Science.gov

Sample records for acellular slime mold

  1. Extended Eden model reproduces growth of an acellular slime mold

    NASA Astrophysics Data System (ADS)

    Wagner, Geri; Halvorsrud, Ragnhild; Meakin, Paul

    1999-11-01

    A stochastic growth model was used to simulate the growth of the acellular slime mold Physarum polycephalum on substrates where the nutrients were confined in separate drops. Growth of Physarum on such substrates was previously studied experimentally and found to produce a range of different growth patterns [Phys. Rev. E 57, 941 (1998)]. The model represented the aging of cluster sites and differed from the original Eden model in that the occupation probability of perimeter sites depended on the time of occupation of adjacent cluster sites. This feature led to a bias in the selection of growth directions. A moderate degree of persistence was found to be crucial to reproduce the biological growth patterns under various conditions. Persistence in growth combined quick propagation in heterogeneous environments with a high probability of locating sources of nutrients.

  2. Gravity related behavior of the acellular slime mold Physarum polycephalum (7-IML-1)

    NASA Technical Reports Server (NTRS)

    Block, I.

    1992-01-01

    The objective of the experiment is to investigate the effect of near weightlessness on a single cell. The test object is the acellular slime mold Physarum polycephalum. This cell is composed of a network of protoplastic strands which perform rhythmic contractions in the minute range. These contractions of the strands' ectoplastic walls generate the force to drive the vigorous shuttle streaming of fluid protoplasm inside the strands (hydrostatic pressure flow). A net transport of protoplasm in one direction determines the direction of the cell's locomotion itself. In this way, gravity modifies the contraction rhythm of the strands, the streaming velocity of protoplasm in the strands, and the direction of locomotion of the whole slime mold (geotaxis). The other parts of this experiment will address the major question of how this cell, which does not possess any specialized gravireceptors, gets the information about the direction of the gravity vector. Details of the experimental setup are given.

  3. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic.

  4. Slimeware: engineering devices with slime mold.

    PubMed

    Adamatzky, Andrew

    2013-01-01

    The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic. PMID:23834592

  5. Physarum attraction: Why slime mold behaves as cats do?

    PubMed

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-05-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms.

  6. Physarum attraction: Why slime mold behaves as cats do?

    PubMed Central

    Adamatzky, Andrew; Costello, Ben De Lacy

    2012-01-01

    We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms. PMID:22896798

  7. Immunocytochemistry of the acellular slime mold Physarum polycephalum. III. Distribution of myosin and the actin-modulating protein (fragmin) in sandwiched plasmodia.

    PubMed

    Osborn, M; Weber, K; Naib-Majani, W; Hinssen, H; Stockem, W; Wohlfarth-Bottermann, K E

    1983-01-01

    The acellular slime mold Physarum forms very thin plasmodia when sandwiched between two agar sheets. After extraction with glycerol-containing buffers, suitable objects for immunofluorescence microscopy are obtained, and an analysis of the cytoskeletal and contractile system of Physarum becomes possible. Plasmodia were stained with antibodies against myosin and fragmin, a protein factor involved in actin filament length regulation. The microanatomy and topography of cellular structures containing these proteins were investigated at the light and electron microscopic levels. The patterns obtained with the two antibodies are closely related to those obtained with actin antibody [25]. In both cases the complex system of cytoplasmic fibrils is stained selectively. The fibrils form a more or less regular network in the advancing front zone with the fibrils being interconnected by focal nodes. In the posterior region of the plasmodium, where endoplasmic pathways and protoplasmic veins are differentiated, larger fibrils are detected, running obliquely or longitudinally to the veins. With both antibodies the fluorescent pattern of the fibrils is continuous without indications of periodic interruptions or striations, which would be expected in the case of sarcomere-like subunits. With anti-myosin unstained patches are frequently seen at or close to the nodes of the fibrillar network in the anterior region. The small lobopodia, which are rich in actin, are apparently not stained by the myosin antibody, a result similar to the situation in "ruffling edges¿ of cultured vertebrate cells. Electron microscopic investigations of antibody-labeled fibrils in embedded and sectioned plasmodia allow the identification of antibody molecules at specific sites along the fibrils with a different distribution pattern for each of the two antibodies. PMID:6339244

  8. Gravitational response of the slime mold Physarum

    NASA Astrophysics Data System (ADS)

    Block, I.; Wolke, A.; Briegleb, W.

    1994-08-01

    The acellular slime mold Physarum polycephalum is used as a model system to investigate the graviresponse of single cells which possess no receptors specialized for the perception of gravity. To obtain insights into the gravity-signal transduciton mechanism the light response of the cell is used: Macroplsmodia of the slime mold show clear geo- and phototaxes. Gravity increases and white light decreases transiently the concentration frequency of plasmodial strands whereby both responses follow the same time pattern. Since mitochodria play major role in changing the contraction rhythm in response to light and gravity stimuli, the simultaneous and subsequent inductions of the opposing light and gravity responses and their mutual influences on one another were investigated. The experiments were performed in weightlessness (0 g) - simulated on the fast-rotating clinostat as well as in actual weightlessness during the IML-1 Space-Shuttle mission. The results indicate that mitochondria (chondriome) are part of the acceleration-stimulus reaction chain in Physarum. Two models for a direct gravireceptor mechanism are discussed.

  9. Galvanotaxis of slime mold.

    PubMed

    ANDERSON, J D

    1951-09-01

    The plasmodium of Physarum polycephalum reacts to direct current by migration toward the cathode. Cathodal migration was obtained upon a variety of substrata such as baked clay, paper, cellophane, and agar with a current density in the substratum of 1.0 microa./mm.(2) Injury was produced by current densities of 8.0 to 12.0 microa./mm.(2) The negative galvanotactic response was not due to electrode products. Attempts to demonstrate that the response was due to gradients or orientation in the substratum, pH changes in the mold, cataphoresis, electroosmosis, or endosmosis were not successful. The addition of salts (CaCl(2), LiCl, NaCl, Na(2)SO(4), NaHCO(3), KCl, MgSO(4), sodium citrate, and sea water) to agar indicated that change of cations had more effect than anions upon galvanotaxis and that the effect was upon threshold values. K ion (0.01 M KCl) increased the lower threshold value to 8.0 microa./mm.(2) and the upper threshold value to 32.0 microa./mm.(2), whereas the Li ion (0.01 M LiCl) increased the lower threshold to only 4.0 microa./mm.(2) and the upper threshold to only 16.0 microa./mm.(2) The passage of electric current produced no increase in the rate of cathodal migration; neither was there a decrease until injurious current densities were reached. With increase of subthreshold current densities there was a progressive decrease in rate of migration toward the anode until complete anodal inhibition occurred. There was orientation at right angles to the electrodes in alternating current (60 cycle) with current density of 4.0 microa./mm.(2) and in direct current of 5.0 microa./mm.(2) when polarity of current was reversed every minute. It is concluded that the negative galvanotactic response of P. polycephalum is due to inhibition of migration on the anodal side of the plasmodium and that this inhibition results in the limitation of the normal migration of the mold to a cathodal direction. The mechanism of the anodal inhibition has not been elucidated.

  10. Streaming instability of aggregating slime mold amoebae

    NASA Astrophysics Data System (ADS)

    Levine, Herbert; Reynolds, William

    1991-05-01

    We propose a new model of aggregation in the cellular slime mold D. Discoideum. Our approach couples the excitable signaling system to amoeba chemotaxis; the resultant system of equations is tractable to analytical and numerical approaches. Using our model, we derive the existence of a streaming instability for the concentric target aggregation pattern.

  11. Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.; Martin, Denise A.

    1998-01-01

    Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)

  12. Universal signals control slime mold stalk formation.

    PubMed

    van Es, S; Nieuwenhuijsen, B W; Lenouvel, F; van Deursen, E M; Schaap, P

    1994-08-16

    The primitive slime mold Dictyostelium minutum does not display oscillations during aggregation, cannot form migrating slugs, and does not form a prestalk/prespore pattern, all of which are characteristic for development of its advanced relative Dictyostelium discoideum. We used D. minutum to investigate whether slime molds share common mechanisms controlling development. In D. discoideum, the morphogen differentiation inducing factor (DIF) can induce stalk-cell differentiation in vitro. However, stalk formation in vivo is supposedly triggered by local depletion of DIF antagonists such as ammonia or cAMP. A homologue of the D. discoideum stalk gene ecmB was cloned in D. minutum that encodes a 3.4-kb mRNA, and its deduced amino acid sequence shows repeats of 24 amino acids that are characteristic for the D. discoideum ecmB gene. Remarkably, DIF effectively induces expression of the D. minutum ecmB gene and ammonia inhibits its expression. D. discoideum cells were transformed with a construct of the D. minutum ecmB promoter fused to the lacZ reporter gene and showed expression in the stalk, but not in the upper and lower cup of the fruiting body, which also express the D. discoideum ecmB gene. In D. discoideum, the D. minutum ecmB and the ecmB promoter are similarly activated by DIF and repressed by both cAMP and ammonia, suggesting that additional signaling is required for ecmB expression in upper and lower cup cells. Our data indicate that the extracellular signals controlling stalk formation and their intracellular signaling cascades including gene regulatory proteins remained highly conserved during slime mold evolution. PMID:8058783

  13. Using Cellular Slime Molds in the High School Laboratory

    ERIC Educational Resources Information Center

    Haskins, P. B.

    1977-01-01

    Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)

  14. Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon.

    PubMed

    Kim, Wan Gyu; Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon

    2009-09-01

    Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon.

  15. Two species of myxomycetes causing slime mold of sweet potato.

    PubMed

    Kim, Wan Gyu; Lee, Sang Yeob; Cho, Weon Dae

    2007-06-01

    Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea.

  16. The cellular slime mold: eukaryotic model microorganism.

    PubMed

    Urushihara, Hideko

    2009-04-01

    Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.

  17. Star Mapping with Slime Mold Physarum Polycephalum

    NASA Astrophysics Data System (ADS)

    Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.

    2014-04-01

    Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.

  18. Potassium loss during galvanotaxis of slime mold.

    PubMed

    ANDERSON, J D

    1962-01-01

    The posterior reticulated regions of the plasmodia of the slime mold, Physarum polycephalum, whose migration has been oriented by direct current (3.0 to 5.0 microa/mm(2) in the agar substrate), contain 30 per cent less potassium than the advancing non-reticulated region. The anterior regions have the same potassium concentration as that of the controls, approximately 32 meq/kg wet weight. Differences in potassium concentration between anterior and posterior regions of control plasmodia, not oriented by electric current, are less than 5 per cent. Sodium, in contrast to potassium, is generally less concentrated in the anterior than in the posterior regions of electrically oriented plasmodia, but sodium concentrations are extremely variable. No significant difference in protein concentration was found between oriented and control plasmodia. Thirty-five per cent of the total potassium, but none of the sodium, is found in acidified ethanol precipitates from plasmodial homogenates. Potassium, but not sodium, appears to be closely associated with processes which differentiate anterior from posterior in an oriented plasmodium.

  19. Proteases in cellular slime mold development: evidence for their involvement.

    PubMed Central

    Fong, D; Bonner, J T

    1979-01-01

    Protein degradation appears to be essential for normal differentiation in the cellular slime mold Dictyostelium discoideum. Several protease inhibitors block normal differentiation, and in most cases this inhibition can be reversed by addition of amino acids. For example, chloroquine, which inhibits slime mold cathepsin B activity, interferred with development by blocking sorocarp formation, and this inhibition was reversed by the addition of amino acids. Tosyllysyl chloromethyl ketone also blocked development, and this inhibition was reversed by simultaneous additions of amino acids and glutathione. Moreover, the addition of antipain and leupeptin delayed sorocarp formation. These results, together with the finding reported earlier that cathepsin B activity is differentially localized in the prestalk-prespore zones of the migrating slugs, suggest that proteolysis might play a regulatory role in cellular slime mold differentiation. Images PMID:293735

  20. Route 20, Autobahn 7, and Slime Mold: Approximating the Longest Roads in USA and Germany With Slime Mold on 3-D Terrains.

    PubMed

    Adamatzky, Andrew I

    2014-01-01

    A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and

  1. Route 20, Autobahn 7, and Slime Mold: Approximating the Longest Roads in USA and Germany With Slime Mold on 3-D Terrains.

    PubMed

    Adamatzky, Andrew I

    2014-01-01

    A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and

  2. SHUTTLE-STREAMING: SYNCHRONIZATION WITH HEAT PRODUCTION IN SLIME MOLD.

    PubMed

    ALLEN, R D; PITTS, W R; SPEIR, D; BRAULT, J

    1963-12-13

    Two small blobs and a channel excised from a slime mold plasmodium were allowed to fuse into a dumbbell-shaped mass in a thermally insulated Kamiya double chamber equipped with naked bead thermistors in contact with the blobs. Cyclic temperature differences of from 1 X 10(-4) to 5 X 10(-2) deg Celsius were recorded by a sensitive lock-in amplifier method with a basal noise level of less than 2 X 10(-2)deg Celsius and a time constant of 0.5 second. The temperature differences were caused by periodic bursts of heat production synchronized perfectly with the shuttle-streaming cycle and invariably localized at the source rather than the destination of the streaming cytoplasm. The results support the theory that the motive force for cytoplasmic streaming in the slime mold is pressure, probably generated by contraction of elements in the channel walls.

  3. How cellular slime molds evade nematodes.

    PubMed Central

    Kessin, R H; Gundersen, G G; Zaydfudim, V; Grimson, M

    1996-01-01

    We have found a predator-prey association between the social amoeba Dictyostelium discoideum and the free soil living nematode Caenorhabditis elegans. C. elegans feeds on the amoebae and multiplies indefinitely when amoebae are the sole food source. In an environment created from soil, D. discoideum grows and develops, but not in the presence of C. elegans. During development, C. elegans feeds on amoebae until they aggregate and synthesize an extracellular matrix called the slime sheath. After the sheath forms, the aggregate and slug are protected. Adult nematodes ingest Dictyostelium spores, which pass through the gut of the worm without loss of structure and remain viable. Nematodes kill the amoebae but disperse the spores. The sheath that is constructed when the social amoebae aggregate and the spore coats of the individual cells may protect against this predator. Individual amoebae may also protect themselves by secreting compounds that repel nematodes. Images Fig. 1 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8643493

  4. Toxicity of heavy metals and insecticides on slime mold Physarum polycephalum.

    PubMed

    Terayama, K; Honma, H; Kawarabayashi, T

    1978-11-01

    Toxicity of heavy metals and insecticides on the slime mold Physarum polycephalum was investigated in order to examine and estimate with ease the toxicity of environmental and occupational contaminants and also to study the effects of various agents on the cell membrane. Changes in survival time and in membrane potential of the slime mold were measured using a double chamber method. The results obtained suggest that their toxicity for the slime mold is accompanied by some change in the cell membrane, and that studies on toxicity for various chemical substances in the slime mold can be used as a screening method.

  5. Photoreceptor pigment that induces differentiation in the slime mold Physarum polycephalum.

    PubMed

    Wormington, W M; Weaver, R F

    1976-11-01

    An extract of small molecules (molecular weight less than 500) of the slime mold Physarum polycephalum undergoes a shift in ultraviolet-visible absorption spectrum upon illumination. This illumination also confers on the extract the ability to induce sporulation when injected into a starved, unilluminated slime mold. The spectral shift and appearance of the sporulation-inducing activity both occur regardless of whether the illumination is carried out on an intact slime mold or on the plasmodium-free extract itself. Thin-layer chromatography resolves the slime mold extract into four major visible fractions. One of these has high sporulation-inducing activity after illumination in vitro.

  6. Feeding Behaviors in Cellular Slime Molds: A Microbial System To Study Competition.

    ERIC Educational Resources Information Center

    Bozzone, Donna M.

    1997-01-01

    Describes a laboratory project for first-year biology students that examines competition among various cellular slime molds. After a brief introduction to the topic of competition and basic life history information about cellular slime molds, students choose a question and design original experiments to seek an answer. (Author/AIM)

  7. MASS CULTURE OF A SLIME MOLD, PHYSARUM POLYCEPHALUM.

    PubMed

    BREWER, E N; KURAISHI, S; GARVER, J C; STRONG, F M

    1964-03-01

    The slime mold, Physarum polycephalum, was cultivated in a soluble natural medium in shake flasks and in 30-liter and 50-gal conventional baffled fermentors. Yields of 6 to 10 g (dry weight) per liter were obtained in the large-scale fermentations. Because of the slow growth of the myxomycete, particular attention had to be paid to aseptic technique. The inability of this organism to withstand the normal degree of agitation employed with most aerobic fermentations made it difficult to obtain adequate aeration. Conditions for growth of the organism on a pilot-plant scale are presented.

  8. Brainless but Multi-Headed: Decision Making by the Acellular Slime Mould Physarum polycephalum.

    PubMed

    Beekman, Madeleine; Latty, Tanya

    2015-11-20

    Because of its peculiar biology and the ease with which it can be cultured, the acellular slime mould Physarum polycephalum has long been a model organism in a range of disciplines. Due to its macroscopic, syncytial nature, it is no surprise that it has been a favourite amongst cell biologists. Its inclusion in the experimental tool kit of behavioural ecologists is much more recent. These recent studies have certainly paid off. They have shown that, for an organism that lacks a brain or central nervous system, P. polycephalum shows rather complex behaviour. For example, it is capable of finding the shortest path through a maze, it can construct networks as efficient as those designed by humans, it can solve computationally difficult puzzles, it makes multi-objective foraging decisions, it balances its nutrient intake and it even behaves irrationally. Are the slime mould's achievements simply "cute", worthy of mentioning in passing but nothing to take too seriously? Or do they hint at the fundamental processes underlying all decision making? We will address this question after reviewing the decision-making abilities of the slime mould.

  9. Brainless but Multi-Headed: Decision Making by the Acellular Slime Mould Physarum polycephalum.

    PubMed

    Beekman, Madeleine; Latty, Tanya

    2015-11-20

    Because of its peculiar biology and the ease with which it can be cultured, the acellular slime mould Physarum polycephalum has long been a model organism in a range of disciplines. Due to its macroscopic, syncytial nature, it is no surprise that it has been a favourite amongst cell biologists. Its inclusion in the experimental tool kit of behavioural ecologists is much more recent. These recent studies have certainly paid off. They have shown that, for an organism that lacks a brain or central nervous system, P. polycephalum shows rather complex behaviour. For example, it is capable of finding the shortest path through a maze, it can construct networks as efficient as those designed by humans, it can solve computationally difficult puzzles, it makes multi-objective foraging decisions, it balances its nutrient intake and it even behaves irrationally. Are the slime mould's achievements simply "cute", worthy of mentioning in passing but nothing to take too seriously? Or do they hint at the fundamental processes underlying all decision making? We will address this question after reviewing the decision-making abilities of the slime mould. PMID:26189159

  10. Material Implementation of Hyperincursive Field on Slime Mold Computer

    NASA Astrophysics Data System (ADS)

    Aono, Masashi; Gunji, Yukio-Pegio

    2004-08-01

    "Elementary Conflictable Cellular Automaton (ECCA)" was introduced by Aono and Gunji as a problematic computational syntax embracing the non-deterministic/non-algorithmic property due to its hyperincursivity and nonlocality. Although ECCA's hyperincursive evolution equation indicates the occurrence of the deadlock/infinite-loop, we do not consider that this problem declares the fundamental impossibility of implementing ECCA materially. Dubois proposed to call a computing system where uncertainty/contradiction occurs "the hyperincursive field". In this paper we introduce a material implementation of the hyperincursive field by using plasmodia of the true slime mold Physarum polycephalum. The amoeboid organism is adopted as a computing media of ECCA slime mold computer (ECCA-SMC) mainly because; it is a parallel non-distributed system whose locally branched tips (components) can act in parallel with asynchronism and nonlocal correlation. A notable characteristic of ECCA-SMC is that a cell representing a spatio-temporal segment of computation is occupied (overlapped) redundantly by multiple spatially adjacent computing operations and by temporally successive computing events. The overlapped time representation may contribute to the progression of discussions on unconventional notions of the time.

  11. A would-be nervous system made from a slime mold.

    PubMed

    Adamatzky, Andrew

    2015-01-01

    The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds.

  12. A would-be nervous system made from a slime mold.

    PubMed

    Adamatzky, Andrew

    2015-01-01

    The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds. PMID:25514435

  13. Novel chlorinated dibenzofurans isolated from the cellular slime mold, Polysphondylium filamentosum, and their biological activities.

    PubMed

    Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru

    2013-08-01

    Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster.

  14. Novel chlorinated dibenzofurans isolated from the cellular slime mold, Polysphondylium filamentosum, and their biological activities.

    PubMed

    Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru

    2013-08-01

    Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster. PMID:23746784

  15. Myosins and cell dynamics in cellular slime molds.

    PubMed

    Yumura, Shigehiko; Uyeda, Taro Q P

    2003-01-01

    Myosin is a mechanochemical transducer and serves as a motor for various motile activities such as cell migration, cytokinesis, maintenance of cell shape, phagocytosis, and morphogenesis. Nonmuscle myosin in vivo does not either stay static at specific subcellular regions or construct highly organized structures, such as sarcomere in skeletal muscle cells. The cellular slime mold Dictyostelium discoideum is an ideal "model organism" for the investigation of cell movement and cytokinesis. The advantages of this organism prompted researchers to carry out pioneering cell biological, biochemical, and molecular genetic studies on myosin II, which resulted in elucidation of many fundamental features of function and regulation of this most abundant molecular motor. Furthermore, recent molecular biological research has revealed that many unconventional myosins play various functions in vivo. In this article, how myosins are organized and regulated in a dynamic manner in Dictyostelium cells is reviewed and discussed. PMID:12722951

  16. On the role of the plasmodial cytoskeleton in facilitating intelligent behavior in slime mold Physarum polycephalum.

    PubMed

    Mayne, Richard; Adamatzky, Andrew; Jones, Jeff

    2015-01-01

    The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently 'intelligent' behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton-a ubiquitous cellular protein scaffold whose functions are manifold and essential to life-and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness.

  17. THE CHANGING PATTERN OF BIREFRINGENCE IN PLASMODIA OF THE SLIME MOLD, PHYSARUM POLYCEPHALUM.

    PubMed

    NAKAJIMA, H; ALLEN, R D

    1965-05-01

    Plasmodia of the acellular slime mold, Physarum polycephalum, reveal a complex and changing pattern of birefringence when examined with a sensitive polarizing microscope. Positively birefringent fibrils are found throughout the ectoplasmic region of the plasmodium. In the larger strands they may be oriented parallel to the strand axis, or arranged circularly or spirally along the periphery of endoplasmic channels. Some fibrils exist for only a few minutes, others for a longer period. Some, particularly the circular fibrils, undergo changes in birefringence as they undergo cyclic deformations. In the ramifying strand region and the advancing margin there is a tendency for fibrils of various sizes to become organized into mutually orthogonal arrays. In some plasmodia the channel wall material immediately adjacent to the endoplasm has been found to be birefringent. The sign of endoplasmic birefringence is negative, and its magnitude is apparently constant over the streaming cycle. The pattern of plasmodial birefringence and its changes during the shuttle streaming cycle of Physarum are considered in the light of several models designed to explain either cytoplasmic streaming alone or the entire gamut of plasmodial motions. The results of this and other recent physical studies suggest that both streaming and the various other motions of the plasmodium may very likely be explained in terms of coordinated contractions taking place in the fibrils which are rendered visible in polarized light.

  18. On the role of the plasmodial cytoskeleton in facilitating intelligent behavior in slime mold Physarum polycephalum.

    PubMed

    Mayne, Richard; Adamatzky, Andrew; Jones, Jeff

    2015-01-01

    The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently 'intelligent' behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton-a ubiquitous cellular protein scaffold whose functions are manifold and essential to life-and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness. PMID:26478782

  19. On the role of the plasmodial cytoskeleton in facilitating intelligent behavior in slime mold Physarum polycephalum

    PubMed Central

    Mayne, Richard; Adamatzky, Andrew; Jones, Jeff

    2015-01-01

    The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently ‘intelligent’ behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton—a ubiquitous cellular protein scaffold whose functions are manifold and essential to life—and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness. PMID:26478782

  20. Altruism, cheating, and anticheater adaptations in cellular slime molds.

    PubMed

    Hudson, Richard Ellis; Aukema, Juliann Eve; Rispe, Claude; Roze, Denis

    2002-07-01

    Cellular slime molds (CSMs) possess a remarkable life cycle that encompasses an extreme act of altruism. CSM cells live as individual amoebae until starved, then aggregate and ultimately transform themselves into a multicellular fruiting body. This fruiting body consists of stalk cells (altruists that eventually die) and spores (the beneficiaries of this sacrifice). Altruistic systems such as this are vulnerable to cheaters, which are individuals unrelated to the altruists that obtain the benefits provided by them without reciprocating. Here, we investigate two forces that can maintain CSM altruism despite cheating: kin selection and anticheater adaptations. First, we present new kinship-based models based on CSM developmental biology to evaluate the efficacy of kin selection. These models show that stalk-making genotypes can still be maintained when aggregations are initiated by multiple "founder" spores, provided that spores of stalkless fruiting bodies have low rates of dispersal and dispersal success is a concave function of stalk height. Second, we review proposals that several features of CSM development, such as the chemical suppression of the redifferentiation of prestalk cells into prespores, act as anticheater adaptations.

  1. Slime mold uses an externalized spatial "memory" to navigate in complex environments.

    PubMed

    Reid, Chris R; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine

    2012-10-23

    Spatial memory enhances an organism's navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem--a classic test of autonomous navigational ability commonly used in robotics--requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism's ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms.

  2. Slime mold uses an externalized spatial "memory" to navigate in complex environments.

    PubMed

    Reid, Chris R; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine

    2012-10-23

    Spatial memory enhances an organism's navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem--a classic test of autonomous navigational ability commonly used in robotics--requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism's ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms. PMID:23045640

  3. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  4. [Comparative study of histones from slime mold Physarum polycephalum and calf thymus].

    PubMed

    Tyrsin, Iu A; Krasheninnikov, I A; Tyrsina, E G

    1977-05-01

    The histones from slime mold Physarum polycephalum and calf thymus were characterized in terms of some physico-chemical properties. The molecular weights of six principal histone fractions of Ph. polycephalum were found to be the following: P1--22 700, P3--15 700, P4a--15 000, P4b--14 300, P5--12 800 and P6--10 500. Electrophoretically homogenous histone fractions H1, H2b and H4 of calf thymus and histones P1, P3, P4b and P6 of slime mold were obtained by gel-filtration on Acrylex P-60. These findings suggest that fractions P1, P4a, P4b, P5 and P6 of slime mold Ph. polycephalum are homologus with respect to the histone fractions H1, H3, H2b, H2a and H4 of calf thymus. Only fraction P3 has no corresponding fraction in the calf thymus histones; a fraction corresponding to histone P3 of slime mold was absent.

  5. Beyond input-output computings: error-driven emergence with parallel non-distributed slime mold computer.

    PubMed

    Aono, Masashi; Gunji, Yukio-Pegio

    2003-10-01

    The emergence derived from errors is the key importance for both novel computing and novel usage of the computer. In this paper, we propose an implementable experimental plan for the biological computing so as to elicit the emergent property of complex systems. An individual plasmodium of the true slime mold Physarum polycephalum acts in the slime mold computer. Modifying the Elementary Cellular Automaton as it entails the global synchronization problem upon the parallel computing provides the NP-complete problem solved by the slime mold computer. The possibility to solve the problem by giving neither all possible results nor explicit prescription of solution-seeking is discussed. In slime mold computing, the distributivity in the local computing logic can change dynamically, and its parallel non-distributed computing cannot be reduced into the spatial addition of multiple serial computings. The computing system based on exhaustive absence of the super-system may produce, something more than filling the vacancy.

  6. Spatiotemporal Symmetry in Rings of Coupled Biological Oscillators of Physarum Plasmodial Slime Mold

    NASA Astrophysics Data System (ADS)

    Takamatsu, Atsuko; Tanaka, Reiko; Yamada, Hiroyasu; Nakagaki, Toshiyuki; Fujii, Teruo; Endo, Isao

    2001-08-01

    Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.

  7. Spatiotemporal Symmetry in Rings of Coupled Biological Oscillators of Physarum Plasmodial Slime Mold

    SciTech Connect

    Takamatsu, Atsuko; Tanaka, Reiko; Yamada, Hiroyasu; Nakagaki, Toshiyuki; Fujii, Teruo; Endo, Isao

    2001-08-13

    Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.

  8. Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum

    SciTech Connect

    Benichou, J.C.; Quiviger, B.; Ryter, A.

    1983-07-01

    The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest of the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.

  9. Streaming instability of slime mold amoebae: An analytical model

    NASA Astrophysics Data System (ADS)

    Höfer, Thomas; Maini, Philip K.

    1997-08-01

    During the aggregation of amoebae of the cellular slime mould Dictyostelium, the interaction of chemical waves of the signaling molecule cAMP with cAMP-directed cell movement causes the breakup of a uniform cell layer into branching patterns of cell streams. Recent numerical and experimental investigations emphasize the pivotal role of the cell-density dependence of the chemical wave speed for the occurrence of the streaming instability. A simple, analytically tractable, model of Dictyostelium aggregation is developed to test this idea. The interaction of cAMP waves with cAMP-directed cell movement is studied in the form of coupled dynamics of wave front geometries and cell density. Comparing the resulting explicit instability criterion and dispersion relation for cell streaming with the previous findings of model simulations and numerical stability analyses, a unifying interpretation of the streaming instability as a cAMP wave-driven chemotactic instability is proposed.

  10. Ground Testing of the EMCS Seed Cassette for Biocompatibility with the Cellular Slime Mold, Dictyostelium Discoideum

    NASA Technical Reports Server (NTRS)

    Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.

    2014-01-01

    The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of

  11. Plant hairy root cultures as plasmodium modulators of the slime mold emergent computing substrate Physarum polycephalum.

    PubMed

    Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G

    2015-01-01

    Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere.

  12. Fully decentralized control of a soft-bodied robot inspired by true slime mold.

    PubMed

    Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio

    2010-03-01

    Animals exhibit astoundingly adaptive and supple locomotion under real world constraints. In order to endow robots with similar capabilities, we must implement many degrees of freedom, equivalent to animals, into the robots' bodies. For taming many degrees of freedom, the concept of autonomous decentralized control plays a pivotal role. However a systematic way of designing such autonomous decentralized control system is still missing. Aiming at understanding the principles that underlie animals' locomotion, we have focused on a true slime mold, a primitive living organism, and extracted a design scheme for autonomous decentralized control system. In order to validate this design scheme, this article presents a soft-bodied amoeboid robot inspired by the true slime mold. Significant features of this robot are twofold: (1) the robot has a truly soft and deformable body stemming from real-time tunable springs and protoplasm, the former is used for an outer skin of the body and the latter is to satisfy the law of conservation of mass; and (2) fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts stemming from the law of conservation of protoplasmic mass. Simulation results show that this robot exhibits highly supple and adaptive locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design methodology for autonomous decentralized control system.

  13. Plant hairy root cultures as plasmodium modulators of the slime mold emergent computing substrate Physarum polycephalum

    PubMed Central

    Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G.

    2015-01-01

    Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere. PMID:26236301

  14. Nature and Development of Membrane Systems in Food Vacuoles of Cellular Slime Molds Predatory upon Bacteria.

    PubMed

    Hohl, H R

    1965-09-01

    Hohl, Hans R. (University of Hawaii, Honolulu). Nature and development of membrane systems in food vacuoles of cellular slime molds predatory upon bacteria. J. Bacteriol. 90:755-765. 1965.-During the digestion of bacteria by the myxamoebae of cellular slime molds, systems of concentric lamellae begin to appear within the food vacuoles. Each constituent lamella is a unit membrane of 75 to 85 A thickness. A study of these lamellae in Dictyostelium discoideum and Polysphondylium pallidum reveals that most of them do not represent original membranes of the ingested bacteria but are formed mainly in two ways. (i) After swelling and partial digestion of the bacteria, the first membranes appear adjacent to pre-existing membranes, e.g., the membrane lining the food vacuole and the cytoplasmic membrane surrounding the bacterium. Progressive addition of lamellae leads to the formation of the systems of concentric lamellae. (ii) After digestion of the bacteria has proceeded to a high degree, the concentric lamellae are formed spontaneously from clouds of amorphous material through condensation and orientation of precursor material. The study shows that, in biological systems, unit membranes may be formed from amorphous material through template action of pre-existing membranes, and does not necessarily involve fusion of membrane-bound vesicles.

  15. Phylogeny of the "forgotten" cellular slime mold, Fonticula alba, reveals a key evolutionary branch within Opisthokonta.

    PubMed

    Brown, Matthew W; Spiegel, Frederick W; Silberman, Jeffrey D

    2009-12-01

    The shared ancestry between Fungi and animals has been unequivocally demonstrated by abundant molecular and morphological data for well over a decade. Along with the animals and Fungi, multiple protists have been placed in the supergroup Opisthokonta making it exceptionally diverse. In an effort to place the cellular slime mold Fonticula alba, an amoeboid protist with aggregative, multicellular fruiting, we sequenced five nuclear encoded genes; small subunit ribosomal RNA, actin, beta-tubulin, elongation factor 1-alpha, and the cytosolic isoform of heat shock protein 70 for phylogenetic analyses. Molecular trees demonstrate that Fonticula is an opisthokont that branches sister to filose amoebae in the genus Nuclearia. Fonticula plus Nuclearia are sister to Fungi. We propose a new name for this well-supported clade, Nucletmycea, incorporating Nuclearia, Fonticula, and Fungi. Fonticula represents the first example of a cellular slime mold morphology within Opisthokonta. Thus, there are four types of multicellularity in the supergroup-animal, fungal, colonial, and now aggregative. Our data indicate that multicellularity in Fonticula evolved independent of that found in the fungal and animal radiations. With the rapidly expanding sequence and genomic data becoming available from many opisthokont lineages, Fonticula may be fundamental to understanding opisthokont evolution as well as any possible commonalities involved with the evolution of multicellularity.

  16. Plant hairy root cultures as plasmodium modulators of the slime mold emergent computing substrate Physarum polycephalum.

    PubMed

    Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G

    2015-01-01

    Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere. PMID:26236301

  17. A coupled-oscillator model with a conservation law for the rhythmic amoeboid movements of plasmodial slime molds

    NASA Astrophysics Data System (ADS)

    Tero, A.; Kobayashi, R.; Nakagaki, T.

    2005-06-01

    Experiments on the fusion and partial separation of plasmodia of the true slime mold Physarum polycephalum are described, concentrating on the spatio-temporal phase patterns of rhythmic amoeboid movement. On the basis of these experimental results we introduce a new model of coupled oscillators with one conserved quantity. Simulations using the model equations reproduce the experimental results well.

  18. Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds.

    PubMed

    Hoppe, Thomas; Kutschera, Ulrich

    2015-01-01

    On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa.

  19. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  20. Experimental Verification of Fully Decentralized Control Inspired by Plasmodium of True Slime Mold

    NASA Astrophysics Data System (ADS)

    Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio

    This paper presents a fully decentralized control inspired by plasmodium of true slime mold and its validity using a soft-bodied amoeboid robot. The notable features of this paper are twofold: (1) the robot has truly soft and deformable body stemming from real-time tunable springs and a balloon, the former is utilized as an outer skin of the body and the latter serves as protoplasm; and (2) a fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts induced by the law of conservation of protoplasmic mass. Experimental results show that this robot exhibits truly supple locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design scheme for autonomous decentralized control system.

  1. SEROLOGICAL ANALYSES OF CELLULAR SLIME-MOLD DEVELOPMENT. I. CHANGES IN ANTIGENIC ACTIVITY DURING CELL AGGREATION.

    PubMed

    SONNEBORN, D R; SUSSMAN, M; LEVINE, L

    1964-06-01

    Sonneborn, D. R. (Brandeis University, Waltham, Mass.), M. Sussman, and L. Levine. Serological analysis of cellular slime-mold development. I. Changes in antigenic activity during cell aggregation. J. Bacteriol. 87:1321-1329. 1964.-During aggregation in Dictyostelium discoideum, the concentration of a single antigenic determinant increased markedly, starting from very low or undetectable levels. Subsequently, the determinant appeared to segregate preferentially into the stalks of terminal fruiting bodies. Sera containing the antibody specific for this determinant inhibited the aggregation of D. discoideum without disturbing cell viability. The properties of the antigen during fractionation are consistent with the supposition that it may be a protein associated with the cell membrane. The ability or inability of three species to coaggregate with D. discoideum was correlated with the presence or absence of the antigenic determinant in aggregates of these species.

  2. Genetic heterogeneity in wild isolates of cellular slime mold social groups.

    PubMed

    Sathe, Santosh; Kaushik, Sonia; Lalremruata, Albert; Aggarwal, Ramesh K; Cavender, James C; Nanjundiah, Vidyanand

    2010-07-01

    This study addresses the issues of spatial distribution, dispersal, and genetic heterogeneity in social groups of the cellular slime molds (CSMs). The CSMs are soil amoebae with an unusual life cycle that consists of alternating solitary and social phases. Because the social phase involves division of labor with what appears to be an extreme form of "altruism", the CSMs raise interesting evolutionary questions regarding the origin and maintenance of sociality. Knowledge of the genetic structure of social groups in the wild is necessary for answering these questions. We confirm that CSMs are widespread in undisturbed forest soil from South India. They are dispersed over long distances via the dung of a variety of large mammals. Consistent with this mode of dispersal, most social groups in the two species examined for detailed study, Dictyostelium giganteum and Dictyostelium purpureum, are multi-clonal.

  3. Developmental and Spatial Expression of sir2 Genes in the Cellular Slime Mold Dictyostelium discoideum.

    PubMed

    Katayama, Takahiro; Yasukawa, Hiro

    2008-01-01

    The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.

  4. Risk management in spatio-temporally varying field by true slime mold

    NASA Astrophysics Data System (ADS)

    Ito, Kentaro; Sumpter, David; Nakagaki, Toshiyuki

    Revealing how lower organisms solve complicated problems is a challenging research area, which could reveal the evolutionary origin of biological information processing. Here we report on the ability of a single-celled organism, true slime mold, to find a smart solution of risk management under spatio-temporally varying conditions. We designed test conditions under which there were three food-locations at vertices of equilateral triangle and a toxic light illuminated the organism on alternating halves of the triangle. We found that the organism behavior depended on the period of the repeated illumination, even though the total exposure time was kept the same . A simple mathematical model for the experimental results is proposed from a dynamical system point of view. We discuss our results in the context of a strategy of risk management by Physarum.

  5. Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds.

    PubMed

    Hoppe, Thomas; Kutschera, Ulrich

    2015-01-01

    On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa. PMID:26357877

  6. Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds

    PubMed Central

    Hoppe, Thomas; Kutschera, Ulrich

    2015-01-01

    On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa. PMID:26357877

  7. SURVEY AND SUMMARY: exon-intron organization of genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcinska-Danielewicz, J; Fronk, J

    2000-09-15

    The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon-intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon-intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon-intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3'-ends.

  8. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds. PMID:10504413

  9. Genetic heterogeneity in wild isolates of cellular slime mold social groups.

    PubMed

    Sathe, Santosh; Kaushik, Sonia; Lalremruata, Albert; Aggarwal, Ramesh K; Cavender, James C; Nanjundiah, Vidyanand

    2010-07-01

    This study addresses the issues of spatial distribution, dispersal, and genetic heterogeneity in social groups of the cellular slime molds (CSMs). The CSMs are soil amoebae with an unusual life cycle that consists of alternating solitary and social phases. Because the social phase involves division of labor with what appears to be an extreme form of "altruism", the CSMs raise interesting evolutionary questions regarding the origin and maintenance of sociality. Knowledge of the genetic structure of social groups in the wild is necessary for answering these questions. We confirm that CSMs are widespread in undisturbed forest soil from South India. They are dispersed over long distances via the dung of a variety of large mammals. Consistent with this mode of dispersal, most social groups in the two species examined for detailed study, Dictyostelium giganteum and Dictyostelium purpureum, are multi-clonal. PMID:20179919

  10. Maternal inheritance of mitochondria: multipolarity, multiallelism and hierarchical transmission of mitochondrial DNA in the true slime mold Physarum polycephalum.

    PubMed

    Moriyama, Yohsuke; Kawano, Shigeyuki

    2010-03-01

    Direct evidence of digestion of paternal mitochondrial DNA (mtDNA) has been found in the true slime mold Physarum polycephalum. This is the first report on the selective digestion of mtDNA inside the zygote, and is striking evidence for the mechanism of maternal inheritance of mitochondria. Moreover, two mitochondrial nuclease activities were detected in this organism as-candidates for the nucleases responsible for selective digestion of mtDNA. In the true slime mold, there is an additional-feature of the uniparental inheritance of mitochondria.Although mitochondria are believed to be inherited from the maternal lineage in nearly all eukaryotes, the mating types of the true slime mold P. polycephalum is not restricted to two: there are three mating loci--matA, matB,and matC--and these loci have 16, 15, and 3 alleles,-respectively. Interestingly, the transmission patterns of mtDNA are determined by the matA locus, in a hierarchical-fashion (matA hierarchy) as follows: matA7[matA2[matA11[matA12[matA15/matA16[matA1[matA6.The strain possessing the higher status of matA would be the mtDNA donor in crosses. Furthermore, we have found that some crosses showed biparental inheritance of mitochondria.This review describes the phenomenon of hierarchical transmission of mtDNA in true slime molds, and discusses the presumed molecular mechanism of maternal and biparental inheritance.

  11. Magnetic field effects on mitochondrion-activity-related optical properties in slime mold and bone forming cells.

    PubMed

    Mizukawa, Yuri; Iwasaka, Masakazu

    2013-01-01

    In the present study, a cellular level response of Cyto-aa3 oxidation was investigated in real time under both time-varying and strong static magnetic fields of 5 T. Two kinds of cells, a slime mold, Physarum polycephalum, and bone forming cells, MC-3T3-E1, were used for the experiments. The oxidation level of the Cyto-aa3 was calculated by optical absorptions at 690 nm, 780 nm and 830 nm. The sample, fiber-optics and an additional optical fiber for light stimulation were set in a solenoidal coil or the bore of a 5-T superconducting magnet. The solenoidal coil for time-varying magnetic fields produced sinusoidal magnetic fields of 6 mT. The slime mold showed a periodic change in Cyto-aa3 oxidation, and the oxidation-reduction cycle of Cyto-aa3 was apparently changed when visible-light irradiated the slime mold. Similarly to the case with light, time-varying magnetic stimulations changed the oxidation-reduction cycle during and after the stimulation for 10 minutes. The same phenomena were observed in the MC-3T3-E1 cell assembly, although their cycle rhythm was comparatively random. Finally, magnetic field exposure of up to 5 T exhibited a distinct suppression of Cyto-aa3 oscillation in the bone forming cells. Exposure up to 5 T was repeated five times, and the change in Cyto-aa3 oxidation reproducibly occurred.

  12. Magnetic field effects on mitochondrion-activity-related optical properties in slime mold and bone forming cells.

    PubMed

    Mizukawa, Yuri; Iwasaka, Masakazu

    2013-01-01

    In the present study, a cellular level response of Cyto-aa3 oxidation was investigated in real time under both time-varying and strong static magnetic fields of 5 T. Two kinds of cells, a slime mold, Physarum polycephalum, and bone forming cells, MC-3T3-E1, were used for the experiments. The oxidation level of the Cyto-aa3 was calculated by optical absorptions at 690 nm, 780 nm and 830 nm. The sample, fiber-optics and an additional optical fiber for light stimulation were set in a solenoidal coil or the bore of a 5-T superconducting magnet. The solenoidal coil for time-varying magnetic fields produced sinusoidal magnetic fields of 6 mT. The slime mold showed a periodic change in Cyto-aa3 oxidation, and the oxidation-reduction cycle of Cyto-aa3 was apparently changed when visible-light irradiated the slime mold. Similarly to the case with light, time-varying magnetic stimulations changed the oxidation-reduction cycle during and after the stimulation for 10 minutes. The same phenomena were observed in the MC-3T3-E1 cell assembly, although their cycle rhythm was comparatively random. Finally, magnetic field exposure of up to 5 T exhibited a distinct suppression of Cyto-aa3 oscillation in the bone forming cells. Exposure up to 5 T was repeated five times, and the change in Cyto-aa3 oxidation reproducibly occurred. PMID:24109969

  13. Genetic Diversity in Cellular Slime Molds: Allozyme Electrophoresis and a Monoclonal Antibody Reveal Cryptic Species among Dictyostelium discoideum Strains

    PubMed Central

    Briscoe, David A.; Gooley, Andrew A.; Bernstein, R. L.; McKay, George M.; Williams, Keith L.

    1987-01-01

    Cellular slime molds have been classified on the basis of a small number of descriptive criteria such as fruiting body color and morphology, and, in heterothallic species, by assignment to compatible mating groups. However, some isolates which are morphologically classified as conspecific do not fall into a simple mating-type classification; for example some are asexual or homothallic. An increasing interest in inter-strain genetic variation in studies of development and simple behavior has led us to reassess genetic relationships among a number of frequently used isolates. Allozyme electrophoresis of 16 soluble enzymes and use of a monoclonal antibody show that there is relatively little genetic diversity among sexually competent Dictyostelium discoideum isolates, despite considerable variation in geographic origin and time since isolation in the laboratory. In contrast a pair of asexual strains and each of two homothallic strains are genetically quite distinct and differ sufficiently from each other, and from sexually competent isolates, to warrant their recognition as separate species. There are probably four biological species represented in the supposedly D. discoideum isolates studied. This heterogeneity extends to other cellular slime mold species. Each of three isolates of Dictyostelium purpureum is genetically distinct from the others. Limited analysis of other cellular slime molds indicates that the generic distinction of Dictyostelium and Polysphondylium must be questioned. This study emphasizes that caution should be applied in classifying simple organisms on morphological criteria. PMID:17246401

  14. Dictyostelid cellular slime molds associated with grasslands of the central and western United States.

    PubMed

    Rollins, Adam W; Landolt, John C; Stephenson, Steven L

    2010-01-01

    Dictyostelid cellular slime molds (dictyostelids) associated with grassland ecosystems of the central and western United States were investigated at nine sites that included examples of the three major ecological types of grasslands (tall grass, mixed grass and short grass) generally recognized for the region. Samples of soil/humus collected from each site were examined with the Cavender method of isolating dictyostelids. For each of those six sites with well developed gallery forests present, an additional set of forest soil/humus samples was collected. A more intensive sampling effort was carried out at one site (Konza LTER) to assess the possible effects of burning and grazing on dictyostelid diversity and density. Twelve species of dictyostelids were recovered from grassland sites, whereas gallery forest sites yielded only nine species. Four cosmopolitan species (Dictyostelium giganteum, D. mucoroides, D. sphaerocephalum and Polysphondylium pallidum) were represented by the greatest densities of clones, with D. sphaerocephalum particularly common. The general pattern across all sites was that both species richness and density of dictyostelids decreased with decreasing precipitation. Samples collected from ungrazed grassland plots yielded higher numbers of both species and clones as compared to grazed plots, and the general pattern was for both values to increase as the interval between fires increased. For numbers of clones this correlation was statistically significant. PMID:20943500

  15. Characterization of Adaptation by Morphology in a Planar Biological Network of Plasmodial Slime Mold

    NASA Astrophysics Data System (ADS)

    Ito, Masateru; Okamoto, Riki; Takamatsu, Atsuko

    2011-07-01

    Growth processes of a planar biological network of plasmodium of a true slime mold, Physarum polycephalum, were analyzed quantitatively. The plasmodium forms a transportation network through which protoplasm conveys nutrients, oxygen, and cellular organelles similarly to blood in a mammalian vascular network. To analyze the network structure, vertices were defined at tube bifurcation points. Then edges were defined for the tubes connecting both end vertices. Morphological analysis was attempted along with conventional topological analysis, revealing that the growth process of the plasmodial network structure depends on environmental conditions. In an attractive condition, the network is a polygonal lattice with more than six edges per vertex at the early stage and the hexagonal lattice at a later stage. Through all growing stages, the tube structure was not highly developed but an unstructured protoplasmic thin sheet was dominantly formed. The network size is small. In contrast, in the repulsive condition, the network is a mixture of polygonal lattice and tree-graph. More specifically, the polygonal lattice has more than six edges per vertex in the early stage, then a tree-graph structure is added to the lattice network at a later stage. The thick tube structure was highly developed. The network size, in the meaning of Euclidean distance but not topological one, grows considerably. Finally, the biological meaning of the environment-dependent network structure in the plasmodium is discussed.

  16. Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.

    PubMed

    Zitnik, Marinka; Zupan, Blaž

    2014-01-01

    The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.

  17. Weight loss by Ppc-1, a novel small molecule mitochondrial uncoupler derived from slime mold.

    PubMed

    Suzuki, Toshiyuki; Kikuchi, Haruhisa; Ogura, Masato; Homma, Miwako K; Oshima, Yoshiteru; Homma, Yoshimi

    2015-01-01

    Mitochondria play a key role in diverse processes including ATP synthesis and apoptosis. Mitochondrial function can be studied using inhibitors of respiration, and new agents are valuable for discovering novel mechanisms involved in mitochondrial regulation. Here, we screened small molecules derived from slime molds and other microorganisms for their effects on mitochondrial oxygen consumption. We identified Ppc-1 as a novel molecule which stimulates oxygen consumption without adverse effects on ATP production. The kinetic behavior of Ppc-1 suggests its function as a mitochondrial uncoupler. Serial administration of Ppc-1 into mice suppressed weight gain with no abnormal effects on liver or kidney tissues, and no evidence of tumor formation. Serum fatty acid levels were significantly elevated in mice treated with Ppc-1, while body fat content remained low. After a single administration, Ppc-1 distributes into various tissues of individual animals at low levels. Ppc-1 stimulates adipocytes in culture to release fatty acids, which might explain the elevated serum fatty acids in Ppc-1-treated mice. The results suggest that Ppc-1 is a unique mitochondrial regulator which will be a valuable tool for mitochondrial research as well as the development of new drugs to treat obesity.

  18. Weight loss by Ppc-1, a novel small molecule mitochondrial uncoupler derived from slime mold.

    PubMed

    Suzuki, Toshiyuki; Kikuchi, Haruhisa; Ogura, Masato; Homma, Miwako K; Oshima, Yoshiteru; Homma, Yoshimi

    2015-01-01

    Mitochondria play a key role in diverse processes including ATP synthesis and apoptosis. Mitochondrial function can be studied using inhibitors of respiration, and new agents are valuable for discovering novel mechanisms involved in mitochondrial regulation. Here, we screened small molecules derived from slime molds and other microorganisms for their effects on mitochondrial oxygen consumption. We identified Ppc-1 as a novel molecule which stimulates oxygen consumption without adverse effects on ATP production. The kinetic behavior of Ppc-1 suggests its function as a mitochondrial uncoupler. Serial administration of Ppc-1 into mice suppressed weight gain with no abnormal effects on liver or kidney tissues, and no evidence of tumor formation. Serum fatty acid levels were significantly elevated in mice treated with Ppc-1, while body fat content remained low. After a single administration, Ppc-1 distributes into various tissues of individual animals at low levels. Ppc-1 stimulates adipocytes in culture to release fatty acids, which might explain the elevated serum fatty acids in Ppc-1-treated mice. The results suggest that Ppc-1 is a unique mitochondrial regulator which will be a valuable tool for mitochondrial research as well as the development of new drugs to treat obesity. PMID:25668511

  19. Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.

    PubMed

    Zitnik, Marinka; Zupan, Blaž

    2014-01-01

    The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565

  20. Resolution of Infinite-Loop in Hyperincursive and Nonlocal Cellular Automata: Introduction to Slime Mold Computing

    NASA Astrophysics Data System (ADS)

    Aono, Masashi; Gunji, Yukio-Pegio

    2004-08-01

    How can non-algorithmic/non-deterministic computational syntax be computed? "The hyperincursive system" introduced by Dubois is an anticipatory system embracing the contradiction/uncertainty. Although it may provide a novel viewpoint for the understanding of complex systems, conventional digital computers cannot run faithfully as the hyperincursive computational syntax specifies, in a strict sense. Then is it an imaginary story? In this paper we try to argue that it is not. We show that a model of complex systems "Elementary Conflictable Cellular Automata (ECCA)" proposed by Aono and Gunji is embracing the hyperincursivity and the nonlocality. ECCA is based on locality-only type settings basically as well as other CA models, and/but at the same time, each cell is required to refer to globality-dominant regularity. Due to this contradictory locality-globality loop, the time evolution equation specifies that the system reaches the deadlock/infinite-loop. However, we show that there is a possibility of the resolution of these problems if the computing system has parallel and/but non-distributed property like an amoeboid organism. This paper is an introduction to "the slime mold computing" that is an attempt to cultivate an unconventional notion of computation.

  1. ELF (Extremely Low Frequency) communications system ecological monitoring program: Slime mold studies

    NASA Astrophysics Data System (ADS)

    Goodman, Eugene; Greenebaum, Ben

    1990-01-01

    It was previously shown that continuous exposure of the slime mold Physarum polycephalum to extremely low frequency (ELF) electromagnetic fields (EMF) simulating those generated by the Navy's ELF communication system (then Project Sanguine) could depress the rate of respiration, and lengthen the mitotic cell cycle. In a series of experiments beginning in 1981 and ending in 1987, it was determined that whether exposing Physarum to the field environment around the Wisconsin Transmitting Facility (WTF) could induce an altered physiological state. A laboratory component was also included to help verify methodology and to supplement studies performed at the WTF. Initially, the experimental effort was directed to devising methods to maintain axenic Physarum cultures under ambient environmental conditions. This involved using growth chambers that admit the electric field or current density from the surrounding environment; the cultures were returned to the laboratory for analysis. The successful methods placed the organism on an agar bed inside double containment and introduced the samples to be assayed into shaken liquid culture medium upon arrival at the laboratory. Both WTF-generated electromagnetic fields and background strengths were measured with the help of IITRI at study locations near the antenna, at the west ground of the WTF antenna, as well as at control sites.

  2. "Slime molds" among the Tubulinea (Amoebozoa): molecular systematics and taxonomy of Copromyxa.

    PubMed

    Brown, Matthew W; Silberman, Jeffrey D; Spiegel, Frederick W

    2011-04-01

    Copromyxa protea is a dung-inhabiting amoeboid organism that aggregates to form simple macroscopic fruiting structures, sorocarps, which are composed of a single cell type. In a recent effort to find the phylogenetic positions of the less well-known sorocarpic protists considered to be "cellular slime molds," or aggregatively fruiting amoebae, we isolated C. protea and sequenced the nuclear-encoded small subunit ribosomal RNA gene from four samples collected from cattle farms in the central USA. Phylogenetic analyses of these data place C. protea in the eukaryotic supergroup Amoebozoa together with the Tubulinea, in which there has been no previous report of an aggregative fruiting habit. This is consistent with the morphology of the trophozoites. In fact, Copromyxa protea is found to be very closely related to Hartmannella cantabrigiensis and to a since lost amoeba isolate, Hartmannella sp. 4/3Da/10. This new grouping of Copromyxa+H. cantabrigiensis is sister to Glaeseria, which together are sister to the Amoebidae (Amoeba+Chaos). We suggest renaming, H. cantabrigiensis as C. cantabrigiensis and designate isolate 4/3Da/10 as C. protea. Future work is needed to see if these newly assigned members of the genus Copromyxa also show evidence of an ability to fruit.

  3. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium. PMID:10542319

  4. Gene trapping with GFP: the isolation of developmental mutants in the slime mold Polysphondylium.

    PubMed

    Fey, P; Cox, E C

    1997-11-01

    In order to study how a cell mass undergoes a transition from one symmetry to another in the slime mold Polysphondylium, we developed a genetic screen in which mutant phenotype and gene expression can easily be visualized in the living organism. The screen combines restriction enzyme-mediated integration (REMI) [1,2] and green fluorescent protein (GFP) [3] expression. In REMI, a restriction enzyme is electroporated along with linearized vector into cells, thus determining the site of plasmid insertion and often increasing the integration frequency. A set of transforming plasmids carrying the GFP coding sequence in three reading frames was used for transformation. The plasmids were constructed so that GFP could be expressed only under control of a host promoter. Living transformants expressing GFP spatially and temporally could be rapidly identified in a very large background of non-expressing cells and fruiting bodies. The phenotypes of representative mutants range from cells that cannot aggregate and initiate cell-cell interactions, through mutant fruiting bodies, to apparently wild-type fruiting bodies expressing GFP in all or a subpopulation of cells. The ability to screen mutant living cells and tissues for GFP expression is rapid and effective and likely to have application in many transformable systems where screening by gene and promoter trapping is essential for understanding temporal and spatial gene regulation. PMID:9382807

  5. Fitness tradeoffs between spores and nonaggregating cells can explain the coexistence of diverse genotypes in cellular slime molds.

    PubMed

    Tarnita, Corina E; Washburne, Alex; Martinez-Garcia, Ricardo; Sgro, Allyson E; Levin, Simon A

    2015-03-01

    Cellular slime molds, including the well-studied Dictyostelium discoideum, are amoebae whose life cycle includes both a single-cellular and a multicellular stage. To achieve the multicellular stage, individual amoebae aggregate upon starvation to form a fruiting body made of dead stalk cells and reproductive spores, a process that has been described in terms of cooperation and altruism. When amoebae aggregate they do not perfectly discriminate against nonkin, leading to chimeric fruiting bodies. Within chimeras, complex interactions among genotypes have been documented, which should theoretically reduce genetic diversity. This is however inconsistent with the great diversity of genotypes found in nature. Recent work has shown that a little-studied component of D. discoideum fitness--the loner cells that do not participate in the aggregation--can be selected for depending on environmental conditions and that, together with the spores, they could represent a bet-hedging strategy. We suggest that in all cellular slime molds the existence of loners could resolve the apparent diversity paradox in two ways. First, if loners are accounted for, then apparent genotypic skew in the spores of chimeras could simply be the result of different investments into spores versus loners. Second, in an ecosystem with multiple local environments differing in their food recovery characteristics and connected globally via weak-to-moderate dispersal, coexistence of multiple genotypes can occur. Finally, we argue that the loners make it impossible to define altruistic behavior, winners or losers, without a clear description of the ecology.

  6. Evolution of hierarchical cytoplasmic inheritance in the plasmodial slime mold Physarum polycephalum.

    PubMed

    Iwanaga, Akiko; Sasaki, Akira

    2004-04-01

    A striking linear dominance relationship for uniparental mitochondrial transmission is known between many mating types of plasmodial slime mold Physarum polycephalum. We herein examine how such hierarchical cytoplasmic inheritance evolves in isogamous organisms with many self-incompatible mating types. We assume that a nuclear locus determines the mating type of gametes and that another nuclear locus controls the digestion of mitochondria DNAs (mtDNAs) of the recipient gamete after fusion. We then examine the coupled genetic dynamics for the evolution of self-incompatible mating types and biased mitochondrial transmission between them. In Physarum, a multiallelic nuclear locus matA controls both the mating type of the gametes and the selective elimination of the mtDNA in the zygotes. We theoretically examine two potential mechanisms that might be responsible for the preferential digestion of mitochondria in the zygote. In the first model, the preferential digestion of mitochondria is assumed to be the outcome of differential expression levels of a suppressor gene carried by each gamete (suppression-power model). In the second model (site-specific nuclease model), the digestion of mtDNAs is assumed to be due to their cleavage by a site-specific nuclease that cuts the mtDNA at unmethylated recognition sites. Also assumed is that the mtDNAs are methylated at the same recognition site prior to the fusion, thereby being protected against the nuclease of the same gamete, and that the suppressor alleles convey information for the recognition sequences of nuclease and methylase. In both models, we found that a linear dominance hierarchy evolves as a consequence of the buildup of a strong linkage disequilibrium between the mating-type locus and the suppressor locus, though it fails to evolve if the recombination rate between the two loci is larger than a threshold. This threshold recombination rate depends on the number of mating types and the degree of fitness reduction in

  7. Elf (extremely low frequency) communications system ecological monitoring program. The effects of exposing the slime mold Physarum polycephalum to electromagnetic fields

    SciTech Connect

    Goodman, E.M.; Marron, M.T.; Greenebaum, B.

    1982-11-01

    Laboratory exposure of the slime mold Physarum polycephalum to weak electromagnetic fields results in a lengthened mitotic cycle and depressed oxygen consumption. This research program has been designed to ascertain if the same physiological effects are obtained when Physarum polycephalum is exposed to electromagnetic fields in the vicinity of the Wisconsin Test Facility at Clam Lake, Wisconsin.

  8. In the shadow of Darwin: Anton de Bary's origin of myxomycetology and a molecular phylogeny of the plasmodial slime molds.

    PubMed

    Hoppe, T; Kutschera, U

    2010-06-01

    In his Origin of Species (John Murray, London, 1859), Charles Darwin described the theory of descent with modification by means of natural selection and postulated that all life may have evolved from one or a few simple kinds of organisms. However, Darwin's concept of evolutionary change is entirely based on observations of populations of animals and plants. He briefly mentioned 'lower algae', but ignored amoebae, bacteria and other micro-organisms. In 1859, Anton de Bary, the founder of mycology and plant pathology, published a seminal paper on the biology and taxonomy of the plasmodial slime molds (myxomycetes). These heterotrophic protists are known primarily as a large composite mass, the plasmodium, in which single nuclei are suspended in a common 'naked' cytoplasm that is surrounded by a plasma membrane. Here we summarize the contents of de Bary's 1859 publication and highlight the significance of this scientific classic with respect to the establishment of the kingdom Protoctista (protists such as amoebae), the development of the protoplasmic theory of the cell, the introduction of the concept of symbiosis and the rejection of the dogma of spontaneous generation. We describe the life cycle of the myxomycetes, present new observations on the myxamoebae and propose a higher-order phylogeny based on elongation factor-1 alpha gene sequences. Our results document the congruence between the morphology-based taxonomy of the myxomycetes and molecular data. In addition, we show that free-living amoebae, common protists in the soil, are among the closest living relatives of the myxomycetes and conclude that de Bary's 'Amoeba-hypothesis' on the evolutionary origin of the plasmodial slime molds may have been correct.

  9. Eumycetozoa = Amoebozoa?: SSUrDNA phylogeny of protosteloid slime molds and its significance for the amoebozoan supergroup.

    PubMed

    Shadwick, Lora L; Spiegel, Frederick W; Shadwick, John D L; Brown, Matthew W; Silberman, Jeffrey D

    2009-08-25

    Amoebae that make fruiting bodies consisting of a stalk and spores and classified as closely related to the myxogastrids have classically been placed in the taxon Eumycetozoa. Traditionally, there are three groups comprising Eumycetozoa: myxogastrids, dictyostelids, and the so-called protostelids. Dictyostelids and myxogastrids both make multicellular fruiting bodies that may contain hundreds of spores. Protostelids are those amoebae that make simple fruiting bodies consisting of a stalk and one or a few spores. Protostelid-like organisms have been suggested as the progenitors of the myxogastrids and dictyostelids, and they have been used to formulate hypotheses on the evolution of fruiting within the group. Molecular phylogenies have been published for both myxogastrids and dictyostelids, but little molecular phylogenetic work has been done on the protostelids. Here we provide phylogenetic trees based on the small subunit ribosomal RNA gene (SSU) that include 21 protostelids along with publicly available sequences from a wide variety of amoebae and other eukaryotes. SSU trees recover seven well supported clades that contain protostelids but do not appear to be specifically related to one another and are often interspersed among established groups of amoebae that have never been reported to fruit. In fact, we show that at least two taxa unambiguously belong to amoebozoan lineages where fruiting has never been reported. These analyses indicate that we can reject a monophyletic Eumycetozoa, s.l. For this reason, we will hereafter refer to those slime molds with simple fruiting as protosteloid amoebae and/or protosteloid slime molds, not as protostelids. These results add to our understanding of amoebozoan biodiversity, and demonstrate that the paradigms for understanding both nonfruiting and sporulating amoebae must be integrated. Finally, we suggest strategies for future research on protosteloid amoebae and nonfruiting amoebae, and discuss the impact of this work

  10. In the shadow of Darwin: Anton de Bary's origin of myxomycetology and a molecular phylogeny of the plasmodial slime molds.

    PubMed

    Hoppe, T; Kutschera, U

    2010-06-01

    In his Origin of Species (John Murray, London, 1859), Charles Darwin described the theory of descent with modification by means of natural selection and postulated that all life may have evolved from one or a few simple kinds of organisms. However, Darwin's concept of evolutionary change is entirely based on observations of populations of animals and plants. He briefly mentioned 'lower algae', but ignored amoebae, bacteria and other micro-organisms. In 1859, Anton de Bary, the founder of mycology and plant pathology, published a seminal paper on the biology and taxonomy of the plasmodial slime molds (myxomycetes). These heterotrophic protists are known primarily as a large composite mass, the plasmodium, in which single nuclei are suspended in a common 'naked' cytoplasm that is surrounded by a plasma membrane. Here we summarize the contents of de Bary's 1859 publication and highlight the significance of this scientific classic with respect to the establishment of the kingdom Protoctista (protists such as amoebae), the development of the protoplasmic theory of the cell, the introduction of the concept of symbiosis and the rejection of the dogma of spontaneous generation. We describe the life cycle of the myxomycetes, present new observations on the myxamoebae and propose a higher-order phylogeny based on elongation factor-1 alpha gene sequences. Our results document the congruence between the morphology-based taxonomy of the myxomycetes and molecular data. In addition, we show that free-living amoebae, common protists in the soil, are among the closest living relatives of the myxomycetes and conclude that de Bary's 'Amoeba-hypothesis' on the evolutionary origin of the plasmodial slime molds may have been correct. PMID:19997788

  11. Antibacterial and Anti-inflammatory Activities of Ppc-1, Active Principle of the Cellular Slime Mold Polysphondylium pseudo-candidum.

    PubMed

    Azelmat, Jabrane; Fiorito, Serena; Genovese, Salvatore; Epifano, Francesco; Grenier, Daniel

    2015-01-01

    The diisopentenyloxy quinolobactin derivative 3-methylbut-2-enyl-4-methoxy-8-[(3-methylbut-2-enyl)oxy] quinoline-2-carboxylate, also named as Ppc-1, has been initially isolated from the fruiting bodies of the cellular slime mold Polysphondylium pseudo-candidum. Given that few data are available in the literature concerning the biological properties of this compound, this study was undertaken to evaluate its antibacterial and anti-inflammatory properties. Ppc-1 exerted antibacterial activity on the Gram negative periodontopathogen Porphyromonas gingivalis, while it had no such effect on the other bacterial species tested. The antibacterial activity of Ppc-1 appeared to result from its ability to permeate the cell membrane. Using the U937-3xκB-LUC human monocytic cell line, Ppc-1 was found to dose-dependently inhibit the lipopolysaccharide-induced NF-κB activation, a signaling pathway that has been associated with inflammatory mediator secretion. In conclusion, Ppc-1, by exhibiting a dual mode of action including antibacterial and anti-inflammatory activities, may represent a promising targeted therapeutic agent for periodontal diseases.

  12. Rhythmicity in the protoplasmic streaming of a slime mold, Physarum polycephalum. I. A statistical analysis of the electric potential rhythm.

    PubMed

    KISHIMOTO, U

    1958-07-20

    The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of the back and forth protoplasmic streaming along the strand. Generally some phase difference is observed between them. Periods of the electric potential rhythm show a Gaussian distribution. Amplitudes give a somewhat different distribution curve. Wave forms are not always simple harmonic ones, but are distorted more or less. However, auto-correlation analysis proves that there is a dominant rhythm of a nearly constant period which coincides with the mean period of the Gaussian distribution curve. Calculations made on an assumption that the electric potential rhythm is the result of many elementary rhythms (i.e., same periodicity, arbitrary phase angles) distributed throughout the plasmodium, give a satisfactory coincidence with the observed distribution for the amplitude. The predominance of a rhythm of a nearly constant periodicity suggests the existence of well organized interactions among components of a contractile protein network, the rhythmic deformation of which is supposed to be responsible for the protoplasmic streaming and for the electric potential rhythm.

  13. Identification of a novel PSR as the substrate of an SR protein kinase in the true slime mold.

    PubMed

    Zhang, Yong-Xia; Xing, Miao; Fei, Xuan; Zhang, Jian-Hua; Tian, Sheng-Li; Li, Ming-Hua; Liu, Shi-De

    2011-03-01

    Here, a novel cDNA encoding a serine/arginine (SR)-rich protein, designated PSR, was isolated from the true slime mold Physarum polycephalum and expressed in Escherichia coli. The deduced amino acid (aa) sequence reveals that PSR contains RS repeats at its C-terminus, similar to the conventional PSRPK substrate ASF/SF2. To study the novel protein, we generated a variety of mutant constructs by PCR and site-directed mutagenesis. Our analysis indicated that the purified recombinant PSR was phosphorylated by PSRPK in vitro and the SR-rich domain (amino acids 460-469) in the PSR protein was required for phosphorylation. In addition, removal of the docking motif (amino acids 424-450) from PSR significantly reduced the overall catalytic efficiency of the phosphorylation reaction. We also found that the conserved ATP-binding region (62)LGWGHFSTVWLAIDEKNGGREVALK(86) and the serine/threonine protein kinases active-site signature (184)IIHTDLKPENVLL(196) of PSRPK played a crucial role in substrate phosphorylation and Lys(86) and Asp(188) were crucial for PSRPK phosphorylation of PSR. These results suggest that PSR is a novel SR-related protein that is phosphorylated by PSRPK.

  14. The TOM Complex of Amoebozoans: the Cases of the Amoeba Acanthamoeba castellanii and the Slime Mold Dictyostelium discoideum.

    PubMed

    Wojtkowska, Małgorzata; Buczek, Dorota; Stobienia, Olgierd; Karachitos, Andonis; Antoniewicz, Monika; Slocinska, Małgorzata; Makałowski, Wojciech; Kmita, Hanna

    2015-07-01

    Protein import into mitochondria requires a wide variety of proteins, forming complexes in both mitochondrial membranes. The TOM complex (translocase of the outer membrane) is responsible for decoding of targeting signals, translocation of imported proteins across or into the outer membrane, and their subsequent sorting. Thus the TOM complex is regarded as the main gate into mitochondria for imported proteins. Available data indicate that mitochondria of representative organisms from across the major phylogenetic lineages of eukaryotes differ in subunit organization of the TOM complex. The subunit organization of the TOM complex in the Amoebozoa is still elusive, so we decided to investigate its organization in the soil amoeba Acanthamoeba castellanii and the slime mold Dictyostelium discoideum. They represent two major subclades of the Amoebozoa: the Lobosa and Conosa, respectively. Our results confirm the presence of Tom70, Tom40 and Tom7 in the A. castellanii and D. discoideum TOM complex, while the presence of Tom22 and Tom20 is less supported. Interestingly, the Tom proteins display the highest similarity to Opisthokonta cognate proteins, with the exception of Tom40. Thus representatives of two major subclades of the Amoebozoa appear to be similar in organization of the TOM complex, despite differences in their lifestyle. PMID:26074248

  15. Antibacterial and Anti-inflammatory Activities of Ppc-1, Active Principle of the Cellular Slime Mold Polysphondylium pseudo-candidum.

    PubMed

    Azelmat, Jabrane; Fiorito, Serena; Genovese, Salvatore; Epifano, Francesco; Grenier, Daniel

    2015-01-01

    The diisopentenyloxy quinolobactin derivative 3-methylbut-2-enyl-4-methoxy-8-[(3-methylbut-2-enyl)oxy] quinoline-2-carboxylate, also named as Ppc-1, has been initially isolated from the fruiting bodies of the cellular slime mold Polysphondylium pseudo-candidum. Given that few data are available in the literature concerning the biological properties of this compound, this study was undertaken to evaluate its antibacterial and anti-inflammatory properties. Ppc-1 exerted antibacterial activity on the Gram negative periodontopathogen Porphyromonas gingivalis, while it had no such effect on the other bacterial species tested. The antibacterial activity of Ppc-1 appeared to result from its ability to permeate the cell membrane. Using the U937-3xκB-LUC human monocytic cell line, Ppc-1 was found to dose-dependently inhibit the lipopolysaccharide-induced NF-κB activation, a signaling pathway that has been associated with inflammatory mediator secretion. In conclusion, Ppc-1, by exhibiting a dual mode of action including antibacterial and anti-inflammatory activities, may represent a promising targeted therapeutic agent for periodontal diseases. PMID:25925558

  16. The TOM Complex of Amoebozoans: the Cases of the Amoeba Acanthamoeba castellanii and the Slime Mold Dictyostelium discoideum.

    PubMed

    Wojtkowska, Małgorzata; Buczek, Dorota; Stobienia, Olgierd; Karachitos, Andonis; Antoniewicz, Monika; Slocinska, Małgorzata; Makałowski, Wojciech; Kmita, Hanna

    2015-07-01

    Protein import into mitochondria requires a wide variety of proteins, forming complexes in both mitochondrial membranes. The TOM complex (translocase of the outer membrane) is responsible for decoding of targeting signals, translocation of imported proteins across or into the outer membrane, and their subsequent sorting. Thus the TOM complex is regarded as the main gate into mitochondria for imported proteins. Available data indicate that mitochondria of representative organisms from across the major phylogenetic lineages of eukaryotes differ in subunit organization of the TOM complex. The subunit organization of the TOM complex in the Amoebozoa is still elusive, so we decided to investigate its organization in the soil amoeba Acanthamoeba castellanii and the slime mold Dictyostelium discoideum. They represent two major subclades of the Amoebozoa: the Lobosa and Conosa, respectively. Our results confirm the presence of Tom70, Tom40 and Tom7 in the A. castellanii and D. discoideum TOM complex, while the presence of Tom22 and Tom20 is less supported. Interestingly, the Tom proteins display the highest similarity to Opisthokonta cognate proteins, with the exception of Tom40. Thus representatives of two major subclades of the Amoebozoa appear to be similar in organization of the TOM complex, despite differences in their lifestyle.

  17. MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD

    PubMed Central

    ŽITNIK, MARINKA; ZUPAN, BLAŽ

    2014-01-01

    The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565

  18. Rhythmicity in the protoplasmic streaming of a slime mold, Physarum polycephalum. II. Theoretical treatment of the electric potential rhythm.

    PubMed

    KISHIMOTO, U

    1958-07-20

    The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of back and forth protoplasmic streaming along the strand. When atmospheric pressure at a part of the plasmodium is increased (about 10 cm. H(2)O), the electric potential at this part becomes positive (0 to 20 mv.) to another part with a time constant of 2 to 15 minutes. If the atmospheric pressure at a part of the plasmodium is changed (about 10 cm. H(2)O) periodically, the electric potential rhythm also changes with the same period as that of the applied pressure change, and the amplitude of the former grows to a new level (i.e., forced oscillation). The electric potential rhythm, in this case, is generally delayed about 90 degrees in phase angle from the external pressure change. The period of the electric potential rhythm which coincided with that of the pressure change is maintained for a while after stopping the application of the pressure change, if the period is not much different from the native flow rhythm. Such a pressure effect is brought about by the forced transport of protoplasm and is reversible as a rule. In the statistical analysis made by Kishimoto (1958) and in the rheological treatment made in the report, the rhythmic deformation of the contractile protein networks is supposed to be the cause of the protoplasmic flow along the strand and of the electric potential rhythm. The role of such submicroscopic networks in the protoplasm in various kinds of protoplasmic movement is emphasized.

  19. Assignment of disulfide bonds in gp64, a putative cell-cell adhesion protein of Polysphondylium pallidum. Presence of Sushi domains in the cellular slime mold protein.

    PubMed

    Saito, T; Kumazaki, T; Ochiai, H

    1994-11-18

    The 64-kDa membrane-bound glycoprotein of the cellular slime mold Polysphondylium pallidum (referred to as gp64), seems to be implicated in cell-cell adhesion. Previously we have isolated a full-length gp64 cDNA, determined its nucleotide sequence, and found that all cysteine residues in the protein are involved in the formation of disulfide bonds. The disulfide arrangement of the 36 cysteines in gp64 was established by analysis of proteolytically cleaved protein and sequence analysis of cystine-containing fragments. Since gp64 has 36 Cys residues, 18 disulfide bonds must exist and the positions of 15 of them were determined. The 15 disulfide bonds in gp64 constitute five characteristic, so-called Sushi domains. In a Sushi domain, the first Cys in a sequence is connected to the third one and the second Cys to the fourth one. This is the first report describing the presence of Sushi domains in a cellular slime mold protein. From these data, gp64 appears to be distinct from all other previously described cell-adhesion proteins.

  20. Slime Factory.

    ERIC Educational Resources Information Center

    Fowler, Marilyn L.

    1992-01-01

    Describes a classroom activity using slime, a colloid: it behaves like both a solid and liquid. Explains how slime can be produced from guar gum. An activity where students work in teams and become a slime factory is presented. (PR)

  1. Molds

    MedlinePlus

    Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...

  2. Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.

    PubMed

    Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu

    2012-03-01

    In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms.

  3. On the applicability of the decentralized control mechanism extracted from the true slime mold: a robotic case study with a serpentine robot.

    PubMed

    Sato, Takahide; Kano, Takeshi; Ishiguro, Akio

    2011-06-01

    A systematic method for an autonomous decentralized control system is still lacking, despite its appealing concept. In order to alleviate this, we focused on the amoeboid locomotion of the true slime mold, and extracted a design scheme for the decentralized control mechanism that leads to adaptive behavior for the entire system, based on the so-called discrepancy function. In this paper, we intensively investigate the universality of this design scheme by applying it to a different type of locomotion based on a 'synthetic approach'. As a first step, we implement this design scheme to the control of a real physical two-dimensional serpentine robot that exhibits slithering locomotion. The experimental results show that the robot exhibits adaptive behavior and responds to the environmental changes; it is also robust against malfunctions of the body segments due to the local sensory feedback control that is based on the discrepancy function. We expect the results to shed new light on the methodology of autonomous decentralized control systems.

  4. Toxicity assessment of diesel- and metal-contaminated soils through elutriate and solid phase assays with the slime mold Dictyostelium discoideum.

    PubMed

    Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan

    2016-06-01

    A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC.

  5. A fluid-filled soft robot that exhibits spontaneous switching among versatile spatiotemporal oscillatory patterns inspired by the true slime mold.

    PubMed

    Umedachi, Takuya; Idei, Ryo; Ito, Kentaro; Ishiguro, Akio

    2013-01-01

    Behavioral diversity is an essential feature of living systems, enabling them to exhibit adaptive behavior in hostile and dynamically changing environments. However, traditional engineering approaches strive to avoid, or suppress, the behavioral diversity in artificial systems to achieve high performance in specific environments for given tasks. The goals of this research include understanding how living systems exhibit behavioral diversity and using these findings to build lifelike robots that exhibit truly adaptive behaviors. To this end, we have focused on one of the most primitive forms of intelligence concerning behavioral diversity, namely, a plasmodium of true slime mold. The plasmodium is a large amoeba-like unicellular organism that does not possess any nervous system or specialized organs. However, it exhibits versatile spatiotemporal oscillatory patterns and switches spontaneously between these. Inspired by the plasmodium, we built a mathematical model that exhibits versatile oscillatory patterns and spontaneously transitions between these patterns. This model demonstrates that, in contrast to coupled nonlinear oscillators with a well-designed complex diffusion network, physically interacting mechanosensory oscillators are capable of generating versatile oscillatory patterns without changing any parameters. Thus, the results are expected to shed new light on the design scheme for lifelike robots that exhibit amazingly versatile and adaptive behaviors. PMID:23186349

  6. A fluid-filled soft robot that exhibits spontaneous switching among versatile spatiotemporal oscillatory patterns inspired by the true slime mold.

    PubMed

    Umedachi, Takuya; Idei, Ryo; Ito, Kentaro; Ishiguro, Akio

    2013-01-01

    Behavioral diversity is an essential feature of living systems, enabling them to exhibit adaptive behavior in hostile and dynamically changing environments. However, traditional engineering approaches strive to avoid, or suppress, the behavioral diversity in artificial systems to achieve high performance in specific environments for given tasks. The goals of this research include understanding how living systems exhibit behavioral diversity and using these findings to build lifelike robots that exhibit truly adaptive behaviors. To this end, we have focused on one of the most primitive forms of intelligence concerning behavioral diversity, namely, a plasmodium of true slime mold. The plasmodium is a large amoeba-like unicellular organism that does not possess any nervous system or specialized organs. However, it exhibits versatile spatiotemporal oscillatory patterns and switches spontaneously between these. Inspired by the plasmodium, we built a mathematical model that exhibits versatile oscillatory patterns and spontaneously transitions between these patterns. This model demonstrates that, in contrast to coupled nonlinear oscillators with a well-designed complex diffusion network, physically interacting mechanosensory oscillators are capable of generating versatile oscillatory patterns without changing any parameters. Thus, the results are expected to shed new light on the design scheme for lifelike robots that exhibit amazingly versatile and adaptive behaviors.

  7. Toxicity assessment of diesel- and metal-contaminated soils through elutriate and solid phase assays with the slime mold Dictyostelium discoideum.

    PubMed

    Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan

    2016-06-01

    A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC. PMID:26450765

  8. Functional expression of Ca²⁺ dependent mammalian transmembrane gap junction protein Cx43 in slime mold Dictyostelium discoideum.

    PubMed

    Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu

    2012-03-01

    In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. PMID:22330805

  9. Spontaneous switching among multiple spatio-temporal patterns in three-oscillator systems constructed with oscillatory cells of true slime mold

    NASA Astrophysics Data System (ADS)

    Takamatsu, Atsuko

    2006-11-01

    Three-oscillator systems with plasmodia of true slime mold, Physarum polycephalum, which is an oscillatory amoeba-like unicellular organism, were experimentally constructed and their spatio-temporal patterns were investigated. Three typical spatio-temporal patterns were found: rotation ( R), partial in-phase ( PI), and partial anti-phase with double frequency ( PA). In pattern R, phase differences between adjacent oscillators were almost 120 ∘. In pattern PI, two oscillators were in-phase and the third oscillator showed anti-phase against the two oscillators. In pattern PA, two oscillators showed anti-phase and the third oscillator showed frequency doubling oscillation with small amplitude. Actually each pattern is not perfectly stable but quasi-stable. Interestingly, the system shows spontaneous switching among the multiple quasi-stable patterns. Statistical analyses revealed a characteristic in the residence time of each pattern: the histograms seem to have Gamma-like distribution form but with a sharp peak and a tail on the side of long period. That suggests the attractor of this system has complex structure composed of at least three types of sub-attractors: a “Gamma attractor”-involved with several Poisson processes, a “deterministic attractor”-the residence time is deterministic, and a “stable attractor”-each pattern is stable. When the coupling strength was small, only the Gamma attractor was observed and switching behavior among patterns R, PI, and PA almost always via an asynchronous pattern named O. A conjecture is as follows: Internal/external noise exposes each pattern of R, PI, and PA coexisting around bifurcation points: That is observed as the Gamma attractor. As coupling strength increases, the deterministic attractor appears then followed by the stable attractor, always accompanied with the Gamma attractor. Switching behavior could be caused by regular existence of the Gamma attractor.

  10. Slime mould processors, logic gates and sensors.

    PubMed

    Adamatzky, A

    2015-07-28

    A heterotic, or hybrid, computation implies that two or more substrates of different physical nature are merged into a single device with indistinguishable parts. These hybrid devices then undertake coherent acts on programmable and sensible processing of information. We study the potential of heterotic computers using slime mould acting under the guidance of chemical, mechanical and optical stimuli. Plasmodium of acellular slime mould Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioural morphological patterns in response to changing environmental conditions. Given data represented by chemical or physical stimuli, we can employ and modify the behaviour of the slime mould to make it solve a range of computing and sensing tasks. We overview results of laboratory experimental studies on prototyping of the slime mould morphological processors for approximation of Voronoi diagrams, planar shapes and solving mazes, and discuss logic gates implemented via collision of active growing zones and tactile responses of P. polycephalum. We also overview a range of electronic components--memristor, chemical, tactile and colour sensors-made of the slime mould.

  11. Lessons: Science. Slime!

    ERIC Educational Resources Information Center

    VanCleave, Janice

    2000-01-01

    Describes a science activity in which students make a non-Newtonian fluid (slime), which has both solid and liquid properties. After reviewing the shape and volume of solids and volume of liquids, students make the slime using glue, liquid starch, and food coloring. They can experiment by rolling and dropping slime balls and by pulling the slime…

  12. Slime mould biotechnology

    NASA Astrophysics Data System (ADS)

    Mayne, Richard

    2015-03-01

    Slime mould computing is an inherently multi-disciplinary subfield of unconventional computing that draws upon aspects of not only theoretical computer science and electronics, but also the natural sciences. This chapter focuses on the biology of slime moulds and expounds the viewpoint that a deep, intuitive understanding of slime mould life processes is a fundamental requirement for understanding -- and, hence, harnessing -- the incredible behaviour patterns we may characterise as "computation"...

  13. On creativity of slime mould

    NASA Astrophysics Data System (ADS)

    Adamatzky, Andrew; Armstrong, Rachel; Jones, Jeff; Gunji, Yukio-Pegio

    2013-07-01

    Slime mould Physarum polycephalum is large single cell with intriguingly smart behaviour. The slime mould shows outstanding abilities to adapt its protoplasmic network to varying environmental conditions. The slime mould can solve tasks of computational geometry, image processing, logics and arithmetics when data are represented by configurations of attractants and repellents. We attempt to map behavioural patterns of slime onto the cognitive control vs. schizotypy spectrum phase space and thus interpret slime mould's activity in terms of creativity.

  14. Mold Allergy

    MedlinePlus

    ... navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores ...

  15. Physiology, biomechanics, and biomimetics of hagfish slime.

    PubMed

    Fudge, Douglas S; Schorno, Sarah; Ferraro, Shannon

    2015-01-01

    Hagfishes thwart attacks by fish predators by producing liters of defensive slime. The slime is produced when slime gland exudate is released into the predator's mouth, where it deploys in a fraction of a second and clogs the gills. Slime exudate is composed mainly of secretory products from two cell types, gland mucous cells and gland thread cells, which produce the mucous and fibrous components of the slime, respectively. Here, we review what is known about the composition of the slime, morphology of the slime gland, and physiology of the cells that produce the slime. We also discuss several of the mechanisms involved in the deployment of both mucous and thread cells during the transition from thick glandular exudate to ultradilute material. We review biomechanical aspects of the slime, along with recent efforts to produce biomimetic slime thread analogs, and end with a discussion of how hagfish slime may have evolved.

  16. The perfect slime.

    PubMed

    Flemming, Hans-Curt

    2011-09-01

    The biofilm mode of life is only possible because biofilm organisms are transiently immobilized in a matrix of extracellular polymeric substances (EPS), also known as "slime". The matrix can be considered an emerging property of microorganisms, allowing them to form stable synergistic consortia, supporting interaction by signaling molecules and horizontal gene transfer and, eventually being activated by extracellular enzymes which turn the matrix into an external digestion system. As unsightly it is, this matrix is--although seemingly stochastic--a highly differentiated and functional immediate environment for biofilm cells.

  17. Mold Allergy

    MedlinePlus

    ... the Allergist Health Professionals Partners Media Donate Allergies Mold Allergy What Is a Mold Allergy? If you have an allergy that occurs ... or basement. What Are the Symptoms of a Mold Allergy? The symptoms of mold allergy are very ...

  18. Cellular Motility--Experiments on Contractile and Motile Mechanisms in the Slime Mould, Physarum Polycephalum

    ERIC Educational Resources Information Center

    Holmes, R. P.; Stewart, P. R.

    1977-01-01

    Actin and myosin have now been demonstrated to be important constituents of many eukaryotic cells. Their role is primarily that of a contractile system underlying all aspects of cellular motility. Described here is a simple experimental system to demonstrate quantitatively aspects of motility and its regulation in a slime mold. (Author/MA)

  19. Stanley Corrsin Award Talk: Fluid Mechanics of Fungi and Slime

    NASA Astrophysics Data System (ADS)

    Brenner, Michael

    2013-11-01

    There are interesting fluid mechanics problems everywhere, even in the most lowly and hidden corners of forest floors. Here I discuss some questions we have been working on in recent years involving fungi and slime. A critical issue for the ecology of fungi and slime is nutrient availability: nutrient sources are highly heterogeneous, and strategies are necessary to find food when it runs out. In the fungal phylum Ascomycota, spore dispersal is the primary mechanism for finding new food sources. The defining feature of this phylum is the ascus, a fluid filled sac from which spores are ejected, through a build up in osmotic pressure. We outline the (largely fluid mechanical) design constraints on this ejection strategy, and demonstrate how it provides strong constraints for the diverse morphologies of spores and asci found in nature. The core of the argument revisits a classical problem in elastohydrodynamic lubrication from a different perspective. A completely different strategy for finding new nutrient is found by slime molds and fungi that stretch out - as a single organism- over enormous areas (up to hectares) over forest floors. As a model problem we study the slime mold Physarum polycephalum, which forages with a large network of connected tubes on the forest floors. Localized regions in the network find nutrient sources and then pump the nutrients throughout the entire organism. We discuss fluid mechanical mechanisms for coordinating this transport, which generalize peristalsis to pumping in a heterogeneous network. We give a preliminary discussion to how physarum can detect a nutrient source and pump the nutrient throughout the organism.

  20. Dramatization of Polymeric Bonding Using Slime.

    ERIC Educational Resources Information Center

    Sarquis, A. M.

    1986-01-01

    Describes a typical presentation in which slime is prepared for young, concrete operational students. Includes the procedures used and a summary written by a fourth-grade teacher after completing the slime experiment with her class. (JN)

  1. Slime mould fluids and networks from an artist's point of view

    NASA Astrophysics Data System (ADS)

    Schubert, Theresa

    2015-03-01

    Slime mould is a fascinating creature. It is the largest acellular organism known on this planet and a primordial being that had no need to undergo evolution. In nature, this proves it to be a very successful creature. As a biological curiosity, the species P. polycephalum serves as a model for network optimisation and cell motility in scientific experiments. It can be interpreted as an "agent" which distributively solves geometrical problems. The starting points for the experiments displayed here are sophisticated setups or growing environments that allow the organism to propagate and grow, yet under conditions that the artist has predefined, sometimes with interaction between human organisms...

  2. MOLDING APPARATUS

    DOEpatents

    Fleming, P.G.

    1963-10-01

    Molding apparatus capable of coating multiple elements each molding cycle is described. The apparatus comprises a centrally disposed reservoir penetrated by a plurality of circumferentially arranged and radially extending passageways. These passageways, in turn, communicate with passages in a separable annular member that retains selectively configured molds and mold seating arrangements. Each mold, which is readily removable from its respective seat, is adapted to retain an element therein in spaced relation to the interior of the mold by utilizing element positioning means within the mold seat and the mold so that coating material may flow about the entire outer surface of the element. (AEC)

  3. Evolving Transport Networks With Cellular Automata Models Inspired by Slime Mould.

    PubMed

    Tsompanas, Michail-Antisthenis I; Sirakoulis, Georgios Ch; Adamatzky, Andrew I

    2015-09-01

    Man-made transport networks and their design are closely related to the shortest path problem and considered amongst the most debated problems of computational intelligence. Apart from using conventional or bio-inspired computer algorithms, many researchers tried to solve this kind of problem using biological computing substrates, gas-discharge solvers, prototypes of a mobile droplet, and hot ice computers. In this aspect, another example of biological computer is the plasmodium of acellular slime mould Physarum polycephalum (P. polycephalum), which is a large single cell visible by an unaided eye and has been proven as a reliable living substrate for implementing biological computing devices for computational geometry, graph-theoretical problems, and optimization and imitation of transport networks. Although P. polycephalum is easy to experiment with, computing devices built with the living slime mould are extremely slow; it takes slime mould days to execute a computation. Consequently, mapping key computing mechanisms of the slime mould onto silicon would allow us to produce efficient bio-inspired computing devices to tackle with hard to solve computational intelligence problems like the aforementioned. Toward this direction, a cellular automaton (CA)-based, Physarum-inspired, network designing model is proposed. This novel CA-based model is inspired by the propagating strategy, the formation of tubular networks, and the computing abilities of the plasmodium of P. polycephalum. The results delivered by the CA model demonstrate a good match with several previously published results of experimental laboratory studies on imitation of man-made transport networks with P. polycephalum. Consequently, the proposed CA model can be used as a virtual, easy-to-access, and biomimicking laboratory emulator that will economize large time periods needed for biological experiments while producing networks almost identical to the tubular networks of the real-slime mould.

  4. On chirality of slime mould.

    PubMed

    Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael

    2016-02-01

    Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown.

  5. On chirality of slime mould.

    PubMed

    Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael

    2016-02-01

    Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown. PMID:26747637

  6. Stalk cell differentiation without polyketides in the cellular slime mold.

    PubMed

    Sato, Yukie G; Suarez, Teresa; Saito, Tamao

    2016-07-01

    Polyketides induce prestalk cell differentiation in Dictyostelium. In the double-knockout mutant of the SteelyA and B polyketide synthases, most of the pstA cells-the major part of the prestalk cells-are lost, and we show by whole mount in situ hybridization that expression of prestalk genes is also reduced. Treatment of the double-knockout mutant with the PKS inhibitor cerulenin gave a further reduction, but some pstA cells still remained in the tip region, suggesting the existence of a polyketide-independent subtype of pstA cells. The double-knockout mutant and cerulenin-treated parental Ax2 cells form fruiting bodies with fragile, single-cell layered stalks after cerulenin treatment. Our results indicate that most pstA cells are induced by polyketides, but the pstA cells at the very tip of the slug are induced in some other way. In addition, a fruiting body with a single-cell layered, vacuolated stalk can form without polyketides.

  7. Alkylbenzoquinone involved in development of cellular slime molds.

    PubMed

    Takaya, Yoshiaki; Hotta, Rie; Fujiwara, Kenshu; Otani, Risa; Uchiyama, Yurika; Sakakibara, Mizuki; Fukuda, Eri; Niwa, Masatake; Inouye, Kei; Oohata, Akiko A

    2014-07-18

    The structure of the prespore-cell-promoting factor from Dictyostelium discoideum was determined to be 2-hydroxy-5-methyl-6-pentylbenzoquinone. The synthetic compound has prespore-cell-promoting activity similar to the natural one, with half-maximal induction at a concentration as low as 40 pM. It was also found that the factor induces aggregation in an aggregation-deficient mutant of a related species, Polysphodilium violaceum. Both these activities are sensitive to positional isomerism with the 6-methyl-5-pentyl isomer showing no detectable activity.

  8. Stalk cell differentiation without polyketides in the cellular slime mold.

    PubMed

    Sato, Yukie G; Suarez, Teresa; Saito, Tamao

    2016-07-01

    Polyketides induce prestalk cell differentiation in Dictyostelium. In the double-knockout mutant of the SteelyA and B polyketide synthases, most of the pstA cells-the major part of the prestalk cells-are lost, and we show by whole mount in situ hybridization that expression of prestalk genes is also reduced. Treatment of the double-knockout mutant with the PKS inhibitor cerulenin gave a further reduction, but some pstA cells still remained in the tip region, suggesting the existence of a polyketide-independent subtype of pstA cells. The double-knockout mutant and cerulenin-treated parental Ax2 cells form fruiting bodies with fragile, single-cell layered stalks after cerulenin treatment. Our results indicate that most pstA cells are induced by polyketides, but the pstA cells at the very tip of the slug are induced in some other way. In addition, a fruiting body with a single-cell layered, vacuolated stalk can form without polyketides. PMID:27305283

  9. Composition of Pseudomonas aeruginosa slime

    PubMed Central

    Brown, M. R. W.; Foster, J. H. Scott; Clamp, J. R.

    1969-01-01

    1. The slime produced by eight strains of Pseudomonas aeruginosa on a number of different media was demonstrated to be qualitatively the same. Small quantitative differences may be occasioned by differences in the extraction procedure, the growth medium or the strain of organism used. 2. The slime was shown to be predominantly polysaccharide with some nucleic acid material and a small amount of protein. 3. The hydrolysed polysaccharide fraction consists mainly of glucose with smaller amounts of mannose. This accounts for some 50–60% of the total slime. In addition, there is some 5% of hyaluronic acid. The nucleic acid material represents approx. 20% of the total weight, and is composed of both RNA and DNA. 4. Minor components are protein, rhamnose and glucosamine, the protein being less than 5% of the total. 5. Hyaluronic acid is produced in greater quantities from nutrient broth than from chemically defined media, and is more firmly attached to the cells than the other components. PMID:4240755

  10. Inquiry, Slime, and the National Standards

    ERIC Educational Resources Information Center

    Krantz, Patrick D.

    2004-01-01

    This elementary activity follows the 5-E Learning Cycle as described by Bybee et al. (1989) and integrates literature from Dr. Seuss. Students observe and identify characteristics of several slime substances and must make comparisons to determine which one most closely resembles the slime substance described by Dr. Seuss. To maximize this…

  11. Hydrogel Beads: The New Slime Lab?

    ERIC Educational Resources Information Center

    Brockway, Debra; Libera, Matthew; Welner, Heidi

    2011-01-01

    Creating slime fascinates students. Unfortunately, though intrigue is at its peak, the educational aspect of this activity is often minimal. This article describes a chemistry lab that closely relates to the slime lab and allows high school students to explore the concepts of chemical bonding, properties, and replacement reactions. It involves the…

  12. Acellular pertussis vaccines in China.

    PubMed

    Wang, Lichan; Lei, Dianliang; Zhang, Shumin

    2012-11-26

    In China, whole-cell pertussis (Pw) vaccines were produced in the early 1960s and acellular pertussis (Pa) vaccines were introduced in 1995. Pa vaccines have now almost completely replaced Pw vaccines in the national immunization program. To strengthen the regulation of vaccines used in China, a vaccine lot release system was established in 2001 and Pa vaccines have been included in the system since 2006. This paper mainly described the current status of production and the quality control measures in place for Pa vaccines; and analyses quality control test data accumulated between 2006 and 2010.

  13. ) Mold Fluxes

    NASA Astrophysics Data System (ADS)

    Seo, Myung-Duk; Shi, Cheng-Bin; Cho, Jung-Wook; Kim, Seon-Hyo

    2014-10-01

    The effects of basicity (CaO/SiO2), B2O3, and Li2O addition on the crystallization behaviors of lime-silica-based mold fluxes have been investigated by non-isothermal differential scanning calorimetry (DSC), field emission scanning electron microscopy, X-ray diffraction (XRD), and single hot thermocouple technique. It was found that the crystallization temperature of cuspidine increased with increasing the basicity of mold fluxes. The crystallization of wollastonite was suppressed with increasing the mold flux basicity due to the enhancement of cuspidine crystallization. The addition of B2O3 suppresses the crystallization of mold flux. The crystallization temperature of mold flux decreases with Li2O addition. The size of cuspidine increases, while the number of cuspidine decreases with increasing mold flux basicity. The morphology of cuspidine in mold fluxes with lower basicity is largely dendritic. The dendritic cuspidine in mold fluxes is composed of many fine cuspidine crystals. On the contrary, in mold fluxes with higher basicity, the cuspidine crystals are larger in size with mainly faceted morphology. The crystalline phase evolution was also calculated using a thermodynamic database, and compared with the experimental results determined by DSC and XRD. The results of thermodynamic calculation of crystalline phase formation are in accordance with the results determined by DSC and XRD.

  14. Mold Charlatans.

    ERIC Educational Resources Information Center

    Woody, Daniel

    2002-01-01

    Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)

  15. MOLD POLLUTION

    EPA Science Inventory

    Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...

  16. Allergies, asthma, and molds

    MedlinePlus

    Reactive airway - mold; Bronchial asthma - mold; Triggers - mold; Allergic rhinitis - pollen ... Things that make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are ...

  17. Recent advances in acellular regenerative tissue scaffolds.

    PubMed

    Protzman, Nicole M; Brigido, Stephen A

    2015-01-01

    The management of chronic wounds is a considerable challenge for foot and ankle surgeons. The well-established tenets of adequate vascular supply, debridement with eradication of infection, and offloading must be employed in the management of all extremity wounds. Regenerative scaffolds are a viable means of reestablishing a favorable wound environment. The matrix facilitates cell migration, chemoattraction, angiogenesis, wound bed granulation, and expedited wound closure. Although studies have demonstrated success with acellular matrices, a multimodal approach should always be employed to improve healing success. Negative pressure wound therapy, compression, offloading, and antibiotics are advocated to improve outcomes. Acellular graft selection requires a multifactorial analysis, taking into consideration the specific patient and wound characteristics as well as the differences between acellular matrices. Patient age, comorbidities, activity level, and ability to comply with protocol as well as wound etiology, duration, depth, surface area, exudate, bacterial burden, location, vascular status, ischemic status, and presentation are all critical components. To effectively choose a matrix, the clinician must have a comprehensive understanding of the products available and the data validating their use. The mechanisms by which the acellular matrix accelerates wound healing and increases the likelihood of wound healing continue to be investigated. However, it is clear that these acellular biologic tissue scaffolds are incorporating into the host tissue, with resultant revascularization and cellular repopulation. Moving forward, additional investigations examining the effectiveness of acellular biologic tissue scaffolds to improve healing in complex, nondiabetic wounds are warranted.

  18. Diversity of slime mould circuits

    NASA Astrophysics Data System (ADS)

    Grube, Martin

    2015-03-01

    Once fused from single amoebae to form an initial plasmodium, P. polycephalum and related species in the order Physarales continue growth via synchronous cell division and extension of the megacells by a contractile plasmodial vein network. These display the phenomenon of shuttle streaming, a rhythmic back-and-forth flow of the protoplasm within a tubular system at a period of approximately 1 to 2 min, with the frequency depending on the nutritional benefits. With time, this develops as a microfluidic circuitry that adapts patterns of contraction to size to optimise the transport throughout an organism. This control of fluid also creates dynamic changes in network architecture seen over time in an individual. Food quality is of considerable importance for slime mould growth dynamics...

  19. Interference with granulocyte function by Staphylococcus epidermidis slime.

    PubMed Central

    Johnson, G M; Lee, D A; Regelmann, W E; Gray, E D; Peters, G; Quie, P G

    1986-01-01

    The interaction of Staphylococcus epidermidis slime with human neutrophils (PMN) was examined by using isolated slime and allowing bacteria to elaborate slime and other extracellular products in situ. S. epidermidis slime was found to contain a chemoattractant. Incubation of PMN with 50 micrograms or more of slime per ml inhibited subsequent chemotaxis of the PMN to n-formyl-methionyl-leucyl-phenylalanine by 27% and to zymosan-activated serum by 44 to 67% with increasing slime concentrations. S. epidermidis slime stimulated little degranulation of untreated PMN. After pretreatment of PMN with 5 micrograms of cytochalasin b per ml, slime predominantly induced release of specific granule contents (33.8% lactoferrin release by 250 micrograms of slime per ml versus 10% myeloperoxidase release by 250 micrograms of slime per ml). By a surface phagocytosis assay, PMN uptake of radiolabeled S. epidermidis which were incubated for 18 h on a plastic surface for slime expression was less than that for S. epidermidis adhered to the plastic for 2 h or grown in unsupplemented nutrient broth. These results suggest that S. epidermidis slime interaction with PMN may be potentially detrimental to host defense and may contribute to the ability of this organism to persist on surfaces of foreign bodies in the vascular or central nervous system. PMID:3019888

  20. INGOT MOLD

    DOEpatents

    Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.

    1958-04-29

    An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.

  1. In vitro assessment of biodurability: acellular systems.

    PubMed Central

    de Meringo, A; Morscheidt, C; Thélohan, S; Tiesler, H

    1994-01-01

    The assessment of biodurability of man-made vitreous fibers is essential to the limitation of health hazards associated with human exposure to environments in which respirable fibers are present. In vitro acellular systems provide effective test methods of measuring fiber solubility provided care is taken to select the most suitable solvent and test conditions for the specific fiber type and dimension. PMID:7882955

  2. Slime mould gates, roads and sensors

    NASA Astrophysics Data System (ADS)

    Adamatzky, Andrew

    2015-03-01

    The photographs present a wide range of problems solved by the slime mould P. polycephalum: imitation of human-made transport pathways, realisation of Boolean logical gates, fabrication of self-repairing routable biowires, implementation of delay elements in computing circuits, computational geometry, sensors and a would-be nervous system...

  3. Cartilage oligomeric matrix protein enhances the vascularization of acellular nerves

    PubMed Central

    Cui, Wei-ling; Qiu, Long-hai; Lian, Jia-yan; Li, Jia-chun; Hu, Jun; Liu, Xiao-lin

    2016-01-01

    Vascularization of acellular nerves has been shown to contribute to nerve bridging. In this study, we used a 10-mm sciatic nerve defect model in rats to determine whether cartilage oligomeric matrix protein enhances the vascularization of injured acellular nerves. The rat nerve defects were treated with acellular nerve grafting (control group) alone or acellular nerve grafting combined with intraperitoneal injection of cartilage oligomeric matrix protein (experimental group). As shown through two-dimensional imaging, the vessels began to invade into the acellular nerve graft from both anastomotic ends at day 7 post-operation, and gradually covered the entire graft at day 21. The vascular density, vascular area, and the velocity of revascularization in the experimental group were all higher than those in the control group. These results indicate that cartilage oligomeric matrix protein enhances the vascularization of acellular nerves. PMID:27127495

  4. Recovering selenium from copper refinery slimes

    NASA Astrophysics Data System (ADS)

    Hyvärinen, Olli; Lindroos, Leo; Yllö, Erkki

    1989-07-01

    The selenium contained within copper refinery slimes may be recovered advantageously by roasting at about 600°C. While roasting in air is inefficient, roasting in a sulfating atmosphere enables practically complete selenium recovery. Based on laboratory tests, a new selenium recovery process was adopted at Outokumpu Copper Refinery. In this process, sulfation is achieved by feeding sulfur dioxide and oxygen into the roasting furnace.

  5. The coal slime slurry combustion technology

    SciTech Connect

    Li, Y.; Xu, Z.

    1997-12-31

    This paper presents the coal slime slurry combustion technology in circulating fluidized bed (CFB) boilers. The technique is that the slurry-based flow from the concentrator in the coal washery plant directly feeds into the fluidized bed by pump for combustion after a simple filtration and enrichment to an approximate concentration of 50% of coal. The coal slime slurry can burn in a CFB boiler alone or jointly with coal refuse. The technique has been used in a 35 t/h (6MWe) CFB for power generation. The result shows that the combustion efficiency is over 96% and boiler thermal efficiency is over 77%. As compared with burning coal refuse alone, the thermal efficiency was improved by 3--4 percent. This technology is simple, easy to operate and reliable. It is an effective way to utilize coal slime slurry. It has a practical significance for saving coal resources and reducing environmental pollution near coal mine areas. As a clean coal technology, it will result in great social, environmental and economic benefits.

  6. Acellular dermal matrix in abdominal wall reconstruction.

    PubMed

    Silverman, Ronald P

    2011-09-01

    Abdominal wall reconstruction is a complex and challenging surgical undertaking. While permanent prosthetic mesh is considered the gold standard for minimizing hernia recurrence, placement of synthetic mesh is sometimes imprudent due to contamination or risk of infection. Acellular dermal matrices (ADM) offer an exciting biologic alternative. This article provides a historical perspective on the evolution of complex ventral hernia repair leading up to and including the placement of ADM, an explanation of the biology of ADM as it relates to ventral hernia repair, and a description of the current indications, techniques, benefits, and shortcomings of its use in the abdominal wall.

  7. Acellular organ scaffolds for tumor tissue engineering

    NASA Astrophysics Data System (ADS)

    Guller, Anna; Trusova, Inna; Petersen, Elena; Shekhter, Anatoly; Kurkov, Alexander; Qian, Yi; Zvyagin, Andrei

    2015-12-01

    Rationale: Tissue engineering (TE) is an emerging alternative approach to create models of human malignant tumors for experimental oncology, personalized medicine and drug discovery studies. Being the bottom-up strategy, TE provides an opportunity to control and explore the role of every component of the model system, including cellular populations, supportive scaffolds and signalling molecules. Objectives: As an initial step to create a new ex vivo TE model of cancer, we optimized protocols to obtain organ-specific acellular matrices and evaluated their potential as TE scaffolds for culture of normal and tumor cells. Methods and results: Effective decellularization of animals' kidneys, ureter, lungs, heart, and liver has been achieved by detergent-based processing. The obtained scaffolds demonstrated biocompatibility and growthsupporting potential in combination with normal (Vero, MDCK) and tumor cell lines (C26, B16). Acellular scaffolds and TE constructs have been characterized and compared with morphological methods. Conclusions: The proposed methodology allows creation of sustainable 3D tumor TE constructs to explore the role of organ-specific cell-matrix interaction in tumorigenesis.

  8. Slime thickness evaluation of bored piles by electrical resistivity probe

    NASA Astrophysics Data System (ADS)

    Chun, Ok-Hyun; Yoon, Hyung-Koo; Park, Min-Chul; Lee, Jong-Sub

    2014-09-01

    The bottoms of bored piles are generally stacked with soil particles, both while boreholes are being drilled, and afterward. The stacked soils are called slime, and when loads are applied on the pile, increase the pile settlement. Thus to guarantee the end bearing capacity of bored piles, the slime thickness should be precisely detected. The objective of this study is to suggest a new method for evaluating the slime thickness, using temperature compensated electrical resistivity. Laboratory studies are performed in advance, to estimate and compare the resolution of the electrical resistivity probe (ERP) and time domain reflectometry (TDR). The electrical properties of the ERP and TDR are measured using coaxial type electrodes and parallel type two-wire electrodes, respectively. Penetration tests, conducted in the fully saturated sand-clay mixtures, demonstrate that the ERP produces a better resolution of layer detection than TDR. Thus, field application tests using the ERP with a diameter of 35.7 mm are conducted for the investigation of slime thickness in large diameter bored piles. Field tests show that the slime layers are clearly identified by the ERP: the electrical resistivity dramatically increases at the interface between the slurry and slime layer. The electrical resistivity in the slurry layer inversely correlates with the amount of circulated water. This study suggests that the new electrical resistivity method may be a useful method for the investigation of the slime thickness in bored piles.

  9. The relationship of root-cap slimes to proteins

    PubMed Central

    Wright, Kenneth; Northcote, D. H.

    1974-01-01

    1. The patterns of incorporation of radioactivity from d-[U-14C]glucose into the pectic components of sections of sycamore roots changed so that sections nearer the tip incorporated relatively more label into arabinose and galactose compared with uronic acid. 2. Radioactive maize root-cap slime was prepared and found to contain three water-soluble component polymers which were electrophoretically (i) neutral, (ii) weakly acidic and (iii) strongly acidic at pH6.5. The neutral component was a glucan. The other components, which could be degraded by trans-elimination, consisted of an acidic backbone chain composed of galacturonic acid and glucose, attached to which were different proportions of neutral sugars. Arabinose, galactose and fucose, the main neutral sugars of the weakly and strongly acidic materials, were absent from the neutral fraction. 3. Fucose was a major sugar in maize-root slime and in a slime of similar composition synthesized by a maize callus of shoot origin. Only trace amounts were found in sycamore, pea and wheat root tips, and in pectin prepared from maize roots and coleoptiles. A high proportion of fucose is therefore a chemical characteristic of maize slime, and slime synthesis indicated a state of differentiation of the tissue. 4. The similarity between the slime and pectin is discussed; slime is a form of pectin modified in such a way as to provide a hydrated protective coating around the root tip. ImagesPLATE 1 PMID:4855044

  10. Molds in the Environment

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... ng Việt [PDF - 273 KB] Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  11. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  12. Pyrotechnic filled molding powder

    DOEpatents

    Hartzel, Lawrence W.; Kettling, George E.

    1978-01-01

    The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.

  13. Hybrid slime mould-based system for unconventional computing

    NASA Astrophysics Data System (ADS)

    Berzina, T.; Dimonte, A.; Cifarelli, A.; Erokhin, V.

    2015-04-01

    Physarum polycephalum is considered to be promising for the realization of unconventional computational systems. In this work, we present results of three slime mould-based systems. We have demonstrated the possibility of transporting biocompatible microparticles using attractors, repellents and a DEFLECTOR. The latter is an external tool that enables to conduct Physarum motion. We also present interactions between slime mould and conducting polymers, resulting in a variation of their colour and conductivity. Finally, incorporation of the Physarum into the organic memristive device resulted in a variation of its electrical characteristics due to the slime mould internal activity.

  14. Slime mould foraging behaviour as optically coupled logical operations

    NASA Astrophysics Data System (ADS)

    Mayne, R.; Adamatzky, A.

    2015-04-01

    Physarum polycephalum is a macroscopic plasmodial slime mould whose apparently 'intelligent' behaviour patterns may be interpreted as computation. We employ plasmodial phototactic responses to construct laboratory prototypes of NOT and NAND logical gates with electrical inputs/outputs and optical coupling in which the slime mould plays dual roles of computing device and electrical conductor. Slime mould logical gates are fault tolerant and resettable. The results presented here demonstrate the malleability and resilience of biological systems and highlight how the innate behaviour patterns of living substrates may be used to implement useful computation.

  15. Mold-Resistant Construction.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…

  16. Molds for cable dielectrics

    DOEpatents

    Roose, L.D.

    1996-12-10

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.

  17. Molds for cable dielectrics

    DOEpatents

    Roose, Lars D.

    1996-01-01

    Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made.

  18. Bleach Neutralizes Mold Allergens

    ERIC Educational Resources Information Center

    Science Teacher, 2005

    2005-01-01

    Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…

  19. Mold and Children's Health.

    ERIC Educational Resources Information Center

    Tuscano, Antoinette

    1998-01-01

    Mold can seriously affect the health of children with asthma or allergies. Indoor air problems related to mold can be difficult to identify, but when several students who spend time in the same classroom area show allergic symptoms, it is important to consider mold and air quality. Failure to respond promptly can have serious consequences. (SM)

  20. New technology of slime drying and its utilizing in China

    SciTech Connect

    Ma Liqiang; Han Minfang; Qin Qiang

    1998-12-31

    China is the largest coal producer and consumer in the world. According to the national conditions, coal will be the major energy source in China over a long period. Along with more extensive use of machinery in coal mining, more coal fines have been produced. It not only troubles some consumers using lump coal, but also results in more slime from coal preparation. Currently about 25% of raw coal are washed and the slime discharged is more than 10 Mt each year. Large scale slime dumping not only results in environment pollution, but also wastes resources. Even though the closed circuit of process water can avoid the pollution of black water, slime dewatering in large amounts is pretty difficult because of its fine size (0--0.5 mm), high moisture preservation ability (25%--35%), high ash content (25%--60%) and higher clay content. A kind of brand-new slime processing technology--Scattered Slime Drying technology has been developed successfully in China. This paper describes the technology.

  1. Slime Mould Analogue Models of Space Exploration and Planet Colonisation

    NASA Astrophysics Data System (ADS)

    Adamatzky, A.; Armstrong, R.; De Lacy Costello, B.; Deng, Y.; Jones, J.; Mayne, R.; Schubert, T.; Sirakoulis, G. Ch.; Zhang, X.

    Slime mould Physarum polycephalum is a single cell that is visible by the unaided eye. When spanning sources of nutrients the slime mould builds a network of protoplasmic tubes which is sometimes considered to be optimal in terms of the minimization of metabolite transportation time and distance away from repellents. Previously we have shown that the slime mould is efficient in imitating the formation of man-made road networks in major countries, where major urban areas are sources of nutrients. We used a similar approach to grow slime mould on a three-dimensional template of the Moon to speculate on potential colonisation scenarios. The slime mould imitated the propagation of colonisation in an exploratory mode, i.e. without any definite targets. Additional transportation hubs/targets were added after the initial network was formed, to imitate the development of colonies in parallel with slime mould growth. We provide analyses of proximity graphs representing colonisation networks and support the findings with Physarum-inspired algorithms to inform supply chain design. We speculate on how living Physarum, or its incorporation into a polymer hybrid material, can be used as a wearable smart wetware based on laboratory experiments interacting with chemical components.

  2. Immunotherapy for mold allergy.

    PubMed

    Coop, Christopher A

    2014-12-01

    The objective of this article is to review the available studies regarding mold immunotherapy. A literature search was conducted in MEDLINE to identify peer-reviewed articles related to mold immunotherapy using the following keywords: mold, allergy, asthma, and immunotherapy. In addition, references cited within these articles were also reviewed. Articles were selected based on their relevance to the topic. Allergic responses to inhaled mold antigens are a recognized factor in allergic rhinitis and asthma. There are significant problems with respect to the production of relevant allergen material for the diagnosis and treatment of mold allergy with immunotherapy. Mold allergens contain proteases and should not be mixed with other allergens for immunotherapy. Most of the immunotherapy studies focus on two molds, Alternaria and Cladosporium. There is a lack of randomized placebo-controlled trials when evaluating the efficacy of mold immunotherapy with trials only focusing on immunotherapy to Alternaria and Cladosporium. Additional studies are needed regarding mold allergy and immunotherapy focusing on which molds are important for causing allergic disease.

  3. Immunotherapy for mold allergy.

    PubMed

    Coop, Christopher A

    2014-12-01

    The objective of this article is to review the available studies regarding mold immunotherapy. A literature search was conducted in MEDLINE to identify peer-reviewed articles related to mold immunotherapy using the following keywords: mold, allergy, asthma, and immunotherapy. In addition, references cited within these articles were also reviewed. Articles were selected based on their relevance to the topic. Allergic responses to inhaled mold antigens are a recognized factor in allergic rhinitis and asthma. There are significant problems with respect to the production of relevant allergen material for the diagnosis and treatment of mold allergy with immunotherapy. Mold allergens contain proteases and should not be mixed with other allergens for immunotherapy. Most of the immunotherapy studies focus on two molds, Alternaria and Cladosporium. There is a lack of randomized placebo-controlled trials when evaluating the efficacy of mold immunotherapy with trials only focusing on immunotherapy to Alternaria and Cladosporium. Additional studies are needed regarding mold allergy and immunotherapy focusing on which molds are important for causing allergic disease. PMID:24057512

  4. 53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  5. Comparative sampling molds evaluation

    SciTech Connect

    Pierrard, L.; Jarry, P.; Charbonnier, J.; Rigaut, C.

    1996-10-01

    The metallurgical industry needs to cast alloys with narrow tolerances in their chemical composition in order to reduce variability of their use properties. Therefore appropriate sampling practices and analytical methods are required. Both accuracy and precision of the analytical results are limited by the non-homogeneity of as-cast disk or cylinder samples, which results from macrosegregation phenomenon. This paper presents a comparison between six commonly used molds: four molds recommended by ASTM standards (center-pour molds type B and vacuum mold), mushroom shaped and cylinder molds. Two complementary approaches are exhibited for the different molds designs: (1) solidification modeling in order to predict macrosegregation localization using the Simulor software; (2) experimental characterization. Radial and axial segregation profiles are determined by Analytical Scanning Electron Microscopy in addition to analytical precision evaluation by spark optical emission and X-Ray fluorescence spectrometries for a given machining depth.

  6. Guide to Molds at School.

    ERIC Educational Resources Information Center

    Healthy Schools Network, Inc., Albany, NY.

    Asserting that molds growing in schools can be harmful to children's health and learning, this guide offers information about the issue. It provides an overview of the basics, then addresses testing, types of molds, molds and health, monitoring schools for mold, mold prevention and clean-up tips for schools, and what parents should do if they…

  7. Molded Magnetic Article

    NASA Technical Reports Server (NTRS)

    Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)

    2000-01-01

    A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.

  8. BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    BRITISH MOLDING MACHINE, PBQ AUTOMATIC COPE AND DRAG MOLDING MACHINE MAKES BOTH MOLD HALVES INDIVIDUALLY WHICH ARE LATER ROTATED, ASSEMBLED, AND LOWERED TO POURING CONVEYORS BY ASSISTING MACHINES. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  9. Acellular Dermal Matrix in Rotator Cuff Surgery.

    PubMed

    Cooper, Joseph; Mirzayan, Raffy

    2016-01-01

    The success of rotator cuff repair (RCR) surgery can be measured clinically (validated outcome scores, range of motion) as well as structurally (re-tear rates using imaging studies). Regardless of repair type or technique, most studies have shown that patients do well clinically. However, multiple studies have also shown that structurally, the failure rate can be very high. A variety of factors, including poor tendon quality, age over 63 years, smoking, advanced fatty infiltration into the muscle, and the inability of the tendon to heal to bone, have been implicated as the cause of the high re-tear rate in RCRs. The suture-tendon interface is felt to be the weakest link in the RCR construct, and suture pullout through the tendon is believed to be the most common method of failure. This review of the published literature seeks to determine if there is support for augmentation of RCR with acellular dermal matrices to strengthen the suture-tendon interface and reduce the re-tear rate. PMID:27552454

  10. 40 CFR 721.10667 - Slimes and sludges, aluminum and iron casting, wastewater treatment, solid waste.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Slimes and sludges, aluminum and iron... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10667 Slimes and sludges, aluminum and... subject to reporting. (1) The chemical substance identified generically as slimes and sludges,...

  11. 40 CFR 721.10667 - Slimes and sludges, aluminum and iron casting, wastewater treatment, solid waste.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Slimes and sludges, aluminum and iron... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.10667 Slimes and sludges, aluminum and... subject to reporting. (1) The chemical substance identified generically as slimes and sludges,...

  12. Challenges to acellular biological scaffold mediated skeletal muscle tissue regeneration.

    PubMed

    Corona, Benjamin T; Greising, Sarah M

    2016-10-01

    Volumetric muscle loss (VML) injuries present a complex and heterogeneous clinical problem that results in a chronic loss of muscle tissue and strength. The primary limitation to muscle tissue regeneration after VML injury is the frank loss of all native muscle constituents in the defect, especially satellite cells and the basal lamina. Recent advancements in regenerative medicine have set forth encouraging and emerging translational and therapeutic options for these devastating injuries including the surgical implantation of acellular biological scaffolds. While these biomaterials can modulate the wound environment, the existing data do not support their capacity to promote appreciable muscle fiber regeneration that can contribute to skeletal muscle tissue functional improvements. An apparent restriction of endogenous satellite cell (i.e., pax7(+)) migration to acellular biological scaffolds likely underlies this deficiency. This work critically evaluates the role of an acellular biological scaffold in orchestrating skeletal muscle tissue regeneration, specifically when used as a regenerative medicine approach for VML injury. PMID:27472161

  13. Challenges to acellular biological scaffold mediated skeletal muscle tissue regeneration.

    PubMed

    Corona, Benjamin T; Greising, Sarah M

    2016-10-01

    Volumetric muscle loss (VML) injuries present a complex and heterogeneous clinical problem that results in a chronic loss of muscle tissue and strength. The primary limitation to muscle tissue regeneration after VML injury is the frank loss of all native muscle constituents in the defect, especially satellite cells and the basal lamina. Recent advancements in regenerative medicine have set forth encouraging and emerging translational and therapeutic options for these devastating injuries including the surgical implantation of acellular biological scaffolds. While these biomaterials can modulate the wound environment, the existing data do not support their capacity to promote appreciable muscle fiber regeneration that can contribute to skeletal muscle tissue functional improvements. An apparent restriction of endogenous satellite cell (i.e., pax7(+)) migration to acellular biological scaffolds likely underlies this deficiency. This work critically evaluates the role of an acellular biological scaffold in orchestrating skeletal muscle tissue regeneration, specifically when used as a regenerative medicine approach for VML injury.

  14. Silicon micro-mold

    DOEpatents

    Morales, Alfredo M.

    2006-10-24

    The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.

  15. Silicone plesiotherapy molds

    SciTech Connect

    Karolis, C.; Reay-Young, P.S.; Walsh, W.; Velautham, G.

    1983-04-01

    Plesiotherapy, the treatment of superficial lesions by radioactive molds has largely been replaced by teletherapy techniques involving high energy photon and electron beams. There are, however, situations for which a short distance type treatment, in one form or another, is superior to any other presently available. Traditionally, molds have taken the form of rigid devices incorporating clamps to attach them to the patient. This ensures a reproducible geometry about a localized region since the molds are applied on a daily basis. To make such devices requires considerable skill and patience. This article describes an alternative method that eliminates the use of cumbersome devices in many situations. Silicone molds made from a plaster cast model have been found suitable for the treatment of surface lesions and especially for lesions in the oral and nasal cavities. With the use of radioactive gold seeds the molds may be left in place for a few days without fear of them moving.

  16. On hybrid circuits exploiting thermistive properties of slime mould.

    PubMed

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A; Adamatzky, Andrew

    2016-04-06

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism's resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays.

  17. On hybrid circuits exploiting thermistive properties of slime mould

    NASA Astrophysics Data System (ADS)

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A.; Adamatzky, Andrew

    2016-04-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism’s resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays.

  18. On hybrid circuits exploiting thermistive properties of slime mould

    PubMed Central

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A.; Adamatzky, Andrew

    2016-01-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism’s resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays. PMID:27048713

  19. On hybrid circuits exploiting thermistive properties of slime mould.

    PubMed

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A; Adamatzky, Andrew

    2016-01-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism's resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays. PMID:27048713

  20. Plasmodial vein networks of the slime mold Physarum polycephalum form regular graphs.

    PubMed

    Baumgarten, Werner; Ueda, Tetsuo; Hauser, Marcus J B

    2010-10-01

    The morphology of a typical developing biological transportation network, the vein network of the plasmodium of the myxomycete Physarum polycephalum is analyzed during its free extension. The network forms a classical, regular graph, and has exclusively nodes of degree 3. This contrasts to most real-world transportation networks which show small-world or scale-free properties. The complexity of the vein network arises from the weighting of the lengths, widths, and areas of the vein segments. The lengths and areas follow exponential distributions, while the widths are distributed log-normally. These functional dependencies are robust during the entire evolution of the network, even though the exponents change with time due to the coarsening of the vein network.

  1. Modelling the aggregation process of cellular slime mold by the chemical attraction.

    PubMed

    Atangana, Abdon; Vermeulen, P D

    2014-01-01

    We put into exercise a comparatively innovative analytical modus operandi, the homotopy decomposition method (HDM), for solving a system of nonlinear partial differential equations arising in an attractor one-dimensional Keller-Segel dynamics system. Numerical solutions are given and some properties show evidence of biologically practical reliance on the parameter values. The reliability of HDM and the reduction in computations give HDM a wider applicability.

  2. Plasmodial vein networks of the slime mold Physarum polycephalum form regular graphs

    NASA Astrophysics Data System (ADS)

    Baumgarten, Werner; Ueda, Tetsuo; Hauser, Marcus J. B.

    2010-10-01

    The morphology of a typical developing biological transportation network, the vein network of the plasmodium of the myxomycete Physarum polycephalum is analyzed during its free extension. The network forms a classical, regular graph, and has exclusively nodes of degree 3. This contrasts to most real-world transportation networks which show small-world or scale-free properties. The complexity of the vein network arises from the weighting of the lengths, widths, and areas of the vein segments. The lengths and areas follow exponential distributions, while the widths are distributed log-normally. These functional dependencies are robust during the entire evolution of the network, even though the exponents change with time due to the coarsening of the vein network.

  3. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

    PubMed

    Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

    2014-03-01

    Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

  4. Growth patterns of the slime mold Physarum on a nonuniform substrate

    NASA Astrophysics Data System (ADS)

    Halvorsrud, Ragnhild; Wagner, Geri

    1998-01-01

    The Myxomycete Physarum polycephalum has been grown on nonuniform substrates, where the nutrients were confined in separated drops of agar medium. Spatial and temporal aspects of the resulting growth structures were studied by time-lapse video techniques and analyzed using image processing software. The growth process on a linear substrate of drops can be described in terms of a searching phase alternating with a feeding phase. On a linear array of drops, the Physarum advanced uniformly after an initial lag phase. On a two-dimensional drop substrate two different growth regimes could be distinguished: branched growth was observed on substrates with small drop diameters and compact growth, similar to growth on uniform substrates, was observed on substrates with larger drop diameters. The drop size is a crucial parameter that mediates characteristic plasmodial morphologies. A crossover from branched to compact growth was observed in some of the experiments. A spatial correlation function was used that could quantitatively distinguish between the different growth regimes.

  5. Slime mold solves maze in one pass, assisted by gradient of chemo-attractants.

    PubMed

    Adamatzky, Andrew

    2012-06-01

    Plasmodium of Physarum polycephalum is a large cell, visible by unaided eye, which exhibits sophisticated patterns of foraging behaviour. The plasmodium's behaviour is well interpreted in terms of computation, where data are spatially extended configurations of nutrients and obstacles, and results of computation are networks of protoplasmic tubes formed by the plasmodium. In laboratory experiments and numerical simulation we show that if plasmodium of P. polycephalum is inoculated in a maze's peripheral channel and an oat flake (source of attractants) in a the maze's central chamber then the plasmodium grows toward target oat flake and connects the flake with the site of original inoculation with a pronounced protoplasmic tube. The protoplasmic tube represents a path in the maze. The plasmodium solves maze in one pass because it is assisted by a gradient of chemo-attractants propagating from the target oat flake.

  6. EDTA treatment alters protein glycosylation in the cellular slime mold Dictyostelium discoideum

    SciTech Connect

    West, C.M.; Brownstein, S.A. )

    1988-03-01

    The authors have found that treatment of cells with EDTA resulted in the accumulation of lower molecular weight forms of two cell-type-specific glycoproteins. These new glycoproteins lacked a developmentally regulated glycoantigen defined by monoclonal antibody 54.2. Since EDTA dissociated the cells, the possible involvement of cell separation was tested by immobilizing cells in soft agarose. Glycoantigen expression on these proteins was found to be dependent on cAMP and high oxygen tension but not on cell contact, and was reversibly sensitive to EDTA regardless of the state of cell association. The EDTA effect was mimicked by other soluble, but not particulate, membrane impermeable chelators, could be completed by Zn{sup 2+} better than Mg{sup 2+}, and appeared to involve an intracellular mechanism. Studies with ({sup 14}C)EDTA showed that EDTA equilibrated with a cellular compartment in a temperature-dependent, Zn{sup 2+}-insensitive fashion with half-time kinetics of loading and unloading of 30-40 min. The data suggest that this step in glycosylation, which was found to be delayed 1 or more hours subsequent to protein synthesis, involves an intracellular, transition metal-ion-dependent process which can be modulated by chelators entering the cell through the endocytic pathway.

  7. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

    PubMed

    Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

    2014-03-01

    Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway. PMID:24499792

  8. Modelling the aggregation process of cellular slime mold by the chemical attraction.

    PubMed

    Atangana, Abdon; Vermeulen, P D

    2014-01-01

    We put into exercise a comparatively innovative analytical modus operandi, the homotopy decomposition method (HDM), for solving a system of nonlinear partial differential equations arising in an attractor one-dimensional Keller-Segel dynamics system. Numerical solutions are given and some properties show evidence of biologically practical reliance on the parameter values. The reliability of HDM and the reduction in computations give HDM a wider applicability. PMID:25114922

  9. Guiding Student Inquiry into Eukaryotic Organismal Biology Using the Plasmodial Slime Mold "Physarum Polycephalum"

    ERIC Educational Resources Information Center

    Weeks, Andrea; Bachman, Beverly; Josway, Sarah; Laemmerzahl, Arndt F.; North, Brittany

    2014-01-01

    In order to challenge our undergraduate students' enduring misconception that plants, animals, and fungi must be "advanced" and that other eukaryotes traditionally called protists must be "primitive," we have developed a 24-hour take-home guided inquiry and investigation of live Physarum cultures. The experiment replicates…

  10. Cross-species functional complementation of cellulose synthase during the development of cellular slime molds.

    PubMed

    Kuwayama, Hidekazu; Tohyama, Takeru; Urushihara, Hideko

    2014-09-01

    Cellulose is a major and important component of the extracellular matrix during the development of Dictyostelium discoideum. Upon starvation, solitary amoebae of D. discoideum gather and form fruiting bodies in which cells differentiate into stalk cells and spores. The stalk tubes and walls of spores and stalk cells are made of cellulose. In the genus Acytostelium, however, all cells are destined to become spores and the stalks comprise only a cellulose tube, suggesting species-specific regulation of cellulose synthesis. In this study, we cloned a putative cellulose synthase gene (cesA) of Acytostelium subglobosum and performed comparative analyses with the D. discoideum cellulose synthase gene (dcsA). Although the deduced amino acid sequences were highly conserved between cesA and dcsA, the numbers of transmembrane spans preceding the catalytic domain were dissimilar; 2 and 3, respectively. Since ectopic expression of cesA in dcsA(-) null cells failed to restore the developmental defects of the mutant, we constructed a series of chimerical genes for complementation analyses and found that the catalytic domain of cesA was functional in D. discoideum cells if the preceding transmembrane region was swapped with dcsA. The non-functional products that contained the cesA-derived transmembrane region were localized to lysosomes. These results indicate that the transmembrane region of cellulose synthase is essential for proper accumulation of cellulose during the development of D. discoideum and that its differential localization in A. subglobosum may be related to the characteristic morphogenesis in this species.

  11. Mutations affecting sensitivity of the cellular slime mold Dictyostelium discoideum to DNA-damaging agents.

    PubMed

    Bronner, C E; Welker, D L; Deering, R A

    1992-09-01

    We describe 22 new mutants of D. discoideum that are sensitive to DNA damage. These mutants were isolated on the basis of sensitivity to either temperature, gamma-rays, or 4-nitroquinolone-1-oxide (4NQO). The doses of gamma-rays, ultraviolet light (UV), and 4NQO required to reduce the survival of colony-forming ability of these mutants to 10% (D10) range from 2% to 100% of the D10s for the nonmutant, parent strains. For most of the mutants, those which are very sensitive to one agent are very sensitive to all agents tested and those which are moderately sensitive to one agent, are moderately sensitive to all agents tested. One mutant is sensitive only to 4NQO. Linkage relationships have been examined for 13 of these mutants. This linkage information was used to design complementation tests to determine allelism with previously characterized complementation groups affecting sensitivity to radiation. 4 of the new mutants fall within previously identified complementation groups and 3 new complementation groups have been identified (radJ, radK and radL). Other new loci probably also exist among these new mutants. This brings the number of characterized mutants of D. discoideum which are sensitive to DNA-damaging agents to 33 and the number of assigned complementation groups to 11. PMID:1380652

  12. Identification of the homolog of cell-counting factor in the cellular slime mold Dictyostelium discoideum.

    PubMed

    Okuwa, Takako; Katayama, Takahiro; Takano, Akinori; Yasukawa, Hiroo

    2002-10-01

    Genes for the cell-counting factors in Dictyostelium discoideum, countin and countin2, are considered to control the size of the multicellular structure of this organism. A novel gene, countin3, that is homologous to countin and countin2 genes (49 and 39% identity in amino acid sequence, respectively) was identified in the D. discoideum genome. The expression of countin3 was observed in the vegetatively growing cells, decreased in the aggregating stage, increased in the mid-developmental stage and decreased again in subsequent stages. This expression pattern is different from that of countin and countin2. The distinct expression kinetics of three genes suggests that they would have unique roles in size control of D. discoideum.

  13. Glass molding process with mold lubrication

    DOEpatents

    Davey, Richard G.

    1978-06-27

    Improvements are provided in glass forming processes of the type wherein hot metal blank molds are employed by using the complementary action of a solid film lubricant layer, of graphite dispersed in a cured thermoset organopolysiloxane, along with an overspray of a lubricating oil.

  14. Resin film infusion mold tooling and molding method

    NASA Technical Reports Server (NTRS)

    Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)

    1999-01-01

    A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.

  15. 92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  16. Evaluation of lymphangiogenesis in acellular dermal matrix

    PubMed Central

    Cherubino, Mario; Pellegatta, Igor; Tamborini, Federico; Cerati, Michele; Sessa, Fausto; Valdatta, Luigi

    2014-01-01

    Introduction: Much attention has been directed towards understanding the phenomena of angiogenesis and lymphangiogenesis in wound healing. Thanks to the manifold dermal substitute available nowadays, wound treatment has improved greatly. Many studies have been published about angiogenesis and cell invasion in INTEGRA®. On the other hand, the development of the lymphatic network in acellular dermal matrix (ADM) is a more obscure matter. In this article, we aim to characterize the different phases of host cell invasion in ADM. Special attention was given to lymphangiogenic aspects. Materials and Methods: Among 57 rats selected to analyse the role of ADM in lymphangiogenesis, we created four groups. We performed an excision procedure on both thighs of these rats: On the left one we did not perform any action except repairing the borders of the wound; while on the right one we used INTEGRA® implant. The excision biopsy was performed at four different times: First group after 7 days, second after 14 days, third after 21 days and fourth after 28 days. For our microscopic evaluation, we used the classical staining technique of haematoxylin and eosin and a semi-quantitative method in order to evaluate cellularity counts. To assess angiogenesis and lymphangiogenesis development we employed PROX-1 Ab and CD31/PECAM for immunohistochemical analysis. Results: We found remarkable wound contraction in defects that healed by secondary intention while minor wound contraction was observed in defects treated with ADM. At day 7, optical microscopy revealed a more plentiful cellularity in the granulation tissue compared with the dermal regeneration matrix. The immunohistochemical process highlighted vascular and lymphatic cells in both groups. After 14 days a high grade of fibrosis was noticeable in the non-treated group. At day 21, both lymphatic and vascular endothelial cells were better developed in the group with a dermal matrix application. At day 28, lymphatic endothelial

  17. Acellular Nerve Allografts in Peripheral Nerve Regeneration: A Comparative Study

    PubMed Central

    Moore, Amy M.; MacEwan, Matthew; Santosa, Katherine B.; Chenard, Kristofer E.; Ray, Wilson Z.; Hunter, Daniel A.; Mackinnon, Susan E.; Johnson, Philip J.

    2011-01-01

    Background Processed nerve allografts offer a promising alternative to nerve autografts in the surgical management of peripheral nerve injuries where short deficits exist. Methods Three established models of acellular nerve allograft (cold-preserved, detergent-processed, and AxoGen® -processed nerve allografts) were compared to nerve isografts and silicone nerve guidance conduits in a 14 mm rat sciatic nerve defect. Results All acellular nerve grafts were superior to silicone nerve conduits in support of nerve regeneration. Detergent-processed allografts were similar to isografts at 6 weeks post-operatively, while AxoGen®-processed and cold-preserved allografts supported significantly fewer regenerating nerve fibers. Measurement of muscle force confirmed that detergent-processed allografts promoted isograft-equivalent levels of motor recovery 16 weeks post-operatively. All acellular allografts promoted greater amounts of motor recovery compared to silicone conduits. Conclusions These findings provide evidence that differential processing for removal of cellular constituents in preparing acellular nerve allografts affects recovery in vivo. PMID:21660979

  18. Newborn head molding

    MedlinePlus

    ... molding. In: Graham JM, Sanchez-Lara PA, eds. Smiths' Recognizable Patterns of Human Deformation . 4th ed. Philadelphia, PA: Elsevier; 2016:chap 35. Smith J. Initial evaluation. In: Gleason CA, Devaskar SU, ...

  19. Breaking the Mold.

    ERIC Educational Resources Information Center

    Huckabee, Christopher

    2003-01-01

    Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)

  20. Mold After a Disaster

    MedlinePlus

    ... Health Matters What's New Preparation & Planning Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ... Disaster Mold Removal After a Disaster Disasters & Severe Weather Earthquakes Extreme Heat Floods Hurricanes Landslides Tornadoes Tsunamis ...

  1. Comparative anatomy of slime glands in onychophora (velvet worms).

    PubMed

    Baer, Alexander; Mayer, Georg

    2012-10-01

    Onychophorans use a unique hunting and defense strategy, which involves the ejection of an adhesive slime secretion produced by a pair of specialized glands. So far, a comparative study on the anatomy of these glands has not been carried out among different species. In this article, we compare anatomical features of slime glands in representatives of two major onychophoran subgroups, the Peripatopsidae and the Peripatidae, from different parts of the world. Our data show that the musculature of the reservoir is conserved whereas the composition of the secretory duct displays taxon-specific variation. Major differences concern the arrangement of glandular endpieces, which are distributed along the duct in Peripatopsidae but condensed in numerous repeated rosettes in Peripatidae. In addition, there are differences in the attachment pattern of slime glands to the inner surface of the body wall and to the outer surface of the gut between the two major onychophoran subgroups. A tube-like structure with a putative valve-like function is found at the transition of the secretory duct and the reservoir in the five Peripatopsidae species studied whereas it is absent in the two representatives of Peripatidae. Our findings suggest that the arrangement of musculature in the reservoir of the slime gland has remained unchanged since the divergence of Peripatidae and Peripatopsidae, while the composition of the secretory duct has been altered in one of these groups. However, the direction of evolutionary changes in duct composition cannot be determined unambiguously due to current uncertainty regarding the phylogenetic relationships of Onychophora.

  2. MOLDS FOR CASTING PLUTONIUM

    DOEpatents

    Anderson, J.W.; Miley, F.; Pritchard, W.C.

    1962-02-27

    A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)

  3. Hagfish slime and mucin flow properties and their implications for defense

    PubMed Central

    Böni, Lukas; Fischer, Peter; Böcker, Lukas; Kuster, Simon; Rühs, Patrick A.

    2016-01-01

    When hagfish (Myxinidae) are attacked by predators, they form a dilute, elastic, and cohesive defensive slime made of mucins and protein threads. In this study we propose a link between flow behavior and defense mechanism of hagfish slime. Oscillatory rheological measurements reveal that hagfish slime forms viscoelastic networks at low concentrations. Mucins alone did not contribute viscoelasticity, however in shear flow, viscosity was observed. The unidirectional flow, experienced by hagfish slime during suction feeding by predators, was mimicked with extensional rheology. Elongational stresses were found to increase mucin viscosity. The resulting higher resistance to flow could support clogging of the attacker’s gills. Shear flow in contrast decreases the slime viscosity by mucin aggregation and leads to a collapse of the slime network. Hagfish may benefit from this collapse when trapped in their own slime and facing suffocation by tying a sliding knot with their body to shear off the slime. This removal could be facilitated by the apparent shear thinning behavior of the slime. Therefore hagfish slime, thickening in elongation and thinning in shear, presents a sophisticated natural high water content gel with flow properties that may be beneficial for both, defense and escape. PMID:27460842

  4. Hagfish slime and mucin flow properties and their implications for defense.

    PubMed

    Böni, Lukas; Fischer, Peter; Böcker, Lukas; Kuster, Simon; Rühs, Patrick A

    2016-07-27

    When hagfish (Myxinidae) are attacked by predators, they form a dilute, elastic, and cohesive defensive slime made of mucins and protein threads. In this study we propose a link between flow behavior and defense mechanism of hagfish slime. Oscillatory rheological measurements reveal that hagfish slime forms viscoelastic networks at low concentrations. Mucins alone did not contribute viscoelasticity, however in shear flow, viscosity was observed. The unidirectional flow, experienced by hagfish slime during suction feeding by predators, was mimicked with extensional rheology. Elongational stresses were found to increase mucin viscosity. The resulting higher resistance to flow could support clogging of the attacker's gills. Shear flow in contrast decreases the slime viscosity by mucin aggregation and leads to a collapse of the slime network. Hagfish may benefit from this collapse when trapped in their own slime and facing suffocation by tying a sliding knot with their body to shear off the slime. This removal could be facilitated by the apparent shear thinning behavior of the slime. Therefore hagfish slime, thickening in elongation and thinning in shear, presents a sophisticated natural high water content gel with flow properties that may be beneficial for both, defense and escape.

  5. Hagfish slime and mucin flow properties and their implications for defense

    NASA Astrophysics Data System (ADS)

    Böni, Lukas; Fischer, Peter; Böcker, Lukas; Kuster, Simon; Rühs, Patrick A.

    2016-07-01

    When hagfish (Myxinidae) are attacked by predators, they form a dilute, elastic, and cohesive defensive slime made of mucins and protein threads. In this study we propose a link between flow behavior and defense mechanism of hagfish slime. Oscillatory rheological measurements reveal that hagfish slime forms viscoelastic networks at low concentrations. Mucins alone did not contribute viscoelasticity, however in shear flow, viscosity was observed. The unidirectional flow, experienced by hagfish slime during suction feeding by predators, was mimicked with extensional rheology. Elongational stresses were found to increase mucin viscosity. The resulting higher resistance to flow could support clogging of the attacker’s gills. Shear flow in contrast decreases the slime viscosity by mucin aggregation and leads to a collapse of the slime network. Hagfish may benefit from this collapse when trapped in their own slime and facing suffocation by tying a sliding knot with their body to shear off the slime. This removal could be facilitated by the apparent shear thinning behavior of the slime. Therefore hagfish slime, thickening in elongation and thinning in shear, presents a sophisticated natural high water content gel with flow properties that may be beneficial for both, defense and escape.

  6. Hagfish slime and mucin flow properties and their implications for defense.

    PubMed

    Böni, Lukas; Fischer, Peter; Böcker, Lukas; Kuster, Simon; Rühs, Patrick A

    2016-01-01

    When hagfish (Myxinidae) are attacked by predators, they form a dilute, elastic, and cohesive defensive slime made of mucins and protein threads. In this study we propose a link between flow behavior and defense mechanism of hagfish slime. Oscillatory rheological measurements reveal that hagfish slime forms viscoelastic networks at low concentrations. Mucins alone did not contribute viscoelasticity, however in shear flow, viscosity was observed. The unidirectional flow, experienced by hagfish slime during suction feeding by predators, was mimicked with extensional rheology. Elongational stresses were found to increase mucin viscosity. The resulting higher resistance to flow could support clogging of the attacker's gills. Shear flow in contrast decreases the slime viscosity by mucin aggregation and leads to a collapse of the slime network. Hagfish may benefit from this collapse when trapped in their own slime and facing suffocation by tying a sliding knot with their body to shear off the slime. This removal could be facilitated by the apparent shear thinning behavior of the slime. Therefore hagfish slime, thickening in elongation and thinning in shear, presents a sophisticated natural high water content gel with flow properties that may be beneficial for both, defense and escape. PMID:27460842

  7. Structure and Composition of Biological Slimes on Paper and Board Machines

    PubMed Central

    Väisänen, O. M.; Nurmiaho-Lassila, E.-L.; Marmo, S. A.; Salkinoja-Salonen, M. S.

    1994-01-01

    Biological slimes (biofilms) collected from the wet end of paper and board machines were examined by electron microscopy and analyzed for fatty acid composition, neutral sugar composition, and ATP. Electron microscopy revealed minuscule prokaryotic organisms (diameter, 0.2 to 0.4 μm). Larger cells morphologically resembling Sphaerotilus and Leptothrix spp. were found in slimes from machines using recycled fiber or unbleached pulp. The bacteria were embedded in a slimy matrix and often contained reserve materials microscopically resembling poly-β-hydroxybutyrate and glycogen. Fatty acid analysis of the slimes revealed bacterial signature fatty acids in concentrations equivalent to the presence of 2 × 1010 to 2.6 × 1012 (average, 7 × 1011) bacterial cells (live and dead) per g (dry weight) of slime. The slimes contained several known components of bacterial polysaccharides in addition to glucose, indicating that the slime body consisted of bacterial polysaccharides. The slimes contained uronic acids equivalent to a binding capacity of 12.5 to 50 μmol of divalent cations per g (dry weight) of slime. The uronic acid-containing polysaccharides may be responsible for the accumulation of heavy metals in the slime. Calculation of the ATP contents of the slimes resulted in an estimate of 5 × 1012 cells per g (dry weight) of slime when calibrated with pure bacterial cultures isolated from the slimes. From electron micrographs, an estimate ranging from 1 × 1010 to 1.5 × 1012 (average, 4 × 1011) cells per g (dry weight) of slime was obtained. Images PMID:16349191

  8. Pressure molding of powdered materials improved by rubber mold insert

    NASA Technical Reports Server (NTRS)

    1964-01-01

    Pressure molding tungsten microspheres is accomplished by applying hydraulic pressure to a silicone rubber mold insert with several barrel shaped chambers which is placed in a steel die cavity. This technique eliminates castings containing shear fractures.

  9. FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    FILLING MOLDS MADE ON THE BRITISH MOLDING MACHINE, AUTOMATIC COPE AND DRAG (BMM) FROM MOBILE LADLE. EMPTY BULL LADLE IN FOREGROUND. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  10. TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TENDING THE MOLD, DURING THE TRANSFER FROM TUNDISH TO MOLD TO CONTAINMENT CHAMBER IS CONTINUOUS CASTING OPERATOR, CALVIN ANDERS. - U.S. Steel, Fairfield Works, Continuous Caster, Fairfield, Jefferson County, AL

  11. Slime production is essential for the adherence of Staphylococcus epidermidis in implant-related infections.

    PubMed

    Nayak, N; Satpathy, G; Nag, H L; Venkatesh, P; Ramakrishnan, S; Nag, T C; Prasad, S

    2011-02-01

    A total of 32 Staphylococcus epidermidis isolates from indwelling device-related infections such as endophthalmitis following intraocular lens (IOL) implantation, intravenous catheter-related sepsis and orthopaedic implant infections, were studied for slime production and adherence to artificial surfaces. Of these, 21 (65.6%) isolates were slime positive by the Congo Red agar method and 24 (75%) were adherent to artificial surfaces by the quantitative slime test. The majority (19 out of 24; 79.1%) of the adherent bacteria were slime producers. Antibody to slime raised in rabbits was able to inhibit the adherence of all 24 bacteria designated as adherent by our quantitative test. It seems that slime is indispensable for the sessile mode of attachment, leading further to the development of biofilms on the indwelling devices.

  12. Comparison of toxicities of acellular pertussis vaccine with whole cell pertussis vaccine in experimental animals.

    PubMed

    Sato, Y; Sato, H

    1991-01-01

    There is no suitable animal model for pertussis encephalopathy in humans. In this study, we have compared the toxicity of acellular pertussis vaccine with whole cell pertussis vaccine in mice or guinea pigs. Two lots of acellular and two lots of whole cell vaccine produced in different countries were assayed in the test. 1. There was no statistical difference in mouse protective potency between these acellular or whole cell pertussis vaccines. 2. There were no differences in chemical ingredients between acellular and whole cell pertussis vaccines except for protein nitrogen content. The protein nitrogen content of whole cell vaccine was at least three times higher than that of the acellular product. 3. Anti-PT antibody productivity of the acellular vaccine was higher than that of the whole cell vaccine. 4. Anti-agglutinogen antibody productivity of the whole cell vaccine was higher than that of the acellular vaccine. 5. There was no pyrogenic activity with the acellular vaccine, but high pyrogenicity was seen with whole cell vaccine. 6. There was high body-weight decreasing toxicity in mice and guinea pigs by the whole cell vaccine. 7. The mice died when they received whole cell pertussis vaccine iv, but no deaths occurred in the mice which received acellular pertussis vaccine. PMID:1778317

  13. BIOCOMPATIBILITY OF ACELLULAR DERMAL MATRIX GRAFT EVALUATED IN CULTURE OF MURINE MACROPHAGES

    PubMed Central

    Vendramini, Ana Paula; Melo, Rafaela Fernanda; Marcantonio, Rosemary Adriana Chiérici; Carlos, Iracilda Zepone

    2006-01-01

    The acellular dermal matrix allograft has been used as an alternative to autogenous palatal mucosal graft. The aim of this study was the evaluation of the biocompatibility of an acellular dermal matrix (AlloDerm®) in culture of macrophages. For hydrogen peroxidase determination we used the method of Pick & Kesari, and the Griess method for nitric oxide determination,. Statistical analysis showed no significant difference (p ≤ 0,05) in the release of nitric oxide and hydrogen peroxide by the macrophages exposed to acellular dermal matrix and the negative control. The results suggest that acellular dermal matrix did not activate the cell inflammatory response. PMID:19089033

  14. Infection in the Nasal Tip Caused by Acellular Dermal Matrix.

    PubMed

    Lee, Kun Hee

    2015-12-01

    A 19-year-old female patient visited our clinic for rhinoplasty. She complained about her low take-off point, which was apparent in profile view, and wanted slight tip projection. She refused additional cartilage harvesting from ears or ribs but consented to the use of homologous tissue, including acellular dermal matrix, for her dorsum and tip. Septoturbinoplasty was performed, and only a very small amount of septal cartilage could be harvested. It was used as both the columellar strut and the alar rim graft. Nasal dorsum and tip were augmented with acellular dermal matrix. Three months postoperatively, she experienced a few episodes of edema and redness on her nasal tip, followed by pus exudation from the nasal skin. Six months postoperatively, she underwent revision rhinoplasty for removal of inflamed grafts, and onlay tip graft with homologous rib cartilage was performed. Nasal dorsum or tip grafts are an integral part of Asian rhinoplasty. Autogenous tissue is the gold standard for grafting materials. However, the limited availability of autogenous tissue and the preference of patients and surgeons for artificial surgical implants make Asian rhinoplasty challenging. Unavailability of autogenous cartilage and patient refusal of artificial implants led to the use of acellular dermal matrix (ADM) in the nasal dorsum and tip for this case. This is the first report of postoperative complication because of infection rather than absorption after ADM use.

  15. Infection in the Nasal Tip Caused by Acellular Dermal Matrix.

    PubMed

    Lee, Kun Hee

    2015-12-01

    A 19-year-old female patient visited our clinic for rhinoplasty. She complained about her low take-off point, which was apparent in profile view, and wanted slight tip projection. She refused additional cartilage harvesting from ears or ribs but consented to the use of homologous tissue, including acellular dermal matrix, for her dorsum and tip. Septoturbinoplasty was performed, and only a very small amount of septal cartilage could be harvested. It was used as both the columellar strut and the alar rim graft. Nasal dorsum and tip were augmented with acellular dermal matrix. Three months postoperatively, she experienced a few episodes of edema and redness on her nasal tip, followed by pus exudation from the nasal skin. Six months postoperatively, she underwent revision rhinoplasty for removal of inflamed grafts, and onlay tip graft with homologous rib cartilage was performed. Nasal dorsum or tip grafts are an integral part of Asian rhinoplasty. Autogenous tissue is the gold standard for grafting materials. However, the limited availability of autogenous tissue and the preference of patients and surgeons for artificial surgical implants make Asian rhinoplasty challenging. Unavailability of autogenous cartilage and patient refusal of artificial implants led to the use of acellular dermal matrix (ADM) in the nasal dorsum and tip for this case. This is the first report of postoperative complication because of infection rather than absorption after ADM use. PMID:26894006

  16. Filtration of slime suspension in water-treatment precipitation clarifiers

    SciTech Connect

    Trofimenko, M.A.; Tyagnyryadno, L.A.; Korol'kov, N.M.; Zheleznyak, A.B.

    1988-02-10

    When water is treated in industrial clarifiers a slime suspension is produced that has a pH 11-12.5 and contains up to 5% solid phase. In order to utilize the excess alkalinity of the suspension and save fresh lime milk, the suspension is used to neutralize the acidic regenerates past the cation-exchanger columns. The operation of the vacuum filter is a narrow part of the wastewater treatment area. The filter cloth often gets choked, the sediment being sticky and difficult to remove from the cloth. We proposed to alter the mode of removal of the slime suspension by submitting it to filtration immediately after its exit from the clarifier. For mixing with the acidic regeneration from the cation-exchanger columns the filtrate was delivered after the vacuum filter.

  17. Vacuum Evaporation Technology for Treating Antimony-Rich Anode Slime

    NASA Astrophysics Data System (ADS)

    Qiu, Keqiang; Lin, Deqiang; Yang, Xuelin

    2012-11-01

    A vacuum evaporation technology for treating antimony-rich anode slime was developed in this work. Experiments were carried out at temperatures from 873 K to 1073 K and residual gas pressures from 50 Pa to 600 Pa. During vacuum evaporation, silver from the antimony-rich anode slime was left behind in the distilland in a silver alloy containing antimony and lead, and antimony trioxide was evaporated. The experimental results showed that 92% by weight of antimony can be removed, and the silver content in the alloy was up to 12.84%. The antimony trioxide content in the distillate was more than 99.7%, and the distillate can be used directly as zero-grade antimony trioxide (China standard).

  18. Kinetics of decomposition of manganese slimes by sulfur dioxide

    SciTech Connect

    Dzhaparidze, P.I.; Kelbakiani, N.V.

    1982-02-20

    Lean manganese ores, and slimes obtained during mechanical beneficiation of Chiatura manganese ores, have been treated by the sulfite process, by saturation of suspensions with sulfur dioxide. The kinetics of saturation of the suspensions with sulfur dioxide, and transfer of manganese into solution was studied. Manganese was leached out by passing sulfur dioxide through the slime suspension. The sulfur dioxide dissolved in water to form the weakly dissociated sulfurous acid in equilibrium with its anhydrides. The leaching was conducted without access of air at room temperature. An equation for determination of the rate of sulfur dioxide adsorption by a manganese-containing slurry and for calculation of the degree of manganese extraction into solution was developed from the experimental results. The reaction order and the control regime of the processes were determined.

  19. Lignite slime as activator in production of oxidized asphalts

    SciTech Connect

    Gureev, A.A.; Gorlov, E.G.; Leont'eva, O.B.; Zotova, O.V.

    1988-03-01

    The possibility of activation of the oxidation of straight-run resids to asphalts by the addition of lignite slimes obtained in the liquefaction of coals of the Kansk-Achinsk basin was studied on the basis of a hypothesis formulated with due regard for the principles of physicochemical mechanics of petroleum disperse systems. A reduction of the air bubble size in the oxidizing vessel should lead to an increase in the total surface of oxidation and hence to a shortening of the time required for oxidation of the feed. A straight-run vacuum resid from mixed West Siberian and Ukhta crudes was used. The resid was oxidized with and without the addition of slime.

  20. End moldings for cable dielectrics

    DOEpatents

    Roose, Lars D.

    2000-01-01

    End moldings for high-voltage cables are described wherein the dielectric insulator of the cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. Disclosed is a method for making the cable connectors either in the field or in a factory, molds suitable for use with the method, and the molded cable connectors, themselves.

  1. Molding process for imidazopyrrolone polymers

    NASA Technical Reports Server (NTRS)

    Johnson, C. L. (Inventor)

    1973-01-01

    A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.

  2. Comparative anatomy of slime glands in onychophora (velvet worms).

    PubMed

    Baer, Alexander; Mayer, Georg

    2012-10-01

    Onychophorans use a unique hunting and defense strategy, which involves the ejection of an adhesive slime secretion produced by a pair of specialized glands. So far, a comparative study on the anatomy of these glands has not been carried out among different species. In this article, we compare anatomical features of slime glands in representatives of two major onychophoran subgroups, the Peripatopsidae and the Peripatidae, from different parts of the world. Our data show that the musculature of the reservoir is conserved whereas the composition of the secretory duct displays taxon-specific variation. Major differences concern the arrangement of glandular endpieces, which are distributed along the duct in Peripatopsidae but condensed in numerous repeated rosettes in Peripatidae. In addition, there are differences in the attachment pattern of slime glands to the inner surface of the body wall and to the outer surface of the gut between the two major onychophoran subgroups. A tube-like structure with a putative valve-like function is found at the transition of the secretory duct and the reservoir in the five Peripatopsidae species studied whereas it is absent in the two representatives of Peripatidae. Our findings suggest that the arrangement of musculature in the reservoir of the slime gland has remained unchanged since the divergence of Peripatidae and Peripatopsidae, while the composition of the secretory duct has been altered in one of these groups. However, the direction of evolutionary changes in duct composition cannot be determined unambiguously due to current uncertainty regarding the phylogenetic relationships of Onychophora. PMID:22707384

  3. REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-06-24

    Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.

  4. New technology and equipment for coal slime recovery in China

    SciTech Connect

    Liu, J.

    1998-12-31

    Yearly output of the medium and small coal mines in China has reached 7.7 hundred million tons. Most coal slime from these coal preparation plants are abandoned, and thence the environment is seriously polluted. Recently, a new technology and equipment for coal slime recovery has been developed. The key equipment of the technology is the cyclone-column flotator. To recover the coal slime, a system consisting of cyclone-column flotator and plate frame filter is used. The cyclone-column flotator is a short body flotator specially designed for flotation of coal with difficult floatability. It consists of a flotation segment on the top and a cyclone segment at the bottom, the later being a supplement of flotation processing. As a result, the separation and recovery are enhanced. Compared with traditional flotation machine--vacuum filter system, this technology has the following advantages: (1) suitable for most types of coal; (2) higher selectivity (the ash content in clean coal dropped by 1--2%); and (3) the system is simple and reliable with lower operation cost. The investment dropped by 40--50%, and power consumption, by 30--40% under the same processing capacity. This technology system, featuring convenience, easy operability, high efficiency and high quality is specially suitable for medium and small coal preparation plants. There are over ten coal preparation plants employing this technology system with success.

  5. MOLDED SEALING ELEMENT

    DOEpatents

    Bradford, B.W.; Skinner, W.J.

    1959-03-24

    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  6. QUANTIFYING INDOOR MOLDS

    EPA Science Inventory

    The US EPA has patented a mold ID technology (#6,387,652) licensed by 15 companies in the US and EU. This technology is based upon DNA sequences. In conjunction with HUD, this technology will be used in a National Survey of Homes.

  7. Porcine acellular lung matrix for wound healing and abdominal wall reconstruction: A pilot study.

    PubMed

    Fernandez-Moure, Joseph S; Van Eps, Jeffrey L; Rhudy, Jessica R; Cabrera, Fernando J; Acharya, Ghanashyam S; Tasciotti, Ennio; Sakamoto, Jason; Nichols, Joan E

    2016-01-01

    Surgical wound healing applications require bioprosthetics that promote cellular infiltration and vessel formation, metrics associated with increased mechanical strength and resistance to infection. Porcine acellular lung matrix is a novel tissue scaffold known to promote cell adherence while minimizing inflammatory reactions. In this study, we evaluate the capacity of porcine acellular lung matrix to sustain cellularization and neovascularization in a rat model of subcutaneous implantation and chronic hernia repair. We hypothesize that, compared to human acellular dermal matrix, porcine acellular lung matrix would promote greater cell infiltration and vessel formation. Following pneumonectomy, porcine lungs were processed and characterized histologically and by scanning electron microscopy to demonstrate efficacy of the decellularization. Using a rat model of subcutaneou implantation, porcine acellular lung matrices (n = 8) and human acellular dermal matrices (n = 8) were incubated in vivo for 6 weeks. To evaluate performance under mechanically stressed conditions, porcine acellular lung matrices (n = 7) and human acellular dermal matrices (n = 7) were implanted in a rat model of chronic ventral incisional hernia repair for 6 weeks. After 6 weeks, tissues were evaluated using hematoxylin and eosin and Masson's trichrome staining to quantify cell infiltration and vessel formation. Porcine acellular lung matrices were shown to be successfully decellularized. Following subcutaneous implantation, macroscopic vessel formation was evident. Porcine acellular lung matrices demonstrated sufficient incorporation and showed no evidence of mechanical failure after ventral hernia repair. Porcine acellular lung matrices demonstrated significantly greater cellular density and vessel formation when compared to human acellular dermal matrix. Vessel sizes were similar across all groups. Cell infiltration and vessel formation are well-characterized metrics of incorporation

  8. Porcine acellular lung matrix for wound healing and abdominal wall reconstruction: A pilot study

    PubMed Central

    Fernandez-Moure, Joseph S; Van Eps, Jeffrey L; Rhudy, Jessica R; Cabrera, Fernando J; Acharya, Ghanashyam S; Tasciotti, Ennio; Sakamoto, Jason; Nichols, Joan E

    2016-01-01

    Surgical wound healing applications require bioprosthetics that promote cellular infiltration and vessel formation, metrics associated with increased mechanical strength and resistance to infection. Porcine acellular lung matrix is a novel tissue scaffold known to promote cell adherence while minimizing inflammatory reactions. In this study, we evaluate the capacity of porcine acellular lung matrix to sustain cellularization and neovascularization in a rat model of subcutaneous implantation and chronic hernia repair. We hypothesize that, compared to human acellular dermal matrix, porcine acellular lung matrix would promote greater cell infiltration and vessel formation. Following pneumonectomy, porcine lungs were processed and characterized histologically and by scanning electron microscopy to demonstrate efficacy of the decellularization. Using a rat model of subcutaneou implantation, porcine acellular lung matrices (n = 8) and human acellular dermal matrices (n = 8) were incubated in vivo for 6 weeks. To evaluate performance under mechanically stressed conditions, porcine acellular lung matrices (n = 7) and human acellular dermal matrices (n = 7) were implanted in a rat model of chronic ventral incisional hernia repair for 6 weeks. After 6 weeks, tissues were evaluated using hematoxylin and eosin and Masson’s trichrome staining to quantify cell infiltration and vessel formation. Porcine acellular lung matrices were shown to be successfully decellularized. Following subcutaneous implantation, macroscopic vessel formation was evident. Porcine acellular lung matrices demonstrated sufficient incorporation and showed no evidence of mechanical failure after ventral hernia repair. Porcine acellular lung matrices demonstrated significantly greater cellular density and vessel formation when compared to human acellular dermal matrix. Vessel sizes were similar across all groups. Cell infiltration and vessel formation are well-characterized metrics of incorporation

  9. High Cost/High Risk Components to Chalcogenide Molded Lens Model: Molding Preforms and Mold Technology

    SciTech Connect

    Bernacki, Bruce E.

    2012-10-05

    This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.

  10. Nonpost mold cure compound

    NASA Astrophysics Data System (ADS)

    Hirata, Akihiro

    1997-08-01

    The recent low price trend of electronic products has made IC manufacturing efficiency a top priority in the semiconductor industry. Post mold cure (PMC) process, which generally involves heating the packages in the oven at 175 C for 4 to 8 hours, takes up much longer time than most other assembly processes. If this PMC process can be reduced or eliminated, semiconductor makers will be rewarded with a much higher cost merit. We define the purpose of Non-PMC as 'to get high reliability with suitable physical and electrical properties without PMC'. We compared carious properties of molding compound before and after PMC. We found that curing reaction has almost complete through DSC and C-NMR measurement, but several properties have not stabilized yet, and that not all properties after PMC were better than before PMC. We developed new grade of molding compound considering these facts. And we found that main factors to accomplish non-PMC compound are curability and flowability, and more, increasing of fundamental properties. To accomplish non-PMC, at first, molding compound need to have very high curability. Generally speaking, too high curability causes low flowability, and causes incomplete filing, wire sweep, pad shift, and weak adhesion to inner parts of IC packages. To prevent these failures, various compound properties were studied, and we achieved in adding good flowability to very high curable molding compound. Finally, anti-popcorn property was improved by adding low moisture, high adhesion, high Tg, and high flexural strengths at high temperature. Through this study, we developed new compound grade for various package, especially large QFP using standard ECN resin.

  11. Purification and characterization of the staphylococcal slime-associated antigen and its occurrence among Staphylococcus epidermis clinical isolates.

    PubMed

    Baldassarri, L; Donnelli, G; Gelosia, A; Voglino, M C; Simpson, A W; Christensen, G D

    1996-08-01

    The Staphylococcus epidermidis slime-associated antigen (SAA) was purified and characterized. N-Acetyl-glucosamine accounted for 70% of the dry weight of SAA, which was immunolocalized on the ruthenium red-positive material produced by slime-positive strains. A total of 59% of slime-producing S. epidermidis clinical isolates expressed SAA, while the phenotype slime- SAA+ was never recovered. PMID:8757885

  12. Phase II trial of whole-cell pertussis vaccine vs an acellular vaccine containing agglutinogens.

    PubMed

    Miller, E; Ashworth, L A; Robinson, A; Waight, P A; Irons, L I

    1991-01-12

    An acellular pertussis vaccine containing agglutinogens 2 and 3, pertussis toxin, and filamentous haemagglutinin was developed by the Centre for Applied Microbiology and Research in the UK. 188 infants were entered into a randomised blind trial and received either the acellular or a whole-cell vaccine, combined with diphtheria and tetanus toxoids, in a 3, 5, and 8-10 month schedule. Local reactions were similar in the two groups but significantly fewer infants had systemic symptoms after the acellular vaccine. Mean log-antibody titres to the agglutinogen and toxin components were higher with the acellular than with the whole-cell vaccine. Persistence of antibodies one year after the third dose was also better in the acellular group. PMID:1670725

  13. Demonstration of the Coagulation and Diffusion of Homemade Slime Prepared under Acidic Conditions without Borate

    ERIC Educational Resources Information Center

    Isokawa, Naho; Fueda, Kazuki; Miyagawa, Korin; Kanno, Kenichi

    2015-01-01

    Poly(vinyl alcohol) (PVA) precipitates in many kinds of aqueous salt solutions. While sodium sulfate, a coagulant for PVA fiber, precipitates PVA to yield a white rigid gel, coagulation of PVA with aluminum sulfate, a coagulant for water treatment, yields a slime-like viscoelastic fluid. One type of homemade slime is prepared under basic…

  14. Multi-agent model of slime mould for computing and robotics

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-03-01

    This chapter features results from a multi-agent model of slime mould. Slime mould is a remarkable organism because it possesses no nervous system, no skeleton, no organised musculature and no special senses. Despite these limitations, slime mould is capable of remarkable biological and computational feats by dynamically adapting its body plan in response to environmental stimuli. Because slime mould consists of simple component parts, its behaviour requires no specialised or critical components and the mechanisms which govern its behaviour are distributed throughout -- and embedded within -- the organism itself. This multi-agent approach to modelling slime mould is a bottom-up model and attempts to specifically use the same -- apparently limiting -- properties found in the organism itself: simple component parts, local interactions and self-organised collective emergent behaviour. The aim of the model is to show how the complexity of slime mould can emerge from these very simple local interactions. The model has successfully been applied to reproducing the biological behaviour of slime mould (growth patterns, network adaptation, oscillatory phenomena) and also the computational and robotic behaviour of slime mould. The images in this chapter give a flavour of the model with topics relating to the complex pattern formation phenomena, amoeboid movement and collective transport phenomena, and its utilisation as a spatially represented unconventional computing substrate...

  15. Whooping cough, twenty years from acellular vaccines introduction.

    PubMed

    Greco, D; Esposito, S; Tozzi, A; Pandolfi, E; Icardi, G; Giammanco, A

    2015-01-01

    Clinical pertussis resulting from infection with B. pertussis is a significant medical and public health problem, despite the huge success of vaccination that has greatly reduced its incidence. The whole cell vaccine had an undeniable success over the last 50 years, but its acceptance was strongly inhibited by fear, only partially justified, of severe side effects, but also, in the Western world, by the difficulty to enter in combination with other vaccines: today multi-vaccine formulations are essential to maintain a high vaccination coverage. The advent of acellular vaccines was greeted with enthusiasm by the public health world: in the Nineties, several controlled vaccine trials were carried out: they demonstrated a high safety and good efficacy of new vaccines. In fact, in the Western world, the acellular vaccines completely replaced the whole cells ones. In the last years, ample evidence on the variety of protection of these vaccines linked to the presence of different antigens of Bordetella pertussis was collected. It also became clear that the protection provided, on average around 80%, leaves every year a significant cohort of vaccinated susceptible even in countries with a vaccination coverage of 95%, such as Italy. Finally, it was shown that, as for the pertussis disease, protection decreases over time, to leave a proportion of adolescents and adults unprotected. Waiting for improved pertussis vaccines, the disease control today requires a different strategy that includes a booster at 5 years for infants, but also boosters for teenagers and young adults, re-vaccination of health care personnel, and possibly of pregnant women and of those who are in contact with infants (cocooning). Finally, the quest for better vaccines inevitably tends towards pertussis acellular vaccines with at least three components, which have demonstrated superior effectiveness and have been largely in use in Italy for fifteen years.

  16. Pigment gallstone pathogenesis: slime production by biliary bacteria is more important than beta-glucuronidase production.

    PubMed

    Stewart, L; Ponce, R; Oesterle, A L; Griffiss, J M; Way, L W

    2000-01-01

    Pigment stones are thought to form as a result of deconjugation of bilirubin by bacterial beta-glucuronidase, which results in precipitation of calcium bilirubinate. Calcium bilirubinate is then aggregated into stones by an anionic glycoprotein. Slime (glycocalyx), an anionic glycoprotein produced by bacteria causing foreign body infections, has been implicated in the formation of the precipitate that blocks biliary stents. We previously showed that bacteria are present within the pigment portions of gallstones and postulated a bacterial role in pigment stone formation through beta-glucuronidase or slime production. Ninety-one biliary bacterial isolates from 61 patients and 12 control stool organisms were tested for their production of beta-glucuronidase and slime. The average slime production was 42 for biliary bacteria and 2.5 for stool bacteria (P <0.001). Overall, 73% of biliary bacteria and 8% of stool bacteria produced slime (optical density >3). In contrast, only 38% of biliary bacteria produced beta-glucuronidase. Eighty-two percent of all patients, 90% of patients with common bile duct (CBD) stones, 100% of patients with primary CBD stones, and 93% of patients with biliary tubes had one or more bacterial species in their stones that produced slime. By comparison, only 47% of all patients, 60% of patients with CBD stones, 62% of patients with primary CBD stones, and 50% of patients with biliary tubes had one or more bacteria that produced beta-glucuronidase. Most biliary bacteria produced slime, and slime production correlated better than beta-glucuronidase production did with stone formation and the presence of biliary tubes or stents. Patients with primary CBD stones and biliary tubes had the highest incidence of slime production. These findings suggest that bacterial slime is important in gallstone formation and the blockage of biliary tubes.

  17. Human acellular dermal wound matrix: evidence and experience.

    PubMed

    Kirsner, Robert S; Bohn, Greg; Driver, Vickie R; Mills, Joseph L; Nanney, Lillian B; Williams, Marie L; Wu, Stephanie C

    2015-12-01

    A chronic wound fails to complete an orderly and timely reparative process and places patients at increased risk for wound complications that negatively impact quality of life and require greater health care expenditure. The role of extracellular matrix (ECM) is critical in normal and chronic wound repair. Not only is ECM the largest component of the dermal skin layer, but also ECM proteins provide structure and cell signalling that are necessary for successful tissue repair. Chronic wounds are characterised by their inflammatory and proteolytic environment, which degrades the ECM. Human acellular dermal matrices, which provide an ECM scaffold, therefore, are being used to treat chronic wounds. The ideal human acellular dermal wound matrix (HADWM) would support regenerative healing, providing a structure that could be repopulated by the body's cells. Experienced wound care investigators and clinicians discussed the function of ECM, the evidence related to a specific HADWM (Graftjacket(®) regenerative tissue matrix, Wright Medical Technology, Inc., licensed by KCI USA, Inc., San Antonio, TX), and their clinical experience with this scaffold. This article distills these discussions into an evidence-based and practical overview for treating chronic lower extremity wounds with this HADWM. PMID:24283346

  18. Preclinical evaluations of acellular biological conduits for peripheral nerve regeneration

    PubMed Central

    Liao, I-Chien; Wan, Hua; Qi, Shijie; Cui, Cunqi; Patel, Paarun; Sun, Wendell

    2013-01-01

    Various types of natural biological conduits have been investigated as alternatives to the current surgical standard approach for peripheral nerve injuries. Autologous nerve graft, the current gold standard for peripheral nerve damage, is limited by clinical challenges such as donor-site morbidity and limited availability. The purpose of this study was to evaluate the efficacy of using acellular xenographic conduits (nerve, artery, and dermis) for the repair of a 1.2 cm critical size defect of peripheral nerve in a rodent model. Four months post surgery, the animal group receiving acellular artery as a nerve conduit showed excellent physiological outcome in terms of the prevention of muscle atrophy and foot ulcer. Histological assessment of the bridged site revealed excellent axon regeneration, as opposed to the nonrepaired control group or the group receiving dermal conduit. Finally, the study evaluated the potential improvement via the addition of undifferentiated mesenchymal stem cells into the artery conduit during the bridging procedure. The mesenchymal stem cell–dosed artery conduit group resulted in significantly higher concentration of regenerated axons over artery conduit alone, and exhibited accelerated muscle atrophy rescue. Our results demonstrated that xenographic artery conduits promoted excellent axonal regeneration with highly promising clinical relevance. PMID:23532671

  19. Multilayered implantation using acellular dermal matrix into nude mice.

    PubMed

    Lee, Dong Won; Lee, Myung Chul; Roh, Hyun; Lee, Won Jai

    2014-12-01

    Soft tissue augmentation using acellular dermal matrix has gained popularity to overcome the shortcomings of autogenous and alloplastic materials. Sometimes it needs multilayered stacking to obtain enough volume. In this study, we investigated the efficacy of multilayered implantation using acellular dermal matrix (MatriDerm(®)) for soft tissue augmentation. MatriDerm was implanted subdermally on each side of the dorsum of nude mice (n = 20), stacked two layers thick in the control group and three layers thick in the experimental group. Alterations of thickness, degree of angiogenesis, and collagen and elastin fiber syntheses were observed over 40 days. Three-layered implantation with MatriDerm maintained its volume similarly as in two-layered implantation, although the thickness decreased after 30 days in both groups. At the early stage of implantation, angiogenesis and collagen and elastin fiber syntheses occurred fluently on the central portion, which is the farthest away from the surface in contact with the host tissue. Collagen and elastin fibers became more concentrated over time, and the original structure of MatriDerm could not be maintained due to being replaced with newly formed collagen and elastin fibers 40 days after implantation. Multilayered implantation with MatriDerm is considered appropriate for tissue ingrowth and can be used as a substitute for soft tissue augmentation.

  20. Acellular dermal matrices in breast reconstructions - a literature review.

    PubMed

    Skovsted Yde, Simon; Brunbjerg, Mette Eline; Damsgaard, Tine Engberg

    2016-08-01

    During the last two decades, acellular dermal matrices (ADM) have been more widely used in reconstructive procedures i.e. breast reconstructions. Several, both synthetic and biologic products derived from human, porcine and bovine tissue, have been introduced. Until this point postoperative complications for the acellular dermal matrices, as a group, have been the main focus. The purpose of this literature review is to summarize the current knowledge on the each biologic product used in breast reconstructions, including product specific complication frequencies. A systematic search of the literature was performed in the PubMed and EMBASE databases, identifying 55 relevant articles, mainly evidence level III. AlloDerm seems to be associated with severe complicating matters in the reconstructive process compared to other products. This could be due to the higher number of investigating studies relative to the others. The surgical area faces certain challenges comparing results, due to surgical variance, the data collection and follow-up. More well-defined guidelines and more high-evidence randomized studies could increase the overall level of evidence in this area. PMID:26881927

  1. Human acellular dermal wound matrix: evidence and experience.

    PubMed

    Kirsner, Robert S; Bohn, Greg; Driver, Vickie R; Mills, Joseph L; Nanney, Lillian B; Williams, Marie L; Wu, Stephanie C

    2015-12-01

    A chronic wound fails to complete an orderly and timely reparative process and places patients at increased risk for wound complications that negatively impact quality of life and require greater health care expenditure. The role of extracellular matrix (ECM) is critical in normal and chronic wound repair. Not only is ECM the largest component of the dermal skin layer, but also ECM proteins provide structure and cell signalling that are necessary for successful tissue repair. Chronic wounds are characterised by their inflammatory and proteolytic environment, which degrades the ECM. Human acellular dermal matrices, which provide an ECM scaffold, therefore, are being used to treat chronic wounds. The ideal human acellular dermal wound matrix (HADWM) would support regenerative healing, providing a structure that could be repopulated by the body's cells. Experienced wound care investigators and clinicians discussed the function of ECM, the evidence related to a specific HADWM (Graftjacket(®) regenerative tissue matrix, Wright Medical Technology, Inc., licensed by KCI USA, Inc., San Antonio, TX), and their clinical experience with this scaffold. This article distills these discussions into an evidence-based and practical overview for treating chronic lower extremity wounds with this HADWM.

  2. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  3. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  4. Low-pressure injection molding

    SciTech Connect

    Mangels, J.A. )

    1994-05-01

    Ceramic injection molding experienced a revival in the 1970s and 1980s with the application of ceramics for gas turbine components. Concurrently, techniques were being developed for the injection molding of powdered metal compositions into complex shaped articles. The impetus for the development of injection molding as a ceramic fabrication process lay in the potential to produce complex-shaped components to near-net shape. In the ceramic injection molding process, ceramic powders are processed to obtain the desired particle size, distribution and morphology and blended to obtain a homogeneous distribution. These powders are then mixed with the organic binders, generally in a heated, highshear mixer at temperatures above the melting point of the organic binders. The injection molding mix is pelletized, cooled and fed into an injection molding machine. The molding mix is reheated to a fluid state and injected under high pressure (7--70 MPa) into a die cavity. The molded part is removed from the tooling after the molding mix has solidified in the die. The organic binders are then removed from the component at temperatures up to 400 C, generally by some combination of wicking and thermal decomposition. Finally, the component is sintered to obtain its final ceramic properties, using conventional ceramic processes.

  5. MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...

  6. 8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. VIEW OF A MOLD FOR PRECISION CASTING. THE MOLD WAS USED IN FOUNDRY OPERATIONS THAT CAST PLUTONIUM EITHER AS INGOTS SUITABLE FOR ROLLING AND FURTHER WROUGHT PROCESSING OR INTO SHAPES AMENABLE TO DIRECT MACHINING OPERATIONS. (5/6/59) - Rocky Flats Plant, Plutonium Fabrication, Central section of Plant, Golden, Jefferson County, CO

  7. Method of continuously producing compression molded coal

    SciTech Connect

    Yoshida, H.; Ishihara, N.; Kuwashima, S.

    1986-08-19

    This patent describes a method of producing a continuous cake of compression molded coal for chamber type coke ovens comprising steps of charging raw material coking coal into a molding box, and pressurizing the raw material coking coal with a pressing plate to obtain compression molded coal and to push the compression molded coal out of the molding box through an outlet. The improvement described here includes: the coking coal having a water content of more than 8.5% is charged into a chamber of the molding box at a side opposite the outlet, the pressing plate in the chamber is so advanced in the molding box to compression mold the coking coal into the preceding compression molded coal at a pressure no more than about 100 Kg/cm/sup 2/ so that the molded coal has a bulk density of at least 1.0 wet ton/m/sup 3/, and to push the molded coal in the molding box toward the outlet, the molded coal pressurized by the pressing plate partly remains in the molding box for supporting the coking coal freshly charged for the following cycle of the operation, and the freshly charged coal is pressed by the pressing plate so that the subsequent molded coal is combined with the preceding compression molded coal and the preceding molded coal is pushed out of the molding box whereby by repeating the serial steps of the operation, continuous cake of compression molded coal is produced.

  8. Habituation in non-neural organisms: evidence from slime moulds.

    PubMed

    Boisseau, Romain P; Vogel, David; Dussutour, Audrey

    2016-04-27

    Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved.

  9. Habituation in non-neural organisms: evidence from slime moulds.

    PubMed

    Boisseau, Romain P; Vogel, David; Dussutour, Audrey

    2016-04-27

    Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. PMID:27122563

  10. Deployment of hagfish slime thread skeins requires the transmission of mixing forces via mucin strands.

    PubMed

    Winegard, T M; Fudge, D S

    2010-04-01

    Hagfishes are benthic marine protovertebrates that secrete copious quantities of slime when threatened. The slime originates as a two-component glandular exudate comprised of coiled bundles of cytoskeletal intermediate filaments (thread skeins) and mucin vesicles. Holocrine secretion of the slime into seawater results in the rapid deployment of both fibrous and mucin components, resulting in about a liter of dilute slime. Deployment of the thread skeins involves their unraveling in a fraction of a second from a 150 microm-long ellipsoid bundle to a thread that is 100x longer. We hypothesized that thread skein deployment requires both vigorous hydrodynamic mixing and the presence of mucin vesicles, both of which are required for whole slime deployment. Here we provide evidence that mixing and mucin vesicles are indeed crucial for skein unraveling. Specifically, we show that mucin vesicles mixed into seawater swell and elongate into high-aspect ratio mucin strands that attach to the thread skeins, transmit hydrodynamic forces to them and effect their unraveling by loading them in tension. Our discovery of mucin strands in hagfish slime not only provides a mechanism for the rapid deployment of thread skeins in vivo, it also helps explain how hagfish slime is able to trap such impressive volumes of seawater via viscous entrainment. We believe that the deployment of thread skeins via their interaction with shear-elongated mucins represents a unique mechanism in biology and may lead to novel technologies for transmitting hydrodynamic forces to microscale particles that would typically be immune to such forces.

  11. Genotypic variation and slime production among blood and catheter isolates of Candida parapsilosis.

    PubMed

    Branchini, M L; Pfaller, M A; Rhine-Chalberg, J; Frempong, T; Isenberg, H D

    1994-02-01

    Candida parapsilosis is an important nosocomial pathogen that can proliferate in high concentrations of glucose and form biofilms on prosthetic materials. We investigated the genotypic diversity and slime production among 31 isolates of C. parapsilosis from individual patients with bloodstream or catheter infections. DNA subtyping was performed by using electrophoretic karyotyping plus restriction endonuclease analysis with BssHII followed by pulsed-field gel electrophoresis. Slime production was evaluated by growing organisms in Sabouraud broth with 8% glucose and examining the walls of the tubes for the presence of an adherent slime layer. Overall there were 14 DNA subtypes among the 31 isolates. Eighty percent of the isolates produced slime; 67% of the isolates were moderately to strongly positive, 13% were weakly positive, and 20% were not slime producers. The ability of isolates of a given DNA type to produce slime under these conditions was variable. The results of these studies indicate moderate genotypic variation among clinical isolates of C. parapsilosis. The propensity of these isolates to form slime in glucose-containing solutions suggests that this phenotypic characteristic may contribute to the ability of C. parapsilosis to adhere to plastic catheters and cause infections. PMID:8150956

  12. Mold Materials For Permanent Molding of Aluminum Alloys

    SciTech Connect

    John F Wallace; David Schwam; Wen Hong dxs11@po.cwru.edu

    2001-09-14

    A test that involves immersion of the potential mod materials for permanent molds has been developed that provides a thermal cycle that is similar to the experienced during casting of aluminum in permanent molds. This test has been employed to determine the relative thermal fatigue resistance of several different types of mold materials. Four commercial mold coatings have been evaluated for their insulating ability, wear resistance and roughness. The results indicate that composition and structure of the mold materials have considerable effect on their thermal fatigue cracking behavior. Irons with a gray iron structure are the most prone to thermal fatigue cracking followed by compacted graphite irons with the least thermal fatigue cracking of the cast irons experienced by ductile iron. The composition of these various irons affects their behavior.

  13. Processing studies in sheet molding compound compression molding

    NASA Astrophysics Data System (ADS)

    Abrams, Lisa Marie

    Due to its high strength to weight ratio, corrosion resistance, and low cost. Sheet Molding Compound (SMC) production offers great potential for growth in the automotive and trucking industry. Much attention is now being given to improving the economy of SMC compression molding by reducing the cycle time required to produce acceptable parts in steady production. One of the fastest growing applications of Sheet Molding Compound (SMC) compression molding panels is the manufacture of truck body panels. Due to their large size, the molding forces developed are substantial and have a major influence in the molding cycle. The relevant process models for SMC flow are reviewed and a procedure is developed that can be used to obtain the closing force and calculate the needed material parameters. Experiments were done using commercially made SMC varying quantities of glass, filler, and thickener to verify the validity of this model and the compression force was predicted for commercially made automotive hoods. It was found that glass and filler had a significant impact on the material parameters. When the amount of glass was increased, both material parameters m/deltan and eta increased. Similar trends were seen when increasing the amount of filler. For the thickener used in this research (magnesium oxide), it was found that it had minimal effect on the material parameters. Molding conditions and initial SMC charge configurations were also varied to see their effects on molding force and material parameters. Initial charge dimensions and volume as well as mold closing speed showed no effect on material parameters, while molding temperature showed a minimal effect. Material parameters were calculated for each SMC composition. These parameters were used to predict the compression force for the Corvette hood and Fiero hood. These predictions were compared with actual Corvette and Fiero hoods manufactured in industry. They predicted the commercially made parts quite well.

  14. Twistable mold for helicopter blades

    NASA Technical Reports Server (NTRS)

    Carter, E. S.; Kiely, E. F.

    1972-01-01

    Design is described of mold for fabrication of blades composed of sets of aerodynamic shells having same airfoil section characteristics but different distributions. Mold consists of opposing stacks of thin templates held together by long bolts. When bolts are loosened, templates can be set at different positions with respect to each other and then locked in place.

  15. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications.

  16. INDOOR MOLDS AND ALLERGIC POTENTIAL

    EPA Science Inventory

    Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...

  17. Thermophilic molds: Biology and applications.

    PubMed

    Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi

    2016-11-01

    Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications. PMID:26777293

  18. Protection against pertussis by Takeda's acellular pertussis vaccine: household contact studies in Kawasaki City, Japan.

    PubMed

    Kato, T; Kaku, H; Arimoto, Y

    1988-01-01

    To evaluate the vaccine efficacy of an acellular pertussis vaccine which has been in clinical use in Japan since 1981, a retrospective study was performed by a questionnaire survey of secondary pertussis attacks through family contact in 146 children with pertussis diagnosed in the period from January 1981 through May 1988. In this study, Takeda's acellular vaccine which contains a high level of FHA, low level of PT and a small amount of agglutinogen, was evaluated. Secondary pertussis attacks through family contact were found in 17 of 27 siblings (62.9%) not immunized with pertussis vaccine. On the other hand, 26 siblings immunized with Takeda's acellular vaccine were exposed to pertussis through family contact and a secondary attack was seen in only one of them (3.8%). The present study revealed an efficacy rate of 93.9% for Takeda's acellular pertussis vaccine. PMID:3078808

  19. Protection against pertussis by acellular pertussis vaccines (Takeda, Japan): household contact studies in Kawasaki City, Japan.

    PubMed

    Kato, T; Goshima, T; Nakajima, N; Kaku, H; Arimoto, Y; Hayashi, F

    1989-12-01

    To evaluate the vaccine efficacy of an acellular pertussis vaccine which has been in clinical use in Japan since 1981, a retrospective study was performed by a questionnaire survey of secondary pertussis attacks through family contact in 146 children with pertussis diagnosed in the period from January 1981 through May 1988. In this study, acellular vaccine made by Takeda Pharmaceutical Company, which contains a high level of FHA (filamentous hemagglutinin), a low level of PT (pertussis toxin) and a small amount of agglutinogen, was evaluated. Secondary pertussis attacks through family contact were found in 17 of 29 siblings (58.6%) not immunized with pertussis vaccine. On the other hand, 27 siblings immunized with Takeda's acellular vaccine were exposed to pertussis through family contact and a secondary attack was seen in only one of them (3.7%). The present study revealed an efficacy rate of 93.7% for Takeda's acellular pertussis vaccine. PMID:2516396

  20. [Protection against pertussis by Japanese T type acellular pertussis vaccine: household contact study in Kawasaki City].

    PubMed

    Kato, T; Matsuyoshi, S; Goshima, T; Nakajima, N; Yamamoto, H; Arimoto, Y; Kaku, H; Hayashi, F

    1989-09-01

    To evaluate the vaccine efficacy of acellular pertussis vaccine which has been in clinical use in Japan since 1981, a retrospective study was made by a questionnaire from secondary pertussis attack through family contact in 149 children with pertussis diagnosed in the period from January 1981 through May 1988. In this study, Takeda's acellular vaccine which contains a high level of FHA, low level of PT and a small amount of agglutinogen, was evaluated. Secondary pertussis attacks through family contact were found in 17 of 29 siblings (58.6%) not immunized with pertussis vaccine. On the other hand of the siblings immunized with Takeda's acellular vaccine 27 were exposed to pertussis through family contact and a secondary attack was seen in only one of them (3.4%). The present study revealed an efficacy rate of 94.2% for the Takeda's acellular pertussis vaccine. PMID:2509597

  1. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  2. Achieved slime flotation in centrifugal force field by float-hydrocyclone

    SciTech Connect

    Guode Xuzhanxian; Gaozhenshen Songzhiwei

    1997-12-31

    Based on the theory of intensifying flotation in a centrifugal force field, float-hydrocyclone (FH) is developed, which is a new type of equipment for slime flotation and consists of an air bubble generator and the cylindrical section of a hydrocyclone. The combination of pulp and air bubbles is fed into the FH tangentially at a high speed to effect the separation of slime in the centrifugal force field. It offers many advantages over mechanically agitated flotation cells. Commercial test results show that slime, especially fine slime, can be perfectly floated in the FH with rapid flotation and fine froth size. The quality and quantity of concentrate and tailings can be adjusted conveniently within a certain range according to different requirements.

  3. Robotized system for removal of slime from the bottom of steam generators

    NASA Astrophysics Data System (ADS)

    Kucherenko, O. V.; Shvarov, V. A.

    2014-02-01

    Reliability of steam generators depends not only on the main technical characteristics and correctness of the operational mode but also on the cleanliness of the heat-exchange surface and the presence of slime precipitated on the bottom. To provide the cleanliness, chemical methods of cleaning the heatexchange surfaces are used. In this article, we consider the process of removal of sediments that are formed precisely on the bottom of the steam generator from its volume. Possible mechanical methods for removal of sediments are presented. The consideration of variants of cleaning approved for acting steam generators showed the efficiency and applicability of the developed installation for the slime removal from steam generators. The main principles of construction of the system for slime removal from the steam generator bottom and constructive features of the installation, which make it possible to implement the stated tasks on the slime removal from the steam generator bottom, are given.

  4. Development and initial testing of a novel slime mould biosensor.

    PubMed

    Whiting, James G H; de Lacy Costello, Ben; Adamatzky, Andrew

    2014-01-01

    A plurality of whole cell biosensors have been developed using many different cell types. Biosensors incorporate biomolecular components or whole cells to facilitate specific analyte interaction; research documented here presents a novel whole cell biosensor based on the slime mould Physarum polycephalum (PP). The electrical response of PP when exposed to multiple chemicals are measured and quantified in terms of amplitude and frequency response. The PP biosensor is capable of detecting the tested chemicals and individually identifying a large number in terms of a specific shift in either oscillation frequency or amplitude. However, it does exhibit a sensitivity to environmental changes such as light level and temperature which may interfere with the detection of the target analyte but could also be used for wider sensing applications. It is proposed that this novel biosensor is capable of detecting many organic chemicals beyond those presented in this work and that the biosensor may be used for environmental monitoring and toxicity evaluation.

  5. You say "lean finely textured beef," I say "pink slime".

    PubMed

    Reid, Rita-Marie Cain

    2014-01-01

    In 2012, American Broadcasting Companies, Inc. (ABC) broadcast a segment on its evening news show regarding the manufacture of "lean finely textured beef" by Beef Products, Inc. (BPI). The broadcast, as well as follow-up reports and social media communications, repeatedly referred to the product as "pink slime," a term originated by a United States Department of Agriculture (USDA) employee for the processed meat. The market backlash against the product was immediate and intense. Ultimately, BPI closed three processing plants, cut hundreds of jobs, and filed for bankruptcy. BPI sued ABC and others for food libel, defamation, and tortious interference. This research analyzes those claims and defenses and discusses the future of such cases.

  6. Cellular automaton model of crowd evacuation inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Kalogeiton, V. S.; Papadopoulos, D. P.; Georgilas, I. P.; Sirakoulis, G. Ch.; Adamatzky, A. I.

    2015-04-01

    In all the living organisms, the self-preservation behaviour is almost universal. Even the most simple of living organisms, like slime mould, is typically under intense selective pressure to evolve a response to ensure their evolution and safety in the best possible way. On the other hand, evacuation of a place can be easily characterized as one of the most stressful situations for the individuals taking part on it. Taking inspiration from the slime mould behaviour, we are introducing a computational bio-inspired model crowd evacuation model. Cellular Automata (CA) were selected as a fully parallel advanced computation tool able to mimic the Physarum's behaviour. In particular, the proposed CA model takes into account while mimicking the Physarum foraging process, the food diffusion, the organism's growth, the creation of tubes for each organism, the selection of optimum tube for each human in correspondence to the crowd evacuation under study and finally, the movement of all humans at each time step towards near exit. To test the model's efficiency and robustness, several simulation scenarios were proposed both in virtual and real-life indoor environments (namely, the first floor of office building B of the Department of Electrical and Computer Engineering of Democritus University of Thrace). The proposed model is further evaluated in a purely quantitative way by comparing the simulation results with the corresponding ones from the bibliography taken by real data. The examined fundamental diagrams of velocity-density and flow-density are found in full agreement with many of the already published corresponding results proving the adequacy, the fitness and the resulting dynamics of the model. Finally, several real Physarum experiments were conducted in an archetype of the aforementioned real-life environment proving at last that the proposed model succeeded in reproducing sufficiently the Physarum's recorded behaviour derived from observation of the aforementioned

  7. Mold-induced hypersensitivity pneumonitis.

    PubMed

    Greenberger, Paul A

    2004-01-01

    Mold-induced hypersensitivity pneumonitis results from macrophage- and lymphocyte-driven inflammation, which may be attributable to contaminated humidifiers or heating-ventilation systems or sources in homes, schools, or workplaces. A case may be suspected when there is water intrusion or inadequate drainage. Some fungal causes include species of Alternaria, Aspergillus, Cryptostroma, Penicillium, Pullularia, Rhodotorula, and Trichosporon. The differential diagnosis includes mold-induced asthma, sick building syndrome, mass psychogenic illness (epidemic hysteria), unjustified fears of "toxic" molds, and conditions causing recurrent pneumonitis. PMID:15510579

  8. ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.

    ERIC Educational Resources Information Center

    CHANDLER, MARION N.

    THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES. ALSO…

  9. Transfer molding of PMR-15 polyimide resin

    NASA Technical Reports Server (NTRS)

    Reardon, J. P.; Moyer, D. W.; Nowak, B. E.

    1985-01-01

    Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.

  10. Surface characterisation of two strains of Staphylococcus epidermidis with different slime-production by AFM

    NASA Astrophysics Data System (ADS)

    Méndez-Vilas, A.; Gallardo-Moreno, A. M.; González-Martín, M. L.; Calzado-Montero, R.; Nuevo, M. J.; Bruque, J. M.; Pérez-Giraldo, C.

    2004-11-01

    Slime-producer Staphylococcus epidermidis is one opportunistic bacteria directly related to biomaterial infections inside the human body. The characterisation of the bacterial surface is crucial when trying to control its adhesion process and prevent the biofilm formation. This work aims to analyse the microscopic and submicroscopic surface structure of two strains of S. epidermidis with different slime production, as well as mapping the surface interaction forces. Atomic force microscopy (AFM) shows that S. epidermidis ATCC35984 is covered by a granular-like film, highly compacted with the presence of repeated "holes". However, S. epidermidis ATCC35983 only shows a partial coverage by a less compacted granular-like film, mainly located in the inter-cellular zones. Both films are related to the slime of the two strains studied. As regards to the adhesion forces, results show a greater adhesion of the tip to the slime covering S. epidermidis ATCC35984, than that covering the surface of S. epidermidis ATCC35983. In addition, the adhesion to the free-slime zones of the last strain was higher than to the slime-covered parts.

  11. Removal of arsenic and antimony from anode slime by vacuum dynamic flash reduction.

    PubMed

    Lin, Deqiang; Qiu, Keqiang

    2011-04-15

    Anode slime is an important material of recycling precious metals. Up to now, treating the arsenic- and antimony-rich anode slime by conventional processes has the following problems: its economic and environmental effect is less than satisfactory, and the removal effect of arsenic and antimony from anode slime in present processes is not all that could be desired. Therefore, vacuum dynamic flash reduction, a new process for treating arsenic- and antimony-rich anode slime, was investigated in this work. During vacuum dynamic flash reduction, silver from the arsenic- and antimony-rich anode slime was left behind in the distilland as the silver alloy, and trivalent oxides of arsenic and antimony were evaporated in the distillate. The experimental results showed that the evaporation percent of the arsenic- and antimony-rich anode slime was 65.6%. Namely, 98.92% by weight of arsenic and 93.67% by weight of antimony can be removed under the following experimental conditions: temperature of 1083 K, vacuum evaporation time of 60 min, and air flow rate of 400 mL/min corresponding to the residual gas pressure of 250 Pa. Moreover, vacuum treatment eliminates much of the air pollution and material losses associated with other conventional treatment methods.

  12. Composition of the bacterial biota in slime developed in two machines at a Canadian paper mill.

    PubMed

    Disnard, Julie; Beaulieu, Carole; Villemur, Richard

    2011-02-01

    During the process of papermaking by pulp and paper plants, a thick and viscous deposits, termed slime, is quickly formed around the paper machines, which can affect the papermaking process. In this study, we explored the composition of the bacterial biota in slime that developed on shower pipes from 2 machines at a Canadian paper mill. Firstly, the composition was assessed for 12 months by DNA profiling with polymerase chain reaction coupled with denaturing gradient gel electrophoresis. Except for short periods (2-3 months), clustered analyses showed that the bacterial composition of the slime varied substantially over the year, with less than 50% similarity between the denaturing gradient gel electrophoresis profiles. Secondly, the screening of 16S rRNA gene libraries derived from 2 slime samples showed that the most abundant bacteria were related to 6 lineages, including Chloroflexi, candidate division OP10, Clostridiales, Bacillales, Burkholderiales, and the genus Deinococcus. Finally, the proportion of 8 bacterial lineages, such as Deinococcus sp., Meiothermus sp., and Chloroflexi, was determined by the Catalyzed Reporter Deposition-Fluorescence In Situ Hybridization in 2 slime samples. The results showed a high proportion of Chloroflexi, Tepidimonas spp., and Schlegelella spp. in the slime samples.

  13. Variations in DNA subtype, antifungal susceptibility, and slime production among clinical isolates of Candida parapsilosis.

    PubMed

    Pfaller, M A; Messer, S A; Hollis, R J

    1995-01-01

    Candida parapsilosis is an important nosocomial pathogen that can proliferate in high concentrations of glucose and form biofilms on prosthetic materials. We investigated the genotypic diversity, slime production, and antifungal susceptibility among 60 isolates of C. parapsilosis from 44 patients and 10 patient care providers from five different medical centers. Molecular typing was performed using macrorestriction digest profiles with BssHII followed by pulsed-field gel electrophoresis (REAG) and by electrophoretic karyotyping (EK). Slime production was evaluated by growing the organisms in Sabouraud broth with 8% glucose and examining the walls of the tubes for the presence of an adherent slime layer. Antifungal susceptibility to amphotericin B, 5-fluorocytosine, fluconazole, and itraconazole was determined using National Committee for Clinical Laboratory Standards proposed standard methods. Overall 28 different DNA types were identified by REAG and EK methods. MIC90 values ranged from 0.12 microgram/ml for itraconazole to 1.0 microgram/ml for fluconazole and amphotericin B. Sixty-five percent of the isolates produced slime: 37% were moderately to strongly positive, 28% were weakly positive, and 35% were negative. Overall, 83% of blood and catheter isolates were slime positive versus 53% of isolates from all other sites (P < 0.05). These data underscore the genetic diversity and susceptibility of C. parapsilosis to antifungal agents. Slime production may be important in enabling C. parapsilosis to cause catheter-related bloodstream infections. PMID:7789100

  14. Rapid control of mold temperature during injection molding process

    SciTech Connect

    Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min; Cakmak, Mukerrem; Sorrentino, Andrea

    2015-05-22

    The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during the entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.

  15. White mold of Jerusalem artichoke

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jerusalem artichoke (Helianthus tuberosus) is a Native American food plant closely related to the common sunflower (Helianthus annuus). Tubers of Jerusalem artichoke are increasingly available in retail grocery outlets. White mold (Sclerotinia stem rot), caused by the fungus, Sclerotinia sclerotioru...

  16. [Health effects of indoor molds].

    PubMed

    Buzina, Walter

    2007-01-01

    Molds are found almost everywhere in the environment. Their airborne propagules (conidia, spores, hyphal fragments) can--under certain circumstances--cause a variety of health problems like mycotic infections, allergies, asthma, irritations or toxic syndromes. PMID:18030548

  17. Mold remediation in a hospital.

    PubMed

    Lee, Tang G

    2009-01-01

    As occupants in a hospital, patients are susceptible to air contaminants that can include biological agents dispersed throughout the premise. An exposed patient can become ill and require medical intervention. A consideration for patients is that they may have become environmentally sensitive and require placement in an environment that does not compromise their health. Unfortunately, the hospital environment often contains more biological substances than can be expected in an office or home environment. When a hospital also experiences water intrusion such as flooding or water leaks, resulting mold growth can seriously compromise the health of patients and others such as nursing staff and physicians (Burge, Indoor Air and Infectious Disease. Occupational Medicine: State of the Art Reviews, 1980; Lutz et al., Clinical Infectious Diseases 37: 786-793, 2003). Micro-organism growth can propagate if the water is not addressed quickly and effectively. Immunocompromised patients are particularly at risk when subjected to fungal infection such that the US Center for Disease Control issued guideline for building mold in health care facilities (Centers for Disease and Control [CDC], Centers for Disease and Control: Questions and Answers on Stachybotrys chartarum and Other Molds, 2000). This paper is based on mold remediation of one portion of a hospital unit due to water from construction activity and inadequate maintenance, resulting in mold growth. A large proportion of the hospital staff, primarily nurses in the dialysis unit, exhibited health symptoms consistent with mold exposure. Unfortunately, the hospital administrators did not consider the mold risk to be serious and refused an independent consultant retained by the nurse's union to examine the premise (Canadian Broadcasting Corporation [CBC], Nurses file complaints over mold at Foothills. Canadian Broadcasting Corporation, 2003). The nurse's union managed to have the premise examined by submitting a court order of

  18. Molded polymer solar water heater

    DOEpatents

    Bourne, Richard C.; Lee, Brian E.

    2004-11-09

    A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.

  19. Oscillator for continuous casting mold

    SciTech Connect

    Behrends, G.

    1993-06-15

    In a continuous casting machine comprising a chilled mold disposed to receive molten metal which is discharged from the mold as a curved casting having a predetermined casting radius, and an oscillating drive for oscillating the mold relative to the casting, wherein the improvement described comprises mold guidance means having a first tensile element having an inner end and an outer end, the outer end being anchored to a fixed external frame and the inner end being secured to move with the mold, the first tensile element lying on a first radius extending from the center of curvature of said pre-determined casting radius; and a second tensile element having an inner and an outer end both anchored to a fixed external frame and secured to move with the mold intermediate the inner and outer ends, at least one end having variable tensioning means adapted to apply a tensile force to the second tensile element, the second tensile element lying on a second radius extending from the center of curvature of said predetermined casting radius.

  20. Investigation of the regenerative capacity of an acellular porcine medial meniscus for tissue engineering applications.

    PubMed

    Stapleton, Thomas W; Ingram, Joanne; Fisher, John; Ingham, Eileen

    2011-01-01

    Previously, we have described the development of an acellular porcine meniscal scaffold. The aims of this study were to determine the immunocompatibility of the scaffold and capacity for cellular attachment and infiltration to gain insight into its potential for meniscal repair and replacement. Porcine menisci were decellularized by exposing the tissue to freeze-thaw cycles, incubation in hypotonic tris buffer, 0.1% (w/v) sodium dodecyl sulfate in hypotonic buffer plus protease inhibitors, nucleases, hypertonic buffer followed by disinfection using 0.1% (v/v) peracetic, and final washing in phosphate-buffered saline. In vivo immunocompatibility was assessed after implantation of the acellular meniscal scaffold subcutaneously into galactosyltransferase knockout mice for 3 months in comparison to fresh and acellular tissue treated with α-galactosidase (negative control). The cellular infiltrates in the explants were assessed by histology and characterized using monoclonal antibodies against: CD3, CD4, CD34, F4/80, and C3c. Static culture was used to assess the potential of acellular porcine meniscal scaffold to support the attachment and infiltration of primary human dermal fibroblasts and primary porcine meniscal cells in vitro. The explants were surrounded by capsules that were more pronounced for the fresh meniscal tissue compared to the acellular tissues. Cellular infiltrates compromised mononuclear phagocytes, CD34-positive cells, and nonlabeled fibroblastic cells. T-lymphocytes were sparse in all explanted tissue types and there was no evidence of C3c deposition. The analysis revealed an absence of a specific immune response to all of the implanted tissues. Acellular porcine meniscus was shown to be capable of supporting the attachment and infiltration of primary human fibroblasts and primary porcine meniscal cells. In conclusion, acellular porcine meniscal tissue exhibits excellent immunocompatibility and potential for cellular regeneration in the longer term.

  1. Emergence and transitions of dynamic patterns of thickness oscillation of the plasmodium of the true slime mold Physarum polycephalum

    NASA Astrophysics Data System (ADS)

    Takagi, Seiji; Ueda, Tetsuo

    2008-03-01

    The emergence and transitions of various spatiotemporal patterns of thickness oscillation were studied in the freshly isolated protoplasm of the Physarum plasmodium. New patterns, such as standing waves, and chaotic and rotating spirals, developed successively before the well-documented synchronous pattern appeared. There was also a spontaneous opposite transition from synchrony to chaotic and rotating spirals. Rotating spiral waves were observed in the large migrating plasmodium, where the vein structures were being destroyed. Thus, the Physarum plasmodium exhibits versatile patterns, which are generally expected in coupled oscillator systems. This paper discusses the physiological roles of spatiotemporal patterns, comparing them with other biological systems.

  2. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species.

  3. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes.

    PubMed

    Liu, Q Sh; Yan, Sh Zh; Chen, Sh L

    2015-01-01

    To date, molecular systematics of Myxogastria has been based primarily on small subunit ribosomal RNA (SSU rRNA) and elongation factor 1-alpha (EF-1α) genes. To establish a natural classification system for the organisms, we examined phylogenetic relationships among myxogastrian species using cytochrome c oxidase subunit I (COL) and SSU rRNA genes. Twenty new sequences were obtained, including 10 COI and 10 SSU rRNA sequences, were compared with sequences of related species from GenBank in order to construct phylogenic trees. The analysis of the two data sets supported the modern phylogeny of myxogastria: orders Liceida and Trichiida formed a sister group at the most basal clade, while orders Stemonitida and Physarida formed a close group, and order Echinostelida was a sister group to Stemonitida and Physarida. However, the partial COI sequences were too conserved to resolve of the branches in Stemonitida and Physarida. In addition, we also deemed the specific edited mRNA events of COI sequences in myxogastrian species. PMID:25857192

  4. The mitochondrial plasmid of the true slime mold Physarum polycephalum bypasses uniparental inheritance by promoting mitochondrial fusion.

    PubMed

    Sakurai, Rakusa; Nomura, Hideo; Moriyam, Yohsuke; Kawano, Shigeyuki

    2004-08-01

    Mitochondrial DNA (mtDNA) is inherited maternally in most eukaryotes. Linear mitochondrial plasmids in higher plants and fungi are also transmitted from the maternal parent to the progeny. However, mF, which is a mitochondrial linear plasmid of Physarum polycephalum, evades uniparental mitochondrial inheritance. We examined 36 myxamoebal strains of Physarum and isolated three novel mF+ strains (JE8, TU111, NG111) that harbored free mF plasmids. These strains were mated with the mF- strain KM88. Of the three mF- x mF+ crosses, only KM88 x JE8 displayed complete uniparental inheritance. However, in KM88 x TU111 and KM88 x NG111, the mtDNA of KM88 and mF of TU111 and NG111 were inherited by the plasmodia and showed recombination. For example, although the mtDNA of TU111 was eliminated, the mF of TU111 persisted and became inserted into the mtDNA of KM88, such that recombinant mtDNA represented 80% of the total mtDNA. The parental mitochondria fused to yield giant mitochondria with two or more mitochondrial nucleoids. The mF appears to exchange mitochondria from the recipient (paternal) to the donor (maternal) by promoting mitochondrial fusion. PMID:15179521

  5. The mitochondrial plasmid of the true slime mold Physarum polycephalum bypasses uniparental inheritance by promoting mitochondrial fusion.

    PubMed

    Sakurai, Rakusa; Nomura, Hideo; Moriyam, Yohsuke; Kawano, Shigeyuki

    2004-08-01

    Mitochondrial DNA (mtDNA) is inherited maternally in most eukaryotes. Linear mitochondrial plasmids in higher plants and fungi are also transmitted from the maternal parent to the progeny. However, mF, which is a mitochondrial linear plasmid of Physarum polycephalum, evades uniparental mitochondrial inheritance. We examined 36 myxamoebal strains of Physarum and isolated three novel mF+ strains (JE8, TU111, NG111) that harbored free mF plasmids. These strains were mated with the mF- strain KM88. Of the three mF- x mF+ crosses, only KM88 x JE8 displayed complete uniparental inheritance. However, in KM88 x TU111 and KM88 x NG111, the mtDNA of KM88 and mF of TU111 and NG111 were inherited by the plasmodia and showed recombination. For example, although the mtDNA of TU111 was eliminated, the mF of TU111 persisted and became inserted into the mtDNA of KM88, such that recombinant mtDNA represented 80% of the total mtDNA. The parental mitochondria fused to yield giant mitochondria with two or more mitochondrial nucleoids. The mF appears to exchange mitochondria from the recipient (paternal) to the donor (maternal) by promoting mitochondrial fusion.

  6. Comparative biological activities of acellular pertussis vaccines produced by Kitasato.

    PubMed

    Watanabe, M; Izumiya, K; Sato, T; Yoshino, K; Nakagawa, N; Ohoishi, M; Hoshino, M

    1991-04-01

    The quality of 14 lots of acellular pertussis-diphtheria-tetanus (AC-PDT) vaccines manufactured by the Kitasato Institute during the period 1987-1990 were investigated. The geometric means of HSU, LPU, and BWDU were 0.078, 0.257, and 7.33 per ml respectively. The potency was higher than 14 IU per ml. These results indicated the consistency of the Kitasato AC-PDT vaccines. The antibody response to the AC-PDT vaccines was measured in primary and secondary vaccinated mice by ELISA. IgG antibody response to FHA and PT was obtained in all immunized mice (P less than 0.001) after the primary injection. In contrast, IgG antibody response to fimbriae 2 showed a significant titer rise (P less than 0.001) after the booster injection. The results indicated that the Kitasato AC-P vaccines consisted of protein, PT and FHA as the major antigens, and a little agglutinogen as the minor antigen. PMID:1798236

  7. Characterization of co-purified acellular pertussis vaccines.

    PubMed

    Xu, Yinghua; Tan, Yajun; Asokanathan, Catpagavalli; Zhang, Shumin; Xing, Dorothy; Wang, Junzhi

    2015-01-01

    Whole-cell pertussis vaccines (WPVs) have been completely replaced by the co-purified acellular vaccines (APVs) in China. To date few laboratory studies were reported for co-purified APVs in terms of their antigenic composition and protective immune responses. To further understand the antigenic composition in co-purified APVs, in the present study 2-dimensional gel electrophoresis-based proteomic technology was used to analyze the composition of co-purified APVs. The results showed that besides the main antigens pertussis toxin (PT) and filamentous hemagglutinin (FHA), co-purified APVs also contained pertactin (PRN), fimbriae (FIM) 2and3 and other minor protein antigens. Of the 9 proteins identified, 3 were differentially presented in products from manufacturer 1 and manufacturer 2. Compared with WPVs and purified APVs, co-purified APVs induced a mixed Th1/Th2 immune response with more toward to a Th1 response than the purified APVs in this study. These results hint that different immune mechanisms might be involved in protection induced by co-purified and purified APVs.

  8. Characterization of co-purified acellular pertussis vaccines

    PubMed Central

    Xu, Yinghua; Tan, Yajun; Asokanathan, Catpagavalli; Zhang, Shumin; Xing, Dorothy; Wang, Junzhi

    2015-01-01

    Whole-cell pertussis vaccines (WPVs) have been completely replaced by the co-purified acellular vaccines (APVs) in China. To date few laboratory studies were reported for co-purified APVs in terms of their antigenic composition and protective immune responses. To further understand the antigenic composition in co-purified APVs, in the present study 2-dimensional gel electrophoresis-based proteomic technology was used to analyze the composition of co-purified APVs. The results showed that besides the main antigens pertussis toxin (PT) and filamentous hemagglutinin (FHA), co-purified APVs also contained pertactin (PRN), fimbriae (FIM) 2and3 and other minor protein antigens. Of the 9 proteins identified, 3 were differentially presented in products from manufacturer 1 and manufacturer 2. Compared with WPVs and purified APVs, co-purified APVs induced a mixed Th1/Th2 immune response with more toward to a Th1 response than the purified APVs in this study. These results hint that different immune mechanisms might be involved in protection induced by co-purified and purified APVs. PMID:25610957

  9. Angiogenic response induced by acellular brain scaffolds grafted onto the chick embryo chorioallantoic membrane.

    PubMed

    Ribatti, Domenico; Conconi, Maria Teresa; Nico, Beatrice; Baiguera, Silvia; Corsi, Patrizia; Parnigotto, Pier Paolo; Nussdorfer, Gastone G

    2003-10-31

    The repair and regeneration of injured tissues and organs depend on the re-establishment of the blood flow needed for cellular infiltration and metabolic support. Among the various materials used in tissue reconstruction, acellular scaffolds have recently been utilized. In this study, we investigated the angiogenic response induced by acellular brain scaffolds implanted in vivo onto the chick embryo chorioallantoic membrane (CAM), a useful model for such investigations. The results show that acellular brain scaffolds are able to induce a strong angiogenic response, comparable to that of fibroblast growth factor-2 (FGF-2), a well known angiogenic cytokine. The response may be considered dependent on a direct angiogenic effect exerted by the scaffold, because no inflammatory infiltrate was detectable in CAM's mesenchyme beneath the implant. Acellular brain scaffolds might induce the release of endogenous angiogenic factors, such as FGF-2 and vascular endothelial growth factor (VEGF) released from the extracellular matrix of the developing CAM. In addition, the angiogenic response may depend, in part, also on the presence in the acellular matrix of transforming growth factor beta 1 (TGFbeta1).

  10. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.

  11. Rotationally Molded Liquid Crystalline Polymers

    NASA Technical Reports Server (NTRS)

    Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce

    2002-01-01

    Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.

  12. Vacuum Carbothermal Reduction for Treating Tin Anode Slime

    NASA Astrophysics Data System (ADS)

    Li, Wei; Guo, Weizhong; Qiu, Keqiang

    2013-11-01

    In this work, a process of vacuum carbothermal reduction was proposed for treating tin anode slime containing antimony and lead. During vacuum carbothermal reduction, the antimony and lead were selectively removed simultaneously by reducing and decomposing the less volatile mixed oxide of lead and antimony into the more volatile Sb2O3 and PbO. Then the tin was enriched in the distilland and primarily present as SnO2. Crude tin was obtained via vacuum reduction of the residual SnO2. The results showed that 92.85% by weight of antimony and 99.58% by weight of lead could be removed at 850°C for 60 min with 4 wt.% of reductant and air flow rate at 400 mL/min corresponding to the residual gas pressure of 40 Pa-150 Pa. Under these conditions, an evaporation ratio of 52.7% was achieved. Crude tin with a tin content of 94.22 wt.% was obtained at temperature of 900°C, reduction time of 60 min, reductant dosage of 12.5 wt.%, and a residual gas pressure of 40 Pa-400 Pa. Correspondingly, the direct recovery of tin was 94.35%.

  13. When 'slime' becomes 'smile': developmental letter position dyslexia in English.

    PubMed

    Kohnen, Saskia; Nickels, Lyndsey; Castles, Anne; Friedmann, Naama; McArthur, Genevieve

    2012-12-01

    We report the first three cases of selective developmental letter position dyslexia in English. Although the parents and teachers of the children were concerned about these children's reading, standard tests did not reveal their deficit. It was only when the appropriate target words were presented, in this case, migratable words, that their letter position dyslexia was detected. Whereas previous research has described cases with acquired and developmental forms of letter position dyslexia in Hebrew and Arabic readers, this is the first report of this type of reading disorder in English. The cardinal symptom of letter position dyslexia is the migration of letters within the word (reading slime as 'smile'; pirates as 'parties'). These migration errors occur in reading aloud as well as in tasks of silent reading. This study provides further evidence that migration errors emerge at the level of early visual-orthographic analysis, in the letter position encoding function. Alternative explanations for the occurrence of migration errors such as poor phonological processing or a deficit in the orthographic input lexicon are ruled out.

  14. Hagfish slime threads as a biomimetic model for high performance protein fibres.

    PubMed

    Fudge, Douglas S; Hillis, Sonja; Levy, Nimrod; Gosline, John M

    2010-09-01

    Textile manufacturing is one of the largest industries in the world, and synthetic fibres represent two-thirds of the global textile market. Synthetic fibres are manufactured from petroleum-based feedstocks, which are becoming increasingly expensive as demand for finite petroleum reserves continues to rise. For the last three decades, spider silks have been held up as a model that could inspire the production of protein fibres exhibiting high performance and ecological sustainability, but unfortunately, artificial spider silks have yet to fulfil this promise. Previous work on the biomechanics of protein fibres from the slime of hagfishes suggests that these fibres might be a superior biomimetic model to spider silks. Based on the fact that the proteins within these 'slime threads' adopt conformations that are similar to those in spider silks when they are stretched, we hypothesized that draw processing of slime threads should yield fibres that are comparable to spider dragline silk in their mechanical performance. Here we show that draw-processed slime threads are indeed exceptionally strong and tough. We also show that post-drawing steps such as annealing, dehydration and covalent cross-linking can dramatically improve the long-term dimensional stability of the threads. The data presented here suggest that hagfish slime threads are a model that should be pursued in the quest to produce fibres that are ecologically sustainable and economically viable. PMID:20729569

  15. Hagfish slime threads as a biomimetic model for high performance protein fibres.

    PubMed

    Fudge, Douglas S; Hillis, Sonja; Levy, Nimrod; Gosline, John M

    2010-09-01

    Textile manufacturing is one of the largest industries in the world, and synthetic fibres represent two-thirds of the global textile market. Synthetic fibres are manufactured from petroleum-based feedstocks, which are becoming increasingly expensive as demand for finite petroleum reserves continues to rise. For the last three decades, spider silks have been held up as a model that could inspire the production of protein fibres exhibiting high performance and ecological sustainability, but unfortunately, artificial spider silks have yet to fulfil this promise. Previous work on the biomechanics of protein fibres from the slime of hagfishes suggests that these fibres might be a superior biomimetic model to spider silks. Based on the fact that the proteins within these 'slime threads' adopt conformations that are similar to those in spider silks when they are stretched, we hypothesized that draw processing of slime threads should yield fibres that are comparable to spider dragline silk in their mechanical performance. Here we show that draw-processed slime threads are indeed exceptionally strong and tough. We also show that post-drawing steps such as annealing, dehydration and covalent cross-linking can dramatically improve the long-term dimensional stability of the threads. The data presented here suggest that hagfish slime threads are a model that should be pursued in the quest to produce fibres that are ecologically sustainable and economically viable.

  16. Characterization of Raw and Decopperized Anode Slimes from a Chilean Refinery

    NASA Astrophysics Data System (ADS)

    Melo Aguilera, Evelyn; Hernández Vera, María Cecilia; Viñals, Joan; Graber Seguel, Teófilo

    2016-04-01

    This work characterizes raw and decopperized slimes, with the objective of identifying the phases in these two sub-products. The main phases in copper anodes are metallic copper, including CuO, which are present in free form or associated with the presence of copper selenide or tellurides (Cu2(Se,Te)) and several Cu-Pb-Sb-As-Bi oxides. During electrorefining, the impurities in the anode release and are not deposited in the cathode, part of them dissolving and concentrated in the electrolyte, and others form a raw anode slime that contains Au, Ag, Cu, As, Se, Te and PGM, depending on the composition of the anode. There are several recovery processes, most of which involve acid leaching in the first step to dissolve copper, whose product is decopperized anode slime. SEM analysis revealed that the mineralogical species present in the raw anode slime under study were mainly eucarite (CuAgSe), naumannite (Ag2Se), antimony arsenate (SbAsO4), and lead sulfate (PbSO4). In the case of decopperized slime, the particles were mainly composed of SbAsO4 (crystalline appearance), non-stoichiometric silver selenide (Ag(2- x)Se), and chlorargyrite (AgCl).

  17. Experimental study of glass molding process and transcription characteristics of mold surface in molding of aspheric glass lenses

    NASA Astrophysics Data System (ADS)

    Cha, Du Hwan; Park, Heung Su; Hwang, Yeon; Kim, Jeong-Ho; Kim, Hye-Jeong

    2011-03-01

    The effects of the process parameters in the molding of aspheric glass lenses for camera phone modules have been investigated experimentally and the surface topographies of the mold and the molded lens were compared to ascertain the transcription characteristics. The molding conditions were optimized with respect to the form error (PV) (the response variable) of the molded lens. The experimental conditions were obtained by employing a factorial design method. From the analysis of variance (ANOVA) and P-value (significance level), the slow cooling rate was found to affect the response variable most significantly. For the form topography, the lens molded under the optimum molding condition showed a transcription ratio of 93.4% against the mold.

  18. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1988-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  19. Staged mold for encapsulating hazardous wastes

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1990-01-01

    A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  20. Flow behavior in liquid molding

    NASA Technical Reports Server (NTRS)

    Hunston, D.; Phelan, F.; Parnas, R.

    1992-01-01

    The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.

  1. Tissue engineering of the small intestine by acellular collagen sponge scaffold grafting.

    PubMed

    Hori, Y; Nakamura, T; Matsumoto, K; Kurokawa, Y; Satomi, S; Shimizu, Y

    2001-01-01

    Tissue engineering of the small intestine will prove a great benefit to patients suffering from short bowel disease. However cell seeding in tissue engineering, such as fetal cell use, is accompanied by problems of ethical issues, rejection, and short supply. To overcome these problems, we carried out an experimental study on tissue engineering of the small intestine by acellular collagen sponge scaffold grafting. We resected the 5 cm long jejunum from beagle dogs and reconstructed it by acellular collagen sponge grafting with a silicon tube stent. The graft was covered with the omentum. At 1 month after operation, the silicon stent was removed endoscopically. Animals were sacrificed 1 and 4 months after operation, and were examined microscopically. Neo-intestinal regeneration was observed and the intestinal mucosa covered the luminal side of the regenerated intestine across the anastomosis. Thus, the small intestine was regenerated by tissue engineering technology using an acellular collagen sponge scaffold.

  2. Pertactin deficient Bordetella pertussis present a better fitness in mice immunized with an acellular pertussis vaccine.

    PubMed

    Hegerle, N; Dore, G; Guiso, N

    2014-11-20

    Bordetella pertussis is the etiologic agent of whooping cough and has been the target of vaccination for over fifty years. The latest strategies include the use of acellular pertussis vaccines that induce specific immunity against few virulence factors amongst which pertactin is included in three and five component acellular pertussis vaccines. Recently, it has been reported that B. pertussis clinical isolates loose the production of this adhesin in regions reaching high vaccine coverage with vaccines targeting this virulence factor. We here demonstrate that isolates not producing pertactin are capable of sustaining longer infection as compared to pertactin producing isolates in an in vivo model of acellular pertussis immunization. Loosing pertactin production might thus provide a selective advantage to these isolates in this background, which could account for the upraise in prevalence of these pertactin deficient isolates in the population.

  3. Acellular comet assay: a tool for assessing variables influencing the alkaline comet assay.

    PubMed

    Kennedy, Erin K; McNamee, James P; Prud'homme Lalonde, Louise; Jones, Trevor; Wilkinson, Diana

    2012-01-01

    In this study, an acellular modification to the alkaline comet assay to further evaluate key variables within the assay that may influence the outcome of genotoxicity studies is described. This acellular comet assay can detect differences of 0.2 Gy of (60)Co gamma-ray radiation between 0 and 1 Gy and differences of 1 Gy between 0 and 8 Gy; thus, this assay is applicable for a wide range of DNA damage levels. It is also shown that DNA damage from different radiation energies was not significantly different from (60)Co gamma-ray. This assay displayed a statistical increase in DNA damage due to uncontrolled exposure to natural light; however, the slope of the dose-response curve for light-exposed samples was similar to that for samples protected from light. A comparison of the alkaline comet assay with the acellular comet assay allowed for the intrinsic repair capacity of the alkaline comet assay to be quantified.

  4. Facts about Stachybotrys chartarum and Other Molds

    MedlinePlus

    ... Program in Brief Related Issues Resources Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ... be removed. Â Top of Page Quick Links Air Pollution & Respiratory Health Air Quality Asthma Mold What's New ...

  5. Evaluation of Slime-Producing Bacteria in Oil Field Core Flood Experiments

    PubMed Central

    Geesey, G. G.; Mittelman, M. W.; Lieu, V. T.

    1987-01-01

    Epifluorescence microscopy and carbohydrate determinations indicated that the decrease in permeability of oil reservoir sand to reclaimed sewage water was partially the result of biological plugging. Filtration and biocide addition studies demonstrated that the increase in bacterial densities and slime concentrations in flooded oil field cores appeared to be due to both deposition from the reclaimed water and in situ microbial growth and slime production. Although these biological components increased throughout the cores during flooding, the region where the water entered the core exhibited the highest cell densities and slime concentrations. The approach described in this report should be useful in predicting the potential of a water source to induce biological plugging of oil reservoir sand. PMID:16347276

  6. The production of fibers and films from solubilized hagfish slime thread proteins.

    PubMed

    Negishi, Atsuko; Armstrong, Clare L; Kreplak, Laurent; Rheinstadter, Maikel C; Lim, Loong-Tak; Gillis, Todd E; Fudge, Douglas S

    2012-11-12

    Hagfish slime threads, which make up the fibrous component of the defensive slime of hagfishes, consist primarily of proteins from the intermediate filament family of proteins and possess impressive mechanical properties that make them attractive biomimetic models. To investigate whether solubilized intermediate filament proteins can be used to make high-performance, environmentally sustainable materials, we cast thin films on the surface of electrolyte buffers using solubilized hagfish slime thread proteins. The films were drawn into fibers, and the tensile properties were measured. Fiber mechanics depended on casting conditions and postspinning processing. Postsecondary drawing resulted in fibers with improved material properties similar to those of regenerated silk fibers. Structural analyses of the fibers revealed increased molecular alignment resulting from the second draw, but no increase in crystallinity. Our findings show promise for intermediate filament proteins as an alternative source for the design and production of high performance protein-based fibers. PMID:23016557

  7. The production of fibers and films from solubilized hagfish slime thread proteins.

    PubMed

    Negishi, Atsuko; Armstrong, Clare L; Kreplak, Laurent; Rheinstadter, Maikel C; Lim, Loong-Tak; Gillis, Todd E; Fudge, Douglas S

    2012-11-12

    Hagfish slime threads, which make up the fibrous component of the defensive slime of hagfishes, consist primarily of proteins from the intermediate filament family of proteins and possess impressive mechanical properties that make them attractive biomimetic models. To investigate whether solubilized intermediate filament proteins can be used to make high-performance, environmentally sustainable materials, we cast thin films on the surface of electrolyte buffers using solubilized hagfish slime thread proteins. The films were drawn into fibers, and the tensile properties were measured. Fiber mechanics depended on casting conditions and postspinning processing. Postsecondary drawing resulted in fibers with improved material properties similar to those of regenerated silk fibers. Structural analyses of the fibers revealed increased molecular alignment resulting from the second draw, but no increase in crystallinity. Our findings show promise for intermediate filament proteins as an alternative source for the design and production of high performance protein-based fibers.

  8. Determination of elemental composition of river water and slime by PIXE method

    SciTech Connect

    Augustyniak, S.; Jarczyk, L.; Lenczowska, J.B.; Rokita, E.; Slominska, D.

    1981-04-01

    The application of PIXE method was developed for determination of concentration of different elements in river water and bottom slime. The internal standard technique was applied for quantitative evaluation of contents of different elements. In case of river water yttrium standard was used in form of yttrium nitrate solution. The measurements for bottom slime was performed with external beam using standards with predetermined concentration of different elements. The concentration of following elements: S, Cl, K, Ca, Ti, V, Cr, Mn, Fe, Ni, Cu, Zn, Se, Br, Rb, Sr, Zr, Hg, Pb was determined with the described procedure. The estimated concentration of elements ranged from about 0.05 to about 200 ppm for water samples and from about 1.5 to about 30000 ppm in bottom slime samples.

  9. MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS

    EPA Science Inventory

    Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...

  10. [Pertussis vaccines: acellular versus whole cell. Perhaps a return to the past?].

    PubMed

    Cofré, José

    2015-10-01

    The resurgence of pertussis in the world and in our country has questioned the effectiveness of cellular and acellular vaccines. The reason why pertussis has not been controlled or eliminated after 70 years of implementation of the vaccination is probably multifactorial. This article, on the basis of questions and answers, describes the benefits and limitations of both cellular and acellular vaccines and suggests new strategies of vaccination in childhood. It is a fact that the currently applied vaccination does not eliminate the circulation of Bordetella pertussis in the community. Perhaps the introduction of vaccines with live B. pertussis, inhalation, will be able to eliminate the disease around the world. PMID:26633113

  11. Histochemical and morphological studies on a new type of acellular cartilage.

    PubMed

    Junqueira, L C; Toledo, O M; Montes, G S

    1983-01-01

    A new type of cartilage was found participating in a valve-like system inside the conus arteriosus of the fresh water sting ray, Potamotrygon sp.. This cartilage possesses no chondrocytes and its matrix is perforated by vascular channels that ramify dendritically forming canaliculi. The acellular cartilage does not possess perichondrium but, rather, it is attached to a basement membrane-like structure. The cartilaginous matrix contains collagen fibrils that strongly interact with the chondroitin sulfate of the ground substance. The histochemical and biochemical findings suggest that not all of the glycosaminoglycans present in the acellular cartilage are bound to protein cores to form proteoglycans. PMID:6407464

  12. Making Internal Molds Of Long, Curved Tubes

    NASA Technical Reports Server (NTRS)

    Burley, Richard K.

    1989-01-01

    Mold material carried to internal weld joint and removed after impression taken. Remotely operated device makes impression mold of interior surface of tube at weld joint. Mold provides indication of extent of mismatch between members at joint. Maneuvered to weld inspected through curved tube 3 in. in diameter by 50 in. long. Readily adapted to making molds to measure depth of corrosion in boiler tubes or other pipes.

  13. Blow molding of melt processible rubber

    SciTech Connect

    Abell, W.R.; Stuart, R.E.; Myrick, R.E.

    1991-07-01

    This article discusses the advantages of making hollow rubber parts by blow molding thermoplastic elastomers (TPEs) versus conventional rubber processing. It describes the various types of blow molding processes and it provides some insight into the rheological properties of melt processible rubber (MPR) and how MPR should be molded by each of these processes. A number of blow molded applications for MPR are also discussed.

  14. Bacterial gliding fluid dynamics on a layer of non-Newtonian slime: Perturbation and numerical study.

    PubMed

    Ali, N; Asghar, Z; Anwar Bég, O; Sajid, M

    2016-05-21

    Gliding bacteria are an assorted group of rod-shaped prokaryotes that adhere to and glide on certain layers of ooze slime attached to a substratum. Due to the absence of organelles of motility, such as flagella, the gliding motion is caused by the waves moving down the outer surface of these rod-shaped cells. In the present study we employ an undulating surface model to investigate the motility of bacteria on a layer of non-Newtonian slime. The rheological behavior of the slime is characterized by an appropriate constitutive equation, namely the Carreau model. Employing the balances of mass and momentum conservation, the hydrodynamic undulating surface model is transformed into a fourth-order nonlinear differential equation in terms of a stream function under the long wavelength assumption. A perturbation approach is adopted to obtain closed form expressions for stream function, pressure rise per wavelength, forces generated by the organism and power required for propulsion. A numerical technique based on an implicit finite difference scheme is also employed to investigate various features of the model for large values of the rheological parameters of the slime. Verification of the numerical solutions is achieved with a variational finite element method (FEM). The computations demonstrate that the speed of the glider decreases as the rheology of the slime changes from shear-thinning (pseudo-plastic) to shear-thickening (dilatant). Moreover, the viscoelastic nature of the slime tends to increase the swimming speed for the shear-thinning case. The fluid flow in the pumping (generated where the organism is not free to move but instead generates a net fluid flow beneath it) is also investigated in detail. The study is relevant to marine anti-bacterial fouling and medical hygiene biophysics. PMID:26903204

  15. Identification of an antigenic marker of slime production for Staphylococcus epidermidis.

    PubMed Central

    Christensen, G D; Barker, L P; Mawhinney, T P; Baddour, L M; Simpson, W A

    1990-01-01

    The pathogenic Staphylococcus epidermidis strain RP62A (ATCC 35984) adheres to smooth surfaces by forming a tenacious bacterial film known as slime. The mechanism of slime production is not known; however, workers in the laboratory of G. Pier (Harvard Medical School, Boston, Mass.) have isolated from RP62A a galactose-rich capsular polysaccharide adhesin (CPA) which mediates the attachment of the organism to smooth surfaces. We have obtained two daughter strains from RP62A that no longer produce slime. One daughter strain, H4A, was obtained by selection for a spontaneous variant; the other strain, HAM892, was obtained by treating growing cultures of RP62A with acriflavin. Using an antiserum generated against whole cells of RP62A, we have examined lysozyme-lysostaphin digests of RP62A, H4A, and HAM892 by double immunodiffusion. The two strains that no longer produced slime no longer produced a particular antigen, which we refer to as the slime-associated antigen (SAA). SAA was also produced by unrelated strains of slime-producing S. epidermidis. SAA was heat and protease stable, had a molecular weight of greater than 50,000, and could be partially purified by chromatographing trypsin-digested material over a Sephadex G-200 column. Chemical analysis of partially purified SAA by gas-liquid chromatography found SAA to be glucose rich (59%) and galactose poor (1.4%). This analysis chemically distinguished SAA from CPA. When tested together by double immunodiffusion with anti-RP62A and anti-CPA antisera, partially purified SAA did not cross-react with CPA. Kinetic studies suggested that SAA is a marker for surface accumulation whereas CPA mediates initial adherence. Images PMID:2387626

  16. Bacterial gliding fluid dynamics on a layer of non-Newtonian slime: Perturbation and numerical study.

    PubMed

    Ali, N; Asghar, Z; Anwar Bég, O; Sajid, M

    2016-05-21

    Gliding bacteria are an assorted group of rod-shaped prokaryotes that adhere to and glide on certain layers of ooze slime attached to a substratum. Due to the absence of organelles of motility, such as flagella, the gliding motion is caused by the waves moving down the outer surface of these rod-shaped cells. In the present study we employ an undulating surface model to investigate the motility of bacteria on a layer of non-Newtonian slime. The rheological behavior of the slime is characterized by an appropriate constitutive equation, namely the Carreau model. Employing the balances of mass and momentum conservation, the hydrodynamic undulating surface model is transformed into a fourth-order nonlinear differential equation in terms of a stream function under the long wavelength assumption. A perturbation approach is adopted to obtain closed form expressions for stream function, pressure rise per wavelength, forces generated by the organism and power required for propulsion. A numerical technique based on an implicit finite difference scheme is also employed to investigate various features of the model for large values of the rheological parameters of the slime. Verification of the numerical solutions is achieved with a variational finite element method (FEM). The computations demonstrate that the speed of the glider decreases as the rheology of the slime changes from shear-thinning (pseudo-plastic) to shear-thickening (dilatant). Moreover, the viscoelastic nature of the slime tends to increase the swimming speed for the shear-thinning case. The fluid flow in the pumping (generated where the organism is not free to move but instead generates a net fluid flow beneath it) is also investigated in detail. The study is relevant to marine anti-bacterial fouling and medical hygiene biophysics.

  17. The Mold that Almost Ate the Principal

    ERIC Educational Resources Information Center

    Barry, Wayne; Bishop, Chuck; Byars, Jennifer

    2006-01-01

    New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…

  18. Attack of the Killer Mold Spores.

    ERIC Educational Resources Information Center

    Moore, Mary

    1999-01-01

    Describes experiences at the Arkansas State University at Jonesboro library when mold was discovered in a large portion of the monograph collection. Discusses causes of mold formation, equipment needed, news media coverage, staff involvement in the cleanup, and possible health hazards from mold. (LRW)

  19. Injection Molding of Plastics from Agricultural Materials

    SciTech Connect

    Bhattacharya, M.; Ruan, R.

    2001-02-22

    The objective of this research was to conduct a systematic study to relate injection molding parameters to properties of blends of starch and synthetic polymer. From this study, we wished to develop a thorough understanding of the injection molding process and gain significant insight into designing molds and aiding in developing products cheaply and efficiently.

  20. [Extracellular slime production and adhesion of Morganella morganii strains to polystyrene].

    PubMed

    Michalska, Anna; Zalas-Wiecek, Patrycja; Sielska, Barbara; Gospodarek, Eugenia

    2011-01-01

    The aim of this study was the evaluation of the ability of extracellular slime production and adhesive properties of M. morganii strains. This study included 50 of M. morganii strains isolated from clinical samples. All of these strains were isolated in the Clinical Microbiology Department of dr. A. Jurasz University Hospital in 2008-2009. Five (10.0%) out of 50. M. morganii strains demonstrated extracellular slime production. Adherence to polystyrene revealed 36 (72.0%) of M. morganii strains in it 6 strains (12.0%) adhered strongly, medium - 12 (24.0%) and weakly - 18 (36.0%).

  1. ALLERGIC POTENTIAL OF INDOOR MOLDS

    EPA Science Inventory

    Many fungi have been associated with allergic lung disease, but few are well studied and even fewer allergens of fungal origin are well characterized. Exposure to damp moldy environments has been associated with the exacerbation of asthma, but the role of molds in the induction o...

  2. Emittance of investment casting molds

    SciTech Connect

    Havstad, M.A.

    1994-07-15

    This document describes measurements of the directional spectral emittance of four ceramic mold materials. The work was performed with the samples at {approximately} 900{degree}C in a vacuum vessel pumped to {approximately}3 {times} 10{sup {minus}6}Torr. Results conform to expectations derived from prior work done with similar samples.

  3. Is Mold the New Asbestos?

    ERIC Educational Resources Information Center

    Colgan, Craig

    2003-01-01

    Mold and indoor air quality (IAQ) are matters of major concern to architects and their educational clients. The Environmental Protection Agency's Indoor Air Quality Tools for Schools program offers help to districts seeking to tackle IAQ issues. Strengthening community relations is one way to be ready in case of a bad environmental or IAQ report.…

  4. ANIMAL MODELS OF MOLD ALLERGY

    EPA Science Inventory

    The concept of molds as causative agents for allergy/asthma is not new. In fact many fungal genera have been associated with allergic lung disease, but only a few fungi are well studied and even fewer fungal allergens well characterized. The complexity and variety of fungal pro...

  5. Molded Concrete Center Mine Wall

    NASA Technical Reports Server (NTRS)

    Lewis, E. V.

    1987-01-01

    Proposed semiautomatic system forms concrete-foam wall along middle of coal-mine passage. Wall helps support roof and divides passage into two conduits needed for ventilation of coal face. Mobile mold and concrete-foam generator form sections of wall in place.

  6. Mold production for polymer optics

    NASA Astrophysics Data System (ADS)

    Boerret, Rainer; Raab, Jonas; Speich, Marco

    2014-09-01

    The fields of application for polymer optics are huge and thus the need for polymer optics is steadily growing. Most polymer optics are produced in high numbers by injection molding. Therefore molds and dies that fulfill special requirements are needed. Polishing is usually the last process in the common process chain for production of molds for polymer optics. Usually this process step is done manually by experienced polishers. Due to the small number of skilled professionals and health problems because of the monotonous work the idea was to support or probably supersede manual polishing. Polishing using an industrial robot as movement system enables totally new possibilities in automated polishing. This work focuses on the surface generation with a newly designed polishing setup and on the code generation for the robot movement. The process starts on ground surfaces and with different tools and polishing agents surfaces that fulfill the requirements for injection molding of optics can be achieved. To achieve this the attention has to be focused not only on the process itself but also on tool path generation. A proprietary software developed in the Centre for Optical Technologies in Aalen University allows the tool path generation on almost any surface. This allows the usage of the newly developed polishing processes on different surfaces and enables an easy adaption. Details of process and software development will be presented as well as results from different polishing tests on different surfaces.

  7. Immunogenicity and safety of a monovalent, multicomponent acellular pertussis vaccine in 15 month-6-year-old German children. Monovalent Acellular Pertussis Vaccine Study Group.

    PubMed

    Stehr, K; Heininger, U; Uhlenbusch, R; Angersbach, P; Hackell, J; Eckhardt, T

    1995-03-01

    Immunization against pertussis has been re-recommended for healthy children in Germany in 1991. In addition the former restriction of immunizing only in the first 2 years of life was abolished. In children born before 1991 immunization rates against pertussis were 15% or less. With the new recommendations physicians are now faced with an increasing demand of parents for catch-up vaccinations in these children. Since they were immunized against diphtheria and tetanus previously monovalent pertussis vaccines are needed for this indication. Therefore a monovalent, multicomponent acellular pertussis vaccine was studied in 249 German children 15 months to 6 years of age. Three doses were administered at 6-10 week intervals. Reactogenicity and antibody responses against the vaccine antigens pertussis toxin (PT), filamentous haemagglutinin (FHA), 69-kd antigen (pertactin) and fimbriae-2 (agglutinogen) were investigated. Local and systemic reactions were minimal in frequency and severity. Antibody responses against all vaccine antigens were pronounced with 93%-100% of vaccinees demonstrating at least four fold titre rises above pre-immunization after the third dose. These findings indicate that this monovalent, multicomponent acellular pertussis vaccine with excellent immunogenicity and low reactogenicity is an appropriate candidate for closing immunization gaps in older children in countries with previously low vaccination rates against pertussis. Based on the results of this study the monovalent acellular pertussis vaccine was licensed in Germany in January 1994. PMID:7758519

  8. Precision injection molding of freeform optics

    NASA Astrophysics Data System (ADS)

    Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong

    2016-08-01

    Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.

  9. HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS

    DOEpatents

    Stoddard, S.D.

    1958-10-21

    An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.

  10. Injection molding ceramics to high green densities

    NASA Technical Reports Server (NTRS)

    Mangels, J. A.; Williams, R. M.

    1983-01-01

    The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.

  11. Repair of a Gingival Fenestration Using an Acellular Dermal Matrix Allograft.

    PubMed

    Breault, Lawrence G; Brentson, Raquel C; Fowler, Edward B; Bisch, Frederick C

    2016-01-01

    A case report illustrating the successful treatment of a gingival fenestration with an acellular dermal matrix (ADM) allograft. After 2½ months of healing, the ADM was completely integrated into the soft tissues of the mandibular anterior gingiva with complete resolution of the gingival fenestration, resulting in excellent gingival esthetics. PMID:26874103

  12. One-stage human acellular nerve allograft reconstruction for digital nerve defects

    PubMed Central

    Li, Xue-yuan; Hu, Hao-liang; Fei, Jian-rong; Wang, Xin; Wang, Tian-bing; Zhang, Pei-xun; Chen, Hong

    2015-01-01

    Human acellular nerve allografts have a wide range of donor origin and can effectively avoid nerve injury in the donor area. Very little is known about one-stage reconstruction of digital nerve defects. The present study observed the feasibility and effectiveness of human acellular nerve allograft in the reconstruction of < 5-cm digital nerve defects within 6 hours after injury. A total of 15 cases of nerve injury, combined with nerve defects in 18 digits from the Department of Emergency were enrolled in this study. After debridement, digital nerves were reconstructed using human acellular nerve allografts. The patients were followed up for 6–24 months after reconstruction. Mackinnon-Dellon static two-point discrimination results showed excellent and good rates of 89%. Semmes-Weinstein monofilament test demonstrated that light touch was normal, with an obvious improvement rate of 78%. These findings confirmed that human acellular nerve allograft for one-stage reconstruction of digital nerve defect after hand injury is feasible, which provides a novel trend for peripheral nerve reconstruction. PMID:25788927

  13. Influence of mold length and mold heat transfer on horizontal continuous casting of nonferrous alloy rods

    NASA Astrophysics Data System (ADS)

    Verwijs, J. P.; Weckman, D. C.

    1988-04-01

    The influence of mold length and mold heat transfer on the conventional hot-top D.C. continuous casting process was studied through numerical simulations and experiments with horizontally cast 20 mm diameter lead and zinc rods. The minimum casting speed was found to be a nonlinear function of the mold length. For short molds, an inverse relationship between mold length and minimum casting speed was observed. However, the minimum casting speed for zinc cast from molds longer than 12 mm was constant at 2.5 mm/s. For lead cast in molds longer than 12 mm, the minimum observed casting speed was constant at 4.0 mm/s. The observed nonlinear relationship between minimum casting speed and mold length was predicted using a numerical model of the process. For this, an analytical expression for the mold boundary conditions was derived which included the influence of gas gap formation between the rod and the mold due to thermoelastic deformations of both the rod and the mold. Correlation between observed and predicted behavior was demonstrated for both the lead and zinc rods. Maximum casting speed was observed to increase with increased mold length; however, this speed was found to be critically dependent on process attributes such as mold and pinch wheel alignment and mold lubrication.

  14. Precision compression molding of chalcogenide glass optical elements

    NASA Astrophysics Data System (ADS)

    Qi, Chaowei; Ma, Tao; Chen, Fan

    2013-12-01

    Precision glass molding process (GMP) is a promising process to manufacture small precision optical elements in large volume. In this paper, we report on the fabrication of a molded chalcogenide glass lens as an optical element. A set of mold was designed and manufactured with silicon carbide material for the molding test. The structure of the mold set was semi-closed and detachable which can make the molded lens easy releasing with non-invasion. The surfaces of the mold cores are coated with thin protecting DLC film to relieve adhesion problem and increase the working life. Experiments were also performed using a precision glass molding machine Toshiba GMP-311V to determine the molding parameters i.e. molding temperature, pressure and cooling rate. The glass lens breakage during precision molding process was analyzed according to the glass property and the molding parameters. By modifying the mold design and optimization the processing parameters, ultimately achieve the desired molded lens.

  15. 40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater...

  16. 40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater...

  17. [Influence of slime production and adhesion of Candida sp. on biofilm formation].

    PubMed

    Ciok-Pater, Emilia; Smolak, Przemysław; Wróblewska, Joanna; Gospodarek, Eugenia

    2011-01-01

    The increase of fungal infections in recent years is connected with the progress in medicine. The vast usage of biomaterials is an inseparable element of contemporary medicine but it also leads to development of infections. Yeast-like fungi Candida albicans are still the main pathogen of candidiasis. The ability to slime production and adhesion to polystyrene of Candida sp. on different surfaces can cause to form biofilm on surfaces of biomaterials used in production of catheters, drains and prosthesis. The aim of the study was to evaluate the influence of slime production and adhesion to polystyrene, of Candida sp. on biofilm formation on different biomaterials. 50 strains of Candida sp. were examined. They isolated from ill to Clinics of Anesthesiology and Intensive Therapy University Hospital No 1 of dr. A. Jurasza in Bydgoszcz. The ability to slime production was evaluated by Christensen method in modification Davenport and Branchini methods. The adhesion to polystyrene was evaluated by Richards et el method. The ability to produce biofilm biomaterials by the studied fungi was measured after 72 hours of incubation at 37 degrees C on different biomaterials. Yeast-like fungi Candida sp. fabricating slime and adhesion forming frequently biofilm on surface researched of biomaterials. Influence of chosen biological specificity ascertain on the ability to produce biofilm on surfaces of siliconized latex and polyvinylchloride.

  18. Spontaneous unraveling of hagfish slime thread skeins is mediated by a seawater-soluble protein adhesive.

    PubMed

    Bernards, Mark A; Oke, Isdin; Heyland, Andreas; Fudge, Douglas S

    2014-04-15

    Hagfishes are known for their ability to rapidly produce vast quantities of slime when provoked. The slime is formed via the interaction between seawater and two components released by the slime glands: mucin vesicles from gland mucous cells, which swell and rupture in seawater to form a network of mucus strands, and intermediate filament-rich threads, which are produced within gland thread cells as tightly coiled bundles called skeins. A previous study showed that the unraveling of skeins from Atlantic hagfish (Myxine glutinosa) requires both the presence of mucins and hydrodynamic mixing. In contrast, skeins from Pacific hagfish (Eptatretus stoutii) unravel in the absence of both mucins and mixing. We tested the hypothesis that spontaneous unraveling of E. stoutii skeins is triggered by the dissolution of a seawater-soluble protein adhesive and the release of stored strain energy within the coiled thread. Here we show that, as predicted by this hypothesis, unraveling can be initiated by a protease under conditions in which unraveling does not normally occur. We also demonstrate, using high resolution scanning electron microscopy, that the treatment of skeins with solutions that cause unraveling also leads to the disappearance of surface and inter-thread features that remain when skeins are washed with stabilizing solutions. Our study provides a mechanism for the deployment of thread skeins in Pacific hagfish slime, and raises the possibility of producing novel biomimetic protein adhesives that are salt, temperature and kosmotrope sensitive.

  19. Recrystallization of white slime (raw material for obtained Na-A zeolite)

    SciTech Connect

    Ganbarov, D.M.

    1986-03-01

    The authors show the possibility of using white slime (hydroxide cancrinite) as the starting material for obtaining Na-A zeolite. The effect of temperature, aging process, and structure of the starting material on the kinetics of Na-A zeolite crystallization is studied.

  20. Acellular ostrich corneal stroma used as scaffold for construction of tissue-engineered cornea

    PubMed Central

    Liu, Xian-Ning; Zhu, Xiu-Ping; Wu, Jie; Wu, Zheng-Jie; Yin, Yong; Xiao, Xiang-Hua; Su, Xin; Kong, Bin; Pan, Shi-Yin; Yang, Hua; Cheng, Yan; An, Na; Mi, Sheng-Li

    2016-01-01

    AIM To assess acellular ostrich corneal matrix used as a scaffold to reconstruct a damaged cornea. METHODS A hypertonic saline solution combined with a digestion method was used to decellularize the ostrich cornea. The microstructure of the acellular corneal matrix was observed by transmission electron microscopy (TEM) and hematoxylin and eosin (H&E) staining. The mechanical properties were detected by a rheometer and a tension machine. The acellular corneal matrix was also transplanted into a rabbit cornea and cytokeratin 3 was used to check the immune phenotype. RESULTS The microstructure and mechanical properties of the ostrich cornea were well preserved after the decellularization process. In vitro, the methyl thiazolyl tetrazolium results revealed that extracts of the acellular ostrich corneas (AOCs) had no inhibitory effects on the proliferation of the corneal epithelial or endothelial cells or on the keratocytes. The rabbit lamellar keratoplasty showed that the transplanted AOCs were transparent and completely incorporated into the host cornea while corneal turbidity and graft dissolution occurred in the acellular porcine cornea (APC) transplantation. The phenotype of the reconstructed cornea was similar to a normal rabbit cornea with a high expression of cytokeratin 3 in the superficial epithelial cell layer. CONCLUSION We first used AOCs as scaffolds to reconstruct damaged corneas. Compared with porcine corneas, the anatomical structures of ostrich corneas are closer to those of human corneas. In accordance with the principle that structure determines function, a xenograft lamellar keratoplasty also confirmed that the AOC transplantation generated a superior outcome compared to that of the APC graft. PMID:27158598

  1. Development and characterization of acellular porcine pulmonary valve scaffolds for tissue engineering.

    PubMed

    Luo, Ji; Korossis, Sotirios A; Wilshaw, Stacy-Paul; Jennings, Louise M; Fisher, John; Ingham, Eileen

    2014-11-01

    Currently available replacement heart valves all have limitations. This study aimed to produce and characterize an acellular, biocompatible porcine pulmonary root conduit for reconstruction of the right ventricular outflow tract e.g., during Ross procedure. A process for the decellularization of porcine pulmonary roots was developed incorporating trypsin treatment of the adventitial surface of the scraped pulmonary artery and sequential treatment with hypotonic Tris buffer (HTB; 10 mM Tris pH 8.0, 0.1% (w/v) EDTA, and 10 KIU aprotinin), 0.1% (w/v) sodium dodecyl sulfate in HTB, two cycles of DNase and RNase, and sterilization with 0.1% (v/v) peracetic acid. Histology confirmed an absence of cells and retention of the gross histoarchitecture. Immunohistochemistry further confirmed cell removal and partial retention of the extracellular matrix, but a loss of collagen type IV. DNA levels were reduced by more than 96% throughout all regions of the acellular tissue and no functional genes were detected using polymerase chain reaction. Total collagen levels were retained but there was a significant loss of glycosaminoglycans following decellularization. The biomechanical, hydrodynamic, and leaflet kinematics properties were minimally affected by the process. Both immunohistochemical labeling and antibody absorption assay confirmed a lack of α-gal epitopes in the acellular porcine pulmonary roots and in vitro biocompatibility studies indicated that acellular leaflets and pulmonary arteries were not cytotoxic. Overall the acellular porcine pulmonary roots have excellent potential for development of a tissue substitute for right ventricular outflow tract reconstruction e.g., during the Ross procedure. PMID:24786313

  2. High Temperature Transfer Molding Resins

    NASA Technical Reports Server (NTRS)

    Connell, John W. (Inventor); Smith, Joseph G., Jr. (Inventor); Hergenrother, Paul M. (Inventor)

    2000-01-01

    High temperature resins containing phenylethynyl groups that are processable by transfer molding have been prepared. These phenylethynyl containing oligomers were prepared from aromatic diamines containing phenylethynyl groups and various ratios of phthalic anhydride and 4-phenylethynlphthalic anhydride in glacial acetic acid to form a mixture of imide compounds in one step. This synthetic approach is advantageous since the products are a mixture of compounds and consequently exhibit a relatively low melting temperature. In addition, these materials exhibit low melt viscosities which are stable for several hours at 210-275 C, and since the thermal reaction of the phenylethynyl group does not occur to any appreciable extent at temperatures below 300 C, these materials have a broad processing window. Upon thermal cure at approximately 300-350 C, the phenylethynyl groups react to provide a crosslinked resin system. These new materials exhibit excellent properties and are potentially useful as adhesives, coatings, films, moldings and composite matrices.

  3. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, Richard W.; Hrubesh, Lawrence W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50-800 kg/m.sup.3 (0.05-0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization.

  4. Compression molding of aerogel microspheres

    DOEpatents

    Pekala, R.W.; Hrubesh, L.W.

    1998-03-24

    An aerogel composite material produced by compression molding of aerogel microspheres (powders) mixed together with a small percentage of polymer binder to form monolithic shapes in a cost-effective manner is disclosed. The aerogel composites are formed by mixing aerogel microspheres with a polymer binder, placing the mixture in a mold and heating under pressure, which results in a composite with a density of 50--800 kg/m{sup 3} (0.05--0.80 g/cc). The thermal conductivity of the thus formed aerogel composite is below that of air, but higher than the thermal conductivity of monolithic aerogels. The resulting aerogel composites are attractive for applications such as thermal insulation since fabrication thereof does not require large and expensive processing equipment. In addition to thermal insulation, the aerogel composites may be utilized for filtration, ICF target, double layer capacitors, and capacitive deionization. 4 figs.

  5. Onychomycosis due to opportunistic molds*

    PubMed Central

    Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto

    2015-01-01

    BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862

  6. Gating of Permanent Molds for ALuminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-03-30

    This report summarizes a two-year project, DE-FC07-01ID13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings.

  7. Amorphous materials molded IR lens progress report

    NASA Astrophysics Data System (ADS)

    Hilton, A. R., Sr.; McCord, James; Timm, Ronald; Le Blanc, R. A.

    2008-04-01

    Amorphous Materials began in 2000 a joint program with Lockheed Martin in Orlando to develop molding technology required to produce infrared lenses from chalcogenide glasses. Preliminary results were reported at this SPIE meeting by Amy Graham1 in 2003. The program ended in 2004. Since that time, AMI has concentrated on improving results from two low softening glasses, Amtir 4&5. Both glasses have been fully characterized and antireflection coatings have been developed for each. Lenses have been molded from both glasses, from Amtir 6 and from C1 Core glass. A Zygo unit is used to evaluate the results of each molded lens as a guide to improving the molding process. Expansion into a larger building has provided room for five production molding units. Molded lens sizes have ranged from 8 mm to 136 mm in diameter. Recent results will be presented

  8. Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding

    NASA Astrophysics Data System (ADS)

    Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.

    2015-03-01

    We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.

  9. Mold in My School: What Do I Do?

    ERIC Educational Resources Information Center

    National Clearinghouse for Educational Facilities, Washington, DC.

    This publication provides information on the most important indoor mold-related health concerns and discusses how school districts can keep school facilities mold-free and avoid these problems. The document addresses when to be concerned, how molds cause health problems, symptoms caused by mold allergies, indoor molds that form toxins, who is most…

  10. Mold For Casting Radius-Inspection Specimens

    NASA Technical Reports Server (NTRS)

    Ball, Robert N.

    1988-01-01

    Thin replicas viewed on comparator without sectioning. New mold machined from piece of transparent poly(methyl methacrylate). Fits around base of post. Two slots machined into inner surface form channels for casting inspection sections. Bottom of mold fits flush against surface around bottom of post. When surface slanted, mold automatically aligns in proper orientation. Time required to inspect elliptical radii located at bottoms of series of small posts reduced from 18 hours to 3 hours.

  11. The Gelation of Polyvinyl Alcohol with Borax: A Novel Class Participation Experiment Involving the Preparation and Properties of a "Slime."

    ERIC Educational Resources Information Center

    Casassa, E. Z.; And Others

    1986-01-01

    Background information, procedures used, and typical results obtained are provided for an experiment in which students prepare and study the characteristics of a "slime." A list of general, inorganic, and polymer chemistry concepts fostered in the experiment is included. (JN)

  12. [Composition of the oil-slime microbial community determined by analysis of the 16S rRNA gene].

    PubMed

    Grigor'eva, T V; Laĭkov, A V; Rizvanov, A A; Il'inskaia, O N; Naumova, R P

    2013-01-01

    Analysis of the 16S rRNA genes of the cultured microorganisms of industrial oil-slime revealed predominance (-85-90%) of the Gammaproteobacteria in the community of aerobic heterotrophs and specific oil-slime degraders. Relation of the isolated strains with members of the genera Pseudomonas, Stenotrophomonas, and Enterobacter was established. Analysis of the same gene in the total DNA from the oil-slime revealed greater microbial diversity (-20 operative taxonomic units determined by T-RFLP) than in the cultured part of the community, which included -12 different colony types. Three major restriction fragments were found, with their total area -50%. These results demonstrated the low morphological and phylogenetic diversity of the oil-slime bacterial community.

  13. Sorption of Sr{sup 2+} and Cu{sup 2+} from aqueous solutions with iron-containing slime

    SciTech Connect

    Pak, V.N.; Obukhova, N.G.

    1995-07-20

    Heavy metal ions are generally removed from industrial wastewater by treating with reagents. The potentiality of highly ferrous slimes for water treatment is shown with the example of Sr{sup 2+} and Cu{sup 2+} sorption.

  14. Slime production by clinical isolates of Blastoschizomyces capitatus from patients with hematological malignancies and catheter-related fungemia.

    PubMed

    D'Antonio, D; Parruti, G; Pontieri, E; Di Bonaventura, G; Manzoli, L; Sferra, R; Vetuschi, A; Piccolomini, R; Romano, F; Staniscia, T

    2004-10-01

    In order to expand the present knowledge of the pathogenic potential of Blastoschizomyces capitatus in central venous catheter (CVC)-related bloodstream infections, six strains of the organism recovered from three leukemic patients with CVC-related fungemia in different years were investigated. Isolates and control strains were tested for their genetic relatedness and for their ability to produce slime in glucose-containing solutions. DNA restriction enzyme analysis revealed that all strains of B. capitatus were identical, whereas slime production assays and examination of ex vivo material showed that they were able to produce large amounts of slime. Slime production may therefore play a relevant pathogenic role in cases of CVC-related fungemia caused by B. capitatus. PMID:15368097

  15. Evaluation of Different Phenotypic Techniques for the Detection of Slime Produced by Bacteria Isolated from Clinical Specimens

    PubMed Central

    HRV, Rajkumar; Devaki, Ramakrishna

    2016-01-01

    Introduction  Microorganisms use various strategies for their survival in both the environment and in humans. Slime production by bacteria is one such mechanism by which microbes colonize on the indwelling prosthetic devices and form biofilms. Infections caused by such microorganisms are difficult to treat as the biofilm acts as a shield and protects microbes against antimicrobial agents. There are several methods for the detection of slime produced by bacteria, and they include both phenotypic and molecular methods. The present study evaluated the Congo red agar/broth method, Christensen’s method, dye elution technique, and the latex agglutination method for the demonstration of slime production by different bacterial clinical isolates. Materials & Methods We collected 151 bacterial clinical isolates (both gram-positive and gram-negative bacteria) from various specimens and tested them for the production of slime both by qualitative and quantitative tests. Congo red agar/broth method, Christensen's method, dye elution technique, and latex agglutination methods were used for detecting the slime or slime-like substance. Results  We found that 103 (68.2%) strains were positive for slime production by Congo red agar/broth method. It was found that 18 (94.7%) strains of Klebsiella pneumoniae, 21 (84.0%) strains of S aureus and 25 (65.7%) strains of coagulase-negative Staphylococci were positive for slime or slime-like substances by Congo red agar/broth method. A total of 41.0% of the strains positive by Christensen's method and 15.2% of the strains by dye elution technique were found to be more adherent organisms and that have the potential to form biofilms. Only the gram-positive organisms showed nonspecific agglutination with latex suspension. Conclusion  Among the various phenotypic methods compared in this study the Congo red agar/broth method is a simple, economical, sensitive, and specific method that can be used by clinical microbiology laboratories

  16. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  17. Mold Infections of the Central Nervous System

    PubMed Central

    McCarthy, Matthew; Rosengart, Axel; Schuetz, Audrey N.; Kontoyiannis, Dimitrios P.; Walsh, Thomas J.

    2016-01-01

    The recent outbreak of exserohilum rostratum meningitis linked to epidural injections of methylprednisolone acetate has brought renewed attention to mold infections of the central nervous system (CNS).1 Although uncommon, these infections are often devastating and difficult to treat. This focused review of the epidemiologic aspects, clinical characteristics, and treatment of mold infections of the CNS covers a group of common pathogens: aspergillus, fusarium, and scedosporium species, molds in the order Mucorales, and dematiaceous molds. Infections caused by these pathogen groups have distinctive epidemiologic profiles, clinical manifestations, microbiologic characteristics, and therapeutic implications, all of which clinicians should understand. PMID:25006721

  18. Analysis of optical properties in injection-molded and compression-molded optical lenses.

    PubMed

    Wang, Chung Yen; Wang, Pei Jen

    2014-04-10

    Numerical mold-flow simulations and experimental measurements for injection-molded lenses have been investigated in form accuracy on a two-cavity mold with various process conditions. First, form profiles of the molded lenses have been measured together with the corresponding simulated mold-temperature distribution and displacement distribution of the lens in the z direction. A flow-through type layout of cooling channels has been devised for balance of mold-temperature distribution in mold cavities with various parametric distances for assessments in uniformity of temperature distribution. Finally, a compression-molding process is proposed for the post-process of birefringence relaxation as well as adequate form accuracy of lenses. In conclusion, optimization of process parameters to achieve good form accuracy in a multicavity mold with symmetric geometry but nonuniform cooling conditions is difficult. A good design of cooling channels plus optimized process conditions could provide uniform mold-temperature distribution so that molded lenses of good quality would be possible. Then, the profile deviation of lenses could be further compensated by profile geometry corrections. In conclusion, the post-compression-molding process could make birefringence-free plastic lenses with good form accuracy.

  19. Indoor mold and Children's health

    PubMed

    Etzel; Rylander

    1999-06-01

    Reactive airways disease in children is increasing in many countries around the world. The clinical diagnosis of asthma or reactive airways disease includes a variable airflow and an increased sensitivity in the airways. This condition can develop after an augmented reaction to a specific agent (allergen) and may cause a life-threatening situation within a very short period of exposure. It can also develop after a long-term exposure to irritating agents that cause an inflammation in the airways in the absence of an allergen. (paragraph) Several environmental agents have been shown to be associated with the increased incidence of childhood asthma. They include allergens, cat dander, outdoor as well as indoor air pollution, cooking fumes, and infections. There is, however, increasing evidence that mold growth indoors in damp buildings is an important risk factor. About 30 investigations from various countries around the world have demonstrated a close relationship between living in damp homes or homes with mold growth, and the extent of adverse respiratory symptoms in children. Some studies show a relation between dampness/mold and objective measures of lung function. Apart from airways symptoms, some studies demonstrate the presence of general symptoms that include fatigue and headache and symptoms from the central nervous system. At excessive exposures, an increased risk for hemorraghic pneumonia and death among infants has been reported. (paragraph) The described effects may have important consequences for children in the early years of life. A child's immune system is developing from birth to adolescence and requires a natural, physiologic stimulation with antigens as well as inflammatory agents. Any disturbances of this normal maturing process will increase the risk for abnormal reactions to inhaled antigens and inflammagenic agents in the environment. (paragraph) The knowledge about health risks due to mold exposure is not widespread and health authorities in

  20. Comparison of slime-producing coagulase-negative Staphylococcus colonization rates on vinyl and ceramic tile flooring materials.

    PubMed

    Yazgi, H; Uyanik, M H; Ayyildiz, A

    2009-01-01

    This study investigated the colonization of slime-producing coagulase-negative Staphylococcus (CoNS) in 80 patient wards in Turkey (40 vinyl and 40 ceramic tile floors). A total of 480 samples that included 557 CoNS isolates were obtained. Slime production was investigated with the Christensen method and methicillin-susceptibility was tested by the disk-diffusion method. There was a significant difference in the percentage of slime-producing CoNS isolates on vinyl (12.4%) versus ceramic tile flooring (4.4%). From vinyl flooring, the percentage of slime producing methicillin-resistant CoNS (MRCoNS) (8.9%) was significantly higher than for methicillin-sensitive CoNS (MSCoNS) (3.6%), whereas there was no difference from ceramic tile flooring (2.5% MRCoNS versus 1.8% MSCoNS). The most commonly isolated slime-producing CoNS species was S. epidermidis on both types of flooring. It is concluded that vinyl flooring seems to be a more suitable colonization surface for slime-producing CoNS than ceramic tile floors. Further studies are needed to investigate bacterial strains colonized on flooring materials, which are potential pathogens for nosocomial infections. PMID:19589249

  1. The structure and function of glycoproteins synthesized during slime-polysaccharide production by membranes of the root-cap cells of maize (Zea mays).

    PubMed Central

    Green, J R; Northcote, D H

    1978-01-01

    The synthesis of the maize root slime polysaccharides was investigated by using [1-3H]-fucose as a marker for slime production. Three fractions were separated by centrifugation in a CsCl density gradient. Two of these were glycoproteins and occurred within the membranes of the cells of the root tip; the third was the slime polysaccharides. Radioactive pulse-chase experiments showed that the glycoproteins were precursors of the slime polysaccharides, and the carbohydrate portion of the glycoproteins had a similar composition to that of the free slime. The linkage between the protein and the carbohydrate of one of the glycoproteins was shown to be a xylose-threonine bond. It is postulated that the slime polysaccharides are synthesized and transported on proteins within the membrane system of the root tip. PMID:646802

  2. DermACELL: Human Acellular Dermal Matrix Allograft A Case Report.

    PubMed

    Cole, Windy E

    2016-03-01

    Diabetes often causes ulcers on the feet of diabetic patients. A 56-year-old, insulin-dependent, diabetic woman presented to the wound care center with a Wagner grade 3 ulcer of the right heel. She reported a 3-week history of ulceration with moderate drainage and odor and had a history of ulceration and osteomyelitis in the contralateral limb. Rigorous wound care, including hospitalization; surgical incision and drainage; intravenous antibiotic drug therapy; vacuum-assisted therapy; and a new room temperature, sterile, human acellular dermal matrix graft were used to heal the wound, save her limb, and restore her activities of daily living. This case presentation involves alternative treatment of a diabetic foot ulcer with this new acellular dermal matrix, DermACELL. PMID:27031550

  3. Prosthetic Breast Reconstruction With Acellular Dermal Matrices: Achieving Predictability and Reproducibility.

    PubMed

    Nahabedian, Maurice Y

    2016-05-01

    The use of acellular dermal matrices in the setting of prosthetic breast reconstruction has captured the attention of many plastic surgeons. The regenerative capacity of these materials has provided additional tissue support to the mastectomy skin flaps with the ultimate result of improving surgical and aesthetic outcomes. Despite the benefits, there remains a significant diversity with regard to outcomes with some surgeons reporting increased morbidity. The reasons for this are varied but ultimately related to differences in patient selection and surgical techniques. The purpose of this article is to provide strategies for using acellular dermal matrix to achieve success in a manner that is usually associated with outcomes that are predictable and reproducible. PMID:27579223

  4. Pioneering technique using Acellular Dermal Matrix in the rescue of a radiation ulcer

    PubMed Central

    NASEEM, S.; PATEL, A.D.; DEVALIA, H.

    2016-01-01

    Background Radiotherapy as an adjuvant to mastectomy is integral to the treatment of breast cancer, but can result in skin ulceration. Skin ulceration following radiotherapy is traditionally managed by removing the implant and allowing the skin to heal by secondary intention. Case report A 42-year-old woman underwent radiotherapy following a breast reconstruction. She developed a 2 x 3cm radiation ulcer. The ulcer was managed by removing the implant and performing capsulectomy. A Beckers 50 expander was placed and reinforced with acellular dermal matrix inferolaterally. At follow-up the patient had a good cosmetic outcome. Conclusion Post-radiation skin ulcers present a challenge to treat with no current standardised management. The use of acellular dermal matrix may present a new technique to promote healing in these testing cases. PMID:27142826

  5. Prosthetic Breast Reconstruction With Acellular Dermal Matrices: Achieving Predictability and Reproducibility

    PubMed Central

    2016-01-01

    Summary: The use of acellular dermal matrices in the setting of prosthetic breast reconstruction has captured the attention of many plastic surgeons. The regenerative capacity of these materials has provided additional tissue support to the mastectomy skin flaps with the ultimate result of improving surgical and aesthetic outcomes. Despite the benefits, there remains a significant diversity with regard to outcomes with some surgeons reporting increased morbidity. The reasons for this are varied but ultimately related to differences in patient selection and surgical techniques. The purpose of this article is to provide strategies for using acellular dermal matrix to achieve success in a manner that is usually associated with outcomes that are predictable and reproducible. PMID:27579223

  6. Use of acrylic sheet molds for elastomeric products

    NASA Technical Reports Server (NTRS)

    Heisman, R. M.; Koerner, A. E.; Messineo, S. M.

    1970-01-01

    Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.

  7. Plastic molds reduce cost of encapsulating electric cable connectors

    NASA Technical Reports Server (NTRS)

    Knott, D.

    1964-01-01

    Resin casting of the aluminum master pattern forms a plastic mold for encapsulating a cable connector. An elastomer is injected into the mold and cured. The mold is disassembled leaving an elastomeric encapsulation around the connector.

  8. Commercial and Residential Water Damage: The Mold Connection.

    ERIC Educational Resources Information Center

    Williams, Del

    2002-01-01

    Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)

  9. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER FREDERICK THOMAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER FREDERICK THOMAS MOLDING A NO. 8507. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  10. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY, MOLDING A RAIL CASTING (LAWLER NO. 1337). - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  11. The Cellular Immune Mechanism after Transfer of Chemically Extracted Acellular Nerve Xenografts

    PubMed Central

    Lin, Xingshi; Yang, Ruojia; He, Qing; Ruan, Dike

    2013-01-01

    Severe peripheral nerve defect by injuries causing functional loss require nerve grafting. Autograft has limitations for clinical use because it results in the creation of a new nerve injury and the generation of donor site morbidity. Based on these limitations, nerve allografts and xenografts provide a readily accessible alternative strategy. The aim of the present study was to observe the immune mechanism underlying the rejection of chemically extracted acellular nerve xenografts, and further evaluate immunogenicity of chemically treated acellular nerve grafts for clinical applications. A total of 160 BALB/c mice were randomly divided into a negative contrast group (NC, 40 mice), a fresh autograft group (AG, 40 mice), a fresh xenogeneic nerve group (FXN, 40 mice) and a chemically extracted acellular xenogeneic nerve group (CEXN, 40 mice). Various types of nerve grafts were implanted into the thigh muscle of BALB/C mice in the corresponding groups. At 3, 7, 14 and 28 days post-operation, the mice (10 mice from each group) were sacrificed and their spleens were extracted. The spleens were ground into paste. The erythrocytes and other cells were lysed using distilled water and the T lymphocytes were collected. Fluorescein isothiocyanate (FITC) -labeled monoclonal antibodies (CD3, CD4, CD8, CD25, IL-2, IFN-γ and TNF-α) were then added to the solution. The Fluorescence Activated Cell Sorting (FACS) was used to determine the positivity rate of the cells combined with the monoclonal antibodies above. No significant statistical differences were observed between the CEXN, NC and AG groups, so that no obvious immune rejections were observed among the chemically extracted acellular nerve xenografts. PMID:23874771

  12. Hertwig's epithelial root sheath cell behavior during initial acellular cementogenesis in rat molars.

    PubMed

    Yamamoto, Tsuneyuki; Yamamoto, Tomomaya; Yamada, Tamaki; Hasegawa, Tomoka; Hongo, Hiromi; Oda, Kimimitsu; Amizuka, Norio

    2014-11-01

    This study was designed to examine developing acellular cementum in rat molars by immunohistochemistry, to elucidate (1) how Hertwig's epithelial root sheath disintegrates and (2) whether epithelial sheath cells transform into cementoblasts through epithelial-mesenchymal transition (EMT). Initial acellular cementogenesis was divided into three developmental stages, which can be seen in three different portions of the root: portion 1, where the epithelial sheath is intact; portion 2, where the epithelial sheath becomes fragmented; and portion 3, where acellular cementogenesis begins. Antibodies against three kinds of matrix proteinases, which degrade epithelial sheath-maintaining factors, including basement membrane and desmosomes, were used to investigate proteolytic activity of the epithelial sheath. Tissue non-specific alkaline phosphatase (TNALP) and keratin were used to investigate EMT. Epithelial sheath cells showed immunoreactivity for all three enzymes at fragmentation, which suggests that epithelial sheath disintegration is enzymatically mediated. Dental follicle cells and cementoblasts showed intense immunoreactivity for TNALP, and from portion 1 through to 3, the reaction extended from the alveolar bone-related zone to the root-related zone. Cells possessing keratin/TNALP double immunoreactivity were virtually absent. Keratin-positive epithelial sheath cells showed negligible immunoreactivity for TNALP, and epithelial cells did not appear to migrate to the dental follicle. Together, these findings suggest that a transition phenotype between epithelial cells and cementoblasts does not exist in the developing dental follicle and hence that epithelial sheath cells do not undergo EMT during initial acellular cementogenesis. In brief, this study supports the notion that cementoblasts derive from the dental follicle. PMID:24859538

  13. Mold

    MedlinePlus

    ... Clin Immunol 130(1):267–270. 12 Chulada PC, Kennedy S, Mvula MM, Jaffee K, Wildfire J, Thornton ... 120(11): 1592–1599. 13 Grimsley LF, Chulada PC, Kennedy S, White L, Wildfire J, Cohn RD, Mitchell ...

  14. Mechanical properties of acellular mouse lungs after sterilization by gamma irradiation.

    PubMed

    Uriarte, Juan J; Nonaka, Paula N; Campillo, Noelia; Palma, Renata K; Melo, Esther; de Oliveira, Luis V F; Navajas, Daniel; Farré, Ramon

    2014-12-01

    Lung bioengineering using decellularized organ scaffolds is a potential alternative for lung transplantation. Clinical application will require donor scaffold sterilization. As gamma-irradiation is a conventional method for sterilizing tissue preparations for clinical application, the aim of this study was to evaluate the effects of lung scaffold sterilization by gamma irradiation on the mechanical properties of the acellular lung when subjected to the artificial ventilation maneuvers typical within bioreactors. Twenty-six mouse lungs were decellularized by a sodium dodecyl sulfate detergent protocol. Eight lungs were used as controls and 18 of them were submitted to a 31kGy gamma irradiation sterilization process (9 kept frozen in dry ice and 9 at room temperature). Mechanical properties of acellular lungs were measured before and after irradiation. Lung resistance (RL) and elastance (EL) were computed by linear regression fitting of recorded signals during mechanical ventilation (tracheal pressure, flow and volume). Static (Est) and dynamic (Edyn) elastances were obtained by the end-inspiratory occlusion method. After irradiation lungs presented higher values of resistance and elastance than before irradiation: RL increased by 41.1% (room temperature irradiation) and 32.8% (frozen irradiation) and EL increased by 41.8% (room temperature irradiation) and 31.8% (frozen irradiation). Similar increases were induced by irradiation in Est and Edyn. Scanning electron microscopy showed slight structural changes after irradiation, particularly those kept frozen. Sterilization by gamma irradiation at a conventional dose to ensure sterilization modifies acellular lung mechanics, with potential implications for lung bioengineering. PMID:25241281

  15. Preparation and characterization of an acellular bovine pericardium intended for manufacture of valve bioprostheses.

    PubMed

    Goissis, Gilberto; Giglioti, Aparecida de Fátima; Braile, Domingo Marcolino

    2011-05-01

    Major problems with biological heart valves post-implantation are associated with progressive structural deterioration and calcification attributed to glutaraldehyde processing, dead cells, and cell fragments present in the native tissue. In spite of these problems, glutaraldehyde still is the reagent of choice. The results with acellular matrix xenograft usually prepared by detergent treatment in association with enzymes are rather conflicting because while preserving mechanical properties, tissue morphology and collagen structure are process dependent. This work describes a chemical approach for the preparation of an acellular bovine pericardium matrix intended for the manufacture of heart valve bioprostheses. Cell removal was performed by an alkaline extraction in the presence of calcium salts for periods ranging from 6 to 48 h. The results showed that cell removal was achieved after 12 h, with swelling and negative charge increasing with processing time. Nevertheless, collagen fibril structure, ability to form fibrils, and stability to collagenase were progressive after 24-h processing. There was no denaturation of the collagen matrix. A process is described for the preparation of acellular bovine pericardium matrices with preserved fibril structure and morphology for the manufacture of cardiac valve bioprostheses and may be used in other applications for tissue reconstruction.

  16. Immunolocation of proteoglycans and bone-related noncollagenous glycoproteins in developing acellular cementum of rat molars.

    PubMed

    Yamamoto, T; Domon, T; Takahashi, S; Arambawatta, A K S; Wakita, M

    2004-09-01

    To elucidate the roles of proteoglycans of (PGs), bone sialoprotein (BSP), and osteopontin (OPN) in cementogenesis, their distribution was investigated in developing and established acellular cementum of rat molars by an immunoperoxidase method. To characterize PGs, antibodies against five species of glycosaminoglycans (GAGS), chondroitin-4-sulfate (C4S), chondroitin-6-sulfate (C6S), unsulfated chondroitin (C0S), dermatan sulfate (DS), and keratan sulfate (KS) were used. Routine histological staining was also applied. With onset of dentin mineralization, the initial cementum appeared on the dentin surface as a hematoxylin-stained fibril-poor layer. Subsequently, primitive principal fibers attached to the initial cementum. As the acellular cementum containing extrinsic fibers covered the initial cementum, the intal cementum formed the cemento-dentinal junction. Following immunohistochemistry at the earliest time of cementogenesis, the initial cementum was intensely immunoreactive for C4S, C6S, C0S, BSP, and OPN. After the initial cementum was embedded, neither the cemento-dentinal junction nor the cementum was immunoreactive for any GAG species. However, the cementum was immunoreactive for any GAG species. However, the cementum and cemento-dentinal were consistently immunoreactive for BSP. Although the cemento-dentinal junction was consistently immunoreactive for OPN, the remaining cementum showed no significant immunoreactivity. Thus, initial acellular cementogenesis requires a dense accumulation of PGs, BSP, and OPN, which may be associated with the mineralization process independently of collagen fibrils and initial principal fiber attachment. PMID:15278434

  17. Preparation and characterization of an acellular bovine pericardium intended for manufacture of valve bioprostheses.

    PubMed

    Goissis, Gilberto; Giglioti, Aparecida de Fátima; Braile, Domingo Marcolino

    2011-05-01

    Major problems with biological heart valves post-implantation are associated with progressive structural deterioration and calcification attributed to glutaraldehyde processing, dead cells, and cell fragments present in the native tissue. In spite of these problems, glutaraldehyde still is the reagent of choice. The results with acellular matrix xenograft usually prepared by detergent treatment in association with enzymes are rather conflicting because while preserving mechanical properties, tissue morphology and collagen structure are process dependent. This work describes a chemical approach for the preparation of an acellular bovine pericardium matrix intended for the manufacture of heart valve bioprostheses. Cell removal was performed by an alkaline extraction in the presence of calcium salts for periods ranging from 6 to 48 h. The results showed that cell removal was achieved after 12 h, with swelling and negative charge increasing with processing time. Nevertheless, collagen fibril structure, ability to form fibrils, and stability to collagenase were progressive after 24-h processing. There was no denaturation of the collagen matrix. A process is described for the preparation of acellular bovine pericardium matrices with preserved fibril structure and morphology for the manufacture of cardiac valve bioprostheses and may be used in other applications for tissue reconstruction. PMID:21595716

  18. Management of complex abdominal wall defects using acellular porcine dermal collagen.

    PubMed

    Chavarriaga, Luis Felipe; Lin, Edward; Losken, Albert; Cook, Michael W; Jeansonne, Louis O; White, Brent C; Sweeney, John F; Galloway, John R; Davis, S Scott

    2010-01-01

    Multiple techniques have been used for the repair of complex abdominal wall defects after recurrent incisional hernias with varying rates of success. Primary repair has been associated with high recurrence rates, and prosthetic mesh placement is contraindicated in contaminated surgical fields. The development of biologic prostheses has changed the approach to these difficult problems. This study evaluates the management of complex abdominal wall defects using acellular porcine dermal collagen. Between August 2006 and May 2007, 18 patients underwent abdominal wall reconstruction for complex defects with acellular porcine dermal collagen (CollaMend; Bard Inc., Warwick, RI). Patient demographics, preoperative risk factors, previous herniorrhaphy attempts, postoperative complications, recurrences, and long-term results were retrospectively reviewed. Records were reviewed at a mean follow up of 7.3 months; the recurrence rate was 44.4 per cent. A total of 38.9 per cent (seven of 18) developed a postoperative wound complications, including infection in 22.2 per cent (four of 18). All of the patients with infection required prosthesis removal as a result of encapsulation rather than incorporation of the biologic prosthesis. Acellular porcine dermal collagen has the potential for reconstruction of abdominal wall defects with postoperative wound occurrences comparable with other biologic materials. Encapsulation of the material was a major problem in cases with wound infection that required graft removal rather than local wound measures. Hernia recurrence and dehiscence of the graft were problems in noncompromised surgical fields.

  19. Process for Making Ceramic Mold

    NASA Technical Reports Server (NTRS)

    Buck, Gregory M. (Inventor); Vasquez, Peter (Inventor)

    2001-01-01

    An improved process for slip casting molds that can be more economically automated and that also exhibits greater dimensional stability is disclosed. The process involves subjecting an investment pattern, preferably made from wax, to successive cycles of wet-dipping in a slurry of colloidal, silica-based binder and dry powder-coating, or stuccoing with plaster of Paris or calcium sulfate mixtures to produce a multi-layer shell over the pattern. The invention as claimed entails applying a primary and a secondary coating to the investment pattern. At least two wet-dipping on in a primary slurry and dry-stuccoing cycles provide the primary coating, and an additional two wet-dippings and dry-stuccoing cycles provide the secondary, or back-up, coating. The primary and secondary coatings produce a multi-layered shell pattern. The multi-layered shell pattern is placed in a furnace first to cure and harden, and then to vaporize the investment pattern, leaving a detailed, high precision shell mold.

  20. The Thermal Distortion of a Funnel Mold

    NASA Astrophysics Data System (ADS)

    Hibbeler, Lance C.; Thomas, Brian G.; Schimmel, Ronald C.; Abbel, Gert

    2012-10-01

    This article investigates the thermal distortion of a funnel mold for continuous casting of thin slabs and explores the implications on taper and solidification of the steel shell. The three-dimensional mold temperatures are calculated using shell-mold heat flux and cooling water profiles that were calibrated with plant measurements. The thermal stresses and distorted shape of the mold are calculated with a detailed finite-element model of a symmetric fourth of the entire mold and waterbox assembly, and they are validated with plant thermocouple data and measurements of the wear of the narrow-face copper mold plates. The narrow-face mold distorts into the typical parabolic arc, and the wide face distorts into a "W" shape owing to the large variation in bolt stiffnesses. The thermal expansion of the wide face works against the applied narrow-face taper and funnel effects, so the effect of thermal distortion must be considered to accurately predict the ideal mold taper.

  1. Mold Remediation in Schools and Commercial Buildings.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.

    This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…

  2. Dynamic Feed Control For Injection Molding

    DOEpatents

    Kazmer, David O.

    1996-09-17

    The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.

  3. 21ST CENTURY MOLD ANALYSIS IN FOOD

    EPA Science Inventory

    Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...

  4. EXPOSURE OF CHILDREN TO INDOOR MOLDS

    EPA Science Inventory

    Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...

  5. Killing effect of peppermint vapor against pink-slime forming microorganisms.

    PubMed

    Ihara, Nozomi; Sakamoto, Jin; Yoshida, Munehiro; Tsuchido, Tetsuaki

    2015-01-01

    The killing effect of peppermint vapor (PMV) against pink-slime forming microorganisms, Methylobacterium mesophilicum as a bacterium and Rhodotorula mucilaginosa as a yeast, was investigated by the agar vapor assay. In this method, microbial cells were spread over the agar surface exposed to PMV in a petri dish, and then transferred into a recovery liquid. When 60μl of the peppermint liquid was added to a paper disc, a marked killing effect of PMV was observed after 48h against M. mesophilicum and after 168h against R. mucilaginosa. M. mesophilicum and R. mucilaginosa were found to be more resistant to PMV than Escherichia coli and Candida albicans, used as reference microorganisms, respectively. With the addition of 0.03% sodium pyruvate as a hydrogen peroxide scavenger in agar, the killing effect of PMV against E. coli and C. albicans was decreased, whereas it was little changed against M. mesophilicum and R. mucilaginosa. In fact, the properties of the killing effect of hydrogen peroxide solution at 0.2-1.0mM was in accord with those of PMV. M. mesophilicum and R. mucilaginosa were more resistant to the oxidant than E. coli and C. albicans, respectively. Results obtained suggested that reactive oxygen species (ROS) may be involved in the killing action of PMV and therefore pink-slime formers are more resistant to PMV than non-pink-slime formers because of the presence of carotenoids as an antioxidant in cells. We also suggest that the use of PMV appeared to be a potential tool for the control of pink-slime forming microorganisms occurring in wet areas of houses such as the bathroom and washing room.

  6. Killing effect of peppermint vapor against pink-slime forming microorganisms.

    PubMed

    Ihara, Nozomi; Sakamoto, Jin; Yoshida, Munehiro; Tsuchido, Tetsuaki

    2015-01-01

    The killing effect of peppermint vapor (PMV) against pink-slime forming microorganisms, Methylobacterium mesophilicum as a bacterium and Rhodotorula mucilaginosa as a yeast, was investigated by the agar vapor assay. In this method, microbial cells were spread over the agar surface exposed to PMV in a petri dish, and then transferred into a recovery liquid. When 60μl of the peppermint liquid was added to a paper disc, a marked killing effect of PMV was observed after 48h against M. mesophilicum and after 168h against R. mucilaginosa. M. mesophilicum and R. mucilaginosa were found to be more resistant to PMV than Escherichia coli and Candida albicans, used as reference microorganisms, respectively. With the addition of 0.03% sodium pyruvate as a hydrogen peroxide scavenger in agar, the killing effect of PMV against E. coli and C. albicans was decreased, whereas it was little changed against M. mesophilicum and R. mucilaginosa. In fact, the properties of the killing effect of hydrogen peroxide solution at 0.2-1.0mM was in accord with those of PMV. M. mesophilicum and R. mucilaginosa were more resistant to the oxidant than E. coli and C. albicans, respectively. Results obtained suggested that reactive oxygen species (ROS) may be involved in the killing action of PMV and therefore pink-slime formers are more resistant to PMV than non-pink-slime formers because of the presence of carotenoids as an antioxidant in cells. We also suggest that the use of PMV appeared to be a potential tool for the control of pink-slime forming microorganisms occurring in wet areas of houses such as the bathroom and washing room. PMID:26133506

  7. Strong, easy-to-mold, spiral buttress thread

    NASA Technical Reports Server (NTRS)

    Heier, W. C.

    1971-01-01

    Buttress thread with steep taper connects two molded plastic cylinders without changing wall thickness or sacrificing longitudinal strength at the juncture. Technique lends itself to conventional molding methods.

  8. IC chip stress during plastic package molding

    SciTech Connect

    Palmer, D.W.; Benson, D.A.; Peterson, D.W.; Sweet, J.N.

    1998-02-01

    Approximately 95% of the world`s integrated chips are packaged using a hot, high pressure transfer molding process. The stress created by the flow of silica powder loaded epoxy can displace the fine bonding wires and can even distort the metalization patterns under the protective chip passivation layer. In this study the authors developed a technique to measure the mechanical stress over the surface of an integrated circuit during the molding process. A CMOS test chip with 25 diffused resistor stress sensors was applied to a commercial lead frame. Both compression and shear stresses were measured at all 25 locations on the surface of the chip every 50 milliseconds during molding. These measurements have a fine time and stress resolution which should allow comparison with computer simulation of the molding process, thus allowing optimization of both the manufacturing process and mold geometry.

  9. Castable plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.

    2004-01-20

    A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  10. Fabrication of metallic nanodots in large-area arrays by mold-to-mold cross imprinting (MTMCI).

    PubMed

    Kwon, Sunghoon; Yan, Xiaoming; Contreras, Anthony M; Liddle, J Alexander; Somorjai, Gabor A; Bokor, Jeffrey

    2005-12-01

    We have developed a mold-to-mold cross imprint (MTMCI) process, which redefines an imprint mold with another imprint mold. By performing MTMCI on two identical imprint molds with silicon spacer nanowires in a perpendicular arrangement, we fabricated a large array of sub-30-nm silicon nanopillars. Large-area arrays of Pt dots are then produced using nanoimprint lithography with the silicon nanopillar mold. PMID:16351215

  11. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    NASA Astrophysics Data System (ADS)

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-07-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods.

  12. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet.

    PubMed

    Hoskins, Jessica L; Janion-Scheepers, Charlene; Chown, Steven L; Duffy, Grant A

    2015-07-08

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the 'suctorial' mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods.

  13. Adherence of Staphylococcus aureus slime-producing strain variants to biomaterials used in orthopaedic surgery.

    PubMed

    Gracia, E; Fernández, A; Conchello, P; Laclériga, A; Paniagua, L; Seral, F; Amorena, B

    1997-01-01

    The adherence of Staphylococcus aureus to biomaterials used in orthopaedic surgery (polymethylmethacrylate, fresh bone, steel and titanium alloys) and to glass was studied in vitro at 1, 2, 6, 24 and 48 h of incubation. Nonslime-producing strains (72, 80 and 510) and slime-producing variants of these strains were used. An automated and fast method of ATP-bioluminiscence was applied to determine bacterial viability. The lowest adherence corresponded to polymethylmethacrylate and bone, and the highest to metals. Significant adherence was detected in all cases after 6 h and was strain dependent, being lowest for strain 72. In most cases, adherence of nonslime-producing variants was not significant compared with controls, and slime-producing were more adherent than nonslime-producing variants. These differences were maximal at 6 h or 48 h, depending on the strain and the material. The findings suggest that the appearance of slime-producing cells within a given nonslime-producing bacterial population may jeopardise postoperative immune systems and antibiotic efficacy as a consequence of biofilm formation on implants and prostheses.

  14. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet.

    PubMed

    Hoskins, Jessica L; Janion-Scheepers, Charlene; Chown, Steven L; Duffy, Grant A

    2015-01-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the 'suctorial' mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

  15. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    PubMed Central

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-01-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

  16. An evaluation of serious neurological disorders following immunization: a comparison of whole-cell pertussis and acellular pertussis vaccines.

    PubMed

    Geier, David A; Geier, Mark R

    2004-08-01

    Serious neurological disorders reported following whole-cell pertussis in comparison to acellular pertussis vaccines were evaluated. The Vaccine Adverse Events Reporting System (VAERS) was analyzed for Emergency Department (ED) visits, life-threatening reactions, hospitalizations, disabilities, deaths, seizures, infantile spasms, encephalitis/encephalopathy, autism, Sudden Infant Death Syndrome (SIDS) and speech disorders reported with an initial onset of symptoms within 3 days following whole-cell pertussis and acellular pertussis vaccines among those residing in the US from 1997 to 1999. Controls were employed to evaluate potential biases in VAERS. Evaluations as to whether whole-cell and acellular vaccines were administered to populations of similar age and sex were undertaken because these factors might influence the study's results. Statistical increases were observed for all events examined following whole-cell pertussis vaccination in comparison to acellular pertussis vaccination, excepting cerebellar ataxia. Reporting biases were minimal in VAERS, and whole-cell and acellular pertussis vaccines were administered to populations of similar age and sex. Biologic mechanisms for the increased reactogenicity of whole-cell pertussis vaccines may stem from the fact that whole-cell pertussis vaccines contain 3,000 different proteins, whereas DTaP contains two to five proteins. Whole-cell pertussis vaccine contains known neurotoxins including: endotoxin, pertussis toxin and adenylate cyclase. Our results, and conclusions by the US Institute of Medicine, suggest an association between serious neurological disorders and whole-cell pertussis immunization. In light of the presence of a safer and at least equally efficacious acellular pertussis vaccine alternative, the Japanese and US switch to using acellular pertussis vaccine seems well justified. Other countries using whole-cell pertussis-containing vaccines should consider following suite in the near future.

  17. Mold Simulator Study of the Initial Solidification of Molten Steel in Continuous Casting Mold: Part II. Effects of Mold Oscillation and Mold Level Fluctuation

    NASA Astrophysics Data System (ADS)

    Zhang, Haihui; Wang, Wanlin

    2016-04-01

    The surface quality of the continuous casting strands is closely related to the initial solidification of liquid steel in the vicinity of the mold meniscus, and thus the clear understanding of the behavior of molten steel initial solidification would be of great importance for the control of the quality of final slab. With the development of the mold simulator techniques, the complex interrelationship between the solidified shell surface profile, heat flux, shell thickness, mold level fluctuation, and the infiltrated slag film was well illustrated in our previous study. As the second part, this article investigated the effect of the mold oscillation frequency, stroke, and mold level fluctuation on the initial solidification of the molten steel through the conduction of five different experiments. Results suggested that in the case of the stable mold level, the oscillation marks (OMs) exhibit equally spaced horizon depressions on the shell surface, where the heat flux at the meniscus area raises rapidly during negative strip time (NST) period and the presence of each OMs on the shell surface is corresponding to a peak value of the heat flux variation rate. Otherwise, the shell surface is poorly defined by the existence of wave-type defects, such as ripples or deep depressions, and the heat flux variation is irregular during NST period. The rising of the mold level leads to the longer-pitch and deeper OMs formation; conversely, the falling of mold level introduces shorter-pitch and shallower OMs. With the increase of the mold oscillation frequency, the average value of the low-frequency heat flux at the meniscus increases; however, it decreases when the mold oscillation stroke increases. Additionally, the variation amplitude of the high-frequency temperature and the high-frequency heat flux decreases with the increase of the oscillation frequency and the reduction of the oscillation stroke.

  18. Characterization of fiberglass-filled diallyl phthalate plastic molding resins and molded parts

    SciTech Connect

    Whitaker, R.B.; Glaub, J.E.; Bonekowski, N.R.; Gillham, P.D.

    1980-12-01

    Characterization of diallyl phthalate (DAP) molding resins was undertaken by differential scanning calorimetry (DSC) and by combined size exclusion chromatography (SEC)/low angle laser light scattering (LALLS) in order to better predict moldability and storage life limits. Completeness of cure of molded parts, before and after any post-curing, was also determined by thermal analysis. Molecular weights and molecular weight distributions of the DAP molding resins by SEC/LALLS indicated that the better molding resins have lower M/sub w//M/sub n/ ratios. Association effects were observed, which could not be overcome by solvent modification alone. Determination of DAP molding resin heats of reaction by DSC indicated a linear relation between ..delta..H/sub R/ and weight percent filler for the good molding resins. DSC analyses of molded DAP parts showed that 95% cure was achieved in some as-molded parts, with a post-cure temperature of 165/sup 0/C being required to complete the cure to 100%. Thickness of the parts was a factor, with the thicker parts being 100% cured as molded. The glass transition temperature (T/sub g/) of the molded parts increased as cure was completed, to approx. 160 to 165/sup 0/C maximum. These results are consistent with a model of thermoset resin curing behavior which states that 100% cure can be achieved only if a post-curing operation is conducted above the T/sub g infinity/ (T/sub g/ at complete cure) of the polymer.

  19. Mold management of wetted carpet.

    PubMed

    Ong, Kee-Hean; Dixit, Anupma; Lewis, Roger D; MacDonald Perkins, Maureen; Backer, Denis; Condoor, Sridhar; Emo, Brett; Yang, Mingan

    2014-01-01

    This study evaluated the growth and removal of fungi on wetted carpet using newly designed technologies that rely on physical principles of steam, heat, and fluid flow. Sixty samples of carpet were embedded with heat-treated house dust, followed by embedding, wearing with a hexapod, and wetting. Samples were inoculated using a liquid suspension of Cladosporium sphaerospermum prior to placement over a water-saturated foam pad. Incubation times were 24 hr, 7 days, and 30 days. Cleaning was performed using three methods; high-flow hot water extraction, hot water and detergent, and steam. Fungal loading increased from approximately 1500 colony forming units per area (CFU/cm(2)) in 24 hr to a maximum of approximately 10,200 CFU/cm(2) after 7 days with a slight decline to 9700 CFU/cm(2) after 30 days incubation. Statistically significant differences were found among all three methods for removal of fungi for all three time periods (p < 0.05). Steam-vapor was significantly better than the alternative methods (p <0.001) with over 99% efficiency in mold spore decline from wetted carpet after 24 hr and 30 days, and over 92% efficiency after 7 days. The alternative methods exhibited lower efficiencies with a decline over time, from a maximum of 82% and 81% at 24 hr down to 60% and 43% at 30 days for detergent-hot water and high-flow, hot water extraction, respectively. The net effect of the mold management study demonstrates that while steam has a consistent fungal removal rate, the detergent and high-flow, hot water methods decline in efficiency with increasing incubation time.

  20. Study on heat flux from resin to mold in injection molding process

    SciTech Connect

    Nishiwaki, Nobuhiko; Hori, Sankei

    1999-07-01

    Recently, an injection molding of thermoplastic is widely used in many industries, because this manufacturing method is very suitable for mass production. For injection molding processes, a number of software packages for simulating an injection molding process have been developed. It is assumed in these software packages that the heat transfer coefficient between the resin and the mold surface is constant at the filling or cooling stages. In general, when melted resin flows into the mold, heat is generated in the flowing resin because of the high viscosity at the filling stage. Moreover at the cooling stage, a separation of the molded part from the mold surface generally occurs because of shrinkage of the molded material. Therefore, the heat transfer coefficient has not been accurately obtained yet at these stages. In this paper, the temperature near the surface of the mold cavity has been experimentally measured, so the heat flux that flows from the resin to the mold has been able to be analytically estimated by an inverse conduction method. On the other hand, the separating behavior of the resin from the mold surface has been measured using an ultrasonic transducer attached to the outer surface of the stationary mold. The heat flux that flows from the resin to the mold has been analytically estimated. The apparent heat transfer coefficient can be obtained from the heat flux and the representative temperature difference, which is measured by an ultrasonic technique. It was discovered that the heat flux and the apparent heat transfer coefficient are hardly influenced by the separation.

  1. Evaluating acellular versus cellular perfusate composition during prolonged ex vivo lung perfusion after initial cold ischaemia for 24 hours.

    PubMed

    Becker, Simon; Steinmeyer, Jasmin; Avsar, Murat; Höffler, Klaus; Salman, Jawad; Haverich, Axel; Warnecke, Gregor; Ochs, Matthias; Schnapper, Anke

    2016-01-01

    Normothermic ex vivo lung perfusion (EVLP) has developed as a powerful technique to evaluate particularly marginal donor lungs prior to transplantation. In this study, acellular and cellular perfusate compositions were compared in an identical experimental setting as no consensus has been reached on a preferred technique yet. Porcine lungs underwent EVLP for 12 h on the basis of an acellular or a cellular perfusate composition after 24 h of cold ischaemia as defined organ stress. During perfusion, haemodynamic and respiratory parameters were monitored. After EVLP, the lung condition was assessed by light and transmission electron microscopy. Aerodynamic parameters did not show significant differences between groups and remained within the in vivo range during EVLP. Mean oxygenation indices were 491 ± 39 in the acellular group and 513 ± 53 in the cellular group. Groups only differed significantly in terms of higher pulmonary artery pressure and vascular resistance in the cellular group. Lung histology and ultrastructure were largely well preserved after prolonged EVLP and showed only minor structural alterations which were similarly present in both groups. Prolonged acellular and cellular EVLP for 12 h are both feasible with lungs prechallenged by ischaemic organ stress. Physiological and ultrastructural analysis showed no superiority of either acellular or cellular perfusate composition.

  2. Investigation of foaming behaviors in injection molding using mold pressure profile

    NASA Astrophysics Data System (ADS)

    Lee, John W. S.

    This thesis is intended to improve the understanding of foaming behaviors in various foam injection molding processes: structural foam molding, gas counter pressure molding, and gas counter pressure with mold opening. The foaming behavior in foam injection molding is different from foam extrusion in two ways. First, foaming occurs in a confined volume, which consists of a mold, whereas, it occurs in an open environment in foam extrusion. And second, while the foaming behavior in foam extrusion does not change with time once the steady state is reached, foam injection molding is on the other hand, time-dependent. These differences made it very challenging to study the foaming behaviors in foam injection molding. In this thesis, experiments were first conducted in foam extrusion to understand the effects of processing and material parameters on cell nucleation and growth behaviors. Subsequently, the knowledge obtained from the foam extrusion experiments was transferred to the foam injection molding process and the fundamental foaming mechanisms in foam injection molding were developed by conducting extensive experiments. Four processing parameters were mainly studied in this thesis: injection speed, void fraction setting (i.e., shot size), nitrogen content, and gate resistance. The experimental results revealed that the mold pressure profile during the foam injection molding process governed its foaming behaviors. Furthermore, by analyzing the mold pressure profile during the structural foam molding, it was possible to predict the achievable cell density in structural foam molding based on the foam extrusion results. When the gas counter pressure was employed, the analysis of the foaming behavior was relatively easier since the cell nucleation did not occur during the injection stage. However, the cell density that was achieved by using the gas counter pressure was generally lower than that obtained in structural foam molding due to the lower pressure drop rate

  3. Mucormycosis, Pseudallescheriasis, and Other Uncommon Mold Infections

    PubMed Central

    Quan, Clifford; Spellberg, Brad

    2010-01-01

    Serious infections due to non-Aspergillus molds are being encountered with increasing frequency. Factors likely responsible for the rise of these infections include aging populations in countries with advanced medical technologies, the resultant increase in incidence of many cancers, increasingly intensive myeloablative therapies for these cancers, increasingly intensive care for critically ill patients, and increases in the frequency of solid organ and hematopoietic stem cell transplantation. Although diagnostic and therapeutic modalities have improved, mortality rates for invasive mold infections remain high. In this review, we summarize current knowledge about non-Aspergillus mold infections of the chest, with a focus on risk factors, clinical features, diagnosis, and treatment. PMID:20463250

  4. Residual stresses in injection molded products

    NASA Astrophysics Data System (ADS)

    Jansen, K. M. B.

    2015-12-01

    During the molding process residual stresses are formed due to thermal contraction during cooling as well as the local pressure history during solidification. In this paper a simple analytical model is reviewed which relates residual stresses, product shrinkage as well as warpage to the temperature and pressure histories during molding. Precise excimer laser layer removal measurements were performed to verify the predicted residual stress distributions. In addition, detailed shrinkage and warpage measurements on a large series of polymers and for different molding conditions were performed and are shown to compare well with the model predictions.

  5. Association of coagulase-negative staphylococcal slime production and adherence with the development and outcome of adult septicemias.

    PubMed Central

    Kotilainen, P

    1990-01-01

    The relationship of coagulase-negative staphylococcal slime production and adherence with the development and outcome of bloodstream infections in two Finnish hospitals was evaluated. Analysis of 64 strains from 62 adult septicemias disclosed 34 (53%) adherent slime producers. In comparison, only 142 (29%) of 489 single blood culture isolates were adherent slime producers. Although tube adherence test-positive strains were significantly (P less than 0.001) more common among the septicemia strains than among clinically insignificant isolates, almost half of the septicemia cases were caused by tube test-negative strains. Thus, regarding any single patient isolate, a cautious posture to the clinical impact of positivity in the tube adherence test seems warranted. Moreover, adherence and slime production, as such, apparently played no role in the clinical outcome of these infections. The epidemiologic findings revealed that slime-producing coagulase-negative staphylococci were common in the hospital environment and suggested that epidemic spread of such strains was influenced by antimicrobial therapy. Collectively, these results indicate that, at least in these two hospitals, positivity in the tube was of minor importance in guiding clinical decisions in treating adult septicemias. PMID:2280010

  6. Defensive slime formation in Pacific hagfish requires Ca2+- and aquaporin-mediated swelling of released mucin vesicles.

    PubMed

    Herr, Julia E; Clifford, Alexander M; Goss, Greg G; Fudge, Douglas S

    2014-07-01

    Hagfishes defend themselves from fish predators via the rapid deployment of a fibrous slime that adheres to and clogs gills. The slime transforms from a thick glandular exudate to a fully hydrated product in a fraction of a second through a process that involves the swelling and rupture of numerous mucin vesicles. Here we demonstrate that the vesicle membrane plays an important role in regulating the swelling of mucin granules, and provide evidence that the membrane contains proteins that facilitate the movement of ions and water molecules. By exposing isolated mucin vesicles to varying combinations of inorganic ions, organic compounds and membrane channel inhibitors, we found that the majority of hagfish mucin vesicles require Ca(2+) to rupture. We also show that Ca(2+)-dependent rupture can be pharmacologically inhibited, which suggests a role for Ca(2+)-activated membrane transporters. We demonstrate that the aquaporin inhibitor mercuric chloride reduces the rate of vesicle swelling by an order of magnitude, which suggests that aquaporins facilitate the influx of water during vesicle deployment. Molecular evidence of two aquaporin homologues expressed in the slime glands further supports this idea. We propose a model of hagfish slime mucin vesicle rupture that involves Ca(2+)-activated transporters and aquaporins, and suggest that the presence of these proteins is an adaptation for increasing the speed of vesicle rupture and, consequently, the speed of the sliming response of hagfishes.

  7. INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW, GRAY IRON MOLDING MACHINE WITH MOLDER, R. L. BRANDY MOLDING A RAIL CASTING (LAWLER NO. 1337, A 16' x 35' MOLD WITH A 5' COPE AND A 4' DRAG). DRAG IS FILLED WITH SAND. - Lawler Machine & Foundry Company, Molding Area, 760 North Forty-fourth Street, Birmingham, Jefferson County, AL

  8. RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    RUN OUTS OCCUR WHEN IRON HAS UNSEATED MOLDING SAND AND RUN OUT OF THE MOLD UNDER POURING JACKETS AND SPILLS ONTO THE MOLDING PLATFORM. WORKERS GENERALLY WAIT SEVERAL MINUTES FOR THE IRON TO SOLIDIFY AND, WHILE IT IS STILL RED-HOT, REMOVE IT FROM THE PLATFORM AND SCRAP THE MOLD. - Southern Ductile Casting Company, Centerville Foundry, 101 Airport Road, Centreville, Bibb County, AL

  9. Hydraulically-assisted compression molding material and process development

    SciTech Connect

    Collister, J.E.; Butler, K.I.; Rinz, J.E.

    1996-11-01

    The Sheet Molding Compound (SMC) industry has recently seen an introduction of novel materials which are claimed to allow molders of SMC parts to alter their process to mold at substantially lower molding pressures. Although this is viewed as a major advantage for SMC molders, little description of molding processes has been given which take full advantage of these novel materials. The work reported in this paper describes one possible alternative process which will enable molders to capture the low-cost potential of reducing the required molding pressures. This process involves the use of low-cost mold construction, and the use of a novel method of applying molding pressure that obviates the need for a high-cost compression press, which causes the authors to apply a new name to this process; Hydraulic-Assisted Compression Molding. Molding results are presented for SMC which was designed to be molded at reduced pressures and temperatures (6.9 bar and 100 C).

  10. Florid pustular dermatitis of breast: A case report on a unusual complication from acellular dermal matrix use

    PubMed Central

    James, Justin; Jackson, Lee; Saunders, Christobel

    2016-01-01

    Introduction Idiopathic erythematous reaction of the breast (Red breast syndrome) is a known complication following breast reconstruction with acellular dermal matrix. However pustular dermatitis like presentation is not previously known. Presentation of case We present a 42-year-old lady who developed bilateral pustular dermatitis like appearance following breast reconstruction with acellular dermal matrix slings. Though surgical washout was done, both expanders and flex HD could be preserved. Discussion Acellular dermal matrix use is the only possible explanation for such a presentation and this can be considered a variant of red breast syndrome. Conclusion Pustular dermatitis like presentation can be associated with acelluar dermal matrix use and should be considered in similar clinical presentations, since this can avoid unnecessary surgical procedures. PMID:27058152

  11. Assessment of mold concentrations in Singapore shopping centers using mold-specific quantitative PCR (MSQPCR) analysis.

    PubMed

    Yap, Jennifer; Toh, Zhen Ann; Goh, Vivien; Ng, Lee Chen; Vesper, Stephen

    2009-09-01

    Molds can pose a human health threat and may amplify in buildings in humid climates. The objective of this study was to evaluate the mold growth in Singapore shopping centers based on the collection of 40 dust samples from 15 shopping centers, including one with a history of water damage. The dust was analyzed by a DNA-based technology called mold-specific quantitative PCR (MSQPCR). In a water-damaged shopping center, most of the 26 water-damage indicator species were detected at some concentration and many were much more abundant than the average in the shopping centers. MSQPCR is a useful method for quantifying indoor molds in tropical climates.

  12. Custom molded thermal MRg-FUS phantom

    NASA Astrophysics Data System (ADS)

    Eames, Matthew D. C.; Snell, John W.; Hananel, Arik; Kassell, Neal F.

    2012-11-01

    This article describes a method for creating custom-molded thermal phantoms for use with MR-guided focused ultrasound systems. The method is defined here for intracranial applications, though it may be modified for other anatomical targets.

  13. Sacrificial plastic mold with electroplatable base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2002-01-01

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  14. Sacrificial Plastic Mold With Electroplatable Base

    DOEpatents

    Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.

    2005-08-16

    A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.

  15. Antimicrobial Treatments of Indoor Mold and Bacteria

    EPA Science Inventory

    Biological contaminants especially mold in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants. Sick buildings are evidence of extremely problematic indoor air quality (IAQ), often resulting from unacceptab...

  16. Organic materials for ceramic molding processes

    NASA Technical Reports Server (NTRS)

    Saito, K.

    1984-01-01

    Ceramic molding processes are examined. Binders, wetting agents, lubricants, plasticizers, surface active agents, dispersants, etc., for pressing, rubber pressing, sip casting, injection casting, taping, extrusion, etc., are described, together with forming machines.

  17. Traditional Mold Analysis Compared to a DNA-based Method of Mold Analysis with Applications in Asthmatics' Homes

    EPA Science Inventory

    Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...

  18. Indoor Molds and Respiratory Hypersensitivity: A Comparison of Selected Molds and House Dust Mite Induced Responses in a Mouse Model**

    EPA Science Inventory

    Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...

  19. Adipose tissue regeneration in vivo using micronized acellular allogenic dermis as an injectable scaffold.

    PubMed

    Lee, Hee Young; Yang, Hyun Jin; Rhie, Jong Won; Han, Ki Talk

    2014-10-01

    Over the past few years, the clinical use of injectable artificial materials in plastic surgery has increased. In addition, autologous lipoimplantation is being performed for volume replacement of soft tissue for aesthetic purposes. In this study, acellular allogenic dermis was utilized as a scaffold for the culturing of preadipocytes, confirming the possibility of three-dimensional proliferation of progenitor cells, the eventual differentiation of stromal cells in adipose tissue into the adipocytes, and the in vivo implantation of such adipocytes to form fat tissue. Preadipocytes, recently called ASCs (adipose tissue-derived stromal/stem cells), were cultured in acellular allogenic dermis, successfully attached to the dermal particles in a three-dimensional structure, and proliferated, differentiated, and eventually formed a cluster. For the in vivo implantation, four groups were formed: the first group was cultured within the dermal scaffold for 24 h before implantation (24-h preconditioned group), the second group was induced for differentiation for 10 days before implantation (10-day preconditioned group), the third group was implanted immediately after cell propagation (nonpreconditioned group), and the control group was implanted with only dermal scaffold. In vivo implanted preadipocytes showed great differentiation into adipocytes within the dermal scaffolds. Also, the 10-day preconditioned group showed a greater volume of fat tissue compared to the 24-h preconditioned group. From these results, we confirmed that after a three-dimensional culture in acellular allogenic dermis, implanted preadipocytes formed a greater amount of fat tissue and that this could be a possible effective method for future soft tissue restoration.

  20. Reconstruction of a Recurrent First Dorsal Web Space Defect using Acellular Dermis

    PubMed Central

    Buck, Donald W.; Kloeters, Oliver; Eo, SuRak; Jones, Neil F.

    2007-01-01

    Oncologic defects of the hand can be problematic for the reconstructive surgeon. These defects may require a delay in definitive coverage until clear margins of resection can be obtained, which can result in a prolonged period of painful dressing changes and increased risk of soft-tissue infection. In addition, reconstructive options for oncologic defects are often limited to skin grafting, which can yield functional deficits secondary to contracted healing. Currently, there is no definitive method for preventing skin graft contracture; however, acellular dermis has been proposed as a biomechanical scaffold to enhance subsequent skin graft healing and slow this functionally debilitating process. Here, we present a patient with recurrent melanoma of the first dorsal web space. After re-resection of the melanoma, the 11 cm × 5 cm defect was reconstructed using acellular dermis as temporary coverage to allow ample time for permanent section results. Ten days later, after confirming negative margins of resection, a split-thickness skin graft (STSG) was applied over the vascularized neo-dermis. Follow-up clinical examination and the Disabilities of the Arm, Shoulder, and Hand (DASH) questionnaires were used to assess outcome. At 7 months, the patient had no recurrence of melanoma and a DASH functional reduction of only 6.9%. After approximately 18 months, the patient’s wounds had healed with excellent cosmetic and functional results, without any evidence of a web space contracture. These observations suggest that acellular dermis is a useful adjunct for wound coverage of the hand, particularly in areas of functional importance, such as the first dorsal web space. PMID:18780060

  1. Adjuvant neurotrophic factors in peripheral nerve repair with chondroitin sulfate proteoglycan-reduced acellular nerve allografts

    PubMed Central

    Boyer, Richard B.; Sexton, Kevin W.; Rodriguez-Feo, Charles L.; Nookala, Ratnam; Pollins, Alonda C.; Cardwell, Nancy L.; Tisdale, Keonna Y.; Nanney, Lillian B.; Shack, R. Bruce; Thayer, Wesley P.

    2014-01-01

    Background Acellular nerve allografts are now standard tools in peripheral nerve repair due to decreased donor site morbidity and operative time savings. Preparation of nerve allografts involves several steps of decellularization and modification of extracellular matrix to remove chondroitin sulfate proteoglycans (CSPGs), which have been shown to inhibit neurite outgrowth through a poorly understood mechanism involving RhoA and ECM-integrin interactions. Chondroitinase ABC (ChABC) is an enzyme that degrades CSPG molecules and has been shown to promote neurite outgrowth following injury of the central and peripheral nervous systems. Variable results following chondroitinase ABC treatment make it difficult to predict the effects of this drug in human nerve allografts, especially in the presence of native extracellular signaling molecules. Several studies have shown cross-talk between neurotrophic factor and CSPG signaling pathways, but their interaction remains poorly understood. In this study, we examined the adjuvant effects of nerve growth factor (NGF) and glial cell line-derived neurotrophic factor (GDNF) on neurite outgrowth post-injury in CSPG-reduced substrates and acellular nerve allografts. Materials and Methods E12 chicken DRG explants were cultured in medium containing ChABC, ChABC + NGF, ChABC + GDNF or control media. Explants were imaged at 3 d and neurite outgrowths measured. The rat sciatic nerve injury model involved a 1-cm sciatic nerve gap that was microsurgically repaired with ChABC pre-treated acellular nerve allografts. Prior to implantation, nerve allografts were incubated in NGF, GDNF or sterile water. Nerve histology was evaluated at 5d and 8wk post-injury. Results The addition of GDNF in vitro produced significant increase in sensory neurite length at 3 d compared to ChABC alone (P < 0.01), while NGF was not significantly different from control. In vivo adjuvant NGF produced increases in total myelinated axon count (P < 0.005) and motor axon

  2. Current opinions on indications and algorithms for acellular dermal matrix use in primary prosthetic breast reconstruction.

    PubMed

    Vu, Michael M; Kim, John Y S

    2015-06-01

    Acellular dermal matrix (ADM) is widely used in primary prosthetic breast reconstruction. Many indications and contraindications to use ADM have been reported in the literature, and their use varies by institution and surgeon. Developing rational, tested algorithms to determine when ADM is appropriate can significantly improve surgical outcomes and reduce costs associated with ADM use. We review the important indications and contraindications, and discuss the algorithms that have been put forth so far. Further research into algorithmic decision-making for ADM use will allow optimized balancing of cost with risk and benefit. PMID:26161304

  3. Current opinions on indications and algorithms for acellular dermal matrix use in primary prosthetic breast reconstruction

    PubMed Central

    Vu, Michael M.

    2015-01-01

    Acellular dermal matrix (ADM) is widely used in primary prosthetic breast reconstruction. Many indications and contraindications to use ADM have been reported in the literature, and their use varies by institution and surgeon. Developing rational, tested algorithms to determine when ADM is appropriate can significantly improve surgical outcomes and reduce costs associated with ADM use. We review the important indications and contraindications, and discuss the algorithms that have been put forth so far. Further research into algorithmic decision-making for ADM use will allow optimized balancing of cost with risk and benefit. PMID:26161304

  4. Effects of extracellular slime produced by Staphylococcus epidermidis on oxidative responses of rabbit alveolar macrophages.

    PubMed

    Myrvik, Q N; Wagner, W; Barth, E; Wood, P; Gristina, A G

    1989-01-01

    Bacterial slime produced in mass cultures of the RP 12 strain of Staphylococcus epidermidis was extracted with 4 M guanidine-HCl plus 0.05 M sodium acetate and 0.5% CHAPS, concentrated, dialyzed, and subjected to separation on DEAE sephacel columns. Three fractions, I-2A, I-2B, and I-4, were eluted with linear gradients of NaCl. Fractions I-2A and I-2B were alcian blue positive, whereas I-4 was alcian blue negative but the most electronegative fraction. The crude polysaccharide fraction and the three purified fractions were incubated individually for 2.5 or 20 h with normal rabbit alveolar macrophages (AM) to determine their effect on a subsequent PMA-induced oxidative burst. The crude fraction (50-200 micrograms/mL) and I-2B (50-200 micrograms/mL) primed the AM to give approximately a threefold increase in the PMA-induced burst after 2.5 h incubation. In contrast, a 20-h incubation resulted in a 30-40% inhibition of the PMA-induced burst with AM incubated with the same concentrations of the crude, I-2A, or I-2B fractions. Fraction I-4 had no detectable effect. The fractions also were tested to determine if they could elicit an oxidative burst in BCG-immune AM. None of the fractions (up to 500 micrograms/mL) elicited a significant oxidative burst even though BCG-immune AM yielded a PMA-induced burst 100 times that observed with normal resident AM. These data suggest that slime from S. epidermidis can impair the PMA-induced oxidative burst of normal AM during a 20-h incubation period and could explain in part why host defenses are compromised by slime-producing S. epidermidis.

  5. Effects of extracellular slime produced by Staphylococcus epidermidis on oxidative responses of rabbit alveolar macrophages.

    PubMed

    Myrvik, Q N; Wagner, W; Barth, E; Wood, P; Gristina, A G

    1989-01-01

    Bacterial slime produced in mass cultures of the RP 12 strain of Staphylococcus epidermidis was extracted with 4 M guanidine-HCl plus 0.05 M sodium acetate and 0.5% CHAPS, concentrated, dialyzed, and subjected to separation on DEAE sephacel columns. Three fractions, I-2A, I-2B, and I-4, were eluted with linear gradients of NaCl. Fractions I-2A and I-2B were alcian blue positive, whereas I-4 was alcian blue negative but the most electronegative fraction. The crude polysaccharide fraction and the three purified fractions were incubated individually for 2.5 or 20 h with normal rabbit alveolar macrophages (AM) to determine their effect on a subsequent PMA-induced oxidative burst. The crude fraction (50-200 micrograms/mL) and I-2B (50-200 micrograms/mL) primed the AM to give approximately a threefold increase in the PMA-induced burst after 2.5 h incubation. In contrast, a 20-h incubation resulted in a 30-40% inhibition of the PMA-induced burst with AM incubated with the same concentrations of the crude, I-2A, or I-2B fractions. Fraction I-4 had no detectable effect. The fractions also were tested to determine if they could elicit an oxidative burst in BCG-immune AM. None of the fractions (up to 500 micrograms/mL) elicited a significant oxidative burst even though BCG-immune AM yielded a PMA-induced burst 100 times that observed with normal resident AM. These data suggest that slime from S. epidermidis can impair the PMA-induced oxidative burst of normal AM during a 20-h incubation period and could explain in part why host defenses are compromised by slime-producing S. epidermidis. PMID:2488002

  6. Gating of Permanent Molds for Aluminum Casting

    SciTech Connect

    David Schwam; John F. Wallace; Tom Engle; Qingming Chang

    2004-01-01

    This report summarizes a two-year project, DE-FC07-011D13983 that concerns the gating of aluminum castings in permanent molds. The main goal of the project is to improve the quality of aluminum castings produced in permanent molds. The approach taken was to determine how the vertical type gating systems used for permanent mold castings can be designed to fill the mold cavity with a minimum of damage to the quality of the resulting casting. It is evident that somewhat different systems are preferred for different shapes and sizes of aluminum castings. The main problems caused by improper gating are entrained aluminum oxide films and entrapped gas. The project highlights the characteristic features of gating systems used in permanent mold aluminum foundries and recommends gating procedures designed to avoid common defects. The study also provides direct evidence on the filling pattern and heat flow behavior in permanent mold castings. Equipment and procedure for real time X-Ray radiography of molten aluminum flow into permanent molds have been developed. Other studies have been conducted using water flow and behavior of liquid aluminum in sand mold using real time photography. This investigation utilizes graphite molds transparent to X-Rays making it possible to observe the flow pattern through a number of vertically oriented grating systems. These have included systems that are choked at the base of a rounded vertical sprue and vertical gating systems with a variety of different ingates into the bottom of a mold cavity. These systems have also been changed to include gating systems with vertical and horizontal gate configurations. Several conclusions can be derived from this study. A sprue-well, as designed in these experiments, does not eliminate the vena contracta. Because of the swirling at the sprue-base, the circulating metal begins to push the entering metal stream toward the open runner mitigating the intended effect of the sprue-well. Improved designs of

  7. A Mold by Any Other Name: One Librarian's Battle Against a Mold Bloom.

    ERIC Educational Resources Information Center

    Smith, Laura Katz

    1997-01-01

    Describes how library staff at Virginia Polytechnic Institute and State University cleaned up materials after a mold bloom in the rare book room. Includes advice for controlling mold: set up a hygrothermograph, clean dust from books, set up fans, do a "skin" test at regular intervals, keep windows closed, have dehumidifiers available. (PEN)

  8. Rapid control of mold temperature during injection molding process: Effect of packing pressure

    NASA Astrophysics Data System (ADS)

    Liparoti, Sara; Sorrentino, Andrea; Titomanlio, Giuseppe

    2015-12-01

    A thorough analysis of the effect of operative conditions of injection molding process on the morphology distribution inside the obtained molded is performed, with particular reference to semi- crystalline polymers. In particular, fully characterized injection molding tests are presented using an isotactic polypropylene, previously carefully characterized as far as most of properties of interest. The effects of mold temperature and packing conditions are analyzed. The mold temperature was controlled by a thin heating device, composed by polyimide as insulating layer and polyimide loaded carbon black as electrical conductive layer, that is able to increase temperature on mold surface in few seconds (70°C/s) by joule effect and cool down soon after. The shear layer thickness in the molded is reduced in the samples produced at high mold temperatures, that means high electrical power and long heating time, and this reduction is more significant at lower packing pressures, indeed, at 360bar as packing pressure and 20s as heating time the shear layer disappear. The resulting morphology was analyzed by optical microscope.

  9. Study on 100 Gbit/inch2 Density Molding Using Double-Sided Heat Insulated Mold

    NASA Astrophysics Data System (ADS)

    Inoue, Kazuo; Hayashi, Kazuhiro; Kawasaki, Yoshihiro; Ohno, Eiji; Masuhara, Shin; Kaneko, Masahiko

    2004-07-01

    Previously we showed substrates without any pit deformation in the case of injection molding a 40 Gbit/inch2 read only memory (ROM) substrate using the single-sided heat insulated mold, in which a heat insulating plate was located below a stamper, and the slow mold opening method. This type of mold is characterized by the fact that pits on the substrates can be replicated at a low mold temperature, to avoid the twisting of substrates. However, it was found that the radial tilt was large. Therefore, we investigated this phenomenon using simulations, and fabricated a double-sided heat insulated mold with a symmetric structure in the thickness direction of the substrates. We showed that performing injection molding using this double-sided mold rendered the radial tilt of substrates controllable, so that it was possible to obtain flat disks. Furthermore, we obtained a 120-mm-diameter 100 Gbit/inch2 ROM substrate, which had no pit deformation over the entire pit area even though the pit wall angle was greater than 80 deg. This density corresponds to approximately 140 Gbyte.

  10. Creation and implantation of acellular rat renal ECM-based scaffolds

    PubMed Central

    Peloso, Andrea; Ferrario, Jacopo; Maiga, Benedetta; Benzoni, Ilaria; Bianco, Carolina; Citro, Antonio; Currao, Manuela; Malara, Alessandro; Gaspari, Annalisa; Balduini, Alessandra; Abelli, Massimo; Piemonti, Lorenzo; Dionigi, Paolo; Orlando, Giuseppe; Maestri, Marcello

    2015-01-01

    Abstract Kidney transplantation is the only potentially curative treatment for patient facing end-stage renal disease, and it is now routinely used. Its use is mainly limited by the supply of transplantable donor organs, which far exceeds the demand. Regenerative medicine and tissue engineering offer promising means for overcoming this shortage. In the present study, we developed and validated a protocol for producing acellular rat renal scaffolds. Left kidneys were removed from 26 male Lewis rats (weights: 250–350 g) and decellularized by means of aortic anterograde perfusion with ionic and anionic detergents (Triton X-100 1% and SDS 1%, respectively). 19 scaffolds thus obtained (and contralateral native kidneys as controls) were deeply characterized in order to evaluate the decellularization quality, the preservation of extracellular matrix components and resultant micro-angioarchitecture structure. The other 7 were transplanted into 7 recipient rats that had undergone unilateral nephrectomy. Recipients were sacrificed on post-transplantation day 7 and the scaffolds subjected to histologic studies. The dual-detergent protocol showed, with only 5 h of perfusion per organ, to obtain thoroughly decellularized renal scaffolds consisting almost exclusively of extracellular matrix. Finally the macro- and the microarchitecture of the renal parenchyma were well preserved, and the grafts were implanted with ease. Seven days after transplant, the scaffolds were morphologically intact although all vascular structures were obstructed with thrombi. Production and implantation of acellular rat renal scaffolds is a suitable platform for further studies on regenerative medicine and tissue engineering. PMID:26186418

  11. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  12. Xenogeneic acellular conjunctiva matrix as a scaffold of tissue-engineered corneal epithelium.

    PubMed

    Zhao, Haifeng; Qu, Mingli; Wang, Yao; Wang, Zhenyu; Shi, Weiyun

    2014-01-01

    Amniotic membrane-based tissue-engineered corneal epithelium has been widely used in the reconstruction of the ocular surface. However, it often degrades too early to ensure the success of the transplanted corneal epithelium when treating patients with severe ocular surface disorders. In the present study, we investigated the preparation of xenogeneic acellular conjunctiva matrix (aCM) and evaluated its efficacy and safety as a scaffold of tissue-engineered corneal epithelium. Native porcine conjunctiva was decellularized with 0.1% sodium dodecyl sulfate (SDS) for 12 h at 37°C and sterilized via γ-irradiation. Compared with native conjunctiva, more than 92% of the DNA was removed, and more than 90% of the extracellular matrix components (glycosaminoglycan and collagen) remained after the decellularization treatment. Compared with denuded amniotic membrane (dAM), the aCM possessed favorable optical transmittance, tensile strength, stability and biocompatibility as well as stronger resistance to degradation both in vitro and in vivo. The corneal epithelial cells seeded on aCM formed a multilayered epithelial structure and endured longer than did those on dAM. The aCM-based tissue-engineered corneal epithelium was more effective in the reconstruction of the ocular surface in rabbits with limbal stem cell deficiency. These findings support the application of xenogeneic acellular conjunctiva matrix as a scaffold for reconstructing the ocular surface.

  13. Deficiency in acellular cementum and periodontal attachment in bsp null mice.

    PubMed

    Foster, B L; Soenjaya, Y; Nociti, F H; Holm, E; Zerfas, P M; Wimer, H F; Holdsworth, D W; Aubin, J E; Hunter, G K; Goldberg, H A; Somerman, M J

    2013-02-01

    Bone sialoprotein (BSP) is an extracellular matrix protein found in mineralized tissues of the skeleton and dentition. BSP is multifunctional, affecting cell attachment and signaling through an RGD integrin-binding region, and acting as a positive regulator for mineral precipitation by nucleating hydroxyapatite crystals. BSP is present in cementum, the hard tissue covering the tooth root that anchors periodontal ligament (PDL) attachment. To test our hypothesis that BSP plays an important role in cementogenesis, we analyzed tooth development in a Bsp null ((-/-)) mouse model. Developmental analysis by histology, histochemistry, and SEM revealed a significant reduction in acellular cementum formation on Bsp (-/-) mouse molar and incisor roots, and the cementum deposited appeared hypomineralized. Structural defects in cementum-PDL interfaces in Bsp (-/-) mice caused PDL detachment, likely contributing to the high incidence of incisor malocclusion. Loss of BSP caused progressively disorganized PDL and significantly increased epithelial down-growth with aging. Bsp (-/-) mice displayed extensive root and alveolar bone resorption, mediated by increased RANKL and the presence of osteoclasts. Results collected here suggest that BSP plays a non-redundant role in acellular cementum formation, likely involved in initiating mineralization on the root surface. Through its importance to cementum integrity, BSP is essential for periodontal function. PMID:23183644

  14. The acellular matrix (ACM) for bladder tissue engineering: A quantitative magnetic resonance imaging study.

    PubMed

    Cheng, Hai-Ling Margaret; Loai, Yasir; Beaumont, Marine; Farhat, Walid A

    2010-08-01

    Bladder acellular matrices (ACMs) derived from natural tissue are gaining increasing attention for their role in tissue engineering and regeneration. Unlike conventional scaffolds based on biodegradable polymers or gels, ACMs possess native biomechanical and many acquired biologic properties. Efforts to optimize ACM-based scaffolds are ongoing and would be greatly assisted by a noninvasive means to characterize scaffold properties and monitor interaction with cells. MRI is well suited to this role, but research with MRI for scaffold characterization has been limited. This study presents initial results from quantitative MRI measurements for bladder ACM characterization and investigates the effects of incorporating hyaluronic acid, a natural biomaterial useful in tissue-engineering and regeneration. Measured MR relaxation times (T(1), T(2)) and diffusion coefficient were consistent with increased water uptake and glycosaminoglycan content observed on biochemistry in hyaluronic acid ACMs. Multicomponent MRI provided greater specificity, with diffusion data showing an acellular environment and T(2) components distinguishing the separate effects of increased glycosaminoglycans and hydration. These results suggest that quantitative MRI may provide useful information on matrix composition and structure, which is valuable in guiding further development using bladder ACMs for organ regeneration and in strategies involving the use of hyaluronic acid.

  15. Creation and implantation of acellular rat renal ECM-based scaffolds.

    PubMed

    Peloso, Andrea; Ferrario, Jacopo; Maiga, Benedetta; Benzoni, Ilaria; Bianco, Carolina; Citro, Antonio; Currao, Manuela; Malara, Alessandro; Gaspari, Annalisa; Balduini, Alessandra; Abelli, Massimo; Piemonti, Lorenzo; Dionigi, Paolo; Orlando, Giuseppe; Maestri, Marcello

    2015-01-01

    Kidney transplantation is the only potentially curative treatment for patient facing end-stage renal disease, and it is now routinely used. Its use is mainly limited by the supply of transplantable donor organs, which far exceeds the demand. Regenerative medicine and tissue engineering offer promising means for overcoming this shortage. In the present study, we developed and validated a protocol for producing acellular rat renal scaffolds. Left kidneys were removed from 26 male Lewis rats (weights: 250-350 g) and decellularized by means of aortic anterograde perfusion with ionic and anionic detergents (Triton X-100 1% and SDS 1%, respectively). 19 scaffolds thus obtained (and contralateral native kidneys as controls) were deeply characterized in order to evaluate the decellularization quality, the preservation of extracellular matrix components and resultant micro-angioarchitecture structure. The other 7 were transplanted into 7 recipient rats that had undergone unilateral nephrectomy. Recipients were sacrificed on post-transplantation day 7 and the scaffolds subjected to histologic studies. The dual-detergent protocol showed, with only 5 h of perfusion per organ, to obtain thoroughly decellularized renal scaffolds consisting almost exclusively of extracellular matrix. Finally the macro- and the microarchitecture of the renal parenchyma were well preserved, and the grafts were implanted with ease. Seven days after transplant, the scaffolds were morphologically intact although all vascular structures were obstructed with thrombi. Production and implantation of acellular rat renal scaffolds is a suitable platform for further studies on regenerative medicine and tissue engineering. PMID:26186418

  16. Sterile acellular dermal collagen as a treatment for rippling deformity of breast.

    PubMed

    Busse, Brittany; Orbay, Hakan; Sahar, David E

    2014-01-01

    Prosthetic implants are frequently used for breast augmentation and breast reconstruction following mastectomy. Unfortunately, long-term aesthetic results of prosthetic breast restoration may be hindered by complications such as rippling, capsular contracture, and implant malposition. The advent of use of acellular dermal matrices has greatly improved the outcomes of prosthetic breast reconstruction. We describe a case of rippling deformity of breast that was treated using an acellular dermal matrix product, AlloMax. The patient presented with visible rippling of bilateral prosthetic breast implants as well as significant asymmetry of the breasts after multiple excisional biopsies for right breast ductal carcinoma in situ. A 6 × 10 cm piece of AlloMax was placed on the medial aspect of each breast between the implant and the skin flap. Follow-up was performed at 1 week, 3 months, and 1 year following the procedure. The patient recovered well from the surgery and there were no complications. At her first postoperative follow-up the patient was extremely satisfied with the result. At her 3-month and 1-year follow-up she had no recurrence of her previous deformity and no new deformity. PMID:25610697

  17. Waning vaccine immunity in teenagers primed with whole cell and acellular pertussis vaccine: recent epidemiology.

    PubMed

    Sheridan, Sarah L; Frith, Katie; Snelling, Thomas L; Grimwood, Keith; McIntyre, Peter B; Lambert, Stephen B

    2014-09-01

    The recent epidemics of pertussis (whooping cough) in parts of the USA and Australia have led to the largest numbers of annual cases reported in over half a century. These epidemics demonstrated a new pattern, with particularly high rates of disease among pre-adolescents and early adolescents. These high rates of pertussis coincided with the first cohorts vaccinated with purely acellular pertussis vaccine, which replaced whole-cell pertussis (wP) vaccine in the later 1990s in the USA and Australia. Studies undertaken during these epidemics provide new evidence of more rapid waning of acellular pertussis-containing vaccines and longer-term protection from effective wP-containing vaccines. There is evidence that receiving wP as at least the first dose of pertussis-containing vaccine provides greater and more long-lived protection, irrespective of the nature of subsequent doses. This evidence will be reviewed together with the immunobiology associated with both vaccines, and the implications for pertussis control discussed. PMID:25093268

  18. Alternatives to HIST for acellular pertussis vaccines: progress and challenges in replacement

    PubMed Central

    Arciniega, J.; Wagner, L.; Prymula, R.; Sebo, P.; Isbrucker, R.; Descampe, B.; Chapsal, J.M.; Costanzo, A.; Hendriksen, C.; Hoonaker, M.; Nelson, S.; Lidster, K.; Casey, W.; Allen, D.

    2016-01-01

    The ‘International Workshop on Alternatives to the Murine Histamine Sensitization Test for Acellular Pertussis Vaccines: Progress and Challenges in the Replacement of HIST’ was held on 24 August 2014, in Prague, Czech Republic, as a satellite meeting to the 9 th World Congress on Alternatives and Animal Use in the Life Sciences. Participants discussed the progress and challenges associated with the development, validation, and implementation of in vitro assays as replacements for the histamine sensitisation test (HIST) for acellular pertussis vaccines. Discussions focused on the consistency approach, the necessary framework for regulatory acceptance of a harmonised method, and recent international efforts towards the development of in vitro assays to replace the HIST. Workshop participants agreed that acceptable alternatives to the HIST should be based on ADP ribosylation-mediated cell intoxication and therefore that the CHO cell clustering assay, which measures cell intoxication, should be further pursued and developed as a possible replacement for the HIST. Participants also agreed to continue ongoing multinational discussions involving national and international standardisation authorities to reach consensus and to organise collaborative studies in this context for assay characterisation and calibration of reference materials. PMID:27506225

  19. Onychomycosis Due to Nondermatophytic Molds

    PubMed Central

    Hwang, Sung Min; Ha, Gyoung Yim

    2012-01-01

    Background Although there have been many studies about onychomycosis due to nondermatophytic molds (NDM), few studies about etiologic agents including NDM in onychomycosis have been reported in Korea. Objective: This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Objective This study investigated onychomycosis due to NDM in the Gyeongju area of Korea. Methods In the 10-year period from 1999~2009, we reviewed 59 patients with onychomycosis due to NDM. The etiologic agents were identified by cultures on Sabouraud's Dextrose agar with and without cycloheximide. In some cases, internal transcribed spacer sequence analysis was done. NDM isolated considered pathogens when the presence of fungal elements was identified by direct microscopy observation and in follow-up cultures yielding the same fungi. Results Onychomycosis due to NDM comprised 2.3% of all onychomycosis. Of the 59 patients with onychomycosis due to NDM, 84.7% were toenail onychomycosis and 15.3% were fingernail onychomycosis. The incidence rate was highest in the fifth decade (27.1%). The ratio of male to female patients was 1:1.6. The frequency of associated diseases, in descending order, was hypertension, diabetes mellitus, and cerebral hematoma. Distal and lateral subungual onychomycosis (86.4%) was the most common clinical type of onychomycosis. Aspergillus spp. was the most frequently isolated etiologic agent of onychomycosis due to NDM (83.0%). Other causative agents were Scopulariopsis brevicaulis (10.2%), Acremonium spp. (3.4%), Fusarium solani (1.7%), and Chaetomium globosum (1.7%). Conclusion Because of the increase in onychomycosis due to NDM, we suggest the need of a careful mycological examination in patients with onychomycosis. PMID:22577268

  20. Development of sheet molding compound solar collectors with molded-in silvered glass reflective surfaces

    SciTech Connect

    Champion, R. L.; Allred, R. E.

    1980-01-01

    An approach to the fabrication of a line-focusng parabolic trough reflector structure which offers the potential of high performance while utilizing mass production type technology with potential for low cost is discussed. The concept is one of a molded structure of fiber reinforced plastic with an integrally molded silvered glass reflective surface. Sheet molding compound (SMC), a mixture of glass fibers and inorganic fillers in polyester resin, has been selected for evaluation as representative of reinforced plastic molding materials. The purpose of the work was to establish the feasibility of molding glass mirrors into SMC structural trough panels. If the effort proved successful, the next stage of development would be demonstration of the structure in a trough collector which incorporates individual SMC reflector panels. The trough has a 2 x 6 m aperture with six individual SMC panels mounted on a torque tube as the main support structure. Results are described. (WHK)

  1. Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites

    SciTech Connect

    Ahmad, Faiz Aslam, Muhammad Altaf, Khurram Shirazi, Irfan

    2015-07-22

    Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Random orientation of fibers was noted in the composites test bars produced from divergent melt flow.

  2. Creating mold-free buildings: a key to avoiding health effects of indoor molds.

    PubMed

    Small, Bruce M

    2003-08-01

    In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing. PMID:15259432

  3. Mathematical modeling of the process of filling a mold during injection molding of ceramic products

    NASA Astrophysics Data System (ADS)

    Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.

    2015-10-01

    Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.

  4. Interposition Porcine Acellular Dermal Matrix Xenograft Successful Alternative in Treatment for Massive Rotator Cuff

    PubMed Central

    Neumann, Julie; Zgonis, Miltiadis H.; Reay, Kathleen Dolores; Mayer, Stephanie W.; Boggess, Blake; Toth, Alison P.

    2016-01-01

    Objectives: Despite advances in the surgical techniques of rotator cuff repair (RCR), the management of massive rotator cuff tears in shoulders without glenohumeral arthritis poses a difficult problem for surgeons. Failure of massive rotator cuff repairs range from 20-90% at one to two years postoperatively using arthrography, ultrasound, or magnetic resonance imaging. Additionally, there are inconsistent outcomes reported with debridement alone of massive rotator cuff tears as well as limitations seen with other current methods of operative intervention including arthroplasty and tendon transfers. The purpose of this prospective, comparative study was to determine if the repair of massive rotator cuff tears using an interposition porcine acellular dermal matrix xenograft improves subjective function, pain, range of motion, and strength at greater than two years follow-up. To our knowledge, this is the largest prospective series reporting outcomes of using porcine acellular dermal matrix xenograft as an interposition graft. Methods: Thirty-seven patients (37 shoulders) with an average age of 66 years (range 51-80 years) were prospectively followed for 33 months (range 23-48) following massive RCR using porcine acellular dermal matrix interposition xenograft. Subjective outcomes were measured using the Visual Analog Scale (VAS) pain score (0-10, 0 = no pain), Modified American Shoulder and Elbow Score (M-ASES), and Short-Form12 (SF-12) scores. Preoperative and postoperative objective outcome measures included active range of motion and supraspinatus and infraspinatus manual muscle strength. Postoperative outcome measures included quantitative muscle strength using a dynamometer and static and dynamic ultrasonography to assess the integrity of the repair. Results: Average VAS pain score decreased from 4.5 to 1.1 (P<0.001). Average postoperative M-ASES was 89.23. Average postoperative SF-12 was 52.6. Mean forward flexion, external and internal rotation significantly

  5. Injection molding simulation with variothermal mold temperature control of highly filled polyphenylene sulfide

    NASA Astrophysics Data System (ADS)

    Birkholz, A.; Tschiersky, M.; Wortberg, J.

    2015-05-01

    For the installation of a fuel cell stack to convert chemical energy into electricity it is common to apply bipolar plates to separate and distribute reaction gases and cooling agents. For reducing manufacturing costs of bipolar plates a fully automated injection molding process is examined. The high performance thermoplastic matrix material, polyphenylene sulfide (PPS), defies against the chemical setting and the operation temperature up to 200 °C. To adjust also high electrical and thermal conductivity, PPS is highly filled with various carbon fillers up to an amount of 65 percentage by volume. In the first step two different structural plates (one-sided) with three different gate heights and molds are designed according to the characteristics of a bipolar plate. To cope with the approach that this plate should be producible on standard injection molding machines with variothermal mold temperature control, injection molding simulation is used. Additionally, the simulation should allow to formulate a quality prediction model, which is transferrable to bipolar plates. Obviously, the basis for a precise simulation output is an accurate description of the material properties and behavior of the highly filled compound. This, the design of the structural plate and mold and the optimization via simulation is presented, as well. The influence of the injection molding process parameters, e.g. injection time, cycle times, packing pressure, mold temperature, and melt temperature on the form filling have been simulated to determine optimal process conditions. With the aid of the simulation and the variothermal mold temperature control it was possible to reduce the required melt temperature below the decomposition temperature of PPS. Thereby, hazardous decomposition products as hydrogen sulfide are obviated. Thus, the health of the processor, the longevity of the injection molding machine as well as the material and product properties can be protected.

  6. AOX in sewer slime -- Identification of industrial wastewater discharges into public sewers

    SciTech Connect

    Antusch, E.; Ripp, C.; Hahn, H.H.

    1995-12-31

    In this study, the authors present the measurements of halogenated organic compounds in sewer slimes. Many of the halogenated organic substances are anthropogenic origin, and, although only some are hazardous, their emission into the natural environment should be avoided. Therefore, the summary parameter AOX has become one of the most important criteria for regulating industrial wastewater discharge in German water quality legislation. The discharge limits have a preventative character, as there is no quantitative relation between the concentration of AOX and its toxicity. If an exceeding value is found in the sewer system, one should look for single components to indicate or to exclude toxic substances. The authors used this method to determine total organic halides as chloride by active carbon adsorption and microcoulometric-titration detection. All samples had been run in duplicate and the reliable limit of sensitivity under these conditions was 5 {micro}g/L. The ``sewer-slime-method`` is explained as a useful tool for localization and identification of indirect discharges.

  7. A morphological adaptation approach to path planning inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-04-01

    Path planning is a classic problem in computer science and robotics which has recently been implemented in unconventional computing substrates such as chemical reaction-diffusion computers. These novel computing schemes utilise the parallel spatial propagation of information and often use a two-stage method involving diffusive propagation to discover all paths and a second stage to highlight or visualise the path between two particular points in the arena. The true slime mould Physarum polycephalum is known to construct efficient transport networks between nutrients in its environment. These networks are continuously remodelled as the organism adapts its body plan to changing spatial stimuli. It can be guided towards attractant stimuli (nutrients, warm regions) and it avoids locations containing hazardous stimuli (light irradiation, repellents, or regions occupied by predatory threats). Using a particle model of slime mould we demonstrate scoping experiments which explore how path planning may be performed by morphological adaptation. We initially demonstrate simple path planning by a shrinking blob of virtual plasmodium between two attractant sources within a polygonal arena. We examine the case where multiple paths are required and the subsequent selection of a single path from multiple options. Collision-free paths are implemented via repulsion from the borders of the arena. Finally, obstacle avoidance is implemented by repulsion from obstacles as they are uncovered by the shrinking blob. These examples show proof-of-concept results of path planning by morphological adaptation which complement existing research on path planning in novel computing substrates.

  8. Catalytic pyrolysis of peat with additions of oil-slime and polymeric waste

    NASA Astrophysics Data System (ADS)

    Sulman, E.; Kosivtsov, Yu.; Sulman, M.; Alfyorov, V.; Lugovoy, Yu.; Chalov, K.; Misnikov, O.; Afanasjev, A.; Kumar, N.; Murzin, D.

    2012-09-01

    In this work the influence of natural and synthetic aluminosilicates, metal chlorides of iron subgroup on the peat low-temperature pyrolysis and co-pyrolysis of peat with oil-slime and polymeric waste was studied in variety of conditions (t = 350-650δC, catalyst loading: from 1 up to 30 % (wt.)). The use of bentonite clay (30 % (wt.)) at 460δC as a catalyst in peat pyrolysis resulted in increase of weight of gaseous and liquid products from 23 up to 30 % (wt.) and from 32 up to 45 % (wt.), respectively. Co-pyrolysis of peat and oil-slime in the presence of bentonite clay resulted in increase of gaseous product weight from 18 up to 26 % (wt.) and liquid fraction yield - from 45 up to 55 % (wt.) in comparison with precalculated value. The use of metal chlorides of iron subgroup (2 % (wt.) concentration) at 500 δC in the co-pyrolysis of peat and polymeric waste led to optimal conversion of substrate in desired products, 15 % increase of total weight of gaseous and liquid products formed during the pyrolysis process and simultaneous decrease of char formation.

  9. Powder Injection Molding of Titanium Components

    SciTech Connect

    Simmons, Kevin L.; Nyberg, Eric A.; Weil, K. Scott; Miller, Megan R.

    2005-01-01

    Powder injection molding (PIM) is a well-established, cost-effective method of fabricating small-to-moderate size metal components. Derived from plastic injection molding and employing a mixture of metal powder and plastic binder, the process has been used with great success in manufacturing a wide variety of metal products, including those made from stainless steel, nickel-based superalloys, and copper alloys. Less progress has been achieved with titanium and other refractory metal alloys because of problems with alloy impurities that are directly attributable to the injection molding process. Specifically, carbon, oxygen, and nitrogen are left behind during binder removal and become incorporated into the chemistry and microstructure of the material during densification. Even at low concentration, these impurities can cause severe degradation in the mechanical properties of titanium and its alloys. We have developed a unique blend of PIM constituents where only a small volume fraction of binder (~5 – 10 vol%) is required for injection molding; the remainder of the mixture consists of the metal powder and binder solvent. Because of the nature of decomposition in the binder system and the relatively small amount used, the binder is eliminated almost completely from the pre-sintered component during the initial stage of a two-step heat treatment process. Results will be presented on the first phase of this research, in which the binder, injection molding, de-binding and sintering schedule were developed. Additional data on the mechanical and physical properties of the material produced will be discussed.

  10. Wet-surface-enhanced ellipsometric contrast microscopy identifies slime as a major adhesion factor during bacterial surface motility.

    PubMed

    Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier

    2012-06-19

    In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces.

  11. Modeling the thin-slab continuous-casting mold

    SciTech Connect

    O'Connor, T.G. . Applied Superconductivity Group); Dantzig, J.A. . Dept. of Mechanical and Industrial Engineering)

    1994-06-01

    A three-dimensional mathematical model has been developed to compute the thermomechanical state in the mold of thin-slab continuous casters. The thin-slab mold differs from those used in conventional slab casters in that the upper portion of the broad side walls defines a funnel-shaped chamber which allows the nozzle to be submerged into the liquid metal. The chamber converges with distance down the mold, reducing to the rectangular cross section of the finished casting near the mold exit. The new mold, along with casting speeds up to 6 m/min, allows slabs to be cast 50--60 mm thick, compared with 150 to 350 mm in conventional continuous slab casting. However, the mold shape and high casting speed lead to higher mold temperatures and shorter mold life than are found in conventional slab casters. In this article, the author develop mathematical models of the process to determine the role of various process parameters in determining the mold life. Finite-element analysis is used to determine the temperatures in the mold and cast slab, and these data are then used in an elastic-viscoplastic analysis to investigate the deformation of the mold wall in service. Cyclic inelastic strains up to 1.75 pct are found in a region below the meniscus along the funnel edge. These large strains result from the combination of locally high temperatures coupled with geometric restraint of the mold. The deformation leads to short mold life because of thermal fatigue cracking of the mold. The computed locations and time to failure of the mold in fatigue agree very well with observations of the appearance of mold surface cracks in an operating caster. The models are also used to develop an improved mold design.

  12. Modeling the thin-slab continuous-casting mold

    NASA Astrophysics Data System (ADS)

    Oconnor, Thomas G.; Dantzig, Jonathan A.

    1994-06-01

    A three-dimensional mathematical model has been developed to compute the thermomechanical state in the mold of thin-slab continuous casters. The thin-slab mold differs from those used in conventional slab casters in that the upper portion of the broad side walls defines a funnel-shaped chamber which allows the nozzle to be submerged into the liquid metal. The chamber converges with distance down the mold, reducing to the rectangular cross section of the finished casting near the mold exit. The new mold, along with casting speeds up to 6 m/min, allows slabs to be cast 50 60 mm thick, compared with 150 to 350 mm in conventional continuous slab casting. However, the mold shape and high casting speed lead to higher mold temperatures and shorter mold life than are found in conventional slab casters. In this article, we develop mathematical models of the process to determine the role of various process parameters in determining the mold life. Finite-element analysis is used to determine the temperatures in the mold and cast slab, and these data are then used in an elastic-viscoplastic analysis to investigate the deformation of the mold wall in service. Cyclic inelastic strains up to 1.75 Pct are found in a region below the meniscus along the funnel edge. These large strains result from the combination of locally high temperatures coupled with geometric restraint of the mold. The deformation leads to short mold life because of thermal fatigue cracking of the mold. The computed locations and time to failure of the mold in fatigue agree very well with observations of the appearance of mold surface cracks in an operating caster. The models are also used to develop an improved mold design.

  13. Method for encapsulating hazardous wastes using a staged mold

    DOEpatents

    Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.

    1989-01-01

    A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.

  14. Development of a silicone transfer molding compound

    SciTech Connect

    Parker, B.G.

    1992-05-01

    Molding compound MS 2072067, designated BRP 50206, is currently used in the manufacture of bobbins and coils. This material was developed as a compression molding compound and is reinforced with 1/4 inch glass fibers. The production yield for coils and bobbins has improved over the years; however, it is still not at a desirable level. A milled glass reinforced version of MS 2072067 silicone molding compound was developed in the laboratory. Milled glass fibers with lengths of 1/32, 1/16, and 1/8 inch were used in place of the 1/4 inch chopped glass fibers in the formulations. The tensile strength, tensile moduli, thermal expansion, and flow properties of these materials were evaluated. These materials exhibited improved flow properties over the existing 1/4 inch glass fiber reinforced material. The new materials also had the same or better tensile strength, as compared to the current production material, and maintained similar thermal expansion characteristics.

  15. Neonatal Ear Molding: Timing and Technique.

    PubMed

    Anstadt, Erin Elizabeth; Johns, Dana Nicole; Kwok, Alvin Chi-Ming; Siddiqi, Faizi; Gociman, Barbu

    2016-03-01

    The incidence of auricular deformities is believed to be ∼11.5 per 10,000 births, excluding children with microtia. Although not life-threatening, auricular deformities can cause undue distress for patients and their families. Although surgical procedures have traditionally been used to reconstruct congenital auricular deformities, ear molding has been gaining acceptance as an efficacious, noninvasive alternative for the treatment of newborns with ear deformations. We present the successful correction of bilateral Stahl's ear deformity in a newborn through a straightforward, nonsurgical method implemented on the first day of life. The aim of this report is to make pediatric practitioners aware of an effective and simple molding technique appropriate for correction of congenital auricular anomalies. In addition, it stresses the importance of very early initiation of ear cartilage molding for achieving the desired outcome.

  16. High rate fabrication of compression molded components

    DOEpatents

    Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.; Smith, Glen L.; Miller, Robert J.

    2016-04-19

    A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; and applying molding pressure to the pre-form to form the composite component.

  17. Human Acellular Dermis versus Submuscular Tissue Expander Breast Reconstruction: A Multivariate Analysis of Short-Term Complications

    PubMed Central

    Davila, Armando A.; Seth, Akhil K.; Wang, Edward; Hanwright, Philip; Bilimoria, Karl; Fine, Neil

    2013-01-01

    Background Acellular dermal matrix (ADM) allografts and their putative benefits have been increasingly described in prosthesis based breast reconstruction. There have been a myriad of analyses outlining ADM complication profiles, but few large-scale, multi-institutional studies exploring these outcomes. In this study, complication rates of acellular dermis-assisted tissue expander breast reconstruction were compared with traditional submuscular methods by evaluation of the American College of Surgeon's National Surgical Quality Improvement Program (NSQIP) registry. Methods Patients who underwent immediate tissue expander breast reconstruction from 2006-2010 were identified using surgical procedure codes. Two hundred forty tracked variables from over 250 participating sites were extracted for patients undergoing acellular dermis-assisted versus submuscular tissue expander reconstruction. Thirty-day postoperative outcomes and captured risk factors for complications were compared between the two groups. Results A total of 9,159 patients underwent tissue expander breast reconstruction; 1,717 using acellular dermis and 7,442 with submuscular expander placement. Total complications and reconstruction related complications were similar in both cohorts (5.5% vs. 5.3%, P=0.68 and 4.7% vs. 4.3%, P=0.39, respectively). Multivariate logistic regression revealed body mass index and smoking as independent risk factors for reconstructive complications in both cohorts (P<0.01). Conclusions The NSQIP database provides large-scale, multi-institutional, independent outcomes for acellular dermis and submuscular breast reconstruction. Both thirty-day complication profiles and risk factors for post operative morbidity are similar between these two reconstructive approaches. PMID:23362476

  18. Mold filling of titanium alloys in two different wedge-shaped molds.

    PubMed

    Shimizu, H; Habu, T; Takada, Y; Watanabe, K; Okuno, O; Okabe, T

    2002-06-01

    Pure titanium and titanium alloys are potential materials for the fabrication of cast dental appliances. One important factor in producing sound castings is the capacity of the metal to fill the mold. This study used a wedge-shaped mold to compare the mold filling of titanium with that of conventional dental casting alloys. The metals used were CP Ti, Ti-6Al-7Nb, Ti-6Al-4V, Ti with 1 and 4wt% Cu and ADA Type III gold alloy and an Ni-Cr alloy. The castings were cut into four pieces parallel to the triangular surface. Mold filling was evaluated as the distance between the tip of the cast wedge and theoretical tip of the triangle. The mold filling of the gold alloy was superior compared to all the metals tested, while the mold filling of the Ni-Cr alloy was the worst. There were no statistical differences at the 30 degrees marginal angle for all the cast titanium metals. At the sharper 15 degrees angle, CP Ti and Ti-6Al-7Nb was superior to both the Ti-Cu alloys. Although the mold filling of titanium was inferior compared to the gold alloy, the data justify the use of titanium for the production of dental appliances.

  19. Numerical recipes for mold filling simulation

    SciTech Connect

    Kothe, D.; Juric, D.; Lam, K.; Lally, B.

    1998-07-01

    Has the ability to simulate the filling of a mold progressed to a point where an appropriate numerical recipe achieves the desired results? If results are defined to be topological robustness, computational efficiency, quantitative accuracy, and predictability, all within a computational domain that faithfully represents complex three-dimensional foundry molds, then the answer unfortunately remains no. Significant interfacial flow algorithm developments have occurred over the last decade, however, that could bring this answer closer to maybe. These developments have been both evolutionary and revolutionary, will continue to transpire for the near future. Might they become useful numerical recipes for mold filling simulations? Quite possibly. Recent progress in algorithms for interface kinematics and dynamics, linear solution methods, computer science issues such as parallelization and object-oriented programming, high resolution Navier-Stokes (NS) solution methods, and unstructured mesh techniques, must all be pursued as possible paths toward higher fidelity mold filling simulations. A detailed exposition of these algorithmic developments is beyond the scope of this paper, hence the authors choose to focus here exclusively on algorithms for interface kinematics. These interface tracking algorithms are designed to model the movement of interfaces relative to a reference frame such as a fixed mesh. Current interface tracking algorithm choices are numerous, so is any one best suited for mold filling simulation? Although a clear winner is not (yet) apparent, pros and cons are given in the following brief, critical review. Highlighted are those outstanding interface tracking algorithm issues the authors feel can hamper the reliable modeling of today`s foundry mold filling processes.

  20. Nickel electroplating for nanostructure mold fabrication.

    PubMed

    Lin, Xiaohui; Dou, Xinyuan; Wang, Xiaolong; Chen, Ray T

    2011-08-01

    We demonstrated a practical process of fabricating nickel molds for nanoimprinting. Dual-side polished glass is chosen as the substrate on which nickel nanostructures are successfully electroplated. Photonic crystal structures with 242 nm diameters and other nanoscale pillars down to 9 nm diameters are achieved over a large area. The electroplating parameters are investigated and optimized. This process extends the feasibility of electroplating process to nanoscale and shows great potential in nanoimprint mold fabrication with its low cost, straightforward process and controllable pattern structures.

  1. Relationship Between Casting Distortion, Mold Filling, and Interfacial Heat Transfer in Sand Molds

    SciTech Connect

    J. K. Parker; K. A. Woodbury; T. S. Piwonka; Y. Owusu

    1999-09-30

    This project sought to determine the relationship between casting dimensions and interfacial heat transfer in aluminum alloy sand castings. The program had four parts; measurement of interfacial heat transfer coefficients in resin bonded and green sand molds, the measurement of gap formation in these molds, the analysis of castings made in varying gatings, orientations and thicknesses, and the measurement of residual stresses in castings in the as-cast and gate removed condition. New values for interfacial heat transfer coefficients were measured, a novel method for gap formation was developed, and the variation of casting dimensions with casting method, gating, and casting orientation in the mold was documented.

  2. MOLD SPECIFIC QUANTITATIVE PCR FOR RAPID IDENTIFICATION AND ENUMERATION

    EPA Science Inventory

    There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...

  3. 27. June 1962 WINDOW JAMB MOLDING DETAILMOLDING CAN BE REMOVED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    27. June 1962 WINDOW JAMB MOLDING DETAIL--MOLDING CAN BE REMOVED BY TURNING WOODEN THUMBSCREWS; WINDOW FRAMES CAN THEN BE REMOVED FOR CLEANING, ETC. - Shaker Church Family Main Dwelling House, U.S. Route 20, Hancock, Berkshire County, MA

  4. MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MOLD MACHINE, BRASS FOUNDRY, USED TO COMPRESS CONDITIONED SAND IN FLASKS OVER PATTERNS TO CREATE MOLD CAVITIES WHICH ARE LATER FILLED WITH MOLTEN BRONZE. - Stockham Pipe & Fittings Company, Brass Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  5. HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE 'SQUEEZING' BOTH HALVES OF A MOLD SURROUNDING A MATCHPLATE PATTERN, DENNIS GRAY OPERATOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  6. Looking east inside of the ingot mold stripeer building at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Looking east inside of the ingot mold stripeer building at a mold being stripped from an ingot. - U.S. Steel Edgar Thomson Works, 44" Slab Mill, Along Monongahela River, Braddock, Allegheny County, PA

  7. 20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  8. INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    INTERIOR VIEW WITH CORE SET IN MOLD HALF IN BOX FLOOR AREA. AWAITING OTHER MOLD HALF TO BE PLACED ON TOP. - Stockham Pipe & Fittings Company, Ductile Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  9. 19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. INTERIOR VIEW WITH IRON POURERS FILLING COMPLETED MOLDS ON GREY IRON UNIT NO. 1 MOLD CONVEYOR. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  10. TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  11. 56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA

  12. Analysis of cracking in glass molds made of cast iron

    NASA Astrophysics Data System (ADS)

    Leushin, I. O.; Chistyakov, D. G.

    2014-09-01

    The cracking in the parts of cast iron molds intended for glass is considered, and this cracking substantially affects the operation of glass-blowing equipment, maintainability, and the replacement of mold sets. The processes that cause cracking in the parts of glass molds and initiate crack growth are studied.

  13. Improved mold release for filled-silicone compounds

    NASA Technical Reports Server (NTRS)

    Accountius, O. E.

    1973-01-01

    Ceramic and filled-plastic materials used for fabrication of tiles are relatively brittle and easily break as they are being removed from molds. Dusting mold surfaces with commercially available glass microspheres provides mold release superior to existing spray releases. Glass-microsphere dusting also permits removal of uncured tile which has very little strength.

  14. 17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. INTERIOR VIEW WITH GREY UNIT NO. 1 MOLD CONVEYOR SHOWING CHAIN HELD WEIGHTS THAT TRAVEL AT THE SAME SPEED AS THE CONVEYOR AND REST ON COMPLETED MOLDS TO HOLD THE SAND SEAMS TOGETHER AS MOLTED IRON IS POURED INTO THE MOLD CAVITY. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  15. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  16. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  17. 21 CFR 874.3430 - Middle ear mold.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Middle ear mold. 874.3430 Section 874.3430 Food... DEVICES EAR, NOSE, AND THROAT DEVICES Prosthetic Devices § 874.3430 Middle ear mold. (a) Identification. A middle ear mold is a preformed device that is intended to be implanted to reconstruct the middle...

  18. HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HUNTER 20 MATCHPLATE MOLDING MACHINE, OPERATING THE SAME AS THE HUNTER 10 AND OTHER HUNTER 20 COMPRESSES BOTH MOLD HALVES OVER A DOUBLE-SIDED MATCH PLATE PATTERN. DENNIS GRAY TESTS A MOLD'S HARDNESS TO ENSURE SAND MIXTURE AND MACHINE COMPRESSIBILITY ARE CORRECT. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL

  19. 1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1928 MALLEABLE FOUNDRY MOLD CONVEYOR #1 SHOWING CONVEYOR AND TRACK ARRANGEMENTS WITH OVERHEAD POURING WEIGHTS THAT REST ON A MOLD'S TOP SURFACE TO ENSURE THAT IRON DOES NOT FLOW OUT OF THE MOLD WHEN IT IS BEING POURED THROUGH THE OPENING IN THE WEIGHT. - Stockham Pipe & Fittings Company, Malleable Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  20. 14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. INTERIOR VIEW WITH JOHNNY TAYLOR REMOVING A MOLD HALF FROM THE PATTERN ON THE MOLDING MACHINE, REVEALING THE CAVITY THAT WILL BE FILLED WITH MOLTEN IRON AFTER IT IS ASSEMBLED WITH THE OTHER MOLD HALF INSIDE GREY IRON UNIT NO. 1. - Stockham Pipe & Fittings Company, Grey Iron Foundry, 4000 Tenth Avenue North, Birmingham, Jefferson County, AL

  1. Multiple polypeptides immunologically related to beta-poly(L-malate) hydrolase (polymalatase) in the plasmodium of the slime mold Physarum polycephalum.

    PubMed

    Karl, M; Holler, E

    1998-01-15

    Plasmodia of Physarum polycephalum contain large amounts of the cell-type-specific polyanion beta-poly(L-malate) and of a corresponding specific hydrolase (polymalatase), both expressed in the plasmodial form of the organism. We have partially purified polymalatase, the preparation consisting of several polypeptides, which could not be separated without destroying the hydrolase activity. Polypeptides of 68 kDa and 97 kDa were identified as polymalatases. Both were glycosylated, the 68-kDa form giving rise to a 54-kDa form when deglycosylated, and the 97-kDa form giving rise to an 88-kDa polypeptide that was indistinguishable from an 88-kDa inactive species also contained in the enzyme preparation. Antisera against each of these proteins were used to detect the intracellular distribution of the proteins. We found that the antisera crossreacted with the three proteins and, furthermore, with a multiplicity of polypeptides ubiquitously distributed over the plasmodium. Results of a two-dimensional non-denaturing in the first dimension and SDS-denaturing polyacrylamide gel electrophoresis in the second dimension suggested that the proteins were derived from a 200-kDa 'precursor' protein by proteolytic fragmentation. Polymalatase activity could be generated from a high molecular-mass precursor. According to several pieces of evidence, the proteolytic nicking occurred within plasmodia. The fragments were sticky and gave rise to preferred sizes of nicked macromolecules. The observed multiplicity varied as a function of the age of the cultures. The cellular distribution and the intracellular pH value were not compatible with an in situ polymalatase activity and suggested other, presently unknown, function(s) such as in the transportation of beta-poly(L-malate) from the nucleus to the culture medium.

  2. Alterations of nuclear DNA synthesis after irradiation of the cellular slime mold Dictyostelium discoideum: studies performed in a mutant strain displaying enhanced thymidine uptake

    SciTech Connect

    Hurley, D.L.

    1986-01-01

    The auxotrophic Dictyostelium discoideum strain HPS 401 was studied. Thymidine at 8 ..mu..g/ml or thymidylate at 50 ..mu..g/ml supported growth to maximal cell densities. Thin layer chromatography of cell extracts showed rapid intracellular accumulation of thymidine in HPS 401 vs slightly detectable accumulation in wild-type cells. Measurements showed that methionine and thymidylate were taken into all strains at a low rate, but HPS 401 had enhanced uptake of thymidine and uridine compared to wild-type. The HPS 401 phenotype is due to the efficient utilization of thymidine as a result of increased nucleoside uptake. Rapid nuclear purification removed mitochondrial DNA without decreasing the single-strand molecular weight of the nuclear DNA. The nuclear DNA peaks on alkaline sucrose gradients were identified using filter hybridization to cloned probes. As measured by pulse-chase labelling, production of full-sized main band DNA required 45-50 minutes. Pulse labelling of the cells immediately after ultraviolet irradiation caused the single-strand molecular weight of the DNA synthesized to decrease from 8 x 10/sup 6/ daltons at O J/m/sup 2/ to 3.9 x 10/sup 6/ daltons at 50 J/m/sup 2/ to 2.6 x 10/sup 6/ daltons at 200 J/m/sup 2/. The time required for maturation into full-sized DNA increased from 1 hour at O J/m/sup 2/ to 4 hours at 20 J/m/sup 2/ and to 21 hours at 200 J/m/sup 2/. Measured amounts of DNA synthesis at times after ultraviolet irradiation showed a period of reduced incorporation, followed by the resumption of control levels. The lag period ended at the same time as the production of full-sized DNA resumed.

  3. Parasexual recombination in Dictyostelium discoideum: selection of stable diploid heterozygotes and stable haploid segregants (clones-temperature sensitive-ploidy-fruiting bodies-spore-slime mold).

    PubMed

    Katz, E R; Sussman, M

    1972-02-01

    Haploid strains of Dictyostelium discoideum bearing temperature-sensitive mutations have been used to select stable diploid, heterozygotic clones, which arise at low frequency (about 10(-5)). Segregants arise from such diploids at low frequency (about 10(-3)). The diploids were heterozygous for resistance to cycloheximide and were phenotypically sensitive to the drug. Growth of the diploid cells in the presence of cycloheximide automatically selected those segregants bearing the resistant allele, and facilitated examination of the assortment of unselected markers. The combination of the two selective methods provides a workable system of genetic analysis in this species. We have used this method to locate six markers on three different linkage groups.

  4. Studies on ribosomal proteins in the cellular slime mold Dictyostelium discoideum. Resolution, nomenclature and molecular weights of proteins in the 40-S and 60-S ribosomal subunits.

    PubMed

    Ramagopal, S; Ennis, H L

    1980-04-01

    This study is concerned with the identification and subunit localization of ribosomal proteins in Dictyostelium discoideum. The characterization is based on the resolution of ribosomal proteins by various methods of electrophoresis. 34 and 42 unique proteins were identified in the 40-S and 60-S ribosomal subunits respectively. The total mass of proteins in the 40-S subunit was 746,100 daltons and 981,900 daltons in the 60-S subunit. The molecular weights of individual proteins in the 40-S subunit ranged from 13,200 to 40,900 with a number-average molecular weight of 21,900. The molecular weight range for the 60-S subunit was 13,800--51,100 with a number-average molecular weight of 23,400. The 80-S ribosome contained 78 proteins, two of which were lost upon its dissociation into subunits. All the proteins of the 40-S and 60-S subunits could be identified individually in a 80-S map as well as in unfractionated proteins from whole cells. Purification of ribosomes in high-ionic-strength buffers resulted in non-specific loss of the various proteins from the 40-S and 60-S subunits. In addition, the undissociated ribosomes contained about 10 acidic proteins in the molecular weight range 50,000--100,000, which were retained after washing the ribosomes in high-salt buffers. They were found in polysomes, run-off ribosomes and could also be identified in the 40-S subunit after dissociation.

  5. Antisense RNA inactivation of gene expression of a cell-cell adhesion protein (gp64) in the cellular slime mold Polysphondylium pallidum.

    PubMed

    Funamoto, S; Ochiai, H

    1996-05-01

    The gp64 protein of Polysphondylium pallidum has been shown to mediate EDTA-stable cell-cell adhesion. To explore the functional role of gp64, we made an antisense RNA expression construct designed to prevent the gene expression of gp64; the construct was introduced into P. pallidum cells and the transformants were characterised. The antisense RNA-expressing clone L3mc2 which had just been harvested at the growth phase tended to re-form in aggregates smaller in size than did the parental cells in either the presence or absence of 10 mM EDTA. In contrast, 6.5-hour starved L3mc2 cells remained considerably dissociated from each other after 5 minutes gyrating, although aggregation gradually increased by 50% during a further 55 minutes gyrating in the presence of 10 mM EDTA. Correspondingly, L3mc2 lacked specifically the cell-cell adhesion protein, gp64. We therefore conclude that the gp64 protein is involved in forming the EDTA-resistant cell-cell contact. In spite of the absence of gp64, L3mc2 exhibited normal developmental processes, a fact which demonstrates that another cell-cell adhesion system exists in the development of Polysphondylium. This is the first report in which an antisense RNA technique was successfully applied to Polysphondylium. PMID:8743948

  6. Effective management of major lower extremity wounds using an acellular regenerative tissue matrix: a pilot study.

    PubMed

    Brigido, Stephen A; Boc, Steven F; Lopez, Ramon C

    2004-01-01

    Wound healing is a significant problem in orthopedics. Graftjacket tissue matrix (Wright Medical Technology, Inc, Arlington, Tenn), a novel acellular regenerative tissue matrix, has been designed to aid wound closure. A prospective, randomized study was initiated to determine the efficacy of this tissue product in wound repair compared with conventional treatment. Lower extremity wounds are refractile to healing in patients with diabetes mellitus. Therefore, researchers used diabetic foot ulcers to evaluate the efficacy of GraftJacket tissue matrix in wound repair. Only a single administration of the tissue matrix was required. After 1 month of treatment, preliminary results demonstrate that this novel tissue matrix promotes faster healing at a statistically significant rate over conventional treatment. Because wounds in this series of patients are deep and circulation around the wound is poor, the preliminary results suggest that this tissue matrix will be applicable to other types of orthopedic wounds.

  7. Tissue-engineered acellular small diameter long-bypass grafts with neointima-inducing activity.

    PubMed

    Mahara, Atsushi; Somekawa, Shota; Kobayashi, Naoki; Hirano, Yoshiaki; Kimura, Yoshiharu; Fujisato, Toshiya; Yamaoka, Tetsuji

    2015-07-01

    Researchers have attempted to develop efficient antithrombogenic surfaces, and yet small-caliber artificial vascular grafts are still unavailable. Here, we demonstrate the excellent patency of tissue-engineered small-caliber long-bypass grafts measuring 20-30 cm in length and having a 2-mm inner diameter. The inner surface of an acellular ostrich carotid artery was modified with a novel heterobifunctional peptide composed of a collagen-binding region and the integrin α4β1 ligand, REDV. Six grafts were transplanted in the femoral-femoral artery crossover bypass method. Animals were observed for 20 days and received no anticoagulant medication. No thrombogenesis was observed on the luminal surface and five cases were patent. In contrast, all unmodified grafts became occluded, and severe thrombosis was observed. The vascular grafts reported here are the first successful demonstrations of short-term patency at clinically applicable sizes. PMID:25941782

  8. Tetanus-diphtheria-acellular pertussis vaccination of adults in the USA.

    PubMed

    Gidengil, Courtney A; Sandora, Thomas J; Lee, Grace M

    2008-07-01

    Pertussis is an important cause of morbidity and mortality, and its incidence has been increasing in adolescents and adults over the past two decades. Waning immunity in adolescents and adults may be partially responsible. Adults can suffer significant illness from pertussis and its complications, such as pneumonia, rib fractures and syncope. Moreover, adults serve as a source of disease for infants, who are more vulnerable to severe complications and even death. The economic burden of pertussis is substantial, in terms of both medical and nonmedical costs. Fortunately, the burden of pertussis disease can now be safely and effectively reduced by vaccinating adults with tetanus-diphtheria-acellular pertussis (Tdap) vaccine. Further research is needed to elucidate the role of vaccination in pregnant women and those over 65 years of age, and also to determine whether further booster doses of Tdap are needed.

  9. Immune Responses to Pertussis Antigens in Infants and Toddlers after Immunization with Multicomponent Acellular Pertussis Vaccine

    PubMed Central

    Wang, Li; Chen, Qingxia

    2014-01-01

    Given the resurgence of pertussis despite high rates of vaccination with the diphtheria-tetanus-acellular pertussis (DTaP) vaccine, a better understanding of vaccine-induced immune responses to Bordetella pertussis is needed. We investigated the antibody, cell-mediated, and cytokine responses to B. pertussis antigens in children who received the primary vaccination series (at 2, 4, and 6 months) and first booster vaccination (at 15 to 18 months) with 5-component acellular pertussis (aP) vaccine. The majority of subjects demonstrated a 4-fold increase in antibody titer to all four pertussis antigens (pertussis toxin [PT], pertactin [PRN], filamentous hemagglutinin [FHA], and fimbriae [FIM]) following the primary series and booster vaccination. Following the primary vaccine series, the majority of subjects (52 to 67%) mounted a positive T cell proliferative response (stimulation index of ≥3) to the PT and PRN antigens, while few subjects (7 to 12%) mounted positive proliferative responses to FHA and FIM. One month after booster vaccination (age 16 to 19 months), our study revealed significant increase in gamma interferon (IFN-γ) production in response to the PT and FIM antigens, a significant increase in IL-2 production with the PT, FHA, and PRN antigens, and a lack of significant interleukin-4 (IL-4) secretion with any of the antigens. While previous reports documented a mixed Th1/Th2 or Th2-skewed response to DTaP vaccine in children, our data suggest that following the first DTaP booster, children aged 16 to 19 months have a cytokine profile consistent with a Th1 response, which is known to be essential for clearance of pertussis infection. To better define aP-induced immune responses following the booster vaccine, further studies are needed to assess cytokine responses pre- and postbooster in DTaP recipients. PMID:25253666

  10. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  11. Physiological distal drift in rat molars contributes to acellular cementum formation.

    PubMed

    Tsuchiya, Shinobu; Tsuchiya, Masahiro; Nishioka, Takashi; Suzuki, Osamu; Sasano, Yasuyuki; Igarashi, Kaoru

    2013-08-01

    Occlusal forces may induce the physiological teeth migration in humans, but there is little direct evidence. Rat molars are known to migrate distally during aging, possibly caused by occlusal forces. The purpose of this study was to determine if a reduction in occlusion would decrease teeth migration and affect associated periodontal structures such as cementum. To reduce occlusal forces, the right upper first molar (M1) in juvenile rats was extracted. The transition of the position of upper second molar (M2) and formation of M2 cementum was followed during aging. From the cephalometric analyses, upper M2 was located more anterior compared with the original position with aging after M1 extraction. Associated with this "slowing-down" of the physiological drift, cementum thickness on distal surface, but not on mesial surface, of M2 root was significantly increased. The accumulation of alizarin red as vital stain indicative of calcification, was observed in the distal cementum of M2 root only on the side of M1 extraction. Extraction of M1 that results in less functional loading, distinctly attenuates the physiological drift only in the upper dentition. The decreased physiological drift appears to activate acellular cementum formation only on distal surface of M2 root, perhaps due to reduced mechanical stress associated with the attenuated distal drift. In conclusion, the physiological distal drift in rat molars appears to be largely driven by the occlusal force and also affects the formation of acellular cementum. These findings provide additional direct evidence for an important role of occlusal forces in tooth migration. PMID:23775928

  12. Experimental Determination of Heat Transfer Within the Metal/Mold Gap in a DC Casting Mold: Part II. Effect of Casting Metal, Mold Material, and Other Casting Parameters

    NASA Astrophysics Data System (ADS)

    Prasad, Arvind; Bainbridge, Ian F.

    2013-07-01

    Extensive experimental studies were conducted to quantify the effect of different parameters that can affect the heat transfer from the metal to the mold during the steady-state phase of DC casting. In the first part previously published, the experimental technique was established and results were reported for the effect of gas type (atmosphere within the mold) and the gap between the metal and the mold. The results showed the significant effect of gas thermal conductivity and the metal-mold gap on the mold wall heat transfer coefficient. In this second publication on heat transfer in the mold wall region of a DC casting mold, the results from the effect of casting temperature, gas flow rate, casting alloy, mold material, and the mold insert material on the mold wall heat transfer coefficient are described. The experiments reported in the current paper show that these additional factors tested do not affect the heat flux through the mold wall to the same extent as the gap size or the gas type. The heat transfer coefficient changes by less than 5 pct when casting temperature is changed by ±25 K, less than 15 pct when the gas flow rate within the metal-mold gap flows at up to 3 LPM, and approximately 30 pct when the mold material is changed from stainless steel to AA601 to copper. Similar results were obtained when different insert materials were used. These results are explained with the help of an electrical analogy of heat transfer and are consistent with the heat transfer theory.

  13. Molding cork sheets to complex shapes

    NASA Technical Reports Server (NTRS)

    Sharpe, M. H.; Simpson, W. G.; Walker, H. M.

    1977-01-01

    Partially cured cork sheet is easily formed to complex shapes and then final-cured. Temperature and pressure levels required for process depend upon resin system used and final density and strength desired. Sheet can be bonded to surface during final cure, or can be first-formed in mold and bonded to surface in separate step.

  14. Illinois Occupational Skill Standards: Plastics Molding Cluster.

    ERIC Educational Resources Information Center

    Illinois Occupational Skill Standards and Credentialing Council, Carbondale.

    This document, which is intended to serve as a guide for work force preparation program providers, details the Illinois occupational skill standards for programs preparing students for employment in jobs in the plastics molding industry. Agency partners involved in this project include: the Illinois State Board of Education, Illinois Community…

  15. Foundry air contaminants from green sand molds.

    PubMed

    Scott, W D; James, R H; Bates, C E

    1976-06-01

    The major gases evolved from foundry molds have been determined in the laboratory. The principal gases evolved during pouring and shakeout of castings include hydrogen, carbon monoxide, carbon dioxide, methane and other low molecular weight hydrocarbons with smaller amounts of ammonia, hydrogen cyanide, and sulfur dioxide. PMID:937172

  16. Bell X-5 Model and Molds

    NASA Technical Reports Server (NTRS)

    1953-01-01

    A Langley model maker examines the molds used to form a model of the Bell X-5, a variable sweep craft that first flew in June of 1951. Photograph published in Winds of Change, 75th Anniversary NASA publication (page 64), by James Schultz.

  17. Contamination of PDMS microchannels by lithographic molds.

    PubMed

    Bubendorfer, Andrea J; Ingham, Bridget; Kennedy, John V; Arnold, W Mike

    2013-11-21

    By use of synchrotron X-ray fluorescence and Rutherford backscattering spectrometry, we show the SU-8 soft lithographic process contaminates PDMS. Residues of the antimony containing photoinitiator are transferred from the master mold to the surface of PDMS, uncontrollably intensifying the surface potential, leading to electroosmotic flow variability in PDMS microfluidic devices. PMID:24080639

  18. Flexible Interior-Impression-Molding Tray

    NASA Technical Reports Server (NTRS)

    Anders, Jeffrey E.

    1991-01-01

    Device used inside combustion chamber of complicated shape for nondestructive evaluation of qualities of welds, including such features as offset, warping, misalignment of parts, and dropthrough. Includes flexible polypropylene tray trimmed to fit desired interior surface contour. Two neodymium boron magnets and inflatable bladder attached to tray. Tray and putty inserted in cavity to make mold of interior surface.

  19. Resin transfer molding speeds composite making

    NASA Astrophysics Data System (ADS)

    Valenti, Michael

    1992-11-01

    Fabrication resin transfer molding (RTM) composite parts for different industrial applications is discussed. These applications include composite aerospace parts, sports car components, and high performance sporting equipment. It is pointed out that RTM parts are lighter than metals and can be formulated to have superior durability. But like all composite parts, they are expensive and are made in limited runs.

  20. Molding Compound For Inspection Of Internal Contours

    NASA Technical Reports Server (NTRS)

    Adams, Jim; Ricklefs, Steve

    1988-01-01

    Material clean, sets rapidly, and easy to use. Silicone elastomer, Citrocon or equivalent, commonly used in dentistry, in combination with mold-release agent (Also see MFS-29240), speeds and facilitates making of impressions of interior surfaces so surface contours examined. Elastomer easily moved around in cavity until required location found.