Slimeware: engineering devices with slime mold.
Adamatzky, Andrew
2013-01-01
The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic.
Physarum attraction: Why slime mold behaves as cats do?
Adamatzky, Andrew; Costello, Ben De Lacy
2012-05-01
We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms.
Gravity related behavior of the acellular slime mold Physarum polycephalum (7-IML-1)
NASA Technical Reports Server (NTRS)
Block, I.
1992-01-01
The objective of the experiment is to investigate the effect of near weightlessness on a single cell. The test object is the acellular slime mold Physarum polycephalum. This cell is composed of a network of protoplastic strands which perform rhythmic contractions in the minute range. These contractions of the strands' ectoplastic walls generate the force to drive the vigorous shuttle streaming of fluid protoplasm inside the strands (hydrostatic pressure flow). A net transport of protoplasm in one direction determines the direction of the cell's locomotion itself. In this way, gravity modifies the contraction rhythm of the strands, the streaming velocity of protoplasm in the strands, and the direction of locomotion of the whole slime mold (geotaxis). The other parts of this experiment will address the major question of how this cell, which does not possess any specialized gravireceptors, gets the information about the direction of the gravity vector. Details of the experimental setup are given.
Physarum attraction: Why slime mold behaves as cats do?
Adamatzky, Andrew; Costello, Ben De Lacy
2012-01-01
We discuss potential chemical substances responsible for attracting acellular slime mold Physarun polycephalum to valerian root. The contributes toward fundamental research into pheromones and chemo-attracts of primitive organisms such as slime molds. The results show that significant information could be gained about the action of compounds on higher organisms. PMID:22896798
Extended Eden model reproduces growth of an acellular slime mold.
Wagner, G; Halvorsrud, R; Meakin, P
1999-11-01
A stochastic growth model was used to simulate the growth of the acellular slime mold Physarum polycephalum on substrates where the nutrients were confined in separate drops. Growth of Physarum on such substrates was previously studied experimentally and found to produce a range of different growth patterns [Phys. Rev. E 57, 941 (1998)]. The model represented the aging of cluster sites and differed from the original Eden model in that the occupation probability of perimeter sites depended on the time of occupation of adjacent cluster sites. This feature led to a bias in the selection of growth directions. A moderate degree of persistence was found to be crucial to reproduce the biological growth patterns under various conditions. Persistence in growth combined quick propagation in heterogeneous environments with a high probability of locating sources of nutrients.
Extended Eden model reproduces growth of an acellular slime mold
NASA Astrophysics Data System (ADS)
Wagner, Geri; Halvorsrud, Ragnhild; Meakin, Paul
1999-11-01
A stochastic growth model was used to simulate the growth of the acellular slime mold Physarum polycephalum on substrates where the nutrients were confined in separate drops. Growth of Physarum on such substrates was previously studied experimentally and found to produce a range of different growth patterns [Phys. Rev. E 57, 941 (1998)]. The model represented the aging of cluster sites and differed from the original Eden model in that the occupation probability of perimeter sites depended on the time of occupation of adjacent cluster sites. This feature led to a bias in the selection of growth directions. A moderate degree of persistence was found to be crucial to reproduce the biological growth patterns under various conditions. Persistence in growth combined quick propagation in heterogeneous environments with a high probability of locating sources of nutrients.
Wada, Fumitaka; Hasegawa, Hiroki; Nakamura, Akio; Sugimura, Yoshiaki; Kawai, Yoshiki; Sasaki, Narie; Shibata, Hideki; Maki, Masatoshi; Hitomi, Kiyotaka
2007-06-01
Transglutaminases are Ca(2+)-dependent enzymes that post-translationally modify proteins by crosslinking or polyamination at specific polypeptide-bound glutamine residues. Physarum polycephalum, an acellular slime mold, is the evolutionarily lowest organism expressing a transglutimase whose primary structure is similar to that of mammalian transglutimases. We observed transglutimase reaction products at injured sites in Physarum macroplasmodia upon mechanical damage. With use of a biotin-labeled primary amine, three major proteins constituting possible transglutimase substrates were affinity-purified from the damaged slime mold. The purified proteins were Physarum actin, a 40 kDa Ca(2+)-binding protein with four EF-hand motifs (CBP40), and a novel 33 kDa protein highly homologous to the eukaryotic adenine nucleotide translocator, which is expressed in mitochondria. Immunochemical analysis of extracts from the damaged macroplasmodia indicated that CBP40 is partly dimerized, whereas the other proteins migrated as monomers on SDS/PAGE. Of the three proteins, CBP40 accumulated most significantly around injured areas, as observed by immunofluoresence. These results suggested that transglutimase reactions function in the response to mechanical injury.
Potential sites for the perception of gravity in the acellular slime mold Physarum polycephalum.
Block, I; Briegleb, W
1989-01-01
Recently a gravisensitivity of the acellular slime mold Physarum polycephalum, which possesses no specialized gravireceptor, could be established by conducting experiments under simulated and under real near weightlessness. In these experiments macroplasmodia showed a modulation of their contraction rhythm followed by regulation phenomena. Until now the perception mechanism for the gravistimulus is unknown, but several findings indicate the involvement of mitochondria: A) During the impediment of respiration the 0g-reaction is inhibited and the regulation is reduced. B) The response to a light stimulus and the following regulation phenomena strongly resemble the behavior during exposure to 0g, the only difference is that the two reactions are directed into opposite directions. In the blue-light reaction a flavin of the mitochondrial matrix seems to be involved in the light perception. C) The contraction rhythm as well as its modulations are coupled to rhythmic changes in the levels of ATP and calcium ions, involving the mitochondria as sites of energy production and of Ca(++)-storage. So the mitochondria could be the site of the regulation and they possibly are the receptor sites for the light and gravity stimuli. Also the observation of a morphologic polarity of the slime mold's plasmodial strands has to be considered: Cross-sections reveal that the ectoplasmic wall surrounding the streaming endoplasm is much thinner on the physically lower side than on the upper side of the strand--this applies to strands lying on or hanging on a horizontal surface. So, in addition to the mitochondria, also the morphologic polarity may be involved in the perception mechanism of the observed gravisensitivity and of the recently established geotaxis. The potential role of the nuclei and of the contractile elements in the perception of gravity is also discussed.
Adamatzky, Andrew I
2014-01-01
A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and
NUTRITION OF CELLULAR SLIME MOLDS I.
Hohl, Hans-Rudolf; Raper, Kenneth B.
1963-01-01
Hohl, Hans-Rudolf (University of Wisconsin, Madison) and Kenneth B. Raper. Nutrition of cullular slime molds. I. Growth on living and dead bacteria. J. Bacteriol. 85:191–198. 1963.—Methods for growing selected species of cellular slime molds in liquid culture on living and dead bacteria are described. Species investigated included Polysphondylium pallidum, P. violaceum, Dictyostelium discoideum, and D. purpureum. Maximal growth of myxamoebae occurred in suspensions of 1010 living bacteria (Escherichia coli B/r)/ml in Sörensen's phosphate buffer (pH 6.0), reaching a density of 107 to 2 × 107 cells/ml in 48 hr. The generation time for the different slime molds ranged from 2.4 hr for P. violaceum to 2.9 hr for D. discoideum (strain V-12). Good growth of P. pallidum occurred between pH 3.6 and 7.8. The slime molds grew less well on dead (autoclaved) than on living bacteria and, except for P. pallidum, the amount and rate of growth decreased markedly as the time of autoclaving was increased from 2.5 to 80 min. Bacteria killed with propylene oxide supported growth equal to those autoclaved for a few minutes. The myxamoebae were very sensitive to the osmotic pressure of the culture medium, especially in the presence of living bacteria, and addition of as little as 0.01 m NaCl caused a measurable decrease in slime mold growth. The culture techniques employed afford useful methods for investigating the nutritional requirements of the cellular slime molds, and the experiments described provide the bases for subsequent studies relating to the axenic cultivation of these singular microorganisms. Images PMID:13961228
Wada, Fumitaka; Ogawa, Atsuko; Hanai, Yuko; Nakamura, Akio; Maki, Masatoshi; Hitomi, Kiyotaka
2004-11-01
Transglutaminase (TGase) is an enzyme that modifies proteins by crosslinking or polyamination. Physarum polycephalum, an acellular slime mold, is the evolutionally lowest organism that has a mammalian-type transglutaminase. We have cloned a cDNA for Physarum polycephalum TGase (PpTGB), homologous to a previously identified TGase (PpTGA), whose sequence is similar to that of mammalian TGases. PpTGB encodes a primary sequence identical to that of PpTGA except for 11 amino acid residues at the N-terminus. Reverse transcription-PCR and Western blotting analyses showed that both PpTGA and PpTGB are expressed in microplasmodia and macroplasmodia during their life cycle, except for in sporangia. For biochemical characterization, we carried out the ectopical expressions of PpTGA and PpTGB in Dictyostelium discoideum. Subcellular fractionation of these Dictyostelium cells showed that the expressed PpTGA, but not PpTGB, localizes to the membrane fraction. Furthermore, in Physarum, subcellular fractionation and immunostaining indicated specific localization at the plasma membrane in macroplasmodia, while the localization was entirely cytoplasmic in microplasmodia.
A would-be nervous system made from a slime mold.
Adamatzky, Andrew
2015-01-01
The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds.
Introducing the slime mold graph repository
NASA Astrophysics Data System (ADS)
Dirnberger, M.; Mehlhorn, K.; Mehlhorn, T.
2017-07-01
We introduce the slime mold graph repository or SMGR, a novel data collection promoting the visibility, accessibility and reuse of experimental data revolving around network-forming slime molds. By making data readily available to researchers across multiple disciplines, the SMGR promotes novel research as well as the reproduction of original results. While SMGR data may take various forms, we stress the importance of graph representations of slime mold networks due to their ease of handling and their large potential for reuse. Data added to the SMGR stands to gain impact beyond initial publications or even beyond its domain of origin. We initiate the SMGR with the comprehensive Kist Europe data set focusing on the slime mold Physarum polycephalum, which we obtained in the course of our original research. It contains sequences of images documenting growth and network formation of the organism under constant conditions. Suitable image sequences depicting the typical P. polycephalum network structures are used to compute sequences of graphs faithfully capturing them. Given such sequences, node identities are computed, tracking the development of nodes over time. Based on this information we demonstrate two out of many possible ways to begin exploring the data. The entire data set is well-documented, self-contained and ready for inspection at http://smgr.mpi-inf.mpg.de.
Using Cellular Slime Molds in the High School Laboratory
ERIC Educational Resources Information Center
Haskins, P. B.
1977-01-01
Described is the life cycle of the cellular slime molds Acrasiales. Experiments that can be used to explore the aggregation, migration, and culmination activities of the organism are suggested. Laboratory procedures for culturing these slime molds and listings of biological supply houses and literature references are also given. (MA)
Two species of myxomycetes causing slime mold of sweet potato.
Kim, Wan Gyu; Lee, Sang Yeob; Cho, Weon Dae
2007-06-01
Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea.
Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon.
Kim, Wan Gyu; Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon
2009-09-01
Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon.
Two Species of Myxomycetes Causing Slime Mold of Sweet Potato
Lee, Sang Yeob; Cho, Weon Dae
2007-01-01
Specimens collected from sweet potato plants with slime mold symptoms in fields in Daejeon, Korea were examined. Two species of Myxomycetes, Fuligo septica and Stemonitis herbatica were identified based on their morphological characteristics. This is the first report that the two species of Myxomycetes cause slime mold of sweet potato in Korea. PMID:24015079
Occurrence of Fuligo gyrosa Causing Slime Mold of Oriental Melon
Choi, Hyo Won; Hong, Sung Kee; Lee, Young Kee; Lee, Su Heon
2009-01-01
Recently, a severe slime mold infestation affected oriental melon plants in fields in Chilgok county, Gyeongbuk province, Korea. Specimens were collected from the fields and examined for identification. A species of Myxomycetes, Fuligo gyrosa, was identified based on its morphological characteristics. This is the first report that F. gyrosa causes slime mold of oriental melon. PMID:23983540
Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.
ERIC Educational Resources Information Center
Bozzone, Donna M.; Martin, Denise A.
1998-01-01
Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)
Feeding Behaviors in Cellular Slime Molds: A Microbial System To Study Competition.
ERIC Educational Resources Information Center
Bozzone, Donna M.
1997-01-01
Describes a laboratory project for first-year biology students that examines competition among various cellular slime molds. After a brief introduction to the topic of competition and basic life history information about cellular slime molds, students choose a question and design original experiments to seek an answer. (Author/AIM)
Aono, Masashi; Gunji, Yukio-Pegio
2003-10-01
The emergence derived from errors is the key importance for both novel computing and novel usage of the computer. In this paper, we propose an implementable experimental plan for the biological computing so as to elicit the emergent property of complex systems. An individual plasmodium of the true slime mold Physarum polycephalum acts in the slime mold computer. Modifying the Elementary Cellular Automaton as it entails the global synchronization problem upon the parallel computing provides the NP-complete problem solved by the slime mold computer. The possibility to solve the problem by giving neither all possible results nor explicit prescription of solution-seeking is discussed. In slime mold computing, the distributivity in the local computing logic can change dynamically, and its parallel non-distributed computing cannot be reduced into the spatial addition of multiple serial computings. The computing system based on exhaustive absence of the super-system may produce, something more than filling the vacancy.
Slime mold uses an externalized spatial "memory" to navigate in complex environments.
Reid, Chris R; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine
2012-10-23
Spatial memory enhances an organism's navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem--a classic test of autonomous navigational ability commonly used in robotics--requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism's ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms.
Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benichou, J.C.; Quiviger, B.; Ryter, A.
1983-07-01
The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest ofmore » the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.« less
The cellular slime mold: eukaryotic model microorganism.
Urushihara, Hideko
2009-04-01
Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.
Kikuchi, Haruhisa; Kubohara, Yuzuru; Nguyen, Van Hai; Katou, Yasuhiro; Oshima, Yoshiteru
2013-08-01
Cellular slime molds are expected to have the huge potential for producing secondary metabolites including polyketides, and we have studied the diversity of secondary metabolites of cellular slime molds for their potential utilization as new biological resources for natural product chemistry. From the methanol extract of fruiting bodies of Polysphondylium filamentosum, we obtained new chlorinated benzofurans Pf-1 (4) and Pf-2 (5) which display multiple biological activities; these include stalk cell differentiation-inducing activity in the well-studied cellular slime mold, Dictyostelium discoideum, and inhibitory activities on cell proliferation in mammalian cells and gene expression in Drosophila melanogaster. Copyright © 2013 Elsevier Ltd. All rights reserved.
Slime mold uses an externalized spatial “memory” to navigate in complex environments
Reid, Chris R.; Latty, Tanya; Dussutour, Audrey; Beekman, Madeleine
2012-01-01
Spatial memory enhances an organism’s navigational ability. Memory typically resides within the brain, but what if an organism has no brain? We show that the brainless slime mold Physarum polycephalum constructs a form of spatial memory by avoiding areas it has previously explored. This mechanism allows the slime mold to solve the U-shaped trap problem—a classic test of autonomous navigational ability commonly used in robotics—requiring the slime mold to reach a chemoattractive goal behind a U-shaped barrier. Drawn into the trap, the organism must rely on other methods than gradient-following to escape and reach the goal. Our data show that spatial memory enhances the organism’s ability to navigate in complex environments. We provide a unique demonstration of a spatial memory system in a nonneuronal organism, supporting the theory that an externalized spatial memory may be the functional precursor to the internal memory of higher organisms. PMID:23045640
Tiunov, Alexei V; Semenina, Eugenia E; Aleksandrova, Alina V; Tsurikov, Sergey M; Anichkin, Alexander E; Novozhilov, Yuri K
2015-08-30
Data on the bulk stable isotope composition of soil bacteria and bacterivorous soil animals are required to estimate the nutrient and energy fluxes via bacterial channels within detrital food webs. We measured the isotopic composition of slime molds (Myxogastria, Amoebozoa), a group of soil protozoans forming macroscopic spore-bearing fruiting bodies. An analysis of largely bacterivorous slime molds can provide information on the bulk stable isotope composition of soil bacteria. Fruiting bodies of slime molds were collected in a monsoon tropical forest of Cat Tien National Park, Vietnam, and analyzed by continuous-flow isotope ratio mass spectrometry. Prior to stable isotope analysis, carbonates were removed from a subset of samples by acidification. To estimate the trophic position of slime molds, their δ(13) C and δ(15) N values were compared with those of plant debris, soil, microbial destructors (litter-decomposing, humus-decomposing, and ectomycorrhizal fungi) and members of higher trophic levels (oribatid mites, termites, predatory macroinvertebrates). Eight species of slime molds represented by at least three independent samples were 3-6‰ enriched in (13) C and (15) N relative to plant litter. A small but significant difference in the δ(13) C and δ(15) N values suggests that different species of myxomycetes can differ in feeding behavior. The slime molds were enriched in (15) N compared with litter-decomposing fungi, and depleted in (15) N compared with mycorrhizal or humus-decomposing fungi. Slime mold sporocarps and plasmodia largely overlapped with oribatid mites in the isotopic bi-plot, but were depleted in (15) N compared with predatory invertebrates and humiphagous termites. A comparison with reference groups of soil organisms suggests strong trophic links of slime molds to saprotrophic microorganisms which decompose plant litter, but not to humus-decomposing microorganisms or to mycorrhizal fungi. Under the assumption that slime molds are
Regulation of aggregate size and pattern by adenosine and caffeine in cellular slime molds
2012-01-01
Background Multicellularity in cellular slime molds is achieved by aggregation of several hundreds to thousands of cells. In the model slime mold Dictyostelium discoideum, adenosine is known to increase the aggregate size and its antagonist caffeine reduces the aggregate size. However, it is not clear if the actions of adenosine and caffeine are evolutionarily conserved among other slime molds known to use structurally unrelated chemoattractants. We have examined how the known factors affecting aggregate size are modulated by adenosine and caffeine. Result Adenosine and caffeine induced the formation of large and small aggregates respectively, in evolutionarily distinct slime molds known to use diverse chemoattractants for their aggregation. Due to its genetic tractability, we chose D. discoideum to further investigate the factors affecting aggregate size. The changes in aggregate size are caused by the effect of the compounds on several parameters such as cell number and size, cell-cell adhesion, cAMP signal relay and cell counting mechanisms. While some of the effects of these two compounds are opposite to each other, interestingly, both compounds increase the intracellular glucose level and strengthen cell-cell adhesion. These compounds also inhibit the synthesis of cAMP phosphodiesterase (PdsA), weakening the relay of extracellular cAMP signal. Adenosine as well as caffeine rescue mutants impaired in stream formation (pde4- and pdiA-) and colony size (smlA- and ctnA-) and restore their parental aggregate size. Conclusion Adenosine increased the cell division timings thereby making large number of cells available for aggregation and also it marginally increased the cell size contributing to large aggregate size. Reduced cell division rates and decreased cell size in the presence of caffeine makes the aggregates smaller than controls. Both the compounds altered the speed of the chemotactic amoebae causing a variation in aggregate size. Our data strongly suggests
Regulation of aggregate size and pattern by adenosine and caffeine in cellular slime molds.
Jaiswal, Pundrik; Soldati, Thierry; Thewes, Sascha; Baskar, Ramamurthy
2012-01-23
Multicellularity in cellular slime molds is achieved by aggregation of several hundreds to thousands of cells. In the model slime mold Dictyostelium discoideum, adenosine is known to increase the aggregate size and its antagonist caffeine reduces the aggregate size. However, it is not clear if the actions of adenosine and caffeine are evolutionarily conserved among other slime molds known to use structurally unrelated chemoattractants. We have examined how the known factors affecting aggregate size are modulated by adenosine and caffeine. Adenosine and caffeine induced the formation of large and small aggregates respectively, in evolutionarily distinct slime molds known to use diverse chemoattractants for their aggregation. Due to its genetic tractability, we chose D. discoideum to further investigate the factors affecting aggregate size. The changes in aggregate size are caused by the effect of the compounds on several parameters such as cell number and size, cell-cell adhesion, cAMP signal relay and cell counting mechanisms. While some of the effects of these two compounds are opposite to each other, interestingly, both compounds increase the intracellular glucose level and strengthen cell-cell adhesion. These compounds also inhibit the synthesis of cAMP phosphodiesterase (PdsA), weakening the relay of extracellular cAMP signal. Adenosine as well as caffeine rescue mutants impaired in stream formation (pde4- and pdiA-) and colony size (smlA- and ctnA-) and restore their parental aggregate size. Adenosine increased the cell division timings thereby making large number of cells available for aggregation and also it marginally increased the cell size contributing to large aggregate size. Reduced cell division rates and decreased cell size in the presence of caffeine makes the aggregates smaller than controls. Both the compounds altered the speed of the chemotactic amoebae causing a variation in aggregate size. Our data strongly suggests that cytosolic glucose and
Material Implementation of Hyperincursive Field on Slime Mold Computer
NASA Astrophysics Data System (ADS)
Aono, Masashi; Gunji, Yukio-Pegio
2004-08-01
"Elementary Conflictable Cellular Automaton (ECCA)" was introduced by Aono and Gunji as a problematic computational syntax embracing the non-deterministic/non-algorithmic property due to its hyperincursivity and nonlocality. Although ECCA's hyperincursive evolution equation indicates the occurrence of the deadlock/infinite-loop, we do not consider that this problem declares the fundamental impossibility of implementing ECCA materially. Dubois proposed to call a computing system where uncertainty/contradiction occurs "the hyperincursive field". In this paper we introduce a material implementation of the hyperincursive field by using plasmodia of the true slime mold Physarum polycephalum. The amoeboid organism is adopted as a computing media of ECCA slime mold computer (ECCA-SMC) mainly because; it is a parallel non-distributed system whose locally branched tips (components) can act in parallel with asynchronism and nonlocal correlation. A notable characteristic of ECCA-SMC is that a cell representing a spatio-temporal segment of computation is occupied (overlapped) redundantly by multiple spatially adjacent computing operations and by temporally successive computing events. The overlapped time representation may contribute to the progression of discussions on unconventional notions of the time.
Smart behavior of true slime mold in a labyrinth.
Nakagaki, T
2001-11-01
Even for humans it is not easy to solve a maze. But the plasmodium of true slime mold, an amoeba-like unicellular organism, has shown an amazing ability to do so. This implies that an algorithm and a high computing capacity are included in the unicellular organism. In this report, we discuss information processing in the microorganism to focus on the issue as to whether the maze-solving behavior is akin to primitive intelligence.
Synthesis of Messenger RNA and Chromosome Structure in the Cellular Slime Mold*
Lodish, Harvey F.; Jacobson, Allan; Firtel, Richard; Alton, Tom; Tuchman, Jessica
1974-01-01
This paper summarizes our knowledge of the structure and biosynthesis of messenger RNA in the slime mold Dictyostelium discoideum, the arrangement of DNA sequences in the Dictyostelium chromosome, and the changes in the pattern of predominant polypeptides synthesized during Dictyostelium development. Images PMID:4531041
Mayne, Richard; Adamatzky, Andrew; Jones, Jeff
2015-01-01
The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently ‘intelligent’ behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton—a ubiquitous cellular protein scaffold whose functions are manifold and essential to life—and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness. PMID:26478782
Mayne, Richard; Adamatzky, Andrew; Jones, Jeff
2015-01-01
The plasmodium of slime mold Physarum polycephalum behaves as an amorphous reaction-diffusion computing substrate and is capable of apparently 'intelligent' behavior. But how does intelligence emerge in an acellular organism? Through a range of laboratory experiments, we visualize the plasmodial cytoskeleton-a ubiquitous cellular protein scaffold whose functions are manifold and essential to life-and discuss its putative role as a network for transducing, transmitting and structuring data streams within the plasmodium. Through a range of computer modeling techniques, we demonstrate how emergent behavior, and hence computational intelligence, may occur in cytoskeletal communications networks. Specifically, we model the topology of both the actin and tubulin cytoskeletal networks and discuss how computation may occur therein. Furthermore, we present bespoke cellular automata and particle swarm models for the computational process within the cytoskeleton and observe the incidence of emergent patterns in both. Our work grants unique insight into the origins of natural intelligence; the results presented here are therefore readily transferable to the fields of natural computation, cell biology and biomedical science. We conclude by discussing how our results may alter our biological, computational and philosophical understanding of intelligence and consciousness.
THE CHANGING PATTERN OF BIREFRINGENCE IN PLASMODIA OF THE SLIME MOLD, PHYSARUM POLYCEPHALUM
Nakajima, Hiromichi; Allen, Robert D.
1965-01-01
Plasmodia of the acellular slime mold, Physarum polycephalum, reveal a complex and changing pattern of birefringence when examined with a sensitive polarizing microscope. Positively birefringent fibrils are found throughout the ectoplasmic region of the plasmodium. In the larger strands they may be oriented parallel to the strand axis, or arranged circularly or spirally along the periphery of endoplasmic channels. Some fibrils exist for only a few minutes, others for a longer period. Some, particularly the circular fibrils, undergo changes in birefringence as they undergo cyclic deformations. In the ramifying strand region and the advancing margin there is a tendency for fibrils of various sizes to become organized into mutually orthogonal arrays. In some plasmodia the channel wall material immediately adjacent to the endoplasm has been found to be birefringent. The sign of endoplasmic birefringence is negative, and its magnitude is apparently constant over the streaming cycle. The pattern of plasmodial birefringence and its changes during the shuttle streaming cycle of Physarum are considered in the light of several models designed to explain either cytoplasmic streaming alone or the entire gamut of plasmodial motions. The results of this and other recent physical studies suggest that both streaming and the various other motions of the plasmodium may very likely be explained in terms of coordinated contractions taking place in the fibrils which are rendered visible in polarized light. PMID:14287186
Moriyama, Yohsuke; Kawano, Shigeyuki
2010-03-01
Direct evidence of digestion of paternal mitochondrial DNA (mtDNA) has been found in the true slime mold Physarum polycephalum. This is the first report on the selective digestion of mtDNA inside the zygote, and is striking evidence for the mechanism of maternal inheritance of mitochondria. Moreover, two mitochondrial nuclease activities were detected in this organism as-candidates for the nucleases responsible for selective digestion of mtDNA. In the true slime mold, there is an additional-feature of the uniparental inheritance of mitochondria.Although mitochondria are believed to be inherited from the maternal lineage in nearly all eukaryotes, the mating types of the true slime mold P. polycephalum is not restricted to two: there are three mating loci--matA, matB,and matC--and these loci have 16, 15, and 3 alleles,-respectively. Interestingly, the transmission patterns of mtDNA are determined by the matA locus, in a hierarchical-fashion (matA hierarchy) as follows: matA7[matA2[matA11[matA12[matA15/matA16[matA1[matA6.The strain possessing the higher status of matA would be the mtDNA donor in crosses. Furthermore, we have found that some crosses showed biparental inheritance of mitochondria.This review describes the phenomenon of hierarchical transmission of mtDNA in true slime molds, and discusses the presumed molecular mechanism of maternal and biparental inheritance.
The Organization of Movement in Slime Mold Plasmodia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, Peter A.
1963-04-22
At first sight, the noncellular slime mold plasmodia appear to be ideal organisms in which to study protoplasmic movement. They are large, easily manipulated, and display high speed protoplasmic streaming. After some experience with them, however, one is likely to become discouraged by the complexity and lability of their movement patterns. While the streaming movements necessarily follow the laws of hydrodynamics, it has not so far been possible to explain them satisfactorily in terms of any simple mechanism. The characteristics of plasmodial streaming which lead to confusion and frustration are outlined below as a substitute for direct observations and cine-photographicmore » records.« less
Mass Culture of a Slime Mold, Physarum polycephalum1
Brewer, E. N.; Kuraishi, S.; Garver, J. C.; Strong, F. M.
1964-01-01
The slime mold, Physarum polycephalum, was cultivated in a soluble natural medium in shake flasks and in 30-liter and 50-gal conventional baffled fermentors. Yields of 6 to 10 g (dry weight) per liter were obtained in the large-scale fermentations. Because of the slow growth of the myxomycete, particular attention had to be paid to aseptic technique. The inability of this organism to withstand the normal degree of agitation employed with most aerobic fermentations made it difficult to obtain adequate aeration. Conditions for growth of the organism on a pilot-plant scale are presented. PMID:14131366
Enteridinines A and B from slime mold Enteridium lycoperdon.
Rezanka, Tomás; Dvoráková, Radmila; Hanus, Lumír O; Dembitsky, Valery M
2004-02-01
Two novel deoxysugar esters, named enteridinines A and B, were isolated from the slime mold Enteridium lycoperdon. Their structures, including the absolute configurations of the hydroxyl and methyl groups, were determined by means of extensive spectroscopic data such as UV, IR, MS, 1D and 2D NMR spectra. Enteridinines A and B have unique structures containing 1,7-dioxaspiro[5.5]undecanes with an O-beta-D-mycarosyl-(1-->4)-beta-D-olivosyl and an O-beta-L-olivomycosyl-(1-->4)-beta-D-amicetosyl-(1-->4)-beta-L-digitoxosyl unit, respectively, and showed growth inhibitory activities against Gram positive bacteria.
Mizukawa, Yuri; Iwasaka, Masakazu
2013-01-01
In the present study, a cellular level response of Cyto-aa3 oxidation was investigated in real time under both time-varying and strong static magnetic fields of 5 T. Two kinds of cells, a slime mold, Physarum polycephalum, and bone forming cells, MC-3T3-E1, were used for the experiments. The oxidation level of the Cyto-aa3 was calculated by optical absorptions at 690 nm, 780 nm and 830 nm. The sample, fiber-optics and an additional optical fiber for light stimulation were set in a solenoidal coil or the bore of a 5-T superconducting magnet. The solenoidal coil for time-varying magnetic fields produced sinusoidal magnetic fields of 6 mT. The slime mold showed a periodic change in Cyto-aa3 oxidation, and the oxidation-reduction cycle of Cyto-aa3 was apparently changed when visible-light irradiated the slime mold. Similarly to the case with light, time-varying magnetic stimulations changed the oxidation-reduction cycle during and after the stimulation for 10 minutes. The same phenomena were observed in the MC-3T3-E1 cell assembly, although their cycle rhythm was comparatively random. Finally, magnetic field exposure of up to 5 T exhibited a distinct suppression of Cyto-aa3 oscillation in the bone forming cells. Exposure up to 5 T was repeated five times, and the change in Cyto-aa3 oxidation reproducibly occurred.
Star Mapping with Slime Mold Physarum Polycephalum
NASA Astrophysics Data System (ADS)
Mihklepp, M.; Domnitch, E.; Gelfand, D.; Foing, B. H.; van der Heide, E.
2014-04-01
Human curiosity and exploration towards outer space has led to many fantastic inventions and given way to alternative scenarios about the origins of life. In the Space Science in the Arts course together with ESTEC with support from ILEWG. I got interested about unicellular slime mold Physarum polycephalum. There has been and still is a lot of research on Physarum polycephalum. This brainless eucaryotic microbe has its smartness and external memory strategies. Physarum can navigate through a maze made of agar using the shortest route possible when two pieces of food are placed at two separate exits of the maze. It can build efficient networks - Physarum created network similar to the existing Tokyo train system. It is being used to control a robot, in USB-sensor and in sound synthesis. Right now there is a lot of research about using Physarum in bio-computing.
Polypropionate lactones of deoxysugars glycosides from slime mold Lycogala epidendrum.
Rezanka, Tomás; Dvoráková, Radmila
2003-08-01
Two novel polypropionate lactone glycosides (1 and 2, i.e. lycogalinosides A and B) were isolated from the slime mold Lycogala epidendrum. Their structures, including the absolute configurations of the hydroxyl and methyls groups, were determined by means of extensive spectroscopic data such as mass, IR, UV, and 1D and 2D NMR spectra and chemical degradation followed by spectroscopic and chromatographic analysis. Compounds 1 and 2 are unique in structure containing a 2-deoxy-alpha-L-fucopyranosyl-(1-4)-6-deoxy-beta-D-gulopyranosyl unit and a beta-D-olivopyranosyl-(1-4)-beta-D-fucopyranosyl unit, respectively, and showed growth inhibitory activities against Gram-positive bacteria.
SEROLOGICAL ANALYSES OF CELLULAR SLIME-MOLD DEVELOPMENT I.
Sonneborn, D. R.; Sussman, M.; Levine, L.
1964-01-01
Sonneborn, D. R. (Brandeis University, Waltham, Mass.), M. Sussman, and L. Levine. Serological analysis of cellular slime-mold development. I. Changes in antigenic activity during cell aggregation. J. Bacteriol. 87:1321–1329. 1964.—During aggregation in Dictyostelium discoideum, the concentration of a single antigenic determinant increased markedly, starting from very low or undetectable levels. Subsequently, the determinant appeared to segregate preferentially into the stalks of terminal fruiting bodies. Sera containing the antibody specific for this determinant inhibited the aggregation of D. discoideum without disturbing cell viability. The properties of the antigen during fractionation are consistent with the supposition that it may be a protein associated with the cell membrane. The ability or inability of three species to coaggregate with D. discoideum was correlated with the presence or absence of the antigenic determinant in aggregates of these species. PMID:14188709
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
NASA Technical Reports Server (NTRS)
Hanely, Julia C.; Reinsch, Sigrid; Myers, Zachary A.; Freeman, John; Steele, Marianne K.; Sun, Gwo-Shing; Heathcote, David G.
2014-01-01
The European Modular Cultivation System, EMCS, was developed by ESA for plant experiments. To expand the use of flight verified hardware for various model organisms, we performed ground experiments to determine whether ARC EMCS Seed Cassettes could be adapted for use with cellular slime mold for future space flight experiments. Dictyostelium is a cellular slime mold that can exist both as a single-celled independent organism and as a part of a multicellular colony which functions as a unit (pseudoplasmodium). Under certain stress conditions, individual amoebae will aggregate to form multicellular structures. Developmental pathways are very similar to those found in Eukaryotic organisms, making this a uniquely interesting organism for use in genetic studies. Dictyostelium has been used as a genetic model organism for prior space flight experiments. Due to the formation of spores that are resistant to unfavorable conditions such as desiccation, Dictyostelium is also a good candidate for use in the EMCS Seed Cassettes. The growth substratum in the cassettes is a gridded polyether sulfone (PES) membrane. A blotter beneath the PES membranes contains dried growth medium. The goals of this study were to (1) verify that Dictyostelium are capable of normal growth and development on PES membranes, (2) develop a method for dehydration of Dictyostelium spores with successful recovery and development after rehydration, and (3) successful mock rehydration experiments in cassettes. Our results show normal developmental progression in two strains of Dictyostelium discoideum on PES membranes with a bacterial food source. We have successfully performed a mock rehydration of spores with developmental progression from aggregation to slug formation, and production of morphologically normal spores within 9 days of rehydration. Our results indicate that experiments on the ISS using the slime mold, Dictyostelium discoideum could potentially be performed in the flight verified hardware of
THE EFFECT OF ACTIDIONE ON MITOSIS IN THE SLIME MOLD PHYSARUM POLYCEPHALUM
Cummins, J. E.; Brewer, E. N.; Rusch, H. P.
1965-01-01
Actidione, reportedly a specific inhibitor of protein synthesis, was found to reduce the incorporation of labeled amino acids into proteins of the slime mold Physarum polycephalum without drastically inhibiting the incorporation of nucleic acid precursors into RNA. This inhibitor was found to completely block the ensuing mitosis if it was added at any time between telophase and late prophase. Plasmodia given Actidione in late prophase (about the time of nucleolar dissolution) went on through telophase to reconstruction even though nuclear amino acid incorporation was drastically reduced during that period. PMID:5894452
Spatiotemporal Symmetry in Rings of Coupled Biological Oscillators of Physarum Plasmodial Slime Mold
NASA Astrophysics Data System (ADS)
Takamatsu, Atsuko; Tanaka, Reiko; Yamada, Hiroyasu; Nakagaki, Toshiyuki; Fujii, Teruo; Endo, Isao
2001-08-01
Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.
Takamatsu, A; Tanaka, R; Yamada, H; Nakagaki, T; Fujii, T; Endo, I
2001-08-13
Spatiotemporal patterns in rings of coupled biological oscillators of the plasmodial slime mold, Physarum polycephalum, were investigated by comparing with results analyzed by the symmetric Hopf bifurcation theory based on group theory. In three-, four-, and five-oscillator systems, all types of oscillation modes predicted by the theory were observed including a novel oscillation mode, a half period oscillation, which has not been reported anywhere in practical systems. Our results support the effectiveness of the symmetric Hopf bifurcation theory in practical systems.
Potassium Loss during Galvanotaxis of Slime Mold
Anderson, John D.
1962-01-01
The posterior reticulated regions of the plasmodia of the slime mold, Physarum polycephalum, whose migration has been oriented by direct current (3.0 to 5.0 µa/mm2 in the agar substrate), contain 30 per cent less potassium than the advancing non-reticulated region. The anterior regions have the same potassium concentration as that of the controls, approximately 32 meq/kg wet weight. Differences in potassium concentration between anterior and posterior regions of control plasmodia, not oriented by electric current, are less than 5 per cent. Sodium, in contrast to potassium, is generally less concentrated in the anterior than in the posterior regions of electrically oriented plasmodia, but sodium concentrations are extremely variable. No significant difference in protein concentration was found between oriented and control plasmodia. Thirty-five per cent of the total potassium, but none of the sodium, is found in acidified ethanol precipitates from plasmodial homogenates. Potassium, but not sodium, appears to be closely associated with processes which differentiate anterior from posterior in an oriented plasmodium. PMID:13861244
Mechanochemical symmetric breaking in cell motility of slime mold
NASA Astrophysics Data System (ADS)
Guy, Robert; Zhang, Shun; Del Alamo, Juan Carlos
2016-11-01
The cytoplasm of the true slime mold Physarum polycephalum exhibits regular rhythmic periodic shuttle streaming though the cell in the direction of motion. The fluid motion is driven by the periodic contraction of an actin-myosin gel that is regulated by a calcium oscillation. When the organism is small (< 100 microns) there is no shuttle streaming, but beyond this size, regular back-and-forth streaming appears and the cell begins to migrate. In this talk we analyze a mechanochemical model of the cell which includes the intracellular fluid, the active contractile cytoskeleton, the adhesion to the substrate, and the dynamics of a chemical oscillator. We use this analysis along with experimental data to identify the instability related to the onset of streaming in order to bring insight into how contraction, flow, and adhesion are coordinated during locomotion.
Nowak, Alexander; Steffan, Bert
1998-12-04
Illumination results in increased formation of metabolites 1 and 2 in the plasmodia of the slime mold Physarum polycephalum. This was determined from HPLC studies undertaken in the search for the photoactive substances involved in the "blue-light phenomenon". The isolation and structure elucidation of 1 and 2 is described. © 1998 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.
Fully decentralized control of a soft-bodied robot inspired by true slime mold.
Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio
2010-03-01
Animals exhibit astoundingly adaptive and supple locomotion under real world constraints. In order to endow robots with similar capabilities, we must implement many degrees of freedom, equivalent to animals, into the robots' bodies. For taming many degrees of freedom, the concept of autonomous decentralized control plays a pivotal role. However a systematic way of designing such autonomous decentralized control system is still missing. Aiming at understanding the principles that underlie animals' locomotion, we have focused on a true slime mold, a primitive living organism, and extracted a design scheme for autonomous decentralized control system. In order to validate this design scheme, this article presents a soft-bodied amoeboid robot inspired by the true slime mold. Significant features of this robot are twofold: (1) the robot has a truly soft and deformable body stemming from real-time tunable springs and protoplasm, the former is used for an outer skin of the body and the latter is to satisfy the law of conservation of mass; and (2) fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts stemming from the law of conservation of protoplasmic mass. Simulation results show that this robot exhibits highly supple and adaptive locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design methodology for autonomous decentralized control system.
NASA Astrophysics Data System (ADS)
Tero, A.; Kobayashi, R.; Nakagaki, T.
2005-06-01
Experiments on the fusion and partial separation of plasmodia of the true slime mold Physarum polycephalum are described, concentrating on the spatio-temporal phase patterns of rhythmic amoeboid movement. On the basis of these experimental results we introduce a new model of coupled oscillators with one conserved quantity. Simulations using the model equations reproduce the experimental results well.
Brown, Matthew W; Spiegel, Frederick W; Silberman, Jeffrey D
2009-12-01
The shared ancestry between Fungi and animals has been unequivocally demonstrated by abundant molecular and morphological data for well over a decade. Along with the animals and Fungi, multiple protists have been placed in the supergroup Opisthokonta making it exceptionally diverse. In an effort to place the cellular slime mold Fonticula alba, an amoeboid protist with aggregative, multicellular fruiting, we sequenced five nuclear encoded genes; small subunit ribosomal RNA, actin, beta-tubulin, elongation factor 1-alpha, and the cytosolic isoform of heat shock protein 70 for phylogenetic analyses. Molecular trees demonstrate that Fonticula is an opisthokont that branches sister to filose amoebae in the genus Nuclearia. Fonticula plus Nuclearia are sister to Fungi. We propose a new name for this well-supported clade, Nucletmycea, incorporating Nuclearia, Fonticula, and Fungi. Fonticula represents the first example of a cellular slime mold morphology within Opisthokonta. Thus, there are four types of multicellularity in the supergroup-animal, fungal, colonial, and now aggregative. Our data indicate that multicellularity in Fonticula evolved independent of that found in the fungal and animal radiations. With the rapidly expanding sequence and genomic data becoming available from many opisthokont lineages, Fonticula may be fundamental to understanding opisthokont evolution as well as any possible commonalities involved with the evolution of multicellularity.
Risk management in spatio-temporally varying field by true slime mold
NASA Astrophysics Data System (ADS)
Ito, Kentaro; Sumpter, David; Nakagaki, Toshiyuki
Revealing how lower organisms solve complicated problems is a challenging research area, which could reveal the evolutionary origin of biological information processing. Here we report on the ability of a single-celled organism, true slime mold, to find a smart solution of risk management under spatio-temporally varying conditions. We designed test conditions under which there were three food-locations at vertices of equilateral triangle and a toxic light illuminated the organism on alternating halves of the triangle. We found that the organism behavior depended on the period of the repeated illumination, even though the total exposure time was kept the same . A simple mathematical model for the experimental results is proposed from a dynamical system point of view. We discuss our results in the context of a strategy of risk management by Physarum.
Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G
2015-01-01
Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere.
Ricigliano, Vincent; Chitaman, Javed; Tong, Jingjing; Adamatzky, Andrew; Howarth, Dianella G.
2015-01-01
Roots of the medicinal plant Valeriana officinalis are well-studied for their various biological activities. We applied genetically transformed V. officinalis root biomass to exert control of Physarum polycephalum, an amoeba-based emergent computing substrate. The plasmodial stage of the P. polycephalum life cycle constitutes a single, multinucleate cell visible by unaided eye. The plasmodium modifies its network of oscillating protoplasm in response to spatial configurations of attractants and repellents, a behavior that is interpreted as biological computation. To program the computing behavior of P. polycephalum, a diverse and sustainable library of plasmodium modulators is required. Hairy roots produced by genetic transformation with Agrobacterium rhizogenes are a metabolically stable source of bioactive compounds. Adventitious roots were induced on in vitro V. officinalis plants following infection with A. rhizogenes. A single hairy root clone was selected for massive propagation and the biomass was characterized in P. polycephalum chemotaxis, maze-solving, and electrical activity assays. The Agrobacterium-derived roots of V. officinalis elicited a positive chemotactic response and augmented maze-solving behavior. In a simple plasmodium circuit, introduction of hairy root biomass stimulated the oscillation patterns of slime mold's surface electrical activity. We propose that manipulation of P. polycephalum with the plant root culture platform can be applied to the development of slime mold microfluidic devices as well as future models for engineering the plant rhizosphere. PMID:26236301
Slime mould processors, logic gates and sensors.
Adamatzky, A
2015-07-28
A heterotic, or hybrid, computation implies that two or more substrates of different physical nature are merged into a single device with indistinguishable parts. These hybrid devices then undertake coherent acts on programmable and sensible processing of information. We study the potential of heterotic computers using slime mould acting under the guidance of chemical, mechanical and optical stimuli. Plasmodium of acellular slime mould Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioural morphological patterns in response to changing environmental conditions. Given data represented by chemical or physical stimuli, we can employ and modify the behaviour of the slime mould to make it solve a range of computing and sensing tasks. We overview results of laboratory experimental studies on prototyping of the slime mould morphological processors for approximation of Voronoi diagrams, planar shapes and solving mazes, and discuss logic gates implemented via collision of active growing zones and tactile responses of P. polycephalum. We also overview a range of electronic components--memristor, chemical, tactile and colour sensors-made of the slime mould. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Genetic heterogeneity in wild isolates of cellular slime mold social groups.
Sathe, Santosh; Kaushik, Sonia; Lalremruata, Albert; Aggarwal, Ramesh K; Cavender, James C; Nanjundiah, Vidyanand
2010-07-01
This study addresses the issues of spatial distribution, dispersal, and genetic heterogeneity in social groups of the cellular slime molds (CSMs). The CSMs are soil amoebae with an unusual life cycle that consists of alternating solitary and social phases. Because the social phase involves division of labor with what appears to be an extreme form of "altruism", the CSMs raise interesting evolutionary questions regarding the origin and maintenance of sociality. Knowledge of the genetic structure of social groups in the wild is necessary for answering these questions. We confirm that CSMs are widespread in undisturbed forest soil from South India. They are dispersed over long distances via the dung of a variety of large mammals. Consistent with this mode of dispersal, most social groups in the two species examined for detailed study, Dictyostelium giganteum and Dictyostelium purpureum, are multi-clonal.
Coupled Oscillators System in the True Slime Mold
NASA Astrophysics Data System (ADS)
Takamatsu, A.; Fujii, T.; Endo, I.
The Plasmodium of true slime mold, Physarum polycephalum, which shows various oscillatory phenomena, can be regarded as a coupled nonlinear oscillators system. The partial bodies of the Plasmodium are interconnected by microscale tubes, whose dimension can be related to the coupling strength between the plasmodial oscillators. Investigation on the collective behavior of the oscillators under the condition that the configuration of the tube structure can be manipulated gives significant information on the characteristics of the Plasmodium from the viewpoint of nonlinear dynamics. In this study, we propose a living coupled oscillators system. Using a microfabricated structure, we patterned the geometry and the dimensions of the microscale tube structure of the Plasmodium. As the first step, the Plasmodium was grown in the microstructure for coupled two oscillators system that has two wells (oscillator part) and a microchannel (coupling part). We investigated the oscillation bahavior by monitoring the thickness oscillation of Plasmodium in the strucutre with various width (W) and length (L) of microchannel. We found that there are various types of oscillation bahavior, such as anti-phase and in-phase oscillations depending on the channel dimension W and L. The present method is suitable for further studies of the network of the Plasmodium as a collective nonlinear oscillators system.
Exon–intron organization of genes in the slime mold Physarum polycephalum
Trzcinska-Danielewicz, Joanna; Fronk, Jan
2000-01-01
The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon–intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon–intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon–intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3′-ends. PMID:10982858
Katayama, Takahiro; Yasukawa, Hiro
2008-01-01
The cellular slime mold Dictyostelium discoideum grows as unicellular free-living amoebae in the presence of nutrients. Upon starvation, the amoebae aggregate and form multicellular structures that each consist of a stalk and spores. D. discoideum encodes at least four proteins (Sir2A, Sir2B, Sir2C, and Sir2D) homologous to human SIRT. RT-PCR and WISH analyses showed that the genes for Sir2A, Sir2C, and Sir2D were expressed at high levels in growing cells but at decreased levels in developing cells, whereas the gene encoding Sir2B was expressed in the prestalk-cell region in the developmental phase.
El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi
2004-06-01
Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.
Robson, Gillian E.; Williams, Keith L.
1979-01-01
The genetic basis of vegetative incompatibility in the cellular slime mold, Dictyostelium discoideum, is elucidated. Vegetatively compatible haploid strains from parasexual diploids at a frequency of between 10-6 and 10-5, whereas "escaped" diploids are formed between vegetatively incompatible strains at a frequency of ∼10-8. There is probably only a single vegetative incompatibility site, which appears to be located at, or closely linked to, the mating-type locus. The nature of the vegetative incompatibility is deduced from parasexual diploid formation between wild isolates and tester strains of each mating type, examination of the frequency of formation of "escaped" diploids formed between vegetatively incompatible strains, and examination of the mating type and vegetative incompatibility of haploid segregants obtained from "escaped" diploids. PMID:17248984
A Method for Growing Bio-memristors from Slime Mold.
Miranda, Eduardo Reck; Braund, Edward
2017-11-02
Our research is aimed at gaining a better understanding of the electronic properties of organisms in order to engineer novel bioelectronic systems and computing architectures based on biology. This specific paper focuses on harnessing the unicellular slime mold Physarum polycephalum to develop bio-memristors (or biological memristors) and bio-computing devices. The memristor is a resistor that possesses memory. It is the 4th fundamental passive circuit element (the other three are the resistor, the capacitor, and the inductor), which is paving the way for the design of new kinds of computing systems; e.g., computers that might relinquish the distinction between storage and a central processing unit. When applied with an AC voltage, the current vs. voltage characteristic of a memristor is a pinched hysteresis loop. It has been shown that P. polycephalum produces pinched hysteresis loops under AC voltages and displays adaptive behavior that is comparable with the functioning of a memristor. This paper presents the method that we developed for implementing bio-memristors with P. polycephalum and introduces the development of a receptacle to culture the organism, which facilitates its deployment as an electronic circuit component. Our method has proven to decrease growth time, increase component lifespan, and standardize electrical observations.
A Method for Growing Bio-memristors from Slime Mold
Miranda, Eduardo Reck; Braund, Edward
2017-01-01
Our research is aimed at gaining a better understanding of the electronic properties of organisms in order to engineer novel bioelectronic systems and computing architectures based on biology. This specific paper focuses on harnessing the unicellular slime mold Physarum polycephalum to develop bio-memristors (or biological memristors) and bio-computing devices. The memristor is a resistor that possesses memory. It is the 4th fundamental passive circuit element (the other three are the resistor, the capacitor, and the inductor), which is paving the way for the design of new kinds of computing systems; e.g., computers that might relinquish the distinction between storage and a central processing unit. When applied with an AC voltage, the current vs. voltage characteristic of a memristor is a pinched hysteresis loop. It has been shown that P. polycephalum produces pinched hysteresis loops under AC voltages and displays adaptive behavior that is comparable with the functioning of a memristor. This paper presents the method that we developed for implementing bio-memristors with P. polycephalum and introduces the development of a receptacle to culture the organism, which facilitates its deployment as an electronic circuit component. Our method has proven to decrease growth time, increase component lifespan, and standardize electrical observations. PMID:29155754
Experimental Verification of Fully Decentralized Control Inspired by Plasmodium of True Slime Mold
NASA Astrophysics Data System (ADS)
Umedachi, Takuya; Takeda, Koichi; Nakagaki, Toshiyuki; Kobayashi, Ryo; Ishiguro, Akio
This paper presents a fully decentralized control inspired by plasmodium of true slime mold and its validity using a soft-bodied amoeboid robot. The notable features of this paper are twofold: (1) the robot has truly soft and deformable body stemming from real-time tunable springs and a balloon, the former is utilized as an outer skin of the body and the latter serves as protoplasm; and (2) a fully decentralized control using coupled oscillators with completely local sensory feedback mechanism is realized by exploiting the long-distance physical interaction between the body parts induced by the law of conservation of protoplasmic mass. Experimental results show that this robot exhibits truly supple locomotion without relying on any hierarchical structure. The results obtained are expected to shed new light on design scheme for autonomous decentralized control system.
Mathematical model for rhythmic protoplasmic movement in the true slime mold.
Kobayashi, Ryo; Tero, Atsushi; Nakagaki, Toshiyuki
2006-08-01
The plasmodium of the true slime mold Physarum polycephalum is a large amoeboid organism that displays "smart" behavior such as chemotaxis and the ability to solve mazes and geometrical puzzles. These amoeboid behaviors are based on the dynamics of the viscoelastic protoplasm and its biochemical rhythms. By incorporating both these aspects, we constructed a mathematical model for the dynamics of the organism as a first step towards understanding the relation between protoplasmic movement and its unusual abilities. We tested the validity of the model by comparing it with physiological observation. Our model reproduces fundamental characteristics of the spatio-temporal pattern of the rhythmic movement: (1) the antiphase oscillation between frontal tip and rear when the front is freely extending; (2) the asynchronous oscillation pattern when the front is not freely extending; and (3) the formation of protoplasmic mounds over a longer time scale. Both our model and physiological observation suggest that cell stiffness plays a primary role in plasmodial behaviors, in contrast to the conventional theory of coupled oscillator systems.
Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds.
Hoppe, Thomas; Kutschera, Ulrich
2015-01-01
On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa.
Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds
Hoppe, Thomas; Kutschera, Ulrich
2015-01-01
On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa. PMID:26357877
RHYTHMICITY IN THE PROTOPLASMIC STREAMING OF A SLIME MOLD, PHYSARUM POLYCEPHALUM
Kishimoto, Uichiro
1958-01-01
The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of the back and forth protoplasmic streaming along the strand. Generally some phase difference is observed between them. Periods of the electric potential rhythm show a Gaussian distribution. Amplitudes give a somewhat different distribution curve. Wave forms are not always simple harmonic ones, but are distorted more or less. However, auto-correlation analysis proves that there is a dominant rhythm of a nearly constant period which coincides with the mean period of the Gaussian distribution curve. Calculations made on an assumption that the electric potential rhythm is the result of many elementary rhythms (i.e., same periodicity, arbitrary phase angles) distributed throughout the plasmodium, give a satisfactory coincidence with the observed distribution for the amplitude. The predominance of a rhythm of a nearly constant periodicity suggests the existence of well organized interactions among components of a contractile protein network, the rhythmic deformation of which is supposed to be responsible for the protoplasmic streaming and for the electric potential rhythm. PMID:13563808
Hoskin, F C; Walker, J E; Mello, C M
1999-05-14
Recently, and for the first time, a diisopropylphosphorofluoridate (DFP)-hydrolyzing enzyme, i.e. an organophosphorus acid anhydrolase (OPAA), has been reported in a plant-source. Based on this and other suggestive evidence, the ability of three plant sources and a protist to hydrolyze DFP and 1,2,2-trimethylpropyl methylphosphonofluoridate (Soman) were tested, and the effects of Mn2+ and ethylenediamine tetraacetate (EDTA) on this activity. The plants are duckweed (Lemna minor), giant duckweed (Spirodela oligorhiza), and germinated mung bean (Vigna radiata); the protist is a slime mold (Dictyostelium discoidium). The tests are based on a crude classification of OPAAs as 'squid type' (DFP hydrolyzed more rapidly than Soman) and all of the others termed by us, with questionable justification, as 'Mazur type' (Soman hydrolyzed more rapidly than DFP). Of the two duckweeds, Spirodela oligorhiza hydrolyzes Soman but not DFP, and Lemna minor does not hydrolyze either substrate. In contrast to the report of Yu and Sakurai, mung bean does not hydrolyze DFP and hydrolyzes Soman with a 5-fold stimulation by Mn2+ and a marked inhibition by EDTA. The slime mold hydrolyzes Soman more rapidly than DFP (but does hydrolyze DFP) and the hydrolysis is Mn2+ stimulated. The failure of these plant sources to hydrolyze DFP is similar to the behavior of OPAA from Bacillus stearothermophilus.
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
SURVEY AND SUMMARY: exon-intron organization of genes in the slime mold Physarum polycephalum.
Trzcinska-Danielewicz, J; Fronk, J
2000-09-15
The slime mold Physarum polycephalum is a morphologically simple organism with a large and complex genome. The exon-intron organization of its genes exhibits features typical for protists and fungi as well as those characteristic for the evolutionarily more advanced species. This indicates that both the taxonomic position as well as the size of the genome shape the exon-intron organization of an organism. The average gene has 3.7 introns which are on average 138 bp, with a rather narrow size distribution. Introns are enriched in AT base pairs by 13% relative to exons. The consensus sequences at exon-intron boundaries resemble those found for other species, with minor differences between short and long introns. A unique feature of P.polycephalum introns is the strong preference for pyrimidines in the coding strand throughout their length, without a particular enrichment at the 3'-ends.
Romeralo, M; Baldauf, S L; Cavender, J C
2009-01-01
Sampling soils to look for dictyostelids in southern Portugal we found an isolate that has a morphology that differed from any previously described species of the group. We sequenced the internally transcribed spacer (ITS) and small subunit (SSU) genes of the nuclear ribosomal RNA and found that both sequences are distinct from all previously described sequences. Phylogenetic analyses place the new species in dictyostelid Group 3 (Rhizostelids) together with D. potamoides, with which it shares 65.8% identity for ITS and 96.6% for SSU. In this paper we describe a new species of cellular slime mold, Dictyostelium ibericum, based on morphological and molecular characters. It is a small species with polar granules in its spores.
Kikuchi, H; Saito, Y; Komiya, J; Takaya, Y; Honma, S; Nakahata, N; Ito, A; Oshima, Y
2001-10-19
We investigated the constituents of Dictyostelium discoideum to clarify the diversity of secondary metabolites of Dictyostelium cellular slime molds and to explore biologically active substances that could be useful in the development of novel drugs. From a methanol extract of the multicellular fruit body of D. discoideum, we isolated two novel amino sugar analogues, furanodictine A (1) and B (2). They are the first 3,6-anhydrosugars to be isolated from natural sources. Their relative structures were elucidated by spectral means, and the absolute configurations were confirmed by asymmetric syntheses of 1 and 2. These furanodictines potently induce neuronal differentiation of rat pheochromocytoma (PC-12) cells.
A mathematical model for adaptive transport network in path finding by true slime mold.
Tero, Atsushi; Kobayashi, Ryo; Nakagaki, Toshiyuki
2007-02-21
We describe here a mathematical model of the adaptive dynamics of a transport network of the true slime mold Physarum polycephalum, an amoeboid organism that exhibits path-finding behavior in a maze. This organism possesses a network of tubular elements, by means of which nutrients and signals circulate through the plasmodium. When the organism is put in a maze, the network changes its shape to connect two exits by the shortest path. This process of path-finding is attributed to an underlying physiological mechanism: a tube thickens as the flux through it increases. The experimental evidence for this is, however, only qualitative. We constructed a mathematical model of the general form of the tube dynamics. Our model contains a key parameter corresponding to the extent of the feedback regulation between the thickness of a tube and the flux through it. We demonstrate the dependence of the behavior of the model on this parameter.
Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.
Zitnik, Marinka; Zupan, Blaž
2014-01-01
The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.
Sawada, T; Aono, M; Asakawa, S; Ito, A; Awano, K
2000-09-01
A novel antibacterial substance, AB0022A, was isolated from the cellular slime mold Dictyostelium purpureum K1001. It inhibited the growth of Gram-positive bacteria, and its MICs ranged from 0.39 to 50 microg/ml. Because AB0022A was a highly substituted aromatic compound, we could not determine its structure based on only its physico-chemical and spectral data. We therefore used a dehalogenated derivative from AB0022A and deduced that its structure was 1,9-dihydroxy-3,7-dimethoxy-2-hexanoyl-4,6,8-trichlorodibenzofuran . To confirm this structure, we synthesized the compound having the deduced structure. The synthetic compound was identical to naturally occurring AB0022A.
Stanley Corrsin Award Talk: Fluid Mechanics of Fungi and Slime
NASA Astrophysics Data System (ADS)
Brenner, Michael
2013-11-01
There are interesting fluid mechanics problems everywhere, even in the most lowly and hidden corners of forest floors. Here I discuss some questions we have been working on in recent years involving fungi and slime. A critical issue for the ecology of fungi and slime is nutrient availability: nutrient sources are highly heterogeneous, and strategies are necessary to find food when it runs out. In the fungal phylum Ascomycota, spore dispersal is the primary mechanism for finding new food sources. The defining feature of this phylum is the ascus, a fluid filled sac from which spores are ejected, through a build up in osmotic pressure. We outline the (largely fluid mechanical) design constraints on this ejection strategy, and demonstrate how it provides strong constraints for the diverse morphologies of spores and asci found in nature. The core of the argument revisits a classical problem in elastohydrodynamic lubrication from a different perspective. A completely different strategy for finding new nutrient is found by slime molds and fungi that stretch out - as a single organism- over enormous areas (up to hectares) over forest floors. As a model problem we study the slime mold Physarum polycephalum, which forages with a large network of connected tubes on the forest floors. Localized regions in the network find nutrient sources and then pump the nutrients throughout the entire organism. We discuss fluid mechanical mechanisms for coordinating this transport, which generalize peristalsis to pumping in a heterogeneous network. We give a preliminary discussion to how physarum can detect a nutrient source and pump the nutrient throughout the organism.
NASA Astrophysics Data System (ADS)
Smith-Ferguson, Jules; Reid, Chris R.; Latty, Tanya; Beekman, Madeleine
2017-10-01
The ability to navigate through an environment is critical to most organisms’ ability to survive and reproduce. The presence of a memory system greatly enhances navigational success. Therefore, natural selection is likely to drive the creation of memory systems, even in non-neuronal organisms, if having such a system is adaptive. Here we examine if the external spatial memory system present in the acellular slime mould, Physarum polycephalum, provides an adaptive advantage for resource acquisition. P. polycephalum lays tracks of extracellular slime as it moves through its environment. Previous work has shown that the presence of extracellular slime allows the organism to escape from a trap in laboratory experiments simply by avoiding areas previously explored. Here we further investigate the benefits of using extracellular slime as an external spatial memory by testing the organism’s ability to navigate through environments of differing complexity with and without the ability to use its external memory. Our results suggest that the external memory has an adaptive advantage in ‘open’ and simple bounded environments. However, in a complex bounded environment, the extracellular slime provides no advantage, and may even negatively affect the organism’s navigational abilities. Our results indicate that the exact experimental set up matters if one wants to fully understand how the presence of extracellular slime affects the slime mould’s search behaviour.
Hasegawa, Yasuna; Wakabayashi, Masayuki; Nakamura, Shogo; Kodaira, Ken-ichi; Shinohara, Hiroaki; Yasukawa, Hiro
2004-05-04
The cellular slime mold Dictyostelium discoideum expresses a gene encoding a 452-amino-acid polypeptide that is 47% identical to Escherichia coli RecA. A recA-deficient E. coli, JE6651, was transformed by pYSN1, which was designed to express the truncated form of the D. discoideum gene, and used in suppression assays. The viability of the transformant, JE6651(pYSN1), increased following UV irradiation or mitomycin C treatment. Phage lambda (red(-) gam(-)), which required RecA activity for DNA packaging, formed plaques on a lawn of JE6651(pYSN1). These results indicate that the gene product has a DNA recombination activity. Fluorescence of D. discoideum protein fused with GFP was detected in mitochondria. The gene disruption mutant was hypersensitive to UV-light (254nm), mitomycin C and H(2)O(2), indicating that D. discoideum recA is important for survival following exposure to DNA damaging agents.
Takamatsu, Atsuko; Takaba, Eri; Takizawa, Ginjiro
2009-01-07
Branching network growth patterns, depending on environmental conditions, in plasmodium of true slime mold Physarum polycephalum were investigated. Surprisingly, the patterns resemble those in bacterial colonies even though the biological mechanisms differ greatly. Bacterial colonies are collectives of microorganisms in which individual organisms have motility and interact through nutritious and chemical fields. In contrast, the plasmodium is a giant amoeba-like multinucleated unicellular organism that forms a network of tubular structures through which protoplasm streams. The cell motility of the plasmodium is generated by oscillation phenomena observed in the partial bodies, which interact through the tubular structures. First, we analyze characteristics of the morphology quantitatively, then we abstract local rules governing the growing process to construct a simple network growth model. This model is independent of specific systems, in which only two rules are applied. Finally, we discuss the mechanism of commonly observed biological pattern formations through comparison with the system of bacterial colonies.
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD
ŽITNIK, MARINKA; ZUPAN, BLAŽ
2014-01-01
The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565
NASA Astrophysics Data System (ADS)
Aono, Masashi; Gunji, Yukio-Pegio
2004-08-01
How can non-algorithmic/non-deterministic computational syntax be computed? "The hyperincursive system" introduced by Dubois is an anticipatory system embracing the contradiction/uncertainty. Although it may provide a novel viewpoint for the understanding of complex systems, conventional digital computers cannot run faithfully as the hyperincursive computational syntax specifies, in a strict sense. Then is it an imaginary story? In this paper we try to argue that it is not. We show that a model of complex systems "Elementary Conflictable Cellular Automata (ECCA)" proposed by Aono and Gunji is embracing the hyperincursivity and the nonlocality. ECCA is based on locality-only type settings basically as well as other CA models, and/but at the same time, each cell is required to refer to globality-dominant regularity. Due to this contradictory locality-globality loop, the time evolution equation specifies that the system reaches the deadlock/infinite-loop. However, we show that there is a possibility of the resolution of these problems if the computing system has parallel and/but non-distributed property like an amoeboid organism. This paper is an introduction to "the slime mold computing" that is an attempt to cultivate an unconventional notion of computation.
Weight loss by Ppc-1, a novel small molecule mitochondrial uncoupler derived from slime mold.
Suzuki, Toshiyuki; Kikuchi, Haruhisa; Ogura, Masato; Homma, Miwako K; Oshima, Yoshiteru; Homma, Yoshimi
2015-01-01
Mitochondria play a key role in diverse processes including ATP synthesis and apoptosis. Mitochondrial function can be studied using inhibitors of respiration, and new agents are valuable for discovering novel mechanisms involved in mitochondrial regulation. Here, we screened small molecules derived from slime molds and other microorganisms for their effects on mitochondrial oxygen consumption. We identified Ppc-1 as a novel molecule which stimulates oxygen consumption without adverse effects on ATP production. The kinetic behavior of Ppc-1 suggests its function as a mitochondrial uncoupler. Serial administration of Ppc-1 into mice suppressed weight gain with no abnormal effects on liver or kidney tissues, and no evidence of tumor formation. Serum fatty acid levels were significantly elevated in mice treated with Ppc-1, while body fat content remained low. After a single administration, Ppc-1 distributes into various tissues of individual animals at low levels. Ppc-1 stimulates adipocytes in culture to release fatty acids, which might explain the elevated serum fatty acids in Ppc-1-treated mice. The results suggest that Ppc-1 is a unique mitochondrial regulator which will be a valuable tool for mitochondrial research as well as the development of new drugs to treat obesity.
RHYTHMICITY IN THE PROTOPLASMIC STREAMING OF A SLIME MOLD, PHYSARUM POLYCEPHALUM
Kishimoto, Uichiro
1958-01-01
The electric potential difference (1 to 15 mv.) between two loci of the slime mold connected with a strand of protoplasm changes rhythmically with the same period (60 to 180 seconds) as that of back and forth protoplasmic streaming along the strand. When atmospheric pressure at a part of the plasmodium is increased (about 10 cm. H2O), the electric potential at this part becomes positive (0 to 20 mv.) to another part with a time constant of 2 to 15 minutes. If the atmospheric pressure at a part of the plasmodium is changed (about 10 cm. H2O) periodically, the electric potential rhythm also changes with the same period as that of the applied pressure change, and the amplitude of the former grows to a new level (i.e., forced oscillation). The electric potential rhythm, in this case, is generally delayed about 90° in phase angle from the external pressure change. The period of the electric potential rhythm which coincided with that of the pressure change is maintained for a while after stopping the application of the pressure change, if the period is not much different from the native flow rhythm. Such a pressure effect is brought about by the forced transport of protoplasm and is reversible as a rule. In the statistical analysis made by Kishimoto (1958) and in the rheological treatment made in the report, the rhythmic deformation of the contractile protein networks is supposed to be the cause of the protoplasmic flow along the strand and of the electric potential rhythm. The role of such submicroscopic networks in the protoplasm in various kinds of protoplasmic movement is emphasized. PMID:13563809
Anderson, John D.
1951-01-01
The plasmodium of Physarum polycephalum reacts to direct current by migration toward the cathode. Cathodal migration was obtained upon a variety of substrata such as baked clay, paper, cellophane, and agar with a current density in the substratum of 1.0 µa./mm.2 Injury was produced by current densities of 8.0 to 12.0 µa./mm.2 The negative galvanotactic response was not due to electrode products. Attempts to demonstrate that the response was due to gradients or orientation in the substratum, pH changes in the mold, cataphoresis, electroosmosis, or endosmosis were not successful. The addition of salts (CaCl2, LiCl, NaCl, Na2SO4, NaHCO3, KCl, MgSO4, sodium citrate, and sea water) to agar indicated that change of cations had more effect than anions upon galvanotaxis and that the effect was upon threshold values. K ion (0.01 M KCl) increased the lower threshold value to 8.0 µa./mm.2 and the upper threshold value to 32.0 µa./mm.2, whereas the Li ion (0.01 M LiCl) increased the lower threshold to only 4.0 µa./mm.2 and the upper threshold to only 16.0 µa./mm.2 The passage of electric current produced no increase in the rate of cathodal migration; neither was there a decrease until injurious current densities were reached. With increase of subthreshold current densities there was a progressive decrease in rate of migration toward the anode until complete anodal inhibition occurred. There was orientation at right angles to the electrodes in alternating current (60 cycle) with current density of 4.0 µa./mm.2 and in direct current of 5.0 µa./mm.2 when polarity of current was reversed every minute. It is concluded that the negative galvanotactic response of P. polycephalum is due to inhibition of migration on the anodal side of the plasmodium and that this inhibition results in the limitation of the normal migration of the mold to a cathodal direction. The mechanism of the anodal inhibition has not been elucidated. PMID:14873916
ERIC Educational Resources Information Center
Fowler, Marilyn L.
1992-01-01
Describes a classroom activity using slime, a colloid: it behaves like both a solid and liquid. Explains how slime can be produced from guar gum. An activity where students work in teams and become a slime factory is presented. (PR)
Takamatsu, A; Yamamoto, T; Fujii, T
2004-01-01
Microfabrication technique was used to construct a model system with a living cell of plasmodium of the true slime mold, Physarum polycephalum, a living coupled oscillator system. Its parameters can be systematically controlled as in computer simulations, so that results are directly comparable to those of general mathematical models. As the first step, we investigated responses in oscillatory cells, the oscillators of the plasmodium, to periodic stimuli by temperature changes to elucidate characteristics of the cells as nonlinear systems whose internal dynamics are unknown because of their complexity. We observed that the forced oscillator of the plasmodium show 1:1, 2:1, 3:1 frequency locking inside so-called Arnold tongues regions as well as in other nonlinear systems such as chemical systems and other biological systems. In addition, we found spontaneous switching behavior from certain frequency locking states to other states, even under certain fixed parameters. This technique can be applied to more complex systems with multiple elements, such as coupled oscillator systems, and would be useful to investigate complicated phenomena in biological systems such as information processing.
Characterization of Adaptation by Morphology in a Planar Biological Network of Plasmodial Slime Mold
NASA Astrophysics Data System (ADS)
Ito, Masateru; Okamoto, Riki; Takamatsu, Atsuko
2011-07-01
Growth processes of a planar biological network of plasmodium of a true slime mold, Physarum polycephalum, were analyzed quantitatively. The plasmodium forms a transportation network through which protoplasm conveys nutrients, oxygen, and cellular organelles similarly to blood in a mammalian vascular network. To analyze the network structure, vertices were defined at tube bifurcation points. Then edges were defined for the tubes connecting both end vertices. Morphological analysis was attempted along with conventional topological analysis, revealing that the growth process of the plasmodial network structure depends on environmental conditions. In an attractive condition, the network is a polygonal lattice with more than six edges per vertex at the early stage and the hexagonal lattice at a later stage. Through all growing stages, the tube structure was not highly developed but an unstructured protoplasmic thin sheet was dominantly formed. The network size is small. In contrast, in the repulsive condition, the network is a mixture of polygonal lattice and tree-graph. More specifically, the polygonal lattice has more than six edges per vertex in the early stage, then a tree-graph structure is added to the lattice network at a later stage. The thick tube structure was highly developed. The network size, in the meaning of Euclidean distance but not topological one, grows considerably. Finally, the biological meaning of the environment-dependent network structure in the plasmodium is discussed.
Weight Loss by Ppc-1, a Novel Small Molecule Mitochondrial Uncoupler Derived from Slime Mold
Suzuki, Toshiyuki; Kikuchi, Haruhisa; Ogura, Masato; Homma, Miwako K.; Oshima, Yoshiteru; Homma, Yoshimi
2015-01-01
Mitochondria play a key role in diverse processes including ATP synthesis and apoptosis. Mitochondrial function can be studied using inhibitors of respiration, and new agents are valuable for discovering novel mechanisms involved in mitochondrial regulation. Here, we screened small molecules derived from slime molds and other microorganisms for their effects on mitochondrial oxygen consumption. We identified Ppc-1 as a novel molecule which stimulates oxygen consumption without adverse effects on ATP production. The kinetic behavior of Ppc-1 suggests its function as a mitochondrial uncoupler. Serial administration of Ppc-1 into mice suppressed weight gain with no abnormal effects on liver or kidney tissues, and no evidence of tumor formation. Serum fatty acid levels were significantly elevated in mice treated with Ppc-1, while body fat content remained low. After a single administration, Ppc-1 distributes into various tissues of individual animals at low levels. Ppc-1 stimulates adipocytes in culture to release fatty acids, which might explain the elevated serum fatty acids in Ppc-1-treated mice. The results suggest that Ppc-1 is a unique mitochondrial regulator which will be a valuable tool for mitochondrial research as well as the development of new drugs to treat obesity. PMID:25668511
Azelmat, Jabrane; Fiorito, Serena; Genovese, Salvatore; Epifano, Francesco; Grenier, Daniel
2015-01-01
The diisopentenyloxy quinolobactin derivative 3-methylbut-2-enyl-4-methoxy-8-[(3-methylbut-2-enyl)oxy] quinoline-2-carboxylate, also named as Ppc-1, has been initially isolated from the fruiting bodies of the cellular slime mold Polysphondylium pseudo-candidum. Given that few data are available in the literature concerning the biological properties of this compound, this study was undertaken to evaluate its antibacterial and anti-inflammatory properties. Ppc-1 exerted antibacterial activity on the Gram negative periodontopathogen Porphyromonas gingivalis, while it had no such effect on the other bacterial species tested. The antibacterial activity of Ppc-1 appeared to result from its ability to permeate the cell membrane. Using the U937-3xκB-LUC human monocytic cell line, Ppc-1 was found to dose-dependently inhibit the lipopolysaccharide-induced NF-κB activation, a signaling pathway that has been associated with inflammatory mediator secretion. In conclusion, Ppc-1, by exhibiting a dual mode of action including antibacterial and anti-inflammatory activities, may represent a promising targeted therapeutic agent for periodontal diseases.
Rodríguez-Ruiz, Amaia; Dondero, Francesco; Viarengo, Aldo; Marigómez, Ionan
2016-06-01
A suite of organisms from different taxonomical and ecological positions is needed to assess environmentally relevant soil toxicity. A new bioassay based on Dictyostelium is presented that is aimed at integrating slime molds into such a testing framework. Toxicity tests on elutriates and the solid phase developmental cycle assay were successfully applied to a soil spiked with a mixture of Zn, Cd, and diesel fuel freshly prepared (recently contaminated) and after 2 yr of aging. The elutriates of both soils provoked toxic effects, but toxicity was markedly lower in the aged soil. In the D. discoideum developmental cycle assay, both soils affected amoeba viability and aggregation, with fewer multicellular units, smaller fruiting bodies and, overall, inhibition of fruiting body formation. This assay is quick and requires small amounts of test soil, which might facilitate its incorporation into a multispecies multiple-endpoint toxicity bioassay battery suitable for environmental risk assessment in soils. Environ Toxicol Chem 2016;35:1413-1421. © 2015 SETAC. © 2015 SETAC.
ERIC Educational Resources Information Center
Holmes, R. P.; Stewart, P. R.
1977-01-01
Actin and myosin have now been demonstrated to be important constituents of many eukaryotic cells. Their role is primarily that of a contractile system underlying all aspects of cellular motility. Described here is a simple experimental system to demonstrate quantitatively aspects of motility and its regulation in a slime mold. (Author/MA)
ERIC Educational Resources Information Center
VanCleave, Janice
2000-01-01
Describes a science activity in which students make a non-Newtonian fluid (slime), which has both solid and liquid properties. After reviewing the shape and volume of solids and volume of liquids, students make the slime using glue, liquid starch, and food coloring. They can experiment by rolling and dropping slime balls and by pulling the slime…
Identification of a novel PSR as the substrate of an SR protein kinase in the true slime mold.
Zhang, Yong-Xia; Xing, Miao; Fei, Xuan; Zhang, Jian-Hua; Tian, Sheng-Li; Li, Ming-Hua; Liu, Shi-De
2011-03-01
Here, a novel cDNA encoding a serine/arginine (SR)-rich protein, designated PSR, was isolated from the true slime mold Physarum polycephalum and expressed in Escherichia coli. The deduced amino acid (aa) sequence reveals that PSR contains RS repeats at its C-terminus, similar to the conventional PSRPK substrate ASF/SF2. To study the novel protein, we generated a variety of mutant constructs by PCR and site-directed mutagenesis. Our analysis indicated that the purified recombinant PSR was phosphorylated by PSRPK in vitro and the SR-rich domain (amino acids 460-469) in the PSR protein was required for phosphorylation. In addition, removal of the docking motif (amino acids 424-450) from PSR significantly reduced the overall catalytic efficiency of the phosphorylation reaction. We also found that the conserved ATP-binding region (62)LGWGHFSTVWLAIDEKNGGREVALK(86) and the serine/threonine protein kinases active-site signature (184)IIHTDLKPENVLL(196) of PSRPK played a crucial role in substrate phosphorylation and Lys(86) and Asp(188) were crucial for PSRPK phosphorylation of PSR. These results suggest that PSR is a novel SR-related protein that is phosphorylated by PSRPK.
Latty, Tanya; Beekman, Madeleine
2010-01-01
How individuals deal with multiple conflicting demands is an important aspect of foraging ecology, yet work on foraging behavior has typically neglected neurologically simple organisms. Here we examine the impact of an abiotic risk (light) and energetic status on the foraging decisions of a protist, the slime mold Physarum polycephalum. We examined patch choice in a "non-risky" environment by presenting starved and non-starved P. polycephalum amoebas with a choice between two shaded food patches (one high quality, one low quality). We next examined patch choice in the presence of a conflict between foraging risk (light exposure) and food quality by presenting amoebas with a choice between a shaded, low-quality patch, and a light-exposed, high-quality patch. When both patches were shaded, 100% of amoebas selected the higher quality food patch, irrespective of food-quality differences or the individual's energetic status. When light exposure and food quality conflicted, amoebas selected the patch with the higher food quality when the quality difference between the patches was high. When the quality difference between patches was small, amoebas selected the shaded, lower quality patch.
Control of interaction strength in a network of the true slime mold by a microfabricated structure.
Takamatsu, A; Fujii, T; Endo, I
2000-02-01
The plasmodium of the true slime mold, Physarum polycephalum, which shows various nonlinear oscillatory phenomena, for example, in its thickness, protoplasmic streaming and concentration of intracellular chemicals, can be regarded as a collective of nonlinear oscillators. The plasmodial oscillators are interconnected by microscale tubes whose dimensions can be closely related to the strength of interaction between the oscillators. Investigation of the collective behavior of the oscillators under the conditions in which the interaction strength can be systematically controlled gives significant information on the characteristics of the system. In this study, we proposed a living model system of a coupled oscillator system in the Physarum plasmodium. We patterned the geometry and dimensions of the microscale tube structure in the plasmodium by a microfabricated structure (microstructure). As the first step, we constructed a two-oscillator system for the plasmodium that has two wells (oscillator part) and a channel (coupling part). We investigated the oscillation behavior by monitoring the thickness oscillation of the plasmodium in the microstructure with various channel widths. It was found that the oscillation behavior of two oscillators dynamically changed depending on the channel width. Based on the results of measurements of the tube dimensions and the velocity of the protoplasmic streaming in the tube, we discuss how the channel width relates to the interaction strength of the coupled oscillator system.
NASA Astrophysics Data System (ADS)
Mayne, Richard
2015-03-01
Slime mould computing is an inherently multi-disciplinary subfield of unconventional computing that draws upon aspects of not only theoretical computer science and electronics, but also the natural sciences. This chapter focuses on the biology of slime moulds and expounds the viewpoint that a deep, intuitive understanding of slime mould life processes is a fundamental requirement for understanding -- and, hence, harnessing -- the incredible behaviour patterns we may characterise as "computation"...
NASA Astrophysics Data System (ADS)
Adamatzky, Andrew; Armstrong, Rachel; Jones, Jeff; Gunji, Yukio-Pegio
2013-07-01
Slime mould Physarum polycephalum is large single cell with intriguingly smart behaviour. The slime mould shows outstanding abilities to adapt its protoplasmic network to varying environmental conditions. The slime mould can solve tasks of computational geometry, image processing, logics and arithmetics when data are represented by configurations of attractants and repellents. We attempt to map behavioural patterns of slime onto the cognitive control vs. schizotypy spectrum phase space and thus interpret slime mould's activity in terms of creativity.
Sato, Takahide; Kano, Takeshi; Ishiguro, Akio
2011-06-01
A systematic method for an autonomous decentralized control system is still lacking, despite its appealing concept. In order to alleviate this, we focused on the amoeboid locomotion of the true slime mold, and extracted a design scheme for the decentralized control mechanism that leads to adaptive behavior for the entire system, based on the so-called discrepancy function. In this paper, we intensively investigate the universality of this design scheme by applying it to a different type of locomotion based on a 'synthetic approach'. As a first step, we implement this design scheme to the control of a real physical two-dimensional serpentine robot that exhibits slithering locomotion. The experimental results show that the robot exhibits adaptive behavior and responds to the environmental changes; it is also robust against malfunctions of the body segments due to the local sensory feedback control that is based on the discrepancy function. We expect the results to shed new light on the methodology of autonomous decentralized control systems.
Zhulidov, Daniel A; Robarts, Richard D; Zhulidov, Alexander V; Zhulidova, Olga V; Markelov, Danila A; Rusanov, Viktor A; Headley, John V
2002-01-01
Samples of the slime mold Fuligo septica (L.) Wiggers were collected from an ecologically diverse selection of sites across the former USSR and in North Korea to determine their Zn concentrations. Plasmodia were collected from trees, rocks, soils, the walls of buildings and a variety of other materials and structures from 1990 to 1996. The biomass collected ranged from 305 to 968 mg, whereas Zn concentrations in plasmodia of F. septica ranged from 8400 to 23,000 mg kg(-1) dry wt. (mean and standard error = 14,200 +/- 860 mg kg(-1) dry wt.). No clear trend as to which areas produced F. septica with the highest Zn concentrations was discernable. Nor was it possible to identify any particular substrate on which F. septica grew that produced noticeably high Zn concentrations. For example, forest litter on which F. septica was found had Zn concentrations of only 25 to 130 mg kg(-1) dry wt. Our data confirm the only other study showing hyperaccumulation of Zn in F. septica, which was carried out in Finland. This ability seems to be unique to this species, but how or why it does this, or why such high Zn concentrations are not toxic to F. septica, are questions requiring future research.
Physiology, biomechanics, and biomimetics of hagfish slime.
Fudge, Douglas S; Schorno, Sarah; Ferraro, Shannon
2015-01-01
Hagfishes thwart attacks by fish predators by producing liters of defensive slime. The slime is produced when slime gland exudate is released into the predator's mouth, where it deploys in a fraction of a second and clogs the gills. Slime exudate is composed mainly of secretory products from two cell types, gland mucous cells and gland thread cells, which produce the mucous and fibrous components of the slime, respectively. Here, we review what is known about the composition of the slime, morphology of the slime gland, and physiology of the cells that produce the slime. We also discuss several of the mechanisms involved in the deployment of both mucous and thread cells during the transition from thick glandular exudate to ultradilute material. We review biomechanical aspects of the slime, along with recent efforts to produce biomimetic slime thread analogs, and end with a discussion of how hagfish slime may have evolved.
The role of noise in self-organized decision making by the true slime mold Physarum polycephalum.
Meyer, Bernd; Ansorge, Cedrick; Nakagaki, Toshiyuki
2017-01-01
Self-organized mechanisms are frequently encountered in nature and known to achieve flexible, adaptive control and decision-making. Noise plays a crucial role in such systems: It can enable a self-organized system to reliably adapt to short-term changes in the environment while maintaining a generally stable behavior. This is fundamental in biological systems because they must strike a delicate balance between stable and flexible behavior. In the present paper we analyse the role of noise in the decision-making of the true slime mold Physarum polycephalum, an important model species for the investigation of computational abilities in simple organisms. We propose a simple biological experiment to investigate the reaction of P. polycephalum to time-variant risk factors and present a stochastic extension of an established mathematical model for P. polycephalum to analyze this experiment. It predicts that-due to the mechanism of stochastic resonance-noise can enable P. polycephalum to correctly assess time-variant risk factors, while the corresponding noise-free system fails to do so. Beyond the study of P. polycephalum we demonstrate that the influence of noise on self-organized decision-making is not tied to a specific organism. Rather it is a general property of the underlying process dynamics, which appears to be universal across a wide range of systems. Our study thus provides further evidence that stochastic resonance is a fundamental component of the decision-making in self-organized macroscopic and microscopic groups and organisms.
The role of noise in self-organized decision making by the true slime mold Physarum polycephalum
Ansorge, Cedrick; Nakagaki, Toshiyuki
2017-01-01
Self-organized mechanisms are frequently encountered in nature and known to achieve flexible, adaptive control and decision-making. Noise plays a crucial role in such systems: It can enable a self-organized system to reliably adapt to short-term changes in the environment while maintaining a generally stable behavior. This is fundamental in biological systems because they must strike a delicate balance between stable and flexible behavior. In the present paper we analyse the role of noise in the decision-making of the true slime mold Physarum polycephalum, an important model species for the investigation of computational abilities in simple organisms. We propose a simple biological experiment to investigate the reaction of P. polycephalum to time-variant risk factors and present a stochastic extension of an established mathematical model for P. polycephalum to analyze this experiment. It predicts that—due to the mechanism of stochastic resonance—noise can enable P. polycephalum to correctly assess time-variant risk factors, while the corresponding noise-free system fails to do so. Beyond the study of P. polycephalum we demonstrate that the influence of noise on self-organized decision-making is not tied to a specific organism. Rather it is a general property of the underlying process dynamics, which appears to be universal across a wide range of systems. Our study thus provides further evidence that stochastic resonance is a fundamental component of the decision-making in self-organized macroscopic and microscopic groups and organisms. PMID:28355213
Kakiuchi, Y; Takahashi, T; Murakami, A; Ueda, T
2001-03-01
A new photomorphogenesis was found in the plasmodium of the true slime mold Physarum polycephalum: the plasmodium broke temporarily into equal-sized spherical pieces, each containing about eight nuclei, about 5 h after irradiation with light. Action spectroscopic study showed that UVA, blue and far-red lights were effective, while red light inhibited the far-red-induced fragmentation. Difference absorption spectra of both the living plasmodium and the plasmodial homogenate after alternate irradiation with far-red and red light gave two extremes at 750 and 680 nm, which agreed with those for the induction and inhibition of the fragmentation, respectively. A kinetic model similar to that of phytochrome action explained quantitatively the fluence rate-response curves of the fragmentation. Our results indicate that one of the photoreceptors for the plasmodial fragmentation is a phytochrome.
Iwanaga, Akiko; Sasaki, Akira
2004-04-01
A striking linear dominance relationship for uniparental mitochondrial transmission is known between many mating types of plasmodial slime mold Physarum polycephalum. We herein examine how such hierarchical cytoplasmic inheritance evolves in isogamous organisms with many self-incompatible mating types. We assume that a nuclear locus determines the mating type of gametes and that another nuclear locus controls the digestion of mitochondria DNAs (mtDNAs) of the recipient gamete after fusion. We then examine the coupled genetic dynamics for the evolution of self-incompatible mating types and biased mitochondrial transmission between them. In Physarum, a multiallelic nuclear locus matA controls both the mating type of the gametes and the selective elimination of the mtDNA in the zygotes. We theoretically examine two potential mechanisms that might be responsible for the preferential digestion of mitochondria in the zygote. In the first model, the preferential digestion of mitochondria is assumed to be the outcome of differential expression levels of a suppressor gene carried by each gamete (suppression-power model). In the second model (site-specific nuclease model), the digestion of mtDNAs is assumed to be due to their cleavage by a site-specific nuclease that cuts the mtDNA at unmethylated recognition sites. Also assumed is that the mtDNAs are methylated at the same recognition site prior to the fusion, thereby being protected against the nuclease of the same gamete, and that the suppressor alleles convey information for the recognition sequences of nuclease and methylase. In both models, we found that a linear dominance hierarchy evolves as a consequence of the buildup of a strong linkage disequilibrium between the mating-type locus and the suppressor locus, though it fails to evolve if the recombination rate between the two loci is larger than a threshold. This threshold recombination rate depends on the number of mating types and the degree of fitness reduction in
Wojtkowska, Małgorzata; Buczek, Dorota; Stobienia, Olgierd; Karachitos, Andonis; Antoniewicz, Monika; Slocinska, Małgorzata; Makałowski, Wojciech; Kmita, Hanna
2015-07-01
Protein import into mitochondria requires a wide variety of proteins, forming complexes in both mitochondrial membranes. The TOM complex (translocase of the outer membrane) is responsible for decoding of targeting signals, translocation of imported proteins across or into the outer membrane, and their subsequent sorting. Thus the TOM complex is regarded as the main gate into mitochondria for imported proteins. Available data indicate that mitochondria of representative organisms from across the major phylogenetic lineages of eukaryotes differ in subunit organization of the TOM complex. The subunit organization of the TOM complex in the Amoebozoa is still elusive, so we decided to investigate its organization in the soil amoeba Acanthamoeba castellanii and the slime mold Dictyostelium discoideum. They represent two major subclades of the Amoebozoa: the Lobosa and Conosa, respectively. Our results confirm the presence of Tom70, Tom40 and Tom7 in the A. castellanii and D. discoideum TOM complex, while the presence of Tom22 and Tom20 is less supported. Interestingly, the Tom proteins display the highest similarity to Opisthokonta cognate proteins, with the exception of Tom40. Thus representatives of two major subclades of the Amoebozoa appear to be similar in organization of the TOM complex, despite differences in their lifestyle. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
Umedachi, Takuya; Idei, Ryo; Ito, Kentaro; Ishiguro, Akio
2013-01-01
Behavioral diversity is an essential feature of living systems, enabling them to exhibit adaptive behavior in hostile and dynamically changing environments. However, traditional engineering approaches strive to avoid, or suppress, the behavioral diversity in artificial systems to achieve high performance in specific environments for given tasks. The goals of this research include understanding how living systems exhibit behavioral diversity and using these findings to build lifelike robots that exhibit truly adaptive behaviors. To this end, we have focused on one of the most primitive forms of intelligence concerning behavioral diversity, namely, a plasmodium of true slime mold. The plasmodium is a large amoeba-like unicellular organism that does not possess any nervous system or specialized organs. However, it exhibits versatile spatiotemporal oscillatory patterns and switches spontaneously between these. Inspired by the plasmodium, we built a mathematical model that exhibits versatile oscillatory patterns and spontaneously transitions between these patterns. This model demonstrates that, in contrast to coupled nonlinear oscillators with a well-designed complex diffusion network, physically interacting mechanosensory oscillators are capable of generating versatile oscillatory patterns without changing any parameters. Thus, the results are expected to shed new light on the design scheme for lifelike robots that exhibit amazingly versatile and adaptive behaviors.
Biolithography: Slime mould patterning of polyaniline
NASA Astrophysics Data System (ADS)
Berzina, Tatiana; Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Iannotta, Salvatore
2018-03-01
Slime mould Physarum polycephalum develops intricate patterns of protoplasmic networks when foraging on a non-nutrient substrates. The networks are optimised for spanning larger spaces with minimum body mass and for quick transfer of nutrients and metabolites inside the slime mould's body. We hybridise the slime mould's networks with conductive polymer polyaniline and thus produce micro-patterns of conductive networks. This unconventional lithographic method opens new perspectives in development of living technology devices, biocompatible non-silicon hardware for applications in integrated circuits, bioelectronics, and biosensing.
Kaufmann, Stefan; Weiss, Ingrid M; Eckstein, Volker; Tanaka, Motomu
2012-03-09
In this paper, we expressed murine gap junction protein Cx43 in Dictyostelium discoideum by introducing the specific vector pDXA. In the first step, the successful expression of Cx43 and Cx43-eGFP was verified by (a) Western blot (anti-Cx43, anti-GFP), (b) fluorescence microscopy (eGFP-Cx43 co-expression, Cx43 immunostaining), and (c) flow cytometry analysis (eGFP-Cx43 co-expression). Although the fluorescence signals from cells expressing Cx43-eGFP detected by fluorescence microscopy seem relatively low, analysis by flow cytometry demonstrated that more than 60% of cells expressed Cx43-eGFP. In order to evaluate the function of expressed Cx43 in D. discoideum, we examined the hemi-channel function of Cx43. In this series of experiments, the passive uptake of carboxyfluorescein was monitored using flow cytometric analysis. A significant number of the transfected cells showed a prominent dye uptake in the absence of Ca(2+). The dye uptake by transfected cells in the presence of Ca(2+) was even lower than the non-specific dye uptake by non-transformed Ax3 orf+ cells, confirming that Cx43 expressed in D. discoideum retains its Ca(2+)-dependent, specific gating function. The expression of gap junction proteins expressed in slime molds opens a possibility to the biological significance of intercellular communications in development and maintenance of multicellular organisms. Copyright © 2012 Elsevier Inc. All rights reserved.
Kihara, Kumiko; Mori, Kotaro; Suzuki, Shingo; Ono, Naoaki; Furusawa, Chikara; Yomo, Tetsuya
2009-05-01
Escherichia coli and the cellular slime mold Dictyostelium discoideum form stable viscous symbiotic colonies in the laboratory. To examine changes in E. coli gene expression during establishment of this symbiotic relationship, cells of symbiotic co-cultures and monocultures at various time points were subjected to microarrays analysis. Genes changed significantly over time compared to the initial gene expression level were determined as characteristics of GO function categories. The categories that appeared significantly at the same sampling time points between the two cultures were also identified. Up-regulation of genes from several GO categories associated with polysaccharide synthesis, cell wall degradation, and iron acquisition as well as down-regulation of genes from GO categories associated with biosynthesis through starvation response were observed in co-cultures, indicating exchange of molecules between the two organisms. Up-regulation of genes from several GO categories associated with anaerobic respiration and flagella biosynthesis were also observed, indicating that the environment inside symbiotic colonies was similar to that in developed biofilms. Up-regulation of genes associated with energy-generating systems indicated that E. coli prolonged survival within the symbiotic colony. Thus, E. coli showed not only molecule exchange but also altered expression of various genes in symbiosis with D. discoideum.
Inquiry, Slime, and the National Standards
ERIC Educational Resources Information Center
Krantz, Patrick D.
2004-01-01
This elementary activity follows the 5-E Learning Cycle as described by Bybee et al. (1989) and integrates literature from Dr. Seuss. Students observe and identify characteristics of several slime substances and must make comparisons to determine which one most closely resembles the slime substance described by Dr. Seuss. To maximize this…
Hydrogel Beads: The New Slime Lab?
ERIC Educational Resources Information Center
Brockway, Debra; Libera, Matthew; Welner, Heidi
2011-01-01
Creating slime fascinates students. Unfortunately, though intrigue is at its peak, the educational aspect of this activity is often minimal. This article describes a chemistry lab that closely relates to the slime lab and allows high school students to explore the concepts of chemical bonding, properties, and replacement reactions. It involves the…
NASA Astrophysics Data System (ADS)
Takamatsu, Atsuko
2006-11-01
Three-oscillator systems with plasmodia of true slime mold, Physarum polycephalum, which is an oscillatory amoeba-like unicellular organism, were experimentally constructed and their spatio-temporal patterns were investigated. Three typical spatio-temporal patterns were found: rotation ( R), partial in-phase ( PI), and partial anti-phase with double frequency ( PA). In pattern R, phase differences between adjacent oscillators were almost 120 ∘. In pattern PI, two oscillators were in-phase and the third oscillator showed anti-phase against the two oscillators. In pattern PA, two oscillators showed anti-phase and the third oscillator showed frequency doubling oscillation with small amplitude. Actually each pattern is not perfectly stable but quasi-stable. Interestingly, the system shows spontaneous switching among the multiple quasi-stable patterns. Statistical analyses revealed a characteristic in the residence time of each pattern: the histograms seem to have Gamma-like distribution form but with a sharp peak and a tail on the side of long period. That suggests the attractor of this system has complex structure composed of at least three types of sub-attractors: a “Gamma attractor”-involved with several Poisson processes, a “deterministic attractor”-the residence time is deterministic, and a “stable attractor”-each pattern is stable. When the coupling strength was small, only the Gamma attractor was observed and switching behavior among patterns R, PI, and PA almost always via an asynchronous pattern named O. A conjecture is as follows: Internal/external noise exposes each pattern of R, PI, and PA coexisting around bifurcation points: That is observed as the Gamma attractor. As coupling strength increases, the deterministic attractor appears then followed by the stable attractor, always accompanied with the Gamma attractor. Switching behavior could be caused by regular existence of the Gamma attractor.
[Penile augmentation using acellular dermal matrix].
Zhang, Jin-ming; Cui, Yong-yan; Pan, Shu-juan; Liang, Wei-qiang; Chen, Xiao-xuan
2004-11-01
Penile enhancement was performed using acellular dermal matrix. Multiple layers of acellular dermal matrix were placed underneath the penile skin to enlarge its girth. Since March 2002, penile augmentation has been performed on 12 cases using acellular dermal matrix. Postoperatively all the patients had a 1.3-3.1 cm (2.6 cm in average) increase in penile girth in a flaccid state. The penis had normal appearance and feeling without contour deformities. All patients gained sexual ability 3 months after the operation. One had a delayed wound healing due to tight dressing, which was repaired with a scrotal skin flap. Penile enlargement by implantation of multiple layers of acellular dermal matrix was a safe and effective operation. This method can be performed in an outpatient ambulatory setting. The advantages of the acellular dermal matrix over the autogenous dermal fat grafts are elimination of donor site injury and scar and significant shortening of operation time.
Antiphagocytic Effect of Slime from a Mucoid Strain of Pseudomonas aeruginosa
Schwarzmann, Stephen; Boring, John R.
1971-01-01
Mucoid strains of Pseudomonas aeruginosa produce a viscid slime when grown on the surface of agar media. These strains are known to colonize persistently the tracheobronchial tree of children with cystic fibrosis. Colonization may result from inhibition of phagocytosis due to slime produced by the organism. Slime separated from one mucoid strain was examined to determine whether it possessed antiphagocytic activity in vitro. Cells of P. aeruginosa, Escherichia coli, and Staphylococcus aureus were rapidly phagocytized by rabbit polymorphonuclear leukocytes when mixtures were rotated for 2 hr at 37 C in the absence of slime. The addition of relatively small amounts of slime to bacteria and leukocytes inhibited phagocytosis as measured by phagocytic killing of the organisms. Inhibition was found to be most complete with P. aeruginosa. PMID:16558051
Slime mould foraging behaviour as optically coupled logical operations
NASA Astrophysics Data System (ADS)
Mayne, R.; Adamatzky, A.
2015-04-01
Physarum polycephalum is a macroscopic plasmodial slime mould whose apparently 'intelligent' behaviour patterns may be interpreted as computation. We employ plasmodial phototactic responses to construct laboratory prototypes of NOT and NAND logical gates with electrical inputs/outputs and optical coupling in which the slime mould plays dual roles of computing device and electrical conductor. Slime mould logical gates are fault tolerant and resettable. The results presented here demonstrate the malleability and resilience of biological systems and highlight how the innate behaviour patterns of living substrates may be used to implement useful computation.
Slime coating of kaolinite on chalcopyrite in saline water flotation
NASA Astrophysics Data System (ADS)
Li, Zhi-li; Rao, Feng; Song, Shao-xian; Li, Yan-mei; Liu, Wen-biao
2018-05-01
In saline water flotation, the salinity can cause a distinguishable slime coating of clay minerals on chalcopyrite particles through its effect on their electrical double layers in aqueous solutions. In this work, kaolinite was used as a representative clay mineral for studying slime coating during chalcopyrite flotation. The flotation of chalcopyrite in the presence and absence of kaolinite in tap water, seawater, and gypsum-saturated water and the stability of chalcopyrite and kaolinite particles in slurries are presented. Zeta-potential distributions and scanning electron microscopy images were used to characterize and explain the different slime coating degrees and the different flotation performances. Kaolinite particles induced slime coating on chalcopyrite surfaces and reduced chalcopyrite floatability to the greatest extent when the pH value was in the alkaline range. At 0.24wt% of kaolinite, the chalcopyrite floatability was depressed by more than 10% at alkaline pH levels in tap water. Salinity in seawater and gypsum-saturated water compressed the electrical double layers and resulted in extensive slime coating.
1992-12-01
engineering support for completed studies--namely, the wetlands, slime mold , and bird species and communities studies performed in Wisconsin-appears in previous...3 4. ENGINEERING SUPPORT ACTIVITIES 4.1 Soil Amoeba Growth Chambers 4.1.1 Background 3 The soil amoeba and now-completed slime mold studies both...cultures of soil amoeba and slime mold to the earth’s ambient temperature. It is also desirable to expose the cultures to the same EM environment that they
[Enzymatic activity, slime production and antifungal agent sensitivity of Candida sp].
Silva, Jaqueline Otero; Ferreira, Joseane Cristina; Candido, Regina Célia
2007-01-01
Abilith of Candida spp to secrete extracellular enzymes and slime has been associated as pathogenicity factors. Out of a total of 37 strains of Candida sp, 100% were proteinase producers, 83.8% were phospholipase producers, 64.9% were slime producers and 100% were sensitive to fluconazole and itraconazole. Seventeen typings (enzymes/slime) were found. This methodology presented a good discrimination rate (D=0.93) and could be used for phenotypic characterization of yeasts.
Recovery of Silver and Gold from Copper Anode Slimes
NASA Astrophysics Data System (ADS)
Chen, Ailiang; Peng, Zhiwei; Hwang, Jiann-Yang; Ma, Yutian; Liu, Xuheng; Chen, Xingyu
2015-02-01
Copper anode slimes, produced from copper electrolytic refining, are important industrial by-products containing several valuable metals, particularly silver and gold. This article provides a comprehensive overview of the development of the extraction processes for recovering silver and gold from conventional copper anode slimes. Existing processes, namely pyrometallurgical processes, hydrometallurgical processes, and hybrid processes involving the combination of pyrometallurgical and hydrometallurgical technologies, are discussed based in part on a review of the form and characteristics of silver and gold in copper anode slimes. The recovery of silver and gold in pyrometallurgical processes is influenced in part by the slag and matte/metal chemistry and related characteristics, whereas the extraction of these metals in hydrometallurgical processes depends on the leaching reagents used to break the structure of the silver- and gold-bearing phases, such as selenides. By taking advantage of both pyrometallurgical and hydrometallurgical techniques, high extraction yields of silver and gold can be obtained using such combined approaches that appear promising for efficient extraction of silver and gold from copper anode slimes.
Production and Characterization of the Slime Polysaccharide of Pseudomonas aeruginosa
Evans, Leigh R.; Linker, Alfred
1973-01-01
The slime polysaccharides produced by Pseudomonas aeruginosa isolated from a variety of human infections were investigated. Slime production in culture seemed optimal when adequate amounts of carbohydrate were present and under conditions of either high osmotic pressure or inadequate protein supply. The polysaccharides produced by the organisms were similar to each other, to the slime of Azotobacter vinelandii, and to seaweed alginic acids. They were composed of β-1,4-linked d-mannuronic acid residues and variable amounts of its 5-epimer l-guluronic acid. All bacterial polymers contained o-acetyl groups which are absent in the alginates. The polysaccharides differed considerably in the ratio of mannuronic to guluronic acid content and in the number of o-acetyl groups. The particular composition of the slime was not found to be characteristic for the disease process from which the mucoid variants of P. aeruginosa were obtained. PMID:4200860
Characterization of Raw and Decopperized Anode Slimes from a Chilean Refinery
NASA Astrophysics Data System (ADS)
Melo Aguilera, Evelyn; Hernández Vera, María Cecilia; Viñals, Joan; Graber Seguel, Teófilo
2016-04-01
This work characterizes raw and decopperized slimes, with the objective of identifying the phases in these two sub-products. The main phases in copper anodes are metallic copper, including CuO, which are present in free form or associated with the presence of copper selenide or tellurides (Cu2(Se,Te)) and several Cu-Pb-Sb-As-Bi oxides. During electrorefining, the impurities in the anode release and are not deposited in the cathode, part of them dissolving and concentrated in the electrolyte, and others form a raw anode slime that contains Au, Ag, Cu, As, Se, Te and PGM, depending on the composition of the anode. There are several recovery processes, most of which involve acid leaching in the first step to dissolve copper, whose product is decopperized anode slime. SEM analysis revealed that the mineralogical species present in the raw anode slime under study were mainly eucarite (CuAgSe), naumannite (Ag2Se), antimony arsenate (SbAsO4), and lead sulfate (PbSO4). In the case of decopperized slime, the particles were mainly composed of SbAsO4 (crystalline appearance), non-stoichiometric silver selenide (Ag(2- x)Se), and chlorargyrite (AgCl).
Enabling Learning through the Assessment Process
2010-04-08
Software, 47. 32 a specific pattern over time.”98 Johnson provides an example of this when discussing the computer simulation of slime mold growth. He...asserts that since the designers understood the underlying interactions between the individual slime molds , they could increase or decrease the...density of individual mold cells and the aggregating chemical that is required for the molds to group together. Furthermore, Johnson suggests that this
The Bark Myxomycetes--Their Collection, Culture and Identification
ERIC Educational Resources Information Center
Mitchell, David W.
1977-01-01
Describes a technique for isolating slime molds from tree bark and outlines projects for working with slime molds in the laboratory. Diagrams of 26 of the more common British species and a key to the Orders of Myxomcetes are given. (CS)
[Preparation of acellular matrix from antler cartilage and its biological compatibility].
Fu, Jing; Zhang, Wei; Zhang, Aiwu; Ma, Lijuan; Chu, Wenhui; Li, Chunyi
2017-06-01
To study the feasibility of acellular matrix materials prepared from deer antler cartilage and its biological compatibility so as to search for a new member of the extracellular matrix family for cartilage regeneration. The deer antler mesenchymal (M) layer tissue was harvested and treated through decellular process to prepare M layer acellular matrix; histologic observation and detection of M layer acellular matrix DNA content were carried out. The antler stem cells [antlerogenic periosteum (AP) cells] at 2nd passage were labelled by fluorescent stains and by PKH26. Subsequently, the M layer acellular matrix and the AP cells at 2nd passage were co-cultured for 7 days; then the samples were transplanted into nude mice to study the tissue compatibility of M layer acellular matrix in the living animals. HE and DAPI staining confirmed that the M layer acellular matrix did not contain nucleus; the DNA content of the M layer acellular matrix was (19.367±5.254) ng/mg, which was significantly lower than that of the normal M layer tissue [(3 805.500±519.119) ng/mg]( t =12.630, P =0.000). In vitro co-culture experiments showed that AP cells could adhere to or even embedded in the M layer acellular matrix. Nude mice transplantation experiments showed that the introduced AP cells could proliferate and induce angiogenesis in the M layer acellular matrix. The deer antler cartilage acellular matrix is successfully prepared. The M layer acellular matrix is suitable for adhesion and proliferation of AP cells in vitro and in vivo , and it has the function of stimulating angiogenesis. This model for deer antler cartilage acellular matrix can be applied in cartilage tissue engineering in the future.
Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael
2016-02-01
Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Stewart, L; Ponce, R; Oesterle, A L; Griffiss, J M; Way, L W
2000-01-01
Pigment stones are thought to form as a result of deconjugation of bilirubin by bacterial beta-glucuronidase, which results in precipitation of calcium bilirubinate. Calcium bilirubinate is then aggregated into stones by an anionic glycoprotein. Slime (glycocalyx), an anionic glycoprotein produced by bacteria causing foreign body infections, has been implicated in the formation of the precipitate that blocks biliary stents. We previously showed that bacteria are present within the pigment portions of gallstones and postulated a bacterial role in pigment stone formation through beta-glucuronidase or slime production. Ninety-one biliary bacterial isolates from 61 patients and 12 control stool organisms were tested for their production of beta-glucuronidase and slime. The average slime production was 42 for biliary bacteria and 2.5 for stool bacteria (P <0.001). Overall, 73% of biliary bacteria and 8% of stool bacteria produced slime (optical density >3). In contrast, only 38% of biliary bacteria produced beta-glucuronidase. Eighty-two percent of all patients, 90% of patients with common bile duct (CBD) stones, 100% of patients with primary CBD stones, and 93% of patients with biliary tubes had one or more bacterial species in their stones that produced slime. By comparison, only 47% of all patients, 60% of patients with CBD stones, 62% of patients with primary CBD stones, and 50% of patients with biliary tubes had one or more bacteria that produced beta-glucuronidase. Most biliary bacteria produced slime, and slime production correlated better than beta-glucuronidase production did with stone formation and the presence of biliary tubes or stents. Patients with primary CBD stones and biliary tubes had the highest incidence of slime production. These findings suggest that bacterial slime is important in gallstone formation and the blockage of biliary tubes.
de Lacy Costello, Ben P J; Adamatzky, Andrew I
2013-09-01
The chemotaxis behavior of the plasmodial stage of the true slime mold Physarum Polycephalum was assessed when given a binary choice between two volatile organic chemicals (VOCs) placed in its environment. All possible binary combinations were tested between 19 separate VOCs selected due to their prevalence and biological activity in common plant and insect species. The slime mold exhibited positive chemotaxis toward a number of VOCs with the following order of preference: Farnesene > β-myrcene > tridecane > limonene > p-cymene > 3-octanone > β-pinene > m-cresol > benzylacetate > cis-3-hexenylacetate. For the remaining compounds, no positive chemotaxis was observed in any of the experiments, and for most compounds there was an inhibitory effect on the growth of the slime mold. By assessing this lack of growth or failure to propagate, it was possible to produce a list of compounds ranked in terms of their inhibitory effect: nonanal > benzaldehyde > methylbenzoate > linalool > methyl-p-benzoquinone > eugenol > benzyl alcohol > geraniol > 2-phenylethanol. This analysis shows a distinct preference of the slime mold for non-oxygenated terpene and terpene-like compounds (farnesene, β-myrcene, limonene, p-cymene and β-pinene). In contrast, terpene-based alcohols such as geraniol and linalool were found to have a strong inhibitory effect on the slime mold. Both the aldehydes utilized in this study had the strongest inhibitory effect on the slime mold of all the 19 VOCs tested. Interestingly, 3-octanone, which has a strong association with a "fungal odor," was the only compound with an oxygenated functionality where Physarum Polycephalum exhibits distinct positive chemotaxis.
de Lacy Costello, Ben P.J.; Adamatzky, Andrew I.
2013-01-01
The chemotaxis behavior of the plasmodial stage of the true slime mold Physarum Polycephalum was assessed when given a binary choice between two volatile organic chemicals (VOCs) placed in its environment. All possible binary combinations were tested between 19 separate VOCs selected due to their prevalence and biological activity in common plant and insect species. The slime mold exhibited positive chemotaxis toward a number of VOCs with the following order of preference: Farnesene > β-myrcene > tridecane > limonene > p-cymene > 3-octanone > β-pinene > m-cresol > benzylacetate > cis-3-hexenylacetate. For the remaining compounds, no positive chemotaxis was observed in any of the experiments, and for most compounds there was an inhibitory effect on the growth of the slime mold. By assessing this lack of growth or failure to propagate, it was possible to produce a list of compounds ranked in terms of their inhibitory effect: nonanal > benzaldehyde > methylbenzoate > linalool > methyl-p-benzoquinone > eugenol > benzyl alcohol > geraniol > 2-phenylethanol. This analysis shows a distinct preference of the slime mold for non-oxygenated terpene and terpene-like compounds (farnesene, β-myrcene, limonene, p-cymene and β-pinene). In contrast, terpene-based alcohols such as geraniol and linalool were found to have a strong inhibitory effect on the slime mold. Both the aldehydes utilized in this study had the strongest inhibitory effect on the slime mold of all the 19 VOCs tested. Interestingly, 3-octanone, which has a strong association with a “fungal odor,” was the only compound with an oxygenated functionality where Physarum Polycephalum exhibits distinct positive chemotaxis. PMID:24265848
[NEW PROGRESS OF ACELLULAR FISH SKIN AS NOVEL TISSUE ENGINEERED SCAFFOLD].
Wei, Xiaojuan; Wang, Nanping; He, Lan; Guo, Xiuyu; Gu, Qisheng
2016-11-08
To review the recent research progress of acellular fish skin as a tissue engineered scaffold, and to analyze the feasibility and risk management in clinical application. The research and development, application status of acellular fish skin as a tissue engineered scaffold were comprehensively analyzed, and then several key points were put forward. Acellular fish skin has a huge potential in clinical practice as novel acellular extracellular matrix, but there have been no related research reports up to now in China. As an emerging point of translational medicine, investigation of acellular fish skin is mainly focused on artificial skin, surgical patch, and wound dressings. Development of acellular fish skin-based new products is concerned to be clinical feasible and necessary, but a lot of applied basic researches should be carried out.
Controlling Interacting Systems in Noisy Environments
2010-01-11
pattern formation and swarming as observed in biological populations including bacterial colonies [1, 3, 4], slime molds [22, 27], locusts [13] and fish...2968–2973, IEEE, Piscataway, NJ, 2001. [22] Herbert Levine and William Reynolds. Streaming instability of aggregating slime mold amoebae. Phys. Rev. Lett
Armour, Alexis D; Fish, Joel S; Woodhouse, Kimberly A; Semple, John L
2006-03-01
Dermal substitutes derived from xenograft materials require elaborate processing at a considerable cost. Acellularized porcine dermis is a readily available material associated with minimal immunogenicity. The objective of this study was to evaluate acellularized pig dermis as a scaffold for human fibroblasts. In vitro methods were used to evaluate fibroblast adherence, proliferation, and migration on pig acellularized dermal matrix. Acellular human dermis was used as a control. Pig acellularized dermal matrix was found to be inferior to human acellularized dermal matrix as a scaffold for human fibroblasts. Significantly more samples of human acellularized dermal matrix (83 percent, n = 24; p < 0.05) demonstrated fibroblast infiltration below the cell-seeded surface than pig acellularized dermal matrix (31 percent, n = 49). Significantly more (p < 0.05) fibroblasts infiltrated below the surface of human acellularized dermal matrix (mean, 1072 +/- 80 cells per section; n = 16 samples) than pig acellularized dermal matrix (mean, 301 +/- 48 cells per section; n = 16 samples). Fibroblasts migrated significantly less (p < 0.05) distance from the cell-seeded pig acellularized dermal matrix surface than in the human acellularized dermal matrix (78.8 percent versus 38.3 percent cells within 150 mum from the surface, respectively; n = 5). Fibroblasts proliferated more rapidly (p < 0.05) on pig acellularized dermal matrix (n = 9) than on the human acellularized dermal matrix (7.4-fold increase in cell number versus 1.8-fold increase, respectively; n = 9 for human acellularized dermal matrix). There was no difference between the two materials with respect to fibroblast adherence (8120 versus 7436 average adherent cells per section, for pig and human acellularized dermal matrix, respectively; n = 20 in each group; p > 0.05). Preliminary findings suggest that substantial differences may exist between human fibroblast behavior in cell-matrix interactions of porcine and human
Information propagation and nutrient flow in Physarum polycephalum
NASA Astrophysics Data System (ADS)
Amselem, Gabriel; Peaudecerf, Francois; Alim, Karen; Dumais, Jacques; Pringle, Anne; Brenner, Michael
2012-02-01
Basal organisms such as slime mold and fungi grow as extended networks that can reach several square meters in size. Despite lacking a central coordination center, these organisms are able to globally reshape their morphology in response to local cues, such as the presence of a patch of nutrient. How are local signals integrated in these organisms, and how do they lead to an overall response? To answer this question, we focus on the flow of nutrients in the slime mold Physarum polycephalum. This slime mold exhibits internal flow oscillations, as well as periodic contractions of its veins. Using plastic masks, we constrain network growth to simple geometries. This allows for an experimental characterization of the relationship between the contractions and the flow. We next describe the change in the overall oscillation pattern when a food source is presented locally to the slime mold, and its implication on the internal flow. Internal flows are both inferred from the contraction pattern and experimentally measured using fluorescent markers.
Ciftci, Alper; Findik, Arzu; Onuk, Ertan Emek; Savasan, Serap
2009-01-01
This study aimed to detect methicillin resistant and slime producing Staphylococcus aureus in cases of bovine mastitis. A triplex PCR was optimized targetting 16S rRNA, nuc and mecA genes for detection of Staphylococcus species, S. aureus and methicillin resistance, respectively. Furthermore, for detection of slime producing strains, a PCR assay targetting icaA and icaD genes was performed. In this study, 59 strains were detected as S. aureus by both conventional tests and PCR, and 13 of them were found to be methicillin resistant and 4 (30.7%) were positive for mecA gene. Although 22 of 59 (37.2%) S. aureus isolates were slime-producing in Congo Red Agar, in PCR analysis only 15 were positive for both icaA and icaD genes. Sixteen and 38 out of 59 strains were positive for icaA and icaD gene, respectively. Only 2 of 59 strains were positive for both methicillin resistance and slime producing, phenotypically, suggesting lack of correlation between methicillin resistance and slime production in these isolates. In conclusion, the optimized triplex PCR in this study was useful for rapid and reliable detection of methicillin resistant S. aureus. Furthermore, only PCR targetting icaA and icaD may not sufficient to detect slime production and further studies targetting other ica genes should be conducted for accurate evaluation of slime production characters of S. aureus strains. PMID:24031354
Determination of Calorific Ability of Fuel Briquettes on the Basis of Oil and Oil Slimes
NASA Astrophysics Data System (ADS)
Fedyaeva, O. A.; Poshelyuzhnaya, E. G.; Rakhmatulina, E. M.; Zakharov, V. A.; Fisenko, T. E.
2018-01-01
Utilization and neutralization of oil slimes is one of important environmental problems of the oil-extracting, oil-processing and petrochemical industry. The easiest and economic way of utilization of oil slimes is their use as a part of the bricketed boiler fuel. In this work the highest calorific ability of crude oil, the oil slimes and fuel briquettes made on their basis is defined. A research problem was carrying out the technical analysis of oil fuels on the content in them analytical moisture, the cindery rest and volatiles. It is established that in comparison with oil slimes crude oil possesses bigger highest calorific ability, has smaller humidity and an ash-content. The highest calorific abilities of the boiler briquettes made of samples of crude oil, oil slimes and peat made 14 - 26 MJ/kg.
NASA Astrophysics Data System (ADS)
Asghar, Z.; Ali, N.; Anwar Bég, O.; Javed, T.
2018-06-01
Gliding bacteria are virtually everywhere. These organisms are phylogenetically diverse with their hundreds of types, different shapes and several modes of motility. One possible mode of gliding motility in the rod shaped bacteria is that they propel themselves by producing undulating waves in their body. Few bacteria glides near the solid surface over the slime without any aid of flagella so the classical Navier-Stokes equations are incapable of explaining the slime rheology at the microscopic level. Micropolar fluid dynamics however provides a solid framework for mimicking bacterial physical phenomena at both micro and nano-scales, and therefore we use the micropolar fluid to characterize the rheology of a thin layer of slime and its dominant microrotation effects. It is also assumed that there is a certain degree of slip between slime and bacterial undulating surface and also between slime and solid substrate. The flow equations are formulated under long wavelength and low Reynolds number assumptions. Exact expressions for stream function and pressure gradient are obtained. The speed of the gliding bacteria is numerically calculated by using a modified Newton-Raphson method. Slip effects and effects of non-Newtonian slime parameters on bacterial speed and power are also quantified. In addition, when the glider is fixed, the effects of slip and rheological properties of micropolar slime parameters on the velocity, micro-rotation (angular velocity) of spherical slime particles, pressure rise per wavelength, pumping and trapping phenomena are also shown graphically and discussed in detail. The study is relevant to emerging biofuel cell technologies and also bacterial biophysics.
Magnetic nanoparticles-loaded Physarum polycephalum: Directed growth and particles distribution.
Dimonte, Alice; Cifarelli, Angelica; Berzina, Tatiana; Chiesi, Valentina; Ferro, Patrizia; Besagni, Tullo; Albertini, Franca; Adamatzky, Andrew; Erokhin, Victor
2014-11-06
Slime mold Physarum polycephalum is a single cell visible by an unaided eye. The slime mold optimizes its network of protoplasmic tubes to minimize expose to repellents and maximize expose to attractants and to make efficient transportation of nutrients. These properties of P. polycephalum, together with simplicity of its handling and culturing, make it a priceless substrate for designing novel sensing, computing and actuating architectures in living amorphous biological substrate. We demonstrate that, by loading Physarum with magnetic particles and positioning it in a magnetic field, we can, in principle, impose analog control procedures to precisely route active growing zones of slime mold and shape topology of its protoplasmic networks.
Magnetic Nanoparticles-Loaded Physarum polycephalum: Directed Growth and Particles Distribution.
Dimonte, Alice; Cifarelli, Angelica; Berzina, Tatiana; Chiesi, Valentina; Ferro, Patrizia; Besagni, Tullo; Albertini, Franca; Adamatzky, Andrew; Erokhin, Victor
2015-12-01
Slime mold Physarum polycephalum is a single cell visible by an unaided eye. The slime mold optimizes its network of protoplasmic tubes to minimize expose to repellents and maximize expose to attractants and to make efficient transportation of nutrients. These properties of P. polycephalum, together with simplicity of its handling and culturing, make it a priceless substrate for designing novel sensing, computing and actuating architectures in living amorphous biological substrate. We demonstrate that, by loading Physarum with magnetic particles and positioning it in a magnetic field, we can, in principle, impose analog control procedures to precisely route active growing zones of slime mold and shape topology of its protoplasmic networks.
Controlling Interacting Systems in Noisy Environments
2010-10-06
including bacterial colonies [1, 3, 4], slime molds [22, 27], locusts [13] and fish [8]. Mathematical studies of this behavior have been performed for a few...Reynolds. Streaming instability of aggregating slime mold amoebae. Phys. Rev. Lett., 66(18):2400–2403, May 1991. [23] K. M. Lynch, I. B. Schwartz, P
Liese, Johannes G; Rieber, Nikolaus; Malzer, Thomas; Ocak, Marion; Johnson, David R; Decker, Michael D
2010-12-01
Safety of a sixth consecutive dose of acellular pertussis vaccine in adolescents was assessed in a 2-armed, randomized study. Adolescents who had received 5 doses of acellular pertussis vaccine combined with diphtheria and tetanus toxoids (6-dose group) received 1 dose of reduced 5-component acellular pertussis vaccine combined with tetanus toxoid and reduced diphtheria toxoid (Tdap). Adolescents who had received a primary series of 3 doses of whole-cell pertussis and 1 acellular or whole-cell pertussis booster received 1 dose of Tdap vaccine (5-dose group). Of 214 participants, 176 (82%) reported an injection-site reaction with pain (80%), erythema (22%), and swelling (19%) most frequently reported. A systemic reaction was reported by 169 of 214 (79%) with myalgia (66%), headache (42%), malaise (39%), and fever (9%) most frequently reported. The overall rate of solicited reactions was lower in the 6-dose group than in the 5-dose group (for injection-site reactions: 76.1% vs. 89.7%; for systemic reactions 72.6% vs. 86.6%). Significant differences were observed for injection-site pain, erythema, and for grade 1 or grade 2 increases in arm circumference. Fever, myalgia, and headache were reported at a significantly lower rate in the 6-dose group. Swelling >10 cm was observed in 5 patients (2%), 4 in the 5-dose group. Tdap vaccine was safe when given to adolescents who had received 5 prior doses of acellular pertussis vaccine.
Amoeboid organism solves complex nutritional challenges
Dussutour, Audrey; Latty, Tanya; Beekman, Madeleine; Simpson, Stephen J.
2010-01-01
A fundamental question in nutritional biology is how distributed systems maintain an optimal supply of multiple nutrients essential for life and reproduction. In the case of animals, the nutritional requirements of the cells within the body are coordinated by the brain in neural and chemical dialogue with sensory systems and peripheral organs. At the level of an insect society, the requirements for the entire colony are met by the foraging efforts of a minority of workers responding to cues emanating from the brood. Both examples involve components specialized to deal with nutrient supply and demand (brains and peripheral organs, foragers and brood). However, some of the most species-rich, largest, and ecologically significant heterotrophic organisms on earth, such as the vast mycelial networks of fungi, comprise distributed networks without specialized centers: How do these organisms coordinate the search for multiple nutrients? We address this question in the acellular slime mold Physarum polycephalum and show that this extraordinary organism can make complex nutritional decisions, despite lacking a coordination center and comprising only a single vast multinucleate cell. We show that a single slime mold is able to grow to contact patches of different nutrient quality in the precise proportions necessary to compose an optimal diet. That such organisms have the capacity to maintain the balance of carbon- and nitrogen-based nutrients by selective foraging has considerable implications not only for our understanding of nutrient balancing in distributed systems but for the functional ecology of soils, nutrient cycling, and carbon sequestration. PMID:20142479
Yazgi, H; Uyanik, M H; Ayyildiz, A
2009-01-01
This study investigated the colonization of slime-producing coagulase-negative Staphylococcus (CoNS) in 80 patient wards in Turkey (40 vinyl and 40 ceramic tile floors). A total of 480 samples that included 557 CoNS isolates were obtained. Slime production was investigated with the Christensen method and methicillin-susceptibility was tested by the disk-diffusion method. There was a significant difference in the percentage of slime-producing CoNS isolates on vinyl (12.4%) versus ceramic tile flooring (4.4%). From vinyl flooring, the percentage of slime producing methicillin-resistant CoNS (MRCoNS) (8.9%) was significantly higher than for methicillin-sensitive CoNS (MSCoNS) (3.6%), whereas there was no difference from ceramic tile flooring (2.5% MRCoNS versus 1.8% MSCoNS). The most commonly isolated slime-producing CoNS species was S. epidermidis on both types of flooring. It is concluded that vinyl flooring seems to be a more suitable colonization surface for slime-producing CoNS than ceramic tile floors. Further studies are needed to investigate bacterial strains colonized on flooring materials, which are potential pathogens for nosocomial infections.
Catalanotti, Piergiorgio; Lanza, Michele; Del Prete, Antonio; Lucido, Maria; Catania, Maria Rosaria; Gallè, Francesca; Boggia, Daniela; Perfetto, Brunella; Rossano, Fabio
2005-10-01
In recent years, an increase in ocular pathologies related to soft contact lens has been observed. The most common infectious agents were Staphylococcus spp. Some strains produce an extracellular polysaccharidic slime that can cause severe infections. Polysaccharide synthesis is under genetic control and involves a specific intercellular adhesion (ica) locus, in particular, icaA and icaD genes. Conjunctival swabs from 97 patients with presumably bacterial bilateral conjunctivitis, wearers of soft contact lenses were examined. We determined the ability of staphylococci to produce slime, relating it to the presence of icaA and icaD genes. We also investigated the antibiotic susceptibility and Pulsed Field Gel Electrophoresis (PFGE) patterns of the clinical isolates. We found that 74.1% of the S. epidermidis strains and 61.1% of the S. aureus strains isolated were slime producers and showed icaA and icaD genes. Both S. epidermidis and S. aureus slime-producing strains exhibited more surface hydrophobicity than non-producing slime strains. The PFGE patterns overlapped in S. epidermidis strains with high hydrophobicity. The similar PFGE patterns were not related to biofilm production. We found scarce matching among the Staphylococcus spp. studied, slime production, surface hydrophobicity and antibiotic susceptibility.
Combined use of fibrin tissue adhesive and acellular dermis in dural repair.
Shah, Anil R; Pearlman, Aaron N; O'Grady, Kevin M; Bhattacharyya, Tappan K; Toriumi, Dean M
2007-01-01
The management of cerebrospinal fluid (CSF) leaks can be challenging. Acellular dermal grafts derived from human cadavers can be used as a replacement material when autogenous materials are unavailable. Fibrin tissue adhesive (FTA) is a wound support product that has been used for hemostatic and tissue fixation purposes. The combined use of acellular dermis in conjunction with FTA for dural repair remains a subject of study. The aim of this study was to evaluate wound healing and tissue compatibility characteristics of acellular dermal substitute material when used both with and without FTA, for repair of a dural tear in a chinchilla model. Forty-nine chinchillas were included in this randomized case-control study. The squamous portion of the temporal bone was removed to expose the tegmen. A 2 x 2 mm dural defect was removed to create an iatrogenic CSF leak. Then, animals were randomly assigned to one of three treatment groups: group 1, acellular dermis alone; group 2, acellular dermis with FTA; group 3, fibrinogen, acellular dermis, and FTA. Surgical sites were examined grossly at 1- and 2-week intervals. Temporal bones were examined histologically. Grossly, groups 2 and 3 had significantly less visible CSF leak and brain herniation noted at both 1- and 2-week intervals when compared with group 1. Histological results confirmed the gross results showing the best seal in group 2 and 3. Acellular dermis combined with FTA provided superior support compared with acellular dermis alone in repair of induced dural defects.
Acellular vaccines for preventing whooping cough in children.
Zhang, Linjie; Prietsch, Sílvio Om; Axelsson, Inge; Halperin, Scott A
2011-01-19
Routine use of whole-cell pertussis vaccines was suspended in some countries in the 1970s/1980s because of concerns about adverse effects. There was a resurgence of whooping cough. Acellular pertussis vaccines (containing purified or recombinant Bordetella pertussis antigens) were developed in the hope that they would be as effective but less reactogenic than the whole-cell vaccines. To assess the efficacy and safety of acellular pertussis vaccines in children. We searched the Cochrane Register of Controlled Trials (CENTRAL) (The Cochrane Library 2009, issue 2) which contains the Acute Respiratory Infections Group's Specialised Register; MEDLINE (1950 to April week 2 2009) and EMBASE (1974 to April 2009). Double-blind randomised efficacy and safety trials of acellular pertussis vaccines in children up to six years old, with active follow-up of participants and laboratory verification of pertussis cases. Two review authors independently performed data extraction and study quality assessment. Differences in trial design precluded pooling of the efficacy data. The safety data from individual trials were pooled using the Cochrane statistical package Review Manager 5. Six efficacy trials and 52 safety trials were included. The efficacy of multi-component (≥ 3) vaccines varied from 84% to 85% in preventing typical whooping cough, and from 71% to 78% in preventing mild pertussis disease. In contrast, the efficacy of one- and two-component vaccines varied from 59% to 75% against typical whooping cough, and from 13% to 54% against mild pertussis disease. Multi-component acellular vaccines is more effective than low-efficacy whole-cell vaccines, but may be less effective than the highest-efficacy whole-cell vaccines. Most systemic and local adverse events were significantly less common with acellular than with whole-cell pertussis vaccines for the primary series as well as for the booster dose. Multi-component acellular pertussis vaccines are effective, and show less
Axonal regeneration through acellular muscle grafts
HALL, SUSAN
1997-01-01
The management of peripheral nerve injury remains a major clinical problem. Progress in this field will almost certainly depend upon manipulating the pathophysiological processes which are triggered by traumatic injuries. One of the most important determinants of functional outcome after the reconstruction of a transected peripheral nerve is the length of the gap between proximal and distal nerve stumps. Long defects (> 2 cm) must be bridged by a suitable conduit in order to support axonal regrowth. This review examines the cellular and acellular elements which facilitate axonal regrowth and the use of acellular muscle grafts in the repair of injuries in the peripheral nervous system. PMID:9034882
Stewart, Lygia; Griffiss, J McLeod; Jarvis, Gary A; Way, Lawrence W
2007-08-01
Gallstone bacteria provide a reservoir for biliary infections. Slime production facilitates adherence, whereas beta-glucuronidase and phospholipase generate colonization surface. These factors facilitate gallstone formation, but their influence on infection severity is unknown. Two hundred ninety-two patients were studied. Gallstones, bile, and blood (as applicable) were cultured. Bacteria were tested for beta-glucuronidase/phospholipase production and quantitative slime production. Infection severity was correlated with bacterial factors. Bacteria were present in 43% of cases, 13% with bacteremia. Severe infections correlated directly with beta-glucuronidase/phospholipase (55% with vs 13% without, P < 0.0001), but inversely with slime production (55 vs 8%, slime <75 or >75, P = 0.008). Low slime production and beta-glucuronidase/phospholipase production were additive: Severe infections were present in 76% with both, but 10% with either or none (P < 0.0001). beta-Glucuronidase/phospholipase production facilitated bactibilia (86% with vs 62% without, P = 0.03). Slime production was 19 (+/-8) vs 50 (+/-10) for bacteria that did or did not cause bacteremia (P = 0.004). No bacteria with slime >75 demonstrated bacteremia. Bacteria-laden gallstones are biofilms whose characteristics influence illness severity. Factors creating colonization surface (beta-glucuronidase/phospholipase) facilitated bacteremia and severe infections; but abundant slime production, while facilitating colonization, inhibited detachment and cholangiovenous reflux. This shows how properties of the gallstone biofilm determine the severity of the associated illness.
Krishnan, Naveen M; Chatterjee, Abhishek; Rosenkranz, Kari M; Powell, Stephen G; Nigriny, John F; Vidal, Dale C
2014-04-01
Expander-implant breast reconstruction is often supplemented with acellular dermal matrix (ADM). The use of acellular dermal matrix has allowed for faster, less painful expansions and improved aesthetics, but with increased cost. Our goal was to provide the first cost utility analysis of using acellular dermal matrix in two-stage, expander-implant immediate breast reconstruction following mastectomy. A comprehensive literature review was conducted to identify complication rates for two-stage, expander-implant immediate breast reconstruction with and without acellular dermal matrix. The probabilities of the most common complications were combined with Medicare Current Procedural Terminology reimbursement codes and expert utility estimates to fit into a decision model. The decision model evaluated the cost effectiveness of acellular dermal matrix relative to reconstructions without it. Retail costs for ADM were derived from the LifeCell 2012 company catalogue for Alloderm. The overall complication rates were 30% and 34.5% with and without ADM. The decision model revealed a baseline cost increase of $361.96 when acellular dermal matrix is used. The increase in Quality-Adjusted Life Years (QALYs) is 1.37 in the population with acellular dermal matrix. This yields a cost effective incremental cost-utility ratio (ICUR) of $264.20/QALY. Univariate sensitivity analysis confirmed that using acellular dermal matrix is cost effective even when using retail costs for unilateral and bilateral reconstructions. Our study shows that, despite an increased cost, acellular dermal matrix is a cost effective technology for patients undergoing two-stage, expander-implant immediate breast reconstruction due to its increased utility in successful procedures. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Hagfish predatory behaviour and slime defence mechanism
Zintzen, Vincent; Roberts, Clive D.; Anderson, Marti J.; Stewart, Andrew L.; Struthers, Carl D.; Harvey, Euan S.
2011-01-01
Hagfishes (Myxinidae), a family of jawless marine pre-vertebrates, hold a unique evolutionary position, sharing a joint ancestor with the entire vertebrate lineage. They are thought to fulfil primarily the ecological niche of scavengers in the deep ocean. However, we present new footage from baited video cameras that captured images of hagfishes actively preying on other fish. Video images also revealed that hagfishes are able to choke their would-be predators with gill-clogging slime. This is the first time that predatory behaviour has been witnessed in this family, and also demonstrates the instantaneous effectiveness of hagfish slime to deter fish predators. These observations suggest that the functional adaptations and ecological role of hagfishes, past and present, might be far more diverse than previously assumed. We propose that the enduring success of this oldest extant family of fishes over 300 million years could largely be due to their unique combination of functional traits. PMID:22355648
Acellular Nerve Allografts in Peripheral Nerve Regeneration: A Comparative Study
Moore, Amy M.; MacEwan, Matthew; Santosa, Katherine B.; Chenard, Kristofer E.; Ray, Wilson Z.; Hunter, Daniel A.; Mackinnon, Susan E.; Johnson, Philip J.
2011-01-01
Background Processed nerve allografts offer a promising alternative to nerve autografts in the surgical management of peripheral nerve injuries where short deficits exist. Methods Three established models of acellular nerve allograft (cold-preserved, detergent-processed, and AxoGen® -processed nerve allografts) were compared to nerve isografts and silicone nerve guidance conduits in a 14 mm rat sciatic nerve defect. Results All acellular nerve grafts were superior to silicone nerve conduits in support of nerve regeneration. Detergent-processed allografts were similar to isografts at 6 weeks post-operatively, while AxoGen®-processed and cold-preserved allografts supported significantly fewer regenerating nerve fibers. Measurement of muscle force confirmed that detergent-processed allografts promoted isograft-equivalent levels of motor recovery 16 weeks post-operatively. All acellular allografts promoted greater amounts of motor recovery compared to silicone conduits. Conclusions These findings provide evidence that differential processing for removal of cellular constituents in preparing acellular nerve allografts affects recovery in vivo. PMID:21660979
D'Antonio, D; Parruti, G; Pontieri, E; Di Bonaventura, G; Manzoli, L; Sferra, R; Vetuschi, A; Piccolomini, R; Romano, F; Staniscia, T
2004-10-01
In order to expand the present knowledge of the pathogenic potential of Blastoschizomyces capitatus in central venous catheter (CVC)-related bloodstream infections, six strains of the organism recovered from three leukemic patients with CVC-related fungemia in different years were investigated. Isolates and control strains were tested for their genetic relatedness and for their ability to produce slime in glucose-containing solutions. DNA restriction enzyme analysis revealed that all strains of B. capitatus were identical, whereas slime production assays and examination of ex vivo material showed that they were able to produce large amounts of slime. Slime production may therefore play a relevant pathogenic role in cases of CVC-related fungemia caused by B. capitatus.
Killing effect of peppermint vapor against pink-slime forming microorganisms.
Ihara, Nozomi; Sakamoto, Jin; Yoshida, Munehiro; Tsuchido, Tetsuaki
2015-01-01
The killing effect of peppermint vapor (PMV) against pink-slime forming microorganisms, Methylobacterium mesophilicum as a bacterium and Rhodotorula mucilaginosa as a yeast, was investigated by the agar vapor assay. In this method, microbial cells were spread over the agar surface exposed to PMV in a petri dish, and then transferred into a recovery liquid. When 60μl of the peppermint liquid was added to a paper disc, a marked killing effect of PMV was observed after 48h against M. mesophilicum and after 168h against R. mucilaginosa. M. mesophilicum and R. mucilaginosa were found to be more resistant to PMV than Escherichia coli and Candida albicans, used as reference microorganisms, respectively. With the addition of 0.03% sodium pyruvate as a hydrogen peroxide scavenger in agar, the killing effect of PMV against E. coli and C. albicans was decreased, whereas it was little changed against M. mesophilicum and R. mucilaginosa. In fact, the properties of the killing effect of hydrogen peroxide solution at 0.2-1.0mM was in accord with those of PMV. M. mesophilicum and R. mucilaginosa were more resistant to the oxidant than E. coli and C. albicans, respectively. Results obtained suggested that reactive oxygen species (ROS) may be involved in the killing action of PMV and therefore pink-slime formers are more resistant to PMV than non-pink-slime formers because of the presence of carotenoids as an antioxidant in cells. We also suggest that the use of PMV appeared to be a potential tool for the control of pink-slime forming microorganisms occurring in wet areas of houses such as the bathroom and washing room.
Ngo, Manh-Dan; Aberman, Harold M; Hawes, Michael L; Choi, Bryan; Gertzman, Arthur A
2011-05-01
Incisional hernias commonly occur following abdominal wall surgery. Human acellular dermal matrices (HADM) are widely used in abdominal wall defect repair. Xenograft acellular dermal matrices, particularly those made from porcine tissues (PADM), have recently experienced increased usage. The purpose of this study was to compare the effectiveness of HADM and PADM in the repair of incisional abdominal wall hernias in a rabbit model. A review from earlier work of differences between human allograft acellular dermal matrices (HADM) and porcine xenograft acellular dermal matrices (PADM) demonstrated significant differences (P < 0.05) in mechanical properties: Tensile strength 15.7 MPa vs. 7.7 MPa for HADM and PADM, respectively. Cellular (fibroblast) infiltration was significantly greater for HADM vs. PADM (Armour). The HADM exhibited a more natural, less degraded collagen by electrophoresis as compared to PADM. The rabbit model surgically established an incisional hernia, which was repaired with one of the two acellular dermal matrices 3 weeks after the creation of the abdominal hernia. The animals were euthanized at 4 and 20 weeks and the wounds evaluated. Tissue ingrowth into the implant was significantly faster for the HADM as compared to PADM, 54 vs. 16% at 4 weeks, and 58 vs. 20% for HADM and PADM, respectively at 20 weeks. The original, induced hernia defect (6 cm(2)) was healed to a greater extent for HADM vs. PADM: 2.7 cm(2) unremodeled area for PADM vs. 1.0 cm² for HADM at 20 weeks. The inherent uniformity of tissue ingrowth and remodeling over time was very different for the HADM relative to the PADM. No differences were observed at the 4-week end point. However, the 20-week data exhibited a statistically different level of variability in the remodeling rate with the mean standard deviation of 0.96 for HADM as contrasted to a mean standard deviation of 2.69 for PADM. This was significant with P < 0.05 using a one tail F test for the inherent
[Influence of slime production and adhesion of Candida sp. on biofilm formation].
Ciok-Pater, Emilia; Smolak, Przemysław; Wróblewska, Joanna; Gospodarek, Eugenia
2011-01-01
The increase of fungal infections in recent years is connected with the progress in medicine. The vast usage of biomaterials is an inseparable element of contemporary medicine but it also leads to development of infections. Yeast-like fungi Candida albicans are still the main pathogen of candidiasis. The ability to slime production and adhesion to polystyrene of Candida sp. on different surfaces can cause to form biofilm on surfaces of biomaterials used in production of catheters, drains and prosthesis. The aim of the study was to evaluate the influence of slime production and adhesion to polystyrene, of Candida sp. on biofilm formation on different biomaterials. 50 strains of Candida sp. were examined. They isolated from ill to Clinics of Anesthesiology and Intensive Therapy University Hospital No 1 of dr. A. Jurasza in Bydgoszcz. The ability to slime production was evaluated by Christensen method in modification Davenport and Branchini methods. The adhesion to polystyrene was evaluated by Richards et el method. The ability to produce biofilm biomaterials by the studied fungi was measured after 72 hours of incubation at 37 degrees C on different biomaterials. Yeast-like fungi Candida sp. fabricating slime and adhesion forming frequently biofilm on surface researched of biomaterials. Influence of chosen biological specificity ascertain on the ability to produce biofilm on surfaces of siliconized latex and polyvinylchloride.
Evolution of the ubiquitin-activating enzyme Uba1 (E1)
NASA Astrophysics Data System (ADS)
Allan, Douglas C.; Phillips, J. C.
2017-10-01
Ubiquitin tags diseased proteins and initiates an enzyme conjugation cascade, which has three stages. The first-stage enzyme Uba1 (E1) has evolved only modestly from slime mold to humans, and is > 14 times larger than Ub. Here we use critical point thermodynamic scaling theory to connect Uba1 (E1) evolution from yeast and slime mold to fruit flies and humans to subtle changes in its amino acid sequences.
Recovering selenium from copper refinery slimes
NASA Astrophysics Data System (ADS)
Hyvärinen, Olli; Lindroos, Leo; Yllö, Erkki
1989-07-01
The selenium contained within copper refinery slimes may be recovered advantageously by roasting at about 600°C. While roasting in air is inefficient, roasting in a sulfating atmosphere enables practically complete selenium recovery. Based on laboratory tests, a new selenium recovery process was adopted at Outokumpu Copper Refinery. In this process, sulfation is achieved by feeding sulfur dioxide and oxygen into the roasting furnace.
Angiogenic response induced by acellular femoral matrix in vivo
Conconi, Maria Teresa; Nico, Beatrice; Rebuffat, Piera; Crivellato, Enrico; Parnigotto, Pier Paolo; Nussdorfer, Gastone G; Ribatti, Domenico
2005-01-01
We investigated the angiogenic response induced by acellular femoral matrices implanted in vivo on to the chick embryo chorioallantoic membrane (CAM), a useful model for such investigation. The results showed that acellular matrices were able to induce a strong angiogenic response, comparable with that of fibroblast growth factor-2 (FGF-2), a well-known angiogenic cytokine. The angiogenic response was further increased when exogenous FGF-2 or transforming growth factor beta-1 (TGF-β1) was added to the matrices and inhibited by the addition of anti-FGF-2 or anti-TGF-β1 antibodies. The response may be considered to be dependent on a direct angiogenic effect exerted by the matrices, and also in part by the presence of FGF-2 and TGF-β1 in the acellular matrices. PMID:16011546
ERIC Educational Resources Information Center
Isokawa, Naho; Fueda, Kazuki; Miyagawa, Korin; Kanno, Kenichi
2015-01-01
Poly(vinyl alcohol) (PVA) precipitates in many kinds of aqueous salt solutions. While sodium sulfate, a coagulant for PVA fiber, precipitates PVA to yield a white rigid gel, coagulation of PVA with aluminum sulfate, a coagulant for water treatment, yields a slime-like viscoelastic fluid. One type of homemade slime is prepared under basic…
Target Patterns in Reaction-Diffusion Systems,
1981-01-01
Riol. 37 (1974), 225-235. 8. M. H. COHEN AND S. A. ROBERTSON, Wave propagation in the early stages of aggregation of cellular slime molds . J. Theoret...the Zaikin-Zhabotinskii-Winfree reagent, Chem. Educ. 56 (1979), 574. 5. F. ALCANTARA AND M. MONK, Signal propagation during aggregation in the slime ... mold Dit’resteltu n discoideum. J. Gen. Microbiol. 85 (1974). 321-334. 6. M. S. COHEN AND P. S. HAGAN, Diffusion induced morphogenesis in the
Complex torso reconstruction with human acellular dermal matrix: long-term clinical follow-up.
Nemeth, Nicole L; Butler, Charles E
2009-01-01
Although reports have demonstrated good early outcomes with human acellular dermal matrix even when used for complex, contaminated defects, no long-term outcomes have been reported. The authors reviewed the long-term outcomes of 13 patients who had complex torso reconstructions that included human acellular dermal matrix. All patients were at increased risk for mesh-related complications. Eight patients died as a result of progression of their oncologic disease at a mean of 258 days postoperatively. The mean follow-up for the remaining five patients was 43.7 months. Six patients had early complications (none were human acellular dermal matrix-related) and were reported on previously. Two patients had developed complications since the initial report. One patient developed a flap donor-site seroma remote from the reconstruction site, and another developed a recurrent ventral hernia. No patients have required additional surgery for human acellular dermal matrix-related complications. This follow-up report indicates that human acellular dermal matrix repair of large, complex torso defects can result in good long-term outcomes even when patients are at high risk for mesh-related complications.
Curbing indoor mold growth with mold inhibitors
Carol A. Clausen; Vina W. Yang
2004-01-01
Environmentally acceptable mold inhibitors are needed to curb the growth of mold fungi in woodframe housing when moisture management measures fail. Excess indoor moisture can lead to rapid mold establishment which, in turn, can have deleterious affects on indoor air quality. Compounds with known mold inhibitory properties and low mammalian toxicity, such as food...
Resin film infusion mold tooling and molding method
NASA Technical Reports Server (NTRS)
Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)
1999-01-01
A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.
... Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores float ...
Interaction of gliding motion of bacteria with rheological properties of the slime.
Asghar, Z; Ali, N; Sajid, M
2017-08-01
Bacteria which do not have organelles of motility, such as flagella, adopt gliding as a mode of locomotion. In gliding motility bacterium moves under its own power by secreting a layer of slime on the substrate. The exact mechanism by which a glider achieves motility is yet in controversy but there are evidences which support the wave-like undulation on the surface of the organism, as a possible mechanism of motility. Based on this observation, a model of undulating sheet over a layer of slime is examined as a possible model of the gliding motion of a bacterium. Three different non-Newtonian constitutive equations namely, finite extendable nonlinear elastic-peterline (FENE-P), Simplified Phan-Thien-Tanner (SPTT) and Rabinowitsch equations are used to capture the rheological properties of the slime. It is found that the governing equation describing the fluid mechanics of the model under lubrication approximation is same for all the considered three constitutive equations. In fact, it involves a single non-Newtonian parameter which assumes different values for each of the considered constitutive relations. This differential equation is solved using both perturbation and semi-analytic procedure. The perturbation solution is exploited to get an estimate of the speed of the glider for different values of the non-Newtonian parameter. The solution obtained via semi-analytic procedure is used to investigate the important features of the flow field in the layer of the slime beneath the glider when the glider is held fixed. The expression of forces generated by the organism and power required for propulsion are also derived based on the perturbation analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...
Kintrup, J; Wünsch, G
2001-11-01
The capability of sewer slime to accumulate heavy metals from municipal wastewater can be exploited to identify the sources of sewage sludge pollution. Former investigations of sewer slime looked for a few elements only and could, therefore, not account for deviations of the enrichment efficiency of the slime or for irregularities from sampling. Results of ICP-MS multi element determinations were analyzed by multivariate statistical methods. A new dimensionless characteristic "sewer slime impact" is proposed, which is zero for unloaded samples. Patterns expressed in this data format specifically extract the information required to identify the type of pollution and polluter quicker and with less effort and cost than hitherto.
Statistical Physics Approaches to RNA Editing
NASA Astrophysics Data System (ADS)
Bundschuh, Ralf
2012-02-01
The central dogma of molecular Biology states that DNA is transcribed base by base into RNA which is in turn translated into proteins. However, some organisms edit their RNA before translation by inserting, deleting, or substituting individual or short stretches of bases. In many instances the mechanisms by which an organism recognizes the positions at which to edit or by which it performs the actual editing are unknown. One model system that stands out by its very high rate of on average one out of 25 bases being edited are the Myxomycetes, a class of slime molds. In this talk we will show how the computational methods and concepts from statistical Physics can be used to analyze DNA and protein sequence data to predict editing sites in these slime molds and to guide experiments that identified previously unknown types of editing as well as the complete set of editing events in the slime mold Physarum polycephalum.
Physarum polycephalum—a new take on a classic model system
NASA Astrophysics Data System (ADS)
Oettmeier, Christina; Brix, Klaudia; Döbereiner, Hans-Günther
2017-10-01
Physarum polycephalum, literally the ‘many-headed’ slime mold, is a giant multi-nucleated but unicellular protist. Since the time of its first description, it has been the subject of a multitude of cell biological, biochemical, genetic, and lately physical studies. The enormous size of the cell, the easy method of in vitro cultivation, the unique life cycle and its highly visible internal cytoplasmic streaming have made it invaluable for investigations on cell cycle regulation, differentiation, cytoskeleton and locomotion. Research on P. polycephalum lost its prominent role when animal cell culture and genetic techniques became more advanced, thereby replacing the slime mold as a state-of-the-art model. However, research continued, driven by a small number of groups, resulting in full sequencing of the slime mold’s genome, hence reviving interest in studying molecular processes that enable the astounding features of P. polycephalum. In recent years, research on P. polycephalum has again become cutting-edge. In 2000, Japanese researcher Toshiyuki Nakagaki performed a seminal experiment showing that the slime mold is able to find the shortest route through a maze. Ever since, smart problem-solving P. polycephalum has returned from the shadows and is nowadays back to center-stage when questions regarding the origins of intelligence and cognition are discussed. The basic mechanisms with which organisms perceive their environment, integrate this information and make decisions based on this input are investigated. The aim is to find underlying universal mechanisms of decision making and awareness. If those mechanisms can be found in as primordial an organism as a slime mold, it could fundamentally change our perception of the nature and evolution of cognition.
Cleft Palate Fistula Closure Utilizing Acellular Dermal Matrix.
Emodi, Omri; Ginini, Jiriys George; van Aalst, John A; Shilo, Dekel; Naddaf, Raja; Aizenbud, Dror; Rachmiel, Adi
2018-03-01
Fistulas represent failure of cleft palate repair. Secondary and tertiary fistula repair is challenging, with high recurrence rates. In the present retrospective study, we review the efficacy of using acellular dermal matrix as an interposition layer for cleft palate fistula closure in 20 consecutive patients between 2013 and 2016. Complete fistula closure was obtained in 16 patients; 1 patient had asymptomatic recurrent fistula; 2 patients had partial closure with reduction of fistula size and minimal nasal regurgitation; 1 patient developed a recurrent fistula without changes in symptoms (success rate of 85%). We conclude that utilizing acellular dermal matrix for cleft palate fistula repair is safe and simple with a high success rate.
Cleft Palate Fistula Closure Utilizing Acellular Dermal Matrix
Emodi, Omri; van Aalst, John A.; Shilo, Dekel; Naddaf, Raja; Aizenbud, Dror; Rachmiel, Adi
2018-01-01
Summary: Fistulas represent failure of cleft palate repair. Secondary and tertiary fistula repair is challenging, with high recurrence rates. In the present retrospective study, we review the efficacy of using acellular dermal matrix as an interposition layer for cleft palate fistula closure in 20 consecutive patients between 2013 and 2016. Complete fistula closure was obtained in 16 patients; 1 patient had asymptomatic recurrent fistula; 2 patients had partial closure with reduction of fistula size and minimal nasal regurgitation; 1 patient developed a recurrent fistula without changes in symptoms (success rate of 85%). We conclude that utilizing acellular dermal matrix for cleft palate fistula repair is safe and simple with a high success rate. PMID:29707449
Ni, Pei-Yan; Fan, Min; Qian, Zhi-Yong; Luo, Jing-Cong; Gong, Chang-Yang; Fu, Shao-Zhi; Shi, Shuai; Luo, Feng; Yang, Zhi-Ming
2012-01-01
In orthopedic tissue engineering, the extensively applied acellular bone matrix (ABM) can seldom be prefabricated just right to mold the cavity of the diverse defects, might induce severe inflammation on account of the migration of small granules and usually bring the patients great pain in the treatment. In this study, a new injectable thermosensitive ABM/PECE composite with good biocompatibility was designed and prepared by adding the ABM granules into the triblock copolymer poly(ethylene eglycol)-poly(ε-caprolactone)-poly(ethylene eglycol) (PEG-PCL-PEG, PECE). The PECE was synthesized by ring-opening copolymerization and characterized by ¹H NMR. The ABM was prepared by acellular treatment of natural bone and ground to fine granules. The obtained ABM/PECE composite showed the most important absorption bands of ABM and PECE copolymer in FT-IR spectroscopy and underwent sol-gel phage transition from solution to nonflowing hydrogel at 37°C. SEM results indicated that the ABM/PECE composite with different ABM contents all presented similar porous 3D structure. ABM/PECE composite presented mild cytotoxicity to rat MSCs in vitro and good biocompatibility in the BALB/c mice subcutis up to 4 weeks. In conclusion, all the results confirmed that the injectable thermosensitive ABM/PECE composite was a promising candidate for orthopedic tissue engineering in a minimally-invasive way. Copyright © 2011 Wiley Periodicals, Inc.
Shivappa, Raghunath B; Christian, Larry S; Law, Jerry M; Lewbart, Gregory A
2017-01-01
A study was carried out to assess the effect of Stress Coat ® on slime production in goldfish ( Carassius auratus) and koi ( Cyprinus carpio ). The study also investigated histological changes that might be associated with slime producing cells, and wound healing in koi. Several formulations of Stress Coat ® were investigated and the results showed that polyvinylpyrrolidone (PVP), also known as povidone, an ingredient of Stress Coat ® , when used alone, showed significantly higher slime production in goldfish than salt and Stress Coat ® without PVP after 25 h. The results also showed that koi treated with compounds containing PVP showed better wound healing than those not exposed to PVP. Histology results showed no difference between compounds tested with regards to density and number of slime producing cells.
A new material for tissue engineered vagina reconstruction: Acellular porcine vagina matrix.
Zhang, Jing-Kun; Du, Run-Xuan; Zhang, Lin; Li, Ya-Nan; Zhang, Ming-Le; Zhao, Shuo; Huang, Xiang-Hua; Xu, Yan-Fang
2017-07-01
Acellular matrix materials have been widely used to repair various tissues and organs. According to the plastic principle, when a part of the body is lost, it should be replaced with a similar material. Therefore, the use of a homologous organ-specific acellular vaginal tissue in vagina reconstruction repair surgery may show good results. However, the acellular vagina matrix (AVM) form large vertebrates is difficult to isolate. In this study, we described a multistep method to prepare porcine AVM and evaluated the efficacy of acellularization. We also investigated the biomechanical properties, biological activity elements, and biocompatibility of the porcine AVM. We then used this material to reconstruct a rat vagina and performed further morphologic and functional analyses. Small intestinal submucosa (SIS), which is a commonly used acellular matrix material, was used in a control group. Histological examination, DNA content analysis, and agarose gel electrophoresis revealed that the decellularization procedure was effective. The AVM had acceptable biomechanical properties and sufficient growth factor production (VEGF, FGF, TGF-β1, and PDGF-BB) compared with that of the SIS. Subcutaneous transplantation in rats showed that the AVM had good biocompatibility. The tissue-engineered vagina using the AVM more resembled normal-appearing tissue than did that using SIS following morphologic and functional analyses. The AVM has great potential for application in vaginal reconstructive surgery. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1949-1959, 2017. © 2017 Wiley Periodicals, Inc.
Frerichs, Onno; Fansa, Hisham; Schicht, Christoph; Wolf, Gerald; Schneider, Wolfgang; Keilhoff, Gerburg
2002-01-01
The bridging of nerve gaps is still one of the major problems in peripheral nerve surgery. The present experiment describes our attempt to engineer different biologic nerve grafts in a rat sciatic nerve model: cultured isogenic Schwann cells were implanted into 2-cm autologous acellular nerve grafts or autologous predegenerated nerve grafts. Autologous nerve grafts and predegenerated or acellular nerve grafts without implanted Schwann cells served as controls. The regenerated nerves were assessed histologically and morphometrically after 6 weeks. Predegenerated grafts showed results superior in regard to axon count and histologic appearance in comparison to standard grafts and acellular grafts. The acellular nerve grafts showed the worst histologic picture, but axon counts were in the range of standard grafts. The implantation of Schwann cells did not yield significant improvements in any group. In conclusion, the status of activation of Schwann cells and the stadium of Wallerian degeneration in a nerve graft might be key factors for regeneration, rather than total number of Schwann cells. Predegenerated nerve grafts are therefore superior to standard grafts in the rat model. Acellular grafts are able to bridge nerve gaps of up to 2 cm in the rat model, but even the addition of cultivated Schwann cells did not lead to results as good as in the group with autologous nerve grafts. Copyright 2002 Wiley-Liss, Inc. MICROSURGERY 22:311-315 2002
Mold Flux Crystallization and Mold Thermal Behavior
NASA Astrophysics Data System (ADS)
Peterson, Elizabeth Irene
Mold flux plays a small but critical role in the continuous casting of steel. The carbon-coated powder is added at the top of the water-cooled copper mold, over time it melts and infiltrates the gap between the copper mold and the solidifying steel strand. Mold powders serve five primary functions: (1) chemical insulation, (2) thermal insulation, (3) lubrication between the steel strand and mold, (4) absorption of inclusions, and (5) promotion of even heat flux. All five functions are critical to slab casting, but surface defect prevention is primarily controlled through even heat flux. Glassy fluxes have high heat transfer and result in a thicker steel shell. Steels with large volumetric shrinkage on cooling must have a crystalline flux to reduce the radiative heat transfer and avoid the formation of cracks in the shell. Crystallinity plays a critical role in steel shell formation, therefore it is important to study the thermal conditions that promote each phase and its morphology. Laboratory tests were performed to generate continuous cooling transformation (CCT) and time-temperature-transformation (TTT) diagrams. Continuous cooling transformation tests were performed in an instrumented eight cell step chill mold. Results showed that cuspidine was the only phase formed in conventional fluxes and all observed structures were dendritic. An isothermal tin bath quench method was also developed to isothermally age glassy samples. Isothermal tests yielded different microstructures and different phases than those observed by continuous cooling. Comparison of aged tests with industrial flux films indicates similar faceted structures along the mold wall, suggesting that mold flux first solidifies as a glass along the mold wall, but the elevated temperature devitrifies the glassy structure forming crystals that cannot form by continuous cooling.
Nonexpansive immediate breast reconstruction using human acellular tissue matrix graft (AlloDerm).
Salzberg, C Andrew
2006-07-01
Immediate breast reconstruction has become a standard of care following mastectomy for cancer, largely due to improved esthetic and psychologic outcomes achieved with this technique. However, the current historical standards--transverse rectus abdominis myocutaneous flap reconstruction and expander--implant surgery-still have limitations as regards patient morbidity, short-term body-image improvements, and even cost. To address these shortcomings, we employ a novel concept of human tissue replacement to enhance breast shape and provide total coverage, enabling immediate mound reconstruction without the need for breast expansion prior to permanent implant placement. AlloDerm (human acellular tissue matrix) is a human-derived graft tissue with extensive experience in various settings of skin and soft tissue replacement surgery. This report describes the success using acellular tissue matrix to provide total coverage over the prosthesis in immediate reconstruction, with limited muscle dissection. In this population, 49 patients (76 breasts) successfully underwent the acellular tissue matrix-based immediate reconstruction, resulting in durable breast reconstruction with good symmetry. These findings may predict that acellular tissue matrix-supplemented immediate breast reconstruction will become a new technique for the immediate reconstruction of the postmastectomy breast.
Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet
Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.
2015-01-01
Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104
Management of gingival recession with acellular dermal matrix graft: A clinical study
Balaji, V. R.; Ramakrishnan, T.; Manikandan, D.; Lambodharan, R.; Karthikeyan, B.; Niazi, Thanvir Mohammed; Ulaganathan, G.
2016-01-01
Aims and Objectives: Obtaining root coverage has become an important part of periodontal therapy. The aims of this studyare to evaluate the clinical efficacy of acellular dermal matrix graft in the coverage of denuded roots and also to examine the change in the width of keratinized gingiva. Materials and Methods: A total of 20 sites with more than or equal to 2 mm of recession depth were taken into the study, for treatment with acellular dermal matrix graft. The clinical parameters such as recession depth, recession width, width of keratinized gingiva, probing pocket depth (PD), and clinical attachment level (CAL) were measured at the baseline, 8th week, and at the end of the study (16th week). The defects were treated with a coronally positioned pedicle graft combined with acellular dermal matrix graft. Results: Out of 20 sites treated with acellular dermal matrix graft, seven sites showed complete root coverage (100%), and the mean root coverage obtained was 73.39%. There was a statistically significant reduction in recession depth, recession width, and probing PD. There was also a statistically significant increase in width of keratinized gingiva and also gain in CAL. The postoperative results were both clinically and statistically significant (P < 0.0001). Conclusion: The results of this study were esthetically acceptable to the patients and clinically acceptable in all cases. From this study, it may be concluded that acellular dermal matrix graft is an excellent substitute for autogenous graft in coverage of denuded roots. PMID:27829749
53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...
53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
Physarum can compute shortest paths.
Bonifaci, Vincenzo; Mehlhorn, Kurt; Varma, Girish
2012-09-21
Physarum polycephalum is a slime mold that is apparently able to solve shortest path problems. A mathematical model has been proposed by Tero et al. (Journal of Theoretical Biology, 244, 2007, pp. 553-564) to describe the feedback mechanism used by the slime mold to adapt its tubular channels while foraging two food sources s(0) and s(1). We prove that, under this model, the mass of the mold will eventually converge to the shortest s(0)-s(1) path of the network that the mold lies on, independently of the structure of the network or of the initial mass distribution. This matches the experimental observations by Tero et al. and can be seen as an example of a "natural algorithm", that is, an algorithm developed by evolution over millions of years. Copyright © 2012 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bernacki, Bruce E.
2012-10-05
This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.
92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...
92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
Using Acellular Bioactive Extracellular Matrix Scaffolds to Enhance Endogenous Cardiac Repair
Svystonyuk, Daniyil A.; Mewhort, Holly E. M.; Fedak, Paul W. M.
2018-01-01
An inability to recover lost cardiac muscle following acute ischemic injury remains the biggest shortcoming of current therapies to prevent heart failure. As compared to standard medical and surgical treatments, tissue engineering strategies offer the promise of improved heart function by inducing regeneration of functional heart muscle. Tissue engineering approaches that use stem cells and genetic manipulation have shown promise in preclinical studies but have also been challenged by numerous critical barriers preventing effective clinical translational. We believe that surgical intervention using acellular bioactive ECM scaffolds may yield similar therapeutic benefits with minimal translational hurdles. In this review, we outline the limitations of cellular-based tissue engineering strategies and the advantages of using acellular biomaterials with bioinductive properties. We highlight key anatomic targets enriched with cellular niches that can be uniquely activated using bioactive scaffold therapy. Finally, we review the evolving cardiovascular tissue engineering landscape and provide critical insights into the potential therapeutic benefits of acellular scaffold therapy. PMID:29696148
MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS
Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...
Molds have the potential to cause health problems. Molds produce allergens (substances that can cause allergic reactions) and irritants. Inhaling or touching mold or mold spores may cause allergic reactions in sensitive individuals.
NASA Astrophysics Data System (ADS)
Zeng, Weizhi; Wang, Shijie; Free, Michael L.
2016-10-01
Copper electrorefining tests were conducted in a pilot-scale cell under commercial tankhouse environment to study the effects of anode compositions, current density, cathode blank width, and flow rate on anode slime behavior and cathode copper purity. Three different types of anodes (high, mid, and low impurity levels) were used in the tests and were analyzed under SEM/EDS. The harvested copper cathodes were weighed and analyzed for impurities concentrations using DC Arc. The adhered slimes and released slimes were collected, weighed, and analyzed for compositions using ICP. It was shown that the lead-to-arsenic ratio in the anodes affects the sintering and coalescence of slime particles. High current density condition can improve anode slime adhesion and cathode purity by intensifying slime particles' coalescence and dissolving part of the particles. Wide cathode blanks can raise the anodic current densities significantly and result in massive release of large slime particle aggregates, which are not likely to contaminate the cathode copper. Low flow rate can cause anode passivation and increase local temperatures in front of the anode, which leads to very intense sintering and coalescence of slime particles. The results and analyses of the tests present potential solutions for industrial copper electrorefining process.
Robust, Nontoxic, Antifouling Polymer.
1996-02-23
easily removable slime of no more than 50 micron 9 thickness was observed on the test panel. Note that the slime was easily removed using 10 light...viscous syrup remains. Pour tbe 2 syrup into molds and heat under vacuum at 120 °C untfl a cured antifouling bulk material 3 is obtained. 4 Example
Rapid control of mold temperature during injection molding process
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min
2015-05-22
The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during themore » entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.« less
Challenges in mold manufacturing for high precision molded diffractive optical elements
NASA Astrophysics Data System (ADS)
Pongs, Guido; Bresseler, Bernd; Schweizer, Klaus; Bergs, Thomas
2016-09-01
Isothermal precision glass molding of imaging optics is the key technology for mass production of precise optical elements. Especially for numerous consumer applications (e.g. digital cameras, smart phones, …), high precision glass molding is applied for the manufacturing of aspherical lenses. The usage of diffractive optical elements (DOEs) can help to further reduce the number of lenses in the optical systems which will lead to a reduced weight of hand-held optical devices. But today the application of molded glass DOEs is limited due to the technological challenges in structuring the mold surfaces. Depending on the application submicrometer structures are required on the mold surface. Furthermore these structures have to be replicated very precisely to the glass lens surface. Especially the micro structuring of hard and brittle mold materials such as Tungsten Carbide is very difficult and not established. Thus a multitude of innovative approaches using diffractive optical elements cannot be realized. Aixtooling has investigated in different mold materials and different suitable machining technologies for the micro- and sub-micrometer structuring of mold surfaces. The focus of the work lays on ultra-precision grinding to generate the diffractive pattern on the mold surfaces. This paper presents the latest achievements in diffractive structuring of Tungsten Carbide mold surfaces by ultra-precision grinding.
Colard, Thomas; Falgayrac, Guillaume; Bertrand, Benoit; Naji, Stephan; Devos, Olivier; Balsack, Clara; Delannoy, Yann; Penel, Guillaume
2016-01-01
Acellular extrinsic fiber cementum is a mineralized tissue that covers the cervical half of the tooth root surface. It contains mainly extrinsic or Sharpey’s fibers that run perpendicular to the root surface to anchor the tooth via the periodontal ligament. Acellular cementum is continuously and slowly produced throughout life and exhibits an alternating bright and dark pattern under light microscopy. However, although a better understanding of the structural background of acellular cementum is relevant to many fields, such as cementochronology, periodontology and tissue engineering, acellular cementum remains rarely studied and poorly understood. In this work, we studied the acellular cementum at the incremental line scale of five human mandibular canines using polarized Raman spectroscopy. We provided Raman imaging analysis and polarized acquisitions as a function of the angular orientation of the sample. The results showed that mineral crystals were always parallel to collagen fibrils, and at a larger scale, we proposed an organizational model in which we found radial collagen fibers, “orthogonal” to the cementum surface, and “non-orthogonal” fibers, which consist of branching and bending radial fibers. Concerning the alternating pattern, we observed that the dark lines corresponded to smaller, more mineralized and probably more organized bands, which is consistent with the zoological assumption that incremental lines are produced during a winter rest period of acellular cementum growth. PMID:27936010
Reactive airway - mold; Bronchial asthma - mold; Triggers - mold; Allergic rhinitis - pollen ... Things that make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are ...
Santos, Antonio; Goumenos, George; Pascual, Andrés; Nart, Jose
2011-02-01
Acellular dermal matrix grafts have become a good alternative to autogenous soft tissue grafts in root coverage. Until now, the literature has reported short- or medium-term data regarding the stability of the gingival margin after the use of acellular dermal matrix on root coverage. The aim of this article is to describe a case report with 10 years of evolution with creeping attachment that developed bucally on a moderate recession of a maxillary canine with an old composite restoration subsequent to an acellular dermal matrix. Long-term creeping attachment and complete root coverage on a restored tooth treated with acellular dermal matrix has not been previously reported in the dental literature.
Acellular organ scaffolds for tumor tissue engineering
NASA Astrophysics Data System (ADS)
Guller, Anna; Trusova, Inna; Petersen, Elena; Shekhter, Anatoly; Kurkov, Alexander; Qian, Yi; Zvyagin, Andrei
2015-12-01
Rationale: Tissue engineering (TE) is an emerging alternative approach to create models of human malignant tumors for experimental oncology, personalized medicine and drug discovery studies. Being the bottom-up strategy, TE provides an opportunity to control and explore the role of every component of the model system, including cellular populations, supportive scaffolds and signalling molecules. Objectives: As an initial step to create a new ex vivo TE model of cancer, we optimized protocols to obtain organ-specific acellular matrices and evaluated their potential as TE scaffolds for culture of normal and tumor cells. Methods and results: Effective decellularization of animals' kidneys, ureter, lungs, heart, and liver has been achieved by detergent-based processing. The obtained scaffolds demonstrated biocompatibility and growthsupporting potential in combination with normal (Vero, MDCK) and tumor cell lines (C26, B16). Acellular scaffolds and TE constructs have been characterized and compared with morphological methods. Conclusions: The proposed methodology allows creation of sustainable 3D tumor TE constructs to explore the role of organ-specific cell-matrix interaction in tumorigenesis.
Tetanus–diphtheria–acellular pertussis vaccination for adults: an update
2017-01-01
Although tetanus and diphtheria have become rare in developed countries, pertussis is still endemic in some developed countries. These are vaccine-preventable diseases and vaccination for adults is important to prevent the outbreak of disease. Strategies for tetanus, diphtheria, and pertussis vaccines vary from country to country. Each country needs to monitor consistently epidemiology of the diseases and changes vaccination policies accordingly. Recent studies showed that tetanus–diphtheria–acellular pertussis vaccine for adults is effective and safe to prevent pertussis disease in infants. However, vaccine coverage still remains low than expected and seroprevalence of protective antibodies levels for tetanus, diphtheria, and pertussis decline with aging. The importance of tetanus–diphtheria–acellular pertussis vaccine administration should be emphasized for the protection of young adult and elderly people also, not limited to children. PMID:28168170
Harris, Randall J
2004-05-01
Obtaining predictable and esthetic root coverage has become important. Unfortunately, there is only a limited amount of information available on the long-term results of root coverage procedures. The goal of this study was to evaluate the short-term and long-term root coverage results obtained with an acellular dermal matrix and a subepithelial graft. An a priori power analysis was done to determine that 25 was an adequate sample size for each group in this study. Twenty-five patients treated with either an acellular dermal matrix or a subepithelial graft for root coverage were included in this study. The short-term (mean 12.3 to 13.2 weeks) and long-term (mean 48.1 to 49.2 months) results were compared. Additionally, various factors were evaluated to determine whether they could affect the results. This study was a retrospective study of patients in a fee-for-service private periodontal practice. The patients were not randomly assigned to treatment groups. The mean root coverages for the short-term acellular dermal matrix (93.4%), short-term subepithelial graft (96.6%), and long-term subepithelial graft (97.0%) were statistically similar. All three were statistically greater than the long-term acellular dermal matrix mean root coverage (65.8%). Similar results were noted in the change in recession. There were smaller probing reductions and less of an increase in keratinized tissue with the acellular dermal matrix than the subepithelial graft. None of the factors evaluated resulted in the acellular dermal graft having a statistically significant better result than the subepithelial graft. However, in long-term cases where multiple defects were treated with an acellular dermal matrix, the mean root coverage (70.8%) was greater than the mean root coverage in long-term cases where a single defect was treated with an acellular dermal matrix (50.0%). The mean results with the subepithelial graft held up with time better than the mean results with an acellular dermal
Liu, Xuqian; Wang, Jie; Dong, Fusheng; Song, Peng; Tian, Songbo; Li, Hexiang; Hou, Yali
2017-10-01
Scaffold material provides a three-dimensional growing environment for seed cells in the research field of tissue engineering. In the present study, rabbit arterial blood vessel cells were chemically removed with trypsin and Triton X-100 to prepare rabbit acellular vascular matrix scaffold material. Observation by He&Masson staining revealed that no cellular components or nuclei existed in the vascular intima and media after decellularization. Human-like collagen I was combined with acellular vascular matrix by freeze-drying to prepare an acellular vascular matrix-0.25% human-like collagen I scaffold to compensate for the extracellular matrix loss during the decellularization process. We next performed a series of experiments to test the water absorbing quality, biomechanics, pressure resistance, cytotoxicity, and ultra-micro structure of the acellular vascular matrix composite material and natural rabbit artery and found that the acellular vascular matrix-0.25% human-like collagen I material behaved similarly to natural rabbit artery. In conclusion, the acellular vascular matrix-0.25% human-like collagen I composite material provides a new approach and lays the foundation for novel scaffold material research into tissue engineering of blood vessels.
Characterizing networks formed by P. polycephalum
NASA Astrophysics Data System (ADS)
Dirnberger, M.; Mehlhorn, K.
2017-06-01
We present a systematic study of the characteristic vein networks formed by the slime mold P. polycephalum. Our study is based on an extensive set of graph representations of slime mold networks. We analyze a total of 1998 graphs capturing growth and network formation of P. polycephalum as observed in 36 independent, identical, wet-lab experiments. Relying on concepts from graph theory such as face cycles and cuts as well as ideas from percolation theory, we establish a broad collection of individual observables taking into account various complementary aspects of P. polycephalum networks. As a whole, the collection is intended to serve as a specialized knowledge-base providing a comprehensive characterization of P. polycephalum networks. To this end, it contains individual as well as cumulative results for all investigated observables across all available data series, down to the level of single P. polycephalum graphs. Furthermore we include the raw numerical data as well as various plotting and analysis tools to ensure reproducibility and increase the usefulness of the collection. All our results are publicly available in an organized fashion in the slime mold graph repository (Smgr).
Habituation in non-neural organisms: evidence from slime moulds.
Boisseau, Romain P; Vogel, David; Dussutour, Audrey
2016-04-27
Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. © 2016 The Author(s).
Habituation in non-neural organisms: evidence from slime moulds
Boisseau, Romain P.; Vogel, David; Dussutour, Audrey
2016-01-01
Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum. In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. PMID:27122563
Improved compression molding process
NASA Technical Reports Server (NTRS)
Heier, W. C.
1967-01-01
Modified compression molding process produces plastic molding compounds that are strong, homogeneous, free of residual stresses, and have improved ablative characteristics. The conventional method is modified by applying a vacuum to the mold during the molding cycle, using a volatile sink, and exercising precise control of the mold closure limits.
Study on In-mold Punching during PPS/GF Injection Molding
NASA Astrophysics Data System (ADS)
Inuzuka, Takayuki; Fujita, Akihiro; Nakai, Asami; Hamada, Hiroyuki
The influence of the punching condition on strength and the amount of shear droop was investigated to optimize the processing condition for punching in the mold during glass fiber reinforced polyphenylenesulfide (PPS/GF) injection molding. For in-mold punching part during cooling process, the tensile strength was constant because the pressure loss by the punch did not occur. The amount of the shear droop decreased in line with the increase in delay time because the rigidity of injection molded part in the mold increased when the resin was cooled. Moreover, when the resin temperature lowered more than the glass transition temperature, the amount of the shear droop was constant because the rigidity became constant. It is necessary to begin punching when the resin temperature lowers more than the glass transition temperature after holding pressure process is completed, to secure high strength and to assume 0.05 mm or less, at which level the shear droop cannot be visually recognized. The shortest delay time for PPS/GF is 8 sec. The delay time to minimize the amount of the shear droop can be guessed by analyzing the temperature change of the resin in the mold by injection molding CAE.
Runge, Kristin K; Chung, Jennifer H; Su, Leona Yi-Fan; Brossard, Dominique; Scheufele, Dietram A
2018-09-01
In March 2012 ABC World News Report aired a series of reports on lean finely textured beef (LFTB) that resulted in a 10-year low for beef prices and the bankruptcy of a major firm that produced LFTB. Using a random sample survey, we tested the effects of the media frame "pink slime" and industry frame "lean finely textured beef," alongside media use, food-related knowledge, trust in food-related institutions and preference for local, fresh, organic and GMO-free foods on perceptions of risk related to ground beef containing pink slime/LFTB, processed foods and red meat. The "pink slime" frame was strongly and positively associated with risk related to ground beef, but not risk related to red meat or processed foods. Attention to news stories about pink slime/LFTB was strongly associated with risk related to ground beef and processed foods, but not red meat. We found varying effects of food values, knowledge and trust on all three dependent variables. Implications are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.
Bovine versus porcine acellular dermal matrix for complex abdominal wall reconstruction.
Clemens, Mark W; Selber, Jesse C; Liu, Jun; Adelman, David M; Baumann, Donald P; Garvey, Patrick B; Butler, Charles E
2013-01-01
Abdominal wall reconstruction with bioprosthetic mesh is associated with lower rates of mesh infection, fistula formation, and mesh explantation than reconstruction with synthetic mesh. The authors directly compared commonly used bioprosthetic meshes in terms of clinical outcomes and complications. A database of consecutive patients who underwent abdominal wall reconstruction with porcine or bovine acellular dermal matrix and midline musculofascial closure at their institution between January of 2008 and March of 2011 was reviewed. Surgical outcomes were compared. One hundred twenty patients were identified who underwent a nonbridged, inlay abdominal wall reconstruction with porcine [69 patients (57.5 percent)] or bovine acellular dermal matrix (51 patients (42.5 percent)]. The mean follow-up time was 21.0 ± 9.9 months. The overall complication rate was 36.6 percent; the porcine matrix group had a significantly higher complication rate (44.9 percent) than the bovine matrix group (25.5 percent; p = 0.04) and statistically equivalent surgical complications (29.2 percent versus 21.6 percent; p = 0.34). There were no significant differences in rates of recurrent hernia (2.9 percent versus 3.9 percent; p = 0.99) or bulge (7.2 percent versus 0 percent; p = 0.07). However, the rate of intraoperative adverse events in the porcine matrix group [seven events (10.1 percent)] was significantly higher than that in the bovine matrix group (0 percent; p = 0.02). In patients who undergo complex abdominal wall reconstruction, both bovine and porcine acellular dermal matrix are associated with similar rates of postoperative surgical complications and appear to result in similar outcomes. Porcine acellular dermal matrix may be prone to intraoperative device failure. Therapeutic, III.
Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding
NASA Astrophysics Data System (ADS)
Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.
2015-03-01
We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.
Zuo, Yanhai; Lu, Shuliang
2017-01-01
To explore the profibrotic characteristics of the autografted dermis, acellular dermal matrix, and dermal fibroblasts from superficial/deep layers of pig skin, 93 wounds were established on the dorsa of 7 pigs. 72 wounds autografted with the superficial/deep dermis and acellular dermal matrix served as the superficial/deep dermis and acellular dermal matrix group, respectively, and were sampled at 2, 4, and 8 weeks post-wounding. 21 wounds autografted with/without superficial/deep dermal fibroblasts served as the superficial/deep dermal fibroblast group and the control group, respectively, and were sampled at 2 weeks post-wounding. The hematoxylin and eosin staining showed that the wounded skin thicknesses in the deep dermis group (superficial acellular dermal matrix group) were significantly greater than those in the superficial dermis group (deep acellular dermal matrix group) at each time point, the thickness of the cutting plane in the deep dermal fibroblast group was significantly greater than that in the superficial dermal fibroblast group and the control group. The western blots showed that the α-smooth muscle actin expression in the deep dermis group (superficial acellular dermal matrix group) was significantly greater than that in the superficial dermis group (deep acellular dermal matrix group) at each time point. In summary, the deep dermis and dermal fibroblasts exhibited more profibrotic characteristics than the superficial ones, on the contrary, the deep acellular dermal matrix exhibited less profibrotic characteristics than the superficial one. PMID:28423561
Myxomycete (slime mold) spores: unrecognized aeroallergens?
Lierl, Michelle B
2013-12-01
Myxomycete spores are present in the outdoor air but have not been studied for allergenicity. To determine whether patients with seasonal allergic rhinitis (SAR) symptoms are sensitized to myxomycete spores. Myxomycete specimens were collected in the field. Nine species of myxomycetes were collected and identified: Arcyria cinerea, Ceratiomyxa fruticulosa, Fuligo septica, Hemitrichia clavata, Lycogala epidendrum, Metatrichia vesparium, Stemonitis nigrescens, Tubifera ferruginosa, and Trichea favoginea. Allergen extracts were made for each species. Protein content of each extract was measured by bicinchoninic acid assay. Protein electrophoresis was performed. Subjects with a history of SAR symptoms were enrolled, and allergy skin prick testing was performed with each extract. Protein content of the extracts ranged from 1.05 to 5.8 mg/mL. Protein bands were seen at 10 to 250 kD. Allergy prick testing was performed in 69 subjects; 42% of subjects had positive prick test results for at least 1 myxomycete extract, with 9% to 22% reacting to each extract. Five of the 12 subjects who tested negative for all allergens on the standard aeroallergen panel had positive prick test results for myxomycetes. Forty-two percent of subjects with SAR were sensitized to myxomycete spores. A significant subset of subjects who had SAR symptoms and otherwise negative skin test results showed sensitization to myxomycetes. These spores are present in the outdoor air during the summer and autumn and might be significant aeroallergens. Copyright © 2013 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
What's bugging youslime molds
Kevin T. Smith
2013-01-01
Summer rains in the northeastern US bring out fist-sized masses of grainy yellow goo, frequently on wood chip mulch or decaying wood. The first concerned "what is that" phone call usually is followed the next day by a more alarmed "what is that", when the blob has moved a foot or two across the mulch. All too often, alarm moves to...
In vitro assessment of biodurability: acellular systems.
de Meringo, A; Morscheidt, C; Thélohan, S; Tiesler, H
1994-01-01
The assessment of biodurability of man-made vitreous fibers is essential to the limitation of health hazards associated with human exposure to environments in which respirable fibers are present. In vitro acellular systems provide effective test methods of measuring fiber solubility provided care is taken to select the most suitable solvent and test conditions for the specific fiber type and dimension. PMID:7882955
Chit, Ayman; Zivaripiran, Hossein; Shin, Thomas; Lee, Jason K. H.; Tomovici, Antigona; Macina, Denis; Johnson, David R.; Decker, Michael D.; Wu, Jianhong
2018-01-01
Background Acellular pertussis vaccine studies postulate that waning protection, particularly after the adolescent booster, is a major contributor to the increasing US pertussis incidence. However, these studies reported relative (ie, vs a population given prior doses of pertussis vaccine), not absolute (ie, vs a pertussis vaccine naïve population) efficacy following the adolescent booster. We aim to estimate the absolute protection offered by acellular pertussis vaccines. Methods We conducted a systematic review of acellular pertussis vaccine effectiveness (VE) publications. Studies had to comply with the US schedule, evaluate clinical outcomes, and report VE over discrete time points. VE after the 5-dose childhood series and after the adolescent sixth-dose booster were extracted separately and pooled. All relative VE estimates were transformed to absolute estimates. VE waning was estimated using meta-regression modeling. Findings Three studies reported VE after the childhood series and four after the adolescent booster. All booster studies reported relative VE (vs acellular pertussis vaccine-primed population). We estimate initial childhood series absolute VE is 91% (95% CI: 87% to 95%) and declines at 9.6% annually. Initial relative VE after adolescent boosting is 70% (95% CI: 54% to 86%) and declines at 45.3% annually. Initial absolute VE after adolescent boosting is 85% (95% CI: 84% to 86%) and declines at 11.7% (95% CI: 11.1% to 12.3%) annually. Interpretation Acellular pertussis vaccine efficacy is initially high and wanes over time. Observational VE studies of boosting failed to recognize that they were measuring relative, not absolute, VE and the absolute VE in the boosted population is better than appreciated. PMID:29912887
In most cases, if visible mold growth is present, sampling is unnecessary. Since no EPA or other federal limits have been set for mold or mold spores, sampling cannot be used to check a building's compliance with federal mold standards.
Manufacturing plastic injection optical molds
NASA Astrophysics Data System (ADS)
Bourque, David
2008-08-01
ABCO Tool & Die, Inc. is a mold manufacturer specializing in the manufacturing of plastic injection molds for molded optical parts. The purpose of this presentation is to explain the concepts and procedures required to build a mold that produces precision optical parts. Optical molds can produce a variety of molded parts ranging from safety eyewear to sophisticated military lens parts, which must meet precise optical specifications. The manufacturing of these molds begins with the design engineering of precision optical components. The mold design and the related optical inserts are determined based upon the specific optical criteria and optical surface geometry. The mold manufacturing techniques will be based upon the optical surface geometry requirements and specific details. Manufacturing processes used will be specific to prescribed geometrical surface requirements of the molded part. The combined efforts result in a robust optical mold which can produce molded parts that meet the most precise optical specifications.
40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.
Code of Federal Regulations, 2014 CFR
2014-07-01
..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater treatment...
40 CFR 721.10636 - Slimes and sludges, automotive coating, wastewater treatment, solid waste.
Code of Federal Regulations, 2013 CFR
2013-07-01
..., wastewater treatment, solid waste. 721.10636 Section 721.10636 Protection of Environment ENVIRONMENTAL..., wastewater treatment, solid waste. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as slimes and sludges, automotive coating, wastewater treatment...
NASA Astrophysics Data System (ADS)
Koizumi, Koji; Charles, Ted; de Keyser, Hendrik
Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.
Effect of acellular human dermis buttress on laparoscopic hiatal hernia repair.
Ward, Kyle C; Costello, Kevin P; Baalman, Sara; Pierce, Richard A; Deeken, Corey R; Frisella, Margaret M; Michael Brunt, L; Matthews, Brent D
2015-08-01
The objective of this study was to evaluate the performance of acellular human dermis reinforcement during laparoscopic hiatal hernia repair. A prospective non-randomized, single institution study enrolled patients undergoing laparoscopic hiatal hernia repair. Acellular human dermis, FlexHD (Musculoskeletal Transplant Foundation, Edison, NJ) or AlloDerm (LifeCell Inc., Branchburg, NJ) were used to buttress the repair after primary closure. A protocol barium swallow (BAS) was performed at 6 months and then as needed due to clinical indications. Primary outcome measure was recurrence. Patients completed preoperative and postoperative GERD symptom questionnaires and quality of life surveys (SF-36). Kruskal-Wallis ANOVA, Student's t test, Fisher's exact test, or Wilcoxon signed-rank test were utilized as appropriate (p < 0.05 considered statistically significant). Fifty-four patients (10 men and 44 women) with a mean age of 62 ± 10 years underwent laparoscopic hiatal hernia repair using Flex HD (n = 37) or AlloDerm (n = 17). Both groups were similar with respect to gender, age, hiatus size, hernia type [sliding/Type I (n = 14) or paraesophageal/Type III/IV (n = 40)], esophageal motor function (manometry), preoperative SF-36 quality of life surveys, and GERD symptom questionnaires. Forty-seven patients (87 %) completed the BAS at 6 months; each group had two recurrences (p = 0.597). At median follow-up of 33 months, there were 3 recurrences (18 %) in the AlloDerm group and 5 recurrences (14 %) in the Flex HD group (p = 0.365). Minimal differences in GERD symptoms or SF-36 scores were detected between groups. However, anti-reflux medication usage, GERD symptoms, and quality of life significantly improved for both groups after laparoscopic hiatal hernia repair. Laparoscopic hiatal hernia repair with acellular human dermis reinforcement results in improvement of GERD-related symptoms and quality of life without mesh-associated complications. The type of acellular human
Ducret, Adrien; Valignat, Marie-Pierre; Mouhamar, Fabrice; Mignot, Tâm; Theodoly, Olivier
2012-01-01
In biology, the extracellular matrix (ECM) promotes both cell adhesion and specific recognition, which is essential for central developmental processes in both eukaryotes and prokaryotes. However, live studies of the dynamic interactions between cells and the ECM, for example during motility, have been greatly impaired by imaging limitations: mostly the ability to observe the ECM at high resolution in absence of specific staining by live microscopy. To solve this problem, we developed a unique technique, wet-surface enhanced ellipsometry contrast (Wet-SEEC), which magnifies the contrast of transparent organic materials deposited on a substrate (called Wet-surf) with exquisite sensitivity. We show that Wet-SEEC allows both the observation of unprocessed nanofilms as low as 0.2 nm thick and their accurate 3D topographic reconstructions, directly by standard light microscopy. We next used Wet-SEEC to image slime secretion, a poorly defined property of many prokaryotic and eukaryotic organisms that move across solid surfaces in absence of obvious extracellular appendages (gliding). Using combined Wet-SEEC and fluorescent-staining experiments, we observed slime deposition by gliding Myxococcus xanthus cells at unprecedented resolution. Altogether, the results revealed that in this bacterium, slime associates preferentially with the outermost components of the motility machinery and promotes its adhesion to the substrate on the ventral side of the cell. Strikingly, analogous roles have been proposed for the extracellular proteoglycans of gliding diatoms and apicomplexa, suggesting that slime deposition is a general means for gliding organisms to adhere and move over surfaces. PMID:22665761
Vibrios from Fish Pen Slime Which Mimic Escherichia coli on Violet Red Bile Agar
Rosen, A.; Levin, R. E.
1970-01-01
Organisms from fish pen slime which mimicked coliforms and Escherichia coli on Violet Red Bile Agar were identified as members of the genus Vibrio on the basis of metabolic and morphological characteristics. Images PMID:4195607
Aust, Gabriela; Boldt, Andreas; Fritsch, Sebastian; Keil, Isabel; Koch, Holger; Möbius, Robert; Scheidt, Holger A.; Wagner, Martin F. X.; Hammer, Niels
2016-01-01
Introduction Though xenogeneic acellular scaffolds are frequently used for surgical reconstruction, knowledge of their mechanical properties is lacking. This study compared the mechanical, histological and ultrastructural properties of various native and acellular specimens. Materials and Methods Porcine esophagi, ureters and skin were tested mechanically in a native or acellular condition, focusing on the elastic modulus, ultimate tensile stress and maximum strain. The testing protocol for soft tissues was standardized, including the adaption of the tissue’s water content and partial plastination to minimize material slippage as well as templates for normed sample dimensions and precise cross-section measurements. The native and acellular tissues were compared at the microscopic and ultrastructural level with a focus on type I collagens. Results Increased elastic modulus and ultimate tensile stress values were quantified in acellular esophagi and ureters compared to the native condition. In contrast, these values were strongly decreased in the skin after acellularization. Acellularization-related decreases in maximum strain were found in all tissues. Type I collagens were well-preserved in these samples; however, clotting and a loss of cross-linking type I collagens was observed ultrastructurally. Elastins and fibronectins were preserved in the esophagi and ureters. A loss of the epidermal layer and decreased fibronectin content was present in the skin. Discussion Acellularization induces changes in the tensile properties of soft tissues. Some of these changes appear to be organ specific. Loss of cross-linking type I collagen may indicate increased mechanical strength due to decreasing transverse forces acting upon the scaffolds, whereas fibronectin loss may be related to decreased load-bearing capacity. Potentially, the alterations in tissue mechanics are linked to organ function and to the interplay of cells and the extracellular matrix, which is different in
Transferability of glass lens molding
NASA Astrophysics Data System (ADS)
Katsuki, Masahide
2006-02-01
Sphere lenses have been used for long time. But it is well known that sphere lenses theoretically have spherical aberration, coma and so on. And, aspheric lenses attract attention recently. Plastic lenses are molded easily with injection machines, and are relatively low cost. They are suitable for mass production. On the other hand, glass lenses have several excellent features such as high refractive index, heat resistance and so on. Many aspheric glass lenses came to be used for the latest digital camera and mobile phone camera module. It is very difficult to produce aspheric glass lenses by conventional process of curve generating and polishing. For the solution of this problem, Glass Molding Machine was developed and is spreading through the market. High precision mold is necessary to mold glass lenses with Glass Molding Machine. The mold core is ground or turned by high precision NC aspheric generator. To obtain higher transferability of the mold core, the function of the molding machine and the conditions of molding are very important. But because of high molding temperature, there are factors of thermal expansion and contraction of the mold and glass material. And it is hard to avoid the factors. In this session, I introduce following items. [1] Technology of glass molding and the machine is introduced. [2] The transferability of glass molding is analyzed with some data of glass lenses molded. [3] Compensation of molding shape error is discussed with examples.
ERIC Educational Resources Information Center
Huckabee, Christopher
2003-01-01
Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…
Whooping cough, twenty years from acellular vaccines introduction.
Greco, D; Esposito, S; Tozzi, A; Pandolfi, E; Icardi, G; Giammanco, A
2015-01-01
Clinical pertussis resulting from infection with B. pertussis is a significant medical and public health problem, despite the huge success of vaccination that has greatly reduced its incidence. The whole cell vaccine had an undeniable success over the last 50 years, but its acceptance was strongly inhibited by fear, only partially justified, of severe side effects, but also, in the Western world, by the difficulty to enter in combination with other vaccines: today multi-vaccine formulations are essential to maintain a high vaccination coverage. The advent of acellular vaccines was greeted with enthusiasm by the public health world: in the Nineties, several controlled vaccine trials were carried out: they demonstrated a high safety and good efficacy of new vaccines. In fact, in the Western world, the acellular vaccines completely replaced the whole cells ones. In the last years, ample evidence on the variety of protection of these vaccines linked to the presence of different antigens of Bordetella pertussis was collected. It also became clear that the protection provided, on average around 80%, leaves every year a significant cohort of vaccinated susceptible even in countries with a vaccination coverage of 95%, such as Italy. Finally, it was shown that, as for the pertussis disease, protection decreases over time, to leave a proportion of adolescents and adults unprotected. Waiting for improved pertussis vaccines, the disease control today requires a different strategy that includes a booster at 5 years for infants, but also boosters for teenagers and young adults, re-vaccination of health care personnel, and possibly of pregnant women and of those who are in contact with infants (cocooning). Finally, the quest for better vaccines inevitably tends towards pertussis acellular vaccines with at least three components, which have demonstrated superior effectiveness and have been largely in use in Italy for fifteen years.
Spectral imaging method for studying Physarum polycephalum growth on polyaniline surface.
Dimonte, A; Fermi, F; Berzina, T; Erokhin, V
2015-08-01
The features of spectrophotometric scanner, generally exploited in the artwork field, are here considered in a non-conventional context to characterize the networks created by Physarum polycephalum slime mold during its motion on glass substrates covered with polyaniline: a polymer that varies its color and conductive properties according to the redox state. The used technique allowed the investigation of the effects coming out from the interaction between P. polycephalum and polyaniline. Thus, the contactless method of the analysis of polyaniline conductivity state resulted from the slime mold metabolism was suggested. Indeed, it is here demonstrated that P. polycephalum can modify properties of polyaniline due to its internal activity in contact zones. Copyright © 2015. Published by Elsevier B.V.
Chemorheology of in-mold coating for compression molded SMC applications
NASA Astrophysics Data System (ADS)
Ko, Seunghyun; Straus, Elliott J.; Castro, Jose M.
2015-05-01
In-mold coating (IMC) is applied to compression molded sheet molding compound (SMC) exterior automotive or truck body panels as an environmentally friendly alternative to make the surface conductive for subsequent electrostatic painting operations. The coating is a thermosetting liquid that when injected onto the surface of the part cures and bonds to provide a smooth conductive surface. In order to optimize the IMC process, it is essential to predict the time available for flow, that is the time before the thermosetting reaction starts (inhibition time) as well as the time when the coating has enough structural integrity so that the mold can be opened without damaging the part surface (cure time). To predict both the inhibition time and the cure time, it is critical to study the chemorheology of IMC. In this paper, we study the chemorheology for a typical commercial IMC system, and show its relevance to both the flow and cure time for the IMC stage during SMC compression molding.
NASA Astrophysics Data System (ADS)
Mertus, Lou; Symmons, Alan
2012-10-01
In recent years, the trend within the molded optics community has been an overall advancement in the capability to diamond grind molds using a variety of grinding techniques. Improvements in grinding equipment, materials and tooling have enabled higher quality ceramic and carbide molds and thereby lenses. Diamond turned molds from ductile metals are still used prevalently throughout the molding industry. Each technology presents a unique set of advantages and disadvantages whether used for precision injection molding of plastic optics or precision glass molding. This paper reviews the manufacturing techniques for each approach and applicable molding process. The advantages and disadvantages of each are compared and analyzed. The subtle differences that exist in optics molded from each technique and the impact they have on the performance in various applications is reviewed. Differences stemming from tooling material properties, material-specific minor defects, as well as cutting and grinding process-induced artifacts are described in detail as well as their influence on the roughness, waviness, and form errors present on the molded surface. A comparison with results between similar surfaces for both diamond grinding and diamond turning is presented.
Campbell, Kristin Turza; Burns, Nadja K; Ensor, Joe; Butler, Charles E
2012-04-01
Human acellular dermal matrix is used for ventral hernia repair, as it resists infection and remodels by means of surrounding tissue. However, the tissue source and impact of basement membrane on cell and vessel infiltration have not been determined. The authors hypothesized that musculofascia would be the primary tissue source of cells and vessels infiltrating into human acellular dermal matrix and that the basement membrane would inhibit infiltration. Fifty-six guinea pigs underwent inlay human acellular dermal matrix ventral hernia repair with the basement membrane oriented toward or away from the peritoneum. At postoperative weeks 1, 2, or 4, repair sites were completely excised. Histologic and immunohistochemical analyses were performed to quantify cell and vessel density within repair-site zones, including interface (lateral, beneath musculofascia) and center (beneath subcutaneous fat) zones. Cell and vessel quantities were compared as functions of zone, basement membrane orientation, and time. Cellular and vascular infiltration increased over time universally. The interface demonstrated greater mean cell density than the center (weeks 1 and 2, p = 0.01 and p < 0.0001, respectively). Cell density was greater with the basement membrane oriented toward the peritoneum at week 4 (p = 0.02). The interface zone had greater mean vessel density than the center zone at week 4 (p < 0.0001). Orienting the basement membrane toward the peritoneum increased vessel density at week 4 (p = 0.0004). Cellular and vascular infiltration into human acellular dermal matrix for ventral hernia repairs was greater from musculofascia than from subcutaneous fat, and the basement membrane inhibited cellular and vascular infiltration. Human acellular dermal matrix should be placed adjacent to the best vascularizing tissue to improve fibrovascular incorporation.
Co-Graft of Acellular Dermal Matrix and Autogenous Microskin in a Child with Extensive Burns
Chen, X.L.; Xia, Z.F.; Fang, L.S.; Wang, Y.J.; Wang, C.H.
2008-01-01
Summary A 6-yr-old boy was the victim of a burns accident in a public bathhouse. The burns involved the face, neck, upper and lower extremities, anterior and posterior trunk, and both buttocks, covering 72% of the total body surface area (TBSA). The lesions in the lower extremities and parts of the right upper extremity were deep partial-thickness, comprising 40% TBSA. On day 5 post-burn, the lesions in both lower extremities were excised to the extent of the fascia under general anaesthesia. Meshed J1 Jayya Acellular Dermis®, a kind of acellular allodermal (ADM) matrix, was then placed on the left knee joint. The right knee joint served as control. The wounds in both lower extremities were then overlaid with microskin autografting. At 19 days post-application, the lesions in both lower extremities had almost completely resurfaced. Follow-up at six months revealed well-healed and stable skin of acellular ADM and microskin autografts on the left knee. However, the skin of the right knee was unstable and there was a chronic residual ulcer. Both legs showed some significant hypertrophic scars. The left knee joint (acellular ADM grafted site) showed mild contractures, while the right knee joint developed a significant contracture. The "skin" of the co-graft covered site appeared thicker and more elastic. The movement range of the left knee joint was much larger than that of the right knee joint. These results suggest that co-graft of acellular dermal matrix and autogenous microskin may be an effective way to repair this functional site in children with extensive burns and to improve the functional and cosmetic results. PMID:21991120
Morales, Alfredo M [Livermore, CA
2006-10-24
The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.
ERIC Educational Resources Information Center
Woody, Daniel
2002-01-01
Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)
Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...
... visit this page: About CDC.gov . Mold Cleanup & Remediation Homeowner’s and Renter’s Guide to Mold Cleanup After ... Home or Building with Mold Damage Prevention and Remediation Strategies for the Control and Removal of Fungal ...
Cohen, Liat; Dean, Mason; Shipov, Anna; Atkins, Ayelet; Monsonego-Ornan, Efrat; Shahar, Ron
2012-06-01
The histological diversity of the skeletal tissues of fishes is impressive compared with that of other vertebrate groups, yet our understanding of the functional consequences of this diversity is limited. In particular, although it has been known since the mid-1800s that a large number of fish species possess acellular bones, the mechanical advantages and consequences of this structural characteristic - and therefore the nature of the evolution of this feature - remain unclear. Although several studies have examined the material properties of fish bone, these have used a variety of techniques and there have been no direct contrasts of acellular and cellular bone. We report on a comparison of the structural and mechanical properties of the ribs and opercula between two freshwater fish - the common carp Cyprinus carpio (a fish with cellular bone) and the tilapia Oreochromis aureus (a fish with acellular bone). We used light microscopy to show that the bones in both fish species exhibit poor blood supply and possess discrete tissue zones, with visible layering suggesting differences in the underlying collagen architecture. We performed identical micromechanical testing protocols on samples of the two bone types to determine the mechanical properties of the bone material of opercula and ribs. Our data support the consensus of literature values, indicating that Young's moduli of cellular and acellular bones are in the same range, and lower than Young's moduli of the bones of mammals and birds. Despite these similarities in mechanical properties between the bone tissues of the fish species tested here, cellular bone had significantly lower mineral content than acellular bone; furthermore, the percentage ash content and bone mineral density values (derived from micro-CT scans) show that the bone of these fishes is less mineralized than amniote bone. Although we cannot generalize from our data to the numerous remaining teleost species, the results presented here suggest
Design of Revolute Joints for In-Mold Assembly Using Insert Molding.
Ananthanarayanan, Arvind; Ehrlich, Leicester; Desai, Jaydev P; Gupta, Satyandra K
2011-12-01
Creating highly articulated miniature structures requires assembling a large number of small parts. This is a very challenging task and increases cost of mechanical assemblies. Insert molding presents the possibility of creating a highly articulated structure in a single molding step. This can be accomplished by placing multiple metallic bearings in the mold and injecting plastic on top of them. In theory, this idea can generate a multi degree of freedom structures in just one processing step without requiring any post molding assembly operations. However, the polymer material has a tendency to shrink on top of the metal bearings and hence jam the joints. Hence, until now insert molding has not been used to create articulated structures. This paper presents a theoretical model for estimating the extent of joint jamming that occurs due to the shrinkage of the polymer on top of the metal bearings. The level of joint jamming is seen as the effective torque needed to overcome the friction in the revolute joints formed by insert molding. We then use this model to select the optimum design parameters which can be used to fabricate functional, highly articulating assemblies while meeting manufacturing constraints. Our analysis shows that the strength of weld-lines formed during the in-mold assembly process play a significant role in determining the minimum joint dimensions necessary for fabricating functional revolute joints. We have used the models and methods described in this paper to successfully fabricate the structure for a minimally invasive medical robot prototype with potential applications in neurosurgery. To the best of our knowledge, this is the first demonstration of building an articulated structure with multiple degrees of freedom using insert molding.
Gaster, Richard S; Berger, Aaron J; Monica, Stefanie D; Sweeney, Robert T; Endress, Ryan; Lee, Gordon K
2013-04-01
This study seeks to determine human host response to fetal bovine acellular dermal matrix (ADM) in staged implant-based breast reconstruction. A prospective study was performed for patients undergoing immediate breast reconstruction with tissue expander placement and SurgiMend acellular fetal bovine dermis. At the time of exchange for permanent implant, we obtained tissue specimens of SurgiMend and native capsule. Histological and immunohistochemical assays were performed to characterize the extent of ADM incorporation/degradation, host cell infiltration, neovascularization, inflammation, and host replacement of acellular fetal bovine collagen. Seventeen capsules from 12 patients were included in our study. The average "implantation" time of SurgiMend was 7.8 months (range, 2-23 months). Histological analysis of the biopsy of tissue revealed rare infiltration of host inflammatory cells, even at 23 months. One patient had an infection requiring removal of the tissue expander at 2 months. Contracture, inflammatory changes, edema, and polymorphonuclear leukocyte infiltration were rare in the ADM. An acellular capsule was seen in many cases, at the interface of SurgiMend with the tissue expander. SurgiMend demonstrated a very infrequent inflammatory response. An antibody specific to bovine collagen allowed for direct identification of bovine collagen separate from human collagen. Cellular infiltration and neovascularization of SurgiMend correlated with the quality of the mastectomy skin flap rather than the duration of implantation. Future studies are needed to further characterize the molecular mechanisms underlying tissue incorporation of this product.
Scarano, Antonio; Barros, Raquel R M; Iezzi, Giovanna; Piattelli, Adriano; Novaes, Arthur B
2009-02-01
The aim of this study was to evaluate clinically, histologically, and ultrastructurally the integration process of the acellular dermal matrix used to increase the band of keratinized tissue while achieving gingival inflammation control. Ten patients exhibiting a mucogingival problem with bands of keratinized tissue
Ozkan, Semiha; Kaynak, Fatma; Kalkanci, Ayse; Abbasoglu, Ufuk; Kustimur, Semra
2005-05-01
Slime and proteinase activity of 54 strains consisting of 19 Candida parapsilosis and 35 C. albicans strains isolated from blood samples were investigated in this study. Ketoconazole, amphothericin B, and fluconazole susceptibility of Candida species were compared with slime production and proteinase activity of these species. For both Candida species, no correlation was detected between the slime activity and minimum inhibitory concentration (MIC) values of the three antifungal agents. For both Candida species no correlation was detected between the proteinase activity and the MIC values of amphothericin B, and fluconazole however, statistically significant difference, was determined between the proteinase activity and MIC values of ketoconazole (p = 0.007). Slime production was determined by using modified Christensen macrotube method and proteinase activity was measured by the method of Staib. Antifungal susceptibility was determined through the guidelines of National Committee for Laboratory Standards (NCCLS M27-A).
NASA Technical Reports Server (NTRS)
Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)
2000-01-01
A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.
Get a quick glimpse of some of the most important ways to protect your home from mold by this interactive tour of the Mold House. Room-by-room, you'll learn about common mold issues and how to address them.
Transition from isotropic to digitated growth modulates network formation in Physarum polycephalum
NASA Astrophysics Data System (ADS)
Vogel, David; Gautrais, Jacques; Perna, Andrea; Sumpter, David J. T.; Deneubourg, Jean-Louis; Dussutour, Audrey
2017-01-01
Some organisms, including fungi, ants, and slime molds, explore their environment and forage by forming interconnected networks. The plasmodium of the slime mold Physarum polycephalum is a large unicellular amoeboid organism that grows a tubular spatial network through which nutrients, body mass, and chemical signals are transported. Individual plasmodia are capable of sophisticated behaviours such as optimizing their network connectivity and dynamics using only decentralized information processing. In this study, we used a population of plasmodia that interconnect through time to analyse the dynamical interactions between growth of individual plasmodia and global network formation. Our results showed how initial conditions, such as the distance between plasmodia, their size, or the presence and quality of food, affect the emerging network connectivity.
Physarum machines: encapsulating reaction-diffusion to compute spanning tree
NASA Astrophysics Data System (ADS)
Adamatzky, Andrew
2007-12-01
The Physarum machine is a biological computing device, which employs plasmodium of Physarum polycephalum as an unconventional computing substrate. A reaction-diffusion computer is a chemical computing device that computes by propagating diffusive or excitation wave fronts. Reaction-diffusion computers, despite being computationally universal machines, are unable to construct certain classes of proximity graphs without the assistance of an external computing device. I demonstrate that the problem can be solved if the reaction-diffusion system is enclosed in a membrane with few ‘growth points’, sites guiding the pattern propagation. Experimental approximation of spanning trees by P. polycephalum slime mold demonstrates the feasibility of the approach. Findings provided advance theory of reaction-diffusion computation by enriching it with ideas of slime mold computation.
A revised model of fluid transport optimization in Physarum polycephalum.
Bonifaci, Vincenzo
2017-02-01
Optimization of fluid transport in the slime mold Physarum polycephalum has been the subject of several modeling efforts in recent literature. Existing models assume that the tube adaptation mechanism in P. polycephalum's tubular network is controlled by the sheer amount of fluid flow through the tubes. We put forward the hypothesis that the controlling variable may instead be the flow's pressure gradient along the tube. We carry out the stability analysis of such a revised mathematical model for a parallel-edge network, proving that the revised model supports the global flow-optimizing behavior of the slime mold for a substantially wider class of response functions compared to previous models. Simulations also suggest that the same conclusion may be valid for arbitrary network topologies.
Courtman, D W; Pereira, C A; Kashef, V; McComb, D; Lee, J M; Wilson, G J
1994-06-01
There is evidence to suggest that the cellular components of homografts and bioprosthetic xenografts may contribute to calcification or immunogenic reactions. A four-step detergent and enzymatic extraction process has been developed to remove cellular components from bovine pericardial tissue. The process results in an acellular matrix material consisting primarily of elastin, insoluble collagen, and tightly bound glycosaminoglycans. Light and electron microscopy confirmed that nearly all cellular constituents are removed without ultrastructural evidence of damage to fibrous components. Collagen denaturation temperatures remained unaltered. Biochemical analysis confirmed the retention of collagen and elastin and some differential extraction of glycosaminoglycans. Low strain rate fracture testing and high strain rate viscoelastic characterization showed that, with the exception of slightly increased stress relaxation, the mechanical properties of the fresh tissue were preserved in the pericardial acellular matrix. Crosslinking of the material in glutaraldehyde or poly(glycidyl ether) produced mechanical changes consistent with the same treatments of fresh tissue. The pericardial acellular matrix is a promising approach to the production of biomaterials for heart valve or cardiovascular patching applications.
Angelbeck, Donald I.; Kirsch, Edwin J.
1969-01-01
Aggregative growth of non-slime-forming strains of Zoogloea ramigera was induced by growing the organisms at a depressed pH. Calcium and magnesium ion was found to reverse aggregative growth of the organisms. Conversely, aggregation was stimulated when the available inorganic cation concentration of the growth medium was lowered by the use of a chelating agent. The aggregative effects of pH depression or cation depletion and the dispersal effects of cation supplementation were observed only during cellular growth. The data suggest that aggregate formation of non-slime-forming strains of Z. ramigera may be related to the calcium or magnesium metabolism of the organisms, or both. Images PMID:4976326
Grinding technoloy of aspheric molds for glass-molding; Technical Digest
NASA Astrophysics Data System (ADS)
Kojima, Yoichi
2005-05-01
We introduce the method of precisely grinding of axis-symmetric aspherical glass-molding dies by using a diamond wheel. Those show how to select vertical-grinding or slant-grinding, how to grind molds with high accuracy and actual grinding results.
Roose, L.D.
1996-12-10
Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.
Bovine versus Porcine Acellular Dermal Matrix: A Comparison of Mechanical Properties.
Adelman, David M; Selber, Jesse C; Butler, Charles E
2014-05-01
Porcine and bovine acellular dermal matrices (PADM and BADM, respectively) are the most commonly used biologic meshes for ventral hernia repair. A previous study suggests a higher rate of intraoperative device failures using PADM than BADM. We hypothesize that this difference is, in part, related to intrinsic mechanical properties of the matrix substrate and source material. The following study directly compares these 2 matrices to identify any potential differences in mechanical properties that may relate to clinical outcomes. Sections of PADM (Strattice; Lifecell, Branchburg, N.J.) and BADM (SurgiMend; TEI Biosciences, Boston, Mass.) were subjected to a series of biomechanical tests, including suture retention, tear strength, and uniaxial tensile strength. Results were collected and compared statistically. In all parameters, BADM exhibited a superior mechanical strength profile compared with PADM of similar thickness. Increased BADM thickness correlated with increased mechanical strength. In suture tear-through testing with steel wire, failure of the steel wire occurred in the 4-mm-thick BADM, whereas the matrix material failed in all other thicknesses of BADM and PADM. Before implantation, BADM is inherently stronger than PADM at equivalent thicknesses and considerably stronger at increased thicknesses. These results corroborate clinical data from a previous study in which PADM was associated with a higher intraoperative device failure rate. Although numerous properties of acellular dermal matrix contribute to clinical outcomes, surgeons should consider initial mechanical strength properties when choosing acellular dermal matrices for load-bearing applications such as hernia repair.
Bleach Neutralizes Mold Allergens
ERIC Educational Resources Information Center
Science Teacher, 2005
2005-01-01
Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…
Effecting aging time of epoxy molding compound to molding process for integrated circuit packaging
NASA Astrophysics Data System (ADS)
Tachapitunsuk, Jirayu; Ugsornrat, Kessararat; Srisuwitthanon, Warayoot; Thonglor, Panakamon
2017-09-01
This research studied about effecting aging time of epoxy molding compound (EMC) that effect to reliability performance of integrated circuit (IC) package in molding process. Molding process is so important of IC packaging process for protecting IC chip (or die) from temperature and humidity environment using encapsulated EMC. For general molding process, EMC are stored in the frozen at 5°C and left at room temperature at 25 °C for aging time on self before molding of die onto lead frame is 24 hours. The aging time effect to reliability performance of IC package due to different temperature and humidity inside the package. In experiment, aging time of EMC were varied from 0 to 24 hours for molding process of SOIC-8L packages. For analysis, these packages were tested by x-ray and scanning acoustic microscope to analyze properties of EMC with an aging time and also analyzed delamination, internal void, and wire sweep inside the packages with different aging time. The results revealed that different aging time of EMC effect to properties and reliability performance of molding process.
Porosity of porcine bladder acellular matrix: impact of ACM thickness.
Farhat, Walid; Chen, Jun; Erdeljan, Petar; Shemtov, Oren; Courtman, David; Khoury, Antoine; Yeger, Herman
2003-12-01
The objectives of this study are to examine the porosity of bladder acellular matrix (ACM) using deionized (DI) water as the model fluid and dextran as the indicator macromolecule, and to correlate the porosity to the ACM thickness. Porcine urinary bladders from pigs weighing 20-50 kg were sequentially extracted in detergent containing solutions, and to modify the ACM thickness, stretched bladders were acellularized in the same manner. Luminal and abluminal ACM specimens were subjected to fixed static DI water pressure (10 cm); and water passing through the specimens was collected at specific time interval. While for the macromolecule porosity testing, the diffusion rate and direction of 10,000 MW fluoroescein-labeled dextrans across the ACM specimens mounted in Ussing's chambers were measured. Both experiments were repeated on the thin stretched ACM. In both ACM types, the fluid porosity in both directions did not decrease with increased test duration (3 h); in addition, the abluminal surface was more porous to fluid than the luminal surface. On the other hand, when comparing thin to thick ACM, the porosity in either direction was higher in the thick ACM. Macromolecule porosity, as measured by absorbance, was higher for the abluminal thick ACM than the luminal side, but this characteristic was reversed in the thin ACM. Comparing thin to thick ACM, the luminal side in the thin ACM was more porous to dextran than in the thick ACM, but this characteristic was reversed for the abluminal side. The porcine bladder ACM possesses directional porosity and acellularizing stretched urinary bladders may increase structural density and alter fluid and macromolecule porosity. Copyright 2003 Wiley Periodicals, Inc. J Biomed Mater Res 67A: 970-974, 2003
Staged mold for encapsulating hazardous wastes
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1990-01-01
A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
Staged mold for encapsulating hazardous wastes
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1988-01-01
A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...
Thermophilic molds: Biology and applications.
Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi
2016-11-01
Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications.
Human acellular dermal wound matrix: evidence and experience.
Kirsner, Robert S; Bohn, Greg; Driver, Vickie R; Mills, Joseph L; Nanney, Lillian B; Williams, Marie L; Wu, Stephanie C
2015-12-01
A chronic wound fails to complete an orderly and timely reparative process and places patients at increased risk for wound complications that negatively impact quality of life and require greater health care expenditure. The role of extracellular matrix (ECM) is critical in normal and chronic wound repair. Not only is ECM the largest component of the dermal skin layer, but also ECM proteins provide structure and cell signalling that are necessary for successful tissue repair. Chronic wounds are characterised by their inflammatory and proteolytic environment, which degrades the ECM. Human acellular dermal matrices, which provide an ECM scaffold, therefore, are being used to treat chronic wounds. The ideal human acellular dermal wound matrix (HADWM) would support regenerative healing, providing a structure that could be repopulated by the body's cells. Experienced wound care investigators and clinicians discussed the function of ECM, the evidence related to a specific HADWM (Graftjacket(®) regenerative tissue matrix, Wright Medical Technology, Inc., licensed by KCI USA, Inc., San Antonio, TX), and their clinical experience with this scaffold. This article distills these discussions into an evidence-based and practical overview for treating chronic lower extremity wounds with this HADWM. © 2013 The Authors. International Wound Journal © 2013 Medicalhelplines.com Inc and John Wiley & Sons Ltd.
MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS
Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...
Mold Allergy: Proper Humidifier Care
... Training Home Conditions Allergy Allergy Overview Allergy Allergens Mold Allergy Proper Humidifier Care Proper Humidifier Care Make ... neglected humidifier can be a major source of mold and mold spores. Learn how to keep a ...
Mechanical properties of acellular mouse lungs after sterilization by gamma irradiation.
Uriarte, Juan J; Nonaka, Paula N; Campillo, Noelia; Palma, Renata K; Melo, Esther; de Oliveira, Luis V F; Navajas, Daniel; Farré, Ramon
2014-12-01
Lung bioengineering using decellularized organ scaffolds is a potential alternative for lung transplantation. Clinical application will require donor scaffold sterilization. As gamma-irradiation is a conventional method for sterilizing tissue preparations for clinical application, the aim of this study was to evaluate the effects of lung scaffold sterilization by gamma irradiation on the mechanical properties of the acellular lung when subjected to the artificial ventilation maneuvers typical within bioreactors. Twenty-six mouse lungs were decellularized by a sodium dodecyl sulfate detergent protocol. Eight lungs were used as controls and 18 of them were submitted to a 31kGy gamma irradiation sterilization process (9 kept frozen in dry ice and 9 at room temperature). Mechanical properties of acellular lungs were measured before and after irradiation. Lung resistance (RL) and elastance (EL) were computed by linear regression fitting of recorded signals during mechanical ventilation (tracheal pressure, flow and volume). Static (Est) and dynamic (Edyn) elastances were obtained by the end-inspiratory occlusion method. After irradiation lungs presented higher values of resistance and elastance than before irradiation: RL increased by 41.1% (room temperature irradiation) and 32.8% (frozen irradiation) and EL increased by 41.8% (room temperature irradiation) and 31.8% (frozen irradiation). Similar increases were induced by irradiation in Est and Edyn. Scanning electron microscopy showed slight structural changes after irradiation, particularly those kept frozen. Sterilization by gamma irradiation at a conventional dose to ensure sterilization modifies acellular lung mechanics, with potential implications for lung bioengineering. Copyright © 2014 Elsevier Ltd. All rights reserved.
Allergy and "toxic mold syndrome".
Edmondson, David A; Nordness, Mark E; Zacharisen, Michael C; Kurup, Viswanath P; Fink, Jordan N
2005-02-01
"Toxic mold syndrome" is a controversial diagnosis associated with exposure to mold-contaminated environments. Molds are known to induce asthma and allergic rhinitis through IgE-mediated mechanisms, to cause hypersensitivity pneumonitis through other immune mechanisms, and to cause life-threatening primary and secondary infections in immunocompromised patients. Mold metabolites may be irritants and may be involved in "sick building syndrome." Patients with environmental mold exposure have presented with atypical constitutional and systemic symptoms, associating those symptoms with the contaminated environment. To characterize the clinical features and possible etiology of symptoms in patients with chief complaints related to mold exposure. Review of patients presenting to an allergy and asthma center with the chief complaint of toxic mold exposure. Symptoms were recorded, and physical examinations, skin prick/puncture tests, and intracutaneous tests were performed. A total of 65 individuals aged 1 1/2 to 52 years were studied. Symptoms included rhinitis (62%), cough (52%), headache (34%), respiratory symptoms (34%), central nervous system symptoms (25%), and fatigue (23%). Physical examination revealed pale nasal mucosa, pharyngeal "cobblestoning," and rhinorrhea. Fifty-three percent (33/62) of the patients had skin reactions to molds. Mold-exposed patients can present with a variety of IgE- and non-IgE-mediated symptoms. Mycotoxins, irritation by spores, or metabolites may be culprits in non-IgE presentations; environmental assays have not been perfected. Symptoms attributable to the toxic effects of molds and not attributable to IgE or other immune mechanisms need further evaluation as to pathogenesis. Allergic, rather than toxic, responses seemed to be the major cause of symptoms in the studied group.
Acellular vaccines for preventing whooping cough in children.
Zhang, Linjie; Prietsch, Sílvio O M; Axelsson, Inge; Halperin, Scott A
2014-09-17
Routine use of whole-cell pertussis (wP) vaccines was suspended in some countries in the 1970s and 1980s because of concerns about adverse effects. Following this action, there was a resurgence of whooping cough. Acellular pertussis (aP) vaccines, containing purified or recombinant Bordetella pertussis (B. pertussis) antigens, were developed in the hope that they would be as effective, but less reactogenic than the whole-cell vaccines. This is an update of a Cochrane review first published in 1999, and previously updated in 2012. In this update, we included no new studies. To assess the efficacy and safety of acellular pertussis vaccines in children and to compare them with the whole-cell vaccines. We searched CENTRAL (2013, Issue 12), MEDLINE (1950 to January week 2, 2014), EMBASE (1974 to January 2014), Biosis Previews (2009 to January 2014) and CINAHL (2009 to January 2014). We selected double-blind randomised efficacy and safety trials of aP vaccines in children up to six years old, with active follow-up of participants and laboratory verification of pertussis cases. Two review authors independently extracted data and assessed the risk of bias in the studies. Differences in trial design precluded a meta-analysis of the efficacy data. We pooled the safety data from individual trials using a random-effects meta-analysis model. We included six efficacy trials with a total of 46,283 participants and 52 safety trials with a total of 136,541 participants. Most of the safety trials did not report the methods for random sequence generation, allocation concealment and blinding, which made it difficult to assess the risk of bias in the studies. The efficacy of multi-component (≥ three) vaccines varied from 84% to 85% in preventing typical whooping cough (characterised by 21 or more consecutive days of paroxysmal cough with confirmation of B. pertussis infection by culture, appropriate serology or contact with a household member who has culture-confirmed pertussis), and
Agarwal, Jayant P; Mendenhall, Shaun D; Anderson, Layla A; Ying, Jian; Boucher, Kenneth M; Liu, Ting; Neumayer, Leigh A
2015-01-01
Recent literature has focused on the advantages and disadvantages of using acellular dermal matrix in breast reconstruction. Many of the reported data are from low level-of-evidence studies, leaving many questions incompletely answered. The present randomized trial provides high-level data on the incidence and severity of complications in acellular dermal matrix breast reconstruction between two commonly used types of acellular dermal matrix. A prospective randomized trial was conducted to compare outcomes of immediate staged tissue expander breast reconstruction using either AlloDerm or DermaMatrix. The impact of body mass index, smoking, diabetes, mastectomy type, radiation therapy, and chemotherapy on outcomes was analyzed. Acellular dermal matrix biointegration was analyzed clinically and histologically. Patient satisfaction was assessed by means of preoperative and postoperative surveys. Logistic regression models were used to identify predictors of complications. This article reports on the study design, surgical technique, patient characteristics, and preoperative survey results, with outcomes data in a separate report. After 2.5 years, we successfully enrolled and randomized 128 patients (199 breasts). The majority of patients were healthy nonsmokers, with 41 percent of patients receiving radiation therapy and 49 percent receiving chemotherapy. Half of the mastectomies were prophylactic, with nipple-sparing mastectomy common in both cancer and prophylactic cases. Preoperative survey results indicate that patients were satisfied with their premastectomy breast reconstruction education. Results from the Breast Reconstruction Evaluation Using Acellular Dermal Matrix as a Sling Trial will assist plastic surgeons in making evidence-based decisions regarding acellular dermal matrix-assisted tissue expander breast reconstruction. Therapeutic, II.
Molding process for imidazopyrrolone polymers
NASA Technical Reports Server (NTRS)
Johnson, C. L. (Inventor)
1973-01-01
A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.
Creating mold-free buildings: a key to avoiding health effects of indoor molds.
Small, Bruce M
2003-08-01
In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing.
ERIC Educational Resources Information Center
Carlson, Kenneth W.
1985-01-01
The slime mold Physarum polycephalum provides an easily maintained classroom plant which can act like an animal. Directions are given for: acquiring the organism; activating it; observing its life cycle; and viewing protoplasmic streaming. (DH)
Interposition Ankle Arthroplasty Using Acellular Dermal Matrix: A Small Series.
Carpenter, Brian; Duncan, Kyle; Ernst, Jordan; Ryba, Dalton; Suzuki, Sumihiro
Although ankle arthrodesis is the reference standard for end-stage ankle arthritis, loss of mobility and adjacent joint arthritis are consequences that alternatives to arthrodesis attempt to avoid. The purpose of the present study was to report the clinical results of interpositional arthroplasty using acellular dermal matrix in 4 patients (age 32 to 42 years) for the treatment of advanced ankle osteoarthritis. The primary findings included relief of pain, with improvement in tibiotalar joint range of motion from a mean of 16.5° (range 0° to 24°) preoperatively to a mean of 31° (range 25° to 40°) postoperatively. All 4 patients underwent open arthrotomy of the anterior and posterior tibiotalar capsule with plafond exostectomy and debridement of all deleterious tissue within the ankle capsule. The articular surface of the talar dome was denuded down to smooth subchondral bone, and microfracture was performed. Autologous calcaneal bone marrow aspirate was applied, and talar resurfacing was achieved using an acellular dermal matrix. Knotless anchors placed medially and laterally within the anterior and posterior dome were used to affix the dermal matrix. The follow-up period ranged from 12 to 18 (mean 14) months. The mean pre- and 12-month postoperative Association of Orthopaedic Foot and Ankle Society hindfoot-ankle scale scores were 35 and 88.5, respectively. These outcomes suggest that interpositional tibiotalar arthroplasty using an acellular dermal matrix is successful in improving function and range of motion and decreasing pain. As an alternative to tibiotalar arthrodesis, interpositional tibiotalar arthroplasty might be the procedure of choice for young patients with end-stage ankle arthritis. Longer follow-up periods, histologic testing, and arthroscopic evaluations would be advantageous to further assess the durability of this procedure. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.
Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...
Computer-aided injection molding system
NASA Astrophysics Data System (ADS)
Wang, K. K.; Shen, S. F.; Cohen, C.; Hieber, C. A.; Isayev, A. I.
1982-10-01
Achievements are reported in cavity-filling simulation, modeling viscoelastic effects, measuring and predicting frozen-in birefringence in molded parts, measuring residual stresses and associated mechanical properties of molded parts, and developing an interactive mold-assembly design program and an automatic NC maching data generation and verification program. The Cornell Injection Molding Program (CIMP) consortium is discussed as are computer user manuals that have been published by the consortium. Major tasks which should be addressed in future efforts are listed, including: (1) predict and experimentally determine the post-fillin behavior of thermoplastics; (2) simulate and experimentally investigate the injection molding of thermosets and filled materials; and (3) further investigate residual stresses, orientation and mechanical properties.
Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmad, Faiz, E-mail: faizahmad@petronas.com.my; Aslam, Muhammad, E-mail: klaira73@gmail.com; Altaf, Khurram, E-mail: khurram.altaf@petronas.com.my
2015-07-22
Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Randommore » orientation of fibers was noted in the composites test bars produced from divergent melt flow.« less
Robison, Nathan E; Tantbirojn, Daranee; Versluis, Antheunis; Cagna, David R
2016-08-01
Denture tooth fracture or debonding remains a common problem in removable prosthodontics. The purpose of this in vitro study was to explore factors determining failure strengths for combinations of different denture tooth designs (shape, materials) and injection or compression molded denture base resins. Three central incisor denture tooth designs were tested: nanohybrid composite (NHC; Ivoclar Phonares II), interpenetrating network (IPN; Dentsply Portrait), and microfiller reinforced polyacrylic (MRP; VITA Physiodens). Denture teeth of each type were processed on an injection molded resin (IvoBase HI; Ivoclar Vivadent AG) or a compression molded resin (Lucitone 199; Dentsply Intl) (n=11 or 12). The denture teeth were loaded at 45 degrees on the incisal edge. The failure load was recorded and analyzed with 2-way ANOVA (α=.05), and the fracture mode was categorized from observed fracture surfaces as cohesive, adhesive, or mixed failure. The following failure loads (mean ±SD) were recorded: NHC/injection molded 280 ±52 N; IPN/injection molded 331 ±41 N; MRP/injection molded 247 ±23 N; NHC/compression molded 204 ±31 N; IPN/compression molded 184 ±17 N; MRP/compression molded 201 ±16 N. Injection molded resin yielded significantly higher failure strength for all denture teeth (P<.001), among which IPN had the highest strength. Failure was predominantly cohesive in the teeth, with the exception of mixed mode for the IPN/compression group. When good bonding was achieved, the strength of the structure (denture tooth/base resin combination) was determined by the strength of the denture teeth, which may be affected by the processing technique. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
Pyrotechnic filled molding powder
Hartzel, Lawrence W.; Kettling, George E.
1978-01-01
The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.
Slime Analysis of Painted Steel Panels Immersed in Biscayne Bay, Miami Beach, Florida.
1981-03-30
site ploratory tests on materials under consideration for water. Since the sample panels are curved to fit the heat exchangers was undertaken to... tested in this program were standard and experimental Navy materials and a selection of proprietary coatings supplied by coinrcial manufacturers. Navy...of marine microbial slime fouling filims. Application Is described to fouling of metal heat exchanger pipe in the Ocean Thermal Enrgy Conversion
[Tissue engineering of urinary bladder using acellular matrix].
Glybochko, P V; Olefir, Yu V; Alyaev, Yu G; Butnaru, D V; Bezrukov, E A; Chaplenko, A A; Zharikova, T M
2017-04-01
Tissue engineering has become a new promising strategy for repairing damaged organs of the urinary system, including the bladder. The basic idea of tissue engineering is to integrate cellular technology and advanced bio-compatible materials to replace or repair tissues and organs. of the study is the objective reflection of the current trends and advances in tissue engineering of the bladder using acellular matrix through a systematic search of preclinical and clinical studies of interest. Relevant studies, including those on methods of tissue engineering of urinary bladder, was retrieved from multiple databases, including Scopus, Web of Science, PubMed, Embase. The reference lists of the retrieved review articles were analyzed for the presence of the missing relevant publications. In addition, a manual search for registered clinical trials was conducted in clinicaltrials.gov. Following the above search strategy, a total of 77 eligible studies were selected for further analysis. Studies differed in the types of animal models, supporting structures, cells and growth factors. Among those, studies using cell-free matrix were selected for a more detailed analysis. Partial restoration of urothelium layer was observed in most studies where acellular grafts were used for cystoplasty, but no the growth of the muscle layer was observed. This is the main reason why cellular structures are more commonly used in clinical practice.
ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.
ERIC Educational Resources Information Center
CHANDLER, MARION N.
THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES.…
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
Tetu, Sasha G; Breakwell, Katy; Elbourne, Liam D H; Holmes, Andrew J; Gillings, Michael R; Paulsen, Ian T
2013-06-01
Beneath Australia's large, dry Nullarbor Plain lies an extensive underwater cave system, where dense microbial communities known as 'slime curtains' are found. These communities exist in isolation from photosynthetically derived carbon and are presumed to be chemoautotrophic. Earlier work found high levels of nitrite and nitrate in the cave waters and a high relative abundance of Nitrospirae in bacterial 16S rRNA clone libraries. This suggested that these communities may be supported by nitrite oxidation, however, details of the inorganic nitrogen cycling in these communities remained unclear. Here we report analysis of 16S rRNA amplicon and metagenomic sequence data from the Weebubbie cave slime curtain community. The microbial community is comprised of a diverse assortment of bacterial and archaeal genera, including an abundant population of Thaumarchaeota. Sufficient thaumarchaeotal sequence was recovered to enable a partial genome sequence to be assembled, which showed considerable synteny with the corresponding regions in the genome of the autotrophic ammonia oxidiser Nitrosopumilus maritimus SCM1. This partial genome sequence, contained regions with high sequence identity to the ammonia mono-oxygenase operon and carbon fixing 3-hydroxypropionate/4-hydroxybutyrate cycle genes of N. maritimus SCM1. Additionally, the community, as a whole, included genes encoding key enzymes for inorganic nitrogen transformations, including nitrification and denitrification. We propose that the Weebubbie slime curtain community represents a distinctive microbial ecosystem, in which primary productivity is due to the combined activity of archaeal ammonia-oxidisers and bacterial nitrite oxidisers.
Mathematical modeling of the process of filling a mold during injection molding of ceramic products
NASA Astrophysics Data System (ADS)
Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.
2015-10-01
Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.
Mold growth may be a problem after flooding. Excess moisture in the home is cause for concern about indoor air quality primarily because it provides breeding conditions for pests, molds and other microorganisms.
Acellular pertussis vaccines--a question of efficacy.
Olin, P
1995-06-01
Whole cell pertussis vaccine is considered to offer at least 80% protection against typical whooping cough. The quest for an equally effective but less reactogenic vaccine is now drawing to a close. During the forthcoming year a number of efficacy trials of acellular pertussis vaccines will be terminated. A variety of vaccines containing one, two, three or five purified pertussis antigens are being tested in Germany, Italy, Senegal and Sweden. About 30,000 infants have been enrolled in placebo-controlled studies and more than 100,000 in whole cell vaccine-controlled trials. The final plans for analysis of a Swedish placebo-controlled trial of whole cell and acellular vaccines is presented. Due to the unexpected high incidence of pertussis in Sweden during 1993-1994, relative risk comparisons between vaccines will be attempted in that trial, in addition to estimating absolute efficacy. A crucial issue is to what extent data may be compared between trials, given differences in design, vaccination schedules, and chosen endpoints. A primary case definition of laboratory-confirmed pertussis with at least 21 days of paroxysmal cough have been adopted in most trials. Pre-planned meta-analysis using this single endpoint will facilitate comparisons between vaccines. Serological correlates to protection in individuals will be sought in the ongoing placebo-controlled trials. The concept of a serological correlate valid for a vaccinated population but not necessarily for the vaccinated individual, as is the case with Hib vaccines, may turn out to be the only alternative to performing large efficacy trials in the future.
Environmental Sustainability and Mold Hygiene in Buildings
Ng, Tsz Wai; Lai, Ka Man
2018-01-01
Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management. PMID:29617339
Environmental Sustainability and Mold Hygiene in Buildings.
Wu, Haoxiang; Ng, Tsz Wai; Wong, Jonathan Wc; Lai, Ka Man
2018-04-04
Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management.
Predicting shrinkage and warpage in injection molding: Towards automatized mold design
NASA Astrophysics Data System (ADS)
Zwicke, Florian; Behr, Marek; Elgeti, Stefanie
2017-10-01
It is an inevitable part of any plastics molding process that the material undergoes some shrinkage during solidification. Mainly due to unavoidable inhomogeneities in the cooling process, the overall shrinkage cannot be assumed as homogeneous in all volumetric directions. The direct consequence is warpage. The accurate prediction of such shrinkage and warpage effects has been the subject of a considerable amount of research, but it is important to note that this behavior depends greatly on the type of material that is used as well as the process details. Without limiting ourselves to any specific properties of certain materials or process designs, we aim to develop a method for the automatized design of a mold cavity that will produce correctly shaped moldings after solidification. Essentially, this can be stated as a shape optimization problem, where the cavity shape is optimized to fulfill some objective function that measures defects in the molding shape. In order to be able to develop and evaluate such a method, we first require simulation methods for the diffierent steps involved in the injection molding process that can represent the phenomena responsible for shrinkage and warpage ina sufficiently accurate manner. As a starting point, we consider the solidification of purely amorphous materials. In this case, the material slowly transitions from fluid-like to solid-like behavior as it cools down. This behavior is modeled using adjusted viscoelastic material models. Once the material has passed a certain temperature threshold during cooling, any viscous effects are neglected and the behavior is assumed to be fully elastic. Non-linear elastic laws are used to predict shrinkage and warpage that occur after this point. We will present the current state of these simulation methods and show some first approaches towards optimizing the mold cavity shape based on these methods.
Woon, Colin Y L; Pridgen, Brian C; Kraus, Armin; Bari, Sina; Pham, Hung; Chang, James
2011-03-01
Tissue engineering of human flexor tendons combines tendon scaffolds with recipient cells to create complete cell-tendon constructs. Allogenic acellularized human flexor tendon has been shown to be a useful natural scaffold. However, there is difficulty repopulating acellularized tendon with recipient cells, as cell penetration is restricted by a tightly woven tendon matrix. The authors evaluated peracetic acid treatment in optimizing intratendinous cell penetration. Cadaveric human flexor tendons were harvested, acellularized, and divided into experimental groups. These groups were treated with peracetic acid in varying concentrations (2%, 5%, and 10%) and for varying time periods (4 and 20 hours) to determine the optimal treatment protocol. Experimental tendons were analyzed for differences in tendon microarchitecture. Additional specimens were reseeded by incubation in a fibroblast cell suspension at 1 × 10(6) cells/ml. This group was then analyzed for reseeding efficacy. A final group underwent biomechanical studies for strength. The optimal treatment protocol comprising peracetic acid at 5% concentration for 4 hours produced increased scaffold porosity, improving cell penetration and migration. Treated scaffolds did not show reduced collagen or glycosaminoglycan content compared with controls (p = 0.37 and p = 0.65, respectively). Treated scaffolds were cytotoxic to neither attached cells nor the surrounding cell suspension. Treated scaffolds also did not show inferior ultimate tensile stress or elastic modulus compared with controls (p = 0.26 and p = 0.28, respectively). Peracetic acid treatment of acellularized tendon scaffolds increases matrix porosity, leading to greater reseeding. It may prove to be an important step in tissue engineering of human flexor tendon using natural scaffolds.
Method for molding ceramic powders
Janney, Mark A.
1990-01-01
A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.
Method for molding ceramic powders
Janney, M.A.
1990-01-16
A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.
Precision injection molding of freeform optics
NASA Astrophysics Data System (ADS)
Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong
2016-08-01
Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.
Full-mouth esthetic rehabilitation with acellular dermal matrix.
Clozza, Emanuele; Suzuki, Takanori; Engebretson, Steven P
2014-01-01
Treatment of multiple recession defects with the adjunct use of a connective tissue graft (CTG) represents a challenge when diagnosed in several teeth of the mouth. The amount of CTG harvested from the palate may not be adequate to address this condition. In such scenarios, alternative sources such as acellular dermal matrix (ADM) are preferred due to the unlimited availability. A case report is presented, dealing with the treatment of multiple gingival recessions affecting the majority of dentition using ADM, with a 6-month follow-up.
Yu, X; Martin, S E; Schmidt, S J
2008-03-01
Mold growth is a common problem during the equilibration of food materials at high relative humidity values using the standard saturated salt slurry method. Exposing samples to toluene vapor and mixing samples with mold inhibitor chemicals are suggested methods for preventing mold growth while obtaining isotherms. However, no published research was found that examined the effect of mold growth on isotherm performance or the efficacy of various mold inhibitor methods, including their possible effect on the physicochemical properties of food materials. Therefore, the objectives of this study were to (1) explore the effect of mold growth on isotherm performance in a range of food materials, (2) investigate the effectiveness of 4 mold inhibitor methods, irradiation, 2 chemical inhibitors (potassium sorbate and sodium acetate), and toluene vapor, on mold growth on dent corn starch inoculated with A. niger, and (3) examine the effect of mold inhibitor methods on the physicochemical properties of dent corn starch, including isotherm performance, pasting properties, gelatinization temperature, and enthalpy. Mold growth was found to affect starch isotherm performance by contributing to weight changes during sample equilibration. Among the 4 mold inhibitor methods tested, irradiation and toluene vapor were found to be the most effective for inhibiting growth of A. niger on dent cornstarch. However, both methods exhibited a significant impact on the starches' physiochemical properties, suggesting the need to probe the efficacy of other mold inhibitor methods and explore the use of new rapid isotherm instruments, which hamper mold growth by significantly decreasing measurement time.
REFRACTORY COATING FOR GRAPHITE MOLDS
Stoddard, S.D.
1958-06-24
Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.
Momoh, Adeyiza O; Kamat, Ashish M; Butler, Charles E
2010-12-01
Pelvic floor reconstruction after pelvic exenteration is challenging, particularly with bacterial contamination and/or pelvic irradiation. Traditional regional myocutaneous flap options are not always avaliable, especially in the multiply operated patient. Human acellular dermal matrix (HADM) confers several advantages and is associated with less morbidity when compared to synthetic mesh used in these compromised wound beds. We report a clinical case of an elderly patient with an anterior pelvic floor defect, who underwent successful reconstruction with a combination of human acellular dermal matrix and an omental flap. Copyright © 2010. Published by Elsevier Ltd.
Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robert D. Pehlke; John T. Berry
2005-12-16
Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, directmore » method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models
NASA Astrophysics Data System (ADS)
Park, Keun; Lee, Sang-Ik
2010-03-01
High-frequency induction is an efficient, non-contact means of heating the surface of an injection mold through electromagnetic induction. Because the procedure allows for the rapid heating and cooling of mold surfaces, it has been recently applied to the injection molding of thin-walled parts or micro/nano-structures. The present study proposes a localized heating method involving the selective use of mold materials to enhance the heating efficiency of high-frequency induction heating. For localized induction heating, a composite injection mold of ferromagnetic material and paramagnetic material is used. The feasibility of the proposed heating method is investigated through numerical analyses in terms of its heating efficiency for localized mold surfaces and in terms of the structural safety of the composite mold. The moldability of high aspect ratio micro-features is then experimentally compared under a variety of induction heating conditions.
Particle Image Velocimetry During Injection Molding
NASA Astrophysics Data System (ADS)
Bress, Thomas; Dowling, David
2012-11-01
Injection molding involves the unsteady non-isothermal flow of a non-Newtonian polymer melt. An optical-access mold has been used to perform particle image velocimetry (PIV) on molten polystyrene during injection molding. Velocimetry data of the mold-filling flow will be presented. Statistical assessments of the velocimetry data and scaled residuals of the continuity equation suggest that PIV can be conducted in molten plastics with an uncertainty of +/-2 percent. Simulations are often used to model polymer flow during injection molding to design molds and select processing parameters but it is difficult to determine the accuracy of these simulations due to a lack of in-mold velocimetry and melt-front progression data. Moldflow was used to simulate the filling of the optical-access mold, and these simulated results are compared to the appropriately-averaged time-varying velocity field measurements. Simulated results for melt-front progression are also compared with the experimentally observed flow fronts. The ratio of the experimentally measured average velocity magnitudes to the simulation magnitudes was found on average to be 0.99 with a standard deviation of 0.25, and the difference in velocity orientations was found to be 0.9 degree with a standard deviation of 3.2 degrees. formerly at the University of Michigan.
Dynamic Feed Control For Injection Molding
Kazmer, David O.
1996-09-17
The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.
Non-cross-linked porcine acellular dermal matrices for abdominal wall reconstruction.
Burns, Nadja K; Jaffari, Mona V; Rios, Carmen N; Mathur, Anshu B; Butler, Charles E
2010-01-01
Non-cross-linked porcine acellular dermal matrices have been used clinically for abdominal wall repair; however, their biologic and mechanical properties and propensity to form visceral adhesions have not been studied. The authors hypothesized that their use would result in fewer, weaker visceral adhesions than polypropylene mesh when used to repair ventral hernias and form a strong interface with the surrounding musculofascia. Thirty-four guinea pigs underwent inlay repair of surgically created ventral hernias using polypropylene mesh, porcine acellular dermal matrix, or a composite of the two. The animals were killed at 4 weeks, and the adhesion tenacity grade and surface area of the repair site involved by adhesions were measured. Sections of the repair sites, including the implant-musculofascia interface, underwent histologic analysis and uniaxial mechanical testing. The incidence of bowel adhesions to the repair site was significantly lower with the dermal matrix (8 percent, p < 0.01) and the matrix/mesh combination (0 percent, p < 0.001) than with polypropylene mesh alone (70 percent). The repairs made with the matrix or the matrix/mesh combination, compared with the polypropylene mesh repairs, had significantly lower mean adhesion surface areas [12.8 percent (p < 0.001), 9.2 percent (p < 0.001), and 79.9 percent] and grades [0.6 (p < 0.001), 0.6 (p < 0.001), and 2.9]. The dermal matrix underwent robust cellular and vascular infiltration. The ultimate tensile strength at the implant-musculofascia interface was similar in all groups. Porcine acellular dermal matrix becomes incorporated into the host tissue and causes fewer adhesions to repair sites than does polypropylene mesh, with similar implant-musculofascia interface strength. It also inhibits adhesions to adjacent dermal matrix in the combination repairs. It has distinct advantages over polypropylene mesh for complex abdominal wall repairs, particularly when material placement directly over bowel is
ERIC Educational Resources Information Center
Herlocker, Helen; And Others
1988-01-01
Provides information on motivational activities, demonstrations, experiments, software, lessons, field trips, and a game as ideas for instructional use. Includes topics on digestion in paramecium, diffusion, cells, interactive displays, slime molds, and the construction of an underwater viewing device. (RT)
The Development of a Biologist
ERIC Educational Resources Information Center
Flannery, Maura C.
2004-01-01
John Tyler Bonner, a biologist writings reminded the reader of how his perspective is different from that of many biologists. Bonner's views, his books, his areas of interest and research and his life, which was spent studying slime molds is described.
Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo
2014-06-27
Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications.
How to control bio-slime in condenser cooling system water
DOE Office of Scientific and Technical Information (OSTI.GOV)
Freymark, S.
1979-08-01
A number of oxidizing and non-oxidizing biocides are currently used for biocontrol. However, yesterday's solution to slime-fouling problems may not apply today in view of tightening effluent restrictions on chlorine. Thus, selection of biocontrol compounds can not be made indiscriminately. In selecting alternative biocontrol compounds, consideration should be given not only to costs but to effectiveness of the biocide in each particular application, taking into consideration cooling water quality, type of microbiological fouling and discharge restrictions. Thoughtful selection of the biocontrol compound(s), alone or in combination with surface-active agents, is essential for maintaining maximum microbiological control in condenser cooling watermore » systems.« less
NASA Astrophysics Data System (ADS)
Slobodzinsky, A.
Features, materials, and techniques of vacuum, pressure, and autoclave FRP bag molding processes are described. The bags are used in sealed environments, inflated to flexibly force a curing FRP laminate to conform to a stiff mold form which defines the shape of the finished product. Densification is achieved as the bag presses out the voids and excess resin from the laminate, and consolidation occurs as the plies and adherends are bonded by the bag pressure. Curing techniques nominally involved room temperature or high temperature, and investigations of alternative techniques, such as induction, dielectric, microwave, xenon flash, UV, electron beam, and gamma radiation heating are proceeding. Polysulfone is the most common thermoplastic. Details are given of mold preparations, peel plies or release films and fabrics, bagging techniques, and reusable venting blankets and silicone rubber bags.
Management of gingival recession by the use of an acellular dermal graft material: a 12-case series.
Santos, A; Goumenos, G; Pascual, A
2005-11-01
Different soft tissue defects can be treated by a variety of surgical procedures. Most of these techniques require the palatal area as a donor site. Recently, an acellular dermal graft has become available that can substitute for palatal donor tissue. This study describes the surgical technique for gingival augmentation and root coverage and the results of 12 clinical cases. A comparison between the three most popular mucogingival procedures for root coverage is also presented. The results of the 12 patients and the 26 denuded surfaces have shown that we can obtain a mean root coverage of 74% with the acellular dermal graft. Thirteen out of the 26 denuded surfaces had complete root coverage. The average increase in keratinized tissue was 1.19 mm. It seems that the long-term results of the cases are stable. The proposed technique of root coverage with an acellular dermal graft can be a good alternative to soft tissue grafts for root coverage, and it should be part of our periodontal plastic surgery armamentarium.
Nagao, Ryan J; Lundy, Scott; Khaing, Zin Z; Schmidt, Christine E
2011-07-01
Acellular grafts are a viable option for use in nerve reconstruction surgeries. Recently, our lab created a novel optimized decellularization procedure that removes immunological material while leaving the majority of the extracellular matrix structure intact. The optimized acellular (OA) graft has been shown to elicit an immune response equal to or less than that elicited by the isograft, the analog of the autograft in the rat model. We investigated the performance of the OA graft to provide functional recovery in a long-term study. We performed a long-term functional regeneration evaluation study using the sciatic functional index to quantify recovery of Lewis rats at regular time intervals for up to 52 weeks after graft implantation following 1 cm sciatic nerve resection. OA grafts were compared against other decellularized methods (Sondell treatment and thermal decellularization), as well as the isograft and primary neurorrhaphy. The OA graft supported comparable functional recovery to the isograft and superior regeneration to thermal and Sondell decellularization methods. Furthermore, the OA graft promoted early recovery to a greater degree compared to acellular grafts obtained using either the thermal or the Sondell methods. Equivalent functional recovery to the isograft suggests that the OA nerve graft may be a future clinical alternative to the current autologous tissue graft.
Graf, Neil J; Bowser, Michael T
2013-10-07
Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries.
Shen, Congcong; Yao, Caroline A; Magee, William; Chai, Gang; Zhang, Yan
2015-06-01
The authors present a novel nasoalveolar molding protocol by prefabricating sets of nasoalveolar molding appliances using three-dimensional technology. Prospectively, 17 infants with unilateral complete cleft lip and palate underwent the authors' protocol before primary cheiloplasty. An initial nasoalveolar molding appliance was created based on the patient's first and only in-person maxillary cast, produced from a traditional intraoral dental impression. Thereafter, each patient's molding course was simulated using computer software that aimed to narrow the alveolar gap by 1 mm each week by rotating the greater alveolar segment. A maxillary cast of each predicted molding stage was created using three-dimensional printing. Subsequent appliances were constructed in advance, based on the series of computer-generated casts. Each patient had a total three clinic visits spaced 1 month apart. Anthropometric measurements and bony segment volumes were recorded before and after treatment. Alveolar cleft widths narrowed significantly (p < 0.01), soft-tissue volume of each segment expanded (p < 0.01), and the arc of the alveolus became more contiguous across the cleft (p < 0.01). One patient required a new appliance at the second visit because of bleeding and discomfort. Eleven patients had mucosal irritation and two experienced minor mucosal ulceration. Three-dimensional technology can precisely represent anatomic structures in pediatric clefts. Results from the authors' algorithm are equivalent to those of traditional nasoalveolar molding therapies; however, the number of required clinic visits and appliance adjustments decreased. As three-dimensional technology costs decrease, multidisciplinary teams may design customized nasoalveolar molding treatment with improved efficiency and less burden to medical staff, patients, and families. Therapeutic, IV.
Li, Yang; Chen, Zhangxing; Xu, Hongyi; ...
2017-01-02
Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yang; Chen, Zhangxing; Xu, Hongyi
Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less
Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo
2014-01-01
Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993
HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS
Stoddard, S.D.
1958-10-21
An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.
Emerging hierarchies in dynamically adapting webs
NASA Astrophysics Data System (ADS)
Katifori, Eleni; Graewer, Johannes; Magnasco, Marcelo; Modes, Carl
Transport networks play a key role across four realms of eukaryotic life: slime molds, fungi, plants, and animals. In addition to the developmental algorithms that build them, many also employ adaptive strategies to respond to stimuli, damage, and other environmental changes. We model these adapting network architectures using a generic dynamical system on weighted graphs and find in simulation that these networks ultimately develop a hierarchical organization of the final weighted architecture accompanied by the formation of a system-spanning backbone. We quantify the hierarchical organization of the networks by developing an algorithm that decomposes the architecture to multiple scales and analyzes how the organization in each scale relates to that of the scale above and below it. The methodologies developed in this work are applicable to a wide range of systems including the slime mold physarum polycephalum, human microvasculature, and force chains in granular media.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, Stuart S; Samulski, Edward; Lopez, Renee
2010-01-01
ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determinemore » the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.« less
Snow Mold Investigations in Eastern Washington
T. H. Filer; A. G. Law
1961-01-01
"Snow mold of turf" in the Pacific Northwest must include both Fusarium Patch caused by Calonectria graminicola (Berk and Br.) (conidial stage Fusarium nivale (Fr. ) CES.), and Gray snow mold caused by Typhula itoana Imai, which occur together to give a disease complex. Snow mold of turf is the most...
Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...
Rotationally Molded Liquid Crystalline Polymers
NASA Technical Reports Server (NTRS)
Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce
2002-01-01
Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.
Transfer molding of PMR-15 polyimide resin
NASA Technical Reports Server (NTRS)
Reardon, J. P.; Moyer, D. W.; Nowak, B. E.
1985-01-01
Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.
Cellular automaton model of crowd evacuation inspired by slime mould
NASA Astrophysics Data System (ADS)
Kalogeiton, V. S.; Papadopoulos, D. P.; Georgilas, I. P.; Sirakoulis, G. Ch.; Adamatzky, A. I.
2015-04-01
In all the living organisms, the self-preservation behaviour is almost universal. Even the most simple of living organisms, like slime mould, is typically under intense selective pressure to evolve a response to ensure their evolution and safety in the best possible way. On the other hand, evacuation of a place can be easily characterized as one of the most stressful situations for the individuals taking part on it. Taking inspiration from the slime mould behaviour, we are introducing a computational bio-inspired model crowd evacuation model. Cellular Automata (CA) were selected as a fully parallel advanced computation tool able to mimic the Physarum's behaviour. In particular, the proposed CA model takes into account while mimicking the Physarum foraging process, the food diffusion, the organism's growth, the creation of tubes for each organism, the selection of optimum tube for each human in correspondence to the crowd evacuation under study and finally, the movement of all humans at each time step towards near exit. To test the model's efficiency and robustness, several simulation scenarios were proposed both in virtual and real-life indoor environments (namely, the first floor of office building B of the Department of Electrical and Computer Engineering of Democritus University of Thrace). The proposed model is further evaluated in a purely quantitative way by comparing the simulation results with the corresponding ones from the bibliography taken by real data. The examined fundamental diagrams of velocity-density and flow-density are found in full agreement with many of the already published corresponding results proving the adequacy, the fitness and the resulting dynamics of the model. Finally, several real Physarum experiments were conducted in an archetype of the aforementioned real-life environment proving at last that the proposed model succeeded in reproducing sufficiently the Physarum's recorded behaviour derived from observation of the aforementioned
Digital Twin concept for smart injection molding
NASA Astrophysics Data System (ADS)
Liau, Y.; Lee, H.; Ryu, K.
2018-03-01
Injection molding industry has evolved over decades and became the most common method to manufacture plastic parts. Monitoring and improvement in the injection molding industry are usually performed separately in each stage, i.e. mold design, mold making and injection molding process. However, in order to make a breakthrough and survive in the industrial revolution, all the stages in injection molding need to be linked and communicated with each other. Any changes in one stage will cause a certain effect in other stage because there is a correlation between each other. Hence, the simulation should not only based on the input of historical data, but it also needs to include the current condition of equipment and prediction of future events in other stages to make the responsive decision. This can be achieved by implementing the concept of Digital Twin that models the entire process as a virtual model and enables bidirectional control with the physical process. This paper presented types of data and technology required to build the Digital Twin for the injection molding industry. The concept includes Digital Twin of each stage and integration of these Digital Twin model as a thoroughgoing model of the injection molding industry.
Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamagata, Hiroshi; Nikawa, Makoto
2011-01-17
Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting.more » The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.« less
You say "lean finely textured beef," I say "pink slime".
Reid, Rita-Marie Cain
2014-01-01
In 2012, American Broadcasting Companies, Inc. (ABC) broadcast a segment on its evening news show regarding the manufacture of "lean finely textured beef" by Beef Products, Inc. (BPI). The broadcast, as well as follow-up reports and social media communications, repeatedly referred to the product as "pink slime," a term originated by a United States Department of Agriculture (USDA) employee for the processed meat. The market backlash against the product was immediate and intense. Ultimately, BPI closed three processing plants, cut hundreds of jobs, and filed for bankruptcy. BPI sued ABC and others for food libel, defamation, and tortious interference. This research analyzes those claims and defenses and discusses the future of such cases.
Mold inhibition on unseasoned southern pine
Carol A. Clausen; Vina W. Yang
2003-01-01
Concerns about indoor air quality due to mold growth have increased dramatically in the United States. In the absence of moisture management, fungicides need to be developed for indoor use to control mold establishment. An ideal fungicide for prevention of indoor mold growth on wood-based materials needs to specifically prevent spore germination and provide long-term...
Medical diagnostics for indoor mold exposure.
Hurraß, Julia; Heinzow, Birger; Aurbach, Ute; Bergmann, Karl-Christian; Bufe, Albrecht; Buzina, Walter; Cornely, Oliver A; Engelhart, Steffen; Fischer, Guido; Gabrio, Thomas; Heinz, Werner; Herr, Caroline E W; Kleine-Tebbe, Jörg; Klimek, Ludger; Köberle, Martin; Lichtnecker, Herbert; Lob-Corzilius, Thomas; Merget, Rolf; Mülleneisen, Norbert; Nowak, Dennis; Rabe, Uta; Raulf, Monika; Seidl, Hans Peter; Steiß, Jens-Oliver; Szewszyk, Regine; Thomas, Peter; Valtanen, Kerttu; Wiesmüller, Gerhard A
2017-04-01
In April 2016, the German Society of Hygiene, Environmental Medicine and Preventative Medicine (Gesellschaft für Hygiene, Umweltmedizin und Präventivmedizin (GHUP)) together with other scientific medical societies, German and Austrian medical societies, physician unions and experts has provided an AWMF (Association of the Scientific Medical Societies) guideline 'Medical diagnostics for indoor mold exposure'. This guideline shall help physicians to advise and treat patients exposed indoors to mold. Indoor mold growth is a potential health risk, even without a quantitative and/or causal association between the occurrence of individual mold species and health effects. Apart from the allergic bronchopulmonary aspergillosis (ABPA) and the mycoses caused by mold, there is only sufficient evidence for the following associations between moisture/mold damages and different health effects: Allergic respiratory diseases, asthma (manifestation, progression, exacerbation), allergic rhinitis, exogenous allergic alveolitis and respiratory tract infections/bronchitis. In comparison to other environmental allergens, the sensitizing potential of molds is estimated to be low. Recent studies show a prevalence of sensitization of 3-10% in the total population of Europe. The evidence for associations to mucous membrane irritation and atopic eczema (manifestation, progression, exacerbation) is classified as limited or suspected. Inadequate or insufficient evidence for an association is given for COPD, acute idiopathic pulmonary hemorrhage in children, rheumatism/arthritis, sarcoidosis, and cancer. The risk of infections from indoor molds is low for healthy individuals. Only molds that are capable to form toxins can cause intoxications. The environmental and growth conditions and especially the substrate determine whether toxin formation occurs, but indoor air concentrations are always very low. In the case of indoor moisture/mold damages, everyone can be affected by odor effects and
The Separate and Cumulative Effects of TBI and PTSD on Cognitive Function and Emotional Control
2009-04-01
CADDIE 80. SHY 80. BABY 80. HATRED 81. BOMB 81. TENANT 81. BUILDING 81. JOYFUL 81. SLIME 82. WMD 82. NFL 82. TOWER...82. SONG 82. FRAUD 83. BASRA 83. PARTISAN 83. HORSE 83. PLEASURE 83. MOLD 84. GUN 84. REDECORATE 84. SLUSH 84. COMEDY
A Mold by Any Other Name: One Librarian's Battle Against a Mold Bloom.
ERIC Educational Resources Information Center
Smith, Laura Katz
1997-01-01
Describes how library staff at Virginia Polytechnic Institute and State University cleaned up materials after a mold bloom in the rare book room. Includes advice for controlling mold: set up a hygrothermograph, clean dust from books, set up fans, do a "skin" test at regular intervals, keep windows closed, have dehumidifiers available.…
Acellular dermal matrix allograft used to gain attached gingiva in a case of epidermolysis bullosa.
Buduneli, Eralp; Ilgenli, Tunç; Buduneli, Nurcan; Ozdemir, Fezal
2003-11-01
Epidermolysis bullosa (EB) is an acquired disease or inherited as either autosomal dominant or recessive with an incidence of 1/50,000. The prominent clinical characteristic of the disease is the development of bullae or vesicles in mucosa or skin in response to minor trauma. A female patient with a dystrophic type of EB had been put in a maintenance regimen after completion of the initial phase of periodontal therapy and followed for 7 years. The purpose of this report is to document acellular dermal matrix allograft application to increase the width of the attached gingiva in this patient experiencing difficulty in chewing and performing plaque control due to the dramatic loss of attached gingiva after 7 years of supportive periodontal therapy. Under local anaesthesia and antibiotic coverage, the acellular dermal matrix allograft was applied in the anterior region of the upper jaw in order to increase the width of attached gingiva, thereby improving patient comfort. The healing was uneventful and a significant gain in attached gingiva dimensions was observed 9 months after the periodontal surgery. The procedure avoided a second surgical site, provided satisfactory results from an aesthetic point of view, and improved patient comfort. Acellular dermal matrix allograft may be regarded as an alternative in the treatment of EB cases to increase the width of attached gingiva and facilitate maintenance of the dentition.
Hao, Tianzhi; Zhu, Jingmin; Hu, Wenbo; Zhang, Hua; Gao, Zhenhui; Wen, Xuehui; Zhou, Zhi; Lu, Gang; Liu, Jingjie; Li, Wen
2010-06-01
To investigate the effectiveness of autogenous platelet-rich plasma (PRP) gel with acellular xenogeneic dermal matrix in the treatment of deep II degree burns. From January 2007 to December 2009, 30 cases of deep II degree burns were treated. There were 19 males and 11 females with an average age of 42.5 years (range, 32-57 years). The burn area was 10% to 48% of total body surface area. The time from burn to hospitalization was 30 minutes to 8 hours. All patients were treated with tangential excision surgery, one side of the wounds were covered with autogenous PRP gel and acellular xenogeneic dermal matrix (PRP group), the other side of the wounds were covered with acellular xenogeneic dermal matrix only (control group). The healing rate, healing time, infection condition, and scar formation were observed. At 7 days after operation, the infection rate in PRP group (6.7%, 2/30) was significantly lower than that in control group (16.7%, 5/30, P < 0.05). The healing times were (18 +/- 4) days and (22 +/- 4) days respectively in PRP group and control group, showing significant difference (P < 0.05). The healing rates at 14 days and 21 days were 75% +/- 7% and 88% +/- 5% in PRP group, were 62% +/- 15% and 73% +/- 7% in control group, showing significant difference (P < 0.05). RPR group was superior to control group in elasticity, color, appearance, softness, scar formation, and healing quality. Autogenous PRP gel with acellular xenogeneic dermal matrix can accelerate the wound healing of deep II degree burns as well as alleviate the scar proliferation.
NASA Astrophysics Data System (ADS)
Kuhn, Sascha; Burr, August; Kübler, Michael; Deckert, Matthias; Bleesen, Christoph
2011-02-01
In this paper the replication qualities of periodically and randomly arranged micro-features molded in the injection molding process and their effects on surface properties are studied. The features are molded in PC, PMMA and PP at different mold wall temperatures in order to point out the necessity and profitability of a variotherm mold wall temperature control system. A one-dimensional heat conduction model is proposed to predict the cycle times of the variotherm injection molding processes. With regard to these processes, the molding results are compared to the molded surface feature heights using an atomic force microscope. In addition, the effects of the molded surface features on macroscopic surfaces are characterized in terms of light reflection using a spectrometer and in terms of water wettability by measuring the static contact angle. Furthermore, due to the sensitivity of the surface features on the molded parts, their durability is compared in a scratch test with a diamond tip. This leads to successful implementation in applications in which the optical appearance, in terms of gloss and reflection, and the water repellence, in terms of drag flow and adhesion, are of importance.
Graf, Neil J.
2013-01-01
Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263
Evacuated displacement compression molding
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1973-01-01
A process for molding long, thin-wall tubular bodies from thermosetting plastic molding compounds is described. The tubular bodies produced may have body lengths several times the diameters. The application of the process for manufacturing rocket engine cases and nozzles is discussed. The advantages of the system over other methods of circular tube manufacture are analyzed.
Mold and Indoor Air Quality in Schools
... Centers Mold Contact Us Share Mold and Indoor Air Quality in Schools Mold and Moisture in Schools Webinar ... premier resource on this issue is the Indoor Air Quality Tools for Schools kit. Our schools-related resources ...
Hernandez, Melissa J.; Christman, Karen L.
2017-01-01
Summary As the number of global deaths attributed to cardiovascular disease continues to rise, viable treatments for cardiovascular events such as myocardial infarction (MI) or conditions like peripheral artery disease (PAD) are critical. Recent studies investigating injectable biomaterials have shown promise in promoting tissue regeneration and functional improvement, and in some cases, incorporating other therapeutics further augments the beneficial effects of these biomaterials. In this review, we aim to emphasize the advantages of acellular injectable biomaterial-based therapies, specifically material-alone approaches or delivery of acellular biologics, in regards to manufacturability and the capacity of these biomaterials to regenerate or repair diseased tissue. We will focus on design parameters and mechanisms that maximize therapeutic efficacy, particularly, improved functional perfusion and neovascularization regarding PAD and improved cardiac function and reduced negative left ventricular (LV) remodeling post-MI. We will then discuss the rationale and challenges of designing new injectable biomaterial-based therapies for the clinic. PMID:29057375
Mold and Human Health: a Reality Check.
Borchers, Andrea T; Chang, Christopher; Eric Gershwin, M
2017-06-01
There are possibly millions of mold species on earth. The vast majority of these mold spores live in harmony with humans, rarely causing disease. The rare species that does cause disease does so by triggering allergies or asthma, or may be involved in hypersensitivity diseases such as allergic bronchopulmonary aspergillosis or allergic fungal sinusitis. Other hypersensitivity diseases include those related to occupational or domiciliary exposures to certain mold species, as in the case of Pigeon Breeder's disease, Farmer's lung, or humidifier fever. The final proven category of fungal diseases is through infection, as in the case of onchomycosis or coccidiomycosis. These diseases can be treated using anti-fungal agents. Molds and fungi can also be particularly important in infections that occur in immunocompromised patients. Systemic candidiasis does not occur unless the individual is immunodeficient. Previous reports of "toxic mold syndrome" or "toxic black mold" have been shown to be no more than media hype and mass hysteria, partly stemming from the misinterpreted concept of the "sick building syndrome." There is no scientific evidence that exposure to visible black mold in apartments and buildings can lead to the vague and subjective symptoms of memory loss, inability to focus, fatigue, and headaches that were reported by people who erroneously believed that they were suffering from "mycotoxicosis." Similarly, a causal relationship between cases of infant pulmonary hemorrhage and exposure to "black mold" has never been proven. Finally, there is no evidence of a link between autoimmune disease and mold exposure.
Interface conditions of two-shot molded parts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kisslinger, Thomas, E-mail: thomas.kisslinger@pccl.at; Bruckmoser, Katharina, E-mail: katharina.bruckmoser@unileoben.ac.at; Resch, Katharina, E-mail: katharina.resch@unileoben.ac.at
2014-05-15
The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes,more » a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.« less
Boháč, Martin; Danišovič, Ľuboš; Koller, Ján; Dragúňová, Jana; Varga, Ivan
2018-01-22
Acellular matrices are used for various purposes and they have been studied extensively for their potential roles in regenerating tissues or organs. The acellular matrix generates physiological cues that mimic the native tissue microenvironment. Acellular dermal matrix (ADM) is a soft connective tissue graft generated by a decellularization process that preserves the intact extracellular skin matrix. Upon implantation, this structure serves as a scaffold for donor-side cells to facilitate subsequent incorporation and revascularization. In breast reconstruction, ADM is used mainly for lower pole coverage and the shaping of a new breast. It helps control the positioning of the implant in the inframammary fold, and prevent the formation of contractile pseudocapsule around the breast implant. In this study, we provide a comprehensive histological description of ADM used for human breast reconstruction over the course of several months following implementation. Using immunohistochemical methods (a panel of 12 antibodies) coupled with optical and transmission electron microscopy, we confirmed that the original acellular dermal matrix became recolonized by fibroblasts and myofibroblasts, and also by various other free cells of the connective tissue (lymphocytes, macrophages and multinucleated giant cells, granulocytes, mast cells) after implantation into the patient's body. Within the implanted ADM, there was a relatively rapid ingrowth of blood vessels. Lymphatic vessels were only detected in one case 9 months after the implantation of the ADM. These results suggest that lymphangiogenesis is a longer process than angiogenesis.
Rotationally Molded Liquid Crystalline Polymers
NASA Technical Reports Server (NTRS)
Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce
2002-01-01
Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.
Pressurized Shell Molds For Metal-Matrix Composites
NASA Technical Reports Server (NTRS)
Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James
1993-01-01
Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.
Injection molding ceramics to high green densities
NASA Technical Reports Server (NTRS)
Mangels, J. A.; Williams, R. M.
1983-01-01
The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.
Toxic mold: phantom risk vs science.
Chapman, Jean A; Terr, Abba I; Jacobs, Robert L; Charlesworth, Ernest N; Bardana, Emil J
2003-09-01
To review the available literature on the subject of fungi (molds) and their potential impact on health and to segregate information that has scientific validity from information that is yet unproved and controversial. This review represents a synthesis of the available literature in this area with the authors' collective experience with many patients presenting with complaints of mold-related illness. Pertinent scientific investigation on toxic mold issues and previously published reviews on this and related subjects that met the educational objectives were critically reviewed. Indoor mold growth is variable, and its discovery in a building does not necessarily mean occupants have been exposed. Human response to fungal antigens may induce IgE or IgG antibodies that connote prior exposure but not necessarily a symptomatic state. Mold-related disease has been discussed in the framework of noncontroversial and controversial disorders. When mold-related symptoms occur, they are likely the result of transient irritation, allergy, or infection. Building-related illness due to mycotoxicosis has never been proved in the medical literature. Prompt remediation of water-damaged material and infrastructure repair should be the primary response to fungal contamination in buildings.
Castable plastic mold with electroplatable base
Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.
2004-01-20
A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
ERIC Educational Resources Information Center
Goldman, Corey A., Ed.
The focus of the Association for Biology Laboratory Education (ABLE) is to improve undergraduate biology laboratory experiences by promoting the development and dissemination of interesting, innovative, and reliable laboratory exercises. This proceedings volume contains 11 papers: "A Practical Guide to the Use of Cellular Slime Molds for…
Acellular dermal matrix as an adjunct in treatment of neuropathic pain at the wrist.
Peterson, Steven L; Adham, Mehdi N
2006-08-01
Traumatic or surgical injury to superficial sensory nerves at the wrist can lead to significant morbidity. Multiple treatment modalities have been proposed, including the use of flap coverage to provide soft-tissue padding and decrease tactile irritation. In this report, acellular dermal matrix (AlloDerm) was used as an alternative to flap coverage, thereby avoiding the need for a donor site. Five patients with postsurgical and five patients with posttraumatic neuropathic pain at the wrist underwent neuroma excision and/or neurolysis followed by interposition of acellular dermal matrix allograft between skin and nerve. Patients were followed from 12 to 25 months and demonstrated substantial improvement in pain. Eight previously employed patients returned to their prior occupations. Dermal matrix allograft may provide cushioning and/or a gliding surface for the nerve and represents a simple alternative to flap coverage in the treatment of neuropathic pain at the wrist.
INDOOR MOLDS AND ALLERGIC POTENTIAL
Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...
Study of parameters in precision optical glass molding
NASA Astrophysics Data System (ADS)
Ni, Ying; Wang, Qin-hua; Yu, Jing-chi
2010-10-01
Precision glass compression molding is an attractive approach to manufacture small precision optics in large volume over traditional manufacturing techniques because of its advantages such as lower cost, faster time to market and being environment friendly. In order to study the relationship between the surface figures of molded lenses and molding process parameters such as temperature, pressure, heating rate, cooling rate and so on, we present some glass compression molding experiments using same low Tg (transition temperature) glass material to produce two different kinds of aspheric lenses by different molding process parameters. Based on results from the experiments, we know the major factors influencing surface figure of molded lenses and the changing range of these parameters. From the knowledge we could easily catch proper molding parameters which are suitable for aspheric lenses with diameter from 10mm to 30mm.
Modeling Physarum space exploration using memristors
NASA Astrophysics Data System (ADS)
Ntinas, V.; Vourkas, I.; Sirakoulis, G. Ch; Adamatzky, A. I.
2017-05-01
Slime mold Physarum polycephalum optimizes its foraging behaviour by minimizing the distances between the sources of nutrients it spans. When two sources of nutrients are present, the slime mold connects the sources, with its protoplasmic tubes, along the shortest path. We present a two-dimensional mesh grid memristor based model as an approach to emulate Physarum’s foraging strategy, which includes space exploration and reinforcement of the optimally formed interconnection network in the presence of multiple aliment sources. The proposed algorithmic approach utilizes memristors and LC contours and is tested in two of the most popular computational challenges for Physarum, namely maze and transportation networks. Furthermore, the presented model is enriched with the notion of noise presence, which positively contributes to a collective behavior and enables us to move from deterministic to robust results. Consequently, the corresponding simulation results manage to reproduce, in a much better qualitative way, the expected transportation networks.
Rotational molding of pultruded profiles reinforced polyethylene
NASA Astrophysics Data System (ADS)
Greco, Antonio; Maffezzoli, Alfonso; Romano, Giorgio
2014-05-01
The aim of this paper is the production of fiber reinforced LLDPE components by rotational molding. To this purpose, a process upgrade was developed, for the incorporation of pultruded tapes in the rotational molding cycle. Pultruded tapes, made of 50% by weight of glass fibers dispersed in a high density polyethylene(HDPE) matrix, were glued on the internal surface of a cubic mold, and rotational molding process was run using the same processing conditions used for conventional LLDPE processing. During processing, melting of LLDPE powders and of HDPE allowed to incorporate the tapes inside rotational molded LLDPE. The glass fiber reinforced prototypes were characterized in terms of mechanical properties. Plate bending tests were performed on the square faces extracted from the rotational molded product. The rotational molding products were also subjected to internal hydrostatic pressure tests up to 10 bar. In any case, no failure of the cubic samples was observed. In both cases, it was found that addition of a single pultruded strips, which corresponds to addition of about 0.6% by weight of glass fibers, involved an increase of the stiffness of the faces by about 25%.
Method for encapsulating hazardous wastes using a staged mold
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1989-01-01
A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
Ort, Stuart A; Ehrlich, H Paul; Isaacson, Jon E
2010-09-01
To demonstrate regeneration of muscle fascia appropriate for future harvest with the use of acellular porcine intestinal submucosa in a rat model. Animal cohort study. Tertiary care academic medical center. Sixteen male Sprague-Dawley rats underwent excision of rectus abdominis muscle fascia. A sheet of acellular porcine intestinal submucosa was placed in the fascia harvest defect. Graft and underlying muscle were harvested at three-, six-, and nine-week intervals. Histologic examination, including immunohistology for anti-von Willebrand factor, was performed at each timepoint. Additional selected specimens were subjected to latex vascular perfusion casts to examine vessel growth patterns within the graft. Gross examination revealed a new tissue plane, indistinguishable from surrounding native fascia. Histology revealed an initial inflammatory response within the graft. Progressive influx of native tissue was noted over successive timepoints. Via collagen-specific staining, we noted progressive reorganization and maturation of the graft collagen matrix. At the final nine-week time point, a new loose connective tissue plane was reestablished between the graft and underlying muscle. Immunohistochemistry and latex perfusion both demonstrate an initial development of small capillaries that progresses over time to greater organization and arteriole formation. Fascia regeneration may be possible with use of an acellular porcine intestinal submucosa graft in an animal model. Future studies may prove beneficial in restoring fascia in humans. Implications for potential advantages in tympanoplasty are discussed. Copyright 2010 American Academy of Otolaryngology-Head and Neck Surgery Foundation. Published by Mosby, Inc. All rights reserved.
Hanson, Summer E; Meaike, Jesse D; Selber, Jesse C; Liu, Jun; Li, Liang; Hassid, Victor J; Baumann, Donald P; Butler, Charles E; Garvey, Patrick B
2018-05-01
Although multiple acellular dermal matrix sources exist, it is unclear how its processing impacts complication rates. The authors compared complications between two preparations of human cadaveric acellular dermal matrix (freeze dried and ready-to-use) in immediate tissue expander breast reconstruction to analyze the effect of processing on complications. The authors retrospectively reviewed all alloplastic breast reconstructions with freeze-dried or ready-to-use human acellular dermal matrices between 2006 and 2016. The primary outcome measure was surgical-site occurrence defined as seroma, skin dehiscence, surgical-site infection, or reconstruction failure. The two groups were compared before and after propensity score matching. The authors included 988 reconstructions (freeze-dried, 53.8 percent; ready-to-use, 46.2 percent). Analysis of 384 propensity score-matched pairs demonstrated a slightly higher rate of surgical-site occurrence (21.4 percent versus 16.7 percent; p = 0.10) and surgical-site infection (9.6 percent versus 7.8 percent; p = 0.13) in the freeze-dried group than in the ready-to-use group, but the difference was not significant. However, failure was significantly higher for the freeze-dried versus ready-to-use group (7.8 percent versus 4.4 percent; p = 0.050). This is the largest study comparing the outcomes of alloplastic breast reconstruction using human acellular dermal matrix materials prepared by different methods. The authors demonstrated higher early complications with aseptic, freeze-dried matrix than with sterile ready-to-use matrix; reconstructive failure was the only outcome to achieve statistical significance. The authors conclude that acellular dermal matrix preparation has an independent impact on patient outcomes in their comparison of one company's product. Therapeutic, III.
Direct micropatterning of polymer materials by ice mold
NASA Astrophysics Data System (ADS)
Yu, Xinhong; Xing, Rubo; Luan, Shifang; Wang, Zhe; Han, Yanchun
2006-10-01
Micropatterning of functional polymer materials by micromolding in capillaries (MIMIC) with ice mold is reported in this paper. Ice mold was selected due to its thaw or sublimation. Thus, the mold can be easily removed. Furthermore, the polymer solution did not react with, swell, or adhere to the ice mold, so the method is suitable for many kinds of materials (such as P3HT, PMMA Alq 3/PVK, PEDOT: PSS, PS, P2VP, etc.). Freestanding polymer microstructures, binary polymer pattern, and microchannels have been fabricated by the use of ice mold freely.
Influence of mold surface temperature on polymer part warpage in rapid heat cycle molding
NASA Astrophysics Data System (ADS)
Berger, G. R.; Pacher, G. A.; Pichler, A.; Friesenbichler, W.; Gruber, D. P.
2014-05-01
Dynamic mold surface temperature control was examined for its influence on the warpage. A test mold, featuring two different rapid heat cycle molding (RHCM) technologies was used to manufacture complex plate-shaped parts having different ribs, varying thin-wall regions, and both, circular and rectangular cut-outs. The mold's nozzle side is equipped with the areal heating and cooling technology BFMOLD®, where the heating/cooling channels are replaced by a ball-filled slot near the cavity surface flooded through with hot and cold water sequentially. Two local electrical ceramic heating elements are installed into the mold's ejection side. Based on a 23 full-factorial design of experiments (DoE) plan, varying nozzle temperature (Tnozzle), rapid heat cycle molding temperature (TRHCM) and holding pressure (pn), specimens of POM were manufactured systematically. Five specimens were examined per DoE run. The resulting warpage was measured at 6 surface line scans per part using the non-contact confocal topography system FRT MicroProf®. Two warpage parameters were calculated, the curvature of a 2nd order approximation a, and the vertical deflection at the profile center d. Both, the influence strength and the acting direction of the process parameters and their interactions on a and d were calculated by statistical analysis. Linear mathematical process models were determined for a and d to predict the warpage as a function of the process parameter settings. Finally, an optimum process setting was predicted, based on the process models and Microsoft Excel GRG solver. Clear and significant influences of TRHCM, pn, Tnozzle, and the interaction of TRHCM and pn were determined. While TRHCM was dominant close to the gate, pn became more effective as the flow length increased.
Rosengard, Heather C; Wheat, Chikoti M; Tilson, Matthew P; Cuda, Jonathan D
2018-01-01
Lichen planus is an inflammatory dermatosis with a prevalence of approximately 1%. Recent meta-analyses show that patients with hepatitis C virus have a 2.5- to 4.5-fold increased risk of developing lichen planus. Lichen planus has also followed vaccinations and has specifically been attributed to the hepatitis B vaccine, the influenza vaccine, and the tetanus-diphtheria-acellular pertussis vaccine. We describe a case of lichen planus in a hepatitis C virus-infected African American male occurring in temporal association with the administration of the tetanus-diphtheria-acellular pertussis vaccine. The patient's presentation was clinically consistent with lichen planus and confirmed by biopsy. It is likely that many cases of vaccine-induced lichen planus have gone unpublished or unrecognized. In areas with high prevalence of hepatitis C virus infection, we may expect to see more cases of vaccine-induced lichen planus especially in light of the updated Centers for Disease Control and Prevention tetanus-diphtheria-acellular pertussis vaccination recommendations. This case serves to educate healthcare providers about vaccine-induced lichen planus and, in particular, the need to counsel hepatitis C virus-infected patients about a potential risk of developing lichen planus following vaccination. We also reflect on current theories suggesting the T-cell-mediated pathogenesis of lichen planus and the role that hepatitis C virus and toxoid or protein vaccines may play in initiating the disease.
Puisys, Algirdas; Vindasiute, Egle; Linkevciene, Laura; Linkevicius, Tomas
2015-04-01
To evaluate the efficiency of acellular dermal matrix membrane to augment vertical peri-implant soft tissue thickness during submerged implant placement. Forty acellular dermal matrix-derived allogenic membranes (AlloDerm, BioHorizons, Birmingham, AL, USA) and 42 laser-modified surface internal hex implants (BioHorizons Tapered Laser Lok, Birmingham, AL, USA) were placed in submerged approach in 40 patients (15 males and 25 females, mean age 42.5 ± 1.7) with a thin vertical soft tissue thickness of 2 mm or less. After 3 months, healing abutments were connected to implants, and the augmented soft tissue thickness was measured with periodontal probe. The gain in vertical soft tissue volume was calculated. Mann-Whitney U-test was applied and significance was set to 0.05. All 40 allografts healed successfully. Thin soft tissue before augmentation had an average thickness of 1.54 ± 0.51 mm SD (range, 0.5-2.0 mm, median 1.75 mm), and after soft tissue augmentation with acellular dermal matrix, thickness increased to 3.75 ± 0.54 mm SD (range, 3.0-5.0 mm, median 4.0 mm) at 3 months after placement. This difference between medians was found to be statistically significant (P < 0.001). Mean increase in soft tissue thickness was 2.21 ± 0.85 mm SD (range, 1.0-4.5 mm, median 2.0 mm). It can be concluded that acellular dermal matrix membrane can be successfully used for vertical soft tissue augmentation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Anderson, J.W.; Miley, F.; Pritchard, W.C.
1962-02-27
A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)
Shorter, Caroline; Crane, Julian; Pierse, Nevil; Barnes, Phillipa; Kang, Janice; Wickens, Kristin; Douwes, Jeroen; Stanley, Thorsten; Täubel, Martin; Hyvärinen, Anne; Howden-Chapman, Philippa
2018-01-01
Evidence is accumulating that indoor dampness and mold are associated with the development of asthma. The underlying mechanisms remain unknown. New Zealand has high rates of both asthma and indoor mold and is ideally placed to investigate this. We conducted an incident case-control study involving 150 children with new-onset wheeze, aged between 1 and 7 years, each matched to two control children with no history of wheezing. Each participant's home was assessed for moisture damage, condensation, and mold growth by researchers, an independent building assessor and parents. Repeated measures of temperature and humidity were made, and electrostatic dust cloths were used to collect airborne microbes. Cloths were analyzed using qPCR. Children were skin prick tested for aeroallergens to establish atopy. Strong positive associations were found between observations of visible mold and new-onset wheezing in children (adjusted odds ratios ranged between 1.30 and 3.56; P ≤ .05). Visible mold and mold odor were consistently associated with new-onset wheezing in a dose-dependent manner. Measurements of qPCR microbial levels, temperature, and humidity were not associated with new-onset wheezing. The association between mold and new-onset wheeze was not modified by atopic status, suggesting a non-allergic association. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
ERIC Educational Resources Information Center
Casassa, E. Z.; And Others
1986-01-01
Background information, procedures used, and typical results obtained are provided for an experiment in which students prepare and study the characteristics of a "slime." A list of general, inorganic, and polymer chemistry concepts fostered in the experiment is included. (JN)
Aggregation Dynamics Using Phase Wave Signals and Branching Patterns
NASA Astrophysics Data System (ADS)
Sakaguchi, Hidetsugu; Kusagaki, Takuma
2016-09-01
The aggregation dynamics of slime mold is studied using coupled equations of phase ϕ and cell concentration n. Phase waves work as tactic signals for aggregation. Branching structures appear during the aggregation. A stationary branching pattern appears like a river network, if cells are uniformly supplied into the system.
Porous media heat transfer for injection molding
Beer, Neil Reginald
2016-05-31
The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and... CATEGORIES National Emissions Standards for Hazardous Air Pollutants: Reinforced Plastic Composites... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and...
Microcellular nanocomposite injection molding process
Mingjun Yuan; Lih-Sheng Turng; Rick Spindler; Daniel Caulfield; Chris Hunt
2003-01-01
This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The molded parts produced based on the Design of Experiments (DOE) matrices were subjected to tensile testing, impact testing, and Scanning Electron Microscope (SEM), Transmission Electron Microscope (TEM), Dynamic Mechanical...
Acellular vaccines for preventing whooping cough in children.
Zhang, Linjie; Prietsch, Sílvio O M; Axelsson, Inge; Halperin, Scott A
2012-03-14
Routine use of whole-cell pertussis (wP) vaccines was suspended in some countries in the 1970s and 1980s because of concerns about adverse effects. Following such action, there was a resurgence of whooping cough. Acellular pertussis (aP) vaccines, containing purified or recombinant Bordetella pertussis (B. pertussis) antigens, were developed in the hope that they would be as effective, but less reactogenic than the whole-cell vaccines. To assess the efficacy and safety of acellular pertussis vaccines in children. We searched the Cochrane Register of Controlled Trials (CENTRAL) (The Cochrane Library 2011, Issue 4) which contains the Cochrane Acute Respiratory Infections Group's Specialised Register, MEDLINE (1950 to December week 4, 2011), EMBASE (1974 to January 2012), Biosis Previews (2009 to January 2012), and CINAHL (2009 to January 2012). We selected double-blind randomised efficacy and safety trials of aP vaccines in children up to six years old, with active follow-up of participants and laboratory verification of pertussis cases. Two review authors independently extracted data and assessed the risk of bias in the studies. Differences in trial design precluded a meta-analysis of the efficacy data. We pooled the safety data from individual trials using a random-effects meta-analysis model. We included six efficacy trials with a total of 46,283 participants and 52 safety trials with a total of 136,541 participants. Most of the safety trials did not report the methods for random sequence generation, allocation concealment and blinding, which made it difficult to assess the risk of bias in the studies. The efficacy of multi-component (≥ three) vaccines varied from 84% to 85% in preventing typical whooping cough (characterised by 21 or more consecutive days of paroxysmal cough with confirmation of B. pertussis infection by culture, appropriate serology or contact with a household member who has culture-confirmed pertussis), and from 71% to 78% in preventing mild
Yeasts from skin colonization are able to cross the acellular dermal matrix.
Jarros, Isabele Carrilho; Okuno, Érika; Costa, Maiara Ignacio; Veiga, Flávia Franco; de Souza Bonfim-Mendonça, Patricia; Negri, Melyssa Fernanda Norman; Svidzinski, Terezinha Inez Estivalet
2018-04-01
In recent decades, the prognosis for burn patients has improved considerably with the development of specialized care. The acellular dermal matrix (ADM) is a totally artificial acellular device that functions to control water loss, prevent penetration by bacteria and allow migration of endothelial cells and fibroblasts from patient tissues. However, little is known about its effectiveness against yeasts. The present study evaluated the capacity of colonization and migration of some human commensal yeasts. Three clinical isolates from skin scales, identified as Candida parapsilosis, Candida glabrata and Rhodotorula mucilaginosa, were used. Their ability to cross the ADM was evaluated. After three days, all isolates had crossed the ADM. C. parapsilosis showed the lowest growth, while R. mucilaginosa showed intermediate and C. glabrata the highest growth. In the plates incubated for seven days, the growth of C. parapsilosis and C. glabrata increased by 1 log over the third day. All isolates have the capacity to colonize and migrate through the matrix, increasing the potential risk to burn patients, who can develop severe and even fatal infections by invasive fungi. Copyright © 2018 Elsevier Ltd. All rights reserved.
Matched metal die compression molded structural random fiber sheet molding compound flywheel
Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.
1985-01-01
A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.
HOW to Recognize and Control Sooty Molds
Kenneth J. Jr. Kessler
1992-01-01
Sooty molds are dark fungi that grow on honeydew excreted by sucking insects or on exudates from leaves of certain plants. Typically, sooty mold growths are composed of fungal complexes made up of ascomycetes and fungi imperfecti. Some of the common genera of fungi found in sooty mold complexes are Cladosporium, Aureobasidium, Antennariella, Limacinula, Scorias, and...
Grinding aspheric and freeform micro-optical molds
NASA Astrophysics Data System (ADS)
Tohme, Yazid E.
2007-02-01
Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.
David, Silke; Vermeer-de Bondt, Patricia E; van der Maas, Nicoline A T
2008-10-29
In addition to the routine enhanced passive safety surveillance of the Dutch National Vaccination Programme, RIVM (National Institute for Public Health and the Environment) started a large questionnaire study enrolling approximately 53,000 children from December 2003 until September 2007. We intended to establish accurate frequency estimates for several more severe adverse events and to compare the incidence rates of three different infant vaccines that were used consecutively. Whole cell pertussis (wP) DTP-IPV-Hib vaccine (NVI) was replaced by acellulair pertussis (aP) in 2005, first Infanrix-IPV-Hib (GSK) followed by Pediacel (Sanofi) in 2006. Pneumococcal vaccine, Prevenar (Wyeth), was added for children born from April 2006. Parents returned 28,796 questionnaires (response 54%), 15,069 for whole cell pertussis and 13,727 for acellular pertussis vaccine, including 4485 with pneumococcal vaccine. The OR for reported events was 3-6 for whole cell pertussis vaccine compared with acellular vaccine. This was true for prolonged crying for 3h and more after the first dose (1.5% versus 0.4%; 95 CI 1.1-1.9 and 95% CI 0.2-0.7, respectively), and very high fever of 40.5 degrees C and over following the fourth dose (0.8% versus 0.2%; 95% CI 0.5-1.1 and 0.06-0.3, respectively), while possible febrile convulsions were diagnosed only twice after the fourth dose in the whole cell vaccine group and one after acellular pertussis vaccine. Pallor was significantly more frequent after the first dose of whole cell pertussis than after acellulair pertussis vaccination (18.3% versus 3.4%; 95% CI 17.2-19.5 and 95% CI 2.8-4.0 respectively) Collapse after the first dose was rare in both vaccine groups (5 after whole cell vaccine and 1 after acellular vaccine). The addition of conjugated pneumococcal vaccine did not result in statistically significant increased rates of adverse events in the acellular vaccine group. Whole cell pertussis vaccine showed a significantly higher reactogenicity
Use of acrylic sheet molds for elastomeric products
NASA Technical Reports Server (NTRS)
Heisman, R. M.; Koerner, A. E.; Messineo, S. M.
1970-01-01
Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.
Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...
The Mold that Almost Ate the Principal
ERIC Educational Resources Information Center
Barry, Wayne; Bishop, Chuck; Byars, Jennifer
2006-01-01
New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…
Commercial and Residential Water Damage: The Mold Connection.
ERIC Educational Resources Information Center
Williams, Del
2002-01-01
Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)
... the AAAAI Foundation Donate Utility navigation Español Journals Pollen Counts Annual Meeting Member Login / My Membership Search ... email alert to keep tabs on mold and pollen counts in your area. • Keep away from uncut ...
Magnusson, Skuli; Baldursson, Baldur Tumi; Kjartansson, Hilmar; Rolfsson, Ottar; Sigurjonsson, Gudmundur Fertram
2017-03-01
Improvised explosive devices and new directed energy weapons are changing warfare injuries from penetrating wounds to large surface area thermal and blast injuries. Acellular fish skin is used for tissue repair and during manufacturing subjected to gentle processing compared to biologic materials derived from mammals. This is due to the absence of viral and prion disease transmission risk, preserving natural structure and composition of the fish skin graft. The aim of this study was to assess properties of acellular fish skin relevant for severe battlefield injuries and to compare those properties with those of dehydrated human amnion/chorion membrane. We evaluated cell ingrowth capabilities of the biological materials with microscopy techniques. Bacterial barrier properties were tested with a 2-chamber model. The microstructure of the acellular fish skin is highly porous, whereas the microstructure of dehydrated human amnion/chorion membrane is mostly nonporous. The fish skin grafts show superior ability to support 3-dimensional ingrowth of cells compared to dehydrated human amnion/chorion membrane (p < 0.0001) and the fish skin is a bacterial barrier for 24 to 48 hours. The unique biomechanical properties of the acellular fish skin graft make it ideal to be used as a conformal cover for severe trauma and burn wounds in the battlefield. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Feng, Yuping; Wang, Jiao; Ling, Shixin; Li, Zhuo; Li, Mingsheng; Li, Qiongyi; Ma, Zongren; Yu, Sijiu
2014-01-01
The purpose of this study was to assess fetal bovine acellular dermal matrix as a scaffold for supporting the differentiation of bone marrow mesenchymal stem cells into neural cells following induction with neural differentiation medium. We performed long-term, continuous observation of cell morphology, growth, differentiation, and neuronal development using several microscopy techniques in conjunction with immunohistochemistry. We examined specific neuronal proteins and Nissl bodies involved in the differentiation process in order to determine the neuronal differentiation of bone marrow mesenchymal stem cells. The results show that bone marrow mesenchymal stem cells that differentiate on fetal bovine acellular dermal matrix display neuronal morphology with unipolar and bi/multipolar neurite elongations that express neuronal-specific proteins, including βIII tubulin. The bone marrow mesenchymal stem cells grown on fetal bovine acellular dermal matrix and induced for long periods of time with neural differentiation medium differentiated into a multilayered neural network-like structure with long nerve fibers that was composed of several parallel microfibers and neuronal cells, forming a complete neural circuit with dendrite-dendrite to axon-dendrite to dendrite-axon synapses. In addition, growth cones with filopodia were observed using scanning electron microscopy. Paraffin sectioning showed differentiated bone marrow mesenchymal stem cells with the typical features of neuronal phenotype, such as a large, round nucleus and a cytoplasm full of Nissl bodies. The data suggest that the biological scaffold fetal bovine acellular dermal matrix is capable of supporting human bone marrow mesenchymal stem cell differentiation into functional neurons and the subsequent formation of tissue engineered nerve. PMID:25598779
Volume-change indicator for molding plastic
NASA Technical Reports Server (NTRS)
Heler, W. C.
1979-01-01
Monitor consisting of two concentric disks measures change in volume of charge during compression/displacement molding. Device enables operator to decide whether process pressure and temperature are set properly or whether sufficient material has been placed in mold.
Silicon micro-mold and method for fabrication
Morales, Alfredo M.
2005-01-11
The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.
Replication of the nano-scale mold fabricated with focused ion beam
NASA Astrophysics Data System (ADS)
Gao, J. X.; Chan-Park, M. B.; Xie, D. Z.; Ngoi, Bryan K. A.
2004-12-01
Silicon mold fabricated with Focused Ion Beam lithography (FIB) was used to make silicone elastomer molds. The silicon mold is composed of lattice of holes which the diameter and depth are about 200 nm and 60 nm, respectively. The silicone elastomer material was then used to replicate slavery mold. Our study show the replication process with the elastomer mold had been performed successfully and the diameter of humps on the elastomer mold is near to that of holes on the master mold. But the height of humps in the elastomer mold is only 42 nm and it is different from the depth of holes in the master mold.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, K.; Meng, W. J.; Mei, F.
2011-02-01
A single crystal Al specimen was molded at room temperature with long, rectangular, strip diamond punches. Quantitative molding response curves were obtained at a series of punch widths, ranging from 5 {micro}m to 550 nm. A significant size effect was observed, manifesting itself in terms of significantly increasing characteristic molding pressure as the punch width decreases to 1.5 {micro}m and below. A detailed comparison of the present strip punch molding results was made with Berkovich pyramidal indentation on the same single crystal Al specimen. The comparison reveals distinctly different dependence of the characteristic pressure on corresponding characteristic length. The presentmore » results show the feasibility of micro-/nano-scale compression molding as a micro-/nano-fabrication technique, and offer an experimental test case for size-dependent plasticity theories.« less
Sacrificial plastic mold with electroplatable base
Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.
2002-01-01
A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
Sacrificial Plastic Mold With Electroplatable Base
Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.
2005-08-16
A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
Study of injection molded microcellular polyamide-6 nanocomposites
Mingjun Yuan; Lih-Sheng Turng; Shaoqin Gong; Daniel Caulfield; Chris Hunt; Rick Spindler
2004-01-01
This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The microcellular nanocomposite processing was performed on an injection-molding machine equipped with a commercially available supercritical fluid (SCF) system. The molded samples produced based on the Design of Experiments (...
Selber, Jesse C; Wren, James H; Garvey, Patrick B; Zhang, Hong; Erickson, Cameron; Clemens, Mark W; Butler, Charles E
2015-07-01
Acellular dermal matrix for implant-based breast reconstruction appears to cause higher early complication rates, but long-term outcomes are perceived to be superior. This dichotomy is the subject of considerable debate. The authors hypothesized that patient characteristics and operative variables would have a greater impact on complications than the type of acellular dermal matrix used. A retrospective cohort study was performed of consecutive patients who underwent two-stage, implant-based breast reconstruction with human cadaveric or bovine acellular dermal matrix from 2006 to 2012 at a single institution. Patient characteristics and operative variables were analyzed using logistic regression analyses to identify risk factors for complications. The authors included 564 reconstructions in the study. Radiation therapy and obesity increased the odds of all complications. Every 100-ml increase in preoperative breast volume increased the odds of any complication by 1 percent, the odds of infection by 27 percent, and the risk of explantation by 16 percent. The odds of seroma increased linearly with increasing surface area of acellular dermal matrix. Odds of infection were higher with an intraoperative expander fill volume greater than 50 percent of the total volume. Risk of explantation was twice as high when intraoperative expander fill volume was greater than 300 ml. Radiation therapy, obesity, larger breasts, higher intraoperative fill volumes, and larger acellular dermal matrices are all independent risk factors for early complications. Maximizing the initial mastectomy skin envelope fill must be balanced with the understanding that higher complication rates may result from a larger intraoperative breast mound. Risk, III.
Zhang, Lin; Zhou, Wenchen; Yi, Allen Y
2017-04-01
In compression molding of polymer optical components with micro/nanoscale surface features, rapid heating of the mold surface is critical for the implementation of this technology for large-scale applications. In this Letter, a novel method of a localized rapid heating process is reported. This process is based on induction heating of a thin conductive coating deposited on a silicon mold. Since the graphene coating is very thin (∼45 nm), a high heating rate of 10∼20°C/s can be achieved by employing a 1200 W 30 kHz electrical power unit. Under this condition, the graphene-coated surface and the polymer substrate can be heated above the polymer's glass transition temperature within 30 s and subsequently cooled down to room temperature within several tens of seconds after molding, resulting in an overall thermal cycle of about 3 min or shorter. The feasibility of this process was validated by fabrication of optical gratings, micropillar matrices, and microlens arrays on polymethylmethacrylate (PMMA) substrates with very high precision. The uniformity and surface geometries of the replicated optical elements are evaluated using an optical profilometer, a diffraction test setup, and a Shack-Hartmann wavefront sensor built with a molded PMMA microlens array. Compared with the conventional bulk heating molding process, this novel rapid localized induction heating process could improve replication efficiency with better geometrical fidelity.
Zhu, Shuang; Liu, Jianghui; Zheng, Canbin; Gu, Liqiang; Zhu, Qingtang; Xiang, Jianping; He, Bo; Zhou, Xiang; Liu, Xiaolin
2017-08-01
Human acellular nerve allografts have been increasingly applied in clinical practice. This study was undertaken to investigate the functional outcomes of nerve allograft reconstruction for nerve defects in the upper extremity. A total of 64 patients from 13 hospitals were available for this follow-up study after nerve repair using human acellular nerve allografts. Sensory and motor recovery was examined according to the international standards for motor and sensory nerve recovery. Subgroup analysis and logistic regression analysis were conducted to identify the relationship between the known factors and the outcomes of nerve repair. Mean follow-up time was 355 ± 158 (35-819) days; mean age was 35 ± 11 (14-68) years; average nerve gap length was 27 ± 13 (10-60) mm; no signs of infection, tissue rejection or extrusion were observed among the patients; 48/64 (75%) repaired nerves experienced meaningful recovery. Univariate analysis showed that site and gap length significantly influenced prognosis after nerve repair using nerve grafts. Delay had a marginally significant relationship with the outcome. A multivariate logistic regression model revealed that gap length was an independent predictor of nerve repair using human acellular nerve allografts. The results indicated that the human acellular nerve allograft facilitated safe and effective nerve reconstruction for nerve gaps 10-60 mm in length in the hand and upper extremity. Factors such as site and gap length had a statistically significant influence on the outcomes of nerve allograft reconstruction. Gap length was an independent predictor of nerve repair using human acellular nerve allografts. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Factors influencing microinjection molding replication quality
NASA Astrophysics Data System (ADS)
Vera, Julie; Brulez, Anne-Catherine; Contraires, Elise; Larochette, Mathieu; Trannoy-Orban, Nathalie; Pignon, Maxime; Mauclair, Cyril; Valette, Stéphane; Benayoun, Stéphane
2018-01-01
In recent years, there has been increased interest in producing and providing high-precision plastic parts that can be manufactured by microinjection molding: gears, pumps, optical grating elements, and so on. For all of these applications, the replication quality is essential. This study has two goals: (1) fabrication of high-precision parts using the conventional injection molding machine; (2) identification of robust parameters that ensure production quality. Thus, different technological solutions have been used: cavity vacuuming and the use of a mold coated with DLC or CrN deposits. AFM and SEM analyses were carried out to characterize the replication profile. The replication quality was studied in terms of the process parameters, coated and uncoated molds and crystallinity of the polymer. Specific studies were processed to quantify the replicability of injection molded parts (ABS, PC and PP). Analysis of the Taguchi experimental designs permits prioritization of the impact of each parameter on the replication quality. A discussion taking into account these new parameters and the thermal and spreading properties on the coatings is proposed. It appeared that, in general, increasing the mold temperature improves the molten polymer fill in submicron features except for the steel insert (for which the presence of a vacuum is the most important factor). Moreover, the DLC coating was the best coating to increase the quality of the replication. This result could be explained by the lower thermal diffusivity of this coating. We noted that the viscosity of the polymers is not a primordial factor of the replication quality.
Wang, Zhenyu; Zheng, Guanyu; Zhou, Lixiang
2015-09-01
Mechanisms responsible for the sludge dewaterability enhanced by filamentous fungi during fungal treatment of sludge were investigated in the present study. The filamentous fungus Mucor sp. GY-1, isolated from waste activated sludge, enhanced sludge dewaterability by 82.1% to achieve the lowest value of normalized sludge specific resistance to filtration (SRF), 8.18 × 10(10) m · L/kg · g-TSS. During the fungal treatment of sludge, 57.8% of slime extracellular polymeric substances (EPS) and 51.1% of polysaccharide in slime EPS were degraded, respectively, by Mucor sp. GY-1, contributing to the improvement of sludge dewaterability. Slime EPS is much more available for Mucor sp. GY-1 than either LB-EPS or TB-EPS that bound with microbial cells. In addition, filamentous fungus Mucor sp. GY-1 entrapped small sludge particles and inhibited the destruction of sludge flocs larger than 100 μm, thus enhancing sludge dewaterability, during fungal treatment of sludge using Mucor sp. GY-1. Copyright © 2015 Elsevier Ltd. All rights reserved.
Taxonomic re-evaluation of black koji molds.
Hong, Seung-Beom; Yamada, Osamu; Samson, Robert A
2014-01-01
Black koji molds including its albino mutant, the white koji mold, have been widely used for making the distilled spirit shochu in Northeast Asia because they produce citric acid which prevents undesirable contamination from bacteria. Since Inui reported Aspergillus luchuensis from black koji in Okinawa in 1901, many fungal names associated with black koji molds were reported. However, some species are similar and differentiation between species is difficult. Fungal taxonomists tried to arrange a taxonomic system for black koji molds, but the results were not clear. Recently, multi-locus sequence typing has been successfully used to taxonomy of black Aspergillus. According to β-tubulin and calmodulin gene sequences, black koji molds can be subdivided in three species, A. luchuensis, Aspergillus niger, and Aspergillus tubingensis. Aspergillus awamori, Aspergillus kawachii, Aspergillus inuii, Aspergillus nakazawai, and Aspergillus coreanus are synonyms of A. luchuensis, Aspergillus batatae, Aspergillus aureus (or Aspergillus foetidus), Aspergillus miyakoensis, and Aspergillus usamii (including A. usamii mut. shirousamii) are synonyms of A. niger and Aspergillus saitoi and A. saitoi var. kagoshimaensis are synonyms of A. tubingensis. A. luchuensis mut. kawachii was suggested particular names for A. kawachii because of their industrial importance. The history and modern taxonomy of black koji molds is further discussed.
EXPOSURE OF CHILDREN TO INDOOR MOLDS
Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...
A hybrid optimization approach in non-isothermal glass molding
NASA Astrophysics Data System (ADS)
Vu, Anh-Tuan; Kreilkamp, Holger; Krishnamoorthi, Bharathwaj Janaki; Dambon, Olaf; Klocke, Fritz
2016-10-01
Intensively growing demands on complex yet low-cost precision glass optics from the today's photonic market motivate the development of an efficient and economically viable manufacturing technology for complex shaped optics. Against the state-of-the-art replication-based methods, Non-isothermal Glass Molding turns out to be a promising innovative technology for cost-efficient manufacturing because of increased mold lifetime, less energy consumption and high throughput from a fast process chain. However, the selection of parameters for the molding process usually requires a huge effort to satisfy precious requirements of the molded optics and to avoid negative effects on the expensive tool molds. Therefore, to reduce experimental work at the beginning, a coupling CFD/FEM numerical modeling was developed to study the molding process. This research focuses on the development of a hybrid optimization approach in Non-isothermal glass molding. To this end, an optimal configuration with two optimization stages for multiple quality characteristics of the glass optics is addressed. The hybrid Back-Propagation Neural Network (BPNN)-Genetic Algorithm (GA) is first carried out to realize the optimal process parameters and the stability of the process. The second stage continues with the optimization of glass preform using those optimal parameters to guarantee the accuracy of the molded optics. Experiments are performed to evaluate the effectiveness and feasibility of the model for the process development in Non-isothermal glass molding.
Predicting and preventing mold spoilage of food products.
Dagnas, Stéphane; Membré, Jeanne-Marie
2013-03-01
This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management
NASA Astrophysics Data System (ADS)
Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.
2015-05-01
Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.
Brightness field distributions of microlens arrays using micro molding.
Cheng, Hsin-Chung; Huang, Chiung-Fang; Lin, Yi; Shen, Yung-Kang
2010-12-20
This study describes the brightness field distributions of microlens arrays fabricated by micro injection molding (μIM) and micro injection-compression molding (μICM). The process for fabricating microlens arrays used room-temperature imprint lithography, photoresist reflow, electroforming, μIM, μICM, and optical properties measurement. Analytical results indicate that the brightness field distribution of the molded microlens arrays generated by μICM is better than those made using μIM. Our results further demonstrate that mold temperature is the most important processing parameter for brightness field distribution of molded microlens arrays made by μIM or μICM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.
The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence ofmore » shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.« less
Proactive approaches for mold-free interior environments.
Warsco, Katherine; Lindsey, Patricia F
2003-08-01
Interior design education and practice can contribute to the prevention of mold growth in indoor environments. The authors provide an overview of current thinking within the interior design educational and professional communities regarding proactive approaches to achieving mold-free building interiors, including identification of current best practices for the prevention of mold problems in buildings. They also discuss the development of certification programs. A review of recent literature points to the need for interior designers to be educated to specify the use of ecologically sound materials that support the health of building occupants. The authors present trade-offs between best practices for designing mold-free indoor environments (including considerations of cost, maintenance, and operation) and occupant comfort, health, and well-being.
Mathematical modeling of the in-mold coating process for injection-molded thermoplastic parts
NASA Astrophysics Data System (ADS)
Chen, Xu
In-Mold Coating (IMC) has been successfully used for many years for exterior body panels made from compression molded Sheet Molding Compound (SMC). The coating material is a single component reactive fluid, designed to improve the surface quality of SMC moldings in terms of functional and cosmetic properties. When injected onto a cured SMC part, IMC cures and bonds to provide a pain-like surface. Because of its distinct advantages, IMC is being considered for application to injection molded thermoplastic parts. For a successful in mold coating operation, there are two key issues related to the flow of the coating. First, the injection nozzle should be located such that the thermoplastic substrate is totally covered and the potential for air trapping is minimized. The selected location should be cosmetically acceptable since it most likely will leave a mark on the coated surface. The nozzle location also needs to be accessible for easy of maintenance. Secondly, the hydraulic force generated by the coating injection pressure should not exceed the available clamping tonnage. If the clamping force is exceeded, coating leakage will occur. In this study, mathematical models for IMC flow on the compressible thermoplastic substrate have been developed. Finite Difference Method (FDM) is first used to solve the 1 dimensional (1D) IMC flow problem. In order to investigate the application of Control Volume based Finite Element Method (CV/FEM) to more complicated two dimensional IMC flow, that method is first evaluated by solving the 1D IMC flow problem. An analytical solution, which can be obtained when a linear relationship between the coating thickness and coating injection pressure is assumed, is used to verify the numerical results. The mathematical models for the 2 dimensional (2D) IMC flow are based on the generalized Hele-Shaw approximation. It has been found experimentally that the power law viscosity model adequately predicts the rheological behavior of the coating
Molded polymer solar water heater
Bourne, Richard C.; Lee, Brian E.
2004-11-09
A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.
Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.
1980-09-24
A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.
Indoor molds and lung function in healthy adults.
Hernberg, Samu; Sripaiboonkij, Penpatra; Quansah, Reginald; Jaakkola, Jouni J K; Jaakkola, Maritta S
2014-05-01
Indoor mold exposure is common worldwide and constitutes an important health problem. There are very few studies assessing the relation between mold exposure and lung function levels among non-asthmatic adults. Our objective was to assess the relations between dampness and mold exposures at home and at work and lung function. In particular, we elaborated the importance of different exposure indicators. In a population-based study, 269 non-asthmatic adults from South Finland answered a questionnaire on indoor dampness and mold exposures at home or at work and other factors potentially influencing lung function, and performed spirometry. Multiple linear regression model was applied to study the relations between exposures and spirometric lung function levels. In linear regression adjusting for confounding, FEV1 level was reduced on average 200 ml related to mold odor at home (effect estimate -0.20, 95% CI -0.60 to 0.21) and FVC level was reduced on average 460 ml (-0.46, -0.95 to 0.03) respectively. Exposure to mold odor at home or at work or both was related to reduced FEV1 (-0.15, -0.42 to 0.12) and FVC (-0.22, -0.55 to 0.11) levels. Women had on average 510 ml reduced FEV1 levels (-0.51, -1.0 to 0.03) and 820 ml reduced FVC levels (-0.82, -1.4 to -0.20) related to mold odor exposure at home. Mold odor exposure was related to lower lung function levels among non-asthmatic adults, especially among women. Copyright © 2014 Elsevier Ltd. All rights reserved.
Mareque-Bueno, Santiago
2011-01-01
This case report describes a surgical procedure for coronally advancing the peri-implant mucosa to treat a soft tissue dehiscence in a single-tooth implant-supported restoration in combination with an acellular dermal matrix graft. The patient was a 41-year-old systemically healthy, non-smoking female. Her chief complaint pertained to the unesthetic appearance of her right lateral upper incisor, caused by recession of the mucosal margin. On examination, a 3-mm recession could be observed. The periodontium was classified as thin. A 2-mm band of keratinized peri-implant mucosa was present. Keratinized gingiva was approximately 6 mm at adjacent areas. The surgical technique included a novel incision design to coronally position the flap over an acellular dermal matrix graft. Partial coverage of the recession was achieved. After a 6-month period, tissues appeared thicker than preoperatively, with no bleeding on probing and no probing depth >2 mm. The patient was satisfied with the overall treatment result. This case report shows the possibility of achieving partial soft tissue coverage over an implant-supported restoration with the combined use of an acellular dermal matrix and a coronally positioned flap. A novel technique is presented that allowed advancing the flap over the graft in a single-tooth restoration where enough keratinized tissue was present preoperatively.
Random network peristalsis in Physarum polycephalum organizes fluid flows across an individual
Alim, Karen; Amselem, Gabriel; Peaudecerf, François; Brenner, Michael P.; Pringle, Anne
2013-01-01
Individuals can function as integrated organisms only when information and resources are shared across a body. Signals and substrates are commonly moved using fluids, often channeled through a network of tubes. Peristalsis is one mechanism for fluid transport and is caused by a wave of cross-sectional contractions along a tube. We extend the concept of peristalsis from the canonical case of one tube to a random network. Transport is maximized within the network when the wavelength of the peristaltic wave is of the order of the size of the network. The slime mold Physarum polycephalum grows as a random network of tubes, and our experiments confirm peristalsis is used by the slime mold to drive internal cytoplasmic flows. Comparisons of theoretically generated contraction patterns with the patterns exhibited by individuals of P. polycephalum demonstrate that individuals maximize internal flows by adapting patterns of contraction to size, thus optimizing transport throughout an organism. This control of fluid flow may be the key to coordinating growth and behavior, including the dynamic changes in network architecture seen over time in an individual. PMID:23898203
Acanthamoeba castellanii STAT protein.
Kicinska, Anna; Leluk, Jacek; Jarmuszkiewicz, Wieslawa
2014-01-01
STAT (signal transducers and activators of transcription) proteins are one of the important mediators of phosphotyrosine-regulated signaling in metazoan cells. We described the presence of STAT protein in a unicellular, free-living amoebae with a simple life cycle, Acanthamoeba castellanii. A. castellanii is the only, studied to date, Amoebozoan that does not belong to Mycetozoa but possesses STATs. A sequence of the A. castellanii STAT protein includes domains similar to those of the Dictyostelium STAT proteins: a coiled coil (characteristic for Dictyostelium STAT coiled coil), a STAT DNA-binding domain and a Src-homology domain. The search for protein sequences homologous to A. castellanii STAT revealed 17 additional sequences from lower eukaryotes. Interestingly, all of these sequences come from Amoebozoa organisms that belong to either Mycetozoa (slime molds) or Centramoebida. We showed that there are four separated clades within the slime mold STAT proteins. The A. castellanii STAT protein branches next to a group of STATc proteins from Mycetozoa. We also demonstrate that Amoebozoa form a distinct monophyletic lineage within the STAT protein world that is well separated from the other groups.
Random network peristalsis in Physarum polycephalum organizes fluid flows across an individual.
Alim, Karen; Amselem, Gabriel; Peaudecerf, François; Brenner, Michael P; Pringle, Anne
2013-08-13
Individuals can function as integrated organisms only when information and resources are shared across a body. Signals and substrates are commonly moved using fluids, often channeled through a network of tubes. Peristalsis is one mechanism for fluid transport and is caused by a wave of cross-sectional contractions along a tube. We extend the concept of peristalsis from the canonical case of one tube to a random network. Transport is maximized within the network when the wavelength of the peristaltic wave is of the order of the size of the network. The slime mold Physarum polycephalum grows as a random network of tubes, and our experiments confirm peristalsis is used by the slime mold to drive internal cytoplasmic flows. Comparisons of theoretically generated contraction patterns with the patterns exhibited by individuals of P. polycephalum demonstrate that individuals maximize internal flows by adapting patterns of contraction to size, thus optimizing transport throughout an organism. This control of fluid flow may be the key to coordinating growth and behavior, including the dynamic changes in network architecture seen over time in an individual.
Preparation and properties of an internal mold release for rigid urethane foam
NASA Astrophysics Data System (ADS)
Paker, B. G.
1980-08-01
Most mold release agents used in the molding of rigid polyurethane foam are applied to the internal surfaces of the mold. These materials form a thin layer between the surface of the mold and the foam, allowing for easy release of the molded parts. This type of mold release must be applied prior to each molding operation; and, after repeated use, cleaning of the mold is required. Small amounts of this mold release are transferred to the molded part, resulting in a part with poor surface bondability characteristics. An internal release agent, which can be mixed in a urethane foam resin was investigated. The internal mold release provided good releasability and resulted in urethane foam that has excellent surface bondability. No compatibility problems are expected from the use of this type of release agent.
Applying simulation to optimize plastic molded optical parts
NASA Astrophysics Data System (ADS)
Jaworski, Matthew; Bakharev, Alexander; Costa, Franco; Friedl, Chris
2012-10-01
Optical injection molded parts are used in many different industries including electronics, consumer, medical and automotive due to their cost and performance advantages compared to alternative materials such as glass. The injection molding process, however, induces elastic (residual stress) and viscoelastic (flow orientation stress) deformation into the molded article which alters the material's refractive index to be anisotropic in different directions. Being able to predict and correct optical performance issues associated with birefringence early in the design phase is a huge competitive advantage. This paper reviews how to apply simulation analysis of the entire molding process to optimize manufacturability and part performance.
Chen, Ying-Chen; Chen, Ray-Neng; Jhan, Hua-Jing; Liu, Der-Zen; Ho, Hsiu-O; Mao, Yong; Kohn, Joachim
2015-01-01
Given the growing number of arthritis patients and the limitations of current treatments, there is great urgency to explore cartilage substitutes by tissue engineering. In this study, we developed a novel decellularization method for menisci to prepare acellular extracellular matrix (ECM) scaffolds with minimal adverse effects on the ECM. Among all the acid treatments, formic acid treatment removed most of the cellular contents and preserved the highest ECM contents in the decellularized porcine menisci. Compared with fresh porcine menisci, the content of DNA decreased to 4.10%±0.03%, and there was no significant damage to glycosaminoglycan (GAG) or collagen. Histological staining also confirmed the presence of ECM and the absence of cellularity. In addition, a highly hydrophilic scaffold with three-dimensional interconnected porous structure was fabricated from decellularized menisci tissue. Human chondrocytes showed enhanced cell proliferation and synthesis of chondrocyte ECM including type II collagen and GAG when cultured in this acellular scaffold. Moreover, the scaffold effectively supported chondrogenesis of human bone marrow-derived mesenchymal stem cells. Finally, in vivo implantation was conducted in rats to assess the biocompatibility of the scaffolds. No significant inflammatory response was observed. The acellular ECM scaffold provided a native environment for cells with diverse physiological functions to promote cell proliferation and new tissue formation. This study reported a novel way to prepare decellularized meniscus tissue and demonstrated the potential as scaffolds to support cartilage repair. PMID:25919905
Mold exposure and health effects following hurricanes Katrina and Rita.
Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen
2010-01-01
The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact.
Testing single point incremental forming molds for thermoforming operations
NASA Astrophysics Data System (ADS)
Afonso, Daniel; de Sousa, Ricardo Alves; Torcato, Ricardo
2016-10-01
Low pressure polymer processing processes as thermoforming or rotational molding use much simpler molds then high pressure processes like injection. However, despite the low forces involved with the process, molds manufacturing for this operations is still a very material, energy and time consuming operation. The goal of the research is to develop and validate a method for manufacturing plastically formed sheets metal molds by single point incremental forming (SPIF) operation for thermoforming operation. Stewart platform based SPIF machines allow the forming of thick metal sheets, granting the required structural stiffness for the mold surface, and keeping the short lead time manufacture and low thermal inertia.
A modified tensionless gingival grafting technique using acellular dermal matrix.
Taylor, John B; Gerlach, Robert C; Herold, Robert W; Bisch, Frederick C; Dixon, Douglas R
2010-10-01
Conventional surgical procedures designed for autogenous tissue material may not be appropriate when using acellular dermal matrix (ADM) for the treatment of gingival recessions. This article describes a new surgical technique that addresses the unique and sensitive aspects of ADM specifically to improve esthetic outcomes and gain increased clinical predictability when treating Miller Class I and II gingival recession defects. In this paper, a root coverage case is described and the specific steps and rationale for this new technique are explained. This technique has been predictable clinically, with results comparable to those achieved using autogenous tissue.
Micro-optical fabrication by ultraprecision diamond machining and precision molding
NASA Astrophysics Data System (ADS)
Li, Hui; Li, Likai; Naples, Neil J.; Roblee, Jeffrey W.; Yi, Allen Y.
2017-06-01
Ultraprecision diamond machining and high volume molding for affordable high precision high performance optical elements are becoming a viable process in optical industry for low cost high quality microoptical component manufacturing. In this process, first high precision microoptical molds are fabricated using ultraprecision single point diamond machining followed by high volume production methods such as compression or injection molding. In the last two decades, there have been steady improvements in ultraprecision machine design and performance, particularly with the introduction of both slow tool and fast tool servo. Today optical molds, including freeform surfaces and microlens arrays, are routinely diamond machined to final finish without post machining polishing. For consumers, compression molding or injection molding provide efficient and high quality optics at extremely low cost. In this paper, first ultraprecision machine design and machining processes such as slow tool and fast too servo are described then both compression molding and injection molding of polymer optics are discussed. To implement precision optical manufacturing by molding, numerical modeling can be included in the future as a critical part of the manufacturing process to ensure high product quality.
Nasoalveolar molding in cleft care: is it efficacious?
Abbott, Megan M; Meara, John G
2012-09-01
In the era of evidence-based medicine, new treatment protocols and interventions should be routinely evaluated for their efficacy by reviewing the available evidence. In the cleft literature, nasoalveolar molding has garnered attention over the last decade as a new option for improving nasal form and symmetry before primary surgical repair. Systematic review of the evidence is, however, currently lacking. This review evaluates whether nasoalveolar molding can improve nasal symmetry and form toward the norm, as well as whether nasoalveolar molding demonstrates advantages over other protocols in achieving this goal. A literature search of five databases plus relevant reference lists retrieved 98 articles regarding nasoalveolar molding, 21 of which reported objective outcome measures of nasal symmetry and form, and six of which were able to be given evidence level ratings, all in the unilateral cleft population. Statistical analysis was not possible given the range of techniques and outcomes. Studies of bilateral cleft were not given evidence level ratings, given the inability to separate the effects of nasoalveolar molding from other primary nasal interventions in studies that would have otherwise been rated. In unilateral cleft lip-cleft palate, there was some evidence that nasoalveolar molding may improve nasal outcomes, though comparison with other techniques was limited. Despite a relative paucity of high-level evidence, nasoalveolar molding appears to be a promising technique that deserves further study.
Flow behavior in liquid molding
NASA Technical Reports Server (NTRS)
Hunston, D.; Phelan, F.; Parnas, R.
1992-01-01
The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.
Epoxy-resin patterns speed shell-molding of aluminum parts
NASA Technical Reports Server (NTRS)
1965-01-01
Half patterns cast from commercial epoxy resin containing aluminum powder are used for shell-molding of aluminum parts. The half patterns are cast in plastic molds of the original wooden pattern. Ten serviceable sand resin molds are made from each epoxy pattern.
NASA Astrophysics Data System (ADS)
Peanpunga, Udom; Ugsornrat, Kessararat; Thorlor, Panakamol; Sumithpibul, Chalermsak
2017-09-01
This research studied about an epoxy molding compound (EMC) floor life to reliability performance of integrated circuit (IC) package. Molding is the process for protecting the die of IC package form mechanical and chemical reaction from external environment by shaping EMC. From normal manufacturing process, the EMC is stored in the frozen at 5oC and left at around room temperature for aging time or floor life before molding process. The EMC floor life effect to its properties and reliability performance of IC package. Therefore, this work interested in varied the floor life of EMC before molding process to analyze properties of EMC such as spiral flow length, gelation time, and viscosity. In experiment, the floor life of EMC was varied to check the effect of its property to reliability performance. The EMC floor life were varied from 0 hours to 60 hours with a step of 12 hours and observed wire sweep, incomplete EMC, and delamination inside the packages for 3x3, 5x5 and 8x8 mm2 of QFN packages. The evaluation showed about clearly effect of EMC floor life to IC packaging reliability. EMC floor life is not any concern for EMC property, moldabilty, and reliability from 0 hours to 48 hours for molding process of 3x3,5x5 and 8x8 mm2 QFN packaging manufacturing
A programmable nanoreplica molding for the fabrication of nanophotonic devices.
Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng
2016-03-01
The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.
A programmable nanoreplica molding for the fabrication of nanophotonic devices
Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng
2016-01-01
The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...
Additive Manufacturing of Wind Turbine Molds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian; Richardson, Bradley; Lloyd, Peter
The objective of this project was to explore the utility of Big Area Additive Manufacturing (BAAM) for low cost manufacturing of wind turbine molds. Engineers at Oak Ridge National Laboratory (ORNL) and TPI Composites (TPI) collaborated to design and manufacture a printed mold that can be used for resin infusion of wind turbine components. Specific focus was on required material properties (operating temperatures and pressures, coefficient of thermal expansion (CTE), thermal conductivity), surface finish (accuracy and coatings) and system integration (integrated vacuum ports, and heating element). The project began with a simple proof of principle components, targeting surface coatings andmore » material properties for printing a small section (approximately 4’ x 4’ x 2’) of a mold. Next, the second phase scaled up and integrated with the objective of capturing all of the necessary components (integrated heating to accelerate cure time, and vacuum, sealing) for resin infusion on a mold of significant size (8’ x 20’ x 6’).« less
Neuropsychological exploration of alleged mold neurotoxicity.
Reinhard, Matthew J; Satz, Paul; Scaglione, Cris A; D'Elia, Louis F; Rassovsky, Yuri; Arita, Anthony A; Hinkin, Charles H; Thrasher, Delaney; Ordog, Gary
2007-05-01
Cognitive and emotional correlates of toxic mold exposure and potential dose-response effects for both outcomes were investigated. Self-reported length of exposure, time since last exposure, and serum immunoglobulin (IgG) levels were assessed. Despite CNS complaints often seen with mold exposed individuals, overall results did not uncover concomitant cognitive deficits suggested in previous studies or a significant reduction in intellectual functioning. Fewer subjects were excluded as result of failing effort/motivation assessment than expected. Correlations of IgG and cognitive function are discussed. A dose-effect for self-reported length of exposure and cognitive outcome was not seen. The sample's overall Minnesota Multiphasic Personality Inventory II (MMPI-2) profile indicated elevations on scales 1, 2, 3, 7 and 8. MMPI-2 clinical scales 1 and 3 were significantly correlated with length of exposure. The MMPI-2 may be sensitive to increasing physical and emotional sequelae as length of exposure increases. A potential subgroup of cognitively impaired outliers within mold exposure litigants is explored. Limitations of self-reported and objective measurements for mold exposure and exploratory statistical methodology are discussed.
Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1974-01-01
A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.
ERIC Educational Resources Information Center
Huckabee, Christopher
2003-01-01
Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)
Wood inhabiting fungi in Alaska : their diversity, roles, and uses
Gary A Laursen; Harold H. Burdsall; Rodney D. Seppelt
2005-01-01
Wood inhabiting, rotting and/or decomposing fungi from Alaska include representatives from an assortment of fungal groups (cup, jelly, pored coral, tooth, puffball, gilled and lichenized fungi) and one fungus-like group (the slime molds). Of the more than 1,500 species recorded for North America, over 250 species of wood-inhabiting fungi have been reported from Alaska...
Genomic characterization of recurrent mold infections in thoracic transplant recipients.
Messina, Julia A; Wolfe, Cameron R; Hemmersbach-Miller, Marion; Milano, Carmelo; Todd, Jamie L; Reynolds, John; Alexander, Barbara D; Schell, Wiley A; Cuomo, Christina A; Perfect, John R
2018-05-31
Invasive mold disease in thoracic organ transplant recipients is a well-recognized complication, but the long-term persistence of molds within the human body and evasion of host defenses has not been well-described. We present 2 cases of invasive mold disease (Verruconis gallopava and Aspergillus fumigatus) in thoracic transplant recipients who had the same mold cultured years prior to the invasive disease presentation. The paired isolates from the index and recurrent infections in both patients were compared using whole-genome sequencing to determine if the same strain of mold caused both the index and recurrent infections. In Case 1, the isolates were found to be of the same strain indicating that the initial colonizing isolate identified pre-transplant eventually caused invasive mold disease post-transplant while in Case 2, the 2 isolates were not of the same strain. These results demonstrate the distinct possibility of molds both persisting within the human body for years prior to invasive mold disease or the long-term risk of recurrent, persistent infection with more than one strain. Further studies of long-term molecular epidemiology of IMD and risk factors for mold persistence in transplant recipients are encouraged. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Lawson, Jeffrey H; Glickman, Marc H; Ilzecki, Marek; Jakimowicz, Tomasz; Jaroszynski, Andrzej; Peden, Eric K; Pilgrim, Alison J; Prichard, Heather L; Guziewicz, Malgorzata; Przywara, Stanisław; Szmidt, Jacek; Turek, Jakub; Witkiewicz, Wojciech; Zapotoczny, Norbert; Zubilewicz, Tomasz; Niklason, Laura E
2016-01-01
Summary Background For patients with end-stage renal disease who are not candidates for fistula, dialysis access grafts are the best option for chronic haemodialysis. However, polytetrafluoroethylene arteriovenous grafts are prone to thrombosis, infection, and intimal hyperplasia at the venous anastomosis. We developed and tested a bioengineered human acellular vessel as a potential solution to these limitations in dialysis access. Methods We did two single-arm phase 2 trials at six centres in the USA and Poland. We enrolled adults with end-stage renal disease. A novel bioengineered human acellular vessel was implanted into the arms of patients for haemodialysis access. Primary endpoints were safety (freedom from immune response or infection, aneurysm, or mechanical failure, and incidence of adverse events), and efficacy as assessed by primary, primary assisted, and secondary patencies at 6 months. All patients were followed up for at least 1 year, or had a censoring event. These trials are registered with ClinicalTrials.gov, NCT01744418 and NCT01840956. Findings Human acellular vessels were implanted into 60 patients. Mean follow-up was 16 months (SD 7·6). One vessel became infected during 82 patient-years of follow-up. The vessels had no dilatation and rarely had post-cannulation bleeding. At 6 months, 63% (95% CI 47–72) of patients had primary patency, 73% (57–81) had primary assisted patency, and 97% (85–98) had secondary patency, with most loss of primary patency because of thrombosis. At 12 months, 28% (17–40) had primary patency, 38% (26–51) had primary assisted patency, and 89% (74–93) had secondary patency. Interpretation Bioengineered human acellular vessels seem to provide safe and functional haemodialysis access, and warrant further study in randomised controlled trials. Funding Humacyte and US National Institutes of Health. PMID:27203778
[Biological monitoring in the molding of plastics and rubbers].
Fustinoni, S; Campo, L; Cirla, A M; Cirla, P E; Cutugno, V; Lionetti, C; Martinotti, I; Mossini, E; Foà, V
2007-01-01
This survey was carried out in the molding of plastics and rubbers, in the "Professional Cancer Prevention Project" sponsored by the Lombardy region with the objective of developing and implementing protocols for evaluating exposure to carcinogens through the biological monitoring. The realities of molding the thermoplastic polymer ABS, rubber, and thermosetting plastics containing formaldehyde were examined. The carcinogenic substances identified in these processes were: 1,3-butadiene, acrylonitrile and styrene in molding ABS, polycyclic aromatic hydrocarbons (PAH) in molding rubber, and formaldehyde in molding the thermosetting plastics. Only for some of these substances biological indicators are available. The limited exposure to airborne chemicals in molding ABS and the intrinsic characteristics of biological indicators available for 1-3 butadiene have determined the non applicability of biological monitoring to this situation. The absence of a biological indicator of exposure to formaldehyde has made this situation not investigable. Exposure in the rubber molding was studied in 19 subjects applying the determination not metabolized PAH in urine. The levels of these indicators were similar to those measured in other groups of subjects without occupational exposure to PAH, confirming a low airborne contamination in this workplace.
Static Mixer for Heat Transfer Enhancement for Mold Cooling Application
NASA Astrophysics Data System (ADS)
Becerra, Rodolfo; Barbosa, Raul; Lee, Kye-Hwan; Park, Younggil
Injection molding is the process by which a material is melted in a barrel and then it is injected through a nozzle in the mold cavity. When it cools down, the material solidifies into the shape of the cavity. Typical injection mold has cooling channels to maintain constant mold temperature during injection molding process. Even and constant temperature throughout the mold are very critical for a part quality and productivity. Conformal cooling improves the quality and productivity of injection molding process through the implementation of cooling channels that ``conform'' to the shape of the molded part. Recent years, the use of conformal cooling increases with advance of 3D printing technology such as Selective Laser Melting (SLM). Although it maximizes cooling, material and dimension limitations make SLM methods highly expensive. An alternative is the addition of static mixers in the molds with integrated cooling channels. A static mixer is a motionless mixing device that enhances heat transfer by producing improved flow mixing in the pipeline. In this study, the performance of the cooling channels will be evaluated with and without static mixers, by measuring temperature, pressure drop, and flow rate. The following question is addressed: Can a static mixer effectively enhance heat transfer for mold cooling application processes? This will provide insight on the development of design methods and guidelines that can be used to increase cooling efficiency at a lower cost.
Treating "cauliflower ear" with silicone mold.
Gross, C G
1978-01-01
Acute hematoma of the ear (cauliflower ear) can be satisfactorily treated with aspiration and the use of the silicone mold to prevent reaccumulation of the blood or serum in the ear. Advantages of the silicone mold over other dressings appears to be ease of application, patient acceptance, and prevention of reoccurrence of reaccumulation of the hematoma.
... condensation because there is a hole in the insulation and it is cold outdoors. Photo courtesy of ... Inside of wall from above, moldy gypsum board, insulation Photo courtesy of Terry Brennan Looking for mold ...
Xenogeneic Acellular Conjunctiva Matrix as a Scaffold of Tissue-Engineered Corneal Epithelium
Zhao, Haifeng; Qu, Mingli; Wang, Yao; Wang, Zhenyu; Shi, Weiyun
2014-01-01
Amniotic membrane-based tissue-engineered corneal epithelium has been widely used in the reconstruction of the ocular surface. However, it often degrades too early to ensure the success of the transplanted corneal epithelium when treating patients with severe ocular surface disorders. In the present study, we investigated the preparation of xenogeneic acellular conjunctiva matrix (aCM) and evaluated its efficacy and safety as a scaffold of tissue-engineered corneal epithelium. Native porcine conjunctiva was decellularized with 0.1% sodium dodecyl sulfate (SDS) for 12 h at 37°C and sterilized via γ-irradiation. Compared with native conjunctiva, more than 92% of the DNA was removed, and more than 90% of the extracellular matrix components (glycosaminoglycan and collagen) remained after the decellularization treatment. Compared with denuded amniotic membrane (dAM), the aCM possessed favorable optical transmittance, tensile strength, stability and biocompatibility as well as stronger resistance to degradation both in vitro and in vivo. The corneal epithelial cells seeded on aCM formed a multilayered epithelial structure and endured longer than did those on dAM. The aCM-based tissue-engineered corneal epithelium was more effective in the reconstruction of the ocular surface in rabbits with limbal stem cell deficiency. These findings support the application of xenogeneic acellular conjunctiva matrix as a scaffold for reconstructing the ocular surface. PMID:25375996
Simulation of cracking cores when molding piston components
NASA Astrophysics Data System (ADS)
Petrenko, Alena; Soukup, Josef
2014-08-01
The article deals with pistons casting made from aluminum alloy. Pistons are casting at steel mold with steel core. The casting is provided by gravity casting machine. The each machine is equipped by two metal molds, which are preheated above temperature 160 °C before use. The steel core is also preheated by flame. The metal molds and cores are heated up within the casting process. The temperature of the metal mold raise up to 200 °C and temperature of core is higher. The surface of the core is treated by nitration. The mold and core are cooled down by water during casting process. The core is overheated and its top part is finally cracked despite its intensive water-cooling. The life time cycle of the core is decreased to approximately 5 to 15 thousands casting, which is only 15 % of life time cycle of core for production of other pistons. The article presents the temperature analysis of the core.
Direct molding of pavement tiles made of ground tire rubber
NASA Astrophysics Data System (ADS)
Quadrini, Fabrizio; Gagliardi, Donatella; Tedde, Giovanni Matteo; Santo, Loredana; Musacchi, Ettore
2016-10-01
Large rubber products can be molded by using only ground tire rubber (GTR) without any additive or binder due to a new technology called "direct molding". Rubber granules and powders from tire recycling are compression molded at elevated temperatures and pressures. The feasibility of this process was clearly shown in laboratory but the step to the industrial scale was missing. Thanks to an European Project (SMART "Sustainable Molding of Articles from Recycled Tires") this step has been made and some results are reported in this study. The press used for compression molding is described. Some tests were made to measure the energy consumption so as to evaluate costs for production in comparison with conventional technologies for GTR molding (by using binders). Results show that 1 m2 tiles can be easily molded with several thicknesses in a reasonable low time. Energy consumption is higher than conventional technologies but it is lower than the cost for binders.
Fundamentals of rapid injection molding for microfluidic cell-based assays.
Lee, Ulri N; Su, Xiaojing; Guckenberger, David J; Dostie, Ashley M; Zhang, Tianzi; Berthier, Erwin; Theberge, Ashleigh B
2018-01-30
Microscale cell-based assays have demonstrated unique capabilities in reproducing important cellular behaviors for diagnostics and basic biological research. As these assays move beyond the prototyping stage and into biological and clinical research environments, there is a need to produce microscale culture platforms more rapidly, cost-effectively, and reproducibly. 'Rapid' injection molding is poised to meet this need as it enables some of the benefits of traditional high volume injection molding at a fraction of the cost. However, rapid injection molding has limitations due to the material and methods used for mold fabrication. Here, we characterize advantages and limitations of rapid injection molding for microfluidic device fabrication through measurement of key features for cell culture applications including channel geometry, feature consistency, floor thickness, and surface polishing. We demonstrate phase contrast and fluorescence imaging of cells grown in rapid injection molded devices and provide design recommendations to successfully utilize rapid injection molding methods for microscale cell-based assay development in academic laboratory settings.
Gallup, J; Kozak, P; Cummins, L; Gillman, S
1987-01-01
We are constantly being exposed to molds in our environment. Indoor mold problems occur after prolonged or chronic water damage to a variety of organic materials such as unfinished wood, jutebacked carpeting, wallpaper, books, cardboard, leather, cork, paper, wallboard, and wicker baskets. Mechanisms for spore dispersal (such as air currents or foot traffic on carpets) must also be present. The presence of these organic materials and dispersal mechanisms leads to significant increases in indoor spore levels.
Efficacy of micronized acellular dermal graft for use in interproximal papillae regeneration.
Geurs, Nico C; Romanos, Alain H; Vassilopoulos, Philip J; Reddy, Michael S
2012-02-01
The aim of this study was to evaluate interdental papillary reconstruction based on a micronized acellular dermal matrix allograft technique. Thirty-eight papillae in 12 patients with esthetic complaints of insufficient papillae were evaluated. Decreased gingival recession values were found postoperatively (P < .001). Chi-square analysis showed significantly higher postoperative Papilla Index values (chi-square = 43, P < .001), further supported by positive symmetry statistical analysis values (positive kappa and weighted kappa values). This procedure shows promise as a method for papillary reconstruction.
Hydrogels in acellular and cellular strategies for intervertebral disc regeneration.
Pereira, D R; Silva-Correia, J; Oliveira, J M; Reis, R L
2013-02-01
Low back pain is an extremely common illness syndrome that causes patient suffering and disability and requires urgent solutions to improve the quality of life of these patients. Treatment options aimed to regenerate the intervertebral disc (IVD) are still under development. The cellular complexity of IVD, and consequently its fine regulatory system, makes it a challenge to the scientific community. Biomaterials-based therapies are the most interesting solutions to date, whereby tissue engineering and regenerative medicine (TE&RM) strategies are included. By using such strategies, i.e., combining biomaterials, cells, and biomolecules, the ultimate goal of reaching a complete integration between native and neo-tissue can be achieved. Hydrogels are promising materials for restoring IVD, mainly nucleus pulposus (NP). This study presents an overview of the use of hydrogels in acellular and cellular strategies for intervertebral disc regeneration. To better understand IVD and its functioning, this study will focus on several aspects: anatomy, pathophysiology, cellular and biomolecular performance, intrinsic healing processes, and current therapies. In addition, the application of hydrogels as NP substitutes will be addressed due to their similarities to NP mechanical properties and extracellular matrix. These hydrogels can be used in cellular strategies when combined with cells from different sources, or in acellular strategies by performing the functionalization of the hydrogels with biomolecules. In addition, a brief summary of therapies based on simple injection for primary biological repair will be examined. Finally, special emphasis will focus on reviewing original studies reporting on the use of autologous cells and biomolecules such as platelet-rich plasma and their potential clinical applications. Copyright © 2011 John Wiley & Sons, Ltd.
56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...
56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
21ST CENTURY MOLD ANALYSIS IN FOOD
Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...
Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses
Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.
2015-01-01
Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation
Mold contamination of automobile air conditioner systems.
Kumar, P; Lopez, M; Fan, W; Cambre, K; Elston, R C
1990-02-01
Eight cars belonging to patients who were found to have exacerbation of allergic rhinitis and bronchial asthma after turning on the air conditioner in their cars were examined. Mold concentrations inside the passenger compartment with the a/c turned off and at different climate control settings were lower than concentrations in the outside air. After turning on the air conditioner to "Max", cultures obtained at various intervals revealed that mold concentrations decreased significantly with time. Furthermore, placement of a filter at the portal of entry of outside air significantly reduced the mold concentration in the passenger compartment.
Rapid manufacturing of metallic Molds for parts in Automobile
NASA Astrophysics Data System (ADS)
Zhang, Renji; Xu, Da; Liu, Yuan; Yan, Xudong; Yan, Yongnian
1998-03-01
The recent research of RPM (Rapid Prototyping Manufacturing) in our lab has been focused on the rapid creation of alloyed cast iron (ACI) molds. There are a lot of machinery parts in an automobile, so a lot of mettallic molds are needed in automobile industry. A new mold manufacturing technology has been proposed. A new large scale RP machine has been set up in our lab now. Then rapid prototypes could be manufactured by means of laminated object manufacturing (LOM) technology. The molds for parts in automobile have been produced by ceramic shell precision casting. An example is a drawing mold for cover parts in automobile. Sufficient precision and surface roughness have been obtained. Itis proved that this is a vew kind of technology. Work supported by the Mational Science Foundation of China.
Development of In-Mold Assembly Methods for Producing Mesoscale Revolute Joints
2009-01-01
tolerances available for manufacturing the molds are relatively low. Any inaccuracy in mold First stage part (ABS) Second stage part ( LDPE ) Pins...case, the viscosity of LDPE is also a function of temperature. For each of these cases, they have considered the filling of a thin mold cavity. From...predicting the weld-line strengths of crystalline polymers such as LDPE . 63 3 Issues in In-Mold Assembly at the Mesoscale 3.1 Motivation In-mold
NASA Astrophysics Data System (ADS)
Lyu, Peisheng; Wang, Wanlin; Long, Xukai; Zhang, Kaixuan; Gao, Erzhuo; Qin, Rongshan
2018-02-01
The chamfered mold with a typical corner shape (angle between the chamfered face and hot face is 45 deg) was applied to the mold simulator study in this paper, and the results were compared with the previous results from a well-developed right-angle mold simulator system. The results suggested that the designed chamfered structure would increase the thermal resistance and weaken the two-dimensional heat transfer around the mold corner, causing the homogeneity of the mold surface temperatures and heat fluxes. In addition, the chamfered structure can decrease the fluctuation of the steel level and the liquid slag flow around the meniscus at mold corner. The cooling intensities at different longitudinal sections of shell are close to each other due to the similar time-average solidification factors, which are 2.392 mm/s1/2 (section A-A: chamfered center), 2.372 mm/s1/2 (section B-B: 135 deg corner), and 2.380 mm/s1/2 (section D-D: face), respectively. For the same oscillation mark (OM), the heights of OM roots at different positions (profile L1 (face), profile L2 (135 deg corner), and profile L3 (chamfered center)) are very close to each other. The average value of height difference (HD) between two OMs roots for L1 and L2 is 0.22 mm, and for L2 and L3 is 0.38 mm. Finally, with the help of metallographic examination, the shapes of different hooks were also discussed.
Three-dimensional numerical simulation for plastic injection-compression molding
NASA Astrophysics Data System (ADS)
Zhang, Yun; Yu, Wenjie; Liang, Junjie; Lang, Jianlin; Li, Dequn
2018-03-01
Compared with conventional injection molding, injection-compression molding can mold optical parts with higher precision and lower flow residual stress. However, the melt flow process in a closed cavity becomes more complex because of the moving cavity boundary during compression and the nonlinear problems caused by non-Newtonian polymer melt. In this study, a 3D simulation method was developed for injection-compression molding. In this method, arbitrary Lagrangian- Eulerian was introduced to model the moving-boundary flow problem in the compression stage. The non-Newtonian characteristics and compressibility of the polymer melt were considered. The melt flow and pressure distribution in the cavity were investigated by using the proposed simulation method and compared with those of injection molding. Results reveal that the fountain flow effect becomes significant when the cavity thickness increases during compression. The back flow also plays an important role in the flow pattern and redistribution of cavity pressure. The discrepancy in pressures at different points along the flow path is complicated rather than monotonically decreased in injection molding.
47 CFR 76.805 - Access to molding.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 4 2010-10-01 2010-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be permitted...
Precision lens molding of asphero diffractive surfaces in chalcogenide materials
NASA Astrophysics Data System (ADS)
Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.
2015-10-01
Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.
Ultrasound - Aided ejection in micro injection molding
NASA Astrophysics Data System (ADS)
Masato, D.; Sorgato, M.; Lucchetta, G.
2018-05-01
In this work, an ultrasound-aided ejection system was designed and tested for different polymers (PS, COC and POM) and mold topographies. The proposed solution aims at reducing the ejection friction by decreasing the adhesion component of the frictional force, which is controlled by the contact area developed during the filling stage of the injection molding process. The experimental results indicate a positive effect of ultrasound vibration on the friction force values, with a maximum reduction of 16. Moreover, it is demonstrated that the ultrasound effect is strictly related to both polymer selection and mold roughness. The combined effect on the ejection force of mold surface roughness, melt viscosity during filling and polymer elastic modulus at ejection was modeled to the experimental data, in order to demonstrate that the effect of ultrasound vibration on the ejection friction reduction is due to the heating of the contact interface and the consequent reduction of the polymer elastic modulus.
Pot, Michiel W; van Kuppevelt, Toin H; Gonzales, Veronica K; Buma, Pieter; IntHout, Joanna; de Vries, Rob B M; Daamen, Willeke F
2017-01-01
Bone marrow stimulation may be applied to regenerate focal cartilage defects, but generally results in transient clinical improvement and formation of fibrocartilage rather than hyaline cartilage. Tissue engineering and regenerative medicine strive to develop new solutions to regenerate hyaline cartilage tissue. This systematic review and meta-analysis provides a comprehensive overview of current literature and assesses the efficacy of articular cartilage regeneration by implantation of cell-laden versus cell-free biomaterials in the knee and ankle joint in animals after bone marrow stimulation. PubMed and EMBASE (via OvidSP) were systematically searched using tissue engineering, cartilage and animals search strategies. Included were primary studies in which cellular and acellular biomaterials were implanted after applying bone marrow stimulation in the knee or ankle joint in healthy animals. Study characteristics were tabulated and outcome data were collected for meta-analysis for studies applying semi-quantitative histology as outcome measure (117 studies). Cartilage regeneration was expressed on an absolute 0-100% scale and random effects meta-analyses were performed. Implantation of cellular biomaterials significantly improved cartilage regeneration by 18.6% compared to acellular biomaterials. No significant differences were found between biomaterials loaded with stem cells and those loaded with somatic cells. Culture conditions of cells did not affect cartilage regeneration. Cartilage formation was reduced with adipose-derived stem cells compared to other cell types, but still improved compared to acellular scaffolds. Assessment of the risk of bias was impaired due to incomplete reporting for most studies. Implantation of cellular biomaterials improves cartilage regeneration compared to acellular biomaterials.
van Kuppevelt, Toin H.; Gonzales, Veronica K.; Buma, Pieter; IntHout, Joanna; de Vries, Rob B.M.
2017-01-01
Bone marrow stimulation may be applied to regenerate focal cartilage defects, but generally results in transient clinical improvement and formation of fibrocartilage rather than hyaline cartilage. Tissue engineering and regenerative medicine strive to develop new solutions to regenerate hyaline cartilage tissue. This systematic review and meta-analysis provides a comprehensive overview of current literature and assesses the efficacy of articular cartilage regeneration by implantation of cell-laden versus cell-free biomaterials in the knee and ankle joint in animals after bone marrow stimulation. PubMed and EMBASE (via OvidSP) were systematically searched using tissue engineering, cartilage and animals search strategies. Included were primary studies in which cellular and acellular biomaterials were implanted after applying bone marrow stimulation in the knee or ankle joint in healthy animals. Study characteristics were tabulated and outcome data were collected for meta-analysis for studies applying semi-quantitative histology as outcome measure (117 studies). Cartilage regeneration was expressed on an absolute 0–100% scale and random effects meta-analyses were performed. Implantation of cellular biomaterials significantly improved cartilage regeneration by 18.6% compared to acellular biomaterials. No significant differences were found between biomaterials loaded with stem cells and those loaded with somatic cells. Culture conditions of cells did not affect cartilage regeneration. Cartilage formation was reduced with adipose-derived stem cells compared to other cell types, but still improved compared to acellular scaffolds. Assessment of the risk of bias was impaired due to incomplete reporting for most studies. Implantation of cellular biomaterials improves cartilage regeneration compared to acellular biomaterials. PMID:29093996
Method and composition for molding low-density desiccant syntactic-foam articles
Not Available
1981-12-07
These and other objects of the invention are achieved by a process for molding to size a desiccant syntactic foam article having a density of 0.2 to 0.9 g/cc and a moisture capacity of 1 to 12% by weight, comprising the steps of: charging a mold with a powdery mixture of an activated desiccant, microspheres and a thermosetting resin, the amount of the desiccant being sufficient to provide the required moisture capacity, and the amounts of the microspheres and resin being such that the microspheres/desiccant volume fraction exceeds the packing factor by an amount sufficient to substantially avoid shrinkage without causing excessively high molding pressures; covering the mold and heating the covered mold to a temperature and for an amount of time sufficient to melt the resin; and tightly closing the mold and heating the closed mold to a temperature and for an amount of time sufficient to cure the resin, and removing the resultant desiccant syntactic foam article from the mold. In a composition of matter aspect, the present invention provides desiccant syntactic foam articles, and a composition of matter for use in molding the same.
Injection molded polymer optics in the 21st Century
NASA Astrophysics Data System (ADS)
Beich, William S.
2005-08-01
Precision polymer optics, manufactured by injection molding techniques, has been a key enabling technology for several decades now. The technology, which can be thought of as a subset of the wider field of precision optics manufacturing, was pioneered in the United States by companies such as Eastman Kodak, US Precision Lens, and Polaroid. In addition to suppliers in the U.S. there are several companies worldwide that design and manufacture precision polymer optics, for example Philips High Tech Plastics in Europe and Fujinon in Japan. Designers who are considering using polymer optics need a fundamental understanding of exactly how the optics are created. This paper will survey the technology and processes that are employed in the successful implementation of a polymer optic solution from a manufacturer's perspective. Special emphasis will be paid to the unique relationship between the molds and the optics that they produce. We will discuss the key elements of production: molding resins, molds and molding equipment, and metrology. Finally we will offer a case study to illustrate just how the optics designer carries a design concept through to production. The underlying theme throughout the discussion of polymer optics is the need for the design team to work closely with an experienced polymer optics manufacturer with a solid track record of success in molded optics. As will be seen shortly, the complex interaction between thermoplastics, molds, and molding machines dictates the need for working closely with a supplier who has the critical knowledge needed to manage all aspects of the program.
Flexible Nonstick Replica Mold for Transfer Printing of Ag Ink.
Lee, Bong Kuk; Yu, Han Young; Kim, Yarkyeon; Yoon, Yong Sun; Jang, Won Ik; Do, Lee-Mi; Park, Ji-Ho; Park, Jaehoon
2016-03-01
We report the fabrication of flexible replica molds for transfer printing of Ag ink on a rigid glass substrate. As mold precursors, acrylic mixtures were prepared from silsesquioxane-based materials, silicone acrylate, poly(propylene glycol) diacrylate, 3,3,4,4,5,5,6,6,7,7,8,8, 9,9,10,10,10-heptadecafluorodecyl methacrylate, and photoinitiator. By using these materials, the replica molds were fabricated from a silicon master onto a flexible substrate by means of UV-assisted molding process at room temperature. The wettability of Ag ink decreased with increase in the water contact angle of replica molds. On the other hand, the transfer rate of Ag ink onto adhesive-modified substrates increased with increase in the water contact angle of replica molds. Transferred patterns were found to be thermally stable on the photocurable adhesive layer, whereas Ag-ink patterns transferred on non-photocurable adhesives were distorted by thermal treatment. We believe that these characteristics of replica molds and adhesives offer a new strategy for the development of the transfer printing of solution-based ink materials.
TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...
TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL
Production application of injection-molded diffractive elements
NASA Astrophysics Data System (ADS)
Clark, Peter P.; Chao, Yvonne Y.; Hines, Kevin P.
1995-12-01
We demonstrate that transmission kinoforms for visible light applications can be injection molded in acrylic in production volumes. A camera is described that employs molded Fresnel lenses to change the convergence of a projection ranging system. Kinoform surfaces are used in the projection system to achromatize the Fresnel lenses.
Classification of buildings mold threat using electronic nose
NASA Astrophysics Data System (ADS)
Łagód, Grzegorz; Suchorab, Zbigniew; Guz, Łukasz; Sobczuk, Henryk
2017-07-01
Mold is considered to be one of the most important features of Sick Building Syndrome and is an important problem in current building industry. In many cases it is caused by the rising moisture of building envelopes surface and exaggerated humidity of indoor air. Concerning historical buildings it is mostly caused by outdated raising techniques among that is absence of horizontal isolation against moisture and hygroscopic materials applied for construction. Recent buildings also suffer problem of mold risk which is caused in many cases by hermetization leading to improper performance of gravitational ventilation systems that make suitable conditions for mold development. Basing on our research there is proposed a method of buildings mold threat classification using electronic nose, based on a gas sensors array which consists of MOS sensors (metal oxide semiconductor). Used device is frequently applied for air quality assessment in environmental engineering branches. Presented results show the interpretation of e-nose readouts of indoor air sampled in rooms threatened with mold development in comparison with clean reference rooms and synthetic air. Obtained multivariate data were processed, visualized and classified using a PCA (Principal Component Analysis) and ANN (Artificial Neural Network) methods. Described investigation confirmed that electronic nose - gas sensors array supported with data processing enables to classify air samples taken from different rooms affected with mold.
Selection of antifungal protein-producing molds from dry-cured meat products.
Acosta, Raquel; Rodríguez-Martín, Andrea; Martín, Alberto; Núñez, Félix; Asensio, Miguel A
2009-09-30
To control unwanted molds in dry-cured meats it is necessary to allow the fungal development essential for the desired characteristics of the final product. Molds producing antifungal proteins could be useful to prevent hazards due to the growth of mycotoxigenic molds. The objective has been to select Penicillium spp. that produce antifungal proteins against toxigenic molds. To obtain strains adapted to these products, molds were isolated from dry-cured ham. A first screening with 281 isolates by the radial inhibition assay revealed that 166 were active against some of the toxigenic P. echinulatum, P. commune, and Aspergillusniger used as reference molds. The activity of different extracts from cultured medium was evaluated by a microspectroscopic assay. Molds producing active chloroform extracts were eliminated from further consideration. A total of 16 Penicillium isolates were screened for antifungal activity from both cell-free media and the aqueous residues obtained after chloroform extraction. The cell-free media of 10 isolates that produced a strong inhibition of the three reference molds were fractionated by FPLC on a cationic column. For protein purification, the fractions of the three molds that showed high inhibitory activity were further chromatographed on a gel filtration column, and the subfractions containing the highest absorbance peaks were assayed against the most sensitive reference molds. One subfraction each from strains AS51D and RP42C from Penicilliumchrysogenum confirmed the inhibitory activity against the reference molds. SDS-PAGE revealed a single band from each subfraction, with estimated molecular masses of 37kDa for AS51D and 9kDa for RP42C. Although further characterisation is required, both these proteins and the producing strains can be of interest to control unwanted molds on foods.
Differential allergy induction by molds found in water-damaged homes**
Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...
Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography
NASA Astrophysics Data System (ADS)
Bae, Chang-Jun
Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to
Mold Remediation in Schools and Commercial Buildings.
ERIC Educational Resources Information Center
Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.
This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…
Feasibility of using Big Area Additive Manufacturing to Directly Manufacture Boat Molds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian K.; Chesser, Phillip C.; Lind, Randall F.
The goal of this project was to explore the feasibility of using Big Area Additive Manufacturing (BAAM) to directly manufacture a boat mold without the need for coatings. All prior tooling projects with BAAM required the use to thick coatings to overcome the surface finish limitations of the BAAM process. While the BAAM process significantly lowers the cost of building the mold, the high cost element rapidly became the coatings (cost of the material, labor on coating, and finishing). As an example, the time and cost to manufacture the molds for the Wind Turbine project with TPI Composites Inc. andmore » the molds for the submarine project with Carderock Naval Warfare Systems was a fraction of the time and cost of the coatings. For this project, a catamaran boat hull mold was designed, manufactured, and assembled with an additional 0.15” thickness of material on all mold surfaces. After printing, the mold was immediately machined and assembled. Alliance MG, LLC (AMG), the industry partner of this project, experimented with mold release agents on the carbon-fiber reinforced acrylonitrile butadiene styrene (CF ABS) to verify that the material can be directly used as a mold (rather than needing a coating). In addition, for large molds (such as the wind turbine mold with TPI Composites Inc.), the mold only provided the target surface. A steel subframe had to be manufactured to provide structural integrity. If successful, this will significantly reduce the time and cost necessary for manufacturing large resin infusion molds using the BAAM process.« less
Microbial Variants from Iron Ore Slimes: Mineral Specificity and pH Tolerance.
Abhilash; Ghosh, A; Pandey, B D; Sarkar, S
2015-12-01
This paper describes the isolation of the native bacterial strains from the iron ore mines slime pond and its extremophilic characteristics. The two microbial isolates designated as CNIOS-1 and CNIOS-2 were grown in selective silicate broth at pH 7.0 and the organisms were tested for their selective adhesion on silicate and alumina minerals. The silicate bacteria with their exopolymers are very potent to grow over aluminosilicates. It was established that CNIOS-1 grew preferentially in the presence of silicate mineral compared to CNIOS-2 which grew in the presence of alumina. The organisms were tested for growth at various pH and trials were carried to define their efficacy for eventual applications to remove gangue minerals of silica and alumina from the raw material.
The US EPA has patented a mold ID technology (#6,387,652) licensed by 15 companies in the US and EU. This technology is based upon DNA sequences. In conjunction with HUD, this technology will be used in a National Survey of Homes.
Prompt remediation of water intrusion corrects the resultant mold contamination in a home.
Rockwell, William
2005-01-01
More patients are turning to their allergists with symptoms compatible with allergic rhinitis, allergic sinusitis, and/or bronchial asthma after exposure to mold-contaminated indoor environments. These patients often seek guidance from their allergists in the remediation of the contaminated home or office. The aim of this study was to determine baseline mold spore counts for noncontaminated homes and report a successful mold remediation in one mold-contaminated home. Indoor air quality was tested using volumetric spore counts in 50 homes where homeowners reported no mold-related health problems and in one mold-contaminated home that was remediated. The health of the occupant of the mold-contaminated home also was assessed. Indoor volumetric mold spore counts ranged from 300 to 1200 spores/m3 in the baseline homes. For the successful remediation, the mold counts started at 300 spores/m3, increased to 2800 spores/m3 at the height of the mold contamination, and then fell to 800 spores/m3 after remediation. The occupant's allergic symptoms ceased on complete remediation of the home. Indoor volumetric mold counts taken with the Allergenco MK-3 can reveal a potential indoor mold contamination, with counts above 1000 spores/m3 suggesting indoor mold contamination. Once the presence of indoor mold growth is found, a prompt and thorough remediation can bring mold levels back to near-baseline level and minimize negative health effects for occupants.
Foreign body reaction to acellular dermal matrix allograft in biologic glenoid resurfacing.
Namdari, Surena; Melnic, Christopher; Huffman, G Russell
2013-08-01
Biologic glenoid resurfacing is a treatment option for young patients with glenohumeral arthritis. An optimal synthetic graft for glenoid resurfacing should allow repopulation with host cells, be durable enough to tolerate suture fixation and forces across the joint, and present no host inflammatory response. We report two cases of giant cell reaction to GraftJacket(®) after biologic glenoid resurfacing. Two patients who underwent hemiarthroplasty and biologic glenoid resurfacing using GraftJacket(®) had a foreign body giant cell reaction that required revision surgery. Intraoperatively, both patients were observed to have a well-fixed humeral component and a dense, erythematous, synovitic membrane overlying the glenoid. Pathology specimens showed a benign reactive synovium, chronic inflammation, and foreign body giant cell reaction. After débridement and conversion to total shoulder arthroplasty, both patients continued to be pain-free at greater than 1-year followup. Multinucleated giant cell and mononuclear cell responses have been observed in an animal model after use of GraftJacket(®). Although the use of acellular matrix-based scaffold for biologic glenoid resurfacing is not new, the possibility of foreign body reaction as a source of persistent symptoms has not been described. Given the lack of data to indicate an advantage to biologic resurfacing of the glenoid over hemiarthroplasty alone, resurfacing should not introduce significant additional surgical complications. We suggest foreign body reaction be considered in the differential diagnosis for a persistently painful shoulder after biologic glenoid resurfacing using an acellular allograft patch.
Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.
1958-04-29
An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.
Yang, Chae Eun; Kim, Soo Jung; Kim, Ji Hee; Lee, Ju Hee; Roh, Tai Suk; Lee, Won Jai
2018-02-01
Asian noses are relatively small and flat compared to Caucasians; therefore, rhinoplasty procedures often focus on dorsal augmentation and tip projection rather than reduction in the nasal framework. Various autologous and alloplastic implant materials have been used for dorsal augmentation. Recently, human acellular dermal matrices have been introduced as an implant material for dorsal augmentation, camouflaging autologous implants without an additional donor site. Here, we introduce a cross-linked human acellular dermal matrix as an implant material in augmentation rhinoplasty and share the clinical experiences. Eighteen patients who underwent augmentation rhinoplasty using acellular dermal matrix from April 2014 to November 2015 were reviewed retrospectively. Clinical outcomes and complications were assessed at the outpatient clinic during the follow-up period ranging from 8 to 38 months. Contour changes were assessed through comparison of preoperative and postoperative photographs by two independent plastic surgeons. Patient satisfaction was assessed at the outpatient clinic by six questions regarding aesthetic and functional aspects. Postoperative photographs demonstrated the height of the nasal dorsum did not decrease over time except two patients whose ADM was grafted into a subperiosteal pocket. Others who underwent supraperiosteal implantation showed acceptable maintenance of dorsal height. No major complication was reported. Overall, patient satisfaction scored 81.02 out of 100. Cross-linked human ADM has advantages of both autogenous and alloplastic materials. The surgical results remain stable without complications. Therefore, it is a suitable alternative implant material for dorsal augmentation in rhinoplasty. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
THE DURABILITY OF LARGE-SCALE ADDITIVE MANUFACTURING COMPOSITE MOLDS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian K; Love, Lonnie J; Duty, Chad
2016-01-01
Oak Ridge National Laboratory s Big Area Additive Manufacturing (BAAM) technology permits the rapid production of thermoplastic composite molds using a carbon fiber filled Acrylonitrile-Butadiene-Styrene (ABS) thermoplastic. Demonstration tools (i.e. 0.965 m X 0.559 m X 0.152 m) for composite part fabrication have been printed, coated, and finished with a traditional tooling gel. We present validation results demonstrating the stability of thermoplastic printed molds for room temperature Vacuum Assisted Resin Transfer Molding (VARTM) processes. Arkema s Elium thermoplastic resin was investigated with a variety of reinforcement materials. Experimental results include dimensional characterization of the tool surface using laser scanning techniquemore » following demolding of 10 parts. Thermoplastic composite molds offer rapid production compared to traditionally built thermoset molds in that near-net deposition allows direct digital production of the net geometry at production rate of 45 kg/hr.« less
Additive Manufacturing of Molds for Fabrication of Insulated Concrete Block
DOE Office of Scientific and Technical Information (OSTI.GOV)
Love, Lonnie J.; Lloyd, Peter D.
ORNL worked with concrete block manufacturer, NRG Insulated Block, to demonstrate additive manufacturing of a multi-component block mold for its line of insulated blocks. Solid models of the mold parts were constructed from existing two-dimensional drawings and the parts were fabricated on a Stratasys Fortus 900 using ULTEM 9085. Block mold parts were delivered to NRG and installed on one of their fabrication lines. While form and fit were acceptable, the molds failed to function during NRG’s testing.
de Souza, Sérgio Luís Scombatti; Novaes, Arthur Belém; Grisi, Daniela Corrêa; Taba, Mário; Grisi, Márcio Fernando de Moraes; de Andrade, Patrícia Freitas
2008-07-01
Different techniques have been proposed for the treatment of gingival recession. This study compared the clinical results of gingival recession treatment using a subepithelial connective tissue graft and an acellular dermal matrix allograft. Seven patients with bilateral Miller class I or II gingival recession were selected. Twenty-six recessions were treated and randomly assigned to the test group. In each case the contralateral recession was assigned to the control group. In the control group, a connective tissue graft in combination with a coronally positioned flap was used; in the test group, an acellular dermal matrix allograft was used as a substitute for palatal donor tissue. Probing depth, clinical attachment level, gingival recession, and width of keratinized tissue were measured two weeks prior to surgery and at six and 12 months post-surgery. There were no statistically significant differences between the groups in terms of recession reduction, clinical attachment gain, probing pocket depth, and increase in the width of the keratinized tissue after six or 12 months. There was no statistically significant increase in the width of keratinized tissue between six and 12 months for either group. Within the limitations of this study, it can be suggested that the acellular dermal matrix allograft may be a substitute for palatal donor tissue in root coverage procedures and that the time required for additional gain in the amount of keratinized tissue may be greater for the acellular dermal matrix than for the connective tissue procedures.
75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-10
...] Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal Emergency Management Agency, DHS. ACTION... accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation. DATES: Comments must be received by... 20472-3100. II. Background The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses...
NASA Astrophysics Data System (ADS)
Yoon, Dae-Woo; Cho, Jung-Wook; Kim, Seon-Hyo
2017-08-01
The present study proposes a countermeasure for regulating total heat flux through the mold flux layer by designed mold flux with additive metallic iron particles. The heat flux through the B2O3-CaO-SiO2-Na2O-CaF2-Fe system was investigated using the infrared emitter technique to evaluate total flux density across the mold flux film. Both scanning electron microscope (SEM) and X-ray diffraction analysis were employed in order to identify the morphological and compositional changes of the crystalline phase, according to increasing iron contents in the mold flux. It was confirmed that the crystalline layer of studied mold fluxes does not have a meaningful effect on the total heat flux density due to the similar structure and fraction of the crystalline phase. The extinction coefficient was measured for glassy mold fluxes using an ultraviolet/visible and a Fourier transformation-infrared ray spectrometer in the range of 0.5 to 5 μm. For analyzing the scattering behavior of iron particles on the extinction coefficient, the number density and diameter of particles were observed by an automated SEM (auto-SEM). With these data, Mie scattering theory is adopted to define the scattering behavior of dispersed iron droplets in glassy matrix. It was found that the theoretical scattering coefficient demonstrated about 1623 to 3295 m-1, which is in accordance with the experimental results. In doing so, this study successfully achieves the strong scattering behavior that would contribute greatly to the optimization of overall heat flux through the mold flux film during the casting process.
Cheng, Hai-Ling Margaret; Loai, Yasir; Beaumont, Marine; Farhat, Walid A
2010-08-01
Bladder acellular matrices (ACMs) derived from natural tissue are gaining increasing attention for their role in tissue engineering and regeneration. Unlike conventional scaffolds based on biodegradable polymers or gels, ACMs possess native biomechanical and many acquired biologic properties. Efforts to optimize ACM-based scaffolds are ongoing and would be greatly assisted by a noninvasive means to characterize scaffold properties and monitor interaction with cells. MRI is well suited to this role, but research with MRI for scaffold characterization has been limited. This study presents initial results from quantitative MRI measurements for bladder ACM characterization and investigates the effects of incorporating hyaluronic acid, a natural biomaterial useful in tissue-engineering and regeneration. Measured MR relaxation times (T(1), T(2)) and diffusion coefficient were consistent with increased water uptake and glycosaminoglycan content observed on biochemistry in hyaluronic acid ACMs. Multicomponent MRI provided greater specificity, with diffusion data showing an acellular environment and T(2) components distinguishing the separate effects of increased glycosaminoglycans and hydration. These results suggest that quantitative MRI may provide useful information on matrix composition and structure, which is valuable in guiding further development using bladder ACMs for organ regeneration and in strategies involving the use of hyaluronic acid.
Crack-resistant siloxane molding compounds. [Patent application
McFarland, J.W.; Swearngin, C.B.
1980-11-03
The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.
Method and mold for casting thin metal objects
Pehrson, Brandon P; Moore, Alan F
2014-04-29
Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.
Progress in Titanium Metal Powder Injection Molding.
German, Randall M
2013-08-20
Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied-density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors.
Progress in Titanium Metal Powder Injection Molding
German, Randall M.
2013-01-01
Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied—density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors. PMID:28811458
Epidemics of mold poisoning past and present.
Meggs, William J
2009-01-01
Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.
Index change of chalcogenide materials from precision glass molding processes
NASA Astrophysics Data System (ADS)
Deegan, J.; Walsh, K.; Lindberg, G.; Benson, R.; Gibson, D.; Bayya, S.; Sanghera, J.; Stover, E.
2015-05-01
With the increase in demand for infrared optics for thermal applications and the use of glass molding of chalcogenide materials to support these higher volume optical designs, an investigation of changes to the optical properties of these materials is required. Typical precision glass molding requires specific thermal conditions for proper lens molding of any type of optical glass. With these conditions a change (reduction) of optical index occurs after molding of all oxide glass types and it is presumed that a similar behavior will happen with chalcogenide based materials. We will discuss the effects of a typical molding thermal cycle for use with commercially and newly developed chalcogenide materials and show results of index variation from nominally established material data.
Onychomycosis due to opportunistic molds*
Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto
2015-01-01
BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862
Low Cost Injection Mold Creation via Hybrid Additive and Conventional Manufacturing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dehoff, Ryan R.; Watkins, Thomas R.; List, III, Frederick Alyious
2015-12-01
The purpose of the proposed project between Cummins and ORNL is to significantly reduce the cost of the tooling (machining and materials) required to create injection molds to make plastic components. Presently, the high cost of this tooling forces the design decision to make cast aluminum parts because Cummins typical production volumes are too low to allow injection molded plastic parts to be cost effective with the amortized cost of the injection molding tooling. In addition to reducing the weight of components, polymer injection molding allows the opportunity for the alternative cooling methods, via nitrogen gas. Nitrogen gas cooling offersmore » an environmentally and economically attractive cooling option, if the mold can be manufactured economically. In this project, a current injection molding design was optimized for cooling using nitrogen gas. The various components of the injection mold tooling were fabricated using the Renishaw powder bed laser additive manufacturing technology. Subsequent machining was performed on the as deposited components to form a working assembly. The injection mold is scheduled to be tested in a projection setting at a commercial vendor selected by Cummins.« less
Diagnosis of mold allergy by RAST and skin prick testing.
Nordvall, S L; Agrell, B; Malling, H J; Dreborg, S
1990-11-01
Sera from 33 patients with mold allergy proven by bronchial provocation were analyzed for specific IgE against six mold species comparing an improved Phadebas RAST with four other techniques. The new method was more sensitive and gave significantly higher IgE antibody concentrations for all tested molds except Cladosporium herbarum.
Investigation of micro-injection molding based on longitudinal ultrasonic vibration core.
Qiu, Zhongjun; Yang, Xue; Zheng, Hui; Gao, Shan; Fang, Fengzhou
2015-10-01
An ultrasound-assisted micro-injection molding method is proposed to improve the rheological behavior of the polymer melt radically, and a micro-injection molding system based on a longitudinal ultrasonic vibration core is developed and employed in the micro-injection molding process of Fresnel lenses. The verification experiments show that the filling mold area of the polymer melt is increased by 6.08% to 19.12%, and the symmetric deviation of the Fresnel lens is improved 15.62% on average. This method improved the filling performance and replication quality of the polymer melt in the injection molding process effectively.
Design and Checking Analysis of Injection Mold for a Plastic Cup
NASA Astrophysics Data System (ADS)
Li, Xuebing
2018-03-01
A special injection mold was designed for the structural characteristics of a plastic cup part. The mold was simulated by Moldflow software and verified by calculating the stripping force, the pulling force and the clamping force of the mold so that to determine the appropriate injection parameters. It has been proved that the injection mold is effective and practical in the actual producing and can meet the quality requirements during the course of using it, which solved some problems for injection molding of this kind of parts and can provide some reference for the production of other products in the same industry.
Residual stresses in injection molded shape memory polymer parts
NASA Astrophysics Data System (ADS)
Katmer, Sukran; Esen, Huseyin; Karatas, Cetin
2016-03-01
Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.
Acellular pertussis vaccines for adolescents.
Pichichero, Michael E; Casey, Janet R
2005-06-01
The epidemiology of pertussis is changing, with a clear increase in the number of cases diagnosed in adolescents and adults. This development has spurred studies and anticipated licensure of safer diphtheria, tetanus, acellular pertussis combined (Tdap) vaccines for this older population. Literature review. Tdap vaccines are safe and immunogenic when administered to adolescents and adults. Correlates of immunity to pertussis after Tdap vaccination have not been established, but various combinations of antibody to pertussis antigens (pertussis toxin, filamentous hemagglutinin, pertactin, and fimbriae) provide protection. The importance of the number of antigens in Tdap vaccines for protection against mild pertussis disease is unclear. Pertussis vaccination establishes herd immunity after sufficient uptake within communities and countries. As experience with TdaP vaccines has accumulated, a 1-2% occurrence of large, local injection-site reactions with all TdaP vaccine products have been observed for booster doses in children 4-6 years of age. The frequency of large local reactions appears lower in adolescents and adults. The pathophysiologic mechanisms for the local reactions are not established, but a majority appears to be immunoglobulin E-mediated-reactive edema, and a minority appears to be immunoglobulin G-mediated Arthus-type reactions. Tdap vaccines appear safe and immunogenic. The economic impact of pertussis provides a cost-benefit justification for widespread use of Tdap vaccine boosting in adolescents.
NASA Astrophysics Data System (ADS)
Srinivasulu Reddy, K.; Venkata Reddy, Vajrala; Mandava, Ravi Kumar
2017-08-01
Chemically bonded no-bake molds and cores have good mechanical properties and produce dimensionally accurate castings compared to green sand molds. Poor collapsibility property of CO2 hardened sodium silicate bonded sand mold and phenolic urethane no-bake (PUN) binder system, made the reclamation of the sands more important. In the present work fine silica sand is mixed with phenolic urethane no-bake binder and the sand sets in a very short time within few minutes. In this paper it is focused on optimizing the process parameters of PUN binder based sand castings for better collapsibility and surface finish of gray cast iron using Taguchi design. The findings were successfully verified through experiments.
Molding apparatus. [for thermosetting plastic compositions
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1974-01-01
Apparatus for compression molding of thermosetting plastics compositions including interfitting hollow male and female components is reported. The components are adapted to be compressed to form a rocket nozzle in a cavity. A thermal jacket is provided exteriorly adjacent to the female component for circulating a thermal transfer fluid to effect curing of a thermosetting plastics material being molded. Each of the male and female components is provided with suitable inlets and outlets for circulating a thermal transfer fluid.
Ultrasonically-assisted Polymer Molding: An Evaluation
NASA Astrophysics Data System (ADS)
Moles, Matthew; Roy, Anish; Silberschmidt, Vadim
Energy reduction in extrusion and injection molding processes can be achieved by the introduction of ultrasonic energy. Polymer flow can be enhanced on application of ultrasonic vibration, which can reduce the thermal and pressure input requirements to produce the same molding; higher productivity may also be achieved. In this paper, a design of an ultrasound-assisted injection mold machine is explored. An extrusion-die design was augmented with a commercial 1.5 kW ultrasonic transducer and sonotrode designed to resonate close to 20 kHz with up to 100 μm vibration amplitude. The design was evaluated with modal and thermal analysis using finite-element analysis software. The use of numerical techniques, including computational fluid dynamics, fluid-structure interaction and coupled Lagrangian-Eulerian method, to predict the effect of ultrasound on polymer flow was considered. A sonotrode design utilizing ceramic to enhance thermal isolation was also explored.
Neonatal Ear Molding: Timing and Technique.
Anstadt, Erin Elizabeth; Johns, Dana Nicole; Kwok, Alvin Chi-Ming; Siddiqi, Faizi; Gociman, Barbu
2016-03-01
The incidence of auricular deformities is believed to be ∼11.5 per 10,000 births, excluding children with microtia. Although not life-threatening, auricular deformities can cause undue distress for patients and their families. Although surgical procedures have traditionally been used to reconstruct congenital auricular deformities, ear molding has been gaining acceptance as an efficacious, noninvasive alternative for the treatment of newborns with ear deformations. We present the successful correction of bilateral Stahl's ear deformity in a newborn through a straightforward, nonsurgical method implemented on the first day of life. The aim of this report is to make pediatric practitioners aware of an effective and simple molding technique appropriate for correction of congenital auricular anomalies. In addition, it stresses the importance of very early initiation of ear cartilage molding for achieving the desired outcome. Copyright © 2016 by the American Academy of Pediatrics.
METHOD FOR EVALUATING MOLD GROWTH ON CEILING TILE
A method to extract mold spores from porous ceiling tiles was developed using a masticator blender. Ceiling tiles were inoculated and analyzed using four species of mold. Statistical analysis comparing results obtained by masticator extraction and the swab method was performed. T...
Laser-Etched Designs for Molding Hydrogel-Based Engineered Tissues
Munarin, Fabiola; Kaiser, Nicholas J.; Kim, Tae Yun; Choi, Bum-Rak
2017-01-01
Rapid prototyping and fabrication of elastomeric molds for sterile culture of engineered tissues allow for the development of tissue geometries that can be tailored to different in vitro applications and customized as implantable scaffolds for regenerative medicine. Commercially available molds offer minimal capabilities for adaptation to unique conditions or applications versus those for which they are specifically designed. Here we describe a replica molding method for the design and fabrication of poly(dimethylsiloxane) (PDMS) molds from laser-etched acrylic negative masters with ∼0.2 mm resolution. Examples of the variety of mold shapes, sizes, and patterns obtained from laser-etched designs are provided. We use the patterned PDMS molds for producing and culturing engineered cardiac tissues with cardiomyocytes derived from human-induced pluripotent stem cells. We demonstrate that tight control over tissue morphology and anisotropy results in modulation of cell alignment and tissue-level conduction properties, including the appearance and elimination of reentrant arrhythmias, or circular electrical activation patterns. Techniques for handling engineered cardiac tissues during implantation in vivo in a rat model of myocardial infarction have been developed and are presented herein to facilitate development and adoption of surgical techniques for use with hydrogel-based engineered tissues. In summary, the method presented herein for engineered tissue mold generation is straightforward and low cost, enabling rapid design iteration and adaptation to a variety of applications in tissue engineering. Furthermore, the burden of equipment and expertise is low, allowing the technique to be accessible to all. PMID:28457187
Manufacture of mold of polymeric composite water pipe reinforced charcoal
NASA Astrophysics Data System (ADS)
Zulfikar; Misdawati; Idris, M.; Nasution, F. K.; Harahap, U. N.; Simanjuntak, R. K.; Jufrizal; Pranoto, S.
2018-03-01
In general, household wastewater pipelines currently use thermoplastic pipes of Polyvinyl Chloride (PVC). This material is known to be not high heat resistant, contains hazardous chemicals (toxins), relatively inhospitable, and relatively more expensive. Therefore, researchers make innovations utilizing natural materials in the form of wood charcoal as the basic material of making the water pipe. Making this pipe requires a simple mold design that can be worked in the scale of household and intermediate industries. This research aims to produce water pipe mold with simple design, easy to do, and making time relatively short. Some considerations for molding materials are weight of mold, ease of raw material, strong, sturdy, and able to cast. Pipe molds are grouped into 4 (four) main parts, including: outer diameter pipe molding, pipe inside diameter, pipe holder, and pipe alignment control. Some materials have been tested as raw materials for outer diameter of pipes, such as wood, iron / steel, cement, and thermoset. The best results are obtained on thermoset material, where the process of disassembling is easier and the resulting mold weight is relatively lighter. For the inside diameter of the pipe is used stainless steel, because in addition to be resistant to chemical processes that occur, in this part of the mold must hold the press load due to shrinkage of raw materials of the pipe during the process of hardening (polymerization). Therefore, it needs high pressure resistant material and does not blend with the raw material of the pipe. The base of the mold is made of stainless steel material because it must be resistant to corrosion due to chemical processes. As for the adjustment of the pipe is made of ST 37 carbon steel, because its function is only as a regulator of the alignment of the pipe structure.
Zhu, Changlai; Huang, Jing; Xue, Chengbin; Wang, Yaxian; Wang, Shengran; Bao, Shuangxi; Chen, Ruyue; Li, Yuan; Gu, Yun
2017-12-27
Extracellular/acellular matrix has been attracted much research interests for its unique biological characteristics, and ACM modified neural scaffolds shows the remarkable role of promoting peripheral nerve regeneration. In this study, skin-derived precursors pre-differentiated into Schwann cells (SKP-SCs) were used as parent cells to generate acellular(ACM) for constructing a ACM-modified neural scaffold. SKP-SCs were co-cultured with chitosan nerve guidance conduits (NGC) and silk fibroin filamentous fillers, followed by decellularization to stimulate ACM deposition. This NGC-based, SKP-SC-derived ACM-modified neural scaffold was used for bridging a 10 mm long rat sciatic nerve gap. Histological and functional evaluation after grafting demonstrated that regenerative outcomes achieved by this engineered neural scaffold were better than those achieved by a plain chitosan-silk fibroin scaffold, and suggested the benefits of SKP-SC-derived ACM for peripheral nerve repair. Copyright © 2017 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.
MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY
Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...
High rate fabrication of compression molded components
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.
2016-04-19
A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; andmore » applying molding pressure to the pre-form to form the composite component.« less
Fabrication of sinterable silicon nitride by injection molding
NASA Technical Reports Server (NTRS)
Quackenbush, C. L.; French, K.; Neil, J. T.
1982-01-01
Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.
Material flow data for numerical simulation of powder injection molding
NASA Astrophysics Data System (ADS)
Duretek, I.; Holzer, C.
2017-01-01
The powder injection molding (PIM) process is a cost efficient and important net-shape manufacturing process that is not completely understood. For the application of simulation programs for the powder injection molding process, apart from suitable physical models, exact material data and in particular knowledge of the flow behavior are essential in order to get precise numerical results. The flow processes of highly filled polymers are complex. Occurring effects are very hard to separate, like shear flow with yield stress, wall slip, elastic effects, etc. Furthermore, the occurrence of phase separation due to the multi-phase composition of compounds is quite probable. In this work, the flow behavior of a 316L stainless steel feedstock for powder injection molding was investigated. Additionally, the influence of pre-shearing on the flow behavior of PIM-feedstocks under practical conditions was examined and evaluated by a special PIM injection molding machine rheometer. In order to have a better understanding of key factors of PIM during the injection step, 3D non-isothermal numerical simulations were conducted with a commercial injection molding simulation software using experimental feedstock properties. The simulation results were compared with the experimental results. The mold filling studies amply illustrate the effect of mold temperature on the filling behavior during the mold filling stage. Moreover, the rheological measurements showed that at low shear rates no zero shear viscosity was observed, but instead the viscosity further increased strongly. This flow behavior could be described with the Cross-WLF approach with Herschel-Bulkley extension very well.
Soft lithography of ceramic microparts using wettability-tunable poly(dimethylsiloxane) (PDMS) molds
NASA Astrophysics Data System (ADS)
Su, Bo; Zhang, Aijun; Meng, Junhu; Zhang, Zhaozhu
2016-07-01
Green alumina microparts were fabricated from a high solid content aqueous suspension by microtransfer molding using air plasma-treated poly(dimethylsiloxane) (PDMS) molds. The wettability of the air plasma-treated PDMS molds spontaneously changed between the hydrophilic and hydrophobic states during the process. Initial hydrophilicity of the air plasma-treated PDMS molds significantly improved the flowability of the concentrated suspension. Subsequent hydrophobic recovery of the air plasma-treated PDMS molds enabled a perfect demolding of the green microparts. Consequently, defect-free microchannel parts of 60 μm and a micromixer with an area of several square centimeters were successfully fabricated. In soft lithography, tuning the wetting behavior of PDMS molds has a great effect on the quality of ceramic microparts. Using wettability-tunable PDMS molds has great potential in producing complex-shaped and large-area ceramic microparts and micropatterns.
Manufacturing Science of Improved Molded Optics
2013-12-05
Forrer, “Interaction of N-FK5 and L- BAL35 optical glass with various carbide and other precision glass mold tooling”, SPIE Optifab 2013 Conference...Richardson, S. Mourad, M. Huber, A. Kunz, M. Forrer. Interaction of N-FK5 and L-BAL35 optical glass with various carbide and other precision glass mold...stoichiometric compounds. As an example, if silicon and oxygen are present in a material, then it was assumed that they are present in the form of
BRIC-60: Biological Research in Canisters (BRIC)-60
NASA Technical Reports Server (NTRS)
Richards, Stephanie E. (Compiler); Levine, Howard G.; Romero, Vergel
2016-01-01
The Biological Research in Canisters (BRIC) is an anodized-aluminum cylinder used to provide passive stowage for investigations evaluating the effects of space flight on small organisms. Specimens flown in the BRIC 60 mm petri dish (BRIC-60) hardware include Lycoperscion esculentum (tomato), Arabidopsis thaliana (thale cress), Glycine max (soybean) seedlings, Physarum polycephalum (slime mold) cells, Pothetria dispar (gypsy moth) eggs and Ceratodon purpureus (moss).
Development of an Optical Disc Recorder
1977-02-01
sheet stock , the feasibil ity of ultrasonically joining the air sandwich components , the cost considerations of injection mold — ing the substrates, and...abou t 7.75 and 3.75) as expected for M iller modulation. Column i!4: Th e Slime ’ i n f o r m a t io n as given in Column 2 e-xcc ’~et th at tI;t
Oscillation of the velvet worm slime jet by passive hydrodynamic instability
Concha, Andrés; Mellado, Paula; Morera-Brenes, Bernal; Sampaio Costa, Cristiano; Mahadevan, L; Monge-Nájera, Julián
2015-01-01
The rapid squirt of a proteinaceous slime jet endows velvet worms (Onychophora) with a unique mechanism for defence from predators and for capturing prey by entangling them in a disordered web that immobilizes their target. However, to date, neither qualitative nor quantitative descriptions have been provided for this unique adaptation. Here we investigate the fast oscillatory motion of the oral papillae and the exiting liquid jet that oscillates with frequencies f~30–60 Hz. Using anatomical images, high-speed videography, theoretical analysis and a physical simulacrum, we show that this fast oscillatory motion is the result of an elastohydrodynamic instability driven by the interplay between the elasticity of oral papillae and the fast unsteady flow during squirting. Our results demonstrate how passive strategies can be cleverly harnessed by organisms, while suggesting future oscillating microfluidic devices, as well as novel ways for micro and nanofibre production using bioinspired strategies. PMID:25780995