protein or polypeptide being produced by recombinant DNA techniques from a lac or T7lac promoter, the bacterial cell encoding a vitamin B12-dependent homocysteine methylase. Finally, disclosed is a bacterial growth medium for suppressing auto-induction of expression in cultures of bacterial cells grown batchwise, said transcription being under the control of lac repressor.
NASA Astrophysics Data System (ADS)
Munoz, R.; Caylor, E.; Yost, C. L.; Drake, C.; Ladwig, J. L.; Myrbo, A.; Howes, T.
2014-12-01
Wild rice (Zizania palustris L.) is an aquatic grass with spiritual and subsistence significance to Native people of the Great Lakes region of North America. Mud Lake (Mashkiigwaagamaag), located on the Fond du Lac Band of Lake Superior Chippewa Reservation in Carlton County, Minnesota, USA, once supported an extensive population of wild rice (manoomin). However, early 20th century attempts to ditch and drain surrounding wetlands for landuse intensification severely altered the natural hydrological system that supports wild rice. Fond du Lac Resource Management (FDLRM) technicians are currently working to increase the wild rice population in Mud Lake. As part of these efforts, this phytolith study was undertaken to better understand how wild rice abundance has fluctuated over the past 400 years, with particular emphasis on the 19th and 20th centuries. Phytoliths are microscopic opal silica plant remains that are incorporated into soils and lake sediments after the plant-parts that contain them decay. Wild rice produces phytolith morphotypes that are unequivocally diagnostic. Mud Lake core MNMN-MUD11-1C-1P-1 (46°43'38.39"N, 92°42'2.45"W) was piston cored by LacCore (National Lacustrine Core Facility) and FDLRM technicians on 24 May 2011. Initial core descriptions, multi-sensor core logging, phytolith sampling and phytolith extractions were completed during the summer of 2014 at LacCore. Wild rice phytolith identification and quantification was conducted on twelve samples using brightfield microscopy at 400x magnification. Wild rice phytolith concentration values ranged from 68 to 2,300 phytoliths/cm3. Wild rice accumulation rates ranged from 9 to 383 phytoliths/ cm2/yr, peaking in 1952 AD. Wild rice abundance in Mud Lake appears to be influenced by a complex set of variables that include anthropogenic disturbance, climatic events and aquatic plant community succession.
Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE
NASA Astrophysics Data System (ADS)
Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.
2015-01-01
In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Avishek A.; Bossanyi, Ervin A.; Scholbrock, Andrew K.
2015-12-14
A severe challenge in controlling wind turbines is ensuring controller performance in the presence of a stochastic and unknown wind field, relying on the response of the turbine to generate control actions. Recent technologies such as LIDAR, allow sensing of the wind field before it reaches the rotor. In this work a field-testing campaign to test LIDAR Assisted Control (LAC) has been undertaken on a 600-kW turbine using a fixed, five-beam LIDAR system. The campaign compared the performance of a baseline controller to four LACs with progressively lower levels of feedback using 35 hours of collected data.
Evidence for an intermediate conformational state of LacY.
Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald
2012-03-20
LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.
Are some BL Lacs artefacts of gravitational lensing?
Ostriker, J P; Vietri, M
1990-03-01
WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.
Are some BL Lac objects artefacts of gravitational lensing?
NASA Technical Reports Server (NTRS)
Ostriker, J. P.; Vietri, M.
1985-01-01
It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.
Liu, Yujie; Liu, Zhifeng; Zeng, Guangming; Chen, Ming; Jiang, Yilin; Shao, Binbin; Li, Zhigang; Liu, Yang
2018-05-22
Some surfactants can enhance the removal of phenol by laccase (Lac) in various industrial effluents. Their behavior and function in the biodegradation of phenolic wastewater have been experimentally reported by many researchers, but the underlying molecular mechanism is still unclear. Therefore, the interaction mechanisms of phenol with Lac from Trametes versicolor were investigated in the presence or absence of Triton X-100 (TX100) or rhamnolipid (RL) by molecular docking and molecular dynamics (MD) simulations. The results indicate that phenol contacts with an active site of Lac by hydrogen bonds (HBs) and van der Waals (vdW) interactions in aqueous solution for maintaining its stability. The presence of TX100 or RL results in the significant changes of enzymatic conformations. Meanwhile, the hydrophobic parts of surfactants contact with the outside surface of Lac. These changes lead to the decrease of binding energy between phenol and Lac. The migration behavior of water molecules within hydration shell is also inevitably affected. Therefore, the amphipathic TX100 or RL may influence the phenol degradation ability of Lac by modulating their interactions and water environment. This study offers molecular level of understanding on the function of surfactants in biosystem. Copyright © 2018 Elsevier B.V. All rights reserved.
Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong
2011-02-01
Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.
Yang, Jie; Lin, Qi; Ng, Tzi Bun; Ye, Xiuyun; Lin, Juan
2014-01-01
Laccases (EC 1.10.3.2) are a class of multi-copper oxidases with important industrial values. A basidiomycete strain Cerrena sp. HYB07 with high laccase yield was identified. After cultivation in the shaking flask for 4 days, a maximal activity of 210.8 U mL−1 was attained. A 58.6-kDa laccase (LacA) with 7.2% carbohydrate and a specific activity of 1952.4 U mg−1 was purified. 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) was the optimal substrate, with K m and k cat being 93.4 µM and 2468.0 s−1, respectively. LacA was stable at 60°C, pH 5.0 and above, and in organic solvents. Metal ions Na+, K+, Ca2+, Mg2+, Mn2+, Zn2+ enhanced LacA activity, while Fe2+ and Li+ inhibited LacA activity. LacA decolorized structurally different dyes and a real textile effluent. Its gene and cDNA sequences were obtained. Putative cis-acting transcriptional response elements were identified in the promoter region. The high production yield and activity, robustness and dye decolorizing capacity make LacA and Cerrena sp. HYB07 potentially useful for industrial and environmental applications such as textile finishing and wastewater treatment. PMID:25356987
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.; ...
2017-02-07
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Involvement of glycosphingolipid-enriched lipid rafts in inflammatory responses.
Iwabuchi, Kazuhisa
2015-01-01
Glycosphingolipids (GSLs) are membrane components consisting of hydrophobic ceramide and hydrophilic sugar moieties. GSLs cluster with cholesterol in cell membranes to form GSL-enriched lipid rafts. Biochemical analyses have demonstrated that GSL-enriched lipid rafts contain several kinds of transducer molecules, including Src family kinases. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms, is highly expressed on the plasma membranes of human phagocytes, and forms lipid rafts containing the Src family tyrosine kinase Lyn. LacCer-enriched lipid rafts mediate immunological and inflammatory reactions, including superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs), which recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. LacCer also serves as a signal transduction molecule for functions mediated by CD11b/CD18-integrin (αM/β2-integrin, CR3, Mac-1), as well as being associated with several key cellular processes. LacCer recruits PCKα/ε and phospholipase A2 to stimulate PECAM-1 expression in human monocytes and their adhesion to endothelial cells, as well as regulating β1-integrin clustering and endocytosis on cell surfaces. This review describes the organizational and inflammation-related functions of LacCer-enriched lipid rafts.
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Enhanced delignification of steam-pretreated poplar by a bacterial laccase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Rahul; Hu, Jinguang; Regner, Matthew R.
The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less
Coarse-grained Simulations of Sugar Transport and Conformational Changes of Lactose Permease
NASA Astrophysics Data System (ADS)
Liu, Jin; Jewel, S. M. Yead; Dutta, Prashanta
2016-11-01
Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves sugar translocation, H+ transfer, as well as large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the transport of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule across a wild-type LacY during lactose/H+ symport process. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Protonation of Glu325 stabilizes the TDG and inward-facing conformation of LacY. Protonation of Glu269 induces a dramatic protein structural reorganization and causes the expulsion of TDG from LacY to both sides of the membrane. The structural changes occur primarily in the N-terminal domain of LacY. This work is supported by NSF Grants: CBET-1250107 and CBET -1604211.
Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio
2008-01-01
Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101
Yu, Yang; Li, Quan-Feng; Zhang, Jin-Ping; Zhang, Fan; Zhou, Yan-Fei; Feng, Yan-Zhao; Chen, Yue-Qin; Zhang, Yu-Chan
2017-01-01
Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 ( OsLAC13 ), a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H 2 O 2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H 2 O 2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H 2 O 2 dynamics and mitochondrial integrity in rice.
Zhao, J.; Kwan, H. S.
1999-01-01
The effect of different substrates and various developmental stages (mycelium growth, primordium appearance, and fruiting-body formation) on laccase production in the edible mushroom Lentinula edodes was studied. The cap of the mature mushroom showed the highest laccase activity, and laccase activity was not stimulated by some well-known laccase inducers or sawdust. For our molecular studies, two genomic DNA sequences, representing allelic variants of the L. edodes lac1 gene, were isolated, and DNA sequence analysis demonstrated that lac1 encodes a putative polypeptide of 526 amino acids which is interrupted by 13 introns. The two allelic genes differ at 95 nucleotides, which results in seven amino acid differences in the encoded protein. The copper-binding domains found in other laccase enzymes are conserved in the L. edodes Lac1 proteins. A fragment of a second laccase gene (lac2) was also isolated, and competitive PCR showed that expression of lac1 and lac2 genes was different under various conditions. Our results suggest that laccases may play a role in the morphogenesis of the mushroom. To our knowledge, this is the first report on the cloning of genes involved in lignocellulose degradation in this economically important edible fungus. PMID:10543802
Fang, Fang; Zhang, Xue-lian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi
2015-01-01
In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. PMID:26514808
Lorenzo, José M; Fonseca, Sonia
2014-11-01
Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.
Imamura, Naoko; Horikoshi, Yosuke; Matsuzaki, Tomohiko; Toriumi, Kentaro; Kitatani, Kanae; Ogura, Go; Masuda, Ryota; Nakamura, Naoya; Takekoshi, Susumu; Iwazaki, Masayuki
2013-12-20
Atypical protein kinase C lambda/iota (aPKC λ/ι) is expressed in several human cancers; however, the correlation between aPKC λ/ι localization and cancer progression in human lung adenocarcinoma (LAC) remains to be clarified. We found that patients with a high level of aPKC λ/ι expression in LAC had significantly shorter overall survival than those with a low level of aPKC λ/ι expression. In addition, localization of aPKC λ/ι in the apical membrane or at the cell-cell contact was associated with both lymphatic invasion and metastasis. The intercellular adhesion molecule, E-cadherin, was decreased in LACs with highly expressed aPKC λ/ι at the invasion site of tumor cells. This result suggested that the expression levels of aPKC λ/ι and E-cadherin reflect the progression of LAC. On double-immunohistochemical analysis, aPKC λ/ι and Lgl2, a protein that interacts with aPKC λ/ι, were co-localized within LACs. Furthermore, we found that Lgl2 bound the aPKC λ/ι-Par6 complex in tumor tissue by immune-cosedimentation analysis. Apical membrane localization of Lgl2 was correlated with lymphatic invasion and lymph node metastasis. These results thus indicate that aPKC λ/ι expression is altered upon the progression of LAC. This is also the first evidence to show aPKC λ/ι overexpression in LAC and demonstrates that aPKC λ/ι localization at the apical membrane or cell-cell contact is associated with lymphatic invasion and metastasis of the tumor.
Malaguarnera, Mariano; Risino, Corrado; Cammalleri, Lisa; Malaguarnera, Lucia; Astuto, Marinella; Vecchio, Ignazio; Rampello, Liborio
2009-07-01
Our earlier study has demonstrated that the administration of L-acetylcarnitine (LAC) improves neurological symptoms and serum parameters in hepatic coma. The aim of this work has been to evaluate the efficacy of the LAC and branched chain amino acids (BCAA) versus BCAA, administered in intravenous infusion, in patients with cirrhotic hepatic coma. Forty-eight highly selected patients were enrolled in the study and, after randomization, received blindly LAC+BCAA (n=24) versus BCAA (n=24). The two groups were similar in age, sex, pathogenesis of cirrhosis, and severity of liver disease. The comparison between values before and after LAC planned treatment showed statistical significant differences in neurological findings, evaluated by the Glasgow Scale, ammonia serum levels, blood urea nitrogen, and EEG. After 60 min of the study period, the LAC+BCAA treated patients compared with BCCA treated showed a significant decrease of ammonia serum levels: 41.20 versus 10.40 mumol P<0.05. After 1 day of the study period, the LAC+BCAA treated patients compared with BCCA treated patients showed a significant increase of Glasgow's score: 3.60 versus 1.50 score P<0.05; a significant decrease of ammonia serum levels: 63.30 versus 27.00 mumol P<0.01; a significant improvement of EEG cps/s: 2.70 versus 0.6 P<0.001. No side-effects were observed in our study series. Our study demonstrated that the administration of BCAA supplemented with LAC might improve neurological symptoms and serum ammonium levels in selected cirrhotic patients with hepatic coma.
NASA Astrophysics Data System (ADS)
Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.
2017-12-01
The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using molecular tools that are also sensitive to environmental parameters.
NASA Astrophysics Data System (ADS)
Ajtai, Tibor; Pinter, Mate; Utry, Noemi; Kiss-Albert, Gergely; Palagyi, Andrea; Manczinger, Laszlo; Vagvölgyi, Csaba; Szabo, Gabor; Bozoki, Zoltan
2016-04-01
In this study we present results of field measurement campaigns focusing on the in-situ characterization of absorption spectra and the health relevance of light absorbing carbonaceous (LAC) in the ambient. The absorption spectra is measured @ 266, 355, 532 and 1064 nm by our state-of-the-art four-wavelength photoacoustic instrument, while for health relevance the eco- cito and genotoxicity parameters were measured using standardized methodologies. We experimentally demonstrated a correlation between the toxicities and the measured absorption spectra quantified by its wavelength dependency. Based on this correlation, we present novel possibilities on real-time air quality monitoring. LAC is extensively studied not only because of its considerable climate effects but as a serious air pollutant too. Gradually increasing number of studies demonstrated experimentally that the health effect of LAC is more serious than it is expected based on its share in total atmospheric aerosol mass. Furthermore during many local pollution events LAC not only has dominancy but it is close to exclusivity. Altogether due to its climate and health effects many studies and proposed regulations focus on the physical, chemical and toxicological properties of LAC as well as on its source apportionment. Despites of its importance, there is not yet a widely accepted standard methodology for the real-time and selective identification of LAC. There are many different reasons of that: starting from its complex inherent physicochemical features including many unknown constituents, via masking effect of ambient on the inherent physicochemical properties taking place even in case of a short residence, ending with the lack of reliable instrumentation for its health or source relevant parameters. Therefore, the methodology and instrument development for selective and reliable identification of LAC is timely and important issues in climate and air quality researches. Recently, many studies demonstrated correlation between the chemical compositions and the absorption features of LAC which open up novel possibilities in real time source apportionment and in air quality monitoring.
O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert
2014-01-01
Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323
Wilson, R L; Stauffer, G V
1994-01-01
The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587
Patterns of expression of position-dependent integrated transgenes in mouse embryo.
Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F
1990-01-01
The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727
Knowles, DB; Shkel, Irina A; Phan, Noel M; Sternke, Matt; Lingeman, Emily; Cheng, Xian; Cheng, Lixue; O’Connor, Kevin; Record, M. Thomas
2015-01-01
Here we obtain the data needed to predict chemical interactions of polyethylene glycols (PEGs) and glycerol with proteins and related organic compounds, and thereby interpret or predict chemical effects of PEGs on protein processes. To accomplish this we determine interactions of glycerol and tetraEG with >30 model compounds displaying the major C, N, and O functional groups of proteins. Analysis of these data yields coefficients (α-values) quantifying interactions of glycerol, tetraEG and PEG end (-CH2OH) and interior (-CH2OCH2-) groups with these groups, relative to interactions with water. TetraEG (strongly) and glycerol (weakly) interact favorably with aromatic C, amide N, and cationic N, but unfavorably with amide O, carboxylate O and salt ions. Strongly unfavorable O and salt anion interactions help make both small and large PEGs effective protein precipitants. Interactions of tetraEG and PEG interior groups with aliphatic C are quite favorable, while interactions of glycerol and PEG end groups with aliphatic C are not. Hence tetraEG and PEG 300 favor unfolding of the DNA-binding domain of lac repressor (lacDBD) while glycerol, di- and mono-ethylene glycol are stabilizers. Favorable interactions with aromatic and aliphatic C explain why PEG400 greatly increases the solubility of aromatic hydrocarbons and steroids. PEG400-steroid interactions are unusually favorable, presumably because of simultaneous interactions of multiple PEG interior groups with the fused ring system of the steroid. Using α-values reported here, chemical contributions to PEG m-values can be predicted or interpreted in terms of changes in water-accessible surface area (ΔASA), and separated from excluded volume effects. PMID:25962980
XCOM intrinsic dimensionality for low-Z elements at diagnostic energies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bornefalk, Hans
2012-02-15
Purpose: To determine the intrinsic dimensionality of linear attenuation coefficients (LACs) from XCOM for elements with low atomic number (Z = 1-20) at diagnostic x-ray energies (25-120 keV). H{sub 0}{sup q}, the hypothesis that the space of LACs is spanned by q bases, is tested for various q-values. Methods: Principal component analysis is first applied and the LACs are projected onto the first q principal component bases. The residuals of the model values vs XCOM data are determined for all energies and atomic numbers. Heteroscedasticity invalidates the prerequisite of i.i.d. errors necessary for bootstrapping residuals. Instead wild bootstrap is applied,more » which, by not mixing residuals, allows the effect of the non-i.i.d residuals to be reflected in the result. Credible regions for the eigenvalues of the correlation matrix for the bootstrapped LAC data are determined. If subsequent credible regions for the eigenvalues overlap, the corresponding principal component is not considered to represent true data structure but noise. If this happens for eigenvalues l and l + 1, for any l{<=}q, H{sub 0}{sup q} is rejected. Results: The largest value of q for which H{sub 0}{sup q} is nonrejectable at the 5%-level is q = 4. This indicates that the statistically significant intrinsic dimensionality of low-Z XCOM data at diagnostic energies is four. Conclusions: The method presented allows determination of the statistically significant dimensionality of any noisy linear subspace. Knowledge of such significant dimensionality is of interest for any method making assumptions on intrinsic dimensionality and evaluating results on noisy reference data. For LACs, knowledge of the low-Z dimensionality might be relevant when parametrization schemes are tuned to XCOM data. For x-ray imaging techniques based on the basis decomposition method (Alvarez and Macovski, Phys. Med. Biol. 21, 733-744, 1976), an underlying dimensionality of two is commonly assigned to the LAC of human tissue at diagnostic energies. The finding of a higher statistically significant dimensionality thus raises the question whether a higher assumed model dimensionality (now feasible with the advent of multibin x-ray systems) might also be practically relevant, i.e., if better tissue characterization results can be obtained.« less
Statins: cost analysis in Indian scenario from eight major clinical trials.
Sanmukhani, J; Shah, V
2010-01-01
Coronary heart disease (CHD) is the leading cause of death in India resulting in loss of young Indians. Statins have proved to reduce the CHD mortality in various clinical trials. The aim of the study is to find the cost-effectiveness ratio (CER) for each major coronary event averted and a coronary death avoided by use of statins in different clinical settings based on the data from the major clinical trials on statins. Using electronic database and as per our inclusion and exclusion criteria we selected the West of Scotland Coronary Prevention Study (WOSCOPS), the Air Force Coronary Atherosclerosis Prevention Study (AFCAPS) and the Anglo-Scandinavian Cardiac Outcomes Trial--Lipid Lowering Arm (ASCOT-LLA) study for primary prevention; the Cholesterol and Recurrent Events Trial (CARE), the Long-term Intervention with Pravastatin in Ischemic Disease (LIPID) Study and the Scandinavian Simvastatin Survival Study (4S) for secondary prevention and two studies, the Heart Protection Study (HPS) and the Pravastatin in elderly individuals at risk of vascular disease (PROSPER) study for high-risk patients. The results of these studies were used for cost-effectiveness analysis of statins in different patient groups. Absolute risk reduction, Number Needed to Benefit (NNTB), NNTB/year for total sample and in subgroups of males, females and age >65 was derived. CER for branded and generic versions was calculated by using the prices of statins listed in Indian Drug Review Triple i. Cost-effectiveness ratio (CER) in primary prevention studies i.e., the WOSCOPS, the AFCAPS and the ASCOT-LLA was Rs. 25.8 lacs, Rs. 23.8 lacs and Rs. 7.9 lacs per major coronary event averted respectively. CER in secondary prevention studies i.e., the CARE and the LIPID was approximately Rs. 20 lacs per major coronary event averted while it was Rs. 52.4 lacs and Rs. 37 lacs per coronary heart disease (CHD) death avoided. CER from the 4S was Rs. 6.9 lacs per major coronary event and Rs. 16.9 lacs per CHD death averted. CER in the HPS and the PROSPER study was Rs. 17.9 lacs and Rs. 27.1 lacs per major coronary event avoided in high-risk patients. Cost associated with the use of statins is higher in primary prevention as compared to secondary prevention. More studies are needed to confirm the cost-effectiveness of statins to make any decision for health policy.
Polarimetry of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Heidt, J.; Nilsson, K.
2011-05-01
We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/529/A162
The physical properties and orbital parameters of the triple system V402 Lac
NASA Astrophysics Data System (ADS)
Hoyman, B.; Kalomeni, B.; Yakut, K.
2018-04-01
We present first ground-based multi-colors photometric study of an eccentric, double-lined eclipsing binary system V402 Lac. Analyzing the data obtained in this study together with earlier studies in the literature we derived the orbital and physical parameters of this detached binary system of considerable interest. Derived physical parameters of the components are as follows; M1 = 2.95 ± 0.06M⊙ , M2 = 2.86 ± 0.06M⊙ , R1 = 2.61 ± 0.04R⊙ , R2 = 2.16 ± 0.03R⊙ , L1 = 98 ± 5L⊙ and L2 = 69 ± 3L⊙ . Using the newly obtained parameters the distance of the binary is determined to be 262 ± 33 pc. In addition, the system show apsidal motion whose period is determined to be 213 years. A possible third star (M3 sin i = 1.9M⊙) orbiting the binary system in an eccentric orbit (e = 0.23) with an orbital period of 20.5 years has been detected in this study with LTT.
In vitro study for laser gene transfer in BHK-21 fibroblast cell line
NASA Astrophysics Data System (ADS)
Abdel Aziz, M.; Salem, D. S.; Salama, M. S.; Badr, Y.
2009-02-01
Modifications to our previously introduced system for laser microbeam cell surgery were carried out in the present work to match animal cells. These modifications included: 1- Using other laser system that used before, Excimer laser with 193 and 308 nm wavelengths. The used laser here, is He-Cd with low power and 441.5 nm wavelength in the visible region. 2- Instead of using pulsed laser, we used here CW He-Cd chopped by electrical chopper, which is synchronized with the mechanical motion of the mobile stage with step 40 microns, according to cell dimensions to avoid puncturing the same cell twice. The advantages of the modified here laser setup for gene transfer is: it is less damaging to the sensitive animal cell which has thin cell membrane. The present work aimed to: 1- Design a modified laser microbeam cell surgery, applicable to animal cells, such as fibroblast cells 2- To examine the efficiency of such system. 3- To assure gene transfer and its expression in the used cells. 4- To evaluate the ultra damages produced from using the laser beam as a modality for gene transfer. On the other wards, to introduce: safe, efficient and less damaging modality for gene transfer in animal cells. To achieve these goals, we applied the introduced here home-made laser setup with its synchronized parameters to introduce pBK-CMV phagemid, containing LacZ and neomycin resistance (neor )genes into BHK-21 fibroblast cell line. The results of the present work showed that: 1- Our modified laser microbeam cell surgery setup proved to be useful and efficient tool for gene transfer into fibroblast cells. 2- The presence and expression of LacZ gene was achieved using histochemical LacZ assay. 3- Selection of G418 antibiotic sensitivity assay confirmed the presence and expression towards stability of neor gene with time. 4- Presence of LacZ and neor genes in the genomic DNA of transfected fibroblast cells was indicated using PCR analysis. 5- Transmission electron microscopy indicated that, no ultradamages or changes for cell; membrane, organilles or any component of transfected fibroblast cell as a result of using laser microbeam compared with control cell.
The Radio-optical Spectra of BL Lacs and Possible Relatives
NASA Astrophysics Data System (ADS)
Dennett-Thorpe, J.
I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Domingues, L.; Dantas, M.M.; Lima, N.
1999-09-20
Alcohol fermentation of lactose was investigated using a recombinant flocculating Saccharomyces cetevisiae, expressing the LAC4 (coding the {beta}-galactosidase) and LAC12 (coding for lactose permease) genes of Kluyveromyces marxianus. Data on yeast fermentation and growth on a medium containing lactose as the sole carbon source are presented. In the range of studied lactose concentrations, total lactose consumption was observed with a conversion yield of ethanol close to the expected theoretical value. For the continuously operating bioreactor, an ethanol productivity of 11 g L{sup {minus}1} h{sup {minus}1} (corresponding to a feed lactose concentration of 50 g L{sup {minus}1} and a dilution ratemore » of 0.55 h{sup {minus}1}) was obtained, which is 7 times larger than the continuous conventional systems. The system stability was confirmed by keeping it in operation for 6 months.« less
GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.
Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G
2016-09-13
The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Wahnschaffe, U; Bitsch, A; Kielhorn, J; Mangelsdorf, I
2005-01-01
As part of a larger literature study on transgenic animals in mutagenicity testing, test results from the transgenic mutagenicity assays (lacI model; commercially available as the Big Blue® mouse, and the lacZ model; commercially available as the Muta™Mouse), were compared with the results on the same substances in the more traditional mouse bone marrow micronucleus test. 39 substances were found which had been tested in the micronucleus assay and in the above transgenic mouse systems. Although, the transgenic animal mutation assay is not directly comparable with the micronucleus test, because different genetic endpoints are examined: chromosome aberration versus gene mutation, the results for the majority of substances were in agreement. Both test systems, the transgenic mouse assay and the mouse bone marrow micronucleus test, have advantages and they complement each other. However, the transgenic animal assay has some distinct advantages over the micronucleus test: it is not restricted to one target organ and detects systemic as well as local mutagenic effects. PMID:15655069
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Ferrazzi, Paola; Colombo, Anna; Di Micco, Pierpaolo; Lodigiani, Corrado; Librè, Luca; Rota, Lidia Luciana; Montanelli, Alessandro; Quaglia, Ilaria
2010-01-01
A possible interference between lupus anticoagulant (LAC), a well characterized clotting inhibitor, in the International Normalized Ratio (INR) determination during oral anticoagulation (OA) has been reported in the literature. Few data are available about the relationship between this kind of interference and the daily clinical management of oral anticoagulation. The aim of the study is to evaluate the role of two different thromboplastins-RecombiPlasTin 2G and HepatoComplex-in the determination of INR values of several patients' ongoing OA for a previous thrombotic disorder with and without positivity to LAC, and to evaluate possible interferences in the daily therapeutic approach. We selected 16 patients (13 females and 3 males, mean age 59 ± 16 years) with LAC positivity ongoing OA and 11 control subjects (7 females and 4 males, mean age 58 ± 14.5 years) with similar characteristics (ie, ethnic background and weight) with LAC negativity ongoing OA. 165 assays for INR determination were analyzed from both groups. Statistical analysis was performed using STATA 10 software. P values were considered significant if <0.05. Mean values of INR for patients with LAC positivity were 3.79 ± 1.63 when tested with RecombiPlasTin 2G vs 3.18 ± 1.15 when tested with HepatoComplex (P < 0.001, s); while mean values of INR for patients with antiphospholipid syndrome (APS) with LAC negativity were 3.54 ± 1.39 when tested with RecombiPlasTin 2G vs 3.23 ± 1.14 when tested with HepatoComplex (P < 0.002, s). An INR value > than 4.5 was found in 31/165 samples in 9 subjects, 8 patients with LAC positivity, and 1 control group subject with LAC negativity. There was a great difference in INR values in these subjects if we use the common thromboplastin (ie, RecombiPlasTin 2G) with a INR range varying from 5.14 ± 0.35 vs 3.79 ± 0.38 if we use another thromboplastin (ie, HepatoComplex) (P < 0.001, s). A change in the therapeutic approach for OA is possible in these cases because different INR values were obtained using different thromboplastins. Our data confirm that INR evaluation does not reveal significant changes also if tested with two different thromboplastins, for patients ongoing OA with and without LAC positivity, when the INR value is < than 4. Over this INR value there is a significant difference in patients with LAC positivity if we use a different thromboplastin for the INR determination. For this reason values obtained by RecombiPlasTin 2G need to be confirmed and matched with another thromboplastin (ie, HepatoComplex). This approach may be useful in order to have a good INR testing for the chronic long-term treatment with OA in particular in patients with LAC positivity.
LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313
Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...
2016-12-21
Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those genes encode global regulatory proteins with extensive regulons. This study indicates that there are small specificC. thermocellumLacI regulons. Finally, the identification of LacI repressor activity for hemicellulase gene expression is a key result of this work and will add to the small body of existing literature on the area of gene regulation inC. thermocellum.« less
Inaba, Masaaki; Okuno, Senji; Nagayama, Harumi; Yamada, Shinsuke; Ishimura, Eiji; Imanishi, Yasuo; Shoji, Shigeichi
2015-03-01
Control of phosphate is the most critical in the treatment of chronic kidney disease with mineral and bone disorder (CKD-MBD). Because calcium-containing phosphate binder to CKD patients is known to induce adynamic bone disease with ectopic calcification by increasing calcium load, we examined the effect of lanthanum carbonate (LaC), a non-calcium containing phosphate binder, to restore bone turnover in 27 hemodialysis patients with suppressed parathyroid function (serum intact parathyroid hormone [iPTH] ≦ 150 pg/mL). At the initiation of LaC administration, the dose of calcium-containing phosphate binder calcium carbonate (CaC) was withdrawn or reduced based on serum phosphate. After initiation of LaC administration, serum calcium and phosphate decreased significantly by 4 weeks, whereas whole PTH and iPTH increased. A significant and positive correlation between decreases of serum calcium, but not phosphate, with increases of whole PTH and iPTH, suggested that the decline in serum calcium with reduction of calcium load by LaC might increase parathyroid function. Serum bone resorption markers, such as serum tartrate-resistant acid phosphatase 5b, and N-telopeptide of type I collagen increased significantly by 4 weeks after LaC administration, which was followed by increases of serum bone formation markers including serum bone alkaline phosphatase, intact procollagen N-propeptide, and osteocalcin. Therefore, it was suggested that LaC attenuated CaC-induced suppression of parathyroid function and bone turnover by decreasing calcium load. In conclusion, replacement of CaC with LaC, either partially or totally, could increase parathyroid function and resultant bone turnover in hemodialysis patients with serum iPTH ≦ 150 pg/mL. Copyright © 2015 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
Meinhardt, Sarah; Swint-Kruse, Liskin
2008-12-01
In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.
Fang, Fang; Zhang, Xue-lian; Luo, Hong-hui; Zhou, Jia-jian; Gong, Yi-hui; Li, Wen-jun; Shi, Zhao-wan; He, Quan; Wu, Qing; Li, Lu; Jiang, Lin-lin; Cai, Zhi-gao; Oren-Shamir, Michal; Zhang, Zhao-qi; Pang, Xue-qun
2015-12-01
In contrast to the detailed molecular knowledge available on anthocyanin synthesis, little is known about its catabolism in plants. Litchi (Litchi chinensis) fruit lose their attractive red color soon after harvest. The mechanism leading to quick degradation of anthocyanins in the pericarp is not well understood. An anthocyanin degradation enzyme (ADE) was purified to homogeneity by sequential column chromatography, using partially purified anthocyanins from litchi pericarp as a substrate. The purified ADE, of 116 kD by urea SDS-PAGE, was identified as a laccase (ADE/LAC). The full-length complementary DNA encoding ADE/LAC was obtained, and a polyclonal antibody raised against a deduced peptide of the gene recognized the ADE protein. The anthocyanin degradation function of the gene was confirmed by its transient expression in tobacco (Nicotiana benthamiana) leaves. The highest ADE/LAC transcript abundance was in the pericarp in comparison with other tissues, and was about 1,000-fold higher than the polyphenol oxidase gene in the pericarp. Epicatechin was found to be the favorable substrate for the ADE/LAC. The dependence of anthocyanin degradation by the enzyme on the presence of epicatechin suggests an ADE/LAC epicatechin-coupled oxidation model. This model was supported by a dramatic decrease in epicatechin content in the pericarp parallel to anthocyanin degradation. Immunogold labeling transmission electron microscopy suggested that ADE/LAC is located mainly in the vacuole, with essential phenolic substances. ADE/LAC vacuolar localization, high expression levels in the pericarp, and high epicatechin-dependent anthocyanin degradation support its central role in pigment breakdown during pericarp browning. © 2015 American Society of Plant Biologists. All Rights Reserved.
Aponte, Maria; Ungaro, Francesca; d'Angelo, Ivana; De Caro, Carmen; Russo, Roberto; Blaiotta, Giuseppe; Dal Piaz, Fabrizio; Calignano, Antonio; Miro, Agnese
2018-05-30
This study reports novel food-grade granules for co-delivery of L. plantarum 299v and a standardized extract of Olea europaea leaves (Phenolea®) as oral carrier of probiotics and hydroxytyrosol. Different granule formulations containing either L. plantarum 299v (Lac), or the olive leave extract (Phe) or their combination (Lac-Phe) have been successfully produced through wet granulation employing excipients generally regarded as safe as granulating/binding agents. L. plantarum cells withstood the manufacturing process and were stable upon storage at 4 °C for more than 6 months. In vitro dissolution studies in simulated gastro-intestinal fluids showed the capability of the granules to rapidly dissolve and deliver both olive leave phenols and living L. plantarum cells. In simulated digestion conditions, Lac and Lac-Phe granules protected L. plantarum against the harsh environment of the gastro-intestinal tract. Co-administration of Lac and Phe oral granules to healthy mice provided for higher amounts of hydroxytyrosol in urines as compared to Phe granules alone, suggesting that L. plantarum 299v boosted in vivo conversion of oleuropein to hydroxytyrosol. On the other hand, PCR-assisted profiling of the Lactobacillus population in faeces obtained from mice treated with Lac or Lac plus Phe confirmed that the probiotic arrived alive to colon and was there able to exert a sort of perturbing effect on the climax colonic microflora. Overall, these results pave the way towards the development of a nutraceutical useful for combined delivery of bioactive hydroxytyrosol and probiotics to colon site. Copyright © 2018 Elsevier B.V. All rights reserved.
Ehara, Tatsuya; Izumi, Hirohisa; Tsuda, Muneya; Nakazato, Yuki; Iwamoto, Hiroshi; Namba, Kazuyoshi; Takeda, Yasuhiro
2016-07-01
It is important to provide formula-fed infants with a bifidobacteria-enriched gut microbiota similar to those of breastfed infants to ensure intestinal health. Prebiotics, such as certain oligosaccharides, are a useful solution to this problem, but the combinational benefits of these oligosaccharides have not been evaluated. This study investigated the benefits of oligosaccharide combinations and screened for an optimal combination of oligosaccharides to promote healthy gut microbiota of formula-fed infants. In vitro and in vivo experiments were performed to assess the bifidogenic effects of lactulose (LAC) alone and LAC combined with raffinose (RAF) and/or galacto-oligosaccharide (GOS), using a mixed culture model and neonatal mice orally administered with these oligosaccharides and Bifidobacterium breve. In the in vitro culture model, the combination of the three oligosaccharides (LAC-RAF-GOS) significantly increased cell numbers of B. breve and Bifidobacterium longum (P<0·05) compared with either LAC alone or the combination of two oligosaccharides, and resulted in the production of SCFA under anaerobic conditions. In the in vivo experiment, the LAC-RAF-GOS combination significantly increased cell numbers of B. breve and Bacteroidetes in the large intestinal content (P<0·05) and increased acetate concentrations in the caecal content and serum of neonatal mice. Genes related to metabolism and immune responses were differentially expressed in the liver and large intestine of mice administered with LAC-RAF-GOS. These results indicate a synergistic effect of the LAC-RAF-GOS combination on the growth of bifidobacteria and reveal possible benefits of this combination to the gut microbiota and health of infants.
Mechanisms of Mutation in Non-Dividing Cells
2003-05-01
which cells with a lac +1 frameshift allele on an F’ plasmid generate Lac+ mutants upon starvation on lactose medium (3). The stationary-phase mutations...starved on lactose . The accumulation of ampD mutants requires RecA, and is promoted at a greater frequency in RecG-deficient cells, similar to Lac...stationary-phase cells after they are starved in the presence of lactose . In studies performed to date by our lab and others, mutation in stationary-phase
Genetic and Molecular Studies of the Phlebotomus Fever Group of Viruses.
1980-08-01
unrelated rhabdovirus , VSV. Two sources of LAC viral antigens were used, those from virus grown in BHK-21 cells and those obtained from LAC virus grown in...KAR, SFS and CHG, as well as those of the bunyaviruses LAC, ORI and BUN, and the viral antigens of the unrelated rhabdovirus , VSV. Again two sources...and Shope, R.E., 1977b, Oligonucleotide fingerprints of RNA obtained from rhabdoviruses belonging to the vesicular stornatitis virus subgroup. J
hsa_circ_0013958: a circular RNA and potential novel biomarker for lung adenocarcinoma.
Zhu, Xiaoli; Wang, Xiyong; Wei, Shuzhen; Chen, Yan; Chen, Yang; Fan, Xiaobo; Han, Shuhua; Wu, Guoqiu
2017-07-01
Circular RNAs (circRNAs) are associated with cancer progression and metastasis, although little is known about their role in lung adenocarcinoma (LAC). In the present study, microarrays were first used to screen for tumour-specific circRNA candidates in LAC tissue. Thirty-nine circRNAs were found to be up-regulated and 20 were down-regulated (fold change > 2.0). Among them, hsa_circ_0013958 was further confirmed to be up-regulated in all of the LAC tissues, cells and plasma. In addition, hsa_circ_0013958 levels were associated with TNM stage (P = 0.009) and lymphatic metastasis (P = 0.006). The area under the receiver operating characteristic curve was 0.815 (95% confidence interval = 0.727-0.903; P < 0.001). In addition, to further illustrate the bioactivities of hsa_circ_0013958 in LAC, siRNA-mediated inhibition of hsa_circ_0013958 was performed in vitro. The results showed that hsa_circ_0013958 promoted cell proliferation and invasion and inhibited cell apoptosis in LAC. Moreover, hsa_circ_0013958 was identified as a sponge of miR-134, and thus it up-regulated oncogenic cyclin D1, which plays a pivotal role in the development of non-small cell lung cancer. In conclusion, our results suggested that hsa_circ_0013958 could be used as a potential non-invasive biomarker for the early detection and screening of LAC. © 2017 Federation of European Biochemical Societies.
Gender differences in Latin-American patients with rheumatoid arthritis.
Barragán-Martínez, Carolina; Amaya-Amaya, Jenny; Pineda-Tamayo, Ricardo; Mantilla, Rubén D; Castellanos-de la Hoz, Juan; Bernal-Macías, Santiago; Rojas-Villarraga, Adriana; Anaya, Juan-Manuel
2012-12-01
Data on the effect of gender in rheumatoid arthritis (RA) in non-Caucasian populations is scarce. Latin America and the Caribbean (LAC) is a large population with unique characteristics, including high admixture. Our aim was to examine the effect of gender in patients with RA in LAC. This was a 2-phase study. First we conducted a cross-sectional and analytical study in which 1128 consecutive Colombian patients with RA were assessed. Second, a systematic review of the literature was done to evaluate the effect of gender in LAC patients with RA. Our results show a high prevalence of RA in LAC women with a ratio of 5.2 women per man. Colombian women with RA are more at risk of having an early age at onset and developing polyautoimmunity and abdominal obesity, and they perform more household duties than their male counterparts. However, male gender was associated with the presence of extra-articular manifestations. Of a total of 641 potentially relevant articles, 38 were considered for final analysis, in which several factors and outcomes related to gender were identified. RA in LAC women is not only more common but presents with some clinical characteristics that differ from RA presentation in men. Some of those characteristics could explain the high rates of disability and worse prognosis observed in women with RA in LAC. Copyright © 2012 Elsevier HS Journals, Inc. All rights reserved.
Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer
Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk
2014-01-01
Purpose Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). Methods This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. Results A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. Conclusion LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes. PMID:24761404
Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Baik, Seung Hyuk; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk
2014-01-01
Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes.
Ulyanova, Yevgenia; Babanova, Sofia; Pinchon, Erica; Matanovic, Ivana; Singhal, Sameer; Atanassov, Plamen
2014-07-14
The effect of proper enzyme orientation at the electrode surface was explored for two multi-copper oxygen reducing enzymes: Bilirubin Oxidase (BOx) and Laccase (Lac). Simultaneous utilization of "tethering" agent (1-pyrenebutanoic acid, succinimidyl ester; PBSE), for stable enzyme immobilization, and syringaldazine (Syr), for enzyme orientation, of both Lac and BOx led to a notable enhancement of the electrode performance. For Lac cathodes tested in solution it was established that PBSE-Lac and PBSE-Syr-Lac modified cathodes demonstrated approximately 6 and 9 times increase in current density, respectively, compared to physically adsorbed and randomly oriented Lac cathodes. Further testing in solution utilizing BOx showed an even higher increase in achievable current densities, thus BOx was chosen for additional testing in air-breathing mode. In subsequent air-breathing experiments the incorporation of PBSE and Syr with BOx resulted in current densities of 0.65 ± 0.1 mA cm(-2); 2.5 times higher when compared to an unmodified BOx cathode. A fully tethered/oriented BOx cathode was combined with a NAD-dependent Glucose Dehydrogenase anode for the fabrication of a complete enzymatic membraneless fuel cell. A maximum power of 1.03 ± 0.06 mW cm(-2) was recorded for the complete fuel cell. The observed significant enhancement in the performance of "oriented" cathodes was a result of proper enzyme orientation, leading to facilitated enzyme/electrode interface interactions.
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Evaluating the potential of immobilized bacterial consortium for black liquor biodegradation.
Paliwal, Rashmi; Uniyal, Shivani; Rai, J P N
2015-05-01
Two indigenous bacterial strains, Bacillus megaterium ETLB-1 (accession no. KC767548) and Pseudomonas plecoglossicida ETLB-3 (accession no. KC767547), isolated from soil contaminated with paper mill effluent, were co-immobilized on corncob cubes to investigate their biodegradation potential against black liquor (BL). Results exhibit conspicuous reduction in color and lignin of BL upto 913.46 Co-Pt and 531.45 mg l(-1), respectively. Reduction in chlorophenols up to 12 mg l(-1) was recorded with highest release of chloride ions, i.e., 1290 mg l(-1). Maximum enzyme activity for lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (LAC) was recorded as 5.06, 8.13, and 8.23 U ml(-1), respectively, during the treatment. Scanning electron microscopy (SEM) revealed successful immobilization of bacterial strains in porous structures of biomaterial. Gas chromatography/mass spectroscopy (GC/MS) showed formation of certain low molecular weight metabolites such as 4-hydroxy-benzoic acid, 3-hydroxy-4-methoxybenzaldehyde, ferulic acid, and t-cinnamic acid and removal of majority of the compounds (such as teratogenic phthalate derivatives) during the period of treatment. Results demonstrated that the indigenous bacterial consortium possesses excellent decolorization and lignin degradation capability which enables its commercial utilization in effluents treatment system.
NASA Astrophysics Data System (ADS)
Messina, Sergio
2007-10-01
The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.
Osadchuk, L V; Salomacheva, I N; Osadchuk, A V
2010-01-01
The study was designed to investigate genetic differences in reproductive consequences of social hierarchy using inbred mice strains BALB/cLac, PT and CBA/Lac. Two adult males of different genotypes were housed together for 5 days. Hierarchical status of both partners was determined by asymmetry in agonistic behavior. The number of epididymal sperm and a proportion of abnormal sperm, weights of reproductive organs, serum concentration and testicular content of testosterone, and the testosterone response to introduction of a receptive female were determined. The testosterone measures were significantly decreased in the PT strain, the epididymal sperm number was significantly decreased in the BALB/cLac strain and a proportion of abnormal sperm heads was significantly increase in the CBA/Lac (in both dominants and subordinates) as compared to control mice. The testicular testosterone response to a receptive female and precopulatory behavior was unchanged in dominants and suppressed in subordinates of the BALB/cLac strain. The results indicate that in laboratory mice the pattern of reproductive response to social hierarchy is determined by genetic background.
The effects of pre-slaughter pig management from the farm to the processing plant on pork quality.
Edwards, L N; Grandin, T; Engle, T E; Ritter, M J; Sosnicki, A A; Carlson, B A; Anderson, D B
2010-12-01
Two experiments (Exp.1, n=80; Exp.2, n=144) were conducted to determine the effects of pre-slaughter pig management on pork quality by monitoring blood lactate concentration ([LAC]) during marketing. [LAC] was measured at: (1) baseline at farm, (2) post-loading on truck, (3) pre-unloading after transport, (4) post-unloading at plant, (5) post-lairage, (6) post-movement to stun, and (7) exsanguination. Pearson correlations were used to determine relationships between [LAC] and meat quality. Higher [LAC] post-loading or a greater change in [LAC] during loading resulted in increased 24h pH (P=0.002, P=0.0006, Exp.1; P=0.0001, P=0.01, Exp.2, respectively), decreased L* (P=0.03, P=0.04; P=0.001, P=0.01) and decreased drip loss (P=0.02, P=0.12; P=0.002, P=0.01). Even though improved handling during loading is important to animal well-being, it will not necessarily translate into improved pork quality. Copyright © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
Low-luminosity Blazars in Wise: A Mid-infrared View of Unification
NASA Astrophysics Data System (ADS)
Plotkin, Richard M.; Anderson, S. F.; Brandt, W. N.; Markoff, S.; Shemmer, O.; Wu, J.
2012-01-01
We use the preliminary data release from the Wide-Field Infrared Survey Explorer (WISE) to perform the first statistical study on the mid-infrared (IR) properties of a large number ( 102) of BL Lac objects -- low-luminosity Active Galactic Nuclei (AGN) with a jet beamed toward the Earth. As expected, many BL Lac objects are so highly beamed that their jet synchrotron emission dominates their IR spectral energy distributions (SEDs), and the shape of their SEDs in the IR correlates well with SED peak frequency. In other BL Lac objects, the jet is not strong enough to completely dilute the rest of the AGN, and we do not see observational signatures of the dusty torus from these weakly beamed BL Lac objects. While at odds with simple unification, the missing torus is consistent with recent suggestions that BL Lac objects are fed by radiatively inefficient accretion flows. We discuss implications on the ``nature vs. nurture" debate for FR I and FR II galaxies, and also on the standard orientation-based AGN unification model.
Expanding the genetic toolbox for Leptospira species by generation of fluorescent bacteria.
Aviat, Florence; Slamti, Leyla; Cerqueira, Gustavo M; Lourdault, Kristel; Picardeau, Mathieu
2010-12-01
Our knowledge of the genetics and molecular basis of the pathogenesis associated with Leptospira, in comparison to those of other bacterial species, is very limited. An improved understanding of pathogenic mechanisms requires reliable genetic tools for functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes under the control of constitutive spirochetal promoters in both saprophytic and pathogenic Leptospira strains. We were able to reliably measure the fluorescence of Leptospira by fluorescence microscopy and a fluorometric microplate reader-based assay. We showed that the expression of the gfp gene had no significant effects on growth in vivo and pathogenicity in L. interrogans. We constructed an expression vector for L. biflexa that contains the lacI repressor, an inducible lac promoter, and gfp as the reporter, demonstrating that the lac system is functional in Leptospira. Green fluorescent protein (GFP) expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) in L. biflexa transformants harboring the expression vector. Finally, we showed that GFP can be used as a reporter to assess promoter activity in different environmental conditions. These results may facilitate further advances for studying the genetics of Leptospira spp.
Essaka, David C; Prendergast, Jillian; Keithley, Richard B; Palcic, Monica M; Hindsgaul, Ole; Schnaar, Ronald L; Dovichi, Norman J
2012-03-20
Metabolic cytometry is a form of chemical cytometry wherein metabolic cascades are monitored in single cells. We report the first example of metabolic cytometry where two different metabolic pathways are simultaneously monitored. Glycolipid catabolism in primary rat cerebella neurons was probed by incubation with tetramethylrhodamine-labeled GM1 (GM1-TMR). Simultaneously, both catabolism and anabolism were probed by coincubation with BODIPY-FL labeled LacCer (LacCer-BODIPY-FL). In a metabolic cytometry experiment, single cells were incubated with substrate, washed, aspirated into a capillary, and lysed. The components were separated by capillary electrophoresis equipped with a two-spectral channel laser-induced fluorescence detector. One channel monitored fluorescence generated by the metabolic products produced from GM1-TMR and the other monitored the metabolic products produced from LacCer-BODIPY-FL. The metabolic products were identified by comparison with the mobility of a set of standards. The detection system produced at least 6 orders of magnitude dynamic range in each spectral channel with negligible spectral crosstalk. Detection limits were 1 zmol for BODIPY-FL and 500 ymol for tetramethylrhodamine standard solutions.
Resolving the host galaxy of a distant blazar with LBT/LUCI 1 + ARGOS
NASA Astrophysics Data System (ADS)
Farina, E. P.; Georgiev, I. Y.; Decarli, R.; Terzić, T.; Busoni, L.; Gässler, W.; Mazzoni, T.; Borelli, J.; Rosensteiner, M.; Ziegleder, J.; Bonaglia, M.; Rabien, S.; Buschkamp, P.; Orban de Xivry, G.; Rahmer, G.; Kulas, M.; Peter, D.
2018-05-01
BL Lac objects emitting in the very high energy (VHE) regime are unique tools to peer into the properties of the extragalactic background light (EBL). However, due to the typical absence of features in their spectra, the determination of their redshifts has proven challenging. In this work, we exploit the superb spatial resolution delivered by the new Advanced Rayleigh guided Ground layer adaptive Optics System (ARGOS) at the Large Binocular Telescope to detect the host galaxy of HESS J1943+213, a VHE emitting BL Lac shining through the Galaxy. Deep H-band imaging collected during the ARGOS commissioning allowed us to separate the contribution of the nuclear emission and to unveil the properties of the host galaxy with unprecedented detail. The host galaxy is well fitted by a Sérsic profile with index of n ˜ 2 and total magnitude of HHost ˜ 16.15 mag. Under the assumption that BL Lac host galaxies are standard candles, we infer a redshift of z ˜ 0.21. In the framework of the current model for the EBL, this value is in agreement with the observed dimming of the VHE spectrum due to the annihilation of energetic photons on the EBL
78 FR 76709 - Proposed Agency Information Collection Activities; Comment Request
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-18
... of Emergency Order No. 28, which requires railroads operating on the general system of transportation... in Lac-M[eacute]gantic, Quebec, Canada, on July 6, 2013. See 78 FR 48218. Emergency Order No. 28 is... secured in order to protect the general public and communities near the general system of rail...
Infrared observations of RS CVn stars
NASA Technical Reports Server (NTRS)
Berriman, G.; De Campli, W. M.; Werner, M. W.; Hatchett, S. P.
1983-01-01
The paper presents infrared photometry of the RS CVn binary stars AR Lac (1.2-10 microns) and MM Her (1.2-3.5 microns) as they egressed from their primary and secondary eclipses; of the eclipsing systems RS CVn and Z Her at maximum light (1.2-10 microns) and of the non-eclipsing systems UX Ari and HR 1099 (1.2-10 microns). An analysis of these and published V data based on flux ratio diagrams (linear analogues of color-color diagrams) shows that G and K stars supply the infrared light of these systems. In AR Lac, the combined light of a G5-K0 subgiant and either a late F dwarf or an early F subgiant can account for the observed visual and infrared light curves. None of these systems shows infrared emission from circumstellar matter. This result is simply understood: dust grains would not be expected to form in the physical conditions surrounding the subgiant, and the corona and chromosphere (whose properties have been deduced from spectroscopic X-ray observations) should not produce appreciable infrared emission.
Chandrasekaran, E V; Xue, Jun; Xia, Jie; Khaja, Siraj D; Piskorz, Conrad F; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L
2016-10-01
Plant lectins through their multivalent quaternary structures bind intrinsically flexible oligosaccharides. They recognize fine structural differences in carbohydrates and interact with different sequences in mucin core 2 or complex-type N-glycan chain and also in healthy and malignant tissues. They are used in characterizing cellular and extracellular glycoconjugates modified in pathological processes. We study here, the complex carbohydrate-lectin interactions by determining the effects of substituents in mucin core 2 tetrasaccharide Galβ1-4GlcNAcβ1-6(Galβ1-3)GalNAcα-O-R and fetuin glycopeptides on their binding to agarose-immobilized lectins PNA, RCA-I, SNA-I and WGA. Briefly, in mucin core 2 tetrasaccharide (i) structures modified by α2-3/6-Sialyl LacNAc, LewisX and α1-3-Galactosyl LacNAc resulted in regular binding to PNA whereas compounds with 6-sulfo LacNAc displayed no-binding; (ii) strucures bearing α2-6-sialyl 6-sulfo LacNAc, or 6-sialyl LacdiNAc carbohydrates displayed strong binding to SNA-I; (iii) structures with α2-3/6-sialyl, α1-3Gal LacNAc or LewisX were non-binder to RCA-I and compounds with 6-sulfo LacNAc only displayed weak binding; (iv) structures containing LewisX, 6-Sulfo LewisX, α2-3/6-sialyl LacNAc, α2-3/6-sialyl 6-sulfo LacNAc and GalNAc Lewis-a were non-binding to WGA, those with α1-2Fucosyl, α1-3-Galactosyl LacNAc, α2-3-sialyl T-hapten plus 3'/6'sulfo LacNAc displayed weak binding, and compounds with α2-3-sialyl T-hapten, α2.6-Sialyl LacdiNAc, α2-3-sialyl D-Fucβ1-3 GalNAc and Fucα-1-2 D-Fucβ-1-3GalNAc displaying regular binding and GalNAc LewisX and LacdiNAc plus D-Fuc β-1-3 GalNAcα resulting in tight binding. RCA-I binds Fetuin triantennary asialoglycopeptide 100 % after α-2-3 and 25 % after α-2-6 sialylation, 30 % after α-1-2 and 100 % after α-1-3 fucosylation, and 50 % after α-1-3 galactosylation. WGA binds 3-but not 6-Fucosyl chitobiose core. Thus, information on the influence of complex carbohydrate chain constituents on lectin binding is apparently essential for the potential application of lectins in glycoconjugate research.
Flood Control Project Lac Qui Parle, Emergency Plan
1988-10-01
elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet
Investigation of physical parameters in stellar flares observed by GINGA
NASA Technical Reports Server (NTRS)
Stern, Robert A.
1994-01-01
This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar x-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program. Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.
Investigation of physical parameters in stellar flares observed by GINGA
NASA Technical Reports Server (NTRS)
Stern, Robert A.
1994-01-01
This program involves analysis and interpretation of results from GINGA Large Area Counter (LAC) observations from a group of large stellar X-ray flares. All LAC data are re-extracted using the standard Hayashida method of LAC background subtraction and analyzed using various models available with the XSPEC spectral fitting program.Temperature-emission measure histories are available for a total of 5 flares observed by GINGA. These will be used to compare physical parameters of these flares with solar and stellar flare models.
Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample
NASA Astrophysics Data System (ADS)
Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.
1994-12-01
The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15
López-Oliva, María Elvira; Garcimartin, Alba; Muñoz-Martínez, Emilia
2017-12-01
The effect and the role played by dietary α-lactalbumin (α-LAC) on hepatic fat metabolism are yet to be fully elucidated. We reported previously that α-LAC intake induced atherogenic dyslipidaemia in Balb/c mice. The aim of the present study was to investigate if this atherogenic effect could be due to a possible α-LAC-induced hepatic steatosis. We examine the ability of dietary α-LAC to induce liver steatosis, identifying the molecular mechanisms underlying hepatic lipid metabolism in association with the lipid profile, peripheral insulin resistance (IR) and changes in the hepatic oxidative environment. Male Balb/c mice (n 6) were fed with diets containing either chow or 14 % α-LAC for 4 weeks. The α-LAC-fed mice developed abdominal adiposity and IR. Moderate liver steatosis with increased TAG and NEFA contents was correlated with atherogenic dyslipidaemia. There was increased nuclear expression of liver X receptor αβ (LXRαβ), sterol regulatory element-binding protein-1c (SREBP-1c) and PPARγ transcription factors and of the cytosolic enzymes acetyl-CoA carboxylase 1 (ACC1) and fatty acid synthase involved in the hepatic de novo lipogenesis. The opposite was found for the nuclear receptor PPARα and the mitochondrial enzyme carnitine palmitoyltransferase-1 (CPT-1), leading to reduced fatty acid β-oxidation (FAO). These changes were associated with a significant decrease in both p-Thr172-AMP-activated protein kinase α (AMPKα) (inactivation) and p-Ser79-ACC1 (activation) and with a more oxidative liver environment increasing lipid peroxidation and protein oxidation and reducing GSH:GSSG ratio in the α-LAC-fed mice. In conclusion, 4 weeks of 14 % α-LAC feeding induced liver steatosis associated with atherogenic dyslipidaemia, IR and oxidative stress by enhancing nuclear LXRαβ/SREBP-1c/PPARγ expression and diminishing PPARα/CPT-1 expression and AMPKα phosphorylation shifting the hepatic FAO toward fatty acid synthesis in Balb/c mice.
Long-Term Correction of Sandhoff Disease Following Intravenous Delivery of rAAV9 to Mouse Neonates
Walia, Jagdeep S; Altaleb, Naderah; Bello, Alexander; Kruck, Christa; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Chowdhury, Biswajit; Hurlbut, David; Hemming, Richard; Kobinger, Gary P; Triggs-Raine, Barbara
2015-01-01
GM2 gangliosidoses are severe neurodegenerative disorders resulting from a deficiency in β-hexosaminidase A activity and lacking effective therapies. Using a Sandhoff disease (SD) mouse model (Hexb−/−) of the GM2 gangliosidoses, we tested the potential of systemically delivered adeno-associated virus 9 (AAV9) expressing Hexb cDNA to correct the neurological phenotype. Neonatal or adult SD and normal mice were intravenously injected with AAV9-HexB or –LacZ and monitored for serum β-hexosaminidase activity, motor function, and survival. Brain GM2 ganglioside, β-hexosaminidase activity, and inflammation were assessed at experimental week 43, or an earlier humane end point. SD mice injected with AAV9-LacZ died by 17 weeks of age, whereas all neonatal AAV9-HexB–treated SD mice survived until 43 weeks (P < 0.0001) with only three exhibiting neurological dysfunction. SD mice treated as adults with AAV9-HexB died between 17 and 35 weeks. Neonatal SD-HexB–treated mice had a significant increase in brain β-hexosaminidase activity, and a reduction in GM2 ganglioside storage and neuroinflammation compared to adult SD-HexB– and SD-LacZ–treated groups. However, at 43 weeks, 8 of 10 neonatal-HexB injected control and SD mice exhibited liver or lung tumors. This study demonstrates the potential for long-term correction of SD and other GM2 gangliosidoses through early rAAV9 based systemic gene therapy. PMID:25515709
EPA Efforts in Latin America and the Caribbean
The Latin America and Caribbean (LAC) program provides environmental tools and information to build the capacity of LAC governments and civil society organizations to reduce environmental degradation and its impacts on public health.
University of Wisconsin - Extension
... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County Jackson County ... Fond du Lac County Forest County Grant County Green County Green Lake County Iowa County Iron County ...
Over-expression of phage HK022 Nun protein is toxic for Escherichia coli
Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.
2008-01-01
The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198
VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)
NASA Astrophysics Data System (ADS)
Marcha, M. J. M.; Caccianiga, A.
2014-04-01
This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).
Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M
2013-05-01
The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.
Beckman, Sarah A; Chen, William C W; Tang, Ying; Proto, Jonathan D; Mlakar, Logan; Wang, Bing; Huard, Johnny
2013-08-01
We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZ-MDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF.
Beckman, Sarah A.; Chen, William C.W.; Tang, Ying; Proto, Jonathan D.; Mlakar, Logan; Wang, Bing; Huard, Johnny
2016-01-01
Objective We previously reported that mechanical stimulation increased the effectiveness of muscle-derived stem cells (MDSCs) for tissue repair. The objective of this study was to determine the importance of vascular endothelial growth factor (VEGF) on mechanically stimulated MDSCs in a murine model of muscle regeneration. Approach and Results MDSCs were transduced with retroviral vectors encoding the LacZ reporter gene (lacZ-MDSCs), the soluble VEGF receptor Flt1 (sFlt1-MDSCs), or a short hairpin RNA (shRNA) targeting messenger RNA of VEGF (shRNA_VEGF MDSCs). Cells were subjected to 24 hours of mechanical cyclic strain and immediately transplanted into the gastrocnemius muscles of mdx/scid mice. Two weeks after transplantation, angiogenesis, fibrosis, and regeneration were analyzed. There was an increase in angiogenesis in the muscles transplanted with mechanically stimulated lacZMDSCs compared with nonstimulated lacZ-MDSCs, sFlt1-MDSCs, and shRNA _VEGF MDSCs. Dystrophin-positive myofiber regeneration was significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. In vitro proliferation of MDSCs was not decreased by inhibition of VEGF; however, differentiation into myotubes and adhesion to collagen were significantly lower in the shRNA_VEGF-MDSC group compared with the lacZ-MDSC and sFlt1-MDSC groups. Conclusions The beneficial effects of mechanical stimulation on MDSC-mediated muscle repair are lost by inhibiting VEGF. PMID:23723372
NASA Technical Reports Server (NTRS)
Stocke, John; Perlman, Eric; Granados, Arno; Schachter, Jonathan; Elvis, Martin; Urry, Meg; Impey, Chris; Smith, Paul
1993-01-01
We present a new, efficient method for discovering new BL Lac Objects based upon the results of the Einstein Extended Medium Sensitivity Survey (EMSS). We have found that all x-ray selected BL Lacs are radio emitters, and further, that in a 'color-color' diagram (radio/optical and optical/x-ray) the BL Lac Objects occupy an area distinct from both radio loud quasars and the radio quiet QSOs and Seyferts which dominate x-ray selected samples. After obtaining radio counterparts via VLA 'snapshot' observations of a large sample of unidentified x-ray sources, the list of candidates is reduced. These candidates then can be confirmed with optical spectroscopy and/or polarimetry. Since greater than 70 percent of these sources are expected to be BL Lacs, the optical observations are very efficient. We have tested this method using unidentified sources found in the Einstein Slew Survey. The 162 Slew Survey x-ray source positions were observed with the VLA in a mixed B/C configuration at 6 cm resulting in 60 detections within 1.5 position error circle radii. These x-ray/optical/radio sources were then plotted, and 40 BL Lac candidates were identified. To date, 10 candidates have been spectroscopically observed resulting in 10 new BL Lac objects! Radio flux, optical magnitude, and polarization statistics (obtained in white light with the Steward Observatory 2.3 m CCD polarimeter) for each are given.
Obesity and the food system transformation in Latin America.
Popkin, B M; Reardon, T
2018-04-24
The Latin America and the Caribbean (LAC) region faces a major diet-related health problem accompanied by enormous economic and social costs. The shifts in diet are profound: major shifts in intake of less-healthful low-nutrient-density foods and sugary beverages, changes in away-from-home eating and snacking and rapid shifts towards very high levels of overweight and obesity among all ages along with, in some countries, high burdens of stunting. Diet changes have occurred in parallel to, and in two-way causality with, changes in the broad food system - the set of supply chains from farms, through midstream segments of processing, wholesale and logistics, to downstream segments of retail and food service (restaurants and fast food chains). An essential contribution of this piece is to marry and integrate the nutrition transition literature with the literature on the economics of food system transformation. These two literatures and debates have been to date largely 'two ships passing in the night'. This review documents in-depth the recent history of rapid growth and transformation of that broad food system in LAC, with the rapid rise of supermarkets, large processors, fast food chains and food logistics firms. The transformation is the story of a 'double-edged sword', showing its links to various negative diet side trends, e.g. the rise of consumption of fast food and highly processed food, as well as in parallel, to various positive trends, e.g. the reduction of the cost of food, de-seasonalization, increase of convenience of food preparation reducing women's time associated with that and increase of availability of some nutritious foods like meat and dairy. We view the transformation of the food system, as well as certain aspects of diet change linked to long-run changes in employment and demographics (e.g. the quest for convenience), as broad parameters that will endure for the next decades without truly major regulatory and fiscal changes. We then focus in on what are the steps that are being and can be taken to curb the negative effects on diet of these changes. We show that countries in LAC are already among the global leaders in initiating demand-related solutions via taxation and marketing controls. But we also show that this is only a small step forward. To shift LAC's food supply towards prices that incentivize consumption of healthier diets and demand away from the less healthy component is not simple and will not happen immediately. We must be cognizant that ultimately, food industry firms must be incentivized to market the components of healthy diets. This will primarily need to be via selective taxes and subsidies, marketing controls, as well as food quality regulations, consumer education and, in the medium term, consumers' desires to combine healthier foods with their ongoing quest for convenience in the face of busy lives. In the end, the food industry in LAC will orient itself towards profitable solutions, ie those demanded by the broad mass of consumers. © 2018 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of World Obesity Federation.
Roepe, P D; Zbar, R I; Sarkar, H K; Kaback, H R
1989-01-01
The lac permease (lacY gene product) of Escherichia coli contains 417 amino acid residues and is predicted to have a short hydrophilic amino terminus on the inner surface of the cytoplasmic membrane, multiple transmembrane hydrophobic segments in alpha-helical conformation, and a 17-amino acid residue hydrophilic carboxyl-terminal tail on the inner surface of the membrane. To assess the importance of the carboxyl terminus, the properties of several truncation mutants were studied. The mutants were constructed by site-directed mutagenesis such that stop codons were placed at specified positions, and the altered lacY genes were expressed at a relatively low rate from plasmid pACYC184. Permease truncated at position 407 or 401 retains full activity, and a normal complement of molecules is present in the membrane, as judged by immunoblot analyses. Thus, it is apparent that the carboxyl-terminal tail plays no direct role in membrane insertion of the permease, its stability, or in the mechanism of lactose/H+ symport. In marked contrast, when truncations are made at residues 396 (i.e., 4 amino acid residues from the carboxyl terminus of putative helix XII), 389, 372, or 346, the permease is no longer found in the membrane. Remarkably, however, when each of the mutated lacY genes is expressed at a high rate by means of the T7 RNA polymerase system [Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1079], all of the truncated permeases are present in the membrane, as indicated by [35S]methionine incorporation studies; however, permease truncated at residue 396, 389, 372, or 346 is defective with respect to lactose/H+ symport. Finally, pulse-chase experiments indicate that wild-type permease or permease truncated at residue 401 is stable, whereas permease truncated at or prior to residue 396 is degraded at a significant rate. The results are consistent with the notion that residues 396-401 in putative helix XII are important for protection against proteolytic degradation and suggest that this region of the permease may be necessary for proper folding. Images PMID:2657733
Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun
2015-01-01
Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1) LacA, 109.9 mg L(-1) MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1), respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.
Bacterial recognition of thermal glycation products derived from porcine serum albumin with lactose.
Sarabia-Sainz, Andre-I; Ramos-Clamont, Gabriela; Winzerling, Joy; Vázquez-Moreno, Luz
2011-01-01
Recently, glyco-therapy is proposed to prevent the interaction of bacterial lectins with host ligands (glycoconjugates). This interaction represents the first step in infection. Neoglycans referred to as PSA-Lac (PSA-Glu (β1-4) Gal) were obtained by conjugation of porcine serum albumin (PSA) with lactose at 80 °C, 100 °C and 120 ºC. Characterization studies of the products showed that PSA could contain 1, 38 or 41 added lactoses, depending on the reaction temperature. These neoglycans were approximately 10 times more glycated than PSA-Lac obtained in previous work. Lactose conjugation occurred only at lysines and PSA-Lac contained terminal galactoses as confirmed by Ricinus communis lectin recognition. Furthermore, Escherichia coli K88+, K88ab, K88ac and K88ad adhesins showed affinity toward all PSA-Lac neoglycans, and the most effective was the PSA-Lac obtained after 100 ºC treatment. In vitro, this neoglycan partially inhibited the adhesion of E. coli K88+ to piglet mucin (its natural ligand). These results provide support for the hypothesis that glycated proteins can be used as an alternative for bioactive compounds for disease prevention.
Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun
2015-01-01
Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270
Miallau, Linda; Hunter, William N; McSweeney, Sean M; Leonard, Gordon A
2007-07-06
High resolution structures of Staphylococcus aureus d-tagatose-6-phosphate kinase (LacC) in two crystal forms are herein reported. The structures define LacC in apoform, in binary complexes with ADP or the co-factor analogue AMP-PNP, and in a ternary complex with AMP-PNP and D-tagatose-6-phosphate. The tertiary structure of the LacC monomer, which is closely related to other members of the pfkB subfamily of carbohydrate kinases, is composed of a large alpha/beta core domain and a smaller, largely beta "lid." Four extended polypeptide segments connect these two domains. Dimerization of LacC occurs via interactions between lid domains, which come together to form a beta-clasp structure. Residues from both subunits contribute to substrate binding. LacC adopts a closed structure required for phosphoryl transfer only when both substrate and co-factor are bound. A reaction mechanism similar to that used by other phosphoryl transferases is proposed, although unusually, when both substrate and co-factor are bound to the enzyme two Mg(2+) ions are observed in the active site. A new motif of amino acid sequence conservation common to the pfkB subfamily of carbohydrate kinases is identified.
X-Ray Variability of BL Lac Objects
NASA Astrophysics Data System (ADS)
McHardy, Ian
I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.
Lactosaminated- N-succinyl chitosan nanoparticles for hepatocyte-targeted delivery of acyclovir
NASA Astrophysics Data System (ADS)
Jain, Nivrati; Rajoriya, Vaibhav; Jain, Prateek Kumar; Jain, Ashish Kumar
2014-01-01
The present study discusses lactose-acyclovir- N-succinyl chitosan nanoparticles (Lac- N-Suc-CSNP) using lactose as an asialoglycoprotein receptor (ASGPR) ligand for hepatic parenchymatic cells targeting. For this purpose, N-succinyl chitosan nanoparticles ( N-Suc-CSNP) were prepared previously by ionotropic gelation method and lactose was conjugated to the free amino terminal group of chitosan. Lactose conjugation with N-Suc-CSNP was confirmed by FT-IR and zeta potential measurements. The Lac- N-Suc-CSNP obtained were characterized for their morphology, particle size, polydispersity index, and zeta potential. The Lac- N-Suc-CSNP showed spherical in shape with 220.3 ± 5.0 nm size range, +4.1 ± 0.2 mV zeta potential, 62.5 ± 1.2 % acyclovir entrapment efficiency and showed 27.3 ± 0.9 % cumulative acyclovir release up to 72 h. The acyclovir concentration from Lac- N-Suc-CSNP was found to be 19.9 ± 1.62 μg/g after 24 h administration revealed remarkably targeting potential to the hepatocytes and keep at a high level during the experiment. These results suggest that Lac- N-Suc-CSNP are potentially vector for hepatocytes targeting.
Jang, Mi-Gyeong; Lee, Ji Yeon; Yang, Jae-Yeon; Park, Hyojung; Kim, Jung Hee; Kim, Jung-Eun; Shin, Chan Soo; Kim, Seong Yeon; Kim, Sang Wan
2016-09-01
Mature osteoblasts have three fates: as osteocytes, quiescent lining cells, or osteoblasts that undergo apoptosis. However, whether intermittent parathyroid hormone (PTH) can modulate the fate of mature osteoblasts in vivo is uncertain. We performed a lineage-tracing study using an inducible gene system. Dmp1-CreERt2 mice were crossed with Rosa26R reporter mice to obtain targeted mature osteoblasts and their descendants, lining cells or osteocytes, which were detected using X-gal staining. Rosa26R:Dmp1-CreERt2(+) mice were injected with 0.25 mg 4-OH-tamoxifen (4-OHTam) on postnatal days 5, 7, 9, 16, and 23. In a previous study, at 22 days after the last 4-OHTam, most LacZ+ cells on the periosteal surface were inactive lining cells. On day 25 (D25), the mice were challenged with an injection of human PTH (1-34, 80 μg/kg) or vehicle daily for 10 (D36) or 20 days (D46). We evaluated the number and thickness of LacZ+ osteoblast descendants in the calvaria and tibia. In the vehicle group, the number and thickness of LacZ+ osteoblast descendants at both D36 and D46 significantly decreased compared to D25, which was attenuated in the PTH group. In line with these results, PTH inhibited the decrease in the number of LacZ+/osteocalcin-positive cells compared to vehicle at both D36 and D46. As well, the serum levels of sclerostin decreased, as did the protein expression of sclerostin in the cortical bone. These results suggest that intermittent PTH treatment can increase the number of periosteal osteoblasts by preventing mature osteoblasts from transforming into lining cells in vivo.
Clustering environments of BL Lac objects
NASA Technical Reports Server (NTRS)
Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.
1993-01-01
We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.
Laccases as palladium oxidases.
Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry
2015-02-01
The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.
Mitchell, Jennie E; Oshima, Taku; Piper, Sarah E; Webster, Christine L; Westblade, Lars F; Karimova, Gouzel; Ladant, Daniel; Kolb, Annie; Hobman, Jon L; Busby, Stephen J W; Lee, David J
2007-05-01
The Escherichia coli Rsd protein forms complexes with the RNA polymerase sigma(70) factor, but its biological role is not understood. Transcriptome analysis shows that overexpression of Rsd causes increased expression from some promoters whose expression depends on the alternative sigma(38) factor, and this was confirmed by experiments with lac fusions at selected promoters. The LP18 substitution in Rsd increases the Rsd-dependent stimulation of these promoter-lac fusions. Analysis with a bacterial two-hybrid system shows that the LP18 substitution in Rsd increases its interaction with sigma(70). Our experiments support a model in which the role of Rsd is primarily to sequester sigma(70), thereby increasing the levels of RNA polymerase containing the alternative sigma(38) factor.
Zheng, Weijiang; Ji, Xu; Zhang, Qing; Yao, Wen
2018-06-16
The objective of the current experiment was to explore the intestinal microbiota ecological response to oral administrations of hydrogen-rich water (HRW) and lactulose (LAC) in female piglets fed a Fusarium mycotoxin-contaminated diet. A total of 24 individually-housed female piglets (Landrace × large × white; initial average body weight, 7.25 ± 1.02 kg) were randomly assigned to receive four treatments (six pigs/treatment): uncontaminated basal diet (negative control, NC), mycotoxin-contaminated diet (MC), MC diet + HRW (MC + HRW), and MC diet + LAC (MC + LAC) for 25 days. Hydrogen levels in the mucosa of different intestine segments were measured at the end of the experiment. Fecal scoring and diarrhea rate were recorded every day during the whole period of the experiment. Short-chain fatty acids (SCFAs) profiles in the digesta of the foregut and hindgut samples were assayed. The populations of selected bacteria and denaturing gradient gel electrophoresis (DGGE) profiles of total bacteria and methanogenic Archaea were also evaluated. Results showed that Fusarium mycotoxins not only reduced the hydrogen levels in the caecum but also shifted the SCFAs production, and populations and communities of microbiota. HRW treatment increased the hydrogen levels of the stomach and duodenum. HRW and LAC groups also had higher colon and caecum hydrogen levels than the MC group. Both HRW and LAC protected against the mycotoxin-contaminated diet-induced higher diarrhea rate and lower SCFA production in the digesta of the colon and caecum. In addition, the DGGE profile results indicated that HRW and LAC might shift the pathways of hydrogen-utilization bacteria, and change the diversity of intestine microbiota. Moreover, HRW and LAC administrations reversed the mycotoxin-contaminated diet-induced changing of the populations of Escherichia coli (E. coli) and Bifidobacterium in ileum digesta and hydrogen-utilizing bacteria in colon digesta.
Zhang, Guo-rong; Geller, Alfred I
2010-05-17
Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.
The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.
Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H
1988-01-01
We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Technical Reports Server (NTRS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-01-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
Time-dependent inhomogeneous jet models for BL Lac objects
NASA Astrophysics Data System (ADS)
Marlowe, A. T.; Urry, C. M.; George, I. M.
1992-05-01
Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.
On the surface density of X-ray selected BL Lacertae objects
NASA Technical Reports Server (NTRS)
Maccacaro, T.; Gioia, I. M.; Maccagni, D.; Stocke, J. T.
1984-01-01
Only a handful of BL Lac objects have been found as a result of systematic optical identification of serendipitous Einstein X-ray sources. By combining the data from two flux-limited complete X-ray surveys (the HEAO 1 A-2 and the Einstein Observatory Medium Sensitivity Survey) the surface density of X-ray emitting BL Lac objects is evaluated as a function of their X-ray flux. It is found that a single power law is not an acceptable representation of the BL Lac objects' X-ray log N-log S. The number-flux relationship is consistent with the Euclidean slope at 'high' flux levels but shows a drastic flattnring below fluxes of the order of 10 to the -12th ergs per sq cm/s. The implications of this result are briefly discussed with respect to the luminosity function, the cosmological evolution, and the X-ray to optical flux ratio in BL Lac objects.
Chen, Juhong; Alcaine, Samuel D; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R
2017-04-28
T7 bacteriophages (phages) have been genetically engineered to carry the lacZ operon, enabling the overexpression of beta-galactosidase (β-gal) during phage infection and allowing for the enhanced colorimetric detection of Escherichia coli (E. coli). Following the phage infection of E. coli, the enzymatic activity of the released β-gal was monitored using a colorimetric substrate. Compared with a control T7 phage, our T7 lacZ phage generated significantly higher levels of β-gal expression following phage infection, enabling a lower limit of detection for E. coli cells. Using this engineered T7 lacZ phage, we were able to detect E. coli cells at 10 CFU·mL -1 within 7 h. Furthermore, we demonstrated the potential for phage-based sensing of bacteria antibiotic resistance profiling using our T7 lacZ phage, and subsequent β-gal expression to detect antibiotic resistant profile of E. coli strains.
Optical and UV spectroscopy of the peculiar RS CVn system RT Lacertae
NASA Technical Reports Server (NTRS)
Huenemoerder, D. P.; Barden, S. C.
1986-01-01
H-alpha and H-beta spectra of the peculiar double-lined RS CVn binary RT Lacertae have been obtained using the IUE, together with a ground-based coude-feed telescope at KPNO. The ground-based spectra show an asymmetry related to the orbital phase in the H-alpha profile. H-beta profiles showed excess emission in one hemisphere and excess absorption in the other, with a broad Gaussian emission component superposed on the excess H-alpha line. A radial velocity curve was derived to estimate the mass ratio and geometry of the system. It is shown that the component of RT Lac fills 80-90 percent of the equilibrium Roche surface. Low-resolution ultraviolet data show that the supposed cooler component is bluer than its companion, suggesting evidence of a scattering shell or a cloud produced by the splash of a gas stream. The phase behavior of the low resolution ultraviolet data support the conclusion that RT Lac is a mass transfer system and that mass transfer is the primary cause of its activity.
A computer-aided detection (CAD) system with a 3D algorithm for small acute intracranial hemorrhage
NASA Astrophysics Data System (ADS)
Wang, Ximing; Fernandez, James; Deshpande, Ruchi; Lee, Joon K.; Chan, Tao; Liu, Brent
2012-02-01
Acute Intracranial hemorrhage (AIH) requires urgent diagnosis in the emergency setting to mitigate eventual sequelae. However, experienced radiologists may not always be available to make a timely diagnosis. This is especially true for small AIH, defined as lesion smaller than 10 mm in size. A computer-aided detection (CAD) system for the detection of small AIH would facilitate timely diagnosis. A previously developed 2D algorithm shows high false positive rates in the evaluation based on LAC/USC cases, due to the limitation of setting up correct coordinate system for the knowledge-based classification system. To achieve a higher sensitivity and specificity, a new 3D algorithm is developed. The algorithm utilizes a top-hat transformation and dynamic threshold map to detect small AIH lesions. Several key structures of brain are detected and are used to set up a 3D anatomical coordinate system. A rule-based classification of the lesion detected is applied based on the anatomical coordinate system. For convenient evaluation in clinical environment, the CAD module is integrated with a stand-alone system. The CAD is evaluated by small AIH cases and matched normal collected in LAC/USC. The result of 3D CAD and the previous 2D CAD has been compared.
DOT National Transportation Integrated Search
2012-07-01
This report presents the Cost Benefit Analysis Test Plan for the national evaluation of the Los Angeles County Congestion Reduction Demonstration (LAC CRD) under the United States Department of Transportation (U.S. DOT) Congestion Reduction Demonstra...
Kamm, Gretel B.; López-Leal, Rodrigo; Lorenzo, Juan R.; Franchini, Lucía F.
2013-01-01
The developmental brain gene NPAS3 stands out as a hot spot in human evolution because it contains the largest number of human-specific, fast-evolving, conserved, non-coding elements. In this paper we studied 2xHAR142, one of these elements that is located in the fifth intron of NPAS3. Using transgenic mice, we show that the mouse and chimp 2xHAR142 orthologues behave as transcriptional enhancers driving expression of the reporter gene lacZ to a similar NPAS3 expression subdomain in the mouse central nervous system. Interestingly, the human 2xHAR142 orthologue drives lacZ expression to an extended expression pattern in the nervous system. Thus, molecular evolution of 2xHAR142 provides the first documented example of human-specific heterotopy in the forebrain promoted by a transcriptional enhancer and suggests that it may have contributed to assemble the unique properties of the human brain. PMID:24218632
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-03-10
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5'-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis.
THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aartsen, M. G.; Abraham, K.; Ackermann, M.
2017-01-20
The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less
Robinson, Patrick A; Orroth, Kate K; Stutts, Lauren A; Baron, Patrick A; Wessner, David R
2018-05-01
The prevalence of public health and global health (PH/GH) curricular offerings appear to be increasing in terms of undergraduate curricula and in the context of liberal arts education in the United States. Liberal arts colleges (LACs) represent stand-alone institutions, which exclusively focus on undergraduate education. The objective of this study was to assess the prevalence of PH/GH study pathways and PH/GH course offerings among LACs. All LACs identified through the US News and World Report (USNWR) college rankings were contacted with a survey about the following: formal majors, minors, or concentrations in PH/GH; independent study (IS) pathways for PH/GH; specific PH/GH courses offered; and the number of students graduating in 2016, 2017, and 2018 with formal and IS degrees in PH/GH. Demographic characteristics of the colleges came from the USNWR database. Almost half (43%) of all LACs in our sample offer a PH/GH major, minor, concentration, or IS pathway. Almost all (90%) colleges offer at least one course in PH/GH. Approximately 2,000 students attending these LACs pursued or are pursuing graduation with majors, minors, or concentrations in PH/GH for the years 2016-2018. The number of students pursuing formal PH/GH programs has increased by 25% from 2016 to 2018. Student interest in public health is rising in U.S. LACs, with more students seeking formal curricular or IS PH degree pathways. Public health messages are prevalent even among institutions without formal programs. Colleges without programs should consider integrating public health into their curriculum.
NASA Technical Reports Server (NTRS)
Rau, A.; Schady, P.; Greiner, J.; Salvato, M.; Ajello, M.; Bottacini, E.; Gehrels, N.; Afonso, P. M. J.; Elliott, J.; Filgas, R.;
2011-01-01
Context. Observations of the gamma-ray sky with Fermi led to significant advances towards understanding blazars, the most extreme class of Active Galactic Nuclei. A large fraction of the population detected by Fermi is formed by BL Lacertae (BL Lac) objects, whose sample has always suffered from a severe redshift incompleteness due to the quasi-featureless optical spectra. Aims. Our goal is to provide a significant increase of the number of confirmed high-redshift BL Lac objects contained in the 2 LAC Fermi/LAT catalog. Methods. For 103 Fermi/LAT blazars, photometric redshifts using spectral energy distribution fitting have been obtained. The photometry includes 13 broad-band filters from the far ultraviolet to the near-IR observed with Swift/UVOT and the multi-channel imager GROND at the MPG/ESO 2.2m telescope. Data have been taken quasi-simultaneously and the remaining source-intrinsic variability has been corrected for. Results. We release the UV-to-near-IR 13-band photometry for all 103 sources and provide redshift constraints for 75 sources without previously known redshift. Out of those, eight have reliable photometric redshifts at z > or approx. 1.3, while for the other 67 sources we provide upper limits. Six of the former eight are BL Lac objects, which quadruples the sample of confirmed high-redshift BL Lac. This includes three sources with redshifts higher than the previous record for BL Lac, including CRATES J0402-2615, with the best-fit solution at z approx. = 1.9.
NASA Technical Reports Server (NTRS)
Jaber, W. A.; Prior, D. L.; Thamilarasan, M.; Grimm, R. A.; Thomas, J. D.; Klein, A. L.; Asher, C. R.
2000-01-01
BACKGROUND: Transesophageal echocardiography (TEE) is the gold standard for evaluation of the left atrium and the left atrial appendage (LAA) for the presence of thrombi. Anticoagulation is conventionally used for patients with atrial fibrillation to prevent embolization of atrial thrombi. The mechanism of benefit and effectiveness of thrombi resolution with anticoagulation is not well defined. METHODS AND RESULTS: We used a TEE database of 9058 consecutive studies performed between January 1996 and November 1998 to identify all patients with thrombi reported in the left atrium and/or LAA. One hundred seventy-four patients with thrombi in the left atrial cavity (LAC) and LAA were identified (1.9% of transesophageal studies performed). The incidence of LAA thrombi was 6.6 times higher than LAC thrombi (151 vs 23, respectively). Almost all LAC thrombi were visualized on transthoracic echocardiography (90.5%). Mitral valve pathology was associated with LAC location of thrombi (P <.0001), whereas atrial fibrillation or flutter was present in most patients with LAA location of thrombi. Anticoagulation of 47 +/- 18 days was associated with thrombus resolution in 80.1% of the patients on follow-up TEE. Further anticoagulation resulted in limited additional benefit. CONCLUSIONS: LAC thrombi are rare and are usually associated with mitral valve pathology. Transthoracic echocardiography is effective in identifying these thrombi. LAA thrombi occur predominantly in patients with atrial fibrillation or flutter. Short-term anticoagulation achieves a high rate of resolution of LAA and LAC thrombi but does not obviate the need for follow-up TEE.
Huang, Jing-Hao; Qi, Yi-Ping; Wen, Shou-Xing; Guo, Peng; Chen, Xiao-Min; Chen, Li-Song
2016-01-01
The mechanisms underlying tolerance to B-toxicity in plants are still controversial. Our previous studies indicated that B-toxicity is mainly limited to leaves in Citrus and that alternations of cell-wall structure in vascular bundles are involved in tolerance to B-toxicity. Here, miRNAs and their expression patterns were first identified in B-treated Citrus sinensis (tolerant) and C. grandis (intolerant) leaves via high-throughput sequencing. Candidate miRNAs were then verified with molecular and anatomical approaches. The results showed that 51 miRNAs in C. grandis and 20 miRNAs in C. sinensis were differentially expressed after B-toxic treatment. MiR395a and miR397a were the most significantly up-regulated miRNAs in B-toxic C. grandis leaves, but both were down-regulated in B-toxic C. sinensis leaves. Four auxin response factor genes and two laccase (LAC) genes were confirmed through 5′-RACE to be real targets of miR160a and miR397a, respectively. Up-regulation of LAC4 resulted in secondary deposition of cell-wall polysaccharides in vessel elements of C. sinensis, whereas down-regulation of both LAC17 and LAC4, led to poorly developed vessel elements in C. grandis. Our findings demonstrated that miR397a plays a pivotal role in woody Citrus tolerance to B-toxicity by targeting LAC17 and LAC4, both of which are responsible for secondary cell-wall synthesis. PMID:26962011
Cardiano, Paola; Cigala, Rosalia Maria; Crea, Francesco; Giacobello, Fausta; Giuffrè, Ottavia; Irto, Anna; Lando, Gabriele; Sammartano, Silvio
2017-11-01
The speciation of Al 3+ in aqueous solutions containing organic and inorganic ligands important from a biological (citrate (Cit 3- ), gluconate (Gluc - ), lactate (Lac - ), silicate (H 2 SiO 4 2- ), carbonate (CO 3 2- ), fluoride (F - )) and industrial (Gantrez ® ; polymethyl-vinyl-ether-co-maleic acids; GTZ S95 and GTZ AN169) point of view is reported. The stability constants of Al 3+ /L z- complexes (L z- = ligand with z - charge) were determined by potentiometry at T = 298.15 K and 0.10 ≤ I/M ≤ 1.00 in NaCl (aq) (in NaNO 3(aq) only for Al 3+ /GTZ S95 and Al 3+ /Gluc - acid systems). For Al 3+ /Cit 3- , Al 3+ /Lac - and Al 3+ /GTZ AN169 4- systems, the investigations were also carried out at 283.15 ≤ T/K ≤ 318.15. The dependence of the thermodynamic parameters on ionic strength and temperature was modelled with a Debye-Hückel type equation. Different speciation schemes of Al 3+ /L z- systems were obtained, including protonated, simple metal-ligand, polynuclear and hydrolytic mixed species. At I → 0 M and T = 298.15 K the stability trend for the AlL (3-z) species is: 14.28 ± 0.02, 13.99 ± 0.03, 10.16 ± 0.03, 3.16 ± 0.08, 2.84 ± 0.10 for GTZ S95, GTZ AN169, Cit 3- , Gluc - and Lac - , respectively. From the investigations at different temperatures, it results that the entropic contribution is the driving force of the reactions. The sequestering ability of the ligands towards Al 3+ was investigated determining the pL 0.5 parameter at different experimental conditions, finding the following trend: Cit 3- » Gluc - > GTZ S95 4- > GTZ AN169 4- > Lac - for the organic ligands, and pL 0.5 : F - » CO 3 2- > H 2 SiO 4 2- for the inorganic ones. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nalos, Marek; Kholodniak, Euguenia; Smith, Louise; Orde, Sam; Ting, Iris; Slama, Michel; Seppelt, Ian; McLean, Anthony S; Huang, Stephen
2018-06-01
To investigate the metabolic and cardiac effects of intravenous administration of two hypertonic solutions - 3% saline (SAL) and 0.5M sodium lactate (LAC). A randomised, doubleblind, crossover study in ten human volunteers. Intravenous bolus of either SAL or LAC at 3 mL/kg over 20 min followed by a 2 mL/kg infusion over 60 min. Acid base parameters and echocardiographic indices of cardiac function, cardiac output (CO), left ventricular ejection fraction (LVEF) and mitral annular peak systolic velocity (Sm) before and after infusion of SAL or LAC. Despite haemodilution, we observed an increase in sodium (139 ± 2 mmol/L to 142 ± 2 mmol/L in both groups) and respective anions, chloride (106 ± 2 mmol/L to 112 ± 3 mmol/L) and lactate (1.01 ± 0.28 mmol/L to 2.38 ± 0.38 mmol/L) with SAL and LAC, respectively. The pH (7.37 ± 0.03 to 7.45 ± 0.03; P < 0.01) and simplified strong ion difference (SID) (36.3 ± 4.6 mmol/L to 39.2 ± 3.6 mmol/L; P < 0.01) increased during the LAC infusion. The pH was unchanged, but SID decreased during SAL infusion (36.3 ± 2.5 mmol/L to 33.9 ± 3.1 mmol/L; P = 0.01). Both solutions led to an increase in preload and cardiac function, CO (4.36 ± 0.79 L/min to 4.98 ± 1.37 L/ min v 4.62 ± 1.30 L/min to 5.13 ± 1.44 L/min), LVEF (61 ± 6% to 63 ± 8% v 64 ± 6% to 68 ± 7%). The averaged Sm improved in the LAC group as compared with the SAL group (0.088 ± 0.008 to 0.096 ± 0.016 v 0.086 ± 0.012 to 0.082 ± 0.012; P = 0.032). The administration of SAL or LAC has opposing effects on acid base variables such as SID. Hypertonic fluid infusion lead to increased cardiac preload and performance with Sm, suggesting better left ventricular systolic function during LAC as compared with SAL. Lactated hypertonic solutions should be evaluated as resuscitation fluids.
Meoli, Luca; Isensee, Jörg; Zazzu, Valeria; Nabzdyk, Christoph S; Soewarto, Dian; Witt, Henning; Foryst-Ludwig, Anna; Kintscher, Ulrich; Noppinger, Patricia Ruiz
2014-05-01
The G protein-coupled receptor 30 (GPR30) has been claimed as an estrogen receptor. However, the literature reports controversial findings and the physiological function of GPR30 is not fully understood yet. Consistent with studies assigning a role of GPR30 in the cardiovascular and metabolic systems, GPR30 expression has been reported in small arterial vessels, pancreas and chief gastric cells of the stomach. Therefore, we hypothesized a role of GPR30 in the onset and progression of cardiovascular and metabolic diseases. In order to test our hypothesis, we investigated the effects of a high-fat diet on the metabolic and cardiovascular profiles of Gpr30-deficient mice (GPR30-lacZ mice). We found that GPR30-lacZ female, rather than male, mice had significant lower levels of HDL along with an increase in fat liver accumulation as compared to control mice. However, two indicators of cardiac performance assessed by echocardiography, ejection fraction and fractional shortening were both decreased in an age-dependent manner only in Gpr30-lacZ male mice. Collectively our results point to a potential role of Gpr30 in preserving lipid metabolism and cardiac function in a sex- and age-dependent fashion. Copyright © 2014 Elsevier B.V. All rights reserved.
Mortality due to cardiovascular diseases in the Americas by region, 2000-2009.
Gawryszewski, Vilma Pinheiro; Souza, Maria de Fatima Marinho de
2014-01-01
Cardiovascular diseases are the leading cause of death worldwide. The aim here was to evaluate trends in mortality due to cardiovascular diseases in three different regions of the Americas. This was a time series study in which mortality data from three different regions in the Americas from 2000 to the latest year available were analyzed. The source of data was the Mortality Information System of the Pan-American Health Organization (PAHO). Data from 27 countries were included. Joinpoint regression analysis was used to analyze trends. During the study period, the age-adjusted mortality rates for men were higher than those of females in all regions. North America (NA) showed lower rates than Latin America countries (LAC) and the Non-Latin Caribbean (NLC). Premature deaths (30-69 years old) accounted for 22.8% of all deaths in NA, 38.0% in LAC and 41.8% in NLC. The trend analysis also showed a significant decline in the three regions. NA accumulated the largest decline. The average annual percentage change (AAPC) and 95% confidence interval was -3.9% [-4.2; -3.7] in NA; -1.8% [-2.2; -1.5] in LAC; and -1.8% [-2.7; -0.9] in NLC. Different mortality rates and reductions were observed among the three regions.
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, Alexandra S., E-mail: alexandra.long@hc-sc.gc.ca; Mechanistic Studies Division, Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON; Lemieux, Christine L.
Test batteries to screen chemicals for mutagenic hazard include several endpoints regarded as effective for detecting genotoxic carcinogens. Traditional in vivo methods primarily examine clastogenic endpoints in haematopoietic tissues. Although this approach is effective for identifying systemically distributed clastogens, some mutagens may not induce clastogenic effects; moreover, genotoxic effects may be restricted to the site of contact and/or related tissues. An OECD test guideline for transgenic rodent (TGR) gene mutation assays was released in 2011, and the TGR assays permit assessment of mutagenicity in any tissue. This study assessed the responses of two genotoxicity endpoints following sub-chronic oral exposures ofmore » male Muta™Mouse to 9 carcinogenic polycyclic aromatic hydrocarbons (PAHs). Clastogenicity was assessed via induction of micronuclei in peripheral blood, and mutagenicity via induction of lacZ transgene mutations in bone marrow, glandular stomach, small intestine, liver, and lung. Additionally, the presence of bulky PAH-DNA adducts was examined. Five of the 9 PAHs elicited positive results across all endpoints in at least one tissue, and no PAHs were negative or equivocal across all endpoints. All PAHs were positive for lacZ mutations in at least one tissue (sensitivity = 100%), and for 8 PAHs, one or more initial sites of chemical contact (i.e., glandular stomach, liver, small intestine) yielded a greater response than bone marrow. Five PAHs were positive in the micronucleus assay (sensitivity = 56%). Furthermore, all PAHs produced DNA adducts in at least one tissue. The results demonstrate the utility of the TGR assay for mutagenicity assessment, especially for compounds that may not be systemically distributed. - Highlights: • The Muta™Mouse is a reliable tool for in vivo mutagenicity assessment of PAHs. • All 9 PAHs induced lacZ transgene mutations in small intestine. • Only 5 of 9 PAHs induced lacZ mutations and micronuclei in haematopoietic tissue. • Tissue-specific results are likely related to metabolism, repair, and proliferation. • For oral exposures, it is important to examine effects at the site-of-contact.« less
Kovács, Ákos T.; van Hartskamp, Mariska; Kuipers, Oscar P.; van Kranenburg, Richard
2010-01-01
Bacillus coagulans has good potential as an industrial production organism for platform chemicals from renewable resources but has limited genetic tools available. Here, we present a targeted gene disruption system using the Cre-lox system, development of a LacZ reporter assay for monitoring gene transcription, and heterologous d-lactate dehydrogenase expression. PMID:20400555
A multi-scaled approach for simulating chemical reaction systems.
Burrage, Kevin; Tian, Tianhai; Burrage, Pamela
2004-01-01
In this paper we give an overview of some very recent work, as well as presenting a new approach, on the stochastic simulation of multi-scaled systems involving chemical reactions. In many biological systems (such as genetic regulation and cellular dynamics) there is a mix between small numbers of key regulatory proteins, and medium and large numbers of molecules. In addition, it is important to be able to follow the trajectories of individual molecules by taking proper account of the randomness inherent in such a system. We describe different types of simulation techniques (including the stochastic simulation algorithm, Poisson Runge-Kutta methods and the balanced Euler method) for treating simulations in the three different reaction regimes: slow, medium and fast. We then review some recent techniques on the treatment of coupled slow and fast reactions for stochastic chemical kinetics and present a new approach which couples the three regimes mentioned above. We then apply this approach to a biologically inspired problem involving the expression and activity of LacZ and LacY proteins in E. coli, and conclude with a discussion on the significance of this work. Copyright 2004 Elsevier Ltd.
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Iwabuchi, Kazuhisa; Nakayama, Hitoshi; Masuda, Hiromi; Kina, Katsunari; Ogawa, Hideoki; Takamori, Kenji
2012-01-01
Over the last 30 years, many studies have indicated that glycosphingolipids (GSLs) expressed on the cell surface may act as binding sites for microorganisms. Based on their physicochemical characteristics, GSLs form membrane microdomains with cholesterol, sphingomyelin, glycosylphosphatidylinositol (GPI)-anchored proteins, and various signaling molecules, and GSL-enriched domains have been shown to be involved in these defense responses. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms. LacCer is expressed at high levels on the plasma membrane of human neutrophils, and forms membrane microdomains associated with the Src family tyrosine kinase Lyn. LacCer-enriched membrane microdomains mediate superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. In contrast, several pathogens have developed infection mechanisms using membrane microdomains. In addition, some pathogens have the ability to avoid degradation by escaping from the vacuolar compartment or preventing phagosome maturation, utilizing membrane microdomains, such as LacCer-enriched domains, of host cells. The detailed molecular mechanisms of these membrane microdomain-associated host-pathogen interactions remain to be elucidated. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.
Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.
Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D
1993-01-01
Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005
2015-01-01
Changes in glycosylation have been shown to have a profound correlation with development/malignancy in many cancer types. Currently, two major enrichment techniques have been widely applied in glycoproteomics, namely, lectin affinity chromatography (LAC)-based and hydrazide chemistry (HC)-based enrichments. Here we report the LC–MS/MS quantitative analyses of human blood serum glycoproteins and glycopeptides associated with esophageal diseases by LAC- and HC-based enrichment. The separate and complementary qualitative and quantitative data analyses of protein glycosylation were performed using both enrichment techniques. Chemometric and statistical evaluations, PCA plots, or ANOVA test, respectively, were employed to determine and confirm candidate cancer-associated glycoprotein/glycopeptide biomarkers. Out of 139, 59 common glycoproteins (42% overlap) were observed in both enrichment techniques. This overlap is very similar to previously published studies. The quantitation and evaluation of significantly changed glycoproteins/glycopeptides are complementary between LAC and HC enrichments. LC–ESI–MS/MS analyses indicated that 7 glycoproteins enriched by LAC and 11 glycoproteins enriched by HC showed significantly different abundances between disease-free and disease cohorts. Multiple reaction monitoring quantitation resulted in 13 glycopeptides by LAC enrichment and 10 glycosylation sites by HC enrichment to be statistically different among disease cohorts. PMID:25134008
Balani, Prashant N; Ng, Wai Kiong; Tan, Reginald B H; Chan, Sui Yung
2010-05-01
The feasibility of using excipients to suppress the amorphization or structural disorder of crystalline salbutamol sulphate (SS) during milling was investigated. SS was subjected to ball-milling in the presence of alpha-lactose monohydrate (LAC), adipic acid (AA), magnesium stearate (MgSt), or polyvinyl pyrrolidone (PVP). X-ray powder diffraction, dynamic vapor sorption (DVS), high sensitivity differential scanning calorimetry (HSDSC) were used to analyze the crystallinity of the milled mixtures. Comilling with crystalline excipients, LAC, AA, and MgSt proved effective in reducing the amorphization of SS. LAC, AA, or MgSt acting as seed crystals to induce recrystallization of amorphous SS formed by milling. During comilling, both SS and LAC turned predominantly amorphous after 45 min but transformed back to a highly crystalline state after 60 min. Amorphous content was below the detection limits of DVS (0.5%) and HSDSC (5%). Comilled and physical mixtures of SS and ALM were stored under normal and elevated humidity conditions. This was found to prevent subsequent changes in crystallinity and morphology of comilled SS:LAC as compared to significant changes in milled SS and physical mixture. These results demonstrate a promising application of comilling with crystalline excipients in mitigating milling induced amorphization of pharmaceutical actives.
Evaluation of anaerobic threshold in non-pregnant and pregnant rats.
Netto, Aline Oliveira; Macedo, Nathália C D; Gallego, Franciane Q; Sinzato, Yuri K; Volpato, Gustavo T; Damasceno, Débora C
2017-01-01
Several studies present different methodologies and results about intensity exercise, and many of them are performed in male rats. However, the impact of different type, intensity, frequency and duration of exercise on female rats needs more investigation. From the analysis of blood lactate concentration during lactate minimum test (LacMin) in the swimming exercise, the anaerobic threshold (AT) was identified, which parameter is defined as the transition point between aerobic and anaerobic metabolism. LacMin test is considered a good indicator of aerobic conditioning and has been used in prescription of training in different exercise modalities. However, there is no evidence of LacMin test in female rats. The objective was to determine AT in non-pregnant and pregnant Wistar rats. The LacMin test was performed and AT defined for mild exercise intensity was from a load equivalent to 1% of body weight (bw), moderate exercise as carrying 4% bw and severe intensity as carrying 7% bw. In pregnant rats, the AT was reached at a lower loading from 5.0% to 5.5% bw, while in non-pregnant the load was from 5.5% to 6.0% bw. Thus, this study was effective to identify exercise intensities in pregnant and non-pregnant rats using anaerobic threshold by LacMin test.
Pinna, C; Stefanelli, C; Biagi, G
2014-12-01
The aim of the present study was to evaluate in vitro the effect of some prebiotic substances and 2 dietary protein levels on the composition and activity of feline fecal microbiota. Two in vitro studies were conducted. First, 6 nondigestible oligosaccharides were studied; treatments were control diet (CTRL), gluconic acid (GA), carrot fiber (CF), fructooligosaccharides (FOS), galactooligosaccharides (GOS), lactitol (LAC), and pectins from citrus fruit (PEC). Substrates were added to feline fecal cultures at 2 g/L for 24 h incubation. Compared with the CTRL, ammonia had been reduced (P<0.05) by GOS (-9%) after 6 h and by GA (-14%), LAC (-12%), and PEC (-10%) after 24 h. After 24 h, all treatments had resulted in a lower pH versus the CTRL. Putrescine concentrations at 24 h were greater (P<0.05) in cultures treated with FOS (+90%), GOS (+96%), and LAC (+87%). Compared with the CTRL, total VFA were higher (P<0.05) in bottles containing CF (+41%), whereas the acetic to propionic acid ratio was reduced by LAC (-51%; P<0.05). After 24 h, Enterobacteriaceae had been reduced (P<0.05) by LAC and PEC. In a second study, LAC and FOS were selected to be tested in the presence of 2 diets differing in their protein content. There were 6 treatments: low-protein (LP) CTRL with no addition of prebiotics (CTRL-LP), high-protein (HP) CTRL with no addition of prebiotics (CTRL-HP), LP diet plus FOS, CTRL-HP plus FOS, LP diet plus LAC, and CTRL-HP plus LAC. Both FOS and LAC were added to feline fecal cultures at 2 g/L for 24 h incubation. Ammonia at 24 h was affected (P<0.05) by the protein level (36.2 vs. 50.2 mmol/L for LP and HP, respectively). The CTRL-HPs resulted in a higher pH and increased concentrations of biogenic amines were found after 6 and 24 h of incubation (P<0.05); putrescine at 24 h showed an increase (P<0.05) in cultures treated with FOS. Total VFA were influenced (P<0.05) by the protein level (40.9 vs. 32.6 mmol/L for LP and HP, respectively). At 24 h, the CTRL-HPs were associated with increased Clostridium perfringens and reduced Lactobacillus spp. and enterococci counts (P<0.05). The results from the present study show that different prebiotics exert different effects on the composition and activity of feline intestinal microbiota and that high dietary protein levels in a cat's diet can have negative effects on the animal intestinal environment.
Qiao, Liang; Liu, Zhi
2015-07-01
To discuss the risk factors of acute respiratory distress syndrome (ARDS) in patients with sepsis in emergency department. 312 patients with sepsis admitted to Department of Emergency of China Medical University Affiliated First Hospital were retrospectively analyzed, and they were divided into two groups according to development of ARDS, which was defined according to the Berlin new definition. The age, gender, vital signs, laboratory results, underlying disease, the mortality in emergency department sepsis (MEDS) score and lung injury prediction score (LIPS) were collected. Univariate analysis was done for each parameter. Statistical significance results were evaluated by multivariate logistic regression analysis. Receiver operating characteristic (ROC) curve was plotted to analyze the predictive value of the parameter for ARDS. The incidence of sepsis-related ARDS was 11.2% (35/312). Within 35 cases of ARDS, there were 10 cases of mild ARDS, 18 cases of moderate ARDS, and 7 cases of severe ARDS. Univariate analysis showed that age (t=-2.134, P=0.035), oxygenation index (t=-4.245, P=0.001), arterial lactate (Lac, t=6.245, P<0.001), drugs for vascular diseases (χ2=4.261, P=0.026), shock (χ2=4.386, P=0.021), MEDS (t=4.021, P=0.045), LIPS (t=5.569, P<0.001), lung infections (χ2=4.289, P=0.025), and mechanical ventilation (χ2=6.245, P=0.001) were related to ARDS. The incidence of ARDS was different in different levels of Lac, which was 5.00% (3/16) at low level of Lac (<2.0 mmol/L), 9.46% (14/148) at middle level of Lac (2.0-3.9 mmol/L) and 17.31% (18/104) at high level of Lac (≥4.0 mmol/L). It was shown by multivariate logistic regression analysis that LIPS [ odds ratio (OR)=5.124, 95% confidence interval (95%CI)=3.642-10.153, P=0.002], Lac (OR=18.180, 95%CI=7.677-32.989, P<0.001) were independent risk factors for ARDS. It was shown by area under ROC (AUC) that the predictive value of LIPS and Lac in ARDS occurrence was significant. AUC of LIPS was 0.725, the cut-off value was 7, when LIPS≥7, the sensitivity was 71.0%, specificity was 75.6%. AUC of Lac was 0.793, the cut-off value was 4.2 mmol/L, when Lac≥4.2 mmol/L, the sensitivity was 72.1%, and specificity was 81.9%. LIPS and Lac are independent risk factors of ARDS in patients with sepsis in emergency department, which may be a reference for the early clinical diagnosis of ARDS.
Lanthanum-mediated dehydrogenation of butenes: Spectroscopy and formation of La(C4H6) isomers
NASA Astrophysics Data System (ADS)
Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng
2018-01-01
La atom reactions with 1-butene, 2-butene, and isobutene are carried out in a laser-vaporization molecular beam source. The three reactions yield the same La-hydrocarbon products from the dehydrogenation and carbon-carbon bond cleavage and coupling of the butenes. The dehydrogenated species La(C4H6) is the major product, which is characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectrum of La(C4H6) produced from the La+1-butene reaction exhibits two band systems, whereas the MATI spectra produced from the La+2-butene and isobutene reactions display only a single band system. Each of these spectra shows a strong origin band and several vibrational progressions. The two band systems from the spectrum of the 1-butene reaction are assigned to the ionization of two isomers: La[C(CH2)3] (Iso A) and La(CH2CHCHCH2) (Iso B), and the single band system from the spectra of the 2-butene and isobutene reactions is attributed to Iso B and Iso A, respectively. The ground electronic states are 2A1 (C3v) for Iso A and 2A' (Cs) for Iso B. The ionization of the doublet state of each isomer removes a La 6s-based electron and leads to the 1A1 ion of Iso A and the 1A' ion of Iso B. The formation of both isomers consists of La addition to the C=C double bond, La insertion into two C(sp3)—H bonds, and H2 elimination. In addition to these steps, the formation of Iso A from the La+1-butene reaction may involve the isomerization of 1-butene to isobutene prior to the C—H bond activation, whereas the formation of Iso B from the La+trans-2-butene reaction may include the trans- to cis-butene isomerization after the C—H bond activation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dooraghi, A. A.; Seetho, I.; Smith, J.. A.
2017-04-27
In this document, we outline an experiment performed at LLNL to evaluate the radiation sensitivity of polytetrafluoroethylene (PTFE) and a PTFE isomer, fluorinated ethylene propylene (FEP). We demonstrate that PTFE, a material currently used for assessing MicroCT system stability, shows higher radiation-dependent change in x-ray attenuation than FEP. Specifically, for a dose of approximately 1.44 x 10 3 Gy, the linear attenuation coefficient (LAC) of PTFE changes by 0.8 ± 0.1 %. During the same irradiation period, the LAC for FEP changes by 0.02 ± 0.1 %, which is within the statistical uncertainty of the measurement. Due to its highermore » resistance to radiation damage, we recommend that LLNL and partner labs operating under the Department of Homeland Security’s Explosives Division (DHS EXD) transition to the use of FEP as a reference material in place of PTFE.« less
Mitchell, Jennie E.; Oshima, Taku; Piper, Sarah E.; Webster, Christine L.; Westblade, Lars F.; Karimova, Gouzel; Ladant, Daniel; Kolb, Annie; Hobman, Jon L.; Busby, Stephen J. W.; Lee, David J.
2007-01-01
The Escherichia coli Rsd protein forms complexes with the RNA polymerase σ70 factor, but its biological role is not understood. Transcriptome analysis shows that overexpression of Rsd causes increased expression from some promoters whose expression depends on the alternative σ38 factor, and this was confirmed by experiments with lac fusions at selected promoters. The LP18 substitution in Rsd increases the Rsd-dependent stimulation of these promoter-lac fusions. Analysis with a bacterial two-hybrid system shows that the LP18 substitution in Rsd increases its interaction with σ70. Our experiments support a model in which the role of Rsd is primarily to sequester σ70, thereby increasing the levels of RNA polymerase containing the alternative σ38 factor. PMID:17351046
Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O
1998-08-01
The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.
The Second Catalog Of Active Galactic Nuclei Detected By The Fermi Large Area Telescope
Ackermann, M.
2011-12-02
The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The Second LAT AGN Catalog (2LAC) includes 1017 γ-ray sources located at high Galactic latitudes (|b| > 10°) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently we define a clean sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lacs), 310 flat-spectrum radio quasars (FSRQs), 157 candidate blazars ofmore » unknown type (i.e., with broad-band blazar characteristics but with no optical spectral measurement yet), eight misaligned AGNs, four narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types and two starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency < 10 14 Hz, about half of the BL Lacs have a synchrotron-peak frequency > 10 15 Hz. The 2LAC represents a significant improvement relative to the First LAT AGN Catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broad-band data. Various properties, such as γ-ray fluxes and photon power law spectral indices, redshifts, γ-ray luminosities, variability, and archival radio luminosities—and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less
Comparison of vonoprazan and proton pump inhibitors for eradication of Helicobacter pylori.
Shinozaki, Satoshi; Nomoto, Hiroaki; Kondo, Yoshie; Sakamoto, Hirotsugu; Hayashi, Yoshikazu; Yamamoto, Hironori; Lefor, Alan Kawarai; Osawa, Hiroyuki
2016-05-01
Alternative eradication therapies for Helicobacter pylori infection are needed because of an increasing failure rate over the past decade. The aim of this study was to determine if vonoprazan, a new potassium-competitive acid blocker, showed superiority to existing proton pump inhibitors for primary eradication of H. pylori in routine clinical practice. Data for 573 patients who underwent primary H. pylori eradication therapy were retrospectively reviewed. Regimens included clarithromycin 200 mg, amoxicillin 750 mg, and an acid-suppressing drug [lansoprazole 30 mg (LAC), rabeprazole 10 mg (RAC), esomeprazole 20 mg (EAC), or vonoprazan 20 mg (VAC)] twice daily for 1 week. Eradication was successful in 73% (419/573) of patients using intention-to-treat (ITT) analysis and 76% (419/549) of patients in per-protocol (PP) analysis. The VAC group had a significantly superior eradication rate compared with the LAC and RAC groups in ITT (VAC 83%, LAC 66% and RAC 67%, p < 0.01) and PP analysis (VAC 85%, LAC 69% and RAC 70%, p < 0.01), and had a similarly high eradication rate to the EAC group (83% in ITT and 87% in PP). Although the eradication rate in the VAC and EAC groups was not significantly higher than in the LAC and RAC groups in patients with mild gastric atrophy with both ITT and PP analyses, it was significantly higher in patients with severe gastric atrophy (p < 0.01). The VAC group had a significantly higher H. pylori eradication rate than the LAC and RAC groups, and a > 80% eradication rate regardless of the degree of atrophy. Copyright © 2016. Published by Elsevier Taiwan.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Staedtler, F.; Locher, F.; Sreenan, G.
1997-10-01
In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less
Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects
NASA Astrophysics Data System (ADS)
Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju
2018-01-01
We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.
Borrell, Jordi H; Montero, M Teresa; Morros, Antoni; Domènech, Òscar
2015-11-01
In this work, we will describe in quantitative terms the unspecific recognition between lactose permease (LacY) of Escherichia coli, a polytopic model membrane protein, and one of the main components of the inner membrane of this bacterium. Supported lipid bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) (3:1, mol/mol) in the presence of Ca(2+) display lateral phase segregation that can be distinguished by atomic force microscopy (AFM) as well as force spectroscopy. LacY shows preference for fluid (Lα) phases when it is reconstituted in POPE : POPG (3:1, mol/mol) proteoliposomes at a lipid-to-protein ratio of 40. When the lipid-to-protein ratio is decreased down to 0.5, two domains can be distinguished by AFM. While the upper domain is formed by self-segregated units of LacY, the lower domain is constituted only by phospholipids in gel (Lβ) phase. On the one hand, classical differential scanning calorimetry (DSC) measurements evidenced the segregation of a population of phospholipids and point to the existence of a boundary region at the lipid-protein interface. On the other hand, Förster Resonance Energy Transfer (FRET) measurements in solution evidenced that POPE is selectively recognized by LacY. A binary pseudophase diagram of POPE : POPG built from AFM observations enables to calculate the composition of the fluid phase where LacY is inserted. These results are consistent with a model where POPE constitutes the main component of the lipid-LacY interface segregated from the fluid bulk phase where POPG predominates. Copyright © 2015 John Wiley & Sons, Ltd.
THE SECOND CATALOG OF ACTIVE GALACTIC NUCLEI DETECTED BY THE FERMI LARGE AREA TELESCOPE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ackermann, M.; Ajello, M.; Allafort, A.
The second catalog of active galactic nuclei (AGNs) detected by the Fermi Large Area Telescope (LAT) in two years of scientific operation is presented. The second LAT AGN catalog (2LAC) includes 1017 {gamma}-ray sources located at high Galactic latitudes (|b| > 10 Degree-Sign ) that are detected with a test statistic (TS) greater than 25 and associated statistically with AGNs. However, some of these are affected by analysis issues and some are associated with multiple AGNs. Consequently, we define a Clean Sample which includes 886 AGNs, comprising 395 BL Lacertae objects (BL Lac objects), 310 flat-spectrum radio quasars (FSRQs), 157more » candidate blazars of unknown type (i.e., with broadband blazar characteristics but with no optical spectral measurement yet), 8 misaligned AGNs, 4 narrow-line Seyfert 1 (NLS1s), 10 AGNs of other types, and 2 starburst galaxies. Where possible, the blazars have been further classified based on their spectral energy distributions (SEDs) as archival radio, optical, and X-ray data permit. While almost all FSRQs have a synchrotron-peak frequency <10{sup 14} Hz, about half of the BL Lac objects have a synchrotron-peak frequency >10{sup 15} Hz. The 2LAC represents a significant improvement relative to the first LAT AGN catalog (1LAC), with 52% more associated sources. The full characterization of the newly detected sources will require more broadband data. Various properties, such as {gamma}-ray fluxes and photon power-law spectral indices, redshifts, {gamma}-ray luminosities, variability, and archival radio luminosities and their correlations are presented and discussed for the different blazar classes. The general trends observed in 1LAC are confirmed.« less
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Deep Eutectic Solvents (DESs) for the Isolation of Willow Lignin (Salix matsudana cv. Zhuliu)
Li, Tengfei; Liu, Yu; Lou, Rui; Yang, Guihua; Chen, Jiachuan; Saeed, Haroon A. M.
2017-01-01
Deep eutectic solvents (DESs) are a potentially high-value lignin extraction methodology. DESs prepared from choline chloride (ChCl) and three hydrogen-bond donors (HBD)—lactic acid (Lac), glycerol, and urea—were evaluated for isolation of willow (Salix matsudana cv. Zhuliu) lignin. DESs types, mole ratio of ChCl to HBD, extraction temperature, and time on the fractionated DES-lignin yield demonstrated that the optimal DES-lignin yield (91.8 wt % based on the initial lignin in willow) with high purity of 94.5% can be reached at a ChCl-to-Lac molar ratio of 1:10, extraction temperature of 120 °C, and time of 12 h. Fourier transform infrared spectroscopy (FT-IR) , 13C-NMR, and 31P-NMR showed that willow lignin extracted by ChCl-Lac was mainly composed of syringyl and guaiacyl units. Serendipitously, a majority of the glucan in willow was preserved after ChCl-Lac treatment. PMID:29143790
An alkaline bacterial laccase for polymerization of natural precursors for hair dye synthesis.
Kumar, Deepak; Kumar, Aditya; Sondhi, Sonica; Sharma, Prince; Gupta, Naveen
2018-03-01
In the present study, an extracellular alkali stable laccase (Lac DS) from Bacillus subtilis DS which has pH optima at 8.5 using p -phenylenediamine (PPD) as substrate has been reported. Lac DS retained 70% activity for 4 h at pH 8.5 and 90% activity for 24 h at 55 °C. The enzyme yield was enhanced by optimization of fermentation conditions. A 746-fold increase in yield was observed under optimized conditions using 150 µM MgSO 4 , 1.2% yeast extract, 0.35% tryptone, and 150 µM vanillic acid. Lac DS was used to polymerize natural dye precursor catechol, pyrogallol, syringaldehyde, syringic acid, ferulic acid and gallic acid to develop a range of natural hair colors such as black, golden yellow, and reddish brown. The results indicate that alkaline Lac DS is a suitable candidate to develop a user-friendly and commercially applicable hair dyeing process in the area of cosmetic industry.
NASA Astrophysics Data System (ADS)
Carby, B. E.
2015-12-01
Latin American and Caribbean (LAC) countries face multiple hazards such as earthquakes, volcanoes, accelerated erosion, landslides, drought, flooding, windstorms and the effects of climate variability and change. World Bank (2005) data indicate that seventeen of the top thirty-five countries with relatively high mortality risk from 3 or more hazards are located in LAC, El Salvador has the second highest per cent of its population at risk - 77.7% and 7 of the top 10 countries for population exposure to multiple hazards are in LAC. All LAC countries have half or more of GDP exposed to at least one hazard. The report underscores the need for better data and information on hazards and disasters to inform disaster risk reduction (DRR) and supports the view that reduction of disaster risk is essential for achieving Sustainable Development (SD). This suggests that DRR must be integrated into development planning of countries. However the Global Assessment Report notes that globally, there has been little progress in mainstreaming DRR in national development (UNISDR 2009). Without this, countries will not realise development goals. DRR efforts in LAC require an integrated approach including societal input in deciding priority DRR research themes and interdisciplinary, multi-hazard research informing DRR policy and practice. Jiminez (2015) from a study of countries across LAC reports that efforts are being made to link research to national planning through inclusion of policy makers in some university-led research projects. Research by the author in Jamaica reveals that the public sector has started to apply research on hazards to inform DRR policy, programmes and plans. As most research is done by universities, there is collaboration between the public sector and academia. Despite differences in scale among countries across the region, similarities in exposure to multiple hazards and potential hazard impacts suggest that collaboration among researchers in LAC could be beneficial. It is proposed here that this collaboration should go beyond the scientific community and should include sharing of experiences in linking DRR research to national development needs, inclusion of policy makers in research design and implementation and integration of research results in policy and programme development.
What are the blood lead levels of children living in Latin America and the Caribbean?
Olympio, Kelly Polido Kaneshiro; Gonçalves, Cláudia Gaudência; Salles, Fernanda Junqueira; Ferreira, Ana Paula Sacone da Silva; Soares, Agnes Silva; Buzalaf, Marília Afonso Rabelo; Cardoso, Maria Regina Alves; Bechara, Etelvino José Henriques
2017-04-01
Information on the prevalence of lead exposure is essential to formulate efficient public health policies. Developed countries have implemented successful public policies for the prevention and control of lead poisoning. In the United States, Canada, Japan and the European Union, for instance, periodically repeated prevalence studies show that blood lead levels (BLLs) in children have decreased overall. Although BLL of Latino children in the U.S. have also dropped in recent years, the geometric mean remains higher than that of white children. Little is known about lead exposure in children in Latin America and the Caribbean (LAC). In this review, we responded to two questions: What is currently known about lead sources and levels in children in LAC? Are there public policies to prevent children's exposure to lead in LAC? We conducted a literature review covering the period from January 2000 to March 2014 in the PubMed and Lilacs databases to obtain English, Portuguese and Spanish language studies reporting the prevalence of BLLs in children aged 0-18years living in LAC countries. No specific analytical method was selected, and given the scarcity of data, the study was highly inclusive. Fifty-six papers were selected from 16 different LAC countries. The children's BLLs found in this review are high (≥10μg/dL) compared to BLLs for the same age group in the U. S. However, most studies reported an association with some type of "lead hot spot", in which children can be exposed to lead levels similar to those of occupational settings. Only Peru and Mexico reported BLLs in children from population-based studies. Most BLLs prevalence studies carried out in LAC were in areas with known emission sources. The percentage of children at risk of lead poisoning in LAC is unknown, and probably underestimated. Thus, there is an urgent need to establish public health policies to quantify and prevent lead poisoning, specifically by prioritizing the identification and control of "hot spots". Copyright © 2017 Elsevier Ltd. All rights reserved.
Human papillomavirus vaccine policy and delivery in Latin America and the Caribbean.
Andrus, Jon Kim; Lewis, Merle J; Goldie, Sue J; García, Patricia J; Winkler, Jennifer L; Ruiz-Matus, Cuauhtémoc; de Quadros, Ciro A
2008-08-19
Cervical cancer caused by human papillomavirus (HPV) is a major preventable public health problem. Two vaccines are now available for primary prevention of HPV infection and their introduction offers new opportunities to enhance comprehensive cervical cancer prevention and control. Currently, HPV vaccine price is a significant barrier to rapid vaccine introduction and access. Therefore, making evidence-based decisions about whether and how to introduce HPV vaccine into the immunization schedule in the countries of Latin America and the Caribbean (LAC) requires a rigorous analysis of several factors. These include: estimates of disease burden, cost-effectiveness, operational feasibility of reaching a population of adolescent females and other key analyses that have been used in recent years to support the introduction of other vaccines, such as rotavirus and pneumococcal conjugate vaccines. Given the large number of public health priorities that are competing for limited public resources, developing and using a sound evidence base is of particular importance for vaccines, like HPV, which are currently available only at prices higher than other vaccines now in use. HPV vaccination provides the opportunity to dramatically improve women's health and partnerships must also be broad-based and effectively coordinated. This can be achieved by developing programs based on the lessons learned from vaccination strategies used to eliminate rubella and neonatal tetanus and for scaling up influenza vaccination in countries of LAC.
Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148
NASA Astrophysics Data System (ADS)
Ciprini, Stefano
2012-06-01
The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.
NASA Technical Reports Server (NTRS)
Stocke, John T.
1998-01-01
This grant has contributed to one of the original goals of the NAS/LTSA program, the goal of junior faculty development. Below I briefly summarize the following major results on BL Lacertae Objects that we have obtained. An invited talk on BL Lac Objects at IAU 175 "Extragalactic Radio Sources" at Bologna Italy in October 1995 summarized some of these results. A second invited talk in Oct 1998 at Green Bamk, WVA presented other BL Lac results at the conference entitled: "Highly Redshifted Radio Lines". We have used the EMSS sample to measure the X-ray luminosity function and cosmological evolution of BL Lacs. A new large sample of XBLs has been discovered.
A KPC-scale X-ray jet in the BL LAC Source S5 2007+777
NASA Technical Reports Server (NTRS)
Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio
2008-01-01
The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.
Langer, A.; Nigenda, G.; Catino, J.
2000-01-01
Many countries in Latin America and the Caribbean (LAC) are currently reforming their national health sectors and also implementing a comprehensive approach to reproductive health care. Three regional workshops to explore how health sector reform could improve reproductive health services have revealed the inherently complex, competing, and political nature of health sector reform and reproductive health. The objectives of reproductive health care can run parallel to those of health sector reform in that both are concerned with promoting equitable access to high quality care by means of integrated approaches to primary health care, and by the involvement of the public in setting health sector priorities. However, there is a serious risk that health reforms will be driven mainly by financial and/or political considerations and not by the need to improve the quality of health services as a basic human right. With only limited changes to the health systems in many Latin American and Caribbean countries and a handful of examples of positive progress resulting from reforms, the gap between rhetoric and practice remains wide. PMID:10859860
Dangles, Olivier; Loirat, Jean; Freour, Claire; Serre, Sandrine; Vacher, Jean; Le Roux, Xavier
2016-01-01
Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES), it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU) strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC) in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions-the European Research Area (ERA) and LAC-that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most prevalent from researchers in emerging countries like Mexico and Brazil. Overall, interdisciplinary publications represented 25.8% of all publications at the interface of biodiversity and climate change in the ERA-LAC network. Further scientific collaborations should be promoted 1) to prevent less developed countries from being isolated from the global cooperation network, 2) to ensure that scientists from these countries are trained to lead visible and recognized biodiversity and climate change research, and 3) to develop common study models that better integrate multiple scientific disciplines and better support decision-making.
Boulay, G; Francoz, D; Doré, E; Dufour, S; Veillette, M; Badillo, M; Bélanger, A-M; Buczinski, S
2014-01-01
The objectives of the current study were (1) to determine the gain in prognostic accuracy of preoperative l-lactate concentration (LAC) measured on farm on cows with right displaced abomasum (RDA) or abomasal volvulus (AV) for predicting negative outcome; and (2) to suggest clinically relevant thresholds for such use. A cohort of 102 cows with on-farm surgical diagnostic of RDA or AV was obtained from June 2009 through December 2011. Blood was drawn from coccygeal vessels before surgery and plasma LAC was immediately measured by using a portable clinical analyzer. Dairy producers were interviewed by phone 30 d following surgery and the outcome was determined: a positive outcome if the owner was satisfied of the overall evolution 30 d postoperatively, and a negative outcome if the cow was culled, died, or if the owner reported being unsatisfied 30 d postoperatively. The area under the curve of the receiver operating characteristic curve for LAC was 0.92 and was significantly greater than the area under the curve of the receiver operating characteristic curve of heart rate (HR; 0.77), indicating that LAC, in general, performed better than HR to predict a negative outcome. Furthermore, the ability to predict a negative outcome was significantly improved when LAC measurement was considered in addition to the already available HR data (area under the curve: 0.93 and 95% confidence interval: 0.87, 0.99). Important inflection points of the misclassification cost term function were noted at thresholds of 2 and 6 mmol/L, suggesting the potential utility of these cut-points. The 2 and 6 mmol/L thresholds had a sensitivity, specificity, positive predictive value, and negative predictive value for predicting a negative outcome of 76.2, 82.7, 53.3, and 93.1%, and of 28.6, 97.5, 75, and 84%, respectively. In terms of clinical interpretation, LAC ≤2 mmol/L appeared to be a good indicator of positive outcome and could be used to support a surgical treatment decision. The treatment decision for cows with LAC between 2 and 6 mmol/L, however, would depend on the economic context and the owner's attitude to risk in regard to potential return on its investment. Finally, performing a surgical correction on commercial cows with RDA or AV and a LAC ≥6 mmol/L appeared to be unjustified and these animals should be culled based on their high probability of negative outcome. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Loiola, Carina Mendes; Azevedo, Alinne Oliveira Nunes; Diniz, Leandro E. C.; Aragão, Wilson Menezes; Azevedo, Carlos Diego de O.; Santos, Pedro Henrique A. D.; Ramos, Helaine Christine C.; Pereira, Messias Gonzaga; Ramos, Semíramis R. Ramalho
2016-01-01
The diversity and genetic relationships among two accessions of tall coconut palms collected in Brazil and seven accessions introduced from different geographic regions of the world were analyzed using 25 microsatellite primers, 19 of which were polymorphic and detected between 4 and 10 alleles per locus, with an average of 6.57. The observed and expected heterozygosity ranged from 0.25 and 0.40 in the Rennell Islands Tall (RIT) accession to 0.54 and 0.62 in the Polynesian Tall (PYT) accession. The analysis of genetic structure resulted in the formation of five distinct groups. The first group was formed by the accessions Brazilian Tall—Praia do Forte (BRTPF), Brazilian Tall—Merepe (BRTMe) and West African Tall (WAT); the second group consisted of Malaysian Tall (MLT); the third group of RIT; the fourth group of Vanuatu Tall (VTT); and the fifth group of Rotuman Tall (RTMT), Tonga Tall (TONT) and PYT. The dendrogram based on the nearest-neighbor method detected the formation of two main groups and five subgroups, indicating that the genetic relationships of the accessions are based on their geographic regions of origin. The analyses revealed genetic relationships between the accessions collected in Brazil and the accession from Africa, and among palms from South East Asia and the South Pacific, confirming the common origin of these accessions. The information obtained in this study can guide decisions on germplasm conservation activities and the efficient selection of genetically divergent parents for use in coconut breeding programs in Brazil, which are attempting to select for disease resistance, mainly to lethal yellowing, among other characteristics. PMID:26974540
Loiola, Carina Mendes; Azevedo, Alinne Oliveira Nunes; Diniz, Leandro E C; Aragão, Wilson Menezes; Azevedo, Carlos Diego de O; Santos, Pedro Henrique A D; Ramos, Helaine Christine C; Pereira, Messias Gonzaga; Ramos, Semíramis R Ramalho
2016-01-01
The diversity and genetic relationships among two accessions of tall coconut palms collected in Brazil and seven accessions introduced from different geographic regions of the world were analyzed using 25 microsatellite primers, 19 of which were polymorphic and detected between 4 and 10 alleles per locus, with an average of 6.57. The observed and expected heterozygosity ranged from 0.25 and 0.40 in the Rennell Islands Tall (RIT) accession to 0.54 and 0.62 in the Polynesian Tall (PYT) accession. The analysis of genetic structure resulted in the formation of five distinct groups. The first group was formed by the accessions Brazilian Tall-Praia do Forte (BRTPF), Brazilian Tall-Merepe (BRTMe) and West African Tall (WAT); the second group consisted of Malaysian Tall (MLT); the third group of RIT; the fourth group of Vanuatu Tall (VTT); and the fifth group of Rotuman Tall (RTMT), Tonga Tall (TONT) and PYT. The dendrogram based on the nearest-neighbor method detected the formation of two main groups and five subgroups, indicating that the genetic relationships of the accessions are based on their geographic regions of origin. The analyses revealed genetic relationships between the accessions collected in Brazil and the accession from Africa, and among palms from South East Asia and the South Pacific, confirming the common origin of these accessions. The information obtained in this study can guide decisions on germplasm conservation activities and the efficient selection of genetically divergent parents for use in coconut breeding programs in Brazil, which are attempting to select for disease resistance, mainly to lethal yellowing, among other characteristics.
Towards the construction of health workforce metrics for Latin America and the Caribbean
2011-01-01
Introduction One of the components of the Health Observatory for Latin American and the Caribbean (HO-LAC) is the design and implementation of metrics for human resources for health. Under the HO-LAC initiative, researchers from nine countries in the region formed the Collaborative Community on Human Resources for Health in Latin America and the Caribbean to identify common metrics applicable to the field of human resources for health (HRH). Case description The case description comprises three stages: a) the origins of an initiative in which a non-governmental organization brings together researchers involved in HRH policy in LAC, b) a literature search to identify initiatives to develop methods and metrics to assess the HRH field in the region, and c) subsequent discussions held by the group of researchers regarding the possibilities of identifying an appropriate set of metrics and indicators to assess HRH throughout the region. Discussion and evaluation A total of 101 documents produced between 1985 and 2008 in the LAC region were identified. Thirty-three of the papers included a variety of measurements comprising counts, percentages, proportions, indicators, averages and metrics, but only 13 were able to fully describe the methods used to identify these metrics and indicators. Of the 33 articles with measurements, 47% addressed labor market issues, 25% were about working conditions, 23% were on HRH training and 5% addressed regulations. Based on these results, through iterative discussions, metrics were defined into three broad categories (training, labor market and working conditions) and available sources of information for their estimation were proposed. While only three of the countries have data on working conditions, all countries have sufficient data to measure at least one aspect of HRH training and the HRH labor market. Conclusions Information gleaned from HRH metrics makes it possible to carry out comparisons on a determined experience in space and time, in a given country and/or region. The results should then constitute evidence for policy formulation and HRH planning and programs, with improved health system performance ultimately contributing to improved population health. The results of this study are expected to guide decision making by incentivizing the construction of metrics that provide information about HRH problems in LAC countries. PMID:21999239
Influence of salt content and processing time on sensory characteristics of cooked "lacón".
Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M
2011-04-01
The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massaro, F.; Marchesini, E. J.; D’Abrusco, R.
2017-01-10
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less
GSL-enriched membrane microdomains in innate immune responses.
Nakayama, Hitoshi; Ogawa, Hideoki; Takamori, Kenji; Iwabuchi, Kazuhisa
2013-06-01
Many pathogens target glycosphingolipids (GSLs), which, together with cholesterol, GPI-anchored proteins, and various signaling molecules, cluster on host cell membranes to form GSL-enriched membrane microdomains (lipid rafts). These GSL-enriched membrane microdomains may therefore be involved in host-pathogen interactions. Innate immune responses are triggered by the association of pathogens with phagocytes, such as neutrophils, macrophages and dendritic cells. Phagocytes express a diverse array of pattern-recognition receptors (PRRs), which sense invading microorganisms and trigger pathogen-specific signaling. PRRs can recognize highly conserved pathogen-associated molecular patterns expressed on microorganisms. The GSL lactosylceramide (LacCer, CDw17), which binds to various microorganisms, including Candida albicans, is expressed predominantly on the plasma membranes of human mature neutrophils and forms membrane microdomains together with the Src family tyrosine kinase Lyn. These LacCer-enriched membrane microdomains can mediate superoxide generation, migration, and phagocytosis, indicating that LacCer functions as a PRR in innate immunity. Moreover, the interactions of GSL-enriched membrane microdomains with membrane proteins, such as growth factor receptors, are important in mediating the physiological properties of these proteins. Similarly, we recently found that interactions between LacCer-enriched membrane microdomains and CD11b/CD18 (Mac-1, CR3, or αMβ2-integrin) are significant for neutrophil phagocytosis of non-opsonized microorganisms. This review describes the functional role of LacCer-enriched membrane microdomains and their interactions with CD11b/CD18.
Nie, Mengyun; Demeaux, Julien; Young, Benjamin T.; ...
2015-07-23
Binder free (BF) graphite electrodes were utilized to investigate the effect of electrolyte additives fluoroethylene carbonate (FEC) and vinylene carbonate (VC) on the structure of the solid electrolyte interface (SEI). The structure of the SEI has been investigated via ex-situ surface analysis including X-ray Photoelectron spectroscopy (XPS), Hard XPS (HAXPES), Infrared spectroscopy (IR) and transmission electron microscopy (TEM). The components of the SEI have been further investigated via nuclear magnetic resonance (NMR) spectroscopy of D2O extractions. The SEI generated on the BF-graphite anode with a standard electrolyte (1.2 M LiPF6 in ethylene carbonate (EC) / ethyl methyl carbonate (EMC), 3/7more » (v/v)) is composed primarily of lithium alkyl carbonates (LAC) and LiF. Incorporation of VC (3% wt) results in the generation of a thinner SEI composed of Li2CO3, poly(VC), LAC, and LiF. Incorporation of VC inhibits the generation of LAC and LiF. Incorporation of FEC (3% wt) also results in the generation of a thinner SEI composed of Li2CO3, poly(FEC), LAC, and LiF. The concentration of poly(FEC) is lower than the concentration of poly(VC) and the generation of LAC is inhibited in the presence of FEC. The SEI appears to be a homogeneous film for all electrolytes investigated.« less
Parra, Mario A.; Baez, Sandra; Allegri, Ricardo; Nitrini, Ricardo; Lopera, Francisco; Slachevsky, Andrea; Custodio, Nilton; Lira, David; Piguet, Olivier; Kumfor, Fiona; Huepe, David; Cogram, Patricia; Bak, Thomas; Manes, Facundo
2018-01-01
The demographic structure of Latin American countries (LAC) is fast approaching that of developing countries, and the predicted prevalence of dementia in the former already exceeds the latter. Dementia has been declared a global challenge, yet regions around the world show differences in both the nature and magnitude of such a challenge. This article provides evidence and insights on barriers which, if overcome, would enable the harmonization of strategies to tackle the dementia challenge in LAC. First, we analyze the lack of available epidemiologic data, the need for standardizing clinical practice and improving physician training, and the existing barriers regarding resources, culture, and stigmas. We discuss how these are preventing timely care and research. Regarding specific health actions, most LAC have minimal mental health facilities and do not have specific mental health policies or budgets specific to dementia. In addition, local regulations may need to consider the regional context when developing treatment and prevention strategies. The support needed nationally and internationally to enable a smooth and timely transition of LAC to a position that integrates global strategies is highlighted. We focus on shared issues of poverty, cultural barriers, and socioeconomic vulnerability. We identify avenues for collaboration aimed to study unique populations, improve valid assessment methods, and generate opportunities for translational research, thus establishing a regional network. The issues identified here point to future specific actions aimed at tackling the dementia challenge in LAC. PMID:29305437
He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing
2018-03-21
Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.
Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing
2018-01-05
A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.
Nielsen, J T; Liesack, W; Finster, K
1999-04-01
A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.
Radio-weak BL Lac Objects in the Fermi Era
NASA Astrophysics Data System (ADS)
Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.
2017-01-01
The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.
Beyond wilderness: Broadening the applicability of limits of acceptable change
Mark W. Brunson
1977-01-01
The Limits of Acceptable Change (LAC) process helps managers preserve wilderness attributes along with recreation opportunities. Ecosystem management likewise requires managers to balance societal and ecosystem needs. Both are more likely to succeed through collaborative planning. Consequently, LAC can offer a conceptual framework for achieving sustainable solutions...
NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)
EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.
Paratachardina pseudolobata (Cocccoidea: Kerriidae): bionomics in Florida
USDA-ARS?s Scientific Manuscript database
Observations on the bionomics of lobate lac scale, Paratachardina pseudolobata Kondo & Gullan in Florida are reported. Lobate lac scale infests primarily the branches and main stems of <2 cm in dia; rarely were they found on stems larger than 4 cm in dia or on leaves and never on roots. They produce...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-19
... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...
Manager Pumped on Tribal College Degree
ERIC Educational Resources Information Center
Ness, Jean E.
2005-01-01
This column relates the story of Dylan Olson, a struggling business student at Fond du Lac Tribal and Community College (Cloquet, Minnesota). During construction of a new gas and convenience store on the Fond du Lac Reservation, Olson recognized an opportunity, applied for the manager's position, and was hired. Olson's experience illustrates the…
Melnikov, Olga; Zaritsky, Arieh; Zarka, Aliza; Boussiba, Sammy; Malchin, Natalia; Yagil, Ezra; Kolot, Mikhail
2009-07-01
The integrase (Int) of the lambda-like coliphage HK022 catalyzes the site-specific integration and excision of the phage DNA into and from the chromosome of its host, Escherichia coli. Int recognizes two different pairs of recombining sites attP x attB and attL x attR for integration and excision, respectively. This system was adapted to the cyanobacterium Anabaena sp. strain PCC 7120 as a potential tool for site-specific gene manipulations in the cyanobacterium. Two plasmids were consecutively cointroduced by conjugation into Anabaena cells, one plasmid that expresses HK022 Int recombinase and the other plasmid that carries the excision substrate P(glnA)-attL-T1/T2-attR-lacZ, where T1/T2 are the strong transcription terminators of rrnB, to prevent expression of the lacZ reporter under the constitutive promoter P(glnA). The Int-catalyzed site-specific recombination reaction was monitored by the expression of lacZ emanating as a result of T1/T2 excision. Int catalyzed the site-specific excision reaction in Anabaena cells when its substrate was located either on the plasmid or on the chromosome with no need to supply an accessory protein, such as integration host factor and excisionase (Xis), which are indispensable for this reaction in its host, E. coli.
NASA Astrophysics Data System (ADS)
Martin, Nicolas F.; Slater, Colin T.; Schlafly, Edward F.; Morganson, Eric; Rix, Hans-Walter; Bell, Eric F.; Laevens, Benjamin P. M.; Bernard, Edouard J.; Ferguson, Annette M. N.; Finkbeiner, Douglas P.; Burgett, William S.; Chambers, Kenneth C.; Hodapp, Klaus W.; Kaiser, Nicholas; Kudritzki, Rolf-Peter; Magnier, Eugene A.; Morgan, Jeffrey S.; Price, Paul A.; Tonry, John L.; Wainscoat, Richard J.
2013-07-01
We report the discovery of two new dwarf galaxies, Lacerta I/Andromeda XXXI (Lac I/And XXXI) and Cassiopeia III/Andromeda XXXII (Cas III/And XXXII), in stacked Pan-STARRS1 r P1- and i P1-band imaging data. Both are luminous systems (MV ~ -12) located at projected distances of 20.°3 and 10.°5 from M31. Lac I and Cas III are likely satellites of the Andromeda galaxy with heliocentric distances of 756^{+44}_{-28}\\,kpc and 772^{+61}_{-56}\\,kpc, respectively, and corresponding M31-centric distances of 275 ± 7 kpc and 144^{+6}_{-4}\\,kpc. The brightest of recent Local Group member discoveries, these two new dwarf galaxies owe their late discovery to their large sizes (r_h = 4.2^{+0.4}_{-0.5} arcmin or 912^{+124}_{-93}\\,pc for Lac I r_h = 6.5^{+1.2}_{-1.0} arcmin or 1456 ± 267 pc for Cas III) and consequently low surface brightness (μ0 ~ 26.0 mag arcsec-2), as well as to the lack of a systematic survey of regions at large radii from M31, close to the Galactic plane. This latter limitation is now alleviated by the 3π Pan-STARRS1 survey, which could lead to the discovery of other distant Andromeda satellite dwarf galaxies.
Diversity of helminth parasites in aquatic invertebrate hosts in Latin America: how much do we know?
Aguirre-Macedo, M L; May-Tec, A L; Martínez-Aquino, A; Cremonte, F; Martorelli, S R
2017-03-01
Helminths in aquatic invertebrate hosts have been overlooked in comparison with vertebrate hosts. Therefore, the known diversity, ecology and distribution of these host-parasite systems are very limited in terms of their taxonomic diversity, habitat and geographic regions. In this study we examined the published literature on helminth parasites of aquatic invertebrates from Latin America and the Caribbean (LAC) to identify the state of the knowledge in the region and to identify patterns of helminth diversity. Results showed that 67% of the literature is from Argentina, Mexico and Brazil. We found records for 772 host-parasite associations. Most records relate to medically or economically important hosts. Molluscs were the most studied host group with 377 helminth records (80% trematodes). The lymnaeids and planorbids were the most studied molluscs across LAC. Arthropods were the second most studied host group with 78 helminth records (trematodes 38%, cestodes 24% and nematodes 20%), with shrimps and crabs being the most studied hosts. Host species with the largest number of helminth taxa were those with a larger sampling effort through time, usually in a small country region. No large geographical-scale studies were identified. In general, the knowledge is still too scarce to allow any zoogeographical or helminth diversity generalization, as most hosts have been studied locally and the studies on invertebrate hosts in LAC are substantially uneven among countries.
Scale-up laccase production from Trametes versicolor stimulated by vanillic acid.
Wang, Ke-Feng; Hu, Jian-Hua; Guo, Chen; Liu, Chun-Zhao
2016-07-01
An efficient strategy for laccase production in Trametes versicolor cultures was developed using vanillic acid as the inducer. The optimized vanillic acid treatment strategy consisted of exposing 2-day-old mycelia cultures to 80 mg/L vanillic acid. After 4 days, laccase activity of 588.84 U/L was achieved in flasks which represented a 1.79-fold increase compared to the control. In 200-L airlift bioreactor, the maximal laccase activity reached up to 785.12 U/L using the optimized vanillic acid treatment strategy. The zymograms of culture supernatants revealed three bands with laccase activity, among which Lac1 and Lac2 were abundant laccase isoforms constitutively expressed, and Lac3 was an inducible isozyme by vanillic acid. The results of real-time quantitative PCR showed that the transcription level of lcc in T. versicolor cultures grown with vanillic acid for 7 days was about 5.64-fold greater than that without vanillic acid in flasks. In 200-L airlift bioreactor cultures of T. versicolor with addition of vanillic acid, the transcript level of lcc at day 7 was 2.62-fold higher than that in flasks with vanillic acid due to the good mass transfer and oxygen supply in the bioreactor system. This study provides a basis for understanding the induction mechanism of vanillic acid for laccase production and has good potential for industrial applications.
Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2
Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.
2000-01-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626
Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.
Kume, T; Deng, K; Hogan, B L
2000-02-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.
Role of public involvement in the limits of acceptable change wilderness planning system
Edwin E. Krumpe; Stephen F. McCool
1997-01-01
Implementation of the LAC within politicized contexts requires that managers/planners involve the public in ways significantly different from the traditional rational-comprehensive paradigm of natural resource planning. In politicized contexts, the lack of clear agreement about goals and disagreement among scientists about cause-effect relationships requires planning...
USDA-ARS?s Scientific Manuscript database
Lectin affinity chromatography (LAC) can provide a valuable front-end enrichment strategy for the study of N-glycoproteins and has been used to characterize a broad range eukaryotic N-glycoproteomes. Moreover, studies with mammalian systems have suggested that the use of multiple lectins with differ...
Jin, Zixue; Wei, Wei; Yang, Marie; Du, Yang; Wan, Yihong
2014-01-01
SUMMARY Mitochondrial complex I (CI) deficiency is associated with multiple neurological and metabolic disorders. However, its effect on innate immunity and bone remodeling is unclear. Using deletion of the essential CI subunit Ndufs4 as a model for mitochondrial dysfunction, we report that mitochondria suppress macrophage activation and inflammation while promoting osteoclast differentiation and bone resorption via both cell-autonomous and systemic regulation. Global Ndufs4 deletion causes systemic inflammation and osteopetrosis. Hematopoietic Ndufs4 deletion causes an intrinsic lineage shift from osteoclast to macrophage. Liver Ndufs4 deletion causes a metabolic shift from fatty acid oxidation to glycolysis, accumulating fatty acids and lactate (FA/LAC) in circulation. FA/LAC further activates Ndufs4−/− macrophages via ROS induction, and diminishes osteoclast lineage commitment in Ndufs4−/− progenitors; both inflammation and osteopetrosis in Ndufs4−/− mice are attenuated by TLR4/2 deletion. Together, these findings reveal mitochondrial CI as a critical rheostat of innate immunity and skeletal homeostasis. PMID:25130399
Robles, Brenda; Kuo, Tony
2017-01-01
Background Since 2010, federal and local agencies have invested broadly in a variety of nutrition-focused policy, systems and environmental change (PSE) initiatives in Los Angeles County (LAC). To date, little is known about whether the public supports such efforts. We address this gap in the literature by examining predictors of support for a variety of PSEs. Methods Voters residing in LAC (n=1007) were randomly selected to participate in a cross-sectional telephone survey commissioned by the LAC Department of Public Health. The survey asked questions about attitudes towards the obesity epidemic, nutrition knowledge and behaviours, public opinions about changing business practices/government policies related to nutrition, and sociodemographics. A factor analysis informed outcome variable selection (ie, type of PSEs). Multivariable regression analyses were performed to examine predictors of public support. Predictors in the regression models included (primary regressor) community economic hardship; (control variables) political affiliation, sex, age, race and income; and (independent variables) perceptions about obesity, perceived health and weight status, frequency reading nutrition labels, ease of finding healthy and unhealthy foods, and food consumption behaviours (ie, fruit and vegetables, non-diet soda, fast-food and sit-down restaurant meals). Results 3 types of PSE outcome variables were identified: promotional/incentivising, limiting/restrictive and business practices. Community economic hardship was not found to be a significant predictor of public support for any of the 3 PSE types. However, Republican party affiliation, being female and perceiving obesity as a serious health problem were. Conclusions These findings have implications for public health practice and community planning in local health jurisdictions. PMID:28087545
Hartenstein, K.; Sinha, P.; Mishra, A.; Schenkel, H.; Torok, I.; Mechler, B. M.
1997-01-01
A recessive semi-lethal mutation resulting from the insertion of a P-lacW transposon at the cytological position 23A on the polytene chromosomes of Drosophila melanogaster was found to affect the unfolding and expansion of the wings resulting in a loss of venation and a marked decrease in their size. Lethality was polyphasic with numerous animals dying during early larval development and displaying apparently collapsed tracheal trees. The gene was therefore designated as congested-like tracheae, or colt. The colt mutation resulted from the insertion of a P-lacW transposon within the coding region of a 1.4-kb transcript. Wild-type function was restored by inducing a precise excision of the P-lacW transposon, while a deletion of the colt locus, produced by imprecise excision of the P element, showed a phenotype similar to that of the original P insert. The colt gene consists of a single exon and encodes a protein of 306 amino acids made of three tandem repeats, each characterized by two predicted transmembrane segments and a loop domain. The COLT protein shares extensive homology with proteins in the mitochondrial carrier family and particularly with the DIF-1 protein of Caenorhabditis elegans, which has been shown to be maternally required for embryonic tissue differentiation. Our analysis revealed that zygotic colt function is dispensable for normal embryonic morphogenesis but is required for gas-filling of the tracheal system at hatching time of the embryo and for normal epithelial morphogenesis of the wings. PMID:9409834
Robles, Brenda; Kuo, Tony
2017-01-13
Since 2010, federal and local agencies have invested broadly in a variety of nutrition-focused policy, systems and environmental change (PSE) initiatives in Los Angeles County (LAC). To date, little is known about whether the public supports such efforts. We address this gap in the literature by examining predictors of support for a variety of PSEs. Voters residing in LAC (n=1007) were randomly selected to participate in a cross-sectional telephone survey commissioned by the LAC Department of Public Health. The survey asked questions about attitudes towards the obesity epidemic, nutrition knowledge and behaviours, public opinions about changing business practices/government policies related to nutrition, and sociodemographics. A factor analysis informed outcome variable selection (ie, type of PSEs). Multivariable regression analyses were performed to examine predictors of public support. Predictors in the regression models included (primary regressor) community economic hardship; (control variables) political affiliation, sex, age, race and income; and (independent variables) perceptions about obesity, perceived health and weight status, frequency reading nutrition labels, ease of finding healthy and unhealthy foods, and food consumption behaviours (ie, fruit and vegetables, non-diet soda, fast-food and sit-down restaurant meals). 3 types of PSE outcome variables were identified: promotional/incentivising, limiting/restrictive and business practices. Community economic hardship was not found to be a significant predictor of public support for any of the 3 PSE types. However, Republican party affiliation, being female and perceiving obesity as a serious health problem were. These findings have implications for public health practice and community planning in local health jurisdictions. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Floden, Lysbeth; Howerter, Amy; Matthews, Eva; Nichter, Mark; Cunningham, James K; Ritenbaugh, Cheryl; Gordon, Judith S; Muramoto, Myra L
2015-05-02
Complementary and alternative medicine (CAM) use has steadily increased globally over the past two decades and is increasingly playing a role in the healthcare system in the United States. CAM practice-based effectiveness research requires an understanding of the settings in which CAM practitioners provide services. This paper describes and quantifies practice environment characteristics for a cross-sectional sample of doctors of chiropractic (DCs), licensed acupuncturists (LAcs), and licensed massage therapists (LMTs) in the United States. Using a cross-sectional telephone survey of DCs (n = 32), LAcs (n = 70), and LMTs (n = 184) in the Tucson, AZ metropolitan area, we collected data about each location where practitioners work, as well as measures on practitioner and practice characteristics including: patient volume, number of locations where practitioners worked, CAM practitioner types working at each location, and business models of practice. The majority of practitioners reported having one practice location (93.8% of DCs, 80% of LAcs and 59.8% of LMTs) where they treat patients. Patient volume/week was related to practitioner type; DCs saw 83.13 (SD = 49.29) patients/week, LAcs saw 22.29 (SD = 16.88) patients/week, and LMTs saw 14.21 (SD =10.25) patients per week. Practitioners completed surveys for N = 388 practice locations. Many CAM practices were found to be multidisciplinary and/or have more than one practitioner: 9/35 (25.7%) chiropractic practices, 24/87 (27.6%) acupuncture practices, and 141/266 (53.0%) massage practices. Practice business models across CAM practitioner types were heterogeneous, e.g. sole proprietor, employee, partner, and independent contractor. CAM practices vary across and within disciplines in ways that can significantly impact design and implementation of practice-based research. CAM research and intervention programs need to be mindful of the heterogeneity of CAM practices in order to create appropriate interventions, study designs, and implementation plans.
Stannous Fluoride Effects on Gene Expression of Streptococcus mutans and Actinomyces viscosus.
Shi, Y; Li, R; White, D J; Biesbrock, A R
2018-02-01
A genome-wide transcriptional analysis was performed to elucidate the bacterial cellular response of Streptococcus mutans and Actinomyces viscosus to NaF and SnF 2 . The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of SnF 2 were predetermined before microarray study. Gene expression profiling microarray experiments were carried out in the absence (control) and presence (experimental) of 10 ppm and 100 ppm Sn 2+ (in the form of SnF 2 ) and fluoride controls for 10-min exposures (4 biological replicates/treatment). These Sn 2+ levels and treatment time were chosen because they have been shown to slow bacterial growth of S. mutans (10 ppm) and A. viscosus (100 ppm) without affecting cell viability. All data generated by microarray experiments were analyzed with bioinformatics tools by applying the following criteria: 1) a q value should be ≤0.05, and 2) an absolute fold change in transcript level should be ≥1.5. Microarray results showed SnF 2 significantly inhibited several genes encoding enzymes of the galactose pathway upon a 10-min exposure versus a negative control: lacA and lacB (A and B subunits of the galactose-6-P isomerase), lacC (tagatose-6-P kinase), lacD (tagatose-1,6-bP adolase), galK (galactokinase), galT (galactose-1-phosphate uridylyltransferase), and galE (UDP-glucose 4-epimerase). A gene fruK encoding fructose-1-phosphate kinase in the fructose pathway was also significantly inhibited. Several genes encoding fructose/mannose-specific enzyme IIABC components in the phosphotransferase system (PTS) were also downregulated, as was ldh encoding lactate dehydrogenase, a key enzyme involved in lactic acid synthesis. SnF 2 downregulated the transcription of most key enzyme genes involved in the galactose pathway and also suppressed several key genes involved in the PTS, which transports sugars into the cell in the first step of glycolysis.
Pharmacokinetics of intramuscular microparticle depot of valdecoxib in an experimental model.
Agnihotri, Sagar M; Vavia, Pradeep R
2009-09-01
We did a prospective study to investigate pharmacokinetics of a single intramuscularly (i.m.) administered Valdecoxib (VC) polymeric microparticles in New Zealand white rabbits. Poly[lac(glc-leu)] microparticles encapsulating a potent cyclooxygenase-2- selective inhibitor, VC, were prepared by emulsion and solvent evaporation technique and administered i.m. to rabbits for pharmacokinetic study. A single i.m. dose of drug-loaded poly[lac(glc-leu)] microparticles resulted in sustained therapeutic drug levels in the plasma for 49 days. The relative bioavailability was increased severalfold as compared with unencapsulated drug. Injectable poly[lac(glc-leu)] microparticles hold promise for increasing drug bioavailability and reducing dosing frequency for better management of rheumatoid arthritis.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Conditional-suicide containment system for bacteria which mineralize aromatics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Contreras, A.; Ramos, J.L.; Molin, S.
A model conditional-suicide system to control genetically engineered microorganisms able to degrade substituted benzoates is reported. The system is based on two elements. One element consists of a fusion between the promoter of the Pseudomonas putide TOL plasmid-encoded meta-cleavage pathway operon (P{sub m}) and the lacI gene encoding Lac repressor plus sylS, coding for the positive regulator of P{sub m}. The other element carries a fusion between the P{sub tac} promoter and the gef gene, which encodes a killing function. In the absence of effectors, expression of the P{sub tac}::gef cassette is no longer prevented and a high rate ofmore » cell killing is observed. The substitution of XylS for XylSthr45, a mutant regulator with altered effector specificity and increased affinity for benzoates, allows the control of populations able to degrade a wider range of benzoates at micromolar substrate concentrations. Given the wide effector specificity of the key regulators, the wild-type and mutant ZylS proteins, the system should allow the control of populations able to metabolize benzoate; methyl-, dimethyl-, chloro-, dichloro-, ethyl-, and methoxybenzoates; salicylate; and methyl- and chlorosalicylates. A small population of genetically engineered microorganisms became Gef resistant; however, the mechanism of such survival remains unknown.« less
[Toward a model of communications in public health in Latin America and the Caribbean].
Macías-Chapula, César A
2005-12-01
So far, there have been no bibliometric or scientometric studies that make it possible to examine, with quantitative, retrospective, and comprehensive criteria, the scientific output on public health in Latin America and the Caribbean (LAC). Further, the weakness of the existing information systems makes it impossible to examine the relevance, quality, and impact of this scientific output, with a view to evaluating it in terms of societal needs and existing patterns of scientific communication. This article presents the results of a bibliographic analysis of the scientific output in the area of public health in Latin America and the Caribbean. The ultimate goal of the analysis is to build a model of scientific communication in this field, to help researchers, managers, and others working in the area of public health to make decisions and choose actions to take. We conducted a literature review in order to identify the distribution of publications on public health that were produced by LAC researchers and published in each of the LAC countries from 1980 through 2002. The review used the Literatura Latino-Americana e do Caribe em Saúde Pública (LILACS-SP) (Latin American and Caribbean Literature on Public Health) bibliographic database. That database is operated by the Latin American and Caribbean Center on Health Sciences Information (BIREME), which is in São Paulo, Brazil. We processed the LILACS-SP data using two software packages, Microsoft Excel and Bibexcel, to obtain indicators of the scientific output, the type of document, the language, the number of authors for each publication, the thematic content, and the participating institutions. For the 1980-2002 period, there were 97,605 publications registered, from a total of 37 LAC countries. For the analysis presented in this article, we limited the sample to the 8 countries in Latin America and the Caribbean that had at least 3,000 documents each registered in the LILACS-SP database over the 1980-2002 study period. In descending order of the number of publications registered, the 8 nations were: Argentina, Brazil, Chile, Colombia, Cuba, Mexico, Peru, and Venezuela. Those 8 countries were responsible for 83,054 publications (85.10% of the total of 97,605 registered documents produced by the 37 LAC countries). Of those 83,054 publications from the 8 countries, 56,253 of them (67.73%) were articles published in scientific journals and 24,488 were monographs (29.48%). The proportion of works produced by two or more coauthors was relatively high (56.48%). The 56,253 articles appeared in a total of 929 different journals. Of the 929 journals, 91 of them published at least 150 articles over the study period. In descending order, LAC journals with the largest number of articles on public health were: Revista de Saúde Pública (Brazil); Cadernos de Saúde Pública (Brazil); Revista Médica de Chile; Archivos Latinoamericanos de Nutrición (Venezuela); and Salud Pública de México. The 91 journals that published at least 150 articles represented 29 different specialties. The most common of the specialties for the 91 journals were general medicine (18 journals) and pediatrics (10 journals). In descending order, the populations that the publications dealt with primarily were human beings in general, females, males, and adults; and, in descending order, a relatively small number of publications dealt with pregnant women and middle-aged or elderly persons. The topics most often covered in the publications were risk factors, health policy, and primary health care, as well as family doctors in the case of Cuba. This research produced a preliminary model of communications in public health in LAC countries that will hopefully help lay the groundwork for further research to develop a model of scientific communication in LAC nations.
Portage Lake: Memories of an Ojibwe Childhood.
ERIC Educational Resources Information Center
Kegg, Maude; Nichols, John D., Ed.
Anishinaabe (Ojibwe or Chippewa) elder Maude Kegg relates stories of her childhood nearly 90 years ago on the Mille Lacs Reservation in central Minnesota. The Nonremoval Mille Lacs Band of Chippewa to which she belonged accommodated their way of life to altered land and new neighbors, but retained their rich religious and social life. Traditional…
The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering
NASA Technical Reports Server (NTRS)
Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.
1993-01-01
Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.
Teaching the Big Ideas of Biology with Operon Models
ERIC Educational Resources Information Center
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
40 CFR 272.951 - Louisiana State-Administered Program: Final Authorization.
Code of Federal Regulations, 2014 CFR
2014-07-01
..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164-0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...
40 CFR 272.951 - Louisiana state-administered Program: Final authorization.
Code of Federal Regulations, 2013 CFR
2013-07-01
..., Baton Rouge, LA 70804-9095; Phone number: (225) 342-5015; Web site: http://doa.louisiana.gov/osr/lac/lac.... Paul, Minnesota 55164 0526; Phone: 1-800-328-4880; Web site: http://west.thomson.com. You may inspect a... National Archives and Records Administration (NARA). For information on the availability of this material...
76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-20
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...
ERIC Educational Resources Information Center
Hirt, Joan B.; Schneiter, Steven R.; Amelink, Catherine T.
2005-01-01
This study examined the nature of relationships and rewards for student affairs administrators at liberal arts colleges (LACs). Forty-three student affairs administrators from LACs participated in five focus groups. Results indicate that administrators tend to spend most of their time with students, followed try other student affairs…
Ramisetti, Nageswara Rao; Kuntamukkala, Ramakrishna; Lakshetti, Sridhar; Sripadi, Prabhakar
2014-07-01
The current study dealt with the degradation behavior of lacosamide (LAC) under ICH prescribed stress conditions. LAC was found to be labile under acid and base hydrolytic stress conditions, while it was stable to neutral hydrolytic, oxidative, photolytic and thermal stress. In total, seven degradation products (DPs) were formed, which were separated on a C18 column using a stability-indicating method. LC-MS analyses indicated that one of the DPs had the same molecular mass as that of the drug. Structural characterization of DPs was carried out using ESI-Q-TOF-MS/MS technique. The degradation pathways and mechanisms of degradation of the drug were delineated by carrying out the degradation in different co-solvents viz. methanol, deuterated methanol, ethanol, 1-propanol and acetonitrile. The developed LC method was validated for the determination of related substances and assay of LAC as per ICH guidelines. This study demonstrates a comprehensive approach of LAC degradation studies during its development phase. Copyright © 2014. Published by Elsevier B.V.
STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne
2014-09-20
The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less
NASA Astrophysics Data System (ADS)
Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.
2015-07-01
High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Y.L.; Garges, S.; Adhya, S.
1988-06-01
Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 canmore » activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.« less
New High-z BL Lacs Using the Photometric Method with Swift and SARA
NASA Astrophysics Data System (ADS)
Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.
2018-06-01
BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.
Kim, Seong-Youl; Wang, Teng-ke; Singh, Raman Deep; Wheatley, Christine L; Marks, David L; Pagano, Richard E
2009-09-01
Plasma membrane (PM) microdomains, including caveolae and other cholesterol-enriched subcompartments, are involved in the regulation of many cellular processes, including endocytosis, attachment and signaling. We recently reported that brief incubation of human skin fibroblasts with the synthetic glycosphingolipid, D-erythro-octanoyl-lactosylceramide (C8-D-e-LacCer), stimulates endocytosis via caveolae and induces the appearance of micron-size microdomains on the PM. To further understand the effects of C8-D-e-LacCer treatment on PM microdomains, we used a detergent-free method to isolate microdomain-enriched membranes from fibroblasts treated +/-C8-D-e-LacCer, and performed 2-DE and mass spectrophotometry to identify proteins that were altered in their distribution in microdomains. Several proteins were identified in the microdomain-enriched fractions, including lipid transfer proteins and proteins related to the functions of small GTPases. One protein, Rho-associated protein kinase 2 (ROCK2), was verified by Western blotting to occur in microdomain fractions and to increase in these fractions after D-e-LacCer treatment. Immunofluorescence revealed that ROCK2 exhibited an increased localization at or near the PM in C8-D-e-LacCer-treated cells. In contrast, ROCK2 distribution in microdomains was decreased by treatment of cells with C8-L-threo-lactosylceramide, a glycosphingolipid with non-natural stereochemistry. This study identifies new microdomain-associated proteins and provides evidence that microdomains play a role in the regulation of the Rho/ROCK signaling pathway.
Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.
Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John
2012-07-01
Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.
Almonte, Maribel; Albero, Ginesa; Molano, Mónica; Carcamo, César; García, Patricia J; Pérez, Gonzalo
2008-08-19
The incidence of cervical cancer in Latin America and the Caribbean (LAC) is among the highest in the world. Because there are major demographic shifts happening in LAC countries (population growth, urbanization and ageing) cervical cancer incidence and mortality will likely continue to be a significant public health problem. Overall human papillomavirus (HPV) prevalence in the LAC general population has been found to be 2-fold higher than the average worldwide prevalence. The large HPV and cancer burden may be explained by the highly prevalent HPV variants of HPV types -16 and 18, which have an increased oncogenic potential. Given the major mode of transmission of genital HPV is sexual, certain, patterns of sexual behaviour (early age at first sexual intercourse, number of sexual partners and sexual behaviour of the partner) are associated with an increased risk of HPV genital acquisition. Although HPV infection is necessary for carcinogenesis, certain co-factors (high parity, long term use of oral contraceptives, smoking and co-infection with the human immunodeficiency virus (HIV)) help in the progression from infection to cancer. Many studies that have contributed to this evidence have been carried out in LAC and are reviewed and summarised in this article. Since HPV vaccines will likely take years to implement, and many more years to show impact on disease, cervical cancer screening programmes remain as the key intervention to control disease in LAC in the years to come.
Laparoscopic resection of transverse colon cancer at splenic flexure: technical aspects and results.
Okuda, Junji; Yamamoto, Masashi; Tanaka, Keitaro; Masubuchi, Shinsuke; Uchiyama, Kazuhisa
2016-03-01
Laparoscopic resection of transverse colon cancer at splenic flexure is technical demanding and its efficacy remains controversial. The aim of this study was to investigate its technical aspects such as pitfalls and overcoming them, and to demonstrate the short-term and oncologic long-term outcomes. To overcome the difficulty in laparoscopic resection of transverse colon cancer at splenic flexure, we recognized the following technical tips as essential. First of all, we have to precisely identify major vessels variations feeding tumor. Secondary, anatomical dissection of mesocolon through medial approach is indispensible. Third, safe takedown of splenic flexure to fully mobilization of left hemicolon is mandatory. This cohort study analyzed 95 patients with stage II (43) and III (52) underwent resection of transverse colon cancer at splenic flexure. 61 laparoscopic surgeries (LAC) and 34 conventional open surgeries (OC) from December 1996 to December 2009 were evaluated. Short-term and oncologic long-term outcomes were recorded. Operative time was longer in LAC. However, blood loss was less, recovery of bowel function and hospital stay were shorter in LAC. There was no conversion in LAC and no significant difference in the postoperative complications. Regarding oncologic long-term outcomes, there were no significant differences between OC and LAC. Laparoscopic resection of transverse colon cancer at splenic flexure resulted in acceptable short-term and oncologic long-term outcomes. Once technical tips acquired, laparoscopic resection of transverse colon cancer at splenic flexure could be feasible as minimally invasive surgery.
Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.
Cowing, D W; Kenyon, C
1992-10-01
mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.
Active galaxies observed during the Extreme Ultraviolet Explorer all-sky survey
NASA Technical Reports Server (NTRS)
Marshall, H. L.; Fruscione, A.; Carone, T. E.
1995-01-01
We present observations of active galactic nuclei (AGNs) obtained with the Extreme Ultraviolet Explorer (EUVE) during the all-sky survey. A total of 13 sources were detected at a significance of 2.5 sigma or better: seven Seyfert galaxies, five BL Lac objects, and one quasar. The fraction of BL Lac objects is higher in our sample than in hard X-ray surveys but is consistent with the soft X-ray Einstein Slew Survey, indicating that the main reason for the large number of BL Lac objects in the extreme ulktraviolet (EUV) and soft X-ray bands is their steeper X-ray spectra. We show that the number of AGNs observed in both the EUVE and ROSAT Wide Field Camera surveys can readily be explained by modelling the EUV spectra with a simple power law in the case of BL Lac objects and with an additional EUV excess in the case of Seyferts and quasars. Allowing for cold matter absorption in Seyfert galaxy hosts drive up the inferred average continuum slope to 2.0 +/- 0.5 (at 90% confidence), compared to a slope of 1.0 usually found from soft X-ray data. If Seyfert galaxies without EUV excesses form a significant fraction of the population, then the average spectrum of those with bumps should be even steeper. We place a conservative limit on neutral gas in BL Lac objects: N(sub H) less than 10(exp 20)/sq cm.
Baezconde-Garbanati, Lourdes; Lienemann, Brianna A; Robles, Marisela; Johnson, Ethel; Sanchez, Kathleen; Singhal, Rita; Steinberg, Jane; Jaque, Jenny M; Pentz, Mary Ann; Gruber, Stephen
2017-09-05
Research shows that vaccination against human papillomavirus (HPV) infection is one of the most effective methods for reducing risk for cervical cancer; it also protects against other HPV-related cancers. Controversies exist regarding HPV vaccination in several communities; which may in part explain why although rates of HPV vaccination are increasing nationwide, Los Angeles County (LAC) data show that many adolescents are still not vaccinated. These adolescents remain at high-risk for infection. Using community-based participatory principles, we conducted an environmental scan that included a literature review, the development of a community advisory board, community feedback from HPV community meetings, and interviews with stakeholders to understand attitudes toward HPV vaccination and their impact in follow through with HPV vaccines. Twenty-eight key stakeholders participated in our coalition comprised of community organizations and clinics with strong ties to the local community. This is the only coalition dedicated exclusively to improving HPV vaccine uptake in LAC. Of these, twenty-one participated in an environmental scan via qualitative interviews about HPV vaccination programs, service delivery priorities, and proposed steps to increase HPV vaccination uptake in LAC. The environmental scan revealed targets for future efforts, barriers to HPV uptake, and next steps for improving local HPV vaccination uptake rates. The environmental scan also identified local HPV vaccination interventions and resources. Although LAC has developed important efforts for vaccination, some interventions are no longer being implemented due to lack of funds; others have not been evaluated with sufficient outcome data. The risk for cervical and other HPV-related cancers could be greatly reduced in LAC if a multilevel, multicultural, and multilingual approach is taken to better understand rates of HPV vaccination uptake, particularly among racial/ethnic minorities and LGBTQ youth. Our environmental scan provides guidance on attitudes toward vaccination, and how best to address the needs of LAC families and providers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Lukens, John R.; Cruise, Michael W.; Lassen, Matthew G.; Hahn, Young S.
2010-01-01
The impaired function of CD8+ T cells is characteristic of hepatitis C virus (HCV) persistent infection. HCV core protein has been reported to inhibit CD8+ T cell responses. To determine the mechanism of the HCV core in suppressing Ag-specific CD8+ T cell responses, we generated a transgenic mouse, core(+) mice, where the expression of core protein is directed to the liver using the albumin promoter. Using a recombinant adenovirus to deliver Ag, we demonstrated that core(+) mice failed to clear adenovirus-LacZ (Ad-LacZ) infection in the liver. The effector function of LacZ-specific CD8+ T cells was particularly impaired in the livers of core(+) mice, with suppression of IFN-γ, TNF-α, and granzyme B production by CD8+ T cells. In addition, the impaired CD8+ T cell responses in core(+) mice were accompanied by the enhanced expression of the inhibitory receptor programmed death-1 (PD-1) by LacZ-specific CD8+ T cells and its ligand B7-H1 on liver dendritic cells following Ad-LacZ infection. Importantly, blockade of the PD-1/B7-H1 inhibitory pathway (using a B7-H1 blocking antibody) in core(+) mice enhanced effector function of CD8+ T cells and cleared Ad-LacZ-infection as compared with that in mice treated with control Ab. This suggests that the regulation of the PD-1/B7-H1 inhibitory pathway is crucial for HCV core-mediated impaired T cell responses and viral persistence in the liver. This also suggests that manipulation of the PD-1/B7-H1 pathway may be a potential immunotherapy to enhance effector T cell responses during persistent HCV infection. PMID:18354211
Epidemiology in Latin America and the Caribbean: current situation and challenges
Barreto, Sandhi M; Miranda, Jaime J; Figueroa, J Peter; Schmidt, Maria Inês; Munoz, Sergio; Kuri-Morales, P Pablo; Silva, Jarbas B
2012-01-01
Background This article analyses the epidemiological research developments in Latin America and the Caribbean (LAC). It integrates the series commissioned by the International Epidemiological Association to all WHO Regions to identify global opportunities to promote the development of epidemiology. Methods Health situations of the regions were analysed based on published data on selected mortality, morbidity and risk factors. Epidemiological publication output by country was estimated by Medline bibliometrics. Internet and literature searches and data provided by key informants were used to describe perspectives on epidemiological training, research and funding. Findings Despite important advances in recent decades, LAC remains the world's most unequal region. In 2010, 10% of the LAC's people still lived in conditions of multidimensional poverty, with huge variation among countries. The region has experienced fast and complex epidemiological changes in past decades, combining increasing rates of non-communicable diseases and injuries, and keeping uncontrolled many existing endemic and emerging diseases. Overall, epidemiological publications per year increased from 160 articles between 1961 and 1970 to 2492 between 2001 and 2010. The increase in papers per million inhabitants in the past three decades varied from 57% in Panama to 1339% in Paraguay. Universities are the main epidemiological training providers. There are at least 34 universities and other institutions in the region that offer postgraduate programmes at the master’s and doctoral levels in epidemiology or public health. Most LAC countries rely largely on external funding and donors to initiate and sustain long-term research efforts. Despite the limited resources, the critical mass of LAC researchers has produced significant scientific contributions. Future needs The health research panorama of the region shows enormous regional discrepancies, but great prospects. Improving research and human resources capacity in the region will require establishing research partnerships within and outside the region, between rich and poor countries, promoting collaborations between LAC research institutions and universities to boost postgraduate programmes and aligning research investments and outputs with the current burden of disease. PMID:22407860
Epidemiology in Latin America and the Caribbean: current situation and challenges.
Barreto, Sandhi M; Miranda, Jaime J; Figueroa, J Peter; Schmidt, Maria Inês; Munoz, Sergio; Kuri-Morales, P Pablo; Silva, Jarbas B
2012-04-01
This article analyses the epidemiological research developments in Latin America and the Caribbean (LAC). It integrates the series commissioned by the International Epidemiological Association to all WHO Regions to identify global opportunities to promote the development of epidemiology. Health situations of the regions were analysed based on published data on selected mortality, morbidity and risk factors. Epidemiological publication output by country was estimated by Medline bibliometrics. Internet and literature searches and data provided by key informants were used to describe perspectives on epidemiological training, research and funding. Despite important advances in recent decades, LAC remains the world's most unequal region. In 2010, 10% of the LAC's people still lived in conditions of multidimensional poverty, with huge variation among countries. The region has experienced fast and complex epidemiological changes in past decades, combining increasing rates of non-communicable diseases and injuries, and keeping uncontrolled many existing endemic and emerging diseases. Overall, epidemiological publications per year increased from 160 articles between 1961 and 1970 to 2492 between 2001 and 2010. The increase in papers per million inhabitants in the past three decades varied from 57% in Panama to 1339% in Paraguay. Universities are the main epidemiological training providers. There are at least 34 universities and other institutions in the region that offer postgraduate programmes at the master's and doctoral levels in epidemiology or public health. Most LAC countries rely largely on external funding and donors to initiate and sustain long-term research efforts. Despite the limited resources, the critical mass of LAC researchers has produced significant scientific contributions. FUTURE NEEDS: The health research panorama of the region shows enormous regional discrepancies, but great prospects. Improving research and human resources capacity in the region will require establishing research partnerships within and outside the region, between rich and poor countries, promoting collaborations between LAC research institutions and universities to boost postgraduate programmes and aligning research investments and outputs with the current burden of disease.
Allay, E; Veigl, M; Gerson, S L
1999-06-24
While it is well known that MNU induces thymic lymphomas in the mouse, it remains unclear which pre-mutagenic lesions are responsible for lymphomagenic transformation. One lesion thought to play a critical role is O6methylguanine[O6mG]which initiates G: C to A:T transition mutations in K-ras and other oncogenes. O6alkylguanine-DNA alkyltransferase (AGT), encoded by the methylguanine methyltransferase gene [MGMT], removes the methyl group thereby preventing the mutation from occurring. When overexpressed in the thymus, MGMT protects mice from MNU-induced thymic lymphomas. To determine whether MGMT overexpression reduced G: C to A: T mutation frequency after MNU, Big Blue lacI and MGMT+/Big Blue mice were treated with MNU and analysed for mutations in the lacI and K-ras genes. The incidence of MNU-induced lymphomas was 84% in Big Blue lacI mice compared to 14% in MGMT+Big Blue lacI mice. Sixty-two per cent of the lymphomas had a GGT to GAT activating mutation in codon 12 of K-ras consistent with O6mG adduct-mediated point mutagenesis. LacI mutation frequency in thymus of MNU treated Big Blue mice was 45-fold above background whereas it was 11-fold above background in MNU treated MGMT+/Big Blue mice. Most lacI mutations were G:C to A:T transitions, implicating O6mG even in the MGMT+mice. No mutations were attributable to chromosomal aberrations or rearrangements. Thus, O6mG adducts account for the carcinogenic effect of MNU and MGMT overexpression is selectively able to reduce O6methylguanine adducts below a carcinogenic threshold. Other adducts are mutagenic but appear to contribute much less to malignant transformation or oncogene activation.
Kupfer, Tom; Lehmann, Joerg; Butler, Duncan J; Ramanathan, Ganesan; Bailey, Tracy E; Franich, Rick D
2017-11-01
This study investigates a large-area plane-parallel ionization chamber (LAC) for measurements of dose-area product in water (DAP w ) in megavoltage (MV) photon fields. Uniformity of electrode separation of the LAC (PTW34070 Bragg Peak Chamber, sensitive volume diameter: 8.16 cm) was measured using high-resolution microCT. Signal dependence on angle α of beam incidence for square 6 MV fields of side length s = 20 cm and 1 cm was measured in air. Polarity and recombination effects were characterized in 6, 10, and 18 MV photons fields. To assess the lateral setup tolerance, scanned LAC profiles of a 1 × 1 cm 2 field were acquired. A 6 MV calibration coefficient, N D ,w, LAC , was determined in a field collimated by a 5 cm diameter stereotactic cone with known DAP w . Additional calibrations in 10 × 10 cm 2 fields at 6, 10, and 18 MV were performed. Electrode separation is uniform and agrees with specifications. Volume-averaging leads to a signal increase proportional to ~1/cos(α) in small fields. Correction factors for polarity and recombination range between 0.9986 to 0.9996 and 1.0007 to 1.0024, respectively. Off-axis displacement by up to 0.5 cm did not change the measured signal in a 1 × 1 cm 2 field. N D ,w, LAC was 163.7 mGy cm -2 nC -1 and differs by +3.0% from the coefficient derived in the 10 × 10 cm 2 6 MV field. Response in 10 and 18 MV fields increased by 1.0% and 2.7% compared to 6 MV. The LAC requires only small correction factors for DAP w measurements and shows little energy dependence. Lateral setup errors of 0.5 cm are tolerated in 1 × 1 cm 2 fields, but beam incidence must be kept as close to normal as possible. Calibration in 10 × 10 fields is not recommended because of the LAC's over-response. The accuracy of relative point-dose measurements in the field's periphery is an important limiting factor for the accuracy of DAP w measurements. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.
Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.
Narang, Atul; Pilyugin, Sergei S
2008-05-01
The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that is proportional to e. These results imply that the lac operon is much more prone to bistability if the medium contains carbon sources that cannot be metabolized by the lac enzymes, e.g., succinate during growth on TMG/succinate and glucose during growth on lactose+glucose. We discuss the experimental data in the light of these results.
Properties of optically selected BL Lacertae candidates from the SDSS
NASA Astrophysics Data System (ADS)
Kügler, S. D.; Nilsson, K.; Heidt, J.; Esser, J.; Schultz, T.
2014-09-01
Context. Deep optical surveys open the avenue for finding large numbers of BL Lac objects that are hard to identify because they lack the unique properties classifying them as such. While radio or X-ray surveys typically reveal dozens of sources, recent compilations based on optical criteria alone have increased the number of BL Lac candidates considerably. However, these compilations are subject to biases and may contain a substantial number of contaminating sources. Aims: In this paper we extend our analysis of 182 optically selected BL Lac object candidates from the SDSS with respect to an earlier study. The main goal is to determine the number of bona fide BL Lac objects in this sample. Methods: We examine their variability characteristics, determine their broad-band radio-UV spectral energy distributions (SEDs), and search for the presence of a host galaxy. In addition we present new optical spectra for 27 targets with improved signal-to-noise ratio with respect to the SDSS spectra. Results: At least 59% of our targets have shown variability between SDSS DR2 and our observations by more than 0.1-0.27 mag depending on the telescope used. A host galaxy was detected in 36% of our targets. The host galaxy type and luminosities are consistent with earlier studies of BL Lac host galaxies. Simple fits to broad-band SEDs for 104 targets of our sample derived synchrotron peak frequencies between 13.5 ≤ log 10(νpeak) ≤ 16 with a peak at log 10 ~ 14.5. Our new optical spectra do not reveal any new redshift for any of our objects. Thus the sample contains a large number of bona fide BL Lac objects and seems to contain a substantial fraction of intermediate-frequency peaked BL Lacs. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory under proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Canarias.Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias.
Mellor, J R; Wisden, W; Randall, A D
2000-07-10
Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden, W., 1997. Ligand-gated ion channel partnerships: GABA(A) receptor alpha(6) subunit inactivation inhibits delta subunit expression. Journal of Neuroscience 17, 1350-1362).
Harder, H; Khol-Parisini, A; Metzler-Zebeli, B U; Klevenhusen, F; Zebeli, Q
2015-11-01
Recent data indicate positive effects of treating grain with citric (CAc) or lactic acid (LAc) on the hydrolysis of phytate phosphorus (P) and fermentation products of the grain. This study used a semicontinuous rumen simulation technique to evaluate the effects of processing of barley with 50.25 g/L (wt/vol) CAc or 76.25 g/L LAc on microbial composition, metabolic fermentation profile, and nutrient degradation at low or high dietary P supply. The low P diet [3.1g of P per kg of dry matter (DM) of dietary P sources only] was not supplemented with inorganic P, whereas the high P diet was supplemented with 0.5 g of inorganic P per kg of DM through mineral premix and 870 mg of inorganic P/d per incubation fermenter via artificial saliva. Target microbes were determined using quantitative PCR. Data showed depression of total bacteria but not of total protozoa or short-chain fatty acid (SCFA) concentration with the low P diet. In addition, the low P diet lowered the relative abundance of Ruminococcus albus and decreased neutral detergent fiber (NDF) degradation and acetate proportion, but increased the abundance of several predominantly noncellulolytic bacterial species and anaerobic fungi. Treatment of grain with LAc increased the abundance of total bacteria in the low P diet only, and this effect was associated with a greater concentration of SCFA in the ruminal fluid. Interestingly, in the low P diet, CAc treatment of barley increased the most prevalent bacterial group, the genus Prevotella, in ruminal fluid and increased NDF degradation to the same extent as did inorganic P supplementation in the high P diet. Treatment with either CAc or LAc lowered the abundance of Megasphaera elsdenii but only in the low P diet. On the other hand, CAc treatment increased the proportion of acetate in the low P diet, whereas LAc treatment decreased this variable at both dietary P levels. The propionate proportion was significantly increased by LAc at both P levels, whereas butyrate increased only with the low P diet. Treatments with CAc or LAc reduced the degradation of CP and ammonia concentration compared with the control diet at both P levels. In conclusion, the beneficial effects of CAc and LAc treatment on specific ruminal microbes, fermentation profile, and fiber degradation in the low P diet suggest the potential for the treatment to compensate for the lack of inorganic P supplementation in vitro. Further research is warranted to determine the extent to which the treatment can alleviate the shortage of inorganic P supplementation under in vivo conditions. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing
2017-09-18
Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.
LUNSORT list of lunar orbiter data by LAC area
NASA Technical Reports Server (NTRS)
Hixon, S.
1976-01-01
Lunar orbiter (missions 1-5) photographic data are listed sequentially according to the number (1 to 147) LAC (Lunar Aeronautical Chart) areas by use of a computer program called LUNSORT. This listing, as well as a similar one from Apollo would simplify the task of identifying images of a given Lunar area. Instructions and sample case are included.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-23
... Application for Expansion; Mercury Marine (Marine Propulsion Products), Fond du Lac and Oshkosh, WI An... of FTZ 41, on behalf of Mercury Marine, operator of Subzone 41H at Mercury Marine's marine propulsion... manufacturing of marine propulsion products at Mercury Marine's facilities located in Fond du Lac and Oshkosh...
Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis
USDA-ARS?s Scientific Manuscript database
As the outermost layer on aerial tissues of the primary plant body, the cuticle plays important roles in plant development and physiology. The major components of the cuticle are cutin and cuticular wax, both of which are composed primarily of fatty acid derivatives synthesized in the epidermal cell...
Neato Mosquito: An Elementary Curriculum Guide. 2nd Edition.
ERIC Educational Resources Information Center
Nasci, Roger S.; Herrington, James E.
This curriculum guide was designed with the purpose of developing public awareness of LaCrosse (LAC) encephalitis, which is a mosquito transmitted disease. LAC cases have been increasing in large numbers in the Upper Midwest and Great Lakes regions during recent years. This disease primarily affects children under the age of 15, and this guide…
The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.
ERIC Educational Resources Information Center
Lindamood, Charles; And Others
The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…
Biorecognition of Escherichia coli K88 adhesin for glycated porcine albumin.
Sarabia-Sainz, Andre-i; Ramos-Clamont, Gabriela; Candia-Plata, Ma María del Carmen; Vázquez-Moreno, Luz
2009-03-01
Escherichia coli (E. coli) that expresses galactose-reactive lectins, like K88 adhesin, causes high mortality among piglets. Carbohydrates that compete for adhesion could serve as an alternative for disease prevention. Porcine serum albumin (PSA) was modified by non-enzymatic glycation with lactose to produce PSA-Lac or PSA-Glc beta (1-4) Gal, as confirmed by reduction of available free amino groups, increased molecular mass and by Ricinus communis lectin recognition. E. coli K88 binds to PSA-Lac treatments containing three and four lactoses, respectively. In addition, PSA-Lac partially inhibited K88 strain adherence to mucins. These results suggest that neoglycoconjugates obtained by non-enzymatic glycation of proteins may serve in the prophylaxis of piglets' diarrhea.
Black carbon is a term that is commonly used to describe strongly light absorbing carbon (LAC), which is thought to play a significant role in global climate change through direct absorption of light, interaction with clouds, and by reducing the reflectivity of snow and ice. BC ...
Progress in gene targeting and gene therapy for retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farrar, G.J.; Humphries, M.M.; Erven, A.
1994-09-01
Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less
Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat
2014-01-01
Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727
Dash, Michael B; Tononi, Giulio; Cirelli, Chiara
2012-07-01
It is well established that brain metabolism is higher during wake and rapid eye movement (REM) sleep than in nonrapid eye movement (NREM) sleep. Most of the brain's energy is used to maintain neuronal firing and glutamatergic transmission. Recent evidence shows that cortical firing rates, extracellular glutamate levels, and markers of excitatory synaptic strength increase with time spent awake and decline throughout NREM sleep. These data imply that the metabolic cost of each behavioral state is not fixed but may reflect sleep-wake history, a possibility that is investigated in the current report. Chronic (4d) electroencephalographic (EEG) recordings in the rat cerebral cortex were coupled with fixed-potential amperometry to monitor the extracellular concentration of oxygen ([oxy]) and lactate ([lac]) on a second-by-second basis across the spontaneous sleep-wake cycle and in response to sleep deprivation. Basic sleep research laboratory. Wistar Kyoto (WKY) adult male rats. N/A. Within 30-60 sec [lac] and [oxy] progressively increased during wake and REM sleep and declined during NREM sleep (n = 10 rats/metabolite), but with several differences. [Oxy], but not [lac], increased more during wake with high motor activity and/or elevated EEG high-frequency power. Meanwhile, only the NREM decline of [lac] reflected sleep pressure as measured by slow-wave activity, mirroring previous results for cortical glutamate. The observed state-dependent changes in cortical [lac] and [oxy] are consistent with higher brain metabolism during waking and REM sleep in comparison with NREM sleep. Moreover, these data suggest that glycolytic activity, most likely through its link with glutamatergic transmission, reflects sleep homeostasis.
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
γ-Ray And Parsec-Scale Jet Properties Of A Complete Sample Of Blazars From The Mojave Program
Lister, M. L.
2011-11-02
We investigate the Fermi LAT -ray and 15 GHz VLBA radio properties of a joint -ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -30° during this period, and thus probes the full range of -ray loudness ( -ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders ofmagnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. Themore » BL Lac objects, however, display a linear correlation of increasing -ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the -ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - -ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.« less
Pastrana, Tania; De Lima, Liliana; Eisenchlas, Jorge; Wenk, Roberto
2012-03-01
Research in palliative care has increased significantly in the last decade, while the vast majority of the global disease burden occurs in developing countries. To explore the palliative care research activity in Latin America and the Caribbean (LAC) and its visibility in the international palliative care literature, with a special focus on research studies. A bibliometric analysis was conducted in MEDLINE(®), Embase(®), PsycINFO(®), and CINAHL(®). Inclusion criteria were: (1) articles published in peer-reviewed scientific journals; (2) main subject was palliative care; (3) research study; (4) the first author or coauthors was based in LAC; and/or (5) the data collected derived from LAC. One hundred six articles from 10 countries were identified in the literature research. The first publication dates from 1989 and was a qualitative study in Brazil. This study shows a modest contribution of publications from LAC. However, the volume of publications within the region is distributed unequally, reflecting the heterogeneity of the region: Brazil published more than half of the articles, while 35 countries have no publications. Most of the studies were quantitative research, predominantly cross-sectional studies. Qualitative studies often used interviews. Health care service was the most researched issue. Seventy percent of studies were carried out in institutions. Palliative care research should have a place in LAC. The development of a regional research agenda tailored to the needs and features of the region considering the health care structure and local resources available is indispensable.
Gamma-Ray and Parsec-Scale Jet Properties of a Complete Sample of Blazars from the MOJAVE Program
NASA Technical Reports Server (NTRS)
Lister, M.L.; Aller, M.; Aller, H.; Hovatta, T.; Kellermann, K. I.; Kovalev, Y. Y.; Meyer, E. T.; Pushkarev, A. B.; Ros, E.; Ackermann, M.;
2011-01-01
We investigate the Fermi LAT gamma-ray and 15 GHz VLBA radio properties of a joint gamma-ray- and radio-selected sample of AGNs obtained during the first 11 months of the Fermi mission (2008 Aug 4 - 2009 Jul 5). Our sample contains the brightest 173 AGNs in these bands above declination -300 during this period, and thus probes the full range of gamma-ray loudness (gamma-ray to radio band luminosity ratio) in the bright blazar population. The latter quantity spans at least four orders of magnitude, reflecting a wide range of spectral energy distribution (SED) parameters in the bright blazar population. The BL Lac objects, however, display a linear correlation of increasing gamma-ray loudness with synchrotron SED peak frequency, suggesting a universal SED shape for objects of this class. The synchrotron self-Compton model is favored for the gamma-ray emission in these BL Lacs over external seed photon models, since the latter predict a dependence of Compton dominance on Doppler factor that would destroy any observed synchrotron SED peak - gamma-ray loudness correlation. The high-synchrotron peaked (HSP) BL Lac objects are distinguished by lower than average radio core brightness temperatures, and none display large radio modulation indices or high linear core polarization levels. No equivalent trends are seen for the flat-spectrum radio quasars (FSRQ) in our sample. Given the association of such properties with relativistic beaming, we suggest that the HSP BL Lacs have generally lower Doppler factors than the lower-synchrotron peaked BL Lacs or FSRQs in our sample.
Institutional barriers and opportunities in application of the limits of acceptable change
George H. Stankey
1997-01-01
Although the Limits of Acceptable Change (LAC) process has been in use since the mid-1980âs and has contributed to improved wilderness management, significant barriers and challenges remain. Formal and informal institutional barriers are the principal constraint to more effective implementation. Although grounded in a traditional management-by-objectives model, the LAC...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-17
... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...
Defining fire and wilderness objectives: Applying limits of acceptable change
David N. Cole
1995-01-01
The Limits of Acceptable Change (LAC) planning process was developed to help define objectives for recreation management in wilderness. This process can be applied to fire in wilderness if its conceptual foundation is broadened. LAC would lead decision makers to identify a compromise between the goal of allowing fire to play its natural role in wilderness and various...
The limits of acceptable change process: modifications and clarifications
David N. Cole; Stephen F. McCool
1997-01-01
Limits of Acceptable Change (LAC) was originally formulated to deal with the issue of recreation carrying capacity in wilderness. Enthusiasm for the process has led to questions about its applicability to a broad range of natural resource issuesâboth within and outside of protected areas. This paper uses a generic version of the LAC process to identify situations where...
Whoever Would Have Thought Book Shopping Might Raise Eyebrows?
ERIC Educational Resources Information Center
Jud, Edie
2007-01-01
In this article, the author shares how she follows the policy developed by the Library Advisory Council (LAC) when she acquires new books for her school library. LAC is a group of fifty or so teaching librarians from all five New York City boroughs. They meet four times a year to help the Office of School Library Services focus on issues important…
Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.
Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J
1986-01-01
Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717
Gallegos-Tabanico, Amed; Sarabia-Sainz, Jose A; Sarabia-Sainz, H Manuel; Carrillo Torres, Roberto; Guzman-Partida, Ana M; Monfort, Gabriela Ramos-Clamont; Silva-Campa, Erika; Burgara-Estrella, Alexel J; Angulo-Molina, Aracely; Acosta-Elias, Mónica; Pedroza-Montero, Martín; Vazquez-Moreno, Luz
2017-01-01
The targeted drug delivery has been studied as one of the main methods in medicine to ensure successful treatments of diseases. Pharmaceutical sciences are using micro or nano carriers to obtain a controlled delivery of drugs, able to selectively interact with pathogens, cells or tissues. In this work, we modified bovine serum albumin (BSA) with lactose, obtaining a neoglycan (BSA-Lac). Subsequently, we synthesized glyconanoparticles (NPBSA-Lac) with the premise that it would be recognized by microbial galactose specific lectins. NPBSA-Lac were tested for bio-recognition with adhesins of E. coli K88 and Ricinus communis agglutinin I (RCA). Glycation of BSA with lactose was analyzed by electrophoresis, infrared spectroscopy and fluorescence. Approximately 41 lactoses per BSA molecule were estimated. Nanoparticles were obtained using water in oil emulsion method and spheroid morphology with a range size of 300-500 nm was observed. Specific recognition of NPBSA-Lac by RCA and E. coli K88 was displayed by aggregation of nanoparticles analyzed by dynamic light scattering and atomic force microscopy. The results indicate that the lactosylated nanovectors could be targeted at the E. coli K88 adhesin and potentially could be used as a transporter for an antibacterial drug.
Single-target regulators form a minor group of transcription factors in Escherichia coli K-12.
Shimada, Tomohiro; Ogasawara, Hiroshi; Ishihama, Akira
2018-05-04
The identification of regulatory targets of all TFs is critical for understanding the entire network of the genome regulation. The lac regulon of Escherichia coli K-12 W3110 is composed of the lacZYA operon and its repressor lacI gene, and has long been recognized as the seminal model of transcription regulation in bacteria with only one highly preferred target. After the Genomic SELEX screening in vitro of more than 200 transcription factors (TFs) from E. coli K-12, however, we found that most TFs regulate multiple target genes. With respect to the number of regulatory targets, a total of these 200 E. coli TFs form a hierarchy ranging from a single target to as many as 1000 targets. Here we focus a total of 13 single-target TFs, 9 known TFs (BetI, KdpE, LacI, MarR, NanR, RpiR, TorR, UlaR and UxuR) and 4 uncharacterized TFs (YagI, YbaO, YbiH and YeaM), altogether forming only a minor group of TFs in E. coli. These single-target TFs were classified into three groups based on their functional regulation.
Ip, H; D'Aoust, F; Begum, A A; Zhang, H; Smith, D L; Driscoll, B T; Charles, T C
2001-12-01
Bradyrhizobium japonicum mutants with altered nod gene induction characteristics were isolated by screening mutants for genistein-independent nod gene expression. Plasmid pZB32, carrying a nodY::lacZ transcriptional gene fusion, was introduced into B. japonicum cells that had been subjected to UV mutagenesis. Ten independent transformants producing a blue color on plates containing 5bromo-4chloro-3indolyl-beta-D-galactopyranoside but lacking genistein, indicative of constitutive expression of the nodY::lacZ reporter gene, were isolated. Beta-galactosidase activity assays revealed that while all of the 10 strains were sensitive to low concentrations of genistein, none exhibited truly constitutive nodY::lacZ expression in liquid culture. Soybean plants inoculated with three of the mutants were chlorotic and stunted, with shoot dry weights close to those of the uninoculated plants, indicating the absence of nitrogen fixation. Differences in the kinetics of nodY::lacZ expression and lipochitin oligosaccharide Nod signal production suggested that the strains carried different mutations. Some of these strains may be useful in mitigating the low root zone temperature-associated delay in soybean nodulation at the northern extent of soybean cultivation.
UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.
UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less
Single-target regulators form a minor group of transcription factors in Escherichia coli K-12
Shimada, Tomohiro; Ogasawara, Hiroshi; Ishihama, Akira
2018-01-01
Abstract The identification of regulatory targets of all TFs is critical for understanding the entire network of the genome regulation. The lac regulon of Escherichia coli K-12 W3110 is composed of the lacZYA operon and its repressor lacI gene, and has long been recognized as the seminal model of transcription regulation in bacteria with only one highly preferred target. After the Genomic SELEX screening in vitro of more than 200 transcription factors (TFs) from E. coli K-12, however, we found that most TFs regulate multiple target genes. With respect to the number of regulatory targets, a total of these 200 E. coli TFs form a hierarchy ranging from a single target to as many as 1000 targets. Here we focus a total of 13 single-target TFs, 9 known TFs (BetI, KdpE, LacI, MarR, NanR, RpiR, TorR, UlaR and UxuR) and 4 uncharacterized TFs (YagI, YbaO, YbiH and YeaM), altogether forming only a minor group of TFs in E. coli. These single-target TFs were classified into three groups based on their functional regulation. PMID:29529243
Rozen, Rima; Schwartz, Robert H.; Hilman, Bettina C.; Stanislovitis, Pat; Horn, Glenn T.; Klinger, Katherine; Daigneault, Jocelyne; De Braekeleer, Marc; Kerem, Bat-sheva; Tsui, Lap-Chee; Fujiwara, T. Mary; Morgan, Kenneth
1990-01-01
A 3-bp deletion (ΔF508) in the cystic fibrosis (CF) gene is the mutation on the majority of CF chromosomes. We studied 112 CF families from North American populations of French ancestry: French-Canadian families referred from hospitals in three cities in Quebec and from the Saguenay-Lac St. Jean region of northeastern Quebec and Acadian families living in Louisiana. ΔF508 was present on 71%, 55%, and 70% of the CF chromosomes from the major-urban Quebec, Saguenay-Lac St. Jean, and Louisiana Acadian families, respectively. A weighted estimate of the proportion of ΔF508 in the French-Canadian patient population of Quebec was 70%. We found that 95% of the CF chromosomes with ΔF508 had D7S23 haplotype B, the most frequent haplotype on CF chromosomes. In the Saguenay-Lac St. Jean families, 86% of the CF chromosomes without ΔF508 had the B haplotype, compared with 31% for the major-urban Quebec and Louisiana Acadian families. The incidence of CF in the Saguenay-Lac St. Jean population was 1/895 live-born infants. PMID:2220803
X-Ray Spectral Variability Signatures of Flares in BL Lac Objects
NASA Technical Reports Server (NTRS)
Boettcher, Markus; Chiang, James; White, Nicholas E. (Technical Monitor)
2002-01-01
We are presenting a detailed parameter study of the time-dependent electron injection and kinematics and the self-consistent radiation transport in jets of intermediate and low-frequency peaked BL Lac objects. Using a time-dependent, combined synchrotron-self-Compton and external-Compton jet model, we study the influence of variations of several essential model parameters, such as the electron injection compactness, the relative contribution of synchrotron to external soft photons to the soft photon compactness, the electron- injection spectral index, and the details of the time profiles of the electron injection episodes giving rise to flaring activity. In the analysis of our results, we focus on the expected X-ray spectral variability signatures in a region of parameter space particularly well suited to reproduce the broadband spectral energy distributions of intermediate and low-frequency peaked BL Lac objects. We demonstrate that SSC- and external-Compton dominated models for the gamma-ray emission from blazars are producing significantly different signatures in the X-ray variability, in particular in the soft X-ray light curves and the spectral hysteresis at soft X-ray energies, which can be used as a powerful diagnostic to unveil the nature of the high-energy emission from BL Lac objects.
Gene Expression of Lytic Endopeptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonads.
Tsfasman, Irina M; Lapteva, Yulia S; Krasovskaya, Ludmila A; Kudryakova, Irina V; Vasilyeva, Natalia V; Granovsky, Igor E; Stepnaya, Olga A
2015-01-01
Development of an efficient expression system for (especially secreted) bacterial lytic enzymes is a complicated task due to the specificity of their action. The substrate for such enzymes is peptidoglycan, the main structural component of bacterial cell walls. For this reason, expression of recombinant lytic proteins is often accompanied with lysis of the producing bacterium. This paper presents data on the construction of an inducible system for expression of the lytic peptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonas fluorescens Q2-87, which provides for the successful secretion of these proteins into the culture liquid. In this system, the endopeptidase gene under control of the T7lac promoter was integrated into the bacterial chromosome, as well as the Escherichia coli lactose operon repressor protein gene. The T7 pol gene under lac promoter control, which encodes the phage T7 RNA polymerase, is maintained in Pseudomonas cells on the plasmids. Media and cultivation conditions for the recombinant strains were selected to enable the production of AlpA and AlpB by a simple purification protocol. Production of recombinant lytic enzymes should contribute to the development of new-generation antimicrobial drugs whose application will not be accompanied by selection of resistant microorganisms. © 2015 S. Karger AG, Basel.
Detection of Protein Interactions in T3S Systems Using Yeast Two-Hybrid Analysis.
Nilles, Matthew L
2017-01-01
Two-hybrid systems, sometimes termed interaction traps, are genetic systems designed to find and analyze interactions between proteins. The most common systems are yeast based (commonly Saccharomyces cerevisae) and rely on the functional reconstitution of the GAL4 transcriptional activator. Reporter genes, such as the lacZ gene of Escherichia coli (encodes β-galactosidase), are placed under GAL4-dependent transcriptional control to provide quick and reliable detection of protein interactions. In this method the use of a yeast-based two-hybrid system is described to study protein interactions between components of type III secretion systems.
Komori, Hirofumi; Miyazaki, Kentaro; Higuchi, Yoshiki
2009-04-02
A multi-copper protein with two cupredoxin-like domains was identified from our in-house metagenomic database. The recombinant protein, mgLAC, contained four copper ions/subunits, oxidized various phenolic and non-phenolic substrates, and had spectroscopic properties similar to common laccases. X-ray structure analysis revealed a homotrimeric architecture for this enzyme, which resembles nitrite reductase (NIR). However, a difference in copper coordination was found at the domain interface. mgLAC contains a T2/T3 tri-nuclear copper cluster at this site, whereas a mononuclear T2 copper occupies this position in NIR. The trimer is thus an essential part of the architecture of two-domain multi-copper proteins, and mgLAC may be an evolutionary precursor of NIR.
A perspective of gene therapy in the glaucomas.
Kaufman, P L; Jia, W W; Tan, J; Chen, Z; Gabelt, B T; Booth, V; Tufaro, F; Cynader, M
1999-06-01
Gene therapy in the anterior and posterior segment tissues may have the potential to favorably influence aqueous hydrodynamics and retinal ganglion cell biology, thereby preventing, delaying, or minimizing glaucomatous damage to the optic nerve. We demonstrated the feasibility of using a herpes viral vector (ribonucleotide reductase defective HSV-1, hrR3) to deliver the lacZ reporter gene to living cat and rat eyes. Cats received injections into the anterior chamber and rats into the vitreous cavity. In cats, lacZ expression was detectable at 1 to 2 days in the anterior outer portion of the ciliary muscle and the lining of the intertrabecular spaces of the corneoscleral and uveal meshwork. Rat eyes showed lacZ expression in the retinal pigment epithelium and photoreceptor outer segments 2 days after injection.
Hammack, Thomas S; Johnson, Mildred L; Jacobson, Andrew P; Andrews, Wallace H
2006-01-01
Studies were conducted to determine the relative effectiveness of buffered peptone water (BPW), lactose (LAC) broth, and Universal Preenrichment (UP) broth for the recovery of Salmonella organisms from fruit rinses, whole fruit, and comminuted fruit. In the first phase, the relative effectiveness of the rinse and soak methods for the recovery of Salmonella from surface-contaminated mangoes and tomatoes was examined. Fruits were spot inoculated with single Salmonella serovars and held for 4 days at 2-6 degrees C before analysis was initiated. The contaminated fruit was rinsed in portions of BPW, LAC broth, or UP broth. Portions from each rinse were added to its respective broth (e.g., BPW to BPW). Individual whole fruit, in their remaining broth rinses (soak method), and the fruit rinse/broths (rinse method) were incubated for 24 h at 35 degrees C. The Bacteriological Analytical Manual (BAM) Salmonella culture method was followed thereafter. The soak method produced significantly greater numbers (P < 0.05) of positive test portions than did the rinse method for the analysis of mangoes (93 versus 12) and tomatoes (85 versus 34). The 3 broths were comparable for the recovery of Salmonella for both the soak and the rinse methods for mangoes. For tomatoes, there were no significant differences among the broths for the soak method, but BPW and UP broth were significantly more productive (P < 0.05) than LAC broth by the rinse method. In the second phase, the relative effectiveness of LAC broth, BPW, and UP broth for the recovery of Salmonella from comminuted fruit was examined. Fruits were contaminated with single Salmonella serovars and aged for 4 days at 2-6 degrees C. Twenty 25 g test portions were preenriched in each of the following broths: BPW, LAC broth, and UP broth. The BAM Salmonella culture method was followed thereafter. For cantaloupes, significantly more (P < 0.05) Salmonella-positive test portions were recovered with UP broth (96 Salmonella-positive test portions) and BPW (87 Salmonella-positive test portions) than with LAC broth (57 Salmonella-positive test portions). For mangoes, BPW recovered an arithmetically larger number of Salmonella-positive test portions (27 Salmonella-positive test portions) than did either LAC broth (14 Salmonella-positive test portions) or UP broth (18 Salmonella-positive test portions). For tomatoes, there were no significant differences among the broths: BPW recovered 65 Salmonella-positive test portions, UP broth recovered 62 Salmonella-positive test portions, and LAC broth recovered 60 Salmonella-positive test portions. For the analysis of whole fruit, it is recommended that the soak method be used. For whole fruit analyzed with the soak method, UP broth should be used for tomatoes and BPW should be used for mangoes. It is further recommended that UP broth be used for the analysis of comminuted cantaloupes and that BPW be used for the analysis of comminuted mangoes and tomatoes.
Dangles, Olivier; Loirat, Jean; Freour, Claire; Serre, Sandrine; Vacher, Jean; Le Roux, Xavier
2016-01-01
Biodiversity loss and climate change are both globally significant issues that must be addressed through collaboration across countries and disciplines. With the December 2015 COP21 climate conference in Paris and the recent creation of the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES), it has become critical to evaluate the capacity for global research networks to develop at the interface between biodiversity and climate change. In the context of the European Union (EU) strategy to stand as a world leader in tackling global challenges, the European Commission has promoted ties between the EU and Latin America and the Caribbean (LAC) in science, technology and innovation. However, it is not clear how these significant interactions impact scientific cooperation at the interface of biodiversity and climate change. We looked at research collaborations between two major regions—the European Research Area (ERA) and LAC—that addressed both biodiversity and climate change. We analysed the temporal evolution of these collaborations, whether they were led by ERA or LAC teams, and which research domains they covered. We surveyed publications listed on the Web of Science that were authored by researchers from both the ERA and LAC and that were published between 2003 and 2013. We also run similar analyses on other topics and other continents to provide baseline comparisons. Our results revealed a steady increase in scientific co-authorships between ERA and LAC countries as a result of the increasingly complex web of relationships that has been weaved among scientists from the two regions. The ERA-LAC co-authorship increase for biodiversity and climate change was higher than those reported for other topics and for collaboration with other continents. We also found strong differences in international collaboration patterns within the LAC: co-publications were fewest from researchers in low- and lower-middle-income countries and most prevalent from researchers in emerging countries like Mexico and Brazil. Overall, interdisciplinary publications represented 25.8% of all publications at the interface of biodiversity and climate change in the ERA-LAC network. Further scientific collaborations should be promoted 1) to prevent less developed countries from being isolated from the global cooperation network, 2) to ensure that scientists from these countries are trained to lead visible and recognized biodiversity and climate change research, and 3) to develop common study models that better integrate multiple scientific disciplines and better support decision-making. PMID:27304924
Embedding research to improve program implementation in Latin America and the Caribbean.
Tran, Nhan; Langlois, Etienne V; Reveiz, Ludovic; Varallyay, Ilona; Elias, Vanessa; Mancuso, Arielle; Becerra-Posada, Francisco; Ghaffar, Abdul
2017-06-08
In the last 10 years, implementation research has come to play a critical role in improving the implementation of already-proven health interventions by promoting the systematic uptake of research findings and other evidence-based strategies into routine practice. The Alliance for Health Policy and Systems Research and the Pan American Health Organization implemented a program of embedded implementation research to support health programs in Latin America and the Caribbean (LAC) in 2014-2015. A total of 234 applications were received from 28 countries in the Americas. The Improving Program Implementation through Embedded Research (iPIER) scheme supported 12 implementation research projects led by health program implementers from nine LAC countries: Argentina, Bolivia, Brazil, Chile, Colombia, Mexico, Panama, Peru, and Saint Lucia. Through this experience, we learned that the "insider" perspective, which implementers bring to the research proposal, is particularly important in identifying research questions that focus on the systems failures that often manifest in barriers to implementation. This paper documents the experience of and highlights key conclusions about the conduct of embedded implementation research. The iPIER experience has shown great promise for embedded research models that place implementers at the helm of implementation research initiatives.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hattemer-Frey, H.A.; Brandt, E.J.; Travis, C.C.
Commercial genetic engineering is advancing into areas that require the small-scale introduction of genetically engineered microorganisms (GEMs) to better quantify variables that affect microorganism distribution and survival and to document potential long-term consequences. A recombinant DNA marker system, the lacZY marker, developed by the Monsanto Agricultural Co., enables the distribution and fate of marked fluorescent pseudomonad organisms to be monitored under actual field conditions. Critical evaluation of GEMs under field conditions is imperative if plant-beneficial effects are to be correlated with organism release. This paper evaluates the effectiveness of this marker system and its ability to facilitate the assessment ofmore » risks associated with deliberate environmental introductions of genetically engineered microorganisms. Results of prerelease contained growth chamber and field experiments demonstrated that: (1) the scientific risk assessment methodology adopted by Monsanto and approved by the U.S. Environmental Protection Agency was appropriate and comprehensive; (2) the deliberate introduction of a GEM did not pose unacceptable or unforeseen risks to human health or the environment; (3) the lacZY marker is an effective environmental tracking tool; and (4) regulatory oversight should reflect the expected risk and not be excessively burdensome for all GEMs.« less
Glyco-Immune Diagnostic Signatures and Therapeutic Targets of Mesothelioma
2014-07-01
Huflejt ME. Processing and analysis of serum antibody binding signals from Printed Glycan Arrays for diagnostic and prognostic applications. Int J...rats 542 LeCLex1-6’(LeC1-3’)Lac-sp4 543 Lex1-6’(LeB1-3’)Lac-sp4 641 E.coli oligosaccharide -2 (1208) 642 E.coli oligosaccharide -3 (1210) 254 More
ERIC Educational Resources Information Center
Colpitts, George
2009-01-01
The author analyzes a buffalo hunt which occurred in 1869. That spring, many hundreds of Cree, Assiniboine, Stoney, and Metis hunters going to the Plains were joined by a contingent of Wesleyan Methodists and their Native affiliates from Fort Edmonton, Pigeon Lake, Lac Ste. Anne, Lac La Biche, and Whitefish Lake--all located on the most northern…
ERIC Educational Resources Information Center
Dalbotten, Diana; Ito, Emi; Myrbo, Amy; Pellerin, Holly; Greensky, Lowana; Howes, Thomas; Wold, Andrew; Breckenridge, Rachel; Drake, Christa; Bucar, Leslie; Kowalczak, Courtney; Lindner, Cameron; Olson, Carolyn; Ray, T. J.; Rhodes, Richard; Woods, Philip; Yellowman, Tom
2014-01-01
The Manoomin ''wild rice'' Science Camp program, a partnership between the University of Minnesota, the Fond du Lac Tribal and Community College, and the Fond du Lac Band of Lake Superior Chippewa is an example of how a community-based participatory research project can become the catalyst for STEM learning for an entire community, providing…
Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27
Pereira-Junior, R A; Huarte-Bonnet, C; Paixão, F R S; Roberts, D W; Luz, C; Pedrini, N; Fernandes, É K K
2018-02-23
The effect of nutritional supplementation of two Metarhizium species with riboflavin (Rb) during production of conidia was evaluated on (i) conidial tolerance (based on germination) to UV-B radiation and on (ii) conidial expression following UV-B irradiation, of enzymes known to be active in photoreactivation, viz., photolyase (Phr), laccase (Lac) and polyketide synthase (Pks). Metarhizium acridum (ARSEF 324) and Metarhizium robertsii (ARSEF 2575) were grown either on (i) potato dextrose agar medium (PDA), (ii) PDA supplemented with 1% yeast extract (PDAY), (iii) PDA supplemented with Rb (PDA+Rb), or (iv) PDAY supplemented with Rb (PDAY+Rb). Resulting conidia were exposed to 866·7 mW m -2 of UV-B Quaite-weighted irradiance to total doses of 3·9 or 6·24 kJ m -2 . Some conidia also were exposed to 16 klux of white light (WL) after being irradiated, or not, with UV-B to investigate the role of possible photoreactivation. Relative germination of conidia produced on PDA+Rb (regardless Rb concentration) or on PDAY and exposed to UV-B was higher compared to conidia cultivated on PDA without Rb supplement, or to conidia suspended in Rb solution immediately prior to UV-B exposure. The expression of MaLac3 and MaPks2 for M. acridum, as well as MrPhr2, MrLac1, MrLac2 and MrLac3 for M. robertsii was higher when the isolates were cultivated on PDA+Rb and exposed to UV-B followed by exposure to WL, or exposed to WL only. Rb in culture medium increases the UV-B tolerance of M. robertsii and M. acridum conidia, and which may be related to increased expression of Phr, Lac and Pks genes in these conidia. The enhanced UV-B tolerance of Metarhizium spp. conidia produced on Rb-enriched media may improve the effectiveness of these fungi in biological control programs. © 2018 The Society for Applied Microbiology.
Ropero-Álvarez, A M; Whittembury, A; Bravo-Alcántara, P; Kurtis, H J; Danovaro-Holliday, M C; Velandia-González, M
2015-01-01
As part of the vaccination activities against influenza A[H1N1]pdm vaccine in 2009-2010, countries in Latin American and the Caribbean (LAC) implemented surveillance of events supposedly attributable to vaccines and immunization (ESAVI). We describe the serious ESAVI reported in LAC in order to further document the safety profile of this vaccine and highlight lessons learned. We reviewed data from serious H1N1 ESAVI cases from LAC countries reported to the Pan American Health Organization/World Health Organization. We estimated serious ESAVI rates by age and target group, as well as by clinical diagnosis, and completed descriptive analyses of final outcomes and classifications given in country. A total of 1000 serious ESAVI were reported by 18 of the 29 LAC countries that vaccinated against A[H1N1]pdm. The overall reporting rate in LAC was 6.91 serious ESAVI per million doses, with country reporting rates ranging from 0.77 to 64.68 per million doses. Rates were higher among pregnant women (16.25 per million doses) when compared to health care workers (13.54 per million doses) and individuals with chronic disease (4.03 per million doses). The top three most frequent diagnoses were febrile seizures (12.0%), Guillain-Barré Syndrome (10.5%) and acute pneumonia (8.0%). Almost half (49.1%) of the serious ESAVI were reported among children aged <18 years of age; within this group, the highest proportion of cases was reported among those aged <2 years (53.1%). Of all serious ESAVI reported, 37.8% were classified as coincidental, 35.3% as related to vaccine components, 26.4% as non-conclusive and 0.5% as a programmatic error. This regional overview of A[H1N1]pdm vaccine safety data in LAC estimated the rate of serious ESAVI at lower levels than other studies. However, the ESAVI diagnosis distribution is comparable to the published literature. Lessons learned can be applied in the response to future pandemics. Copyright © 2014. Published by Elsevier Ltd.
Observational Evaluation of Simulated Land-Atmosphere Coupling on the U.S. Southern Great Plains
NASA Astrophysics Data System (ADS)
Phillips, T. J.; Klein, S. A.
2014-12-01
In a recent study of observed features of land-atmosphere coupling (LAC) at the ARM Southern Great Plains (ARM SGP) site in northern Oklahoma (Phillips and Klein, 2014 Journal of Geophysical Research), we identified statistically significant interactions between 1997-2008 summertime daily averages of soil moisture (at 10 cm depth) and a number of surface atmospheric variables, such as surface evaporation, relative humidity, and temperature. Here we will report on an evaluation of similar features of LAC simulated by version 5 of the global Community Atmosphere Model (CAM5), coupled to its native CLM4 land model, and downscaled to the vicinity of the ARM SGP site. In these case studies, the CAM5 was initialized from a 6-hourly atmospheric reanalysis for each day of the years 2008 and 2009 (where the CLM4 land state was equilibrated to the atmospheric model state), thus permitting a close comparison of the modeled and observed summer daily average features of the LAC in these years. Correlation coefficients R and "sensitivity indices" I (a measure of the comparative change of an atmospheric variable for a one-standard-deviation change in soil moisture) provided quantitative measures of the respective coupling strengths. Such a comparison of observed versus modeled LAC is complicated by differences in atmospheric forcings of the land; for example, the CAM5's summertime precipitation is too scant, and thus the model's upper soil layer often is drier than observed. The modeled daily average covariations of soil moisture with lower atmospheric variables also display less coherence (lower R values), but sometimes greater "sensitivity" (higher I values) than are observed at the ARM SGP site. Since the observational estimate of LAC may itself be sensitive to soil moisture measurement biases, we also will report on a planned investigation of the dependence of LAC on several alternative choices of soil moisture data sets local to the ARM SGP site. AcknowledgmentsThis work was funded by the U.S. Department of Energy Office of Science and was performed at the Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Dacquin, Romain; Starbuck, Michael; Schinke, Thorsten; Karsenty, Gérard
2002-06-01
Cell- and time-specific gene inactivation should enhance our knowledge of bone biology. Implementation of this technique requires construction of transgenic mouse lines expressing Cre recombinase in osteoblasts, the bone forming cell. We tested several promoter fragments for their ability to drive efficient Cre expression in osteoblasts. In the first mouse transgenic line, the Cre gene was placed under the control of the 2.3-kb proximal fragment of the alpha1(I)-collagen promoter, which is expressed at high levels in osteoblasts throughout their differentiation. Transgenic mice expressing this transgene in bone were bred with the ROSA26 reporter (R26R) strain in which the ROSA26 locus is targeted with a conditional LacZ reporter cassette. In R26R mice, Cre expression and subsequent Cre-mediated recombination lead to expression of the LacZ reporter gene, an event that can be monitored by LacZ staining. LacZ staining was detected in virtually all osteoblasts of alpha1(I)-Cre;R26R mice indicating that homologous recombination occurred in these cells. No other cell type stained blue. In the second line studied, the 1.3-kb fragment of osteocalcin gene 2 (OG2) promoter, which is active in differentiated osteoblasts, was used to drive Cre expression. OG2-Cre mice expressed Cre specifically in bone. However, cross of OG2-Cre mice with R26R mice did not lead to any detectable LacZ staining in osteoblasts. Lastly, we tested a more active artificial promoter derived from the OG2 promoter. The artificial OG2-Cre transgene was expressed by reverse transcriptase-polymerase chain reaction in cartilage and bone samples. After cross of the artificial OG2-Cre mice with R26R mice, we detected a LacZ staining in articular chondrocytes but not in osteoblasts. Our data suggest that the only promoter able to drive Cre expression at a level sufficient to induce recombination in osteoblasts is the alpha1(I)-collagen promoter. Copyright 2002 Wiley-Liss, Inc.
Effective spectral index properties for Fermi blazars
NASA Astrophysics Data System (ADS)
Yang, JiangHe; Fan, JunHui; Liu, Yi; Zhang, YueLian; Tuo, ManXian; Nie, JianJun; Yuan, YuHai
2018-05-01
Blazars are a special subclass of active galactic nuclei with extreme observation properties. This subclass can be divided into two further subclasses of flat spectrum radio quasars (FSRQs) and BL Lacertae objects (BL Lacs) according to their emission line features. To compare the spectral properties of FSRQs and BL Lacs, the 1.4 GHz radio, optical R-band, 1 keV X-ray, and 1 GeV γ-ray flux densities for 1108 Fermi blazars are calculated to discuss the properties of the six effective spectral indices of radio to optical ( α RO), radio to X-ray ( α RX), radio to γ ray ( α Rγ), optical to X-ray ( α OX), optical to γ ray ( α Oγ), and X-ray to γ ray ( α Xγ). The main results are as follows: For the averaged effective spectral indices, \\overline {{α _{OX}}} > \\overline {{α _{Oγ }}} > \\overline {{α _{Xγ }}} > \\overline {{α _{Rγ }}} > \\overline {{α _{RX}}} > \\overline {{α _{RO}}} for samples of whole blazars and BL Lacs; \\overline {{α _{Xγ }}} ≈ \\overline {{α _{Rγ }}} ≈ \\overline {{α _{RX}}} for FSRQs and low-frequency-peaked BL Lacs (LBLs); and \\overline {{α _{OX}}} ≈ \\overline {{α _{Oγ }}} ≈ \\overline {{α _{Xγ }}} for high-synchrotron-frequency-peaked BL Lacs (HBLs). The distributions of the effective spectral indices involving optical emission ( α RO, α OX, and α Oγ) for LBLs are different from those for FSRQs, but if the effective spectral index does not involve optical emission ( α RX, α Rγ, and α Xγ), the distributions for LBLs and FSRQs almost come from the same parent population. X-ray emissions from blazars include both synchrotron and inverse Compton (IC) components; the IC component for FSRQs and LBLs accounts for a larger proportion than that for HBLs; and the radiation mechanism for LBLs is similar to that for FSRQs, but the radiation mechanism for HBLs is different from that for both FSRQs and LBLs in X-ray bands. The tendency of α Rγ decreasing from LBLs to HBLs suggests that the synchrotron self-Compton model explains the main process for highly energetic γ rays in BL Lacs.
Barthel, Steven R.; Antonopoulos, Aristotelis; Cedeno-Laurent, Filiberto; Schaffer, Lana; Hernandez, Gilberto; Patil, Shilpa A.; North, Simon J.; Dell, Anne; Matta, Khushi L.; Neelamegham, Sriram; Haslam, Stuart M.; Dimitroff, Charles J.
2011-01-01
Prior studies have shown that treatment with the peracetylated 4-fluorinated analog of glucosamine (4-F-GlcNAc) elicits anti-skin inflammatory activity by ablating N-acetyllactosamine (LacNAc), sialyl Lewis X (sLeX), and related lectin ligands on effector leukocytes. Based on anti-sLeX antibody and lectin probing experiments on 4-F-GlcNAc-treated leukocytes, it was hypothesized that 4-F-GlcNAc inhibited sLeX formation by incorporating into LacNAc and blocking the addition of galactose or fucose at the carbon 4-position of 4-F-GlcNAc. To test this hypothesis, we determined whether 4-F-GlcNAc is directly incorporated into N- and O-glycans released from 4-F-GlcNAc-treated human sLeX (+) T cells and leukemic KG1a cells. At concentrations that abrogated galectin-1 (Gal-1) ligand and E-selectin ligand expression and related LacNAc and sLeX structures, MALDI-TOF and MALDI-TOF/TOF mass spectrometry analyses showed that 4-F-GlcNAc 1) reduced content and structural diversity of tri- and tetra-antennary N-glycans and of O-glycans, 2) increased biantennary N-glycans, and 3) reduced LacNAc and sLeX on N-glycans and on core 2 O-glycans. Moreover, MALDI-TOF MS did not reveal any m/z ratios relating to the presence of fluorine atoms, indicating that 4-F-GlcNAc did not incorporate into glycans. Further analysis showed that 4-F-GlcNAc treatment had minimal effect on expression of 1200 glycome-related genes and did not alter the activity of LacNAc-synthesizing enzymes. However, 4-F-GlcNAc dramatically reduced intracellular levels of uridine diphosphate-N-acetylglucosamine (UDP-GlcNAc), a key precursor of LacNAc synthesis. These data show that Gal-1 and E-selectin ligand reduction by 4-F-GlcNAc is not caused by direct 4-F-GlcNAc glycan incorporation and consequent chain termination but rather by interference with UDP-GlcNAc synthesis. PMID:21493714
Msx1 is expressed in retina endothelial cells at artery branching sites.
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-04-15
Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1(lacZ) is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2(lacZ) is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1(lacZ) and Msx2(lacZ) reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1(lacZ) is expressed more broadly and dynamically. At birth Msx1(lacZ) expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature.