Science.gov

Sample records for acentric chromosome fragments

  1. Centric rings, acentric rings and excess acentric fragments based on a random-walk interphase chromosome model

    NASA Technical Reports Server (NTRS)

    Wu, H.; Durante, M.; Sachs, R. K.; Yang, T. C.

    1997-01-01

    Excess acentric fragments, consisting of acentric rings and acentric linear fragments, are among the most frequent kinds of chromosome-type aberrations produced by radiation. The frequency of acentric rings cannot be obtained directly by experiment but is estimated here from the ratio of acentric to centric rings, evaluated using a random-walk model for the organization of chromatin during interphase and an assumption that the probability of an exchange formation is proportional to the rate of collision between two DSB. This ratio is calculated to be 2.5 in low-LET irradiated human fibroblasts, significantly greater than the ratio if proximity effects are not considered. The calculated frequency of acentric rings is insufficient to account for all the observed excess acentric fragments. Assuming that the rest of the excess acentric fragments are due to incomplete exchanges, all possible recombinations between two DSB that result in acentric rings and acentric linear fragments have been identified. From the chromosome aberration data, the incompleteness parameter has been estimated. Intra-arm chromosome exchanges, either complete or incomplete, were estimated to account for more than 50% of the excess acentric fragments in human fibroblasts.

  2. Formaldehyde-induced acentric chromosome fragments and chromosome stickiness in Chortophaga neuroblasts

    SciTech Connect

    Dowd, M.A.; Gaulden, M.E.; Proctor, B.L.; Seibert, G.B.

    1986-01-01

    Embryos of the grasshopper Chortophaga viridifasciata were exposed in vitro to formaldehyde (FA), as formalin, at concentrations ranging from 10/sup -8/ M (0.0003 ppm) to 10/sup -3/ M (30 ppm) at 38/sup 0/C. A low frequency of distinct acentric chromosome fragments was observed in the neuroblasts after 1 hr exposure to 7.5 x 10/sup -4/ or 10/sup -3/ M FA plus 3 hr recovery, but not at lower concentrations, even with 4 hr exposure. Neuroblasts with sticky chromosomes were observed at 10/sup -4/, 7.5 x 10/sup -4/, and 10/sup -3/ M FA, the percent of cells with slight, moderate, or severe stickiness varying with FA concentrations. Fragments were associated with the sticky chromosomes. It is concluded that the distinct acentric fragments induced by FA result from breakage at a single sticky point (slight stickiness) between separating sister chromatids. The chromosome effects observed probably result from the action of daughter products that are formed by the interaction of FA with culture medium components, especially the fetal calf serum.

  3. Chromosome aberrations produced by radiation: The relationship between excess acentric fragments and dicentrics

    SciTech Connect

    Hahnfeldt, P.; Hlatky, L.R.; Brenner, D.J.; Sachs, R.K.

    1995-02-01

    Most chromosome aberrations produced by ionizing radiation develop from DNA double-strand breaks (DSBs). Published date on the yield and variance of excess acentric fragments after in vitro irradiation of human lymphocytes were compared with corresponding data on dicentrics. At low LET the number of excess acentric fragments is about 60% of the number of dicentrics, independent of dose and perhaps of dose rate, suggesting that dicentrics and excess acentric fragments arise from similar kinetics rather than from fundamentally different reactions. Only a weak dependence of the ratio on LET is observed. These results are quantified using generalizations of models for pairwise DSB interactions suggested by Brewen and Brock based on data for marsupial cells. By allowing singly incomplete and some {open_quotes}doubly incomplete{close_quotes} exchanges, the models can also account for the experimental observation that the dispersion for excess acentric fragments, a measure of cell-to-cell variance, is systematically larger than the dispersion for dicentrics. Numerical estimates of an incompleteness parameter are derived. 47 refs., 8 figs., 4 tabs.

  4. Microtubule Flux Mediates Poleward Motion of Acentric Chromosome Fragments during Meiosis in Insect SpermatocytesV⃞

    PubMed Central

    LaFountain, James R.; Oldenbourg, Rudolf; Cole, Richard W.; Rieder, Conly L.

    2001-01-01

    We applied a combination of laser microsurgery and quantitative polarization microscopy to study kinetochore-independent forces that act on chromosome arms during meiosis in crane fly spermatocytes. When chromosome arms located within one of the half-spindles during prometa- or metaphase were cut with the laser, the acentric fragments (lacking kinetochores) that were generated moved poleward with velocities similar to those of anaphase chromosomes (∼0.5 μm/min). To determine the mechanism underlying this poleward motion of detached arms, we treated spermatocytes with the microtubule-stabilizing drug taxol. Spindles in taxol-treated cells were noticeably short, yet with polarized light, the distribution and densities of microtubules in domains where fragment movement occurred were not different from those in control cells. When acentric fragments were generated in taxol-treated spermatocytes, 22 of 24 fragments failed to exhibit poleward motion, and the two that did move had velocities attenuated by 80% (to ∼0.1 μm/min). In these cells, taxol did not inhibit the disjunction of chromosomes nor prevent their poleward segregation during anaphase, but the velocity of anaphase was also decreased 80% (∼0.1 μm/min) relative to untreated controls. Together, these data reveal that microtubule flux exerts pole-directed forces on chromosome arms during meiosis in crane fly spermatocytes and strongly suggest that the mechanism underlying microtubule flux also is used in the anaphase motion of kinetochores in these cells. PMID:11739800

  5. Acentric chromosome ends are prone to fusion with functional chromosome ends through a homology-directed rearrangement.

    PubMed

    Ohno, Yuko; Ogiyama, Yuki; Kubota, Yoshino; Kubo, Takuya; Ishii, Kojiro

    2016-01-01

    The centromeres of many eukaryotic chromosomes are established epigenetically on potentially variable tandem repeats; hence, these chromosomes are at risk of being acentric. We reported previously that artificially created acentric chromosomes in the fission yeast Schizosaccharomyces pombe can be rescued by end-to-end fusion with functional chromosomes. Here, we show that most acentric/functional chromosome fusion events in S. pombe cells harbouring an acentric chromosome I differed from the non-homologous end-joining-mediated rearrangements that result in deleterious dicentric fusions in normal cells, and were elicited by a previously unidentified homologous recombination (HR) event between chromosome end-associated sequences. The subtelomere repeats associated with the non-fusogenic ends were also destabilized in the surviving cells, suggesting a causal link between general subtelomere destabilization and acentric/functional chromosome fusion. A mutational analysis indicated that a non-canonical HR pathway was involved in the rearrangement. These findings are indicative of a latent mechanism that conditionally induces general subtelomere instability, presumably in the face of accidental centromere loss events, resulting in rescue of the fatal acentric chromosomes by interchromosomal HR.

  6. A stable acentric marker chromosome: Possible existence of an intercalary ancient centromere at distal 8p

    SciTech Connect

    Ohashi, Hirofumi; Fukushima, Yoshimitsu; Wakui, Keiko; Ogawa, Kioyshi; Okano, Tetsuroh; Niikawa, Norio

    1994-12-01

    A centromere is considered to be an essential chromosomal component where microtubule-kinetochore interaction occurs to segregate sister chromatids faithfully and acentric chromosomes are unstable and lost through cell divisions. We report a novel marker chromosome that was acentric but stable through cell divisions. The patient was a 2-year-old girl with mental retardation, patent ductus arteriosus, and mild dysmorphic features. G-banded chromosome analysis revealed that an additional small marker chromosome was observed in all 100 cells examined. By the reverse-chromosome-painting method, the marker was found to originate from the distal region of 8p, and a subsequent two-color FISH analysis with cosmid probes around the region revealed that the marker was an inverted duplication interpreted as 8pter {yields} p23.1::p23.1 {yields} 8pter. No centromeric region was involved in the marker. By FISH, no {alpha}-satellite sequence was detected on the marker, while a telomere sequence was detected at each end. Anti-kinetochore immunostaining, using a serum from a patient with CREST (calcinosis, Raynaud syndrome, esophageal dismotility, sclerodactyly, and telangiectasia) syndrome, showed a pair of signals on the marker, which indicated that a functional kinetochore was present on the marker. The analysis of this patient might suggest the possibility that an ancient centromere sequence exists at distal 8p (8p23.1-pter) and was activated through the chromosome rearrangement in the patient.

  7. Aurora B–mediated localized delays in nuclear envelope formation facilitate inclusion of late-segregating chromosome fragments

    PubMed Central

    Karg, Travis; Warecki, Brandt; Sullivan, William

    2015-01-01

    To determine how chromosome segregation is coordinated with nuclear envelope formation (NEF), we examined the dynamics of NEF in the presence of lagging acentric chromosomes in Drosophila neuroblasts. Acentric chromosomes often exhibit delayed but ultimately successful segregation and incorporation into daughter nuclei. However, it is unknown whether these late-segregating acentric fragments influence NEF to ensure their inclusion in daughter nuclei. Through live analysis, we show that acentric chromosomes induce highly localized delays in the reassembly of the nuclear envelope. These delays result in a gap in the nuclear envelope that facilitates the inclusion of lagging acentrics into telophase daughter nuclei. Localized delays of nuclear envelope reassembly require Aurora B kinase activity. In cells with reduced Aurora B activity, there is a decrease in the frequency of local nuclear envelope reassembly delays, resulting in an increase in the frequency of acentric-bearing, lamin-coated micronuclei. These studies reveal a novel role of Aurora B in maintaining genomic integrity by promoting the formation of a passageway in the nuclear envelope through which late-segregating acentric chromosomes enter the telophase daughter nucleus. PMID:25877868

  8. A stable acentric marker chromosome derived from distal 8p: Reactivation of a latent ancient centromere at 8p23.1?

    SciTech Connect

    Ohashi, H.; Wakui, K.; Ogawa, K.

    1994-09-01

    Centromere is considered to be an essential chromosomal component for faithful segregation, and acentric chromosomes are unstable and lost through cell divisions. We report a novel marker chromosome that was acentric but stable through cell divisions. The patient was a 2-year-old girl with mental retardation, patent ductus arteriosus and mild dysmorphic features. G-banded chromosome analysis revealed an additional small marker chromosome in all 100 cells examined. Using the targeted chromosome-band painting method, the marker was found to originate from the distal region of 8p, and subsequent two color FISH analysis with cosmid probes around the region revealed the marker was a rearranged chromosome interpreted as 8pter{r_arrow}p23.1{r_arrow}8pter. No centromeric region was involved in the marker. By FISH, no {alpha}-satellite sequence was detected on the marker, while telomere sequence was detected at each end. Antikinetochore immunostaining using a serum from a patient with CREST syndrome showed a pair of signals on the marker, which indicated that a functional kinetochore was present on the marker, presumably at 8p23.1-corresponding region. The patient may provide evidence that an ancient centromere sequence exists at 8p23.1 and was reactivated through the chromosome rearrangement in the patient.

  9. BubR1- and Polo-Coated DNA Tethers Facilitate Poleward Segregation of Acentric Chromatids

    PubMed Central

    Royou, Anne; Gagou, Mary E.; Karess, Roger; Sullivan, William

    2010-01-01

    Summary The mechanisms that safeguard cells against chromosomal instability (CIN) are of great interest, as CIN contributes to tumorigenesis. To gain insight into these mechanisms, we studied the behavior of cells entering mitosis with damaged chromosomes. We used the endonuclease I-CreI to generate acentric chromosomes in Drosophila larvae. While I-CreI expression produces acentric chromosomes in the majority of neuronal stem cells, remarkably, it has no effect on adult survival. Our live studies reveal that acentric chromatids segregate efficiently to opposite poles. The acentric chromatid poleward movement is mediated through DNA tethers decorated with BubR1, Polo, INCENP, and Aurora-B. Reduced BubR1 or Polo function results in abnormal segregation of acentric chromatids, a decrease in acentric chromosome tethering, and a great reduction in adult survival. We propose that BubR1 and Polo facilitate the accurate segregation of acentric chromatids by maintaining the integrity of the tethers that connect acentric chromosomes to their centric partners. PMID:20141837

  10. Widespread distribution of extensive chromosomal fragmentation in ciliates.

    PubMed

    Riley, J L; Katz, L A

    2001-07-01

    Ciliates are a diverse group of eukaryotes characterized by their division of nuclear function into a "germ line" micronucleus and a "somatic" macronucleus. After conjugation, chromosomes in the transcriptionally active macronucleus develop by fragmentation, elimination, and amplification of germ line chromosomes. Extensive chromosomal processing that generates a macronucleus with gene-sized fragments has thus far been well documented in members of only one class of ciliates, the Spirotrichea. Here we establish the broad distribution of extensive fragmentation among members of the class Phyllopharyngea and the genera Metopus (order Armophorida) and Nyctotherus (order Clevelandellida). Moreover, analyses of small-subunit rDNA genealogies indicate that gene-sized chromosomes occur in members of the three separate clades: (1) the class Spirotrichea, (2) the class Phyllopharyngea, and (3) the two orders Clevelandellida and Armophorida. Together, these data indicate that the generation of gene-sized chromosomes is widespread and demonstrate multiple origins of extensive fragmentation within ciliates.

  11. Comparison of mitotic cell death by chromosome fragmentation to premature chromosome condensation

    PubMed Central

    2010-01-01

    Mitotic cell death is an important form of cell death, particularly in cancer. Chromosome fragmentation is a major form of mitotic cell death which is identifiable during common cytogenetic analysis by its unique phenotype of progressively degraded chromosomes. This morphology however, can appear similar to the morphology of premature chromosome condensation (PCC) and thus, PCC has been at times confused with chromosome fragmentation. In this analysis the phenomena of chromosome fragmentation and PCC are reviewed and their similarities and differences are discussed in order to facilitate differentiation of the similar morphologies. Furthermore, chromosome pulverization, which has been used almost synonymously with PCC, is re-examined. Interestingly, many past reports of chromosome pulverization are identified here as chromosome fragmentation and not PCC. These reports describe broad ranging mechanisms of pulverization induction and agree with recent evidence showing chromosome fragmentation is a cellular response to stress. Finally, biological aspects of chromosome fragmentation are discussed, including its application as one form of non-clonal chromosome aberration (NCCA), the driving force of cancer evolution. PMID:20959006

  12. Characterization of chromosome fragmentation in two protozoans and identification of a candidate fragmentation sequence in Euplotes crassus.

    PubMed

    Baird, S E; Klobutcher, L A

    1989-05-01

    Following the sexual cycle, hypotrichous ciliated protozoans fragment a set of their micronuclear chromosomes to generate the thousands of short, linear DNA molecules present in the transcriptionally active macronucleus. We have used a hybrid selection procedure to examine macronuclear DNA molecules for subtelomeric length heterogeneity to determine whether chromosome fragmentation occurs at unique or multiple sites. The results suggest that multiple, but closely spaced, chromosome fragmentation sites are used by Oxytricha nova. In contrast, Euplotes crassus uses unique chromosome fragmentation sites in a reproducible manner to generate the ends of macronuclear DNA molecules. Additional studies compared DNA sequences in the vicinity of chromosome fragmentation sites in an attempt to define cis-acting sequences that direct the fragmentation process. A conserved sequence was found near chromosome fragmentation sites in E. crassus. The location of the conserved sequence suggests that chromosome fragmentation involves staggered cuts of the micronuclear DNA molecules.

  13. Chromosomal aberrations induced by in vitro irradiation: comparisons between human sperm and lymphocytes

    SciTech Connect

    Brandriff, B.F.; Gordon, L.A.; Ashworth, L.K.; Carrano, A.V.

    1988-01-01

    Types and frequencies of structural aberrations in human sperm and lymphocyte chromosomes from one donor were compared after in vitro irradiation with 100, 200, and 400 rad in order to determine if cells with dramatically different chromatin configurations are similarly affected and to investigate the feasibility of using lymphocytes as surrogates for germ cells in risk estimation. Sperm chromosomes were analyzed after fusion with eggs from the golden hamster. Total frequencies of induced aberrations were similar in the two cell types. However, the relative frequencies of rejoined lesions (dicentrics), compared with unrejoined lesions (chromosome breaks and acentric fragments), were different. At the three doses tested, a constant ratio of 5 dicentrics in lymphocytes for every dicentric in sperm was induced. Conversely, for every chromosome break or acentric fragment induced in lymphocytes, 1.7 such events were induced in sperm at the three doses tested.

  14. Diverse system stresses: common mechanisms of chromosome fragmentation

    PubMed Central

    Stevens, J B; Abdallah, B Y; Liu, G; Ye, C J; Horne, S D; Wang, G; Savasan, S; Shekhar, M; Krawetz, S A; Hüttemann, M; Tainsky, M A; Wu, G S; Xie, Y; Zhang, K; Heng, H H Q

    2011-01-01

    Chromosome fragmentation (C-Frag) is a newly identified MCD (mitotic cell death), distinct from apoptosis and MC (mitotic catastrophe). As different molecular mechanisms can induce C-Frag, we hypothesize that the general mechanism of its induction is a system response to cellular stress. A clear link between C-Frag and diverse system stresses generated from an array of molecular mechanisms is shown. Centrosome amplification, which is also linked to diverse mechanisms of stress, is shown to occur in association with C-Frag. This led to a new model showing that diverse stresses induce common, MCD. Specifically, different cellular stresses target the integral chromosomal machinery, leading to system instability and triggering of MCD by C-Frag. This model of stress-induced cell death is also applicable to other types of cell death. The current study solves the previously confusing relationship between the diverse molecular mechanisms of chromosome pulverization, suggesting that incomplete C-Frag could serve as the initial event responsible for forms of genome chaos including chromothripsis. In addition, multiple cell death types are shown to coexist with C-Frag and it is more dominant than apoptosis at lower drug concentrations. Together, this study suggests that cell death is a diverse group of highly heterogeneous events that are linked to stress-induced system instability and evolutionary potential. PMID:21716293

  15. Number and size of human X chromosome fragments transferred to mouse cells by chromosome-mediated gene transfer

    SciTech Connect

    Olsen, A.S.; McBride, O.W.; Moore, D.E.

    1981-05-01

    Labeled probes of unique-sequence human X chromosomal deoxyribonucleic acid, prepared by two different procedures, were used to measure the amount of human X chromosomal deoxyribonucleic acid in 12 mouse cell lines expressing human hypoxanthine phosphoribosyltransferase after chromosome-mediated gene transfer. The amount of X chromosomal deoxyribonucleic acid detected by this procedure ranged from undetectable levels in the three stable transformants and some unstable transformants examined to about 20% of the human X chromosome in two unstable transformants. Reassociation kinetics of the X chromosomal probe with deoxyribonucleic acid from the two unstable transformants containing 15 to 20% of the human X chromosome indicate that a single copy of these sequences is present. In one of these lines, the X chromosomal sequences exist as multiple fragments which were not concordantly segregated when the cells were selected for loss of hprt.

  16. Chromosome Fragments in DICTYOSTELIUM DISCOIDEUM Obtained from Parasexual Crosses between Strains of Different Genetic Background

    PubMed Central

    Williams, Keith L.; Robson, Gillian E.; Welker, Dennis L.

    1980-01-01

    The first aneuploid strains of Dictyostelium discoideum have been unambiguously characterized, using cytological and genetic analysis. Three independently isolated, but genetically similar, fragment chromosomes have been observed in segregants from diploids formed between haploid strains derived from the NC4 and V12 isolates of D. discoideum. Once generated, the fragment chromosomes, all of which have V12-derived centromeres, can be maintained in a NC4 genetic background. Genetic evidence is consistent with the view that all three fragment chromosomes studied encompass the region from the centromere to the whiA locus of linkage group II and terminate in the interval between whiA and acrA. From cytological studies, one of the fragment chromosomes consists of approximately half of linkage group II.—We observed no deleterious effect on viability or asexual fruiting-body formation in either haploid or diploid strains carrying an additional incomplete chromosome and hence are disomic or trisomic, respectively, for part of linkage group II. The incomplete chromosome is lost at a frequency of 2 to 3% from disomic and trisomic strains, but surprisingly this loss is not increased in the presence of the haploidizing agent, benlate. A new locus (clyA), whose phenotype is altered colony morphology, is assigned to the region of linkage group II encompassed by the fragment chromosome. PMID:17249037

  17. Conserved DNA sequences adjacent to chromosome fragmentation and telomere addition sites in Euplotes crassus.

    PubMed

    Klobutcher, L A; Gygax, S E; Podoloff, J D; Vermeesch, J R; Price, C M; Tebeau, C M; Jahn, C L

    1998-09-15

    During the formation of a new macronucleus in the ciliate Euplotes crassus, micronuclear chromosomes are reproducibly broken at approximately 10 000 sites. This chromosome fragmentation process is tightly coupled with de novo telomere synthesis by the telomerase ribonucleoprotein complex, generating short linear macronuclear DNA molecules. In this study, the sequences of 58 macronuclear DNA termini and eight regions of the micronuclear genome containing chromosome fragmentation/telomere addition sites were determined. Through a statistically based analysis of these data, along with previously published sequences, we have defined a 10 bp conserved sequence element (E-Cbs, 5'-HATTGAAaHH-3', H = A, C or T) near chromosome fragmentation sites. The E-Cbs typically resides within the DNA destined to form a macronuclear DNA molecule, but can also reside within flanking micronuclear DNA that is eliminated during macronuclear development. The location of the E-Cbs in macronuclear-destined versus flanking micronuclear DNA leads us to propose a model of chromosome fragmentation that involves a 6 bp staggered cut in the chromosome. The identification of adjacent macronuclear-destined sequences that overlap by 6 bp provides support for the model. Finally, our data provide evidence that telomerase is able to differentiate between newly generated ends that contain partial telomeric repeats and those that do not in vivo.

  18. Detection of chromosomal abnormalities in human sperm

    SciTech Connect

    Brandriff, B.; Gordon, L.; Ashworth, A.K.; Watchmaker, G.; Carrano, A.V.

    1985-06-19

    A new technology developed by Rudak, et al. for examining the chromosomal constitution of human sperm through fusion with eggs from the Syrian hamster was used to obtain baseline data on the types and frequencies of aberrations in sperm of normal men. The frequency of structural aberrations in 2724 sperm chromosome karyotypes from the 13 healthy non-exposed donors ranged from 2 to 15.8%, demonstrating significant interindividual variability. The most frequently occurring aberrations were chromosome breaks, followed by acentric fragments, chromatid exchanges, chromatid breaks, dicentrics and translocations, chromosome deletions and duplications, inversions, and chromatid deletions. Two donors previously reported had one cell each with multiple chromatid exchanges and breaks. In addition, the oldest donor, AA, had 5 cells out of 124 examined with multiple breaks and rearrangements too extensive to completely identify. 17 refs., 2 tabs.

  19. Developmentally regulated chromosome fragmentation linked to imprecise elimination of repeated sequences in paramecia.

    PubMed

    Le Mouël, Anne; Butler, Alain; Caron, François; Meyer, Eric

    2003-10-01

    The chromosomes of ciliates are fragmented at reproducible sites during the development of the polyploid somatic macronucleus, but the mechanisms involved appear to be quite diverse in different species. In Paramecium aurelia, the process is imprecise and results in de novo telomere addition at locally heterogeneous positions. To search for possible determinants of chromosome fragmentation, we have studied an approximately 21-kb fragmentation region from the germ line genome of P. primaurelia. The mapping and sequencing of alternative macronuclear versions of the region show that two distinct multicopy elements, a minisatellite and a degenerate transposon copy, are eliminated by an imprecise mechanism leading either to chromosome fragmentation and the formation of new telomeres or to the rejoining of flanking sequences. Heterogeneous internal deletions occur between short direct repeats containing TA dinucleotides. The complex rearrangement patterns produced vary slightly among genetically identical cell lines, show non-Mendelian inheritance during sexual reproduction, and can be experimentally modified by transformation of the maternal macronucleus with homologous sequences. These results suggest that chromosome fragmentation in Paramecium is the consequence of imprecise DNA elimination events that are distinct from the precise excision of single-copy internal eliminated sequences and that target multicopy germ line sequences by homology-dependent epigenetic mechanisms.

  20. Developmentally regulated chromosome fragmentation linked to imprecise elimination of repeated sequences in paramecia.

    PubMed

    Le Mouël, Anne; Butler, Alain; Caron, François; Meyer, Eric

    2003-10-01

    The chromosomes of ciliates are fragmented at reproducible sites during the development of the polyploid somatic macronucleus, but the mechanisms involved appear to be quite diverse in different species. In Paramecium aurelia, the process is imprecise and results in de novo telomere addition at locally heterogeneous positions. To search for possible determinants of chromosome fragmentation, we have studied an approximately 21-kb fragmentation region from the germ line genome of P. primaurelia. The mapping and sequencing of alternative macronuclear versions of the region show that two distinct multicopy elements, a minisatellite and a degenerate transposon copy, are eliminated by an imprecise mechanism leading either to chromosome fragmentation and the formation of new telomeres or to the rejoining of flanking sequences. Heterogeneous internal deletions occur between short direct repeats containing TA dinucleotides. The complex rearrangement patterns produced vary slightly among genetically identical cell lines, show non-Mendelian inheritance during sexual reproduction, and can be experimentally modified by transformation of the maternal macronucleus with homologous sequences. These results suggest that chromosome fragmentation in Paramecium is the consequence of imprecise DNA elimination events that are distinct from the precise excision of single-copy internal eliminated sequences and that target multicopy germ line sequences by homology-dependent epigenetic mechanisms. PMID:14555491

  1. Synthesis, structure, spectroscopic and ferroelectric properties of an acentric polyoxotungstate containing 1:2-type [Sm(α-PW₁₁O₃₉)₂]¹¹⁻ fragment and D-proline components.

    PubMed

    Liu, Yingjie; Li, Hailou; Zhang, Jingli; Zhao, Junwei; Chen, Lijuan

    2015-01-01

    An organic-inorganic hybrid mono-Sm(III) substituted phosphotungstate KNa3[HPro]₇[Sm(α-PW₁₁O₃₉)₂]·Pro·₁₈H₂O (1) (Pro=D-proline) has been synthesized in the conventional aqueous solution and structurally characterized by elemental analyses, inductively coupled plasma atomic emission spectrometry (ICP-AES) analyses, IR spectra, UV spectra, powder X-ray diffraction (PXRD), thermogravimetric analysis (TGA) and single-crystal X-ray diffraction. The molecule of 1 consists of a classical 1:2-type [Sm(α-PW₁₁O₃₉)₂](11-) fragment and free D-proline components. It should be pointed out that the synergistic action between the in-situ formed chiral [Sm(α-PW₁₁O₃₉)₂](11-) fragment and chiral D-proline components results in the formation of the chiral 1. The luminescence emission of 1 reveals three characteristic bands that derive from the (4)G₅/₂→(6)H₅/₂, (4)G₅/₂→(6)H₇/₂ and (4)G₅/₂→(6)H₉/₂ transitions of the Sm(III) cation as well as the synergistic contribution of the O→W transitions of [α-PW₁₁O₃₉](7-) moieties and a π(*)-n or π(*)-π transitions of Pro. Its ferroelectric behavior has been measured.

  2. Molecular Cytogenetic Mapping of Chromosomal Fragments and Immunostaining of Kinetochore Proteins in Beta

    PubMed Central

    Dechyeva, Daryna; Schmidt, Thomas

    2009-01-01

    By comparative multicolor FISH, we have physically mapped small chromosome fragments in the sugar beet addition lines PRO1 and PAT2 and analyzed the distribution of repetitive DNA families in species of the section Procumbentes of the genus Beta. Six repetitive probes were applied, including genotype-specific probes—satellites pTS4.1, pTS5, and pRp34 and a dispersed repeat pAp4, the telomere (TTTAGGG)n, and the conserved 18S-5.8S-25S rRNA genes. Pachytene-FISH analysis of the native centromere organization allowed proposing the origin of PRO1 and PAT2 fragments. Comparative analysis of the repetitive DNA distribution and organization in the wild beet and in the addition lines allowed the development of a physical model of the chromosomal fragments. Immunostaining revealed that the PRO1 chromosome fragment binds α-tubulin and the serine 10-phosphorylated histone H3 specific for the active centromere. This is the first experimental detection of the kinetochore proteins in Beta showing their active involvement in chromosome segregation in mitosis. PMID:19911065

  3. Molecular cytogenetic mapping of chromosomal fragments and immunostaining of kinetochore proteins in Beta.

    PubMed

    Dechyeva, Daryna; Schmidt, Thomas

    2009-01-01

    By comparative multicolor FISH, we have physically mapped small chromosome fragments in the sugar beet addition lines PRO1 and PAT2 and analyzed the distribution of repetitive DNA families in species of the section Procumbentes of the genus Beta. Six repetitive probes were applied, including genotype-specific probes-satellites pTS4.1, pTS5, and pRp34 and a dispersed repeat pAp4, the telomere (TTTAGGG)(n), and the conserved 18S-5.8S-25S rRNA genes. Pachytene-FISH analysis of the native centromere organization allowed proposing the origin of PRO1 and PAT2 fragments. Comparative analysis of the repetitive DNA distribution and organization in the wild beet and in the addition lines allowed the development of a physical model of the chromosomal fragments. Immunostaining revealed that the PRO1 chromosome fragment binds alpha-tubulin and the serine 10-phosphorylated histone H3 specific for the active centromere. This is the first experimental detection of the kinetochore proteins in Beta showing their active involvement in chromosome segregation in mitosis. PMID:19911065

  4. Noninvolvement of the X chromosome in radiation-induced chromosome translocations in the human lymphoblastoid cell line TK6

    SciTech Connect

    Jordan, R.; Schwartz, J.L. )

    1994-03-01

    Fluorescence in situ hybridization procedures were used to examine the influence of chromosome locus on the frequency and type of chromosome aberrations induced by [sup 60]Co [gamma] rays in the human lymphoblastoid cell line TK6. Aberrations involving the X chromosome were compared to those involving the similarly sized autosome chromosome 7. When corrected for DNA content, acentric fragments were induced with equal frequency in the X and 7 chromosomes. Dose-dependent increases in chromosomal interchanges involving chromosome 7 were noted, and the frequencies of balanced translocations and dicentrics produced were approximately equal. Chromosome interchanges involving the X chromosome were rare and showed no apparent dose dependence. Thus, while chromosomes 7 and X are equally sensitive to the induction of chromosome breaks, the X chromosome is much less likely to interact with autosomes than chromosome 7. The noninvolvement of the X chromosome in translocations with autosomes may reflect a more peripheral and separate location for the X chromosome in the mammalian nucleus. 20 refs., 2 figs., 1 tab.

  5. Introgression of a 4D chromosomal fragment into durum wheat confers aluminium tolerance

    PubMed Central

    Han, Chang; Ryan, Peter R.; Yan, ZeHong; Delhaize, Emmanuel

    2014-01-01

    Background and Aim Aluminium (Al3+) inhibits root growth of sensitive plant species and is a key factor that limits durum wheat (Triticum turgidum) production on acid soils. The aim of this study was to enhance the Al3+ tolerance of an elite durum cultivar by introgression of a chromosomal fragment from hexaploid wheat (Triticum aestivum) that possesses an Al3+ tolerance gene. Methods A 4D(4B) substitution line of durum wheat ‘Langdon’ was backcrossed to ‘Jandaroi’, a current semi-dwarf Australian durum. In the second backcross, using ‘Jandaroi’ as the recurrent parent, a seedling was identified where TaALMT1 on chromosome 4D was recombined with the Rht-B1b locus on chromosome 4B to yield an Al3+-tolerant seedling with a semi-dwarf habit. This seedling was used in a third backcross to generate homozygous sister lines with contrasting Al3+ tolerances. The backcrossed lines were characterized and compared with selected cultivars of hexaploid wheat for their Al3+ and Na+ tolerances in hydroponic culture as well as in short-term experiments to assess their growth on acid soil. Key Results Analysis of sister lines derived from the third backcross showed that the 4D chromosomal fragment substantially enhanced Al3+ tolerance. The ability to exclude Na+ from leaves was also enhanced, indicating that the chromosomal fragment possessed the Kna1 salt tolerance locus. Although Al3+ tolerance of seminal roots was enhanced in acid soil, the development of fine roots was not as robust as found in Al3+-tolerant lines of hexaploid wheat. Analysis of plant characteristics in the absence of Al3+ toxicity showed that the introgressed fragment did not affect total grain yield but reduced the weight of individual grains. Conclusions The results show that it is possible to increase substantially the Al3+ tolerance of an elite durum wheat cultivar by introgression of a 4D chromosomal fragment. Further improvements are possible, such as introducing additional genes to enhance

  6. Chromosome fragments possessing only one kinetochore can congress to the spindle equator.

    PubMed

    Khodjakov, A; Cole, R W; McEwen, B F; Buttle, K F; Rieder, C L

    1997-01-27

    We used laser microsurgery to cut between the two sister kinetochores on bioriented prometaphase chromosomes to produce two chromosome fragments containing one kinetochore (CF1K). Each of these CF1Ks then always moved toward the spindle pole to which their kinetochores were attached before initiating the poleward and away-from-the-pole oscillatory motions characteristic of monooriented chromosomes. CF1Ks then either: (a) remained closely associated with this pole until anaphase (50%), (b) moved (i.e., congressed) to the spindle equator (38%), where they usually (13/19 cells) remained stably positioned throughout the ensuing anaphase, or (c) reoriented and moved to the other pole (12%). Behavior of congressing CF1Ks was indistinguishable from that of congressing chromosomes containing two sister kinetochores. Three-dimensional electron microscopic tomographic reconstructions of CF1Ks stably positioned on the spindle equator during anaphase revealed that the single kinetochore was highly stretched and/or fragmented and that numerous microtubules derived from the opposing spindle poles terminated in its structure. These observations reveal that a single kinetochore is capable of simultaneously supporting the function of two sister kinetochores during chromosome congression and imply that vertebrate kinetochores consist of multiple domains whose motility states can be regulated independently.

  7. A Sex Chromosomal Restriction-Fragment-Length Marker Linked to Melanoma-Determining Tu Loci in Xiphophorus

    PubMed Central

    Schartl, M.

    1988-01-01

    In Xiphophorus, the causative genetic information for melanoma formation has been assigned by classical genetics to chromosomal loci, which are located on the sex chromosomes. In our attempts to molecularly clone these melanoma-determining loci, named Tu, we have looked for restriction-fragment-length markers (RFLMs) linked to the Tu loci. These RFLMs should be useful in obtaining a physical map of a Tu locus, which will aid in the cloning of the corresponding sequences. DNA samples from various Xiphophorus strains and hybrids including those bearing different Tu wild-type, deletion and translocation chromosomes, were screened for the presence of random RFLMs using homologous or heterologous sequences as hybridization probes. We find an EcoRI restriction fragment which shows limited crosshybridization to the v-erb B gene--but not representing the authentic c-erb B gene of Xiphophorus--to be polymorphic with respect to different sex chromosomes. Linkage analysis revealed that a 5-kb fragment is linked to the Tu-Sd locus on the X chromosome, a 7-kb fragment is linked to the Tu-Sr locus on the Y chromosome, both of Xiphophorus maculatus, and that a 12-kb fragment is linked to the Tu-Li locus on the X chromosome of Xiphophorus variatus. Using different chromosomal mutants this RFLM has been mapped to a frequent deletion/translocation breakpoint of the X chromosome, less than 0.3 cM apart from the Tu locus. PMID:2841190

  8. A sex chromosomal restriction-fragment-length marker linked to melanoma-determining Tu loci in Xiphophorus.

    PubMed

    Schartl, M

    1988-07-01

    In Xiphophorus, the causative genetic information for melanoma formation has been assigned by classical genetics to chromosomal loci, which are located on the sex chromosomes. In our attempts to molecularly clone these melanoma-determining loci, named Tu, we have looked for restriction-fragment-length markers (RFLMs) linked to the Tu loci. These RFLMs should be useful in obtaining a physical map of a Tu locus, which will aid in the cloning of the corresponding sequences. DNA samples from various Xiphophorus strains and hybrids including those bearing different Tu wild-type, deletion and translocation chromosomes, were screened for the presence of random RFLMs using homologous or heterologous sequences as hybridization probes. We find an EcoRI restriction fragment which shows limited crosshybridization to the v-erb B gene--but not representing the authentic c-erb B gene of Xiphophorus--to be polymorphic with respect to different sex chromosomes. Linkage analysis revealed that a 5-kb fragment is linked to the Tu-Sd locus on the X chromosome, a 7-kb fragment is linked to the Tu-Sr locus on the Y chromosome, both of Xiphophorus maculatus, and that a 12-kb fragment is linked to the Tu-Li locus on the X chromosome of Xiphophorus variatus. Using different chromosomal mutants this RFLM has been mapped to a frequent deletion/translocation breakpoint of the X chromosome, less than 0.3 cM apart from the Tu locus. PMID:2841190

  9. Chromosome aberrations induced by zebularine in triticale.

    PubMed

    Ma, Xuhui; Wang, Qing; Wang, Yanzhi; Ma, Jieyun; Wu, Nan; Ni, Shuang; Luo, Tengxiao; Zhuang, Lifang; Chu, Chenggen; Cho, Seong-Woo; Tsujimoto, Hisashi; Qi, Zengjun

    2016-07-01

    Chromosome engineering is an important approach for generating wheat germplasm. Efficient development of chromosome aberrations will facilitate the introgression and application of alien genes in wheat. In this study, zebularine, a DNA methylation transferase inhibitor, was successfully used to induce chromosome aberrations in the octoploid triticale cultivar Jinghui#1. Dry seeds were soaked in zebularine solutions (250, 500, and 750 μmol/L) for 24 h, and the 500 μmol/L treatment was tested in three additional treatment times, i.e., 12, 36, and 48 h. All treatments induced aberrations involving wheat and rye chromosomes. Of the 920 cells observed in 67 M1 plants, 340 (37.0%) carried 817 aberrations with an average of 0.89 aberrations per cell (range: 0-12). The aberrations included probable deletions, telosomes and acentric fragments (49.0%), large segmental translocations (28.9%), small segmental translocations (17.1%), intercalary translocations (2.6%), long chromosomes that could carry more than one centromere (2.0%), and ring chromosomes (0.5%). Of 510 M2 plants analyzed, 110 (21.6%) were found to carry stable aberrations. Such aberrations included 79 with varied rye chromosome numbers, 7 with wheat and rye chromosome translocations, 15 with possible rye telosomes/deletions, and 9 with complex aberrations involving variation in rye chromosome number and wheat-rye translocations. These indicated that aberrations induced by zebularine can be steadily transmitted, suggesting that zebularine is a new efficient agent for chromosome manipulation. PMID:27334255

  10. Fluorescent in situ hybridization with arbitrarily amplified DNA fragments differentiates carrot (Daucus carota L.) chromosomes.

    PubMed

    Nowicka, Anna; Grzebelus, Ewa; Grzebelus, Dariusz

    2012-03-01

    Carrot (Daucus carota L.) chromosomes are small and poorly differentiated in size and morphology. Here we demonstrate that fluorescent in situ hybridization (FISH) signals derived from arbitrary PCR probes can be used for chromosome identification in carrot. To prepare probes, we searched for nonpolymorphic products abundantly amplified with arbitrary decamer primers in a group of accessions representing carrot genetic diversity. As a result, 13 fragments ranging in size from 517 to 1758 bp were selected, sequenced, and used as probes for fluorescent in situ hybridization. Four of these probes produced clear and reproducible hybridization signals. The sequences showed similarity to a number of carrot BAC-end sequences, indicating their repetitive character. Three of them were similar to internal portions of gypsy and copia LTR retrotransposons previously identified in plants. Hybridization signals for the four probes were observed as dotted tracks on chromosomes, differing in distribution and intensity. Generally, they were present in pericentromeric and (or) interstitial localizations on chromosome arms. The use of the four probes allowed discrimination of chromosome pairs and construction of more detailed karyotypes and idiograms of carrot.

  11. Restriction fragment length polymorphism of C4 genes in mice with t chromosomes.

    PubMed

    Golubić, M; Figueroa, F; Tosi, M; Klein, J

    1985-01-01

    Genomic DNA was isolated from 29 t strains and 4 congenic lines of mice, digested with restriction endonucleases, and hybridized with a probe representing the complement component 4 (C4) gene. All but one of the enzymes revealed restriction fragment length polymorphism in this sample of C4-related genes. Double digestion analysis suggested the presence of three C4 gene copies in some of the t chromosomes and two copies in others. The enzymes distinguished 16 different haplotypes among the 33 strains tested. Based on their restriction fragment length patterns, the t strains could be divided into four groups with strains in each group more closely related to each other with respect to their C4-region genes than strains belonging to different groups. At least three of these four groups represent different branches of the evolutionary tree constructed for the t chromosomes. The C4-related genes of the chromosomes are in strong linkage disequilibrium with the class II genes of the H-2 complex. Typing for the Ss and Slp allotypes of C4 has revealed the presence of the Ss1 phenotype in two t strains and of the Slpa phenotype in one strain.

  12. Anomalous Separation of Small Y-Chromosomal DNA Fragments on Microchip Electrophoresis

    PubMed Central

    Jabasini, Mohammad; Ewis, Ashraf; Sato, Youichi; Nakahori, Yutaka; Baba, Yoshinobu

    2016-01-01

    We investigated an anomalous DNA separation where two DNA fragments from the human Y-chromosome sY638 (64 bp) and sY592 (65 bp), with only one base pair difference, were separated. This result is abnormal since in a previous study, we found that 5 bp was the minimum difference between two DNA fragments that the microchip electrophoresis system can separate. The formation of a mini-loop in the structure of the DNA fragment of sY638 (64 bp) was strongly expected to be the reason. To investigate this, we synthesized three modified DNA fragments for sY638 (64 bp), and the modifications were in two expected locations for possible mini-loop formation. Later, the separation between sY592 (65 bp) and the three modified fragments of sY638 (64 bp) was not possible. Thus, we conclude that the formation of a mini-loop in the structure of the DNA is the reason behind this anomalous separation.

  13. Chromosomal aneuploidies and DNA fragmentation of human spermatozoa from patients exposed to perfluorinated compounds.

    PubMed

    Governini, L; Guerranti, C; De Leo, V; Boschi, L; Luddi, A; Gori, M; Orvieto, R; Piomboni, P

    2015-11-01

    This study investigated chromosomal aneuploidies and DNA damage in spermatozoa from male patients contaminated by perfluorinated compounds (PFCs) in whole blood and seminal plasma. Sperm aneuploidy and diploidy rate for chromosomes 18, X and Y were evaluated by FISH; sperm DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling technique coupled to flow cytometry. Our results indicated that PFC contamination was present in 58% of subjects included in the study. A significant increase in alterations of sperm parameters was observed in PFC-positive subjects compared to PFC-negative subjects. As regards the sperm aneuploidy, both disomy and diploidy rates resulted significantly increased in subjects positive for PFC contamination compared to PFC-negative samples. In addition, sperm DNA fragmentation index resulted significantly increased in PFC-contaminated subjects compared to PFC-non-contaminated subjects, with a significant increased level of dimmer DNA fragmentation index. Our results clearly indicate that PFC contamination may detrimentally affect spermatogenesis, disturbing both meiotic segregation and DNA integrity. We could therefore suggest cautions to reduce or eliminate any contact with these compounds because the long-term effects of PFC accumulation in the body are not predictable.

  14. Schizophrenia-associated chromosome 11q21 translocation: Identification of flanking markers and development of chromosome 11q fragment hybrids as cloning and mapping resources

    SciTech Connect

    Fletcher, J.M.; Evans, K.; Baillie, D.; Byrd, P.; Hanratty, D.; Leach, S.; Gosden, J.R.; Muir, W.; Porteous, D.J.; St. Clair, D.; Heyningen, V. van ); Julier, C. )

    1993-03-01

    Genetic linkage, molecular analysis, and in situ hybridization have identified TYR and D11S388 as markers flanking the chromosome 11 breakpoint in a large pedigree where a balanced translocation, t(1;11)(q43;q21), segregates with schizophrenia and related affective disorders. Somatic cell hybrids, separating the two translocation chromosomes from each other and from the normal homologues, have been produced with the aid of immunomagnetic sorting for chromosome 1- and chromosome 11-encoded cell-surface antigens. The genes for two of these antigens map on either side of the 11q breakpoint. Immunomagnetic bead sorting was also used to isolate two stable X-irradiation hybrids for each cells-surface antigen. Each hybrid carriers only chromosome 11 fragments. Translocation and X-irradiation hybrids were analyzed, mainly by PCR, for the presence of 19 chromosome 11 and 4 chromosome 1 markers. Ten newly designed primers are reported. The X-irradiation hybrids were also studied cytogenetically, for human DNA content, by in situ Cot1 DNA hybridization and by painting the Alu-PCR products from these four lines back onto normal human metaphases. The generation of the translocation hybrids and of the chromosome 11q fragment hybrids is a necessary preliminary to determining whether a achizophrenia-predisposition gene SCZD2 is encoded at this site. 56 refs., 4 figs., 2 tabs.

  15. Paracentric inversions do not normally generate monocentric recombinant chromosomes

    SciTech Connect

    Sutherland, G.R.; Callen, D.F.; Gardner, R.J.M.

    1995-11-20

    Dr. Pettenati et al. recently reported a review of paracentric inversions in humans in which they concluded that carriers of these have a 3.8% risk of viable offspring with recombinant chromosomes. We are of the view that there are serious problems with this estimate which should be much closer to zero. The only recombinant chromosomes which can be generated by a paracentric inversion undergoing a normal meiotic division are dicentrics and acentric fragments. Only two such cases were found by Pettenati et al. Several of the alleged monocentric recombinants were originally reported as arising from parental insertions (3-break rearrangements) and it is not legitimate to include them in any analysis of paracentric inversions. Any monocentric recombinant chromosome can only arise from a paracentric inversion by some abnormal process which must involve chromatid breakage and reunion. 4 refs.

  16. Extensive fragmentation of the X chromosome in the bed bug Cimex lectularius Linnaeus, 1758 (Heteroptera, Cimicidae): a survey across Europe

    PubMed Central

    Sadílek, David; Šťáhlavský, František; Vilímová, Jitka; Zima, Jan

    2013-01-01

    Abstract Variation in the number of chromosomes was revealed in 61 samples of Cimex lectularius Linnaeus, 1758 from the Czech Republic and other European countries, hosted on Myotis Kaup, 1829 (4) and Homo sapiens Linnaeus, 1758 (57). The karyotype of all the specimens of Cimex lectularius analysed contained 26 autosomes and a varying number of the sex chromosomes. The number of sex chromosomes showed extensive variation, and up to 20 fragments were recorded. Altogether, 12 distinct karyotypes were distinguished. The male karyotypes consisted of 29, 30, 31, 32, 33, 34, 35, 36, 37, 40, 42 and 47 chromosomes. The females usually exhibited the number of chromosomes which was complementary to the number established in the males from the same sample. However, 11 polymorphic samples were revealed in which the karyotypes of females and males were not complementary each other. The complement with 2n = 26+X1X2Y was found in 44% of the specimens and 57,4% samples of bed bugs studied. The karyotypes with higher chromosome numbers as well as individuals with chromosomal mosaics were usually found within the samples exhibiting particularly extensive variation between individuals, and such complements were not found within samples contaning a few or single specimen. The occurrence of chromosomal mosaics with the karyotype constitution varying between cells of single individual was observed in five specimens (4.3%) from five samples. We assume that polymorphism caused by fragmentation of the X chromosome may result in meiotic problems and non-disjunction can produce unbalanced gametes and result in lowered fitness of individuals carrying higher numbers of the X chromosome fragments. This effect should be apparently enhanced with the increasing number of the fragments and this may be the reason for the observed distribution pattern of individual karyotypes in the studied samples and the rarity of individuals with extremely high chromosome numbers. The assumed lowering of the

  17. Extensive fragmentation of the X chromosome in the bed bug Cimex lectularius Linnaeus, 1758 (Heteroptera, Cimicidae): a survey across Europe.

    PubMed

    Sadílek, David; Sťáhlavský, František; Vilímová, Jitka; Zima, Jan

    2013-10-01

    Variation in the number of chromosomes was revealed in 61 samples of Cimex lectularius Linnaeus, 1758 from the Czech Republic and other European countries, hosted on Myotis Kaup, 1829 (4) and Homo sapiens Linnaeus, 1758 (57). The karyotype of all the specimens of Cimex lectularius analysed contained 26 autosomes and a varying number of the sex chromosomes. The number of sex chromosomes showed extensive variation, and up to 20 fragments were recorded. Altogether, 12 distinct karyotypes were distinguished. The male karyotypes consisted of 29, 30, 31, 32, 33, 34, 35, 36, 37, 40, 42 and 47 chromosomes. The females usually exhibited the number of chromosomes which was complementary to the number established in the males from the same sample. However, 11 polymorphic samples were revealed in which the karyotypes of females and males were not complementary each other. The complement with 2n = 26+X1X2Y was found in 44% of the specimens and 57,4% samples of bed bugs studied. The karyotypes with higher chromosome numbers as well as individuals with chromosomal mosaics were usually found within the samples exhibiting particularly extensive variation between individuals, and such complements were not found within samples contaning a few or single specimen. The occurrence of chromosomal mosaics with the karyotype constitution varying between cells of single individual was observed in five specimens (4.3%) from five samples. We assume that polymorphism caused by fragmentation of the X chromosome may result in meiotic problems and non-disjunction can produce unbalanced gametes and result in lowered fitness of individuals carrying higher numbers of the X chromosome fragments. This effect should be apparently enhanced with the increasing number of the fragments and this may be the reason for the observed distribution pattern of individual karyotypes in the studied samples and the rarity of individuals with extremely high chromosome numbers. The assumed lowering of the fitness of

  18. Chromosomal Fragmentation in "Escherichia Coli": Its Absence in "mutT" Mutants and Its Mechanisms in "seqA" Mutants

    ERIC Educational Resources Information Center

    Rotman, Ella Rose

    2009-01-01

    Chromosomal fragmentation in "Escherichia coli" is a lethal event for the cell unless mended by the recombinational repair proteins RecA, RecBCD, and RuvABC. Certain mutations exacerbate problems that cause the cell to be dependent on the recombinational repair proteins for viability. We tested whether the absence of the MutT protein caused…

  19. [Nonhomologous mechanisms of repair of chromosomal breaks]. Progress report

    SciTech Connect

    Haber, J.E.

    1993-09-01

    Broken chromosomes must either be repaired or lost. The break separates part of the chromosome, containing a telomere, from the rest, containing a centromere. While the centromerecontaining fragment can properly segregate, the broken end will be progressively degraded. The acentric fragment cannot segregate and will also be degraded. We have centered our attention on two alternative non-homologous mechanisms of repair: (1) the acquisition of a new telomere, and (2) repair of broken chromosomes by non-homologous joining of broken chromosome ends. In both cases, we create a double-strand break at a defined chromosomal location in yeast cells. The break is created by the site-specific HO endonuclease in cells that carry the rad52 mutation to prevent repair of a double-strand break by homologous recombination. In diploid cells, we can recover cells that contain a terminally deleted, healed chromosome that has acquired a new telomere. In haploid cells, we can recover cells in which the double-strand break has been repaired by rejoining the broken ends, usually accompanied by a deletion.

  20. The impact of homologous recombination repair deficiency on depleted uranium clastogenicity in Chinese hamster ovary cells: XRCC3 protects cells from chromosome aberrations, but increases chromosome fragmentation.

    PubMed

    Holmes, Amie L; Joyce, Kellie; Xie, Hong; Falank, Carolyne; Hinz, John M; Wise, John Pierce

    2014-04-01

    Depleted uranium (DU) is extensively used in both industry and military applications. The potential for civilian and military personnel exposure to DU is rising, but there are limited data on the potential health hazards of DU exposure. Previous laboratory research indicates DU is a potential carcinogen, but epidemiological studies remain inconclusive. DU is genotoxic, inducing DNA double strand breaks, chromosome damage and mutations, but the mechanisms of genotoxicity or repair pathways involved in protecting cells against DU-induced damage remain unknown. The purpose of this study was to investigate the effects of homologous recombination repair deficiency on DU-induced genotoxicity using RAD51D and XRCC3-deficient Chinese hamster ovary (CHO) cell lines. Cells deficient in XRCC3 (irs1SF) exhibited similar cytotoxicity after DU exposure compared to wild-type (AA8) and XRCC3-complemented (1SFwt8) cells, but DU induced more break-type and fusion-type lesions in XRCC3-deficient cells compared to wild-type and XRCC3-complemented cells. Surprisingly, loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. DU induced selective X-chromosome fragmentation irrespective of RAD51D status, but loss of XRCC3 nearly eliminated fragmentation observed after DU exposure in wild-type and XRCC3-complemented cells. Thus, XRCC3, but not RAD51D, protects cells from DU-induced breaks and fusions and also plays a role in DU-induced chromosome fragmentation. PMID:24561002

  1. Analysis of spontaneous chromosomal rearrangements in neuroblasts of genetically unstable mutant lines of Drosophila melanogaster

    SciTech Connect

    Derzhavets, E.M.; Kim, A.I.; Aslanyan, M.M.

    1988-11-01

    The spectrum and frequency of chromosomal aberrations in the somatic cells of III instar larvae of Drosophila melanogaster mutator line were studied using three of its derivatives (sbt, if, and w/sup a/) and line w as control. It has been demonstrated that the frequency of anaphases with bridges and acentric fragments increases in the neuroblast of flies of the mutator line as well as in the neuroblasts of the larvae of the lines sbt, if, and w/sup a/. The metaphase analysis revealed that the mutator line and its derivatives are characterized by higher frequencies of chromosomal aberrations as compared to the control. Chromatid breaks are predominant type of rearrangements. These results, suggest probably presence of the specific mutator factor or factors in the line studied, affecting chromosomal structure and, possibly, activating migration of the mobile genetic elements in the mutator line.

  2. A DNA Fragment Mapped within the Submicroscopic Deletion of Ph1, a Chromosome Pairing Regulator Gene in Polyploid Wheat

    PubMed Central

    Gill, K. S.; Gill, B. S.

    1991-01-01

    Bread wheat is an allohexaploid consisting of three genetically related (homoeologous) genomes. The homoeologous chromosomes are capable of pairing but strict homologous pairing is observed at metaphase 1. The diploid-like pairing is regulated predominantly by Ph1, a gene mapped on long arm of chromosome 5B. We report direct evidence that a mutant of the gene (ph1b) arose from a submicroscopic deletion. A probe (XksuS1-5) detects the same missing fragment in two independent mutants ph1b and ph1c and a higher intensity fragment in a duplication of the Ph1 gene. It is likely that XksuS1-5 lies adjacent to Ph1 on the same chromosome fragment that is deleted in ph1b and ph1c. XksuS1-5 can be used to tag Ph1 gene to facilitate incorporation of genetic material from homoeologous genomes of the Triticeae. It may also be a useful marker in cloning Ph1 gene by chromosome walking. PMID:1936962

  3. Cyanide enhances hydrogen peroxide toxicity by recruiting endogenous iron to trigger catastrophic chromosomal fragmentation

    PubMed Central

    Mahaseth, Tulip; Kuzminov, Andrei

    2015-01-01

    Hydrogen peroxide (HP) or cyanide (CN) are bacteriostatic at low-millimolar concentrations for growing Escherichia coli, whereas CN+HP mixture is strongly bactericidal. We show that this synergistic toxicity is associated with catastrophic chromosomal fragmentation. Since CN-alone does not kill at any concentration, while HP-alone kills at 20 mM, CN must potentiate HP poisoning. The CN+HP killing is blocked by iron chelators, suggesting Fenton’s reaction. Indeed, we show that CN enhances plasmid DNA relaxation due to Fenton’s reaction in vitro. However, mutants with elevated iron or HP pools are not acutely sensitive to HP-alone treatment, suggesting that, in addition, in vivo CN recruits iron from intracellular depots. We found that part of the CN-recruited iron pool is managed by ferritin and Dps: ferritin releases iron on cue from CN, while Dps sequesters it, quelling Fenton’s reaction. We propose that disrupting intracellular iron trafficking is a common strategy employed by the immune system to kill microbes. PMID:25598241

  4. Cyanide enhances hydrogen peroxide toxicity by recruiting endogenous iron to trigger catastrophic chromosomal fragmentation.

    PubMed

    Mahaseth, Tulip; Kuzminov, Andrei

    2015-04-01

    Hydrogen peroxide (HP) or cyanide (CN) are bacteriostatic at low-millimolar concentrations for growing Escherichia coli, whereas CN + HP mixture is strongly bactericidal. We show that this synergistic toxicity is associated with catastrophic chromosomal fragmentation. Since CN alone does not kill at any concentration, while HP alone kills at 20 mM, CN must potentiate HP poisoning. The CN + HP killing is blocked by iron chelators, suggesting Fenton's reaction. Indeed, we show that CN enhances plasmid DNA relaxation due to Fenton's reaction in vitro. However, mutants with elevated iron or HP pools are not acutely sensitive to HP-alone treatment, suggesting that, in addition, in vivo CN recruits iron from intracellular depots. We found that part of the CN-recruited iron pool is managed by ferritin and Dps: ferritin releases iron on cue from CN, while Dps sequesters it, quelling Fenton's reaction. We propose that disrupting intracellular iron trafficking is a common strategy employed by the immune system to kill microbes. PMID:25598241

  5. Cyanide enhances hydrogen peroxide toxicity by recruiting endogenous iron to trigger catastrophic chromosomal fragmentation.

    PubMed

    Mahaseth, Tulip; Kuzminov, Andrei

    2015-04-01

    Hydrogen peroxide (HP) or cyanide (CN) are bacteriostatic at low-millimolar concentrations for growing Escherichia coli, whereas CN + HP mixture is strongly bactericidal. We show that this synergistic toxicity is associated with catastrophic chromosomal fragmentation. Since CN alone does not kill at any concentration, while HP alone kills at 20 mM, CN must potentiate HP poisoning. The CN + HP killing is blocked by iron chelators, suggesting Fenton's reaction. Indeed, we show that CN enhances plasmid DNA relaxation due to Fenton's reaction in vitro. However, mutants with elevated iron or HP pools are not acutely sensitive to HP-alone treatment, suggesting that, in addition, in vivo CN recruits iron from intracellular depots. We found that part of the CN-recruited iron pool is managed by ferritin and Dps: ferritin releases iron on cue from CN, while Dps sequesters it, quelling Fenton's reaction. We propose that disrupting intracellular iron trafficking is a common strategy employed by the immune system to kill microbes.

  6. Chromosomal mosaicism in mouse two-cell embryos after paternal exposure to acrylamide

    SciTech Connect

    Marchetti, Francesco; Bishop, Jack; Lowe, Xiu; Wyrobek, Andrew J

    2008-10-14

    Chromosomal mosaicism in human preimplantation embryos is a common cause ofspontaneous abortions, however, our knowledge of its etiology is limited. We used multicolor fluorescence in situ hybridization (FISH) painting to investigate whether paternally-transmitted chromosomal aberrations result in mosaicism in mouse 2-cell embryos. Paternal exposure to acrylamide, an important industrial chemical also found in tobacco smoke and generated during the cooking process of starchy foods, produced significant increases in chromosomally defective 2-cell embryos, however, the effects were transient primarily affecting the postmeiotic stages of spermatogenesis. Comparisons with our previous study of zygotes demonstrated similar frequencies of chromosomally abnormal zygotes and 2-cell embryos suggesting that there was no apparent selection against numerical or structural chromosomal aberrations. However, the majority of affected 2-cell embryos were mosaics showing different chromosomal abnormalities in the two blastomeric metaphases. Analyses of chromosomal aberrations in zygotes and 2-cell embryos showed a tendency for loss of acentric fragments during the first mitotic division ofembryogenesis, while both dicentrics and translocations apparently underwent propersegregation. These results suggest that embryonic development can proceed up to the end of the second cell cycle of development in the presence of abnormal paternal chromosomes and that even dicentrics can persist through cell division. The high incidence of chromosomally mosaic 2-cell embryos suggests that the first mitotic division of embryogenesis is prone to missegregation errors and that paternally-transmitted chromosomal abnromalities increase the risk of missegregation leading to embryonic mosaicism.

  7. Cells with dysfunctional telomeres are susceptible to reactive oxygen species hydrogen peroxide via generation of multichromosomal fusions and chromosomal fragments bearing telomeres

    SciTech Connect

    Woo, Seon Rang; Park, Jeong-Eun; Juhn, Kyoung-Mi; Ju, Yeun-Jin; Jeong, Jaemin; Kang, Chang-Mo; Yun, Hyun Jin; Yun, Mi Yong; Shin, Hyun-Jin; Joo, Hyun-Yoo; Park, Eun-Ran; Park, In-Chul; Hong, Sung Hee; Hwang, Sang-Gu; Kim, Haekwon; Cho, Myung-Haing; Kim, Sang Hoon; Park, Gil Hong; Lee, Kee-Ho

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Under conditions of telomere erosion, cells become extremely sensitive to H{sub 2}O{sub 2}. Black-Right-Pointing-Pointer Chromosomal regions adjacent to telomeres are cleaved by H{sub 2}O{sub 2} under such conditions. Black-Right-Pointing-Pointer H{sub 2}O{sub 2} thus causes multichromosomal fusions and generation of small chromosomal fragments. Black-Right-Pointing-Pointer N-acetylcysteine prevents H{sub 2}O{sub 2}-induced chromosomal aberrations. -- Abstract: During genotoxic stress, reactive oxygen species hydrogen peroxide (H{sub 2}O{sub 2}) is a prime mediator of the DNA damage response. Telomeres function both to assist in DNA damage repair and to inhibit chromosomal end-to-end fusion. Here, we show that telomere dysfunction renders cells susceptible to H{sub 2}O{sub 2}, via generation of multichromosomal fusion and chromosomal fragments. H{sub 2}O{sub 2} caused formation of multichromosomal end-to-end fusions involving more than three chromosomes, preferentially when telomeres were erosive. Interestingly, extensive chromosomal fragmentation (yielding small-sized fragments) occurred only in cells exhibiting such multichromosomal fusions. Telomeres were absent from fusion points, being rather present in the small fragments, indicating that H{sub 2}O{sub 2} cleaves chromosomal regions adjacent to telomeres. Restoration of telomere function or addition of the antioxidant N-acetylcysteine prevented development of chromosomal aberrations and rescued the observed hypersensitivity to H{sub 2}O{sub 2}. Thus, chromosomal regions adjacent to telomeres become sensitive to reactive oxygen species hydrogen peroxide when telomeres are dysfunctional, and are cleaved to produce multichromosomal fusions and small chromosomal fragments bearing the telomeres.

  8. Chromosome

    MedlinePlus

    Chromosomes are structures found in the center (nucleus) of cells that carry long pieces of DNA. DNA ... is the building block of the human body. Chromosomes also contain proteins that help DNA exist in ...

  9. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    PubMed Central

    Leclerc, Xavier; Danos, Olivier; Scherman, Daniel; Kichler, Antoine

    2009-01-01

    Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1). Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments. PMID:19379497

  10. [Analysis of fragments of intergenome spacers of human body observed in chromosomes containing no nuclear organization].

    PubMed

    Kupriyanova, N S; Nechvolodov, K K; Korsunenko, A V

    2014-01-01

    Tandem repetitions of rDNA provide so-called nuclear organizations (NOR). On the other hand, rDNA-structures are observed in some NOR chromosomes. It was demonstrated that, in addition to ribosome biogenesis, nucleoli provided a number of functions: cell cycle regulation, stress-induced response, transcription regulation, which often induced cell cascades. The mechanisms of the induction of rDNA segments in NOR chromosomes are obscure and require further research. About 1/3 repetitions are associated with nucleoli and SINE/Alu repetitions, homogeneous repetition, and tandem repetition. Perhaps, relative position of nucleoli and chromosomes may facilitate/prevent interaction of chromosomes with rDNA clusters. The variability of two larger repetitions in the central part of rMGS, LR1, and LR2 similar by -90% and separated by several hundred pairs of bases from each other was studied in our previous works. This work was devoted to the search for the LR1-LR2 segments in other chromosomes, characterization of their terminal tips at rupture points and genome areas of incorporation of the LR1-LR2 segments.

  11. Genome doubling and chromosome elimination with fragment recombination leading to the formation of Brassica rapa-type plants with genomic alterations in crosses with Orychophragmus violaceus.

    PubMed

    Liu, Min; Li, Zai-Yun

    2007-11-01

    In distant hybridization of plants, nonclassical hybrids with unexpected chromosome complements, chromosome elimination, and genetic introgression have been well documented. We obtained intergeneric hybrids between Brassica rapa, B. rapa var. chinensis, and another cruciferous species, Orychophragmus violaceus, following embryo rescue. Hybrids mainly displayed phenotypes of B. rapa, although certain O. violaceus or novel characteristics also appeared. Variable numbers of chromosomes were observed in somatic cells in the roots of plantlets on medium and in ovaries and pollen mother cells (PMCs). However, higher numbers were recorded in the roots. GISH revealed that the majority of ovary cells and PMCs contained 20 chromosomes of B. rapa with or without individual O. violaceus chromosomes or fragments added or introgressed. AFLP analysis showed that fragments deleted from the B. rapa genome were much more frequent than novel and O. violaceus fragments. The mechanisms involved genome doubling and successive elimination of O. violaceus chromosomes accompanied by fragment recombination and introgression, producing B. rapa-type plants with modified genetic constitutions and phenotypes.

  12. Flow cytometry may allow microscope-independent detection of holocentric chromosomes in plants

    PubMed Central

    Zedek, František; Veselý, Pavel; Horová, Lucie; Bureš, Petr

    2016-01-01

    Two chromosomal structures, known as monocentric and holocentric chromosomes, have evolved in eukaryotes. Acentric fragments of monocentric chromosomes are unequally distributed to daughter cells and/or lost, while holocentric fragments are inherited normally. In monocentric species, unequal distribution should generate chimeras of cells with different nuclear DNA content. We investigated whether such differences in monocentric species are detectable by flow cytometry (FCM) as (i) a decreased nuclear DNA content and (ii) an increased coefficient of variance (CV) of the G1 peak after gamma radiation-induced fragmentation. We compared 13 monocentric and 9 holocentric plant species. Unexpectedly, monocentrics and holocentrics did not differ with respect to parameters (i) and (ii) in their response to gamma irradiation. However, we found that the proportion of G2 nuclei was highly elevated in monocentrics after irradiation, while holocentrics were negligibly affected. Therefore, we hypothesize that DNA-damaging agents induce cell cycle arrest leading to endopolyploidy only in monocentric and not (or to much lesser extent) in holocentric plants. While current microscope-dependent methods for holocentrism detection are unreliable for small and numerous chromosomes, which are common in holocentrics, FCM can use somatic nuclei. Thus, FCM may be a rapid and reliable method of high-throughput screening for holocentric candidates across plant phylogeny. PMID:27255216

  13. Deliberate design of an acentric diamondoid metal-organic network

    SciTech Connect

    Yang Caiqin; Wang Jing; Wang Wei; Zhan Wenhong

    2011-09-15

    Reaction of 2.5-dicarboxy-1-methylpyridinium (DCMP) chloride and Zn(NO{sub 3}){sub 2}.6H{sub 2}O in the presence of NaHCO{sub 3} in water gave an expected acentric diamondoid network [Zn(DCMP){sub 2}] with a three-fold interpenetration. With long Zn-Zn separations, very large cavities are formed within each diamondoid network with high propensity to interpenetration, which makes it show a promising non-linear optical property with SHG efficiency approximately 7 times higher than that of potassium dihydrogen phosphate (KDP). The design strategy of ligand through methylation of the corresponding pyrdinecarboxylic acid can be extended to other widely used carboxylic acids, more importantly, to lead to an unsymmetric bifunctional bridging ligand, which is essential for generating polar solids. - Graphical Abstract: Reaction of Zn(NO{sub 3}){sub 2}.6H{sub 2}O with a deliberately designed unsymmetrical ligand 2.5-dicarboxy-1-methylpyridinium (DCMP) chloride and in the presence of NaHCO{sub 3} gave an expected noncentric diamondoid network [Zn(DCMP){sub 2}], which has its SHG response approximately 7 times higher than that of potassium dihydrogen phosphate (KDP). Highlights: > DCMP as an unsymmetrical organic ligand to design metal organic framework. > Long Zn-Zn separations and very large cavities formed. > Diamondoid network with high propensity to interpenetration formed. > Bifunctional bridging ligand was used to generate polar solids with large SHG response.

  14. Acentric lattice electro-optic materials by rational design

    NASA Astrophysics Data System (ADS)

    Dalton, Larry; Robinson, Bruce; Jen, Alex; Ried, Philip; Eichinger, Bruce; Sullivan, Philip; Akelaitis, Andrew; Bale, Denise; Haller, Marnie; Luo, Jingdong; Liu, Sen; Liao, Yi; Firestone, Kimberly; Bhatambrekar, Nishant; Bhattacharjee, Sanchali; Sinness, Jessica; Hammond, Scott; Buker, Nicholas; Snoeberger, Robert; Lingwood, Mark; Rommel, Harry; Amend, Joe; Jang, Sei-Hum; Chen, Antao; Steier, William

    2005-08-01

    Quantum and statistical mechanical calculations have been used to guide the improvement of the macroscopic electro-optic activity of organic thin film materials to values greater than 300 pm/V at telecommunication wavelengths. Various quantum mechanical methods (Hartree-Fock, INDO, and density functional theory) have been benchmarked and shown to be reliable for estimating trends in molecular first hyperpolarizability, β, for simple variation of donor, bridge, and acceptor structures of charge-transfer (dipolar) chromophores. β values have been increased significantly over the past five years and quantum mechanical calculations suggest that they can be further significantly improved. Statistical mechanical calculations, including pseudo-atomistic Monte Carlo calculations, have guided the design of the super/supramolecular structures of chromophores so that they assemble, under the influence of electric field poling, into macroscopic lattices with high degrees of acentric order. Indeed, during the past year, chromophores doped into single- and multi-chromophore-containing dendrimer materials to form binary glasses have yielded thin films that exhibit electro-optic activities at telecommunication wavelengths of greater than 300 pm/V. Such materials may be viewed as intermediate between chromophore/polymer composites and crystalline organic chromophore materials. Theory suggests that further improvements of electro-optic activity are possible. Auxiliary properties of these materials, including optical loss, thermal and photochemical stability, and processability are discussed. Such organic electro-optic materials have been incorporated into silicon photonic circuitry for active wavelength division multiplexing, reconfigurable optical add/drop multiplexing, and high bandwidth optical rectification. A variety of all-organic devices, including stripline, cascaded prism, Fabry-Perot etalon, and ring microresonator devices, have been fabricated and evaluated.

  15. Integration of erm(B)-containing elements through large chromosome fragment exchange in Clostridium difficile

    PubMed Central

    Wasels, François; Spigaglia, Patrizia; Barbanti, Fabrizio; Monot, Marc; Villa, Laura; Dupuy, Bruno; Carattoli, Alessandra; Mastrantonio, Paola

    2015-01-01

    In Clostridium difficile, erm(B) genes are located on mobile elements like Tn5398 and Tn6215. In previous studies, some of these elements were transferred by conjugation-like mechanisms, mobilized in trans by helper conjugative systems. In this study, we analyzed the genomes of several recipient strains that acquired either Tn5398 or Tn6215-like elements. We demonstrated that the integration of the transposons in the genome of the recipient cell was always due to homologous recombination events, involving exchange of large chromosomal segments. We did not observed transposon transfer to a C. difficile strain in presence of DNAse, suggesting that a possible transformation-like mechanism occurred in this recipient. PMID:26442177

  16. Doping strategies to control A-centres in silicon: insights from hybrid density functional theory.

    PubMed

    Wang, H; Chroneos, A; Londos, C A; Sgourou, E N; Schwingenschlögl, U

    2014-05-14

    Hybrid density functional theory is used to gain insights into the interaction of intrinsic vacancies (V) and oxygen-vacancy pairs (VO, known as A-centres) with the dopants (D) germanium (Ge), tin (Sn), and lead (Pb) in silicon (Si). We determine the structures as well as binding and formation energies of the DVO and DV complexes. The results are discussed in terms of the density of states and in view of the potential of isovalent doping to control A-centres in Si. We argue that doping with Sn is the most efficient isovalent doping strategy to suppress A-centres by the formation of SnVO complexes, as these are charge neutral and strongly bound.

  17. An acentric rotation of two helical vortices of the same circulations

    NASA Astrophysics Data System (ADS)

    Okulov, Valery L.

    2016-05-01

    The aim of this paper is to test the possibility of a secondary solution of the acentric rotation of helical vortex pairs with the same pitch, sign and strength. The investigation addresses the three-dimensional vortex dynamics of thin vortex filaments. As a result of the current investigation, this secondary solution with acentric vortex positions in the helical pairs is found. This fact was not discussed in previous studies, and the existence of the new equilibrium solution for the helical vortex pairs is an original result.

  18. Role of the distal fragment of chromosome 13 in the regulation of IL-6-induced effect on the behavior of mice.

    PubMed

    Bazovkina, D V; Sinyakova, N A; Kulikov, A V

    2014-02-01

    We studied the effect of IL-6 on the open-field behavior and degree of cataleptic freezing in male AKR/J mice and AKR.CBA-D13Mit76 congenic animals (differing from CBA/Lac mice in the chromosome 13 fragment of 111.35-116.14 Mbp). IL-6 in both doses significantly increased the time of cataleptic freezing. IL-6 in a dose of 3 μg/kg had a strong inhibitory effect on locomotor activity of AKR.CBA-D13Mit76 males in the open-field test. However, IL-6 in both doses did not modulate locomotor activity and severity of catalepsy in AKR/J males. Our results indicate that the distal fragment of chromosome 13 is involved in the effect of IL-6 on the locomotor activity of mice.

  19. Chromosomal assignment of human genomic NotI restriction fragments in a two-dimensional electrophoresis profile

    SciTech Connect

    Yoshikawa, Hirohide; Nagai, Hisaki; Matsubara, Kenichi

    1996-01-01

    Using DNA from sorted human chromosomes and two-dimensional gel electrophoresis, we assigned 2295 NotI sites, 43% of the total, to specific chromosomes and designated the procedure CA-RLGS (chromosome-assigned restriction landmark genomic scanning). Although the NotI enzyme is sensitive to DNA methylation, our results suggested that the majority of the spots did not seem to be affected by this modification. The NotI sites were distributed at higher levels in chromosomes 17, 19, and 22, suggesting higher gene content in these chromosomes. Most spots were assigned to unique chromosomes, but some spots were found on two or more chromosomes. Quantitative analysis revealed the intensity of the DNA spots on the sex chromosomes to be haploid and that of the chromosome 21 spots in DNA from a male with Down syndrome to be trisomic, although there were exceptions. We report here the first-generation CA-RLGS map of the human genome. 23 refs., 4 figs.

  20. The antigenotoxic activities of cactus (Opuntia ficus-indica) cladodes against the mycotoxin zearalenone in Balb/c mice: prevention of micronuclei, chromosome aberrations and DNA fragmentation.

    PubMed

    Zorgui, Lazhar; Ayed-Boussema, Imen; Ayed, Yosra; Bacha, Hassen; Hassen, Wafa

    2009-03-01

    Zearalenone (ZEN) is a potent estrogenic metabolite. Evidence of its cytotoxicity and genotoxicity has recently emerged from several reports. This study was conducted to evaluate the ability of cactus (Opuntia ficus-indica) cladodes to protect Balb/c mice against ZEN induced genotoxicity. To this end, the effect of a single dose of ZEN (40 mg/kg b.w.) alone and with extract of cactus cladodes (25, 50 and 100 mg/kg b.w.) was monitored by measuring: (i) micronuclei induction in bone marrow cells, (ii) chromosome aberrations mainly breaks and gaps in bone marrow cells also and finally and (iii) DNA fragmentation in liver and kidney. Our results clearly show that ZEN is genotoxic to Balb/c mice. It induces DNA damage as indicated by DNA fragmentation, micronuclei and chromosomal aberrations in bone marrow cells. It is of note that cactus cladodes extract assayed alone at high dose (100 mg/kg b.w.) was found completely safe and did not induce any genotoxic effects. The simultaneous administration of cactus cladodes extract with ZEN resulted in an efficient prevention of micronuclei (the number of PCE MN decreased from 71.3+/-6.1 for animals treated with Zen to 32.6+/-15.5 for animals treated with cactus cladodes), chromosomal aberrations frequency (the % of chromosomal aberrations decreased from 38.3+/-3.0 to 18.6+/-1.1) in bone marrow cells and of DNA fragmentation compared to the group treated with ZEN alone. It could be concluded that cactus cladodes extract was effective in the protection against ZEN genotoxicity. This could be relevant, particularly with the emergent demand for natural products which may neutralize the genotoxic effects of the multiple food contaminants.

  1. The antigenotoxic activities of cactus (Opuntia ficus-indica) cladodes against the mycotoxin zearalenone in Balb/c mice: prevention of micronuclei, chromosome aberrations and DNA fragmentation.

    PubMed

    Zorgui, Lazhar; Ayed-Boussema, Imen; Ayed, Yosra; Bacha, Hassen; Hassen, Wafa

    2009-03-01

    Zearalenone (ZEN) is a potent estrogenic metabolite. Evidence of its cytotoxicity and genotoxicity has recently emerged from several reports. This study was conducted to evaluate the ability of cactus (Opuntia ficus-indica) cladodes to protect Balb/c mice against ZEN induced genotoxicity. To this end, the effect of a single dose of ZEN (40 mg/kg b.w.) alone and with extract of cactus cladodes (25, 50 and 100 mg/kg b.w.) was monitored by measuring: (i) micronuclei induction in bone marrow cells, (ii) chromosome aberrations mainly breaks and gaps in bone marrow cells also and finally and (iii) DNA fragmentation in liver and kidney. Our results clearly show that ZEN is genotoxic to Balb/c mice. It induces DNA damage as indicated by DNA fragmentation, micronuclei and chromosomal aberrations in bone marrow cells. It is of note that cactus cladodes extract assayed alone at high dose (100 mg/kg b.w.) was found completely safe and did not induce any genotoxic effects. The simultaneous administration of cactus cladodes extract with ZEN resulted in an efficient prevention of micronuclei (the number of PCE MN decreased from 71.3+/-6.1 for animals treated with Zen to 32.6+/-15.5 for animals treated with cactus cladodes), chromosomal aberrations frequency (the % of chromosomal aberrations decreased from 38.3+/-3.0 to 18.6+/-1.1) in bone marrow cells and of DNA fragmentation compared to the group treated with ZEN alone. It could be concluded that cactus cladodes extract was effective in the protection against ZEN genotoxicity. This could be relevant, particularly with the emergent demand for natural products which may neutralize the genotoxic effects of the multiple food contaminants. PMID:19152824

  2. Triage biodosimetry using centromeric/telomeric PNA probes and Giemsa staining to score dicentrics or excess fragments in non-stimulated lymphocyte prematurely condensed chromosomes.

    PubMed

    Karachristou, Ioanna; Karakosta, Maria; Pantelias, Antonio; Hatzi, Vasiliki I; Karaiskos, Pantelis; Dimitriou, Panagiotis; Pantelias, Gabriel; Terzoudi, Georgia I

    2015-11-01

    The frequency of dicentric chromosomes in human peripheral blood lymphocytes at metaphase is considered as the "gold-standard" method for biological dosimetry and, presently, it is the most widely used for dose assessment. Yet, it needs lymphocyte stimulation and a 2-day culture, failing the requirement of rapid dose estimation, which is a high priority in radiation emergency medicine and triage biodosimetry. In the present work, we assess the applicability of cell fusion mediated premature chromosome condensation (PCC) methodology, which enables the analysis of radiation-induced chromosomal aberrations directly in non-stimulated G0-lymphocytes, without the 2-day culture delay. Despite its advantages, quantification of an exposure by means of the PCC-method is not currently widely used, mainly because Giemsa-staining of interphase G0-lymphocyte chromosomes facilitates the analysis of fragments and rings, but not of dicentrics. To overcome this shortcoming, the PCC-method is combined with fluorescence in situ hybridization (FISH), using simultaneously centromeric/telomeric peptide nucleic acid (PNA)-probes. This new approach enables an accurate analysis of dicentric and centric ring chromosomes, which are formed within 8h post irradiation and will, therefore, be present in the blood sample by the time it arrives for dose estimation. For triage biodosimetry, a dose response curve for up to 10Gy was constructed and compared to that obtained using conventional metaphase analysis with Giemsa or centromeric/telomeric PNA-probes in metaphase. Since FISH is labor intensive, a simple PCC-method scoring Giemsa-stained fragments in excess of 46 was also assessed as an even more rapid approach for triage biodosimetry. First, we studied the rejoining kinetics of fragments and constructed a dose-response curve for 24h repair time. Then, its applicability was assessed for four different doses and compared with the PCC-method using centromeric/telomeric PNA-probes, through the

  3. First insight into divergence, representation and chromosome distribution of reverse transcriptase fragments from L1 retrotransposons in peanut and wild relative species.

    PubMed

    Samoluk, Sergio Sebastián; Robledo, Germán; Podio, Maricel; Chalup, Laura; Ortiz, Juan Pablo A; Pessino, Silvina Claudia; Seijo, José Guillermo

    2015-02-01

    Peanut is an allotetraploid (2n = 2x = 40, AABB) of recent origin. Arachis duranensis and A. ipaënsis, the most probable diploid ancestors of the cultigen, and several other wild diploid species with different genomes (A, B, D, F and K) are used in peanut breeding programs. However, the genomic relationships and the evolutionary pathways of genome differentiation of these species are poorly understood. We performed a sequence-based phylogenetic analysis of the L1 reverse transcriptase and estimated its representation and chromosome distribution in species of five genomes and three karyotype groups with the aim of contributing to the knowledge of the genomic structure and evolution of peanut and wild diploid relatives. All the isolated rt fragments were found to belong to plant L1 lineage and were named ALI. The best supported phylogenetic groups were not concordant with the genomes or karyotype groups. The copy number of ALI sequences was higher than the expected one for plants and directly related to genome size. FISH experiments revealed that ALI is mainly located on the euchromatin of interstitial and distal regions of most chromosome arms. Divergence of ALI sequences would have occurred before the differentiation of the genomes and karyotype groups of Arachis. The representation and chromosome distribution of ALI in peanut was almost additive of those of the parental species suggesting that the spontaneous hybridization of the two parental species of peanut followed by chromosome doubling would not have induced a significant burst of ALI transposition. PMID:25633099

  4. A study of aneuploidy and DNA fragmentation in spermatozoa of three men with sex chromosome mosaicism including a 45,X cell line.

    PubMed

    Nguyen, Minh Huong; Morel, Frederic; Bujan, Louis; May-Panloup, Pascale; De Braekeleer, Marc; Perrin, Aurore

    2015-06-01

    Meiotic segregation of mosaic males with a 45,X cell line has been little examined. In this study, we evaluated the risk of aneuploid gametes using fluorescence in situ hybridization (FISH) and DNA fragmentation in ejaculated spermatozoa of three men with sex chromosome mosaicism including a 45,X cell line. Triple- and dual-color FISH were performed. Sperm DNA fragmentation was detected using the TUNEL assay. A significantly increased frequency of XY disomic spermatozoa was observed for patients (P)1 and P2. A significant increase in diploidy and autosomal aneuploidy was found in P2 and P3, respectively. The rate of DNA fragmentation was not different from that observed in a control group. Data from the literature are scarce (only 3 cases reported), making comparison of the present data difficult, especially as the frequencies of the cell lines comprising the mosaicism differed between patients. Furthermore, the proportion of the different cell lines can differ from one tissue to another in the same patient. Whether the relative levels of the several cell lines present in the mosaicism can influence the rate of aneuploid spermatozoa remains unknown.

  5. A 9359 bp fragment from the right arm of Saccharomyces cerevisiae chromosome VII includes the FOL2 and YTA7 genes and three unknown open reading frames.

    PubMed

    Agostoni Carbone, M L; Lucchini, G; Melchioretto, P; Nardese, V; Vanoni, M; Panzeri, L

    1998-04-30

    In the framework of the EU programme for systematic sequencing of the Saccharomyces cervisiae genome we determined the sequence of a 9359 bp fragment of the right arm of chromosome VII. Five open reading frames (ORFs) of at least 300 nucleotides were found in this region. YGR267c encodes a protein with significant similarity to the enzyme GTP-cyclohydrolase I, that controls the first step in the biosynthetic pathway leading to various pterins and shows a high degree of sequence conservation from bacteria to mammals. We have recently demonstrated (Nardese et al., 1996) that YGR267c corresponds to the FOL2 gene, previously localized in the same chromosomal region by genetic mapping. The protein deduced from YGR270w belongs to the superfamily of putative ATPases associated with diverse cellular activities. It corresponds to the YTA7 gene, a member of a set of yeast genes coding for putative ATPases with high similarity to constituents of the 26S protease. The three ORFs YGR266w, YGR268c and YGR269w encode putative products of unknown function, with neither significant similarity to proteins in databases nor recognizable domains. YGR268c and YGR269w are partially overlapping ORFs: YGR268c seems to correspond to a real gene. whereas YGR269w is probably a fortuitous ORF. PMID:9605509

  6. Induction of chromosome aberrations by Fusarium T-2 toxin in cultured human peripheral blood lymphocytes and Chinese hamster fibroblasts

    SciTech Connect

    Hsia, C.C.; Gao, Y.; Wu, J.L.; Tzian, B.

    1986-01-01

    T-2 toxin is an important representative of trichothecenes produced by various species of imperfect fungi, mainly Fusarium genus. No definite data demonstrating the carcinogenic potential of T-2 toxin had been reported up to now. The authors demonstrated that T-2 toxin reproducibly induced chromosomal structural aberrations both in cultured human peripheral blood lymphocytes as well as in V/sub 79/ Chinese hamster fibroblasts. The mean percentage of cells with aberration of human lymphocytes from normal individuals induced by T-2 toxin is 49-fold (9.8%) of the mean percentage of corresponding control cultures without T-2 toxin (0.2%). T-2 toxin induced chromosome type (76%) as well as chromatid type (24%) of aberrations; among them, acentric fragment (46%) was the most common type, and chromatid gap, deletion, and chromosome gap were the next most common. T-2 toxin can induce aberrations in cells at different phases of the cell cycle. There are definite dose-effect relationships within a certain range of dosage of T-2 toxin in experiments with both human peripheral blood lymphocytes and V/sub 79/ cells. T-2 toxin exhibited three types of effects on cells, namely, mitogenic at lowest concentration, clastogenic (chromosome aberration) at median concentration, and cytotoxic at higher concentration. The dose-effect curves of these three effects are partly overlapping. Sex or age effect was not observed. The results suggest that T-2 toxin has carcinogenic potentials. The dosage of aflatoxin that can induce chromosomal aberration of human peripheral blood lymphocytes is thousands-fold of the dosage of T-2 toxin as shown in this report.

  7. [Developing a physical map of human chromosome 22 using Pace electrophoresis and large fragment cloning]. Annual report, October 1, 1990--September 30, 1991

    SciTech Connect

    Simon, M.I.

    1991-12-31

    Recent technical progress in molecular biology has made the mapping of entire mammalian chromosomes an attainable goal. However, a number of problems must still be overcome before genome mapping becomes rapid, efficient, and reliable. The limited size of cosmid inserts, as well as their tendency to rearrange, necessitates construction of very large libraries for mapping, due to the many gaps encountered in aligning cosmid contigs. Larger fragments can be cloned using the phage P1, but the maximum size of cloned inserts is fixed at only twice that of cosmids. The power of YACs has been demonstrated in isolating large regions of human DNA, recombining them to build up even larger regions and closing gaps in cosmid based maps. However, existing YAC libraries contain a high proportion of chimeric clones, and YACs are difficult to use for detailed mapping, often requiring recloning into cosmid sized pieces. The work has addressed some of these issues by creating an alternative and complementary approach to cloning and mapping large DNA.

  8. The coding sequence for the 32,000-dalton pulmonary surfactant-associated protein A is located on chromosome 10 and identifies two separate restriction-fragment-length polymorphisms.

    PubMed Central

    Fisher, J H; Kao, F T; Jones, C; White, R T; Benson, B J; Mason, R J

    1987-01-01

    The primary protein component of human pulmonary surfactant is a 32,000-dalton glycoprotein called surfactant-associated protein A. This protein is important for normal lung function, and its expression is developmentally regulated. Using a mapping panel of somatic-cell hybrids, we have localized the coding sequence for pulmonary surfactant-associated protein A to chromosome 10. Additionally, this sequence identifies two separate MspI restriction-fragment-length polymorphisms. Since there is a relative lack of polymorphic markers for chromosome 10, this sequence may be useful in linkage analysis. Images Fig. 1 Fig. 2 PMID:2884868

  9. Isomorphism in Fluid Phase Diagrams: Kulinskii Transformations Related to the Acentric Factor

    SciTech Connect

    Wei, Q; Herschbach, DR

    2013-10-31

    For a wide class of molecular fluids, the temperature-density phase diagrams exhibit two prominent generic properties: a nearly linear locus, termed the Zeno line, along which the compressibility factor, Z = P/rho RT = 1 (same as an ideal gas), and the widely arching border of the vapor-liquid coexistence region, termed the binodal curve, with gas and liquid branches meeting at the critical point. The Zeno and binodal loci have been known for more than a century, yet only during the past two decades were striking empirical correlations between them recognized. Recently, Kulinskii introduced a remarkably simple projective transformation, wherein the linearity of the Zeno line and its relation to the binodal curve are geometrical consequences of an approximate isomorphism of the fluid with a venerable theoretical model, the lattice gas (equivalent to the Ising spin model). Here we show the Kulinskii transformation is significantly improved in accuracy and scope by using as input, in place of the lattice gas, the original van der Waals equation or simulation results for the Lennard-Jones potential. Moreover, the key parameters in these transformations can be expressed in terms of the acentric factor, introduced by Pitzer to extend corresponding states.

  10. Persistence of chromosome aberrations in mice acutely exposed to 56Fe+26 ions.

    PubMed

    Tucker, James D; Marples, Brian; Ramsey, Marilyn J; Lutze-Mann, Louise H

    2004-06-01

    Space exploration has the potential to yield exciting and significant discoveries, but it also brings with it many risks for flight crews. Among the less well studied of these are health effects from space radiation, which includes the highly charged, energetic particles of elements with high atomic numbers that constitute the galactic cosmic rays. In this study, we demonstrated that 1 Gy iron ions acutely administered to mice in vivo resulted in highly complex chromosome damage. We found that all types of aberrations, including dicentrics as well as translocations, insertions and acentric fragments, disappear rapidly with time after exposure, probably as a result of the death of heavily damaged cells, i.e. cells with multiple and/or complex aberrations. In addition, numerous cells have apparently simple exchanges as their only aberrations, and these cells appear to survive longer than heavily damaged cells. Eight weeks after exposure, the frequency of cells showing cytogenetic damage was reduced to less than 20% of the levels evident at 1 week, with little further decline apparent over an additional 8 weeks. These results indicate that exposure to 1 Gy iron ions produces heavily damaged cells, a small fraction of which appear to be capable of surviving for relatively long periods. The health effects of exposure to high-LET radiation in humans on prolonged space flights should remain a matter of concern.

  11. Persistence of chromosome aberrations in mice acutely exposed to 56Fe+26 ions.

    PubMed

    Tucker, James D; Marples, Brian; Ramsey, Marilyn J; Lutze-Mann, Louise H

    2004-06-01

    Space exploration has the potential to yield exciting and significant discoveries, but it also brings with it many risks for flight crews. Among the less well studied of these are health effects from space radiation, which includes the highly charged, energetic particles of elements with high atomic numbers that constitute the galactic cosmic rays. In this study, we demonstrated that 1 Gy iron ions acutely administered to mice in vivo resulted in highly complex chromosome damage. We found that all types of aberrations, including dicentrics as well as translocations, insertions and acentric fragments, disappear rapidly with time after exposure, probably as a result of the death of heavily damaged cells, i.e. cells with multiple and/or complex aberrations. In addition, numerous cells have apparently simple exchanges as their only aberrations, and these cells appear to survive longer than heavily damaged cells. Eight weeks after exposure, the frequency of cells showing cytogenetic damage was reduced to less than 20% of the levels evident at 1 week, with little further decline apparent over an additional 8 weeks. These results indicate that exposure to 1 Gy iron ions produces heavily damaged cells, a small fraction of which appear to be capable of surviving for relatively long periods. The health effects of exposure to high-LET radiation in humans on prolonged space flights should remain a matter of concern. PMID:15161355

  12. Silencing expression of the catalytic subunit of DNA-dependent protein kinase by small interfering RNA sensitizes human cells for radiation-induced chromosome damage, cell killing, and mutation

    NASA Technical Reports Server (NTRS)

    Peng, Yuanlin; Zhang, Qinming; Nagasawa, Hatsumi; Okayasu, Ryuichi; Liber, Howard L.; Bedford, Joel S.

    2002-01-01

    Targeted gene silencing in mammalian cells by RNA interference (RNAi) using small interfering RNAs (siRNAs) was recently described by Elbashir et al. (S. M. Elbashir et al., Nature (Lond.), 411: 494-498, 2001). We have used this methodology in several human cell strains to reduce expression of the Prkdc (DNA-PKcs) gene coding for the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) that is involved in the nonhomologous end joining of DNA double-strand breaks. We have also demonstrated a radiosensitization for several phenotypic endpoints of radiation damage. In low-passage normal human fibroblasts, siRNA knock-down of DNA-PKcs resulted in a reduced capacity for restitution of radiation-induced interphase chromosome breaks as measured by premature chromosome condensation, an increased yield of acentric chromosome fragments at the first postirradiation mitosis, and an increased radiosensitivity for cell killing. For three strains of related human lymphoblasts, DNA-PKcs-targeted siRNA transfection resulted in little or no increase in radiosensitivity with respect to cell killing, a 1.5-fold decrease in induced mutant yield in TK6- and p53-null NH32 cells, but about a 2-fold increase in induced mutant yield in p53-mutant WTK1 cells at both the hypoxanthine quanine phosphoribosyl transferase (hprt) and the thymidine kinase loci.

  13. Effect of mouse chromosome 13 terminal fragment on liability to catalepsy and expression of tryptophane hydroxylase-2, serotonin transporter, and 5-HT1A receptor genes in the brain.

    PubMed

    Kulikov, A V; Naumenko, V S; Bazovkina, D V; Dee, V Yu; Osipova, D V; Popova, N K

    2009-05-01

    Congenic mice obtained by genome fragments transfer from one strain to another are a potent tool for studies of the molecular mechanisms of behavioral mutations. The 59-70 cM fragment of chromosome 13 containing the locus determining predisposition to freezing reaction (catalepsy) and the gene encoding 5-HT(1A) receptor were transferred from cataleptic CBA/Lac mice into the genome of catalepsy-resistant AKR/J mice. The impact of this fragment for the severity of catalepsy and expression of genes encoding tryptophane hydroxylase-2, serotonin transporter, and 5-HT(1A) receptor was studied. Half of mice of the resultant congenic AKR.CBA-D13Mit76 strain exhibited pronounced catalepsy, similarly to donor CBA animals. The expression of 5-HT(1A) receptor gene in the midbrain of AKR animals was significantly higher than in CBA. The level of 5-HT(1A) receptor mRNA in AKR.CBA-D13Mit76 animals was significantly higher than in the donor strain. Mice of parental AKR and CBA strains did not differ from each other and from AKR.CBA-D13Mit76 animals by the levels of tryptophane hydroxylase-2 and serotonin transporter genes mRNA. These data prove the location of catalepsy regulating gene in the distal fragment of chromosome 13. The recipient strain genome enhanced the expression of 5-HT(1A) receptor gene in the brain without modulating the expression of catalepsy gene.

  14. Down syndrome due to a recombination of a chromosome 21 paracentric inversion in 1 of 2 cases with a review of paracentric recombinants

    SciTech Connect

    Jewett, T.; Rao, P.N.; Berry, M.

    1994-09-01

    We recently identified 2 paracentric inversions (PAI) of chromosome 21. Case 1 was identified prenatally and paternally inherited: 46,XY,inv(21)(q21.2q22.13). The outcome is pending. Case 2 was a newborn male infant with clinical features of Down syndrome and an apparent inversion-duplication within chromosome 21. Parental chromosome analysis showed a maternal PAI: 46,XX,inv(21)(q21.2q22.3). The resulting child`s karyotype was: 46,XY,rec(21)(pter{yields}q21.2::q22.3{yields}q21.2::q22.3{yields}pter). Duplication of chromosome region q22.3{yields}qter was confirmed by FISH using a Down syndrome region specific probe (Cambio). Cytologically, the cornerstone of meiotic recombination from a paracentric inversion is the {open_quotes}reverse loop{close_quotes} model. In this model, a crossover event in the inversion loop results in the formation of gametes carrying either a dicentric chromatid, an acentric fragment, a normal chromatid or a chromatid with an inversion. However, a literature review of 326 PAI identified only 2 dicentrics and 15 other recombinants: 1 duplication/deletion; 6 deletions; 8 duplications. A U-type exchange model during meiosis within the inversion loop may best account for duplication/deletion recombinants. In contrast, the recombination in our case 2 would have occurred outside the loop. It is possible that no single explanation for PAI recombination may account for all outcomes. Alternative models of PAI recominational events will be presented. The literature suggests a low risk for prenatal loss due to abnormal PAI recombinants. In our review, viable offspring with recombinant chromosomes occurred in 3.8% of the PAI. Considering the potential for an increased incidence of recombination, prenatal diagnosis for all PAI carriers is warranted.

  15. Chromosomal destabilization during gene amplification.

    PubMed Central

    Ruiz, J C; Wahl, G M

    1990-01-01

    Acentric extrachromosomal elements, such as submicroscopic autonomously replicating circular molecules (episomes) and double minute chromosomes, are common early, and in some cases initial, intermediates of gene amplification in many drug-resistant and tumor cell lines. In order to gain a more complete understanding of the amplification process, we investigated the molecular mechanisms by which such extrachromosomal elements are generated and we traced the fate of these amplification intermediates over time. The model system consists of a Chinese hamster cell line (L46) created by gene transfer in which the initial amplification product was shown previously to be an unstable extrachromosomal element containing an inverted duplication spanning more than 160 kilobases (J. C. Ruiz and G. M. Wahl, Mol. Cell. Biol. 8:4302-4313, 1988). In this study, we show that these molecules were formed by a process involving chromosomal deletion. Fluorescence in situ hybridization was performed at multiple time points on cells with amplified sequences. These studies reveal that the extrachromosomal molecules rapidly integrate into chromosomes, often near or at telomeres, and once integrated, the amplified sequences are themselves unstable. These data provide a molecular and cytogenetic chronology for gene amplification in this model system; an early event involves deletion to generate extrachromosomal elements, and subsequent integration of these elements precipitates a cascade of chromosome instability. Images PMID:2188107

  16. [Cloning and identification of an Agrobacterium radiobacter 5D-1 chromosome fragment involved in control of nitrogen metabolism, biosynthesis of indolylacetic acid and replication of ColE1 plasmids].

    PubMed

    Kameneva, S V; Rusliakova, M V; Muronets, E M; Elanskaia, I V

    2001-07-01

    Pleiotropic chromosomal mutations were earlier identified in saprophytic associative bacterium Agrobacterium radiobacter 5D-1. The mutations changed nitrogen metabolism, disturbed synthesis of indolylacetic acid (IAA), and conferred the ability to sustain replication of ColE1 plasmid derivatives, which are not normally maintained in bacteria other than Escherichia. The mutations were designated Nr (Nitrogen metabolism) and assigned to a single cluster on an A. radiobacter genetic map. A 420-bp fragment AGH23.1.1 was cloned from an agrobacterial genomic library. Introduced in the Nr mutants as a part of a pUC18-based recombinant plasmid, the AGH23.1.1 fragment complemented the Nr mutations with respect to nitrogen metabolism and IAA biosynthesis, but transformants still sustained replication of ColE1 plasmids. Transformation with the linear AGH23.1.1 fragment was due to substitution of a mutant allele of the nr gene with its wild-type counterpart as a result of recombination and completely restored the wild type in the Nr mutants, including the inability to maintain ColE1 plasmids. The AGH23.1.1 fragment and its flanking regions were sequenced. The established sequence was shown to contain two open reading frames (ORFs) coding for proteins with unknown functions. Thus, the cloned fragment contained a gene(s) that controls nitrogen metabolism and IAA synthesis and prevent replication of ColE1 plasmids in A. radiobacter cells. Possible variants of the genetic control of these processes are considered.

  17. Pure chromosome-specific PCR libraries from single sorted chromosomes.

    PubMed Central

    VanDevanter, D R; Choongkittaworn, N M; Dyer, K A; Aten, J; Otto, P; Behler, C; Bryant, E M; Rabinovitch, P S

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted chromosome or chromosome fragment. Previously reported methods for the development of chromosome libraries require larger numbers of chromosomes, with preparation of pure chromosomes sorted by flow cytometry, generation of somatic cell hybrids containing targeted chromosomes, or a combination of both procedures. These procedures are labor intensive, especially when hybrid cell lines are not already available, and this has limited the generation of chromosome-specific DNA libraries from nonhuman species. In contrast, a single sorted chromosome is a pure source of DNA for library production even when flow cytometric resolution of chromosome populations is poor. Furthermore, any sorting cytometer may be used with this technique. Using this approach, we demonstrate the generation of PCR libraries suitable for both molecular and fluorescence in situ hybridization studies from individual baboon and canine chromosomes, separate human homologues, and a rearranged marker chromosome from a transformed cell line. PCR libraries specific to subchromosomal regions have also been produced by sorting a small chromosome fragment. This simple and rapid technique will allow generation of nonhuman linkage maps and probes for fluorescence in situ hybridization and the characterization of marker chromosomes from solid tumors. In addition, allele-specific libraries generated by this strategy may also be useful for mapping genetic diseases. Images PMID:8016078

  18. Sequence and gene content of a large fragment of a lizard sex chromosome and evaluation of candidate sex differentiating gene R-spondin 1

    PubMed Central

    2013-01-01

    Background Scant genomic information from non-avian reptile sex chromosomes is available, and for only a few lizards, several snakes and one turtle species, and it represents only a small fraction of the total sex chromosome sequences in these species. Results We report a 352 kb of contiguous sequence from the sex chromosome of a squamate reptile, Pogona vitticeps, with a ZZ/ZW sex microchromosome system. This contig contains five protein coding genes (oprd1, rcc1, znf91, znf131, znf180), and major families of repetitive sequences with a high number of copies of LTR and non-LTR retrotransposons, including the CR1 and Bov-B LINEs. The two genes, oprd1 and rcc1 are part of a homologous syntenic block, which is conserved among amniotes. While oprd1 and rcc1 have no known function in sex determination or differentiation in amniotes, this homologous syntenic block in mammals and chicken also contains R-spondin 1 (rspo1), the ovarian differentiating gene in mammals. In order to explore the probability that rspo1 is sex determining in dragon lizards, genomic BAC and cDNA clones were mapped using fluorescence in situ hybridisation. Their location on an autosomal microchromosome pair, not on the ZW sex microchromosomes, eliminates rspo1 as a candidate sex determining gene in P. vitticeps. Conclusion Our study has characterized the largest contiguous stretch of physically mapped sex chromosome sequence (352 kb) from a ZZ/ZW lizard species. Although this region represents only a small fraction of the sex chromosomes of P. vitticeps, it has revealed several features typically associated with sex chromosomes including the accumulation of large blocks of repetitive sequences. PMID:24344927

  19. Ubiquitous accumulation of 3' mRNA decay fragments in Saccharomyces cerevisiae mRNAs with chromosomally integrated MS2 arrays.

    PubMed

    Garcia, Jennifer F; Parker, Roy

    2016-05-01

    The binding of MS2-GFP protein to arrays of MS2 sites in yeast mRNAs has been used extensively to visualize mRNA localization. We previously reported that arrays of MS2 sites bound by MS2 protein could inhibit Xrn1p and lead to the accumulation of 3' mRNA decay fragments. We suggest that these decay fragments have the potential to complicate mRNA localization studies, as stated in an earlier study. PMID:27090788

  20. Methods for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1995-01-01

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  1. Human glioblastoma cells persistently infected with simian virus 40 carry nondefective episomal viral DNA and acquire the transformed phenotype and numerous chromosomal abnormalities.

    PubMed

    Norkin, L C; Steinberg, V I; Kosz-Vnenchak, M

    1985-02-01

    A stable, persistent infection of A172 human glioblastoma cells with simian virus 40 (SV40) was readily established after infection at an input of 450 PFU per cell. Only 11% of the cells were initially susceptible to SV40, as shown by indirect immunofluorescent staining for the SV40 T antigen at 48 h. However, all cells produced T antigen by week 11. In contrast, viral capsid proteins were made in only about 1% of the cells in the established carrier system. Weekly viral yields ranged between 10(4) and 10(6) PFU/ml. Most of the capsid protein-producing cells contained enormous aberrant (lobulated or multiple) nuclei. Persistent viral DNA appeared in an episomal or "free" state exclusively in Southern blots and was indistinguishable from standard SV40 DNA by restriction analysis. Viral autointerference activity was not detected, and yield reduction assays did not indicate defective interfering particle activity, further implying that variant viruses were not a factor in this carrier system. Interferon was also not a factor in the system, as shown by direct challenge with vesicular stomatitis virus. Persistent infection resulted in cellular growth changes (enhanced saturation density and plating efficiency) characteristic of SV40 transformation. Persistent infection also led to an increased frequency of cytogenetic effects. These included sister chromatid exchanges, a variety of chromosomal abnormalities (ring chromosomes, acentric fragments, breaks, and gaps), and an increase in the chromosome number. Nevertheless, the persistently infected cells continued to display a bipolar glial cell-like morphology with extensive process extension and intercellular contacts.

  2. Detection and Automated Scoring of Dicentric Chromosomes in Nonstimulated Lymphocyte Prematurely Condensed Chromosomes After Telomere and Centromere Staining

    SciTech Connect

    M'kacher, Radhia; El Maalouf, Elie; Terzoudi, Georgia; Ricoul, Michelle; Heidingsfelder, Leonhard; Karachristou, Ionna; Laplagne, Eric; Hempel, William M.; Colicchio, Bruno; Dieterlen, Alain; Pantelias, Gabriel; Sabatier, Laure

    2015-03-01

    Purpose: To combine telomere and centromere (TC) staining of premature chromosome condensation (PCC) fusions to identify dicentrics, centric rings, and acentric chromosomes, making possible the realization of a dose–response curve and automation of the process. Methods and Materials: Blood samples from healthy donors were exposed to {sup 60}Co irradiation at varying doses up to 8 Gy, followed by a repair period of 8 hours. Premature chromosome condensation fusions were carried out, and TC staining using peptide nucleic acid probes was performed. Chromosomal aberration (CA) scoring was carried out manually and automatically using PCC-TCScore software, developed in our laboratory. Results: We successfully optimized the hybridization conditions and image capture parameters, to increase the sensitivity and effectiveness of CA scoring. Dicentrics, centric rings, and acentric chromosomes were rapidly and accurately detected, leading to a linear-quadratic dose–response curve by manual scoring at up to 8 Gy. Using PCC-TCScore software for automatic scoring, we were able to detect 95% of dicentrics and centric rings. Conclusion: The introduction of TC staining to the PCC fusion technique has made possible the rapid scoring of unstable CAs, including dicentrics, with a level of accuracy and ease not previously possible. This new approach can be used for biological dosimetry in radiation emergency medicine, where the rapid and accurate detection of dicentrics is a high priority using automated scoring. Because there is no culture time, this new approach can also be used for the follow-up of patients treated by genotoxic therapy, creating the possibility to perform the estimation of induced chromosomal aberrations immediately after the blood draw.

  3. Checkpoints are blind to replication restart and recombination intermediates that result in gross chromosomal rearrangements

    PubMed Central

    Mohebi, Saed; Mizuno, Ken’Ichi; Watson, Adam; Carr, Antony M.; Murray, Johanne M.

    2015-01-01

    Replication fork inactivation can be overcome by homologous recombination, but this can cause gross chromosomal rearrangements that subsequently missegregate at mitosis, driving further chromosome instability. It is unclear when the chromosome rearrangements are generated and whether individual replication problems or the resulting recombination intermediates delay the cell cycle. Here we have investigated checkpoint activation during HR-dependent replication restart using a site-specific replication fork-arrest system. Analysis during a single cell cycle shows that HR-dependent replication intermediates arise in S phase, shortly after replication arrest, and are resolved into acentric and dicentric chromosomes in G2. Despite this, cells progress into mitosis without delay. Neither the DNA damage nor the intra-S phase checkpoints are activated in the first cell cycle, demonstrating that these checkpoints are blind to replication and recombination intermediates as well as to rearranged chromosomes. The dicentrics form anaphase bridges that subsequently break, inducing checkpoint activation in the second cell cycle. PMID:25721418

  4. Amplification of chromosomal DNA in situ

    DOEpatents

    Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.

    2002-01-01

    Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.

  5. Identification and Sequence Analysis of a 27-Kilobase Chromosomal Fragment Containing a Salmonella Pathogenicity Island Located at 92 Minutes on the Chromosome Map of Salmonella enterica Serovar Typhimurium LT2

    PubMed Central

    Wong, Kwong-Kwok; McClelland, Michael; Stillwell, Lisa C.; Sisk, Ellen C.; Thurston, Sarah J.; Saffer, Jeffrey D.

    1998-01-01

    Using a genomic approach, we have identified a new Salmonella pathogenicity island, SPI-4, which is the fourth Salmonella pathogenicity island to be identified. SPI-4 was located at 92 min on the chromosome map and was flanked by the ssb and soxSR loci. The DNA sequence covering the entire SPI-4 and both boundaries was determined. The size of SPI-4 was about 25 kb and it contains 18 putative open reading frames (ORFs). Three of these ORFs encode proteins that have significant homology with proteins involved in toxin secretion. Another five ORFs encode proteins that have significant homology with hypothetical proteins from Synechocystis sp. strain PCC6803 or Acinetobacter calcoaceticus. The rest of the ORFs encode novel proteins, one of which has five membrane-spanning domains. SPI-4 is likely to carry a type I secretion system involved in toxin secretion. Furthermore, a previously identified locus (ims98), which is required for intramacrophage survival, was also mapped within the SPI-4 region. These findings suggested that SPI-4 is needed for intramacrophage survival. PMID:9632606

  6. Lead nitrate hydroxide: A strong second-order optical nonlinearity acentric crystal with high laser damage thresholds

    NASA Astrophysics Data System (ADS)

    Reshak, A. H.

    2016-03-01

    A comprehensive theoretical calculation for the complex first-order linear and the second-order non-linear optical dispersion of acentric lead nitrate hydroxide (Pb16(OH)16(NO3)16) single crystals was performed based on the experimental crystallographic data obtained by Chang et al. [Inorg. Chem. 53, 3320-3325 (2014)]. Calculations show an energy band gap of about 3.70 eV, in close agreement to the measured one (3.78 eV). The energy gap value confirms that the Pb16(OH)16(NO3)16 single crystal exhibits an exceptional laser damage threshold. The complex first-order linear optical dispersion helps to get deep insight into the electronic structure and reveals the existence of considerable anisotropy, negative uniaxial anisotropy, and positive birefringence. The calculated second harmonic generation of Pb16(OH)16(NO3)16 at wavelength ( λ = 1064 nm) shows a good agreement with the reported measured value. In addition, the microscopic first hyperpolarizability was obtained at the static limit and at the wavelength 1064 nm.

  7. Alleviation of radiation-induced genomic damage in human peripheral blood lymphocytes by active principles of Podophyllum hexandrum: an in vitro study using chromosomal and CBMN assay.

    PubMed

    Dutta, Sangeeta; Gupta, Manju Lata

    2014-03-01

    This study was aimed to evaluate the protection against radiation of human peripheral blood lymphocytic DNA by a formulation of three isolated active principles of Podophyllum hexandrum (G-002M). G-002M in various concentrations was administered 1h prior to irradiation in culture media containing blood. Radioprotective efficacy of G-002M to lymphocytic DNA was estimated using various parameters such as dicentrics, micronuclei (MN), nucleoplasmic bridges (NPB) and nuclear buds (NuB) in binucleated cells. Certain experiments to ascertain the G2/M arrest potential of G-002M were also conducted. It was effective in arresting the cells even at half of the concentration of colchicine used. Observations demonstrated a radiation-dose-dependent increase in dicentric chromosomes (DC), acentric fragments, MN, NPB and NuB upto 5Gy. These changes were found significantly decreased by pre-administration of G-002M. A highly significant dose modifying factor (DMF) 1.43 and 1.39 based on dicentric assay and cytokinesis block micronuclei assay, respectively, was observed against 5Gy exposure in the current experiments. G-002M alone in its effective dose did not induct any change in any of the parameters mentioned above. Observations on cell cycle arrest by G-002M showed that the formulation has potential in arresting cells at G2/M, compared with colchicine. Based on significant DMF at highest radiation dose (5Gy) studied currently and meaningful reduction in radiation-induced chromosomal aberrations, we express that G-002M has a potential of minimising radiation-induced DNA (cytogenetic) damage.

  8. Chromosomal Conditions

    MedlinePlus

    ... 150 babies is born with a chromosomal condition. Down syndrome is an example of a chromosomal condition. Because ... all pregnant women be offered prenatal tests for Down syndrome and other chromosomal conditions. A screening test is ...

  9. Methods for chromosome-specific staining

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1995-09-05

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.

  10. Methods and compositions for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    2003-07-22

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  11. Okazaki fragment metabolism.

    PubMed

    Balakrishnan, Lata; Bambara, Robert A

    2013-02-01

    Cellular DNA replication requires efficient copying of the double-stranded chromosomal DNA. The leading strand is elongated continuously in the direction of fork opening, whereas the lagging strand is made discontinuously in the opposite direction. The lagging strand needs to be processed to form a functional DNA segment. Genetic analyses and reconstitution experiments identified proteins and multiple pathways responsible for maturation of the lagging strand. In both prokaryotes and eukaryotes the lagging-strand fragments are initiated by RNA primers, which are removed by a joining mechanism involving strand displacement of the primer into a flap, flap removal, and then ligation. Although the prokaryotic fragments are ~1200 nucleotides long, the eukaryotic fragments are much shorter, with lengths determined by nucleosome periodicity. The prokaryotic joining mechanism is simple and efficient. The eukaryotic maturation mechanism involves many enzymes, possibly three pathways, and regulation that can shift from high efficiency to high fidelity.

  12. Optical selection and collection of DNA fragments

    DOEpatents

    Roslaniec, Mary C.; Martin, John C.; Jett, James H.; Cram, L. Scott

    1998-01-01

    Optical selection and collection of DNA fragments. The present invention includes the optical selection and collection of large (>.mu.g) quantities of clonable, chromosome-specific DNA from a sample of chromosomes. Chromosome selection is based on selective, irreversible photoinactivation of unwanted chromosomal DNA. Although more general procedures may be envisioned, the invention is demonstrated by processing chromosomes in a conventional flow cytometry apparatus, but where no droplets are generated. All chromosomes in the sample are first stained with at least one fluorescent analytic dye and bonded to a photochemically active species which can render chromosomal DNA unclonable if activated. After passing through analyzing light beam(s), unwanted chromosomes are irradiated using light which is absorbed by the photochemically active species, thereby causing photoinactivation. As desired chromosomes pass this photoinactivation point, the inactivating light source is deflected by an optical modulator; hence, desired chromosomes are not photoinactivated and remain clonable. The selection and photoinactivation processes take place on a microsecond timescale. By eliminating droplet formation, chromosome selection rates 50 times greater than those possible with conventional chromosome sorters may be obtained. Thus, usable quantities of clonable DNA from any source thereof may be collected.

  13. Chromosomal Flexibility

    ERIC Educational Resources Information Center

    Journal of College Science Teaching, 2005

    2005-01-01

    Scientists have shown that a genetic element on one chromosome may direct gene activity on another. Howard Hughes Medical Institute (HHMI) researchers report that a multitasking master-control region appears to over-see both a set of its own genes and a related gene on a nearby chromosome. The findings reinforce the growing importance of location…

  14. Chromosomal intrachanges induced by swift iron ions

    NASA Astrophysics Data System (ADS)

    Horstmann, M.; Durante, M.; Johannes, C.; Obe, G.

    We measured the induction of aberrations in human chromosome 5 by iron ions using the novel technique of multicolor banding in situ hybridization (mBAND). Human lymphocytes isolated from whole blood were exposed in vitro to 500 MeV/n (LET=200 keV/μ m, doses 1 or 4 Gy) 56Fe nuclei at the HIMAC accelerator in Chiba (Japan). Chromosomes were prematurely condensed by calyculin A after 48 h in culture, and slides were painted by mBAND (MetaSystems). We found a frequency of 0.11 and 0.57 residual breakpoints per chromosome 5 after 1 Gy and 4 Gy Fe-ions, respectively. The distribution per unit length were similar in the p- and q-arm of chromosome 5, and >50% of the observed fragments measured <30% of the whole chromosome length. Only small fragments (<40% of the chromosome size) were involved in intra-chromosomal exchanges (interstitial deletions or inversions), whereas fragments up to 75% of the whole chromosome 5 were found in inter-chromosomal exchanges. We measured more inter-changes than intra-changes, and more intra-arm than inter-arm exchanges at both doses. No significant differences in the ratios of these aberrations were detected with respect to X-rays. On the other hand, Fe-ions induced a significantly higher fraction of complex-type exchanges when compared to sparsely ionizing radiation. Work supported by DLR, BMBF, INTAS and NIRS-HIMAC.

  15. The role of centromere alignment in meiosis I segregation of homologous chromosomes in Saccharomyces cerevisiae.

    PubMed Central

    Guerra, C E; Kaback, D B

    1999-01-01

    During meiosis, homologous chromosomes pair and then segregate from each other at the first meiotic division. Homologous centromeres appear to be aligned when chromosomes are paired. The role of centromere alignment in meiotic chromosome segregation was investigated in Saccharomyces cerevisiae diploids that contained one intact copy of chromosome I and one copy bisected into two functional centromere-containing fragments. The centromere on one fragment was aligned with the centromere on the intact chromosome while the centromere on the other fragment was either aligned or misaligned. Fragments containing aligned centromeres segregated efficiently from the intact chromosome, while fragments containing misaligned centromeres segregated much less efficiently from the intact chromosome. Less efficient segregation was correlated with crossing over in the region between the misaligned centromeres. Models that suggest that these crossovers impede proper segregation by preventing either a segregation-promoting chromosome alignment on the meiotic spindle or some physical interaction between homologous centromeres are proposed. PMID:10581265

  16. Magma Fragmentation

    NASA Astrophysics Data System (ADS)

    Gonnermann, Helge M.

    2015-05-01

    Magma fragmentation is the breakup of a continuous volume of molten rock into discrete pieces, called pyroclasts. Because magma contains bubbles of compressible magmatic volatiles, decompression of low-viscosity magma leads to rapid expansion. The magma is torn into fragments, as it is stretched into hydrodynamically unstable sheets and filaments. If the magma is highly viscous, resistance to bubble growth will instead lead to excess gas pressure and the magma will deform viscoelastically by fracturing like a glassy solid, resulting in the formation of a violently expanding gas-pyroclast mixture. In either case, fragmentation represents the conversion of potential energy into the surface energy of the newly created fragments and the kinetic energy of the expanding gas-pyroclast mixture. If magma comes into contact with external water, the conversion of thermal energy will vaporize water and quench magma at the melt-water interface, thus creating dynamic stresses that cause fragmentation and the release of kinetic energy. Lastly, shear deformation of highly viscous magma may cause brittle fractures and release seismic energy.

  17. Nanometer-Scale Dissection of Chromosomes by Atomic Force Microscopy Combined with Heat-Denaturing Treatment

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Kazumi; Kuwazaki, Seigo; Yamamoto, Kimiko; Shichiri, Motoharu; Yoshino, Tomoyuki; Ohtani, Toshio; Sugiyama, Shigeru

    2006-03-01

    We have developed a method for dissecting chromosome fragments with a size of a few hundred nanometers by atomic force microscopy (AFM). By using this method, we demonstrated reproducible dissections of silkworm chromosomes in the pachytene phase. The dissected fragments were successfully recovered on the cantilever tips, as confirmed by fluorescent microscopy using fluorescent stained chromosomes. To recover dissected chromosome fragments from a larger chromosome, such as the human metaphase chromosome of a somatic cell, heat denaturation was found to be effective. Further improvements in this method may lead to a novel tool for isolating valuable genes and/or investigating local genome structures in the near future.

  18. Chromosome Abnormalities

    MedlinePlus

    ... decade, newer techniques have been developed that allow scientists and doctors to screen for chromosomal abnormalities without using a microscope. These newer methods compare the patient's DNA to a normal DNA ...

  19. Growth and characterization of acentric BaHf(BO{sub 3}){sub 2} and BaZr(BO{sub 3}){sub 2}

    SciTech Connect

    Mączka, Mirosław; Szymborska-Małek, Katarzyna; Gągor, Anna; Majchrowski, Andrzej

    2015-05-15

    Growth, single crystal X-ray diffraction, polarized Raman and infrared (IR) studies of BaHf(BO{sub 3}){sub 2} are presented. Raman and IR spectra of polycrystalline BaZr(BO{sub 3}){sub 2} are also reported to facilitate assignment of modes. BaHf(BO{sub 3}){sub 2} borate crystallizes in trigonal system, space group R3c, with lattice parameters: a=5.1540(4) Å, c=33.901(3) Å. It accommodates dolomite-like structure doubled in the c direction, which is built of alternating layers of HfO{sub 6} octahedra and BaO{sub 6} distorted trigonal prisms that are connected through borate groups. The obtained structural as well as spectroscopic data show that BaHf(BO{sub 3}){sub 2} is isostructural with BaZr(BO{sub 3}){sub 2} and the deviations from centrosymmetry is small. - Graphical abstract: Arrangement of BO{sub 3} groups in BaHf(BO{sub 3}){sub 2} along the c direction in one unit cell. Dark and light blue denote different borate groups. - Highlights: • BaHf(BO{sub 3}){sub 2} single crystals were grown. • X-ray diffraction showed that this borate crystallizes in the acentric R3c structure. • Raman and IR spectra were measured for BaHf(BO{sub 3}){sub 2} and BaZr(BO{sub 3}){sub 2}, respectively. • Assignment of modes is proposed.

  20. Chromosome and cell genetics

    SciTech Connect

    Sharma, A.K.; Sharma, A.

    1985-01-01

    This book contains 11 chapters. Some of the titles are: Chromosomes in differentiation; Chromosome axis; Nuclear and organelle split genes; Chemical mutagenesis; and Chromosome architecture and additional elements.

  1. 40 CFR 798.5395 - In vivo mammalian bone marrow cytogenetics tests: Micronucleus assay.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    .... Micronuclei are small particles consisting of acentric fragments of chromosomes or entire chromosomes, which... counting a total of 200 erythrocytes. To ensure consistency with OECD and other guidelines, 1,000... recommendations as specified under 40 CFR part 792, subpart J, the following specific information shall...

  2. 40 CFR 798.5395 - In vivo mammalian bone marrow cytogenetics tests: Micronucleus assay.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    .... Micronuclei are small particles consisting of acentric fragments of chromosomes or entire chromosomes, which... counting a total of 200 erythrocytes. To ensure consistency with OECD and other guidelines, 1,000... recommendations as specified under 40 CFR part 792, subpart J, the following specific information shall...

  3. 40 CFR 798.5395 - In vivo mammalian bone marrow cytogenetics tests: Micronucleus assay.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    .... Micronuclei are small particles consisting of acentric fragments of chromosomes or entire chromosomes, which... counting a total of 200 erythrocytes. To ensure consistency with OECD and other guidelines, 1,000... recommendations as specified under 40 CFR part 792, subpart J, the following specific information shall...

  4. 40 CFR 798.5395 - In vivo mammalian bone marrow cytogenetics tests: Micronucleus assay.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    .... Micronuclei are small particles consisting of acentric fragments of chromosomes or entire chromosomes, which... counting a total of 200 erythrocytes. To ensure consistency with OECD and other guidelines, 1,000... recommendations as specified under 40 CFR part 792, subpart J, the following specific information shall...

  5. Biological dosimetry by interphase chromosome painting

    NASA Technical Reports Server (NTRS)

    Durante, M.; George, K.; Yang, T. C.

    1996-01-01

    Both fluorescence in situ hybridization of metaphase spreads with whole-chromosome probes and premature chromosome condensation in interphase nuclei have been used in the past to estimate the radiation dose to lymphocytes. We combined these techniques to evaluate the feasibility of using painted interphase chromosomes for biodosimetry. Human peripheral lymphocytes were exposed to gamma rays and fused to mitotic Chinese hamster cells either immediately after irradiation or after 8 h incubation at 37 degrees C. Interphase or metaphase human chromosomes were hybridized with a composite probe specific for human chromosomes 3 and 4. The dose-response curve for fragment induction immediately after irradiation was linear; these results reflected breakage frequency in the total genome in terms of DNA content per chromosome. At 8 h after irradiation, the dose-response curve for chromosome interchanges, the prevalent aberration in interphase chromosomes, was linear-quadratic and similar to that observed for metaphase chromosomes. These results suggest that painting prematurely condensed chromosomes can be useful for biological dosimetry when blood samples are available shortly after the exposure, or when interphase cells are to be scored instead of mitotic cells.

  6. Chromosome mutations and tissue regeneration in the cornea after the UV laser irradiation

    NASA Astrophysics Data System (ADS)

    Razhev, Alexander M.; Bagayev, Sergei N.; Lebedeva, Lidya I.; Akhmametyeva, Elena M.; Zhupikov, Andrey A.

    2003-06-01

    In present paper the findings on chromosome mutations, the nature of damage and the repair of the cornea tissue after UV irradiation by excimer lasers at 193, 223 and 248 nm were made. Structural mutations induced by short-pulses UV irradiation were shown to be similar to spontaneous ones by the type, time of formation in the mitotic cycle and location of acentrics. Ten hours after irradiation of the cornea with doses of 0,09 to 1,5 J/cm2 the incidence of cells with chromosome aberrations increased linearly with dose and amounted to 11,7% at 248 nm, 5,5% at 223 nm and 2,6% at 193 nm per 1 J/cm2. No induced chromosome aberrations occurred 72 hour following irradiation. Within the dose range from 3,0 to 18 J/cm2 the cytogenesis effect of radiation was less manifest than that with the doses mentioned above, the frequency of chromosome aberrations being independent of either radiation wavelength or radiation dose and amounted of 2,5 to 3,0%. Thus, large doses of powerful short-pulse UV radiation are safe according to the structural mutation criterion.

  7. Chromosome Microarray.

    PubMed

    Anderson, Sharon

    2016-01-01

    Over the last half century, knowledge about genetics, genetic testing, and its complexity has flourished. Completion of the Human Genome Project provided a foundation upon which the accuracy of genetics, genomics, and integration of bioinformatics knowledge and testing has grown exponentially. What is lagging, however, are efforts to reach and engage nurses about this rapidly changing field. The purpose of this article is to familiarize nurses with several frequently ordered genetic tests including chromosomes and fluorescence in situ hybridization followed by a comprehensive review of chromosome microarray. It shares the complexity of microarray including how testing is performed and results analyzed. A case report demonstrates how this technology is applied in clinical practice and reveals benefits and limitations of this scientific and bioinformatics genetic technology. Clinical implications for maternal-child nurses across practice levels are discussed. PMID:27276104

  8. Fe, Ti ordering and octahedral distortions in acentric neptunite: Temperature dependent X-ray and neutron structure refinements and Mössbauer spectroscopy

    NASA Astrophysics Data System (ADS)

    Kunz, Martin; Armbruster, Thomas; Lager, George A.; Schultz, Arthur J.; Goyette, Rick J.; Lottermoser, Werner; Amthauer, Georg

    1991-10-01

    Single-crystal X-ray and neutron structure refinements carried out on neptunite (KNa2Li(Fe, Mg, Mn)2Ti2Si8O24) from San Benito, California at various temperatures (neutrons: 15 K and 293 K; X-rays: 110 K, 293 K and 493 K) indicate that this mineral crystallizes in the acentric space group Cc ( T=293K: a=16.427 Å, b=12.478 Å, c=9.975 Å, β= 115.56°, Z=4, V=1844.53 Å3) due to ordering of octahedrally coordinated metals (Ti, Fe, Mn, Mg). In the neptunite structure, Ti and (Fe, Mn, Mg) octahedra share edges to form chains that run along [110] and [110]. These chains are, in turn, linked through shared corners along [001]. The resulting octahedral framework is interwoven by a similar [Si8O22] tetrahedral framework. Li, Na and K occupy 6-, 8- and 10- coordinated sites within the framework. The metal-containing polyhedra show strong distortions at all temperatures. In particular, Ti exhibits a strong off-center displacement (≈0.25 Å) within its octahedron, leading to four Ti-O distances of 2.0 Å, one of 2.2 Å and one of 1.7 Å. The displaced Ti position is in good agreement with a position that minimizes differences between ionic bond strengths and is interpreted as an energy minimum in an ionic potential model. Mössbauer spectra collected at 77 K, 293 K and 400 K indicate all Fe to be present as octahedral Fe2+. Although two distinct Fe positions were found in the structure, 77 K and 293 K spectra display only one quadrupole doublet. Two Fe sites can only be resolved in the 400 K spectrum. It is suggested that the temperature dependence of octahedral edge distortions is responsible for the separation of the Mössbauer doublets.

  9. Chromosome Analysis

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Perceptive Scientific Instruments, Inc., provides the foundation for the Powergene line of chromosome analysis and molecular genetic instrumentation. This product employs image processing technology from NASA's Jet Propulsion Laboratory and image enhancement techniques from Johnson Space Center. Originally developed to send pictures back to earth from space probes, digital imaging techniques have been developed and refined for use in a variety of medical applications, including diagnosis of disease.

  10. Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

    PubMed

    Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

    1996-06-15

    We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

  11. DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

    PubMed

    Lafuente, M J; Gamo, F J; Gancedo, C

    1996-09-01

    We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

  12. Computational methods for physical mapping of chromosomes

    SciTech Connect

    Torney, D.C.; Schenk, K.R. ); Whittaker, C.C. Los Alamos National Lab., NM ); White, S.W. )

    1990-01-01

    A standard technique for mapping a chromosome is to randomly select pieces, to use restriction enzymes to cut these pieces into fragments, and then to use the fragments for estimating the probability of overlap of these pieces. Typically, the order of the fragments within a piece is not determined, and the observed fragment data from each pair of pieces must be permuted N1 {times} N2 ways to evaluate the probability of overlap, N1 and N2 being the observed number of fragments in the two selected pieces. We will describe computational approaches used to substantially reduce the computational complexity of the calculation of overlap probability from fragment data. Presently, about 10{sup {minus}4} CPU seconds on one processor of an IBM 3090 is required for calculation of overlap probability from the fragment data of two randomly selected pieces, with an average of ten fragments per piece. A parallel version has been written using IBM clustered FORTRAN. Parallel measurements for 1, 6, and 12 processors will be presented. This approach has proven promising in the mapping of chromosome 16 at Los Alamos National Laboratory. We will also describe other computational challenges presented by physical mapping. 4 refs., 4 figs., 1 tab.

  13. Y Chromosome Evolution in the Subgenus Mus (Genus Mus)

    PubMed Central

    Tucker, P. K.; Lee, B. K.; Eicher, E. M.

    1989-01-01

    A 305 base pair DNA sequence isolated from the Y chromosome of the inbred mouse strain C57BL/10 was used to investigate the pattern and tempo of evolution of Y chromosome DNA sequences for five species in the subgenus Mus, including Mus spretus, Mus hortulanus, Mus abbotti, Mus musculus and Mus domesticus. Variation in hybridization patterns between species was characterized by differences in fragment lengths of both intensely and faintly hybridizing fragments, whereas variation in hybridization patterns within species was characterized primarily by differences in fragment lengths of faintly hybridizing fragments. Phylogenetic analyses were conducted based on fragment size variation within and among species. Phylogenetic relationships inferred from these analyses partly agree with the phylogenetic relationships obtained from biochemical and mitochondrial DNA data. We conclude that a set of DNA sequences common to the Y chromosomes of a closely related group of species in the subgenus Mus has evolved rapidly as reflected by sequence divergence and sequence amplification. PMID:2543607

  14. [The role of chromosomal regions anchored to the nuclear envelope in the functional organization of chromosomes].

    PubMed

    Shabarina, A N; Shostak, N G; Glazkov, M V

    2010-09-01

    The functional characteristics of the DNA fragments responsible for chromosome attachment to the nuclear envelope during the interphase (neDNAs) have been studied. The neDNAs flanking the transgene have been found to promote a steadily high rate of its expression, irrespective of the site of its insertion into the host chromosomes. At the same time, neDNAs themselves have no transcription regulatory functions. PMID:21061611

  15. Relationships between chromosome structure and chromosomal aberrations

    NASA Astrophysics Data System (ADS)

    Eidelman, Yuri; Andreev, Sergey

    An interphase nucleus of human lymphocyte was simulated by the novel Monte Carlo tech-nique. The main features of interphase chromosome structure and packaging were taken into account: different levels of chromatin organisation; nonrandom localisation of chromosomes within a nucleus; chromosome loci dynamics. All chromosomes in a nucleus were modelled as polymer globules. A dynamic pattern of intra/interchromosomal contacts was simulated. The detailed information about chromosomal contacts, such as distribution of intrachromoso-mal contacts over the length of each chromosome and dependence of contact probability on genomic separation between chromosome loci, were calculated and compared to the new exper-imental data obtained by the Hi-C technique. Types and frequencies of simple and complex radiation-induced chromosomal exchange aberrations (CA) induced by X-rays were predicted with taking formation and decay of chromosomal contacts into account. Distance dependence of exchange formation probability was calculated directly. mFISH data for human lymphocytes were analysed. The calculated frequencies of simple CA agreed with the experimental data. Complex CA were underestimated despite the dense packaging of chromosome territories within a nucleus. Possible influence of chromosome-nucleus structural organisation on the frequency and spectrum of radiation-induced chromosome aberrations is discussed.

  16. Human chromosome 8.

    PubMed Central

    Wood, S

    1988-01-01

    The role of human chromosome 8 in genetic disease together with the current status of the genetic linkage map for this chromosome is reviewed. Both hereditary genetic disease attributed to mutant alleles at gene loci on chromosome 8 and neoplastic disease owing to somatic mutation, particularly chromosomal translocations, are discussed. PMID:3070042

  17. Molecular Evolution of the Escherichia Coli Chromosome. II. Clonal Segments

    PubMed Central

    Milkman, R.; Stoltzfus, A.

    1988-01-01

    Remarkable sequence similarities in the trp region among Escherichia coli strains of diverse natural origins imply the existence of worldwide clones of very recent origin. This in turn implies a low rate of fixation of new universally favorable alleles, which carry adjacent stretches of chromosome to high frequency. These clonal segments begin as entire chromosomes; recombination shortens them progressively by substituting less closely related homologous DNA. The rate of this recombination, comprising the introduction of a homologous chromosomal fragment to a cell and the replacement of part of the original chromosome, is estimated from observations. PMID:3058547

  18. Delimiting the Origin of a B Chromosome by FISH Mapping, Chromosome Painting and DNA Sequence Analysis in Astyanax paranae (Teleostei, Characiformes)

    PubMed Central

    Silva, Duílio M. Z. de A.; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Araya-Jaime, Cristian; Ruiz-Ruano, Francisco J.; Daniel, Sandro Natal; Hashimoto, Diogo Teruo; Oliveira, Cláudio; Camacho, Juan Pedro M.; Porto-Foresti, Fábio; Foresti, Fausto

    2014-01-01

    Supernumerary (B) chromosomes have been shown to contain a wide variety of repetitive sequences. For this reason, fluorescent in situ hybridisation (FISH) is a useful tool for ascertaining the origin of these genomic elements, especially when combined with painting from microdissected B chromosomes. In order to investigate the origin of B chromosomes in the fish species Astyanax paranae, these two approaches were used along with PCR amplification of specific DNA sequences obtained from the B chromosomes and its comparison with those residing in the A chromosomes. Remarkably, chromosome painting with the one-arm metacentric B chromosome probe showed hybridization signals on entire B chromosome, while FISH mapping revealed the presence of H1 histone and 18S rDNA genes symmetrically placed in both arms of the B chromosome. These results support the hypothesis that the B chromosome of A. paranae is an isochromosome. Additionally, the chromosome pairs Nos. 2 or 23 are considered the possible B chromosome ancestors since both contain syntenic H1 and 18S rRNA sequences. The analysis of DNA sequence fragments of the histone and rRNA genes obtained from the microdissected B chromosomes showed high similarity with those obtained from 0B individuals, which supports the intraspecific origin of B chromosomes in A. paranae. Finally, the population hereby analysed showed a female-biased B chromosome presence suggesting that B chromosomes in this species could influence sex determinism. PMID:24736529

  19. Fractals and fragmentation

    NASA Technical Reports Server (NTRS)

    Turcotte, D. L.

    1986-01-01

    The use of renormalization group techniques on fragmentation problems is examined. The equations which represent fractals and the size-frequency distributions of fragments are presented. Method for calculating the size distributions of asteriods and meteorites are described; the frequency-mass distribution for these interplanetary objects are due to fragmentation. The application of two renormalization group models to fragmentation is analyzed. It is observed that the models yield a fractal behavior for fragmentation; however, different values for the fractal dimension are produced . It is concluded that fragmentation is a scale invariant process and that the fractal dimension is a measure of the fragility of the fragmented material.

  20. Field-flow fractionation of chromosomes

    SciTech Connect

    Giddings, J.C.

    1993-04-01

    The first topic of this project involved the preparation, fractionation by sedimentation/steric Field Flow Fractionation (FFF), and modeling of metaphase chromosomes. After numerous unsuccessful attempts to prepare chromosomes, we have implemented a procedure (in collaboration with Los Alamos National Laboratory) to prepare metaphase chromosomes from Chinese hamster cells. Extensive experimentation was necessary to identify a suitable FFF channel surface to minimize chromosome adsorption and a carrier liquid to stabilize and disperse the chromosomes. Under suitable operating conditions, the Chinese hamster chromosomes were purified from cell debris and partially fractionated. The purified, preenriched chromosomes that can be prepared by sedimentation/steric FFF or produced continuously by continuous SPLITT fractionation provide an enriched feed material for subsequent flow cytometry. In the second project component, flow FFF permitted successful separations of single- from double-stranded circular DNA, double-stranded circular DNAs of various sizes, and linear double-stranded DNA fragments of various lengths. Diffusion coefficients extracted from retention data agreed well with literature data as well as predictions of major polymer theories. The capacity of FFF separations was evaluated to examine potential applications to long DNA chains.

  1. Undetected sex chromosome aneuploidy by chromosomal microarray.

    PubMed

    Markus-Bustani, Keren; Yaron, Yuval; Goldstein, Myriam; Orr-Urtreger, Avi; Ben-Shachar, Shay

    2012-11-01

    We report on a case of a female fetus found to be mosaic for Turner syndrome (45,X) and trisomy X (47,XXX). Chromosomal microarray analysis (CMA) failed to detect the aneuploidy because of a normal average dosage of the X chromosome. This case represents an unusual instance in which CMA may not detect chromosomal aberrations. Such a possibility should be taken into consideration in similar cases where CMA is used in a clinical setting.

  2. The precarious prokaryotic chromosome.

    PubMed

    Kuzminov, Andrei

    2014-05-01

    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other "precarious" features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction.

  3. B-chromosome evolution.

    PubMed Central

    Camacho, J P; Sharbel, T F; Beukeboom, L W

    2000-01-01

    B chromosomes are extra chromosomes to the standard complement that occur in many organisms. They can originate in a number of ways including derivation from autosomes and sex chromosomes in intra- and interspecies crosses. Their subsequent molecular evolution resembles that of univalent sex chromosomes, which involves gene silencing, heterochromatinization and the accumulation of repetitive DNA and transposons. B-chromosome frequencies in populations result from a balance between their transmission rates and their effects on host fitness. Their long-term evolution is considered to be the outcome of selection on the host genome to eliminate B chromosomes or suppress their effects and on the B chromosome's ability to escape through the generation of new variants. Because B chromosomes interact with the standard chromosomes, they can play an important role in genome evolution and may be useful for studying molecular evolutionary processes. PMID:10724453

  4. Chromosome end elongation by recombination in the mosquito Anopheles gambiae.

    PubMed Central

    Roth, C W; Kobeski, F; Walter, M F; Biessmann, H

    1997-01-01

    One of the functions of telomeres is to counteract the terminal nucleotide loss associated with DNA replication. While the vast majority of eukaryotic organisms maintain their chromosome ends via telomerase, an enzyme system that generates short, tandem repeats on the ends of chromosomes, other mechanisms such as the transposition of retrotransposons or recombination can also be used in some species. Chromosome end regression and extension were studied in a medically important mosquito, the malaria vector Anopheles gambiae, to determine how this dipteran insect maintains its chromosome ends. The insertion of a transgenic pUChsneo plasmid at the left end of chromosome 2 provided a unique marker for measuring the dynamics of the 2L telomere over a period of about 3 years. The terminal length was relatively uniform in the 1993 population with the chromosomes ending within the white gene sequence of the inserted transgene. Cloned terminal chromosome fragments did not end in short repeat sequences that could have been synthesized by telomerase. By late 1995, the chromosome ends had become heterogeneous: some had further shortened while other chromosomes had been elongated by regenerating part of the integrated pUChsneo plasmid. A model is presented for extension of the 2L chromosome by recombination between homologous 2L chromosome ends by using the partial plasmid duplication generated during its original integration. It is postulated that this mechanism is also important in wild-type telomere elongation. PMID:9271395

  5. Integrative bacterial artificial chromosomes for DNA integration into the Bacillus subtilis chromosome.

    PubMed

    Juhas, Mario; Ajioka, James W

    2016-06-01

    Bacillus subtilis is a well-characterized model bacterium frequently used for a number of biotechnology and synthetic biology applications. Novel strategies combining the advantages of B. subtilis with the DNA assembly and editing tools of Escherichia coli are crucial for B. subtilis engineering efforts. We combined Gibson Assembly and λ red recombineering in E. coli with RecA-mediated homologous recombination in B. subtilis for bacterial artificial chromosome-mediated DNA integration into the well-characterized amyE target locus of the B. subtilis chromosome. The engineered integrative bacterial artificial chromosome iBAC(cav) can accept any DNA fragment for integration into B. subtilis chromosome and allows rapid selection of transformants by B. subtilis-specific antibiotic resistance and the yellow fluorescent protein (mVenus) expression. We used the developed iBAC(cav)-mediated system to integrate 10kb DNA fragment from E. coli K12 MG1655 into B. subtilis chromosome. iBAC(cav)-mediated chromosomal integration approach will facilitate rational design of synthetic biology applications in B. subtilis.

  6. Telomere Restriction Fragment (TRF) Analysis

    PubMed Central

    Mender, Ilgen; Shay, Jerry W.

    2016-01-01

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al., 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al., 1990; Ouellette et al., 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  7. [Understanding mitochondrial genome fragmentation in parasitic lice (Insecta: Phthiraptera)].

    PubMed

    Dong, Wen-Ge; Guo, Xian-Guo; Jin, Dao-Chao; Xue, Shi-Peng; Qin, Feng; Simon, Song; Stephen, C Barker; Renfu, Shao

    2013-07-01

    Lice are obligate ectoparasites of mammals and birds. Extensive fragmentation of mitochondrial genomes has been found in some louse species in the families Pediculidae, Pthiridae, Philopteridae and Trichodectidae. For example, the mt genomes of human body louse (Pediculus humanus), head louse (Pediculus capitis), and public louse (Pthirus pubis) have 20, 20 and 14 mini-chromosomes, respectively. These mini-chromosomes might be the results of deletion and recombination of mt genes. The factors and mechanisms of mitochondrial genome fragmentation are currently unknown. The fragmentation might be the results of evolutionary selection or random genetic drift or it is probably related to the lack of mtSSB (mitochondrial single-strand DNA binding protein). Understanding the fragmentation of mitochondrial genomes is of significance for understanding the origin and evolution of mitochondria. This paper reviews the recent advances in the studies of mito-chondrial genome fragmentation in lice, including the phenomena of mitochondrial genome fragmentation, characteristics of fragmented mitochondrial genomes, and some factors and mechanisms possibly leading to the mitochondrial genome fragmentation of lice. Perspectives for future studies on fragmented mt genomes are also discussed. PMID:23853355

  8. [Understanding mitochondrial genome fragmentation in parasitic lice (Insecta: Phthiraptera)].

    PubMed

    Dong, Wen-Ge; Guo, Xian-Guo; Jin, Dao-Chao; Xue, Shi-Peng; Qin, Feng; Simon, Song; Stephen, C Barker; Renfu, Shao

    2013-07-01

    Lice are obligate ectoparasites of mammals and birds. Extensive fragmentation of mitochondrial genomes has been found in some louse species in the families Pediculidae, Pthiridae, Philopteridae and Trichodectidae. For example, the mt genomes of human body louse (Pediculus humanus), head louse (Pediculus capitis), and public louse (Pthirus pubis) have 20, 20 and 14 mini-chromosomes, respectively. These mini-chromosomes might be the results of deletion and recombination of mt genes. The factors and mechanisms of mitochondrial genome fragmentation are currently unknown. The fragmentation might be the results of evolutionary selection or random genetic drift or it is probably related to the lack of mtSSB (mitochondrial single-strand DNA binding protein). Understanding the fragmentation of mitochondrial genomes is of significance for understanding the origin and evolution of mitochondria. This paper reviews the recent advances in the studies of mito-chondrial genome fragmentation in lice, including the phenomena of mitochondrial genome fragmentation, characteristics of fragmented mitochondrial genomes, and some factors and mechanisms possibly leading to the mitochondrial genome fragmentation of lice. Perspectives for future studies on fragmented mt genomes are also discussed.

  9. Chromatin structure and ionizing-radiation-induced chromosome aberrations

    SciTech Connect

    Muehlmann-Diaz, M.C.

    1993-01-01

    The possible influence of chromatic structure or activity on chromosomal radiosensitivity was studied. A cell line was isolated which contained some 10[sup 5] copies of an amplified plasmid in a single large mosquito artificial chromosome (MAC). This chromosome was hypersensitive to DNase I. Its radiosensitivity was some three fold greater than normal mosquito chromosomes in the same cell. In cultured human cells irradiated during G[sub 0], the initial breakage frequency in chromosome 4, 19 and the euchromatic and heterochromatic portions of the Y chromosome were measured over a wide range of doses by inducing Premature Chromosome Condensation (PCC) immediately after irradiation with Cs-137 gamma rays. No evidence was seen that Y heterochromatin or large fragments of it remained unbroken. The only significant deviation from the expected initial breakage frequency per Gy per unit length of chromosome was that observed for the euchromatic portion of the Y chromosome, with breakage nearly twice that expected. The development of aberrations involving X and Y chromosomes at the first mitosis after irradation was also studied. Normal female cells sustained about twice the frequency of aberrations involving X chromosomes for a dose of 7.3 Gy than the corresponding male cells. Fibroblasts from individuals with supernumerary X chromosomes did not show any further increase in X aberrations for this dos. The frequency of aberrations involving the heterochromatic portion of the long arm of the Y chromosome was about what would be expected for a similar length of autosome, but the euchromatic portion of the Y was about 3 times more radiosensitive per unit length. 5-Azacytidine treatment of cultured human female fibroblasts or fibroblasts from a 49,XXXXY individual, reduced the methylation of cytosine residues in DNA, and resulted in an increased chromosomal radiosensitivity in general, but it did not increase the frequency of aberrations involving the X chromosomes.

  10. Isolation of a single rice chromosome by optical micromanipulation

    NASA Astrophysics Data System (ADS)

    Wang, Haowei; Liu, Xiaohui; Li, Yinmei; Han, Bin; Lou, Liren; Wang, Kangjun

    2004-01-01

    A new method based on optical tweezers technology is reported for the isolation of a single chromosome. A rice cell suspended in liquid was first fragmented by laser pulses (optical scalpel). Then a single released chromosome from the cell was manipulated and pulled away from other cells and oddments by optical tweezers without any direct mechanical contact. Finally the isolated single chromosome was extracted individually into a glass capillary nearby. After molecular cloning of the isolated chromosome, we obtained some specific DNA segments from the single chromosome. All these segments can be used for rice genomic sequencing. Different methods of extracting a single chromosome are compared. The advantages of optical micromanipulation method are summarized.

  11. Chromosome Disorder Outreach

    MedlinePlus

    ... BLOG Join Us Donate You are not alone. Chromosome Disorder Outreach, Inc. is a non-profit organization, ... Support For all those diagnosed with any rare chromosome disorder. Since 1992, CDO has supported the parents ...

  12. Chromosome map of the thermophilic archaebacterium Thermococcus celer

    NASA Technical Reports Server (NTRS)

    Noll, K. M.; Woese, C. R. (Principal Investigator)

    1989-01-01

    A physical map for the chromosome of the thermophilic archaebacterium Thermococcus celer Vu13 has been constructed. Thirty-four restriction endonucleases were tested for their ability to generate large restriction fragments from the chromosome of T. celer. Of these, the enzymes NheI, SpeI, and XbaI yielded the fewest fragments when analyzed by pulsed-field electrophoresis. NheI and SpeI each gave 5 fragments, while XbaI gave 12. The size of the T. celer chromosome was determined from the sum of the apparent sizes of restriction fragments derived from single and double digests by using these enzymes and was found to be 1,890 +/- 27 kilobase pairs. Partial and complete digests allowed the order of all but three small (less than 15 kilobase pairs) fragments to be deduced. These three fragments were assigned positions by using hybridization probes derived from these restriction fragments. The positions of the other fragments were confirmed by using hybridization probes derived in the same manner. The positions of the 5S, 16S, and 23S rRNA genes as well as the 7S RNA gene were located on this map by using cloned portions of these genes as hybridization probes. The 5S rRNA gene was localized 48 to 196 kilobases from the 5' end of the 16S gene. The 7S RNA gene was localized 190 to 504 kilobases from the 3' end of the 23S gene. These analyses demonstrated that the chromosome of T. celer is a single, circular DNA molecule. This is the first such demonstration of the structure of an archaebacterial chromosome.

  13. Abnormal human sex chromosome constitutions

    SciTech Connect

    1993-12-31

    Chapter 22, discusses abnormal human sex chromosome constitution. Aneuploidy of X chromosomes with a female phenotype, sex chromosome aneuploidy with a male phenotype, and various abnormalities in X chromosome behavior are described. 31 refs., 2 figs.

  14. Chromosomal Disorders and Autism.

    ERIC Educational Resources Information Center

    Gillberg, Christopher

    1998-01-01

    This paper reviews the literature on chromosomal aberrations in autism, especially possible gene markers. It notes that Chromosome 15 and numerical and structural abnormalities of the sex chromosomes have been most frequently reported as related to the genesis of autism. (Author/DB)

  15. Selectable fragmentation warhead

    SciTech Connect

    Bryan, C.S.; Paisley, D.L.; Montoya, N.I.; Stahl, D.B.

    1992-12-31

    This report discusses a selectable fragmentation warhead which is capable of producing a predetermined number of fragments from a metal plate, and accelerating the fragments toward a target. A first explosive located adjacent to the plate is detonated at selected number of points by laser-driven slapper detonators. In one embodiment, a smoother-disk and a second explosive, located adjacent to the first explosive, serve to increase acceleration of the fragments toward a target. The ability to produce a selected number of fragments allows for effective destruction of a chosen target.

  16. Selectable fragmentation warhead

    DOEpatents

    Bryan, Courtney S.; Paisley, Dennis L.; Montoya, Nelson I.; Stahl, David B.

    1993-01-01

    A selectable fragmentation warhead capable of producing a predetermined number of fragments from a metal plate, and accelerating the fragments toward a target. A first explosive located adjacent to the plate is detonated at selected number of points by laser-driven slapper detonators. In one embodiment, a smoother-disk and a second explosive, located adjacent to the first explosive, serve to increase acceleration of the fragments toward a target. The ability to produce a selected number of fragments allows for effective destruction of a chosen target.

  17. Physical map of the Brucella melitensis 16 M chromosome.

    PubMed Central

    Allardet-Servent, A; Carles-Nurit, M J; Bourg, G; Michaux, S; Ramuz, M

    1991-01-01

    We present the first restriction map of the Brucella melitensis 16 M chromosome obtained by Southern blot hybridization of SpeI, XhoI, and XbaI fragments separated by pulsed-field gel electrophoresis. All restriction fragments (a total of 113) were mapped into an open circle. The main difficulty in mapping involved the exceedingly high number of restriction fragments, as was expected considering the 59% G + C content of the Brucella genome. Several cloned genes were placed on this map, especially rRNA operons which are repeated three times. The size of the B. melitensis chromosome, estimated as 2,600 kb long in a previous study, appeared longer (3,130 kb) by restriction mapping. This restriction map is an initial approach to achieve a genetic map of the Brucella chromosome. Images PMID:2007548

  18. Physical map of the linear chromosome of Streptomyces griseus.

    PubMed Central

    Lezhava, A; Mizukami, T; Kajitani, T; Kameoka, D; Redenbach, M; Shinkawa, H; Nimi, O; Kinashi, H

    1995-01-01

    The chromosomal DNA of Streptomyces griseus 2247 (a derivative of strain IFO3237) was digested with several restriction endonucleases and analyzed by pulsed-field gel electrophoresis (PFGE). Digestion with AseI and DraI gave 15 and 9 fragments, respectively, the total sizes of which were 7.8 Mb. All the AseI and DraI fragments were aligned on a linear chromosome map by using linking plasmids and cosmids. PFGE analysis of the intact chromosome also showed a linear DNA band of about 8 Mb. Detailed physical maps of both terminal regions were constructed; they revealed the presence of a 24-kb terminal inverted repeat on each end. PFGE analysis with and without proteinase K treatment suggested that each end of the chromosome carries a protein molecule. PMID:7592425

  19. Mapping strategies: Chromosome 16 workshop

    SciTech Connect

    Not Available

    1989-01-01

    The following topics from a workshop on chromosome 16 are briefly discussed: genetic map of chromosome 16; chromosome breakpoint map of chromosome 16; integrated physical/genetic map of chromosome 16; pulsed field map of the 16p13.2--p13.3 region (3 sheets); and a report of the HGM10 chromosome 16 committee.

  20. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    PubMed Central

    Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana

    2016-01-01

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis. PMID:27425629

  1. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    PubMed

    Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana

    2016-07-18

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis.

  2. The Distribution of Chromosomal Aberrations in Human Cells Predicted by a Generalized Time-Dependent Model of Radiation-Induced Formation of Aberrations

    NASA Technical Reports Server (NTRS)

    Ponomarev, Artem L.; George, K.; Cucinotta, F. A.

    2011-01-01

    New experimental data show how chromosomal aberrations for low- and high-LET radiation are dependent on DSB repair deficiencies in wild-type, AT and NBS cells. We simulated the development of chromosomal aberrations in these cells lines in a stochastic track-structure-dependent model, in which different cells have different kinetics of DSB repair. We updated a previously formulated model of chromosomal aberrations, which was based on a stochastic Monte Carlo approach, to consider the time-dependence of DSB rejoining. The previous version of the model had an assumption that all DSBs would rejoin, and therefore we called it a time-independent model. The chromosomal-aberrations model takes into account the DNA and track structure for low- and high-LET radiations, and provides an explanation and prediction of the statistics of rare and more complex aberrations. We compared the program-simulated kinetics of DSB rejoining to the experimentally-derived bimodal exponential curves of the DSB kinetics. We scored the formation of translocations, dicentrics, acentric and centric rings, deletions, and inversions. The fraction of DSBs participating in aberrations was studied in relation to the rejoining time. Comparisons of simulated dose dependence for simple aberrations to the experimental dose-dependence for HF19, AT and NBS cells will be made.

  3. Identification of bacterial cells by chromosomal painting.

    PubMed Central

    Lanoil, B D; Giovannoni, S J

    1997-01-01

    Chromosomal painting is a technique for the microscopic localization of genetic material. It has been applied at the subcellular level to identify regions of eukaryotic chromosomes. Here we describe the development of bacterial chromosomal painting (BCP), a related technology for the identification of bacterial cells. Purified genomic DNAs from six bacterial strains were labeled by nick translation with the fluorochrome Fluor-X, Cy3, or Cy5. The average size of the labeled fragments was ca. 50 to 200 bp. The probes were hybridized to formaldehyde-fixed microbial cells attached to slides and visualized by fluorescence microscopy. In reciprocal comparisons, distantly related members of the class Proteobacteria (Escherichia coli and Oceanospirillum linum), different species of the genus Bacillus (B. subtilis and B. megaterium), and different serotypes of the subspecies Salmonella choleraesuis subsp. choleraesuis (serotype typhimurium LT2 and serotype typhi Ty2) could easily be distinguished. A combination of two probes, each labeled with a different fluorochrome, was used successfully to simultaneously identify two cell types in a mixture. Lysozyme treatment was required for the identification of Bacillus spp., and RNase digestion and pepsin digestion were found to enhance signal strength and specificity for all cell types tested. Chromosome in situ suppression, a technique that removes cross-hybridizing fragments from the probe, was necessary for the differentiation of the Salmonella serotypes but was not required to distinguish the more distantly related taxa. BCP may have applications in diverse branches of microbiology where the objective is the identification of bacterial cells. PMID:9055426

  4. Universality of fragment shapes

    PubMed Central

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-01-01

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism. PMID:25772300

  5. Universality of fragment shapes.

    PubMed

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-01-01

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism. PMID:25772300

  6. Fragmentation properties of metals

    SciTech Connect

    Grady, D.E.; Kipp, M.E.

    1996-06-01

    In the present study we are developing an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests, both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  7. Interchromosomal Duplications on the Bactrocera oleae Y Chromosome Imply a Distinct Evolutionary Origin of the Sex Chromosomes Compared to Drosophila

    PubMed Central

    Gabrieli, Paolo; Gomulski, Ludvik M.; Bonomi, Angelica; Siciliano, Paolo; Scolari, Francesca; Franz, Gerald; Jessup, Andrew; Malacrida, Anna R.; Gasperi, Giuliano

    2011-01-01

    Background Diptera have an extraordinary variety of sex determination mechanisms, and Drosophila melanogaster is the paradigm for this group. However, the Drosophila sex determination pathway is only partially conserved and the family Tephritidae affords an interesting example. The tephritid Y chromosome is postulated to be necessary to determine male development. Characterization of Y sequences, apart from elucidating the nature of the male determining factor, is also important to understand the evolutionary history of sex chromosomes within the Tephritidae. We studied the Y sequences from the olive fly, Bactrocera oleae. Its Y chromosome is minute and highly heterochromatic, and displays high heteromorphism with the X chromosome. Methodology/Principal Findings A combined Representational Difference Analysis (RDA) and fluorescence in-situ hybridization (FISH) approach was used to investigate the Y chromosome to derive information on its sequence content. The Y chromosome is strewn with repetitive DNA sequences, the majority of which are also interdispersed in the pericentromeric regions of the autosomes. The Y chromosome appears to have accumulated small and large repetitive interchromosomal duplications. The large interchromosomal duplications harbour an importin-4-like gene fragment. Apart from these importin-4-like sequences, the other Y repetitive sequences are not shared with the X chromosome, suggesting molecular differentiation of these two chromosomes. Moreover, as the identified Y sequences were not detected on the Y chromosomes of closely related tephritids, we can infer divergence in the repetitive nature of their sequence contents. Conclusions/Significance The identification of Y-linked sequences may tell us much about the repetitive nature, the origin and the evolution of Y chromosomes. We hypothesize how these repetitive sequences accumulated and were maintained on the Y chromosome during its evolutionary history. Our data reinforce the idea that the

  8. The transfer of human artificial chromosomes via cryopreserved microcells.

    PubMed

    Uno, Narumi; Uno, Katsuhiro; Zatti, Susi; Ueda, Kana; Hiratsuka, Masaharu; Katoh, Motonobu; Oshimura, Mitsuo

    2013-10-01

    Microcell-mediated chromosome transfer (MMCT) technology enables a single and intact mammalian chromosome or megabase-sized chromosome fragments to be transferred from donor to recipient cells. The conventional MMCT method is performed immediately after the purification of microcells. The timing of the isolation of microcells and the preparation of recipient cells is very important. Thus, ready-made microcells can improve and simplify the process of MMCT. Here, we established a cryopreservation method to store microcells at -80 °C, and compared these cells with conventionally- (immediately-) prepared cells with respect to the efficiency of MMCT and the stability of a human artificial chromosome (HAC) transferred to human HT1080 cells. The HAC transfer in microcell hybrids was confirmed by FISH analysis. There was no significant difference between the two methods regarding chromosome transfer efficiency and the retention rate of HAC. Thus, cryopreservation of ready-to-use microcells provides an improved and simplified protocol for MMCT.

  9. Chromosomal polymorphism in the Sporothrix schenckii complex.

    PubMed

    Sasaki, Alexandre A; Fernandes, Geisa F; Rodrigues, Anderson M; Lima, Fábio M; Marini, Marjorie M; Dos S Feitosa, Luciano; de Melo Teixeira, Marcus; Felipe, Maria Sueli Soares; da Silveira, José Franco; de Camargo, Zoilo P

    2014-01-01

    Sporotrichosis is a polymorphic disease caused by a complex of thermodimorphic fungi including S. brasiliensis, S. schenckii sensu stricto (s. str.), S. globosa and S. luriei. Humans and animals can acquire the disease through traumatic inoculation of propagules into the subcutaneous tissue. Despite the importance of sporotrichosis as a disease that can take epidemic proportions there are just a few studies dealing with genetic polymorphisms and genomic architecture of these pathogens. The main objective of this study was to investigate chromosomal polymorphisms and genomic organization among different isolates in the S. schenckii complex. We used pulsed field gel electrophoresis (PFGE) to separate chromosomal fragments of isolated DNA, followed by probe hybridization. Nine loci (β-tubulin, calmodulin, catalase, chitin synthase 1, Internal Transcribed Spacer, Pho85 cyclin-dependent kinase, protein kinase C Ss-2, G protein α subunit and topoisomerase II) were mapped onto chromosomal bands of Brazilian isolates of S. schenckii s. str. and S. brasiliensis. Our results revealed the presence of intra and interspecies polymorphisms in chromosome number and size. The gene hybridization analysis showed that closely related species in phylogenetic analysis had similar genetic organizations, mostly due to identification of synteny groups in chromosomal bands of similar sizes. Our results bring new insights into the genetic diversity and genome organization among pathogenic species in the Sporothrix schenckii complex.

  10. Chromosomal Polymorphism in the Sporothrix schenckii Complex

    PubMed Central

    Sasaki, Alexandre A.; Fernandes, Geisa F.; Rodrigues, Anderson M.; Lima, Fábio M.; Marini, Marjorie M.; dos S. Feitosa, Luciano; de Melo Teixeira, Marcus; Felipe, Maria Sueli Soares; da Silveira, José Franco; de Camargo, Zoilo P.

    2014-01-01

    Sporotrichosis is a polymorphic disease caused by a complex of thermodimorphic fungi including S. brasiliensis, S. schenckii sensu stricto (s. str.), S. globosa and S. luriei. Humans and animals can acquire the disease through traumatic inoculation of propagules into the subcutaneous tissue. Despite the importance of sporotrichosis as a disease that can take epidemic proportions there are just a few studies dealing with genetic polymorphisms and genomic architecture of these pathogens. The main objective of this study was to investigate chromosomal polymorphisms and genomic organization among different isolates in the S. schenckii complex. We used pulsed field gel electrophoresis (PFGE) to separate chromosomal fragments of isolated DNA, followed by probe hybridization. Nine loci (β-tubulin, calmodulin, catalase, chitin synthase 1, Internal Transcribed Spacer, Pho85 cyclin-dependent kinase, protein kinase C Ss-2, G protein α subunit and topoisomerase II) were mapped onto chromosomal bands of Brazilian isolates of S. schenckii s. str. and S. brasiliensis. Our results revealed the presence of intra and interspecies polymorphisms in chromosome number and size. The gene hybridization analysis showed that closely related species in phylogenetic analysis had similar genetic organizations, mostly due to identification of synteny groups in chromosomal bands of similar sizes. Our results bring new insights into the genetic diversity and genome organization among pathogenic species in the Sporothrix schenckii complex. PMID:24466257

  11. Molecular mapping of chromosomes 17 and X

    SciTech Connect

    Barker, D.F.

    1991-01-15

    Progress toward the construction of high density genetic maps of chromosomes 17 and X has been made by isolating and characterizing a relatively large set of polymorphic probes for each chromosome and using these probes to construct genetic maps. We have mapped the same polymorphic probes against a series of chromosome breakpoints on X and 17. The probes could be assigned to over 30 physical intervals on the X chromosome and 7 intervals on 17. In many cases, this process resulted in improved characterization of the relative locations of the breakpoints with respect to each other and the definition of new physical intervals. The strategy for isolation of the polymorphic clones utilized chromosome specific libraries of 1--15 kb segments from each of the two chromosomes. From these libraries, clones were screened for those detecting restriction fragment length polymorphisms. The markers were further characterized, the chromosomal assignments confirmed and in most cases segments of the original probes were subcloned into plasmids to produce probes with improved signal to noise ratios for use in the genetic marker studies. The linkage studies utilize the CEPH reference families and other well-characterized families in our collection which have been used for genetic disease linkage work. Preliminary maps and maps of portions of specific regions of 17 and X are provided. We have nearly completed a map of the 1 megabase Mycoplasma arthritidis genome by applying these techniques to a lambda phage library of its genome. We have found bit mapping to be an efficient means to organize a contiguous set of overlapping clones from a larger genome.

  12. Chromosomal aberration analysis among underground water well workers in Saudi Arabia.

    PubMed

    AlSuhaibani, Entissar S

    2011-03-01

    In the absence of permanent rivers or bodies of water, half of the Saudi Arabia domestic water consumption is provided through desalination. The other half is derived from groundwater. Groundwater from the Disi aquifer is already used for drinking water in parts of Jordan and, more extensively, in Saudi Arabia, where it is known as the Saq aquifer. Some of the geological analyses of the host sandstone aquifer rocks show (228)Ra and (226)Ra. The usefulness of chromosomal aberrations analysis as a bioindicator for ionising radiation effect was tested in underground water well workers of Saudi Arabia in this industry producing technologically enhanced naturally occurring radioactive material. The incidence of chromosomal aberrations was evaluated using the metaphase analysis method in the lymphocytes of peripheral blood of 10 persons working in underground water well. The age range of the workers was 25-40 y and their duration of service ranged from 3-7 y. For comparison, blood samples were also collected from 10 subjects (controls) who belonged to same age and socioeconomic status. Subjects in the both groups were non-smokers and non-alcoholics. Results showed that the mean frequencies of dicentrics and acentrics in underground water well workers are significantly higher than those in controls. The higher frequency of chromosomal aberration in lymphocytes of underground water well workers compared with controls could be due to the accumulative effect of radiation. The results of this study demonstrated that occupational exposure to radiation leads to a significant induction of cytogenetic damage in peripheral lymphocytes of workers engaged in underground water well.

  13. Molecular characterization of the pericentric inversion that causes differences between chimpanzee chromosome 19 and human chromosome 17.

    PubMed

    Kehrer-Sawatzki, Hildegard; Schreiner, Bettina; Tänzer, Simone; Platzer, Matthias; Müller, Stefan; Hameister, Horst

    2002-08-01

    A comparison of the human genome with that of the chimpanzee is an attractive approach to attempts to understand the specificity of a certain phenotype's development. The two karyotypes differ by one chromosome fusion, nine pericentric inversions, and various additions of heterochromatin to chromosomal telomeres. Only the fusion, which gave rise to human chromosome 2, has been characterized at the sequence level. During the present study, we investigated the pericentric inversion by which chimpanzee chromosome 19 differs from human chromosome 17. Fluorescence in situ hybridization was used to identify breakpoint-spanning bacterial artificial chromosomes (BACs) and plasmid artificial chromosomes (PACs). By sequencing the junction fragments, we localized breakpoints in intergenic regions rich in repetitive elements. Our findings suggest that repeat-mediated nonhomologous recombination has facilitated inversion formation. No addition or deletion of any sequence element was detected at the breakpoints or in the surrounding sequences. Next to the break, at a distance of 10.2-39.1 kb, the following genes were found: NGFR and NXPH3 (on human chromosome 17q21.3) and GUC2D and ALOX15B (on human chromosome 17p13). The inversion affects neither the genomic structure nor the gene-activity state with regard to replication timing of these genes.

  14. UV-A breakage sensitivity of human chromosomes as measured by COMET-FISH depends on gene density and not on the chromosome size.

    PubMed

    Rapp, A; Bock, C; Dittmar, H; Greulich, K O

    2000-07-01

    COMET-FISH, a single cell-based combination of COMET-assay (also known as single cell gel electrophoresis (SCGE)) with fluorescence in situ hybridization (FISH) allows region specific studies on DNA stability and damage. COMET-FISH can be used to investigate UV-A-induced DNA damage of selected whole chromosomes. In the present work, a modified COMET-FISH protocol with whole chromosome painting probes was used to study whether UV-A-induced DNA damage is distributed randomly over the whole genome or occurs at preferred sites. The study was performed with 12 different chromosome painting probes (for chromosomes 1, 2, 3, 8, 9, 11, 14, 18, 19, 21, X and Y). The results on human lymphocytes irradiated with 500 kJ/m2 at a wavelength of 365 nm indicate that the induced number of chromatin strand breaks does not correlate with the chromosome size. They therefore are distributed in a non-random manner. For example, fragments of the gene-rich chromosome chromosome 1 were found in the comet tail in only 3% of the examined cells, and thus chromosome 1 is rather stable, whereas fragmentation of the gene-poor chromosome 8 was observed in 25% of all comets. On the basis of all 12 chromosomes analyzed, an inverse correlation between the density of active genes and the sensitivity toward UV-A radiation is found. PMID:11079471

  15. Comparison of cell repair mechanisms by means of chromosomal aberration induced by proton and gamma irradiation - preliminary results

    NASA Astrophysics Data System (ADS)

    Kowalska, A.; Czerski, K.; Kaczmarski, M.; Lewocki, M.; Masojć, B.; Łukowiak, A.

    2015-03-01

    DNA damage of peripheral blood lymphocytes exposed to gamma and proton irradiation is studied by means of chromosome aberrations to validate the efficiency of the repair mechanisms of individual cells. A new method based on an observed deviation from the Poisson statistics of the chromosome aberration number is applied for estimation of a repair factor ( RF) defined as a ratio between originally damaged cells to the amount of finally observed aberrations. The repair factors are evaluated by studying the variance of individual damage factors in a collective of healthy persons at a given dose as well as by using the chi-square analysis for the dose-effect curves. The blood samples from fifteen donors have been irradiated by Co60 gamma rays and from nine persons by 150 MeV protons with different doses up to 2 Gy. A standard extraction of lymphocyte has been used whereby dicentrics, acentrics and rings have been scored under a microscope. The RF values determined for the proton radiation are slightly larger than for gamma rays, indicating that up to 70% DNA double strand breaks can be repaired.

  16. Selectable fragmentation warhead

    SciTech Connect

    Bryan, C.S.; Paisley, D.L.; Montoya, N.I.; Stahl, D.B.

    1993-07-20

    A selectable fragmentation warhead is described comprising: a case having proximal and distal ends; a fragmenting plate mounted in said distal end of said casing; first explosive means cast adjacent to said fragmenting plate for creating a predetermined number of fragments from said fragmenting plate; three or more first laser-driven slapper detonators located adjacent to said first explosive means for detonating said first explosive means in a predetermined pattern; smoother-disk means located adjacent to said first means for accelerating said fragments; second explosive means cast adjacent to said smoother-disk means for further accelerating said fragments; at least one laser-driven slapper detonators located in said second explosive means; a laser located in said proximal end of said casing; optical fibers connecting said laser to said first and second laser-driven slapper detonators; and optical switch means located in series with said optical fibers connected to said plurality of first laser-driven slapper detonators for blocking or passing light from said laser to said plurality of first laser-driven slapper detonators.

  17. Opaque rock fragments

    SciTech Connect

    Abhijit, B.; Molinaroli, E.; Olsen, J.

    1987-05-01

    The authors describe a new, rare, but petrogenetically significant variety of rock fragments from Holocene detrital sediments. Approximately 50% of the opaque heavy mineral concentrates from Holocene siliciclastic sands are polymineralic-Fe-Ti oxide particles, i.e., they are opaque rock fragments. About 40% to 70% of these rock fragments show intergrowth of hm + il, mt + il, and mt + hm +/- il. Modal analysis of 23,282 opaque particles in 117 polished thin sections of granitic and metamorphic parent rocks and their daughter sands from semi-arid and humid climates show the following relative abundances. The data show that opaque rock fragments are more common in sands from igneous source rocks and that hm + il fragments are more durable. They assume that equilibrium conditions existed in parent rocks during the growth of these paired minerals, and that the Ti/Fe ratio did not change during oxidation of mt to hm. Geothermometric determinations using electron probe microanalysis of opaque rock fragments in sand samples from Lake Erie and the Adriatic Sea suggest that these rock fragments may have equilibrated at approximately 900/sup 0/ and 525/sup 0/C, respectively.

  18. Auroral fragmentation into patches

    NASA Astrophysics Data System (ADS)

    Shiokawa, Kazuo; Hashimoto, Ayumi; Hori, Tomoaki; Sakaguchi, Kaori; Ogawa, Yasunobu; Donovan, Eric; Spanswick, Emma; Connors, Martin; Otsuka, Yuichi; Oyama, Shin-Ichiro; Nozawa, Satonori; McWilliams, Kathryn

    2014-10-01

    Auroral patches in diffuse auroras are very common features in the postmidnight local time. However, the processes that produce auroral patches are not yet well understood. In this paper we present two examples of auroral fragmentation which is the process by which uniform aurora is broken into several fragments to form auroral patches. These examples were observed at Athabasca, Canada (geomagnetic latitude: 61.7°N), and Tromsø, Norway (67.1°N). Captured in sequences of images, the auroral fragmentation occurs as finger-like structures developing latitudinally with horizontal-scale sizes of 40-100 km at ionospheric altitudes. The structures tend to develop in a north-south direction with speeds of 150-420 m/s without any shearing motion, suggesting that pressure-driven instability in the balance between the earthward magnetic-tension force and the tailward pressure gradient force in the magnetosphere is the main driving force of the auroral fragmentation. Therefore, these observations indicate that auroral fragmentation associated with pressure-driven instability is a process that creates auroral patches. The observed slow eastward drift of aurora during the auroral fragmentation suggests that fragmentation occurs in low-energy ambient plasma.

  19. [Cloning and expression of a promoter function fragment from Thiobacillus thiooxidans in Escherichia coli].

    PubMed

    Yan, W

    1990-01-01

    This paper reports a recombinant plasmid pSDR12 which is constructed through the substitution of the EcoRI-HindIII fragment of pBR322 by a specific fragment of chromosomal DNA of T. thiooxidans. After it was transformed into C600, the transformants revealed higher levels of Tc resistance. This result shows that a promoter function fragment from autotrophic bacteria is able to express in Escherichia coil.

  20. Capturing Chromosome Conformation

    NASA Astrophysics Data System (ADS)

    Dekker, Job; Rippe, Karsten; Dekker, Martijn; Kleckner, Nancy

    2002-02-01

    We describe an approach to detect the frequency of interaction between any two genomic loci. Generation of a matrix of interaction frequencies between sites on the same or different chromosomes reveals their relative spatial disposition and provides information about the physical properties of the chromatin fiber. This methodology can be applied to the spatial organization of entire genomes in organisms from bacteria to human. Using the yeast Saccharomyces cerevisiae, we could confirm known qualitative features of chromosome organization within the nucleus and dynamic changes in that organization during meiosis. We also analyzed yeast chromosome III at the G1 stage of the cell cycle. We found that chromatin is highly flexible throughout. Furthermore, functionally distinct AT- and GC-rich domains were found to exhibit different conformations, and a population-average 3D model of chromosome III could be determined. Chromosome III emerges as a contorted ring.

  1. [Developing a physical map of human chromosome 22]. Progress report

    SciTech Connect

    Simon, M.I.

    1991-12-31

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  2. (Developing a physical map of human chromosome 22)

    SciTech Connect

    Simon, M.I.

    1991-01-01

    We have developed bacterial F-factor based systems for cloning large fragments of human DNA in E. coli. In addition to large size, these systems are capable of maintaining human DNA with a high degree of stability. The cosmid size clones are called Fosmids and the clones containing larger inserts (100--200 kb) are called bacterial artificial chromosomes (BACs). The ultimate test of the effectiveness of cloning and mapping technology is the degree to which it can be efficiently applied to solve complex mapping problems. We, therefore, plan to use the large fragment cloning procedure as well as a variety of other approaches to generate a complete map of overlapping clones corresponding to human chromosome 22. We have thus far prepared two human chromosome 22 specific Fosmid libraries and we are in the process of constructing a chromosome 22 specific BAC library composed of fragments larger than 100 kb. We will further optimize the technology so that libraries of fragments larger than 200 kb can be readily prepared.

  3. DNA fragmentation by charged particle tracks

    NASA Astrophysics Data System (ADS)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  4. Strategies for cloning and manipulating natural and synthetic chromosomes.

    PubMed

    Karas, Bogumil J; Suzuki, Yo; Weyman, Philip D

    2015-02-01

    Advances in synthetic biology methods to assemble and edit DNA are enabling genome engineering at a previously impracticable scale and scope. The synthesis of the Mycoplasma mycoides genome followed by its transplantation to convert a related cell into M. mycoides has transformed strain engineering. This approach exemplifies the combination of newly emerging chromosome-scale genome editing strategies that can be defined in three main steps: (1) chromosome acquisition into a microbial engineering platform, (2) alteration and improvement of the acquired chromosome, and (3) installation of the modified chromosome into the original or alternative organism. In this review, we outline recent progress in methods for acquiring chromosomes and chromosome-scale DNA molecules in the workhorse organisms Bacillus subtilis, Escherichia coli, and Saccharomyces cerevisiae. We present overviews of important genetic strategies and tools for each of the three organisms, point out their respective strengths and weaknesses, and highlight how the host systems can be used in combination to facilitate chromosome assembly or engineering. Finally, we highlight efforts for the installation of the cloned/altered chromosomes or fragments into the target organism and present remaining challenges in expanding this powerful experimental approach to a wider range of target organisms.

  5. Sequence analysis of 203 kilobases from Saccharomyces cerevisiae chromosome VII.

    PubMed

    Rieger, M; Brückner, M; Schäfer, M; Müller-Auer, S

    1997-09-15

    The nucleotide sequences of five major regions from chromosome VII of Saccharomyces cerevisiae have been determined and analysed. These regions represent 203 kilobases corresponding to approximately one-fifth of the complete yeast chromosome VII. Two fragments originate from the left arm of this chromosome. The first one of about 15.8 kb starts approximately 75 kb from the left telomere and is bordered by the SK18 chromosomal marker. The second fragment covers the 72.6 kb region between the chromosomal markers CYH2 and ALG2. On the right chromosomal arm three regions, a 70.6 kb region between the MSB2 and the KSS1 chromosomal markers and two smaller regions dominated by the KRE11 marker and another one in the vicinity of the SER2 marker were sequenced. We found a total of 114 open reading frames (ORFs), 13 of which were completely overlapping with larger ORFs running in the opposite direction. A total of 44 yeast genes, the physiological functions of which are known, could be precisely mapped on this chromosome. Of the remaining 57 ORFs, 26 shared sequence homologies with known genes, among which were 13 other S. cerevisiae genes and five genes from other organisms. No homology with any sequence in the databases could be found for 31 ORFs. Furthermore, five Ty elements were found, one of which may not be functional due to a frame shift in its Ty1B amino acid sequence. The five chromosomal regions harboured five potential ARS elements and one sigma element together with eight tRNA genes and two snRNAs, one of which is encoded by an intron of a protein-coding gene. PMID:9290212

  6. A new nonlinear optical silicate carbonate K2Ca[Si2O5](CO3) with a hybrid structure of kalsilite and soda-like layered fragments

    NASA Astrophysics Data System (ADS)

    Belokoneva, Elena L.; Stefanovich, Sergey Yu.; Volkov, Anatoly S.; Dimitrova, Olga V.

    2016-10-01

    Single crystals of a new silicate carbonate, K2Ca[Si2O5](CO3), have been synthesized in a multi-components hydrothermal solution with a pH value close to neutral and a high concentration of a carbonate mineralizer. The new compound has an axial structure (s.g. P6322) with unit cell parameters a = 5.04789 (15), c = 17.8668 (6) Å. Pseudosymmetry of the structure corresponds to s.g. P63/mmc which is broken only by one oxygen position. The structure consists of two layered fragments: one of the type of the mineral kalsilite (KAlSiO4) and the other of the high-temperature soda-like α-Na2CO3, Ca substituting for Na. The electro-neutral layer K2[Si2O5] (denoted K) as well as the layer Ca(CO3) (denoted S) may separately correspond to individual structures. In K2Ca[Si2O5](CO3) the S-K layers are connected together via Ca-O interactions between Ca atoms from the carbonate layer and apical O atoms from the silicate one, and also via K-O interlayer interactions. A hypothetical acentric structure, sp.gr. P-62c, is predicted on the basis of the order-disorder theory. It presents another symmetrical option for the arrangement of K-layers relative to S-layers. The K,Ca-silicate-carbonate powder produces a moderate SHG signal that is two times larger that of the α-quartz powder standard and close to other silicates with acentric structures and low electronic polarizability.

  7. Fragment capture device

    DOEpatents

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  8. Fragmentation in Biaxial Tension

    SciTech Connect

    Campbell, G H; Archbold, G C; Hurricane, O A; Miller, P L

    2006-06-13

    We have carried out an experiment that places a ductile stainless steel in a state of biaxial tension at a high rate of strain. The loading of the ductile metal spherical cap is performed by the detonation of a high explosive layer with a conforming geometry to expand the metal radially outwards. Simulations of the loading and expansion of the metal predict strain rates that compare well with experimental observations. A high percentage of the HE loaded material was recovered through a soft capture process and characterization of the recovered fragments provided high quality data, including uniform strain prior to failure and fragment size. These data were used with a modified fragmentation model to determine a fragmentation energy.

  9. Human chromosome 22.

    PubMed Central

    Kaplan, J C; Aurias, A; Julier, C; Prieur, M; Szajnert, M F

    1987-01-01

    The acrocentric chromosome 22, one of the shortest human chromosomes, carries about 52 000 kb of DNA. The short arm is made up essentially of heterochromatin and, as in other acrocentric chromosomes, it contains ribosomal RNA genes. Ten identified genes have been assigned to the long arm, of which four have already been cloned and documented (the cluster of lambda immunoglobulin genes, myoglobin, the proto-oncogene c-sis, bcr). In addition, about 10 anonymous DNA segments have been cloned from chromosome 22 specific DNA libraries. About a dozen diseases, including at least four different malignancies, are related to an inherited or acquired pathology of chromosome 22. They have been characterised at the phenotypic or chromosome level or both. In chronic myelogenous leukaemia, with the Ph1 chromosome, and Burkitt's lymphoma, with the t(8;22) variant translocation, the molecular pathology is being studied at the DNA level, bridging for the first time the gap between cytogenetics and molecular genetics. PMID:3550088

  10. Sequential cloning of chromosomes

    DOEpatents

    Lacks, Sanford A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

  11. Sequential cloning of chromosomes

    DOEpatents

    Lacks, S.A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

  12. Mitotic recombination of chromosome 17 in astrocytomas

    SciTech Connect

    James, C.D.; Carlbom, E.; Nordenskjold, M.; Collins, V.P.; Cavenee, W.K. )

    1989-04-01

    Allelic combinations at seven loci on human chromosome 17 defined by restriction fragment length polymorphisms were determined in tumor and normal tissues from 35 patients with gliomas. Loss of constitutional heterozygosity at one or more of these loci was observed in 8 of the 24 tumors displaying astrocytic differentiation and in the single primitive neuroectodermal tumor examined. The astrocytomas showing these losses included examples of each adult malignancy grade of the disease, including glioblastoma (malignancy grade IV), and seven of them demonstrated concurrent maintenance of heterozygosity for at least one chromosome 17 locus. Determination of allele dosage together with the genotypic data indicated that the tumor chromosomes 17 were derived by mitotic recombination in 7 of the 9 cases with shared homozygosity of the region 17p11.2-ptr in all cases. In contrast, tumors of oligodendrocytic, ependymal, or mixed cellular differentiation did not exhibit loss of alleles at any of the loci examined. These data suggest that the somatic attainment of homozygosity for loci on chromosome 17p is frequently associated with the oncogenesis of central nervous system tumors, particularly those showing solely astrocytic differentiation, and that mitotic recombination mapping is a useful approach towards the subregional localization of a locus whose rearrangement is involved in this disease.

  13. Sequential cloning of chromosomes

    SciTech Connect

    Lacks, S.A.

    1991-12-31

    A method for sequential cloning of chromosomal DNA and chromosomal DNA cloned by this method are disclosed. The method includes the selection of a target organism having a segment of chromosomal DNA to be sequentially cloned. A first DNA segment, having a first restriction enzyme site on either side. homologous to the chromosomal DNA to be sequentially cloned is isolated. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

  14. Multidirectional chromosome painting reveals a remarkable syntenic homology between the greater galagos and the slow loris.

    PubMed

    Stanyon, R; Dumas, F; Stone, G; Bigoni, F

    2006-04-01

    We report on the first reciprocal chromosome painting of lorisoids and humans. The chromosome painting showed a remarkable syntenic homology between Otolemur and Nycticebus. Eight derived syntenic associations of human segments are common to both Otolemur and Nycticebus, indicative of a considerable period of common evolution between the greater galago and the slow loris. Five additional Robertsonian translocations form the slow loris karyotype, while the remaining chromosomes are syntenically equivalent, although some differ in terms of centromere position and heterochromatin additions. Strikingly, the breakpoints of the human chromosomes found fragmented in these two species are apparently identical. Only fissions of homologs to human chromosomes 1 and 15 provide significant evidence of a cytogenetic link between Lemuriformes and Lorisiformes. The association of human chromosomes 7/16 in both lorisoids strongly suggests that this chromosome was present in the ancestral primate genome.

  15. The gamma fibrinogen gene (FGG) maps to chromosome 17 in both cattle and sheep.

    PubMed

    Johnson, S E; Barendse, W; Hetzel, D J

    1993-01-01

    The gamma fibrinogen gene (FGG) was localised in both cattle and sheep using in situ hybridisation. The probe employed was a 1-kb bovine cDNA fragment. Based on observations of QFQ-banded chromosome preparations, this locus is on bovine chromosome 17q12-->q13 and on the homologous sheep chromosome 17. This localisation is, to our knowledge, the first assignment to chromosome 17 in either the bovine or ovine genome. In addition to localising FGG to this chromosome, the assignment provisionally maps the previously unassigned syntenic group U23, containing (besides FGG) the genes for mitochondrial aldehyde dehydrogenase 2 (ALDH2), interleukin 2 (IL2), immunoglobulin lambda (IGL), and beta fibrinogen (FGB), to chromosome 17 in cattle and probably to the same chromosome in sheep.

  16. Supernumerary (B) chromosomes in populations of Picea abies (L.) H. Karst. from Western Rhodopes (Bulgaria).

    PubMed

    Tashev, A N; Sedel'nikova, T S; Pimenov, A V

    2014-01-01

    Investigations on B chromosomes found for the first time for Picea abies (L.) H. Karst. have been conducted. Seeds of Picea abies from two populations of Western Rhodopes (Bulgaria) located at the southern border of species range, and protected according to Bern Convention and EC Habitat Directive were collected for this study. Mixoploidy was detected in some germinating seeds of Picea abies. It was found that metaphase cells of germinating seeds contain 0-4 B chromosomes of both metacentric and submetacentric types. The variability of B chromosomes number and their occurrence was observed. Along with B chromosomes, some chromosome aberrations such as fragments and ring chromosomes were revealed in metaphase cells of Picea abies from studied populations. The possible adaptive role of B chromosomes presence for Picea spp. is discussed.

  17. Chromosome breakages associated with 45S ribosomal DNA sequences in spotted snakehead fish Channa punctatus.

    PubMed

    Singh, Mamta; Barman, Anindya Sundar

    2013-01-01

    It is well known that transcriptionally inactive rRNA genes are correlated with DNA hyper-methylation and histone hypo-methylation and there is clear evidence in humans that DNA and histone modification which alter chromatin structure are related to chromosome fragility. Very little is known about the biological cause of 45S rDNA fragility. In this report we characterized the chromosome breakage or gap associated with 45S rDNA in a fish species Channa punctatus. The rDNA mapping in C. punctatus, showed many chromosome breakages or gap formations, and all occurred exclusively in the 45S rDNA sites in anterior kidney cells. We observed that the number of chromosomes plus chromosome fragments was often more than the expected 32 in most cells. Total 67 % metaphase spread showed the expected or normal 32 chromosomes, while 33 % metaphase spread showed 33 and/or 34 chromosomes and/or chromosome fragments. The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are also discussed in present report.

  18. CHROMOSOMES OF AMERICAN MARSUPIALS.

    PubMed

    BIGGERS, J D; FRITZ, H I; HARE, W C; MCFEELY, R A

    1965-06-18

    Studies of the chromosomes of four American marsupials demonstrated that Caluromys derbianus and Marmosa mexicana have a diploid number of 14 chromosomes, and that Philander opossum and Didelphis marsupialis have a diploid number of 22. The karyotypes of C. derbianus and M. mexicana are similar, whereas those of P. opossum and D. marsupialis are dissimilar. If the 14-chromosome karyotype represents a reduction from a primitive number of 22, these observations suggest that the change has occurred independently in the American and Australasian forms.

  19. A new chromosome was born: comparative chromosome painting in Boechera.

    PubMed

    Koch, Marcus A

    2015-09-01

    Comparative chromosome painting is a powerful tool to study the evolution of chromosomes and genomes. Analyzing karyotype evolution in cruciferous plants highlights the origin of aberrant chromosomes in apomictic Boechera and further establishes the cruciferous plants as important model system for our understanding of plant chromosome and genome evolution. PMID:26228436

  20. Chromosome doubling method

    DOEpatents

    Kato, Akio

    2006-11-14

    The invention provides methods for chromosome doubling in plants. The technique overcomes the low yields of doubled progeny associated with the use of prior techniques for doubling chromosomes in plants such as grasses. The technique can be used in large scale applications and has been demonstrated to be highly effective in maize. Following treatment in accordance with the invention, plants remain amenable to self fertilization, thereby allowing the efficient isolation of doubled progeny plants.

  1. Telomeres and their possible role in chromosome stabilization

    SciTech Connect

    Day, J.P.; Marder, B.A.; Morgan, W.F. )

    1993-01-01

    The evidence to date generally supports the hypothesis that telomere capping makes chromosome fragments refractory to subsequent rejoining events, but this control may be somewhat relaxed after chromosome breakage. Cell survival requires that the fragments rejoin before metaphase. Unprotected ends such as those produced by DNA damage are subject to degradation, presumably by endogenous cellular exo- and endonucleases. Telomere repeat sequences may be added to broken chromosome ends to protect the ends from further degradation. That telomeric DNA does not always prevent rejoining raises interesting questions as to what constitutes capping, and how rapidly it occurs after DNA damage in relation to chromosome break rejoining. The prevention of degradation and control of rejoining may be mediated by telomere-specific binding proteins, especially the telomere terminal binding protein. Some of these proteins may be involved in scavenging telomeric DNA when the cell senses that chromosomal breaks have occurred. Although chromosome break rejoining is an efficient process in eukaryotic cells, some breaks are never rejoined and can result in terminal delections and chromatid and isochromatid deletions at metaphase. It is unclear why these breaks are not rejoined, but it may be due to one or more of the following: (1) chance: broken chromosomes are separated, do not approach sufficiently close to one another, and are consequently physically unable to rejoin; (2) a large number of added telomere repeat sequences indicating to the cell that the chromosome has an authentic telomere; (3) some other DNA modification event that protects DNA ends from degradation, e.g., folding back of DNA ends to form a hairpin, as has been implicated in VDJ recombination.

  2. Origin and evolution of B chromosomes in the cichlid fish Astatotilapia latifasciata based on integrated genomic analyses.

    PubMed

    Valente, Guilherme T; Conte, Matthew A; Fantinatti, Bruno E A; Cabral-de-Mello, Diogo C; Carvalho, Robson F; Vicari, Marcelo R; Kocher, Thomas D; Martins, Cesar

    2014-08-01

    Approximately 15% of eukaryotes contain supernumerary B chromosomes. When present, B chromosomes frequently represent as much as 5% of the genome. Despite thousands of reports describing the distribution of supernumeraries in various taxa, a comprehensive theory for the origin, maintenance, and evolution of B chromosomes has not emerged. Here, we sequence the complete genomes of individual cichlid fish (Astatotilapia latifasciata) with and without B chromosomes, as well as microdissected B chromosomes, to identify DNA sequences on the B. B sequences were further analyzed through quantitative polymerase chain reaction and in situ hybridization. We find that the B chromosome contains thousands of sequences duplicated from essentially every chromosome in the ancestral karyotype. Although most genes on the B chromosome are fragmented, a few are largely intact, and we detect evidence that at least three of them are transcriptionally active. We propose a model in which the B chromosome originated early in the evolutionary history of Lake Victoria cichlids from a small fragment of one autosome. DNA sequences originating from several autosomes, including protein-coding genes and transposable elements, subsequently inserted into this proto-B. We propose that intact B chromosome genes involved with microtubule organization, kinetochore structure, recombination and progression through the cell cycle may play a role in driving the transmission of the B chromosome. Furthermore, our work suggests that karyotyping is an essential step prior to genome sequencing to avoid problems in genome assembly and analytical biases created by the presence of high copy number sequences on the B chromosome.

  3. Micromechanics of human mitotic chromosomes

    NASA Astrophysics Data System (ADS)

    Sun, Mingxuan; Kawamura, Ryo; Marko, John F.

    2011-02-01

    Eukaryote cells dramatically reorganize their long chromosomal DNAs to facilitate their physical segregation during mitosis. The internal organization of folded mitotic chromosomes remains a basic mystery of cell biology; its understanding would likely shed light on how chromosomes are separated from one another as well as into chromosome structure between cell divisions. We report biophysical experiments on single mitotic chromosomes from human cells, where we combine micromanipulation, nano-Newton-scale force measurement and biochemical treatments to study chromosome connectivity and topology. Results are in accord with previous experiments on amphibian chromosomes and support the 'chromatin network' model of mitotic chromosome structure. Prospects for studies of chromosome-organizing proteins using siRNA expression knockdowns, as well as for differential studies of chromosomes with and without mutations associated with genetic diseases, are also discussed.

  4. Heavy fragment radioactivities

    SciTech Connect

    Price, P.B.

    1987-12-10

    This recently discovered mode of radioactive decay, like alpha decay and spontaneous fission, is believed to involve tunneling through the deformation-energy barrier between a very heavy nucleus and two separated fragments the sum of whose masses is less than the mass of the parent nucleus. In all known cases the heavier of the two fragments is close to doubly magic /sup 208/Pb, and the lighter fragment has even Z. Four isotopes of Ra are known to emit /sup 14/C nuclei; several isotopes of U as well as /sup 230/Th and /sup 231/Pa emit Ne nuclei; and /sup 234/U exhibits four hadronic decay modes: alpha decay, spontaneous fission, Ne decay and Mg decay.

  5. Allogenous tooth fragment reattachment

    PubMed Central

    Maitin, Nitin; Maitin, Shipra; Rastogi, Khushboo; Bhushan, Rajarshi

    2013-01-01

    Coronal fractures of the anterior teeth are a common form of dental trauma and its sequelae may impair the establishment and accomplishment of an adequate treatment plan. Among the various treatment options, reattachment of a crown fragment obtained from a previously extracted tooth is a conservative treatment that should be considered for crown fractures of anterior teeth. This article reports reattachment of an allogenous tooth fragment in a fractured maxillary lateral incisor in a 38-year-old patient. It is suggested that allogenous reattachment in a fractured anterior tooth serves to be a better alternative and should be further researched. Aesthetic and functional rehabilitation of a fractured complicated anterior crown using allogenous tooth fragment is a better alternative to other more conventional treatment options. PMID:23845684

  6. Genetic maps of polymorphic DNA loci on rat chromosome 1

    SciTech Connect

    Ding, Yan-Ping; Remmers, E.F.; Longman, R.E.

    1996-09-01

    Genetic linkage maps of loci defined by polymorphic DNA markers on rat chromosome 1 were constructed by genotyping F2 progeny of F344/N x LEW/N, BN/SsN x LEW/N, and DA/Bkl x F344/Hsd inbred rat strains. In total, 43 markers were mapped, of which 3 were restriction fragment length polymorphisms and the others were simple sequence length polymorphisms. Nineteen of these markers were associated with genes. Six markers for five genes, {gamma}-aminobutyric acid receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}1 (Adrb1), carcinoembryonic antigen gene family member 1 (Cgm1), and lipogenic protein S14 (Lpgp), and 20 anonymous loci were not previously reported. Thirteen gene loci (Myl2, Aldoa, Tnt, Igf2, Prkcg, Cgm4, Calm3, Cgm3, Psbp1, Sa, Hbb, Ins1, and Tcp1) were previously mapped. Comparative mapping analysis indicated that the large portion of rat chromosome 1 is homologous to mouse chromosome 7, although the homologous to mouse chromosome 7, although the homologs of two rat genes are located on mouse chromosomes 17 and 19. Homologs of the rat chromosome 1 genes that we mapped are located on human chromosomes 6, 10, 11, 12, 15, 16, and 19. 38 refs., 1 fig., 3 tabs.

  7. Microdissected double-minute DNA detects variable patterns of chromosomal localizations and multiple abundantly expressed transcripts in normal and leukemic cells

    SciTech Connect

    Sen, S.; Zhou, Hongyi; Stass, S.A.; Sen, P. ); Mulac-Jericevic, B.; Pirrotta, V. )

    1994-02-01

    Double-minute (dm) chromosomes are cytogenetically resolvable DNA amplification-mediating acentric extrachromosomal structures that are commonly seen in primary tumors, tumor cell lines, and drug-resistant cells grown in vitro. Selective isolation of dm DNAs with standard molecular biological techniques is difficult, and thus, detailed studies to elucidate their structure, site of chromosomal origin, and chromosomal reintegration patterns have been limited. In those instances in which a gene has been localized on dms, characterization of the remainder of the DNA, which far exceeds the size of the gene identified, has remained inconclusive. dms seen in the acute myeloid leukemia cell line HL-60 have been shown to harbor the c-myc protooncogene. In this paper, the authors report the successful isolation of the dm-specific DNAs from these cells by the microdissection/polymerase chain reaction technique and demonstrate that the dm DNAs derived from a single discrete normal chromosome segment 8q24.1-q24.2 reintegrate at various specific locations in the leukemic cells. The microdissected dm DNA detects multiple abundantly expressed transcripts distinct from c-myc mRNA on Northern blots. By devising a [open quotes]transcript selection[close quotes] strategy, they cloned the partial genomic sequence of a gene from the microdissected DNA that encodes two of these RNAs. This strategy will be generally applicable for rapid cloning of unknown amplified genes harbored on dms. With DNA from 20 microdissected dms, they constructed a genomic library of about 20,000 recombinant microclones with an average insert size of about 450 bp. The microclones should help in isolating corresponding yeast artificial chromosome clones for high-resolution physical mapping of dms in HL-60 cells. Furthermore, application of the microdissection technique appears to be an extremely feasible approach to characterization of dms in other cell types. 42 refs., 6 figs., 1 tab.

  8. IMPACT fragmentation model developments

    NASA Astrophysics Data System (ADS)

    Sorge, Marlon E.; Mains, Deanna L.

    2016-09-01

    The IMPACT fragmentation model has been used by The Aerospace Corporation for more than 25 years to analyze orbital altitude explosions and hypervelocity collisions. The model is semi-empirical, combining mass, energy and momentum conservation laws with empirically derived relationships for fragment characteristics such as number, mass, area-to-mass ratio, and spreading velocity as well as event energy distribution. Model results are used for several types of analysis including assessment of short-term risks to satellites from orbital altitude fragmentations, prediction of the long-term evolution of the orbital debris environment and forensic assessments of breakup events. A new version of IMPACT, version 6, has been completed and incorporates a number of advancements enabled by a multi-year long effort to characterize more than 11,000 debris fragments from more than three dozen historical on-orbit breakup events. These events involved a wide range of causes, energies, and fragmenting objects. Special focus was placed on the explosion model, as the majority of events examined were explosions. Revisions were made to the mass distribution used for explosion events, increasing the number of smaller fragments generated. The algorithm for modeling upper stage large fragment generation was updated. A momentum conserving asymmetric spreading velocity distribution algorithm was implemented to better represent sub-catastrophic events. An approach was developed for modeling sub-catastrophic explosions, those where the majority of the parent object remains intact, based on estimated event energy. Finally, significant modifications were made to the area-to-mass ratio distribution to incorporate the tendencies of different materials to fragment into different shapes. This ability enabled better matches between the observed area-to-mass ratios and those generated by the model. It also opened up additional possibilities for post-event analysis of breakups. The paper will discuss

  9. A pathway from chromosome transfer to engineering resulting in human and mouse artificial chromosomes for a variety of applications to bio-medical challenges.

    PubMed

    Oshimura, Mitsuo; Uno, Narumi; Kazuki, Yasuhiro; Katoh, Motonobu; Inoue, Toshiaki

    2015-02-01

    Microcell-mediated chromosome transfer (MMCT) is a technique to transfer a chromosome from defined donor cells into recipient cells and to manipulate chromosomes as gene delivery vectors and open a new avenue in somatic cell genetics. However, it is difficult to uncover the function of a single specific gene via the transfer of an entire chromosome or fragment, because each chromosome or fragment contains a set of numerous genes. Thus, alternative tools are human artificial chromosome (HAC) and mouse artificial chromosome (MAC) vectors, which can carry a gene or genes of interest. HACs/MACs have been generated mainly by either a "top-down approach" (engineered creation) or a "bottom-up approach" (de novo creation). HACs/MACs with one or more acceptor sites exhibit several characteristics required by an ideal gene delivery vector, including stable episomal maintenance and the capacity to carry large genomic loci plus their regulatory elements, thus allowing the physiological regulation of the introduced gene in a manner similar to that of native chromosomes. The MMCT technique is also applied for manipulating HACs and MACs in donor cells and delivering them to recipient cells. This review describes the lessons learned and prospects identified from studies on the construction of HACs and MACs, and their ability to drive exogenous gene expression in cultured cells and transgenic animals via MMCT. New avenues for a variety of applications to bio-medical challenges are also proposed.

  10. Target fragmentation in radiobiology

    NASA Technical Reports Server (NTRS)

    Wilson, John W.; Cucinotta, Francis A.; Shinn, Judy L.; Townsend, Lawrence W.

    1993-01-01

    Nuclear reactions in biological systems produce low-energy fragments of the target nuclei seen as local high events of linear energy transfer (LET). A nuclear-reaction formalism is used to evaluate the nuclear-induced fields within biosystems and their effects within several biological models. On the basis of direct ionization interaction, one anticipates high-energy protons to have a quality factor and relative biological effectiveness (RBE) of unity. Target fragmentation contributions raise the effective quality factor of 10 GeV protons to 3.3 in reasonable agreement with RBE values for induced micronuclei in bean sprouts. Application of the Katz model indicates that the relative increase in RBE with decreasing exposure observed in cell survival experiments with 160 MeV protons is related solely to target fragmentation events. Target fragment contributions to lens opacity given an RBE of 1.4 for 2 GeV protons in agreement with the work of Lett and Cox. Predictions are made for the effective RBE for Harderian gland tumors induced by high-energy protons. An exposure model for lifetime cancer risk is derived from NCRP 98 risk tables, and protraction effects are examined for proton and helium ion exposures. The implications of dose rate enhancement effects on space radiation protection are considered.

  11. Fragment Separator ACCULINNA-2

    SciTech Connect

    Krupko, S. A.; Fomichev, A. S.; Chudoba, V.; Daniel, A. V.; Golovkov, M. S.; Gorshkov, V. A.; Oganessian, Yu. Ts.; Sidorchuk, S. I.; Slepnev, R. S.; Stepantsov, S. V.; Ter-Akopian, G. M.; Wolski, R.; Grigorenko, L. V.; Tarasov, O. B.; Ershov, S. N.; Lukyanov, V. K.; Danilin, B. V.; Korsheninnikov, A. A.; Goldberg, V. Z.; Mukha, I. G.

    2010-04-30

    Project of a new in-flight fragment separator is proposed as a part of the third generation DRIBs facilities in Dubna. As compared to the existing separator ACCULINNA, beam intensity should be increased by a factor 10-15, the beam quality improved and the RIB assortment should broaden considerably at ACCULINNA-2. Research program and structure are outlined for the new instrument.

  12. Comment on diquark fragmentation

    SciTech Connect

    Fredriksson, S.; Larsson, T.

    1983-07-01

    We discuss diquark fragmentation and suggest that a spectator uu system in deep-inelastic lepton-nucleon scattering has a larger breakup probability than a ud system. The reason for this is argued to be that half of the leftover ud systems are in bound (ud)/sub 0/ diquark configurations, while no such bound uu diquarks exist.

  13. Molecular characterisation of a mosaicism with a complex chromosome rearrangement: evidence for coincident chromosome healing by telomere capture and neo‐telomere formation

    PubMed Central

    Chabchoub, Elyes; Rodríguez, Laura; Galán, Enrique; Mansilla, Elena; Martínez‐Fernandez, Maria Luisa; Martínez‐Frías, Maria Luisa; Fryns, Jean‐Pierre; Vermeesch, Joris Robert

    2007-01-01

    Background Broken chromosomes must acquire new telomeric “caps” to be structurally stable. Chromosome healing can be mediated either by telomerase through neo‐telomere synthesis or by telomere capture. Aim To unravel the mechanism(s) generating complex chromosomal mosaicisms and healing broken chromosomes. Methods G banding, array comparative genomic hybridization (aCGH), fluorescence in‐situ hybridisation (FISH) and short tandem repeat analysis (STR) was performed on a girl presenting with mental retardation, facial dysmorphism, urogenital malformations and limb anomalies carrying a complex chromosomal mosaicism. Results & discussion The karyotype showed a de novo chromosome rearrangement with two cell lines: one cell line with a deletion 9pter and one cell line carrying an inverted duplication 9p and a non‐reciprocal translocation 5pter fragment. aCGH, FISH and STR analysis enabled the deduction of the most likely sequence of events generating this complex mosaic. During embryogenesis, a double‐strand break occurred on the paternal chromosome 9. Following mitotic separation of both broken sister chromatids, one acquired a telomere vianeo‐telomere formation, while the other generated a dicentric chromosome which underwent breakage during anaphase, giving rise to the del inv dup(9) that was subsequently healed by chromosome 5 telomere capture. Conclusion Broken chromosomes can coincidently be rescued by both telomere capture and neo‐telomere synthesis. PMID:17172463

  14. Chromosome Conformation Capture Carbon Copy (5C) in Budding Yeast.

    PubMed

    Belton, Jon-Matthew; Dekker, Job

    2015-06-01

    Chromosome conformation capture carbon copy (5C) is a high-throughput method for detecting ligation products of interest in a chromosome conformation capture (3C) library. 5C uses ligation-mediated amplification (LMA) to generate carbon copies of 3C ligation product junctions using single-stranded oligonucleotide probes. This procedure produces a 5C library of short DNA molecules which represent the interactions between the corresponding restriction fragments. The 5C library can be amplified using universal primers containing the Illumina paired-end adaptor sequences for subsequent high-throughput sequencing.

  15. Evolution of the Leucine Gene Cluster in Buchnera aphidicola: Insights from Chromosomal Versions of the Cluster

    PubMed Central

    Sabater-Muñoz, Beatriz; van Ham, Roeland C. H. J.; Moya, Andrés; Silva, Francisco J.; Latorre, Amparo

    2004-01-01

    In Buchnera aphidicola strains associated with the aphid subfamilies Thelaxinae, Lachninae, Pterocommatinae, and Aphidinae, the four leucine genes (leuA, -B, -C, and -D) are located on a plasmid. However, these genes are located on the main chromosome in B. aphidicola strains associated with the subfamilies Pemphiginae and Chaitophorinae. The sequence of the chromosomal fragment containing the leucine cluster and flanking genes has different positions in the chromosome in B. aphidicola strains associated with three tribes of the subfamily Pemphiginae and one tribe of the subfamily Chaitophorinae. Due to the extreme gene order conservation of the B. aphidicola genomes, the variability in the position of the leucine cluster in the chromosome may be interpreted as resulting from independent insertions from an ancestral plasmid-borne leucine gene. These findings do not support a chromosomal origin for the leucine genes in the ancestral B. aphidicola and do support a back transfer evolutionary scenario from a plasmid to the main chromosome. PMID:15090505

  16. Cryobiology of coral fragments.

    PubMed

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (P<0.05, ANOVA). A seasonal response to chilling was observed in the coral tissue, but not in the zooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (P<0.05, ANOVA). However, in the late spring, coral tissue (∼75% loss) and zooxanthellae numbers declined in response to chilling alone (P<0.05, ANOVA). When a cryoprotectant (1M dimethyl sulfoxide) was used in concert with chilling it protected the coral against tissue loss after 45min of cryoprotectant exposure (P>0.05, ANOVA), but it did not protect against the loss of zooxanthellae (P<0.05, ANOVA). The zooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity.

  17. Fragmentation of cancer cells

    NASA Astrophysics Data System (ADS)

    Vanapalli, Siva; Kamyabi, Nabiollah

    Tumor cells have to travel through blood capillaries to be able to metastasize and colonize in distant organs. Among the numerous cells that are shed by the primary tumor, very few survive in circulation. In vivo studies have shown that tumor cells can undergo breakup at microcapillary junctions affecting their survival. It is currently unclear what hydrodynamic and biomechanical factors contribute to fragmentation and moreover how different are the breakup dynamics of highly and weakly metastatic cells. In this study, we use microfluidics to investigate flow-induced breakup of prostate and breast cancer cells. We observe several different modes of breakup of cancer cells, which have striking similarities with breakup of viscous drops. We quantify the breakup time and find that highly metastatic cancer cells take longer to breakup than lowly metastatic cells suggesting that tumor cells may dynamically modify their deformability to avoid fragmentation. We also identify the role that cytoskeleton and membrane plays in the breakup process. Our study highlights the important role that tumor cell fragmentation plays in cancer metastasis. Cancer Prevention and Research Institute of Texas.

  18. Fracture, failure, and fragmentation

    SciTech Connect

    Dienes, J.K.

    1984-01-01

    Though continuum descriptions of material behavior are useful for many kinds of problems, particularly those involving plastic flow, a more general approach is required when the failure is likely to involve growth and coalescence of a large number of fractures, as in fragmentation. Failures of this kind appear frequently in rapid dynamic processes such as those resulting from impacts and explosions, particularly in the formation of spall fragments. In the first part of this paper an approach to formulating constitutive relations that accounts for the opening, shear and growth of an ensemble of cracks is discussed. The approach also accounts for plastic flow accompanying fragmentation. The resulting constitutive relations have been incorporated into a Lagrangean computer program. In the second part of this paper a theoretical approach to coalescence is described. The simplest formulation makes use of a linear Liouville equation, with crack growth limited by the mean free path of cracks, assumed constant. This approach allows for an anisotropic distribution of cracks. An alternative approach is also described in which the decrease of the mean free path with increasing crack size is accounted for, but the crack distribution is assumed isotropic. A reduction of the governing Liouville equation to an ordinary differential equation of third order is possible, and the result can be used to determine how mean-free-path decreases with increasing crack size.

  19. DOP-PCR based painting of rye chromosomes in a wheat background.

    PubMed

    Deng, Chuanliang; Bai, Lili; Li, Shufen; Zhang, Yingxin; Li, Xiang; Chen, Yuhong; Wang, Richard R-C; Han, Fangpu; Hu, Zanmin

    2014-09-01

    To determine the appropriateness of chromosome painting for identifying genomic elements in rye, we microdissected the 1R and 1RS chromosomes from rye (Secale cereale L. var. King II) and wheat-rye addition line 1RS, respectively. Degenerate oligonucleotide primed - polymerase chain reaction (DOP-PCR) amplification of 1R and 1RS products from dissected chromosomes were used as probes to hybridize to metaphase chromosomes of rye, wheat-rye addition lines 1R and 1RS, translocation line 1RS.1BL, and allohexaploid triticale. The results showed that (i) the hybridization signal distribution patterns on rye chromosomes using 1R-derived DOP-PCR products as the probe were similar to those using 1RS-derived DOP-PCR products as the probe; (ii) 1R and (or) 1RS could not be distinguished from other rye chromosomes solely by the hybridization patterns using 1R- and (or) 1RS-derived DOP-PCR products as the probe; (iii) rye chromosomes and (or) rye chromosome fragments could be clearly identified in wheat-rye hybrids using either 1R- or 1RS-derived DOP-PCR products as the probe and could be more accurate in the nontelomeric region than using genomic in situ hybridization (GISH). Our results suggested that 1R- and (or) 1RS-derived DOP-PCR products contain many repetitive DNA sequences, are similar on different rye chromosomes, are R-genome specific, and can be used to identify rye chromosomes and chromosome fragments in wheat-rye hybrids. Our research widens the application range of chromosome painting in plants.

  20. DOP-PCR based painting of rye chromosomes in a wheat background.

    PubMed

    Deng, Chuanliang; Bai, Lili; Li, Shufen; Zhang, Yingxin; Li, Xiang; Chen, Yuhong; Wang, Richard R-C; Han, Fangpu; Hu, Zanmin

    2014-09-01

    To determine the appropriateness of chromosome painting for identifying genomic elements in rye, we microdissected the 1R and 1RS chromosomes from rye (Secale cereale L. var. King II) and wheat-rye addition line 1RS, respectively. Degenerate oligonucleotide primed - polymerase chain reaction (DOP-PCR) amplification of 1R and 1RS products from dissected chromosomes were used as probes to hybridize to metaphase chromosomes of rye, wheat-rye addition lines 1R and 1RS, translocation line 1RS.1BL, and allohexaploid triticale. The results showed that (i) the hybridization signal distribution patterns on rye chromosomes using 1R-derived DOP-PCR products as the probe were similar to those using 1RS-derived DOP-PCR products as the probe; (ii) 1R and (or) 1RS could not be distinguished from other rye chromosomes solely by the hybridization patterns using 1R- and (or) 1RS-derived DOP-PCR products as the probe; (iii) rye chromosomes and (or) rye chromosome fragments could be clearly identified in wheat-rye hybrids using either 1R- or 1RS-derived DOP-PCR products as the probe and could be more accurate in the nontelomeric region than using genomic in situ hybridization (GISH). Our results suggested that 1R- and (or) 1RS-derived DOP-PCR products contain many repetitive DNA sequences, are similar on different rye chromosomes, are R-genome specific, and can be used to identify rye chromosomes and chromosome fragments in wheat-rye hybrids. Our research widens the application range of chromosome painting in plants. PMID:25429799

  1. The DNA sequence and analysis of human chromosome 14.

    PubMed

    Heilig, Roland; Eckenberg, Ralph; Petit, Jean-Louis; Fonknechten, Núria; Da Silva, Corinne; Cattolico, Laurence; Levy, Michaël; Barbe, Valérie; de Berardinis, Véronique; Ureta-Vidal, Abel; Pelletier, Eric; Vico, Virginie; Anthouard, Véronique; Rowen, Lee; Madan, Anup; Qin, Shizhen; Sun, Hui; Du, Hui; Pepin, Kymberlie; Artiguenave, François; Robert, Catherine; Cruaud, Corinne; Brüls, Thomas; Jaillon, Olivier; Friedlander, Lucie; Samson, Gaelle; Brottier, Philippe; Cure, Susan; Ségurens, Béatrice; Anière, Franck; Samain, Sylvie; Crespeau, Hervé; Abbasi, Nissa; Aiach, Nathalie; Boscus, Didier; Dickhoff, Rachel; Dors, Monica; Dubois, Ivan; Friedman, Cynthia; Gouyvenoux, Michel; James, Rose; Madan, Anuradha; Mairey-Estrada, Barbara; Mangenot, Sophie; Martins, Nathalie; Ménard, Manuela; Oztas, Sophie; Ratcliffe, Amber; Shaffer, Tristan; Trask, Barbara; Vacherie, Benoit; Bellemere, Chadia; Belser, Caroline; Besnard-Gonnet, Marielle; Bartol-Mavel, Delphine; Boutard, Magali; Briez-Silla, Stéphanie; Combette, Stephane; Dufossé-Laurent, Virginie; Ferron, Carolyne; Lechaplais, Christophe; Louesse, Claudine; Muselet, Delphine; Magdelenat, Ghislaine; Pateau, Emilie; Petit, Emmanuelle; Sirvain-Trukniewicz, Peggy; Trybou, Arnaud; Vega-Czarny, Nathalie; Bataille, Elodie; Bluet, Elodie; Bordelais, Isabelle; Dubois, Maria; Dumont, Corinne; Guérin, Thomas; Haffray, Sébastien; Hammadi, Rachid; Muanga, Jacqueline; Pellouin, Virginie; Robert, Dominique; Wunderle, Edith; Gauguet, Gilbert; Roy, Alice; Sainte-Marthe, Laurent; Verdier, Jean; Verdier-Discala, Claude; Hillier, LaDeana; Fulton, Lucinda; McPherson, John; Matsuda, Fumihiko; Wilson, Richard; Scarpelli, Claude; Gyapay, Gábor; Wincker, Patrick; Saurin, William; Quétier, Francis; Waterston, Robert; Hood, Leroy; Weissenbach, Jean

    2003-02-01

    Chromosome 14 is one of five acrocentric chromosomes in the human genome. These chromosomes are characterized by a heterochromatic short arm that contains essentially ribosomal RNA genes, and a euchromatic long arm in which most, if not all, of the protein-coding genes are located. The finished sequence of human chromosome 14 comprises 87,410,661 base pairs, representing 100% of its euchromatic portion, in a single continuous segment covering the entire long arm with no gaps. Two loci of crucial importance for the immune system, as well as more than 60 disease genes, have been localized so far on chromosome 14. We identified 1,050 genes and gene fragments, and 393 pseudogenes. On the basis of comparisons with other vertebrate genomes, we estimate that more than 96% of the chromosome 14 genes have been annotated. From an analysis of the CpG island occurrences, we estimate that 70% of these annotated genes are complete at their 5' end. PMID:12508121

  2. The Y Chromosome

    ERIC Educational Resources Information Center

    Offner, Susan

    2010-01-01

    The Y chromosome is of great interest to students and can be used to teach about many important biological concepts in addition to sex determination. This paper discusses mutation, recombination, mammalian sex determination, sex determination in general, and the evolution of sex determination in mammals. It includes a student activity that…

  3. Why Chromosome Palindromes?

    PubMed Central

    Betrán, Esther; Demuth, Jeffery P.; Williford, Anna

    2012-01-01

    We look at sex-limited chromosome (Y or W) evolution with particular emphasis on the importance of palindromes. Y chromosome palindromes consist of inverted duplicates that allow for local recombination in an otherwise nonrecombining chromosome. Since palindromes enable intrachromosomal gene conversion that can help eliminate deleterious mutations, they are often highlighted as mechanisms to protect against Y degeneration. However, the adaptive significance of recombination resides in its ability to decouple the evolutionary fates of linked mutations, leading to both a decrease in degeneration rate and an increase in adaptation rate. Our paper emphasizes the latter, that palindromes may exist to accelerate adaptation by increasing the potential targets and fixation rates of incoming beneficial mutations. This hypothesis helps reconcile two enigmatic features of the “palindromes as protectors” view: (1) genes that are not located in palindromes have been retained under purifying selection for tens of millions of years, and (2) under models that only consider deleterious mutations, gene conversion benefits duplicate gene maintenance but not initial fixation. We conclude by looking at ways to test the hypothesis that palindromes enhance the rate of adaptive evolution of Y-linked genes and whether this effect can be extended to palindromes on other chromosomes. PMID:22844637

  4. Mitotic chromosome structure and condensation.

    PubMed

    Belmont, Andrew S

    2006-12-01

    Mitotic chromosome structure has been the cell biology equivalent of a 'riddle, wrapped in a mystery, inside an enigma'. Observations that genetic knockout or knockdown of condensin subunits or topoisomerase II cause only minimal perturbation in overall chromosome condensation, together with analysis of early stages of chromosome condensation and effects produced by histone H1 depletion, suggest a need to reconsider textbook models of mitotic chromosome condensation and organization. PMID:17046228

  5. Chromosomal breakpoints characterization of two supernumerary ring chromosomes 20.

    PubMed

    Guediche, N; Brisset, S; Benichou, J-J; Guérin, N; Mabboux, P; Maurin, M-L; Bas, C; Laroudie, M; Picone, O; Goldszmidt, D; Prévot, S; Labrune, P; Tachdjian, G

    2010-02-01

    The occurrence of an additional ring chromosome 20 is a rare chromosome abnormality, and no common phenotype has been yet described. We report on two new patients presenting with a supernumerary ring chromosome 20 both prenatally diagnosed. The first presented with intrauterine growth retardation and some craniofacial dysmorphism, and the second case had a normal phenotype except for obesity. Conventional cytogenetic studies showed for each patient a small supernumerary marker chromosome (SMC). Using fluorescence in situ hybridization, these SMCs corresponded to ring chromosomes 20 including a part of short and long arms of chromosome 20. Detailed molecular cytogenetic characterization showed different breakpoints (20p11.23 and 20q11.23 for Patient 1 and 20p11.21 and 20q11.21 for Patient 2) and sizes of the two ring chromosomes 20 (13.6 Mb for case 1 and 4.8 Mb for case 2). Review of the 13 case reports of an extra r(20) ascertained postnatally (8 cases) and prenatally (5 cases) showed varying degrees of phenotypic abnormalities. We document a detailed molecular cytogenetic chromosomal breakpoints characterization of two cases of supernumerary ring chromosomes 20. These results emphasize the need to characterize precisely chromosomal breakpoints of supernumerary ring chromosomes 20 in order to establish genotype-phenotype correlation. This report may be helpful for prediction of natural history and outcome, particularly in prenatal diagnosis.

  6. Familial complex chromosomal rearrangement resulting in a recombinant chromosome.

    PubMed

    Berend, Sue Ann; Bodamer, Olaf A F; Shapira, Stuart K; Shaffer, Lisa G; Bacino, Carlos A

    2002-05-15

    Familial complex chromosomal rearrangements (CCRs) are rare and tend to involve fewer breakpoints and fewer chromosomes than CCRs that are de novo in origin. We report on a CCR identified in a child with congenital heart disease and dysmorphic features. Initially, the child's karyotype was thought to involve a straightforward three-way translocation between chromosomes 3, 8, and 16. However, after analyzing the mother's chromosomes, the mother was found to have a more complex rearrangement that resulted in a recombinant chromosome in the child. The mother's karyotype included an inverted chromosome 2 and multiple translocations involving chromosomes 3, 5, 8, and 16. No evidence of deletion or duplication that could account for the clinical findings in the child was identified.

  7. Virtual fragment preparation for computational fragment-based drug design.

    PubMed

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges

  8. Ordered yeast artificial chromosome clones representing the Dictyostelium discoideum genome.

    PubMed Central

    Kuspa, A; Loomis, W F

    1996-01-01

    High resolution gene maps of the six chromosomes of Dictyostelium discoideum have been generated by a combination of physical mapping techniques. A set of yeast artificial chromosome clones has been ordered into overlapping arrays that cover >98% of the 34-magabase pair genome. Clones were grouped and ordered according to the genes they carried, as determined by hybridization analyses with DNA fragments from several hundred genes. Congruence of the gene order within each arrangement of clones with the gene order determined from whole genome restriction site mapping indicates that a high degree of confidence can be placed on the clone map. This clone-based description of the Dictyostelium chromosomes should be useful for the physical mapping and subcloning of new genes and should facilitate more detailed analyses of this genome. cost of silicon-based construction and in the efficient sample handling afforded by component integration. PMID:8643615

  9. Degeneration of a Nonrecombining Chromosome

    NASA Astrophysics Data System (ADS)

    Rice, William R.

    1994-01-01

    Comparative studies suggest that sex chromosomes begin as ordinary autosomes that happen to carry a major sex determining locus. Over evolutionary time the Y chromosome is selected to stop recombining with the X chromosome, perhaps in response to accumulation of alleles beneficial to the heterogametic but harmful to the homogametic sex. Population genetic theory predicts that a nonrecombining Y chromosome should degenerate. Here this prediction is tested by application of specific selection pressures to Drosophila melanogaster populations. Results demonstrate the decay of a nonrecombining, nascent Y chromosome and the capacity for recombination to ameliorate such decay.

  10. New Scalings in Nuclear Fragmentation

    SciTech Connect

    Bonnet, E.; Bougault, R.; Galichet, E.; Gagnon-Moisan, F.; Guinet, D.; Lautesse, P.; Marini, P.; Parlog, M.

    2010-10-01

    Fragment partitions of fragmenting hot nuclei produced in central and semiperipheral collisions have been compared in the excitation energy region 4-10 MeV per nucleon where radial collective expansion takes place. It is shown that, for a given total excitation energy per nucleon, the amount of radial collective energy fixes the mean fragment multiplicity. It is also shown that, at a given total excitation energy per nucleon, the different properties of fragment partitions are completely determined by the reduced fragment multiplicity (i.e., normalized to the source size). Freeze-out volumes seem to play a role in the scalings observed.

  11. Fragmentation function measurements at Belle

    SciTech Connect

    Seidl, Ralf; Vossen, Anselm; Leitgab, Martin; Grosse-Perdekamp, Matthias; Giordano, Francesca; Ogawa, Akio

    2011-12-14

    The precision measurement of fragmentation functions is an important requirement to study the spin structure of the nucleon. Unpolarized fragmentation functions at reasonably low scale and high fractional energy are necessary to complement the measurements mostly performed at LEP in order to obtain high enough precision for measurements at semi-inclusive DIS experiments and at RHIC. Those can be obtained from the abundant data collected with the Belle detector at the e{sup +}e{sup -} collider KEKB. In addition one can cleanly measure the transversely polarized fragmentation functions such as the Collins fragmentation function and the interference fragmentation functions. Both have been obtained with great precision at Belle.

  12. Mapping of the chromosome of bacteria Erwinia carotovora subsp. atroseptica 3-2

    SciTech Connect

    Nikolaichik, E.A.; Pesnyakevich, A.G.

    1995-07-01

    Two Hfr-like donor strains of bacteria Erwinia carotovora subsp. atroseptica (Eca) 3-2 were developed by integration into the chromosome of the conjugative plasmid R471a via homology with transposon Tn9. Using these and two donor strains created earlier, we constructed the genetic map of a fragment of the chromosome of strain Eca 3-2. The location of 14 loci is shown in this map. 15 refs., 3 figs., 1 tab.

  13. Analytical cytology applied to detection of induced cytogenetic abnormalities

    SciTech Connect

    Gray, J.W.; Lucas, J.; Straume, T.; Pinkel, D.

    1987-08-06

    Radiation-induced biological damage results in formation of a broad spectrum of cytogenetic changes such as translocations, dicentrics, ring chromosomes, and acentric fragments. A battery of analytical cytologic techniques are now emerging that promise to significantly improve the precision and ease with which these radiation induced cytogenetic changes can be quantified. This report summarizes techniques to facilitate analysis of the frequency of occurrence of structural and numerical aberrations in control and irradiated human cells. 14 refs., 2 figs.

  14. The chromosome cycle of prokaryotes.

    PubMed

    Kuzminov, Andrei

    2013-10-01

    In both eukaryotes and prokaryotes, chromosomal DNA undergoes replication, condensation-decondensation and segregation, sequentially, in some fixed order. Other conditions, like sister-chromatid cohesion (SCC), may span several chromosomal events. One set of these chromosomal transactions within a single cell cycle constitutes the 'chromosome cycle'. For many years it was generally assumed that the prokaryotic chromosome cycle follows major phases of the eukaryotic one: -replication-condensation-segregation-(cell division)-decondensation-, with SCC of unspecified length. Eventually it became evident that, in contrast to the strictly consecutive chromosome cycle of eukaryotes, all stages of the prokaryotic chromosome cycle run concurrently. Thus, prokaryotes practice 'progressive' chromosome segregation separated from replication by a brief SCC, and all three transactions move along the chromosome at the same fast rate. In other words, in addition to replication forks, there are 'segregation forks' in prokaryotic chromosomes. Moreover, the bulk of prokaryotic DNA outside the replication-segregation transition stays compacted. I consider possible origins of this concurrent replication-segregation and outline the 'nucleoid administration' system that organizes the dynamic part of the prokaryotic chromosome cycle.

  15. Fragment oriented molecular shapes.

    PubMed

    Hain, Ethan; Camacho, Carlos J; Koes, David Ryan

    2016-05-01

    Molecular shape is an important concept in drug design and virtual screening. Shape similarity typically uses either alignment methods, which dynamically optimize molecular poses with respect to the query molecular shape, or feature vector methods, which are computationally less demanding but less accurate. The computational cost of alignment can be reduced by pre-aligning shapes, as is done with the Volumetric-Aligned Molecular Shapes (VAMS) method. Here, we introduce and evaluate fragment oriented molecular shapes (FOMS), where shapes are aligned based on molecular fragments. FOMS enables the use of shape constraints, a novel method for precisely specifying molecular shape queries that provides the ability to perform partial shape matching and supports search algorithms that function on an interactive time scale. When evaluated using the challenging Maximum Unbiased Validation dataset, shape constraints were able to extract significantly enriched subsets of compounds for the majority of targets, and FOMS matched or exceeded the performance of both VAMS and an optimizing alignment method of shape similarity search. PMID:27085751

  16. Chromosome 19 International Workshop

    SciTech Connect

    Pericak-Vance, M.A. . Medical Center); Ropers, H.H. . Dept. of Human Genetics); Carrano, A.J. )

    1993-01-04

    The Second International Workshop on Human Chromosome 19 was hosted on January 25 and 26, 1992, by the Department of Human Genetics, University Hospital Nijmegen, The Netherlands, at the 'Meerdal Conference Center'. The workshop was supported by a grant from the European Community obtained through HUGO, the Dutch Research Organization (NWO) and the Muscular Dystrophy Association (MDA). Travel support for American participants was provided by the Department of Energy. The goals of this workshop were to produce genetic, physical and integrated maps of chromosome 19, to identify inconsistencies and gaps, and to discuss and exchange resources and techniques available for the completion of these maps. The second day of the meeting was largely devoted to region or disease specific efforts. In particular, the meeting served as a platform for assessing and discussing the recent progress made into the molecular elucidation of myotonic dystrophy.

  17. Chromosomal evolution in Rodentia.

    PubMed

    Romanenko, S A; Perelman, P L; Trifonov, V A; Graphodatsky, A S

    2012-01-01

    Rodentia is the most species-rich mammalian order and includes several important laboratory model species. The amount of new information on karyotypic and phylogenetic relations within and among rodent taxa is rapidly increasing, but a synthesis of these data is currently lacking. Here, we have integrated information drawn from conventional banding studies, recent comparative painting investigations and molecular phylogenetic reconstructions of different rodent taxa. This permitted a revision of several ancestral karyotypic reconstructions, and a more accurate depiction of rodent chromosomal evolution.

  18. Construction of human chromosome 21-specific yeast artificial chromosomes.

    PubMed

    McCormick, M K; Shero, J H; Cheung, M C; Kan, Y W; Hieter, P A; Antonarakis, S E

    1989-12-01

    Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to greater than 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtained from a mouse-human hybrid, ranging in size from 200 to greater than 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes (corresponding to the YAC ends recovered in Escherichia coli) to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from approximately equal to 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.

  19. Effect of met-enkephalin on chromosomal aberrations in the lymphocytes of the peripheral blood of patients with multiple sclerosis

    PubMed Central

    Rakanović-Todić, Maida; Burnazović-Ristić, Lejla; Ibrulj, Slavka; Mulabegović, Nedžad

    2014-01-01

    Endogenous opiod met-enkephalin throughout previous research manifested cytoprotective and anti-inflammatory effects. Previous research suggests that met-enkephalin has cytogenetic effects. Reducement in the frequency of structural chromosome aberrations as well as a suppressive effect on lymphocyte cell cycle is found. It also reduces apoptosis in the blood samples of the patients with immune-mediated diseases. Met-enkephalin exerts immunomodulatory properties and induces stabilization of the clinical condition in patients with multiple Sclerosis (MS). The goal of the present research was to evaluate met-enkephalin in vitro effects on the number and type of chromosome aberrations in the peripheral blood lymphocytes of patients with MS. Our research detected disappearance of ring chromosomes and chromosome fragmentations in the cultures of the peripheral blood lymphocytes treated with met-enkephalin (1.2 μg/mL). However, this research did not detect any significant effects of met-enkephalin on the reduction of structural chromosome aberrations and disappearance of dicentric chromosomes. Chromosomes with the greatest percent of inclusion in chromosome aberrations were noted as: chromosome 1, chromosome 2 and chromosome 9. Additionally, we confirmed chromosome 14 as the most frequently included in translocations. Furthermore, met-enkephalin effects on the increase of the numerical aberrations in both concentrations applied were detected. Those findings should be interpreted cautiously and more research in this field should be conducted. PMID:24856378

  20. Chromosome abnormalities in glioma

    SciTech Connect

    Li, Y.S.; Ramsay, D.A.; Fan, Y.S.

    1994-09-01

    Cytogenetic studies were performed in 25 patients with gliomas. An interesting finding was a seemingly identical abnormality, an extra band on the tip of the short arm of chromosome 1, add(1)(p36), in two cases. The abnormality was present in all cells from a patient with a glioblastoma and in 27% of the tumor cells from a patient with a recurrent irradiated anaplastic astrocytoma; in the latter case, 7 unrelated abnormal clones were identified except 4 of those clones shared a common change, -Y. Three similar cases have been described previously. In a patient with pleomorphic astrocytoma, the band 1q42 in both homologues of chromosome 1 was involved in two different rearrangements. A review of the literature revealed that deletion of the long arm of chromosome 1 including 1q42 often occurs in glioma. This may indicate a possible tumor suppressor gene in this region. Cytogenetic follow-up studies were carried out in two patients and emergence of unrelated clones were noted in both. A total of 124 clonal breakpoints were identified in the 25 patients. The breakpoints which occurred three times or more were: 1p36, 1p22, 1q21, 1q25, 3q21, 7q32, 8q22, 9q22, 16q22, and 22q13.

  1. Interpreting Chromosome Aberration Spectra

    NASA Technical Reports Server (NTRS)

    Levy, Dan; Reeder, Christopher; Loucas, Bradford; Hlatky, Lynn; Chen, Allen; Cornforth, Michael; Sachs, Rainer

    2007-01-01

    Ionizing radiation can damage cells by breaking both strands of DNA in multiple locations, essentially cutting chromosomes into pieces. The cell has enzymatic mechanisms to repair such breaks; however, these mechanisms are imperfect and, in an exchange process, may produce a large-scale rearrangement of the genome, called a chromosome aberration. Chromosome aberrations are important in killing cells, during carcinogenesis, in characterizing repair/misrepair pathways, in retrospective radiation biodosimetry, and in a number of other ways. DNA staining techniques such as mFISH ( multicolor fluorescent in situ hybridization) provide a means for analyzing aberration spectra by examining observed final patterns. Unfortunately, an mFISH observed final pattern often does not uniquely determine the underlying exchange process. Further, resolution limitations in the painting protocol sometimes lead to apparently incomplete final patterns. We here describe an algorithm for systematically finding exchange processes consistent with any observed final pattern. This algorithm uses aberration multigraphs, a mathematical formalism that links the various aspects of aberration formation. By applying a measure to the space of consistent multigraphs, we will show how to generate model-specific distributions of aberration processes from mFISH experimental data. The approach is implemented by software freely available over the internet. As a sample application, we apply these algorithms to an aberration data set, obtaining a distribution of exchange cycle sizes, which serves to measure aberration complexity. Estimating complexity, in turn, helps indicate how damaging the aberrations are and may facilitate identification of radiation type in retrospective biodosimetry.

  2. Chromosome size-correlated and chromosome size-uncorrelated homogenization of centromeric repetitive sequences in New World quails.

    PubMed

    Ishishita, Satoshi; Tsuruta, Yuri; Uno, Yoshinobu; Nakamura, Atsushi; Nishida, Chizuko; Griffin, Darren K; Tsudzuki, Masaoki; Ono, Tamao; Matsuda, Yoichi

    2014-04-01

    Many families of centromeric repetitive DNA sequences isolated from Struthioniformes, Galliformes, Falconiformes, and Passeriformes are localized primarily to microchromosomes. However, it is unclear whether chromosome size-correlated homogenization is a common characteristic of centromeric repetitive sequences in Aves. New World and Old World quails have the typical avian karyotype comprising chromosomes of two distinct sizes, and C-positive heterochromatin is distributed in centromeric regions of most autosomes and the whole W chromosome. We isolated six types of centromeric repetitive sequences from three New World quail species (Colinus virginianus, CVI; Callipepla californica, CCA; and Callipepla squamata, CSQ; Odontophoridae) and one Old World quail species (Alectoris chukar, ACH; Phasianidae), and characterized the sequences by nucleotide sequencing, chromosome in situ hybridization, and filter hybridization. The 385-bp CVI-MspI, 591-bp CCA-BamHI, 582-bp CSQ-BamHI, and 366-bp ACH-Sau3AI fragments exhibited tandem arrays of the monomer unit, and the 224-bp CVI-HaeIII and 135-bp CCA-HaeIII fragments were composed of minisatellite-like and microsatellite-like repeats, respectively. ACH-Sau3AI was a homolog of the chicken nuclear membrane repeat sequence, whose homologs are common in Phasianidae. CVI-MspI, CCA-BamHI, and CSQ-BamHI showed high homology and were specific to the Odontophoridae. CVI-MspI was localized to microchromosomes, whereas CVI-HaeIII, CCA-BamHI, and CSQ-BamHI were mapped to almost all chromosomes. CCA-HaeIII was localized to five pairs of macrochromosomes and most microchromosomes. ACH-Sau3AI was distributed in three pairs of macrochromosomes and all microchromosomes. Centromeric repetitive sequences may be homogenized in chromosome size-correlated and -uncorrelated manners in New World quails, although there may be a mechanism that causes homogenization of centromeric repetitive sequences primarily between microchromosomes, which is commonly

  3. Synthesis and structure of bismuth(III)-containing noncentrosymmetric phosphates, Cs3KBi2M4(PO4)6Cl (M = Mn, Fe). Monoclinic (Cc) and tetragonal (P43) polymorphs templated by chlorine-centered Cl(Bi2Cs) acentric units.

    PubMed

    West, J Palmer; Sulejmanovic, Dino; Hwu, Shiou-Jyh; He, Jian; VanDerveer, Don; Johnson, B Keith

    2012-09-17

    Single crystals of three new noncentrosymmetric (NCS) phosphates, α (1) and β (2) forms of Cs(3)KBi(2)Mn(4)(PO(4))(6)Cl and α-Cs(3)KBi(2)Fe(4)(PO(4))(6)Cl (3), were grown in a reactive CsCl/KCl molten-salt media. Their structures were determined by single-crystal X-ray diffraction methods showing that the α form crystallizes in the space group Cc (No. 9), which is in one of the 10 NCS polar crystal classes, m (2/m) while the β form crystallizes in P4(3) (No. 78) of another polar class, 4 (4/m). The unit cell parameters of the α form can be approximately correlated with that of the β form via the 3 × 3 orientation matrix [0.5, 0.5, 0; -0.5, 0.5, 0; 0, 0, 2 sin β]. The structures of these otherwise complicated phosphates exhibit two types of channels with circular and elliptical windows where the Cl-centered Cl(Bi(2)Cs) acentric unit is located. The neighboring acentric units are arranged in a parallel fashion in the α form, resulting in the monoclinic (Cc) lattice, but "antiparallel" in the β form, thus giving the tetragonal (P4(3)) unit cell. 1-3 feature the compatible M-O-P unit that contains four crystallographically independent MO(x) (x = 4, 5) polyhedra, which are connected to the Cl(Bi(2)Cs) acentric unit through one short and one long M(II)···Cl bond. The compositions of 1 and 2 consist of three Mn(2+) (d(5)) and one Mn(3+) (d(4)) per formula unit and that of 3 has three Fe(2+) (d(6)) and one Fe(3+) (d(5)). Bond valence sums reveal that, in the α phase, the trivalent site adopts distorted tetrahedral M(1)(3+)O(4) coordination and, in the β phase, distorted trigonal-bipyramidal M(4)(3+)O(5). Thus far, the iron phase has only been isolated in the α form presumably because of little extra stabilization energy gain if the Fe(2+) d(6) ion were to occupy the M(1)O(4) site. The possible origins pertaining to the structural differences in the α and β forms are discussed. PMID:22924609

  4. The human immediate early gene BRF1 maps to chromosome 14q22-q24

    SciTech Connect

    Maclean, K.N.; Bustin, S.A.; McKay, I.A.; See, C.G.

    1995-11-01

    BRF1 (Butyrate response factor 1) is a member of an immediate early gene family specifying putative nuclear transcription factors. A repeat motif incorporating two Cys and two His is highly conserved between family members identified from yeast, Drosophila, mouse, rat, and human. The chromosome localization of none of the human genes has been determined thus far. Using the polymerase chain reaction on a human-rodent hybrid panel, we have localized BRF1 to chromosome 14. This was confirmed by direct sequencing of the PCR fragment. Using fluorescence in situ hybridization, the chromosome localization of BRF1 was further determined as 14q22-q24. 15 refs., 1 fig.

  5. Synthesis and characterization of magnetic solids featuring 3d-4f heterometallic oxides comprised of spin chains and 3d-6p noncentrosymmetric oxides templated by acentric salt units

    NASA Astrophysics Data System (ADS)

    West, Jennings Palmer

    solvent media is the fact that the salt itself or the alkali/alkaline-earth oxides formed in situ can be incorporated in phase formations. Both of the aforementioned cases, if incorporated, lead to an additional and different type of nonmagnetic spacer for the formation of low-dimensional 3d-4 f extended solids. It is believed that these nonmagnetic, ionic spacers are more disruptive to magnetic super-super-exchange in comparison to the nonmagnetic oxyanionic spacers, and should assist further in achieving truly confined magnetic sublattices. In the studies presented, the overall highlight considering structure and property correlations will be most exemplified through the comparison of two different pseudo-one-dimensional (1D), 3d-4 f arsenate systems (Chapters 3 and 4) where it is observed that further spacing of the 3d-4f sublattices leads to interesting low-dimensional magnetic behavior. In addition, an extension of one of these pseudo-1D, 3d-4f systems (Chapter 5) will highlight the intriguing properties resulting from the study of a family of compounds whereby a double aliovalent substitution has been performed with respect to the parent family. This particular system features a solid solution series where charge disorder exists, and in terms of magnetic properties, there are unique variations in comparison to the parent family. And finally, in relation to heterometallic system types, a new noncentrosymmetric phosphate family containing mixed 3d-6p (where 3 d = Mn, Fe; 6p = Bi3+) will be discussed (Chapter 6). As will be mentioned, new 3d-6p systems were explored originally for host materials where lanthanides could be substituted. Independent of lanthanide substitutions that are yet to be proven, the combination of both bulk acentricity and magnetically active ions makes systems of this type worthy of study due to multiferroic potentials aimed toward the coupling of polarization and magnetization.

  6. Pulsed-field gel electrophoresis for isolation of full-length phytoplasma chromosomes from plants.

    PubMed

    Marcone, Carmine

    2013-01-01

    Pulsed-field gel electrophoresis (PFGE) is a powerful technique for genomic studies of unculturable plant-pathogenic phytoplasmas, which enables separation of full-length phytoplasma chromosomes from contaminating host plant nucleic acids. The PFGE method described here involves isolation of phytoplasmal DNA from high-titer phytoplasma-infected herbaceous plants using a phytoplasma enrichment procedure, embedding of phytoplasma chromosomes in agarose blocks, and separation of entire phytoplasma chromosomes from contaminating host plant nucleic acids by electrophoresis. Full-length phytoplasma chromosomes are resolved as single, discrete bands in the gel. The identity of these bands can be confirmed by Southern blot hybridization using a ribosomal DNA fragment as a probe. The method does not utilize gamma-irradiation to linearize phytoplasma chromosomes prior to electrophoresis. PMID:22987433

  7. Chromosome aberrations in plants as a monitoring system.

    PubMed Central

    Grant, W F

    1978-01-01

    The potential of higher plants as a first-tier assay system for detecting chemical mutagens is evaluated. The use of plant tissue (primarily root tips and pollen mother cells) for studying the induction of chromosomal aberrations is one of the oldest, simplest, most reliable, and inexpensive methods available. Specific types of abnormalities have been induced by different classes of pesticides. Chromosome clumping, contraction, stickiness, paling, fragmentation, dissolution, chromosome and chromatid bridges, C-mitosis, and endoploidy have been reported in the literature. Examples of cytogenetic studies with pesticides demonstrating the usefulness of higher plants as a monitoring system are reviewed. Pesticides which cause chromosome aberrations in plant cells also produce chromosome aberrations in cultured animal cells. Frequently, the aberrations are identical. For example, studies have shown that compounds which have a C-mitotic effect on plant cells have the same effect on animal cells. It is recommended that plant systems be accepted as a first-tier assay system for the detection of possible genetic damage by environmental chemicals. PMID:367773

  8. Moving toward a higher efficiency of microcell-mediated chromosome transfer

    PubMed Central

    Liskovykh, Mikhail; Lee, Nicholas CO; Larionov, Vladimir; Kouprina, Natalay

    2016-01-01

    Microcell-mediated chromosome transfer (MMCT) technology enables individual mammalian chromosomes, megabase-sized chromosome fragments, or mammalian artificial chromosomes that include human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) to be transferred from donor to recipient cells. In the past few decades, MMCT has been applied to various studies, including mapping the genes, analysis of chromosome status such as aneuploidy and epigenetics. Recently, MMCT was applied to transfer MACs/HACs carrying entire chromosomal copies of genes for genes function studies and has potential for regenerative medicine. However, a safe and efficient MMCT technique remains an important challenge. The original MMCT protocol includes treatment of donor cells by Colcemid to induce micronucleation, where each chromosome becomes surrounded with a nuclear membrane, followed by disarrangement of the actin cytoskeleton using Cytochalasin B to help induce microcells formation. In this study, we modified the protocol and demonstrated that replacing Colcemid and Cytochalasin B with TN-16 + Griseofulvin and Latrunculin B in combination with a Collage/Laminin surface coating increases the efficiency of HAC transfer to recipient cells by almost sixfold and is possibly less damaging to HAC than the standard MMCT method. We tested the improved MMCT protocol on four recipient cell lines, including human mesenchymal stem cells and mouse embryonic stem cells that could facilitate the cell engineering by HACs. PMID:27382603

  9. Mitotic and meiotic behavior of rye chromosomes in wheat - Psathyrostachys huashanica amphiploid x triticale progeny.

    PubMed

    Xie, Q; Kang, H; Sparkes, D L; Tao, S; Fan, X M; Xu, L; Fan, X; Sha, L; Zhang, H; Wang, Y; Zeng, J; Zhou, Y

    2013-07-24

    The dynamics of rye chromosomes during mitosis and meiosis was analyzed in a subset comprising 33 F3 lines from the cross of wheat, Psathyrostachys huashanica amphiploid (AABBDDNsNs) and hexaploid triticale (AABBRR), as visualized by genomic in situ hybridization. The results indicated that 31 of the total lines contained 4-14 rye chromosomes. Twenty-eight combinations had more rye chromosomes than the F1 hybrids, suggesting the occurrence of spontaneous quantitative increment. No P. huashanica chromosomes were detected in all of the combinations tested. Mitotic analysis showed that rye chromosomes progressed normally with the wheat counterparts without loss. However, abnormal meiosis was found in almost all lines. Similar progression between wheat and rye genomes appeared from interphase to metaphase I. It was at anaphase I that many rye univalents lagged behind those of wheat, followed by equational division. This resulted in the formation of chromosomal segments and micronuclei at telophase I or II. Micronuclei could also be generated from the immobilized univalents in the periphery of cells. Synapsis and translocations between wheat and rye genomes, chromosome bridges, and unreduced gametes were detected. Therefore, it is proposed that rye chromosome elimination may involve chromatid lagging, fragmentation and micronucleation, or the immobilization of certain univalents during meiosis instead of mitosis in the relatively advanced generations. This mechanism, together with spontaneous incremental increase of rye chromosome number, permitted the generation of various germplasms for wheat improvement.

  10. Moving toward a higher efficiency of microcell-mediated chromosome transfer.

    PubMed

    Liskovykh, Mikhail; Lee, Nicholas Co; Larionov, Vladimir; Kouprina, Natalay

    2016-01-01

    Microcell-mediated chromosome transfer (MMCT) technology enables individual mammalian chromosomes, megabase-sized chromosome fragments, or mammalian artificial chromosomes that include human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) to be transferred from donor to recipient cells. In the past few decades, MMCT has been applied to various studies, including mapping the genes, analysis of chromosome status such as aneuploidy and epigenetics. Recently, MMCT was applied to transfer MACs/HACs carrying entire chromosomal copies of genes for genes function studies and has potential for regenerative medicine. However, a safe and efficient MMCT technique remains an important challenge. The original MMCT protocol includes treatment of donor cells by Colcemid to induce micronucleation, where each chromosome becomes surrounded with a nuclear membrane, followed by disarrangement of the actin cytoskeleton using Cytochalasin B to help induce microcells formation. In this study, we modified the protocol and demonstrated that replacing Colcemid and Cytochalasin B with TN-16 + Griseofulvin and Latrunculin B in combination with a Collage/Laminin surface coating increases the efficiency of HAC transfer to recipient cells by almost sixfold and is possibly less damaging to HAC than the standard MMCT method. We tested the improved MMCT protocol on four recipient cell lines, including human mesenchymal stem cells and mouse embryonic stem cells that could facilitate the cell engineering by HACs. PMID:27382603

  11. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    PubMed

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  12. Loss of heterozygosity in human ductal breast tumors indicates a recessive mutation on chromosome 13

    SciTech Connect

    Lundberg, C.; Skoog, L.; Cavenee, W.K.; Nordenskjoeld, M.

    1987-04-01

    The genotypes at chromosomal loci defined by recombinant DNA probes revealing restriction fragment length polymorphisms were determined in constitutional and tumor tissue from 10 cases of ductal breast cancer: eight premenopausal females and two males. Somatic loss of constitutional heterozygosity was observed at loci on chromosome 13 in primary tumor tissue from three females and one male. In two cases, specific loss of heterozygosity at three distinct genetic loci along the length of the chromosome was observed. In another case, concurrent loss of alleles at loci on chromosomes 2, 13, 14, and 20 was detected, whereas a fourth case showed loss of heterozygosity for chromosomes 5 and 13. In each instance, the data were consistent with loss of one of the homologous chromosomes by mitotic nondisjunction. Analysis of loci on several other chromosomes showed retention of constitutional heterozygosity suggesting the relative specificity of the events. In contrast, similar analyses of other breast cancers, including comedocarcinoma, medullary carcinoma, and juvenile secretory carcinoma, showed no loss of alleles at loci on chromosome 13. These data indicate that the pathogenesis of ductal breast cancer may, in a substantial proportion of cases, involve unmasking of a recessive locus on chromosome 13 and suggest the involvement of such a locus in heritable forms of this disease.

  13. Chapter 4 embedded metal fragments.

    PubMed

    Kalinich, John F; Vane, Elizabeth A; Centeno, Jose A; Gaitens, Joanna M; Squibb, Katherine S; McDiarmid, Melissa A; Kasper, Christine E

    2014-01-01

    The continued evolution of military munitions and armor on the battlefield, as well as the insurgent use of improvised explosive devices, has led to embedded fragment wounds containing metal and metal mixtures whose long-term toxicologic and carcinogenic properties are not as yet known. Advances in medical care have greatly increased the survival from these types of injuries. Standard surgical guidelines suggest leaving embedded fragments in place, thus individuals may carry these retained metal fragments for the rest of their lives. Nursing professionals will be at the forefront in caring for these wounded individuals, both immediately after the trauma and during the healing and rehabilitation process. Therefore, an understanding of the potential health effects of embedded metal fragment wounds is essential. This review will explore the history of embedded fragment wounds, current research in the field, and Department of Defense and Department of Veterans Affairs guidelines for the identification and long-term monitoring of individuals with embedded fragments.

  14. Binary stars - Formation by fragmentation

    NASA Technical Reports Server (NTRS)

    Boss, Alan P.

    1988-01-01

    Theories of binary star formation by capture, separate nuclei, fission and fragmentation are compared, assessing the success of theoretical attempts to explain the observed properties of main-sequence binary stars. The theory of formation by fragmentation is examined, discussing the prospects for checking the theory against observations of binary premain-sequence stars. It is concluded that formation by fragmentation is successful at explaining many of the key properties of main-sequence binary stars.

  15. Chromosome assortment in Saccharum.

    PubMed

    Al-Janabi, S M; Honeycutt, R J; Sobral, B W

    1994-12-01

    Recent work has revealed random chromosome pairing and assortment in Saccharum spontaneum L., the most widely distributed, and morphologically and cytologically variable of the species of Saccharum. This conclusion was based on the analysis of a segregating population from across between S. spontaneum 'SES 208' and a spontaneously-doubled haploid of itself, derived from anther culture. To determine whether polysomic inheritance is common in Saccharum and whether it is observed in a typical biparental cross, we studied chromosome pairing and assortment in 44 progeny of a cross between euploid, meiotically regular, 2n=80 forms of Saccharum officinarum 'LA Purple' and Saccharum robustum ' Mol 5829'. Papuan 2n=80 forms of S. robustum have been suggested as the immediate progenitor species for cultivated sugarcane (S. officinarum). A total of 738 loci in LA Purple and 720 loci in Mol 5829 were amplified and typed in the progeny by arbitrarily primed PCR using 45 primers. Fifty and 33 single-dose polymorphisms were identified in the S. officinarum and S. robustum genomes, respectively (χ 2 at 98%). Linkage analysis of single-dose polymorphisms in both genomes revealed linkages in repulsion and coupling phases. In the S. officinarum genome, a map hypothesis gave 7 linkage groups with 17 linked and 33 unlinked markers. Four of 13 pairwise linkages were in repulsion phase and 9 were in coupling phase. In the S. robustum genome, a map hypothesis gave 5 linkage groups, defined by 12 markers, with 21 markers unlinked, and 2 of 9 pairwise linkages were in repulsion phase. Therefore, complete polysomic inheritance was not observed in either species, suggesting that chromosomal behavior is different from that observed by linkage analysis of over 500 markers in the S. spontaneum map. Implications of this finding for evolution and breeding are discussed.

  16. Constructing chromosome- and region-specific cosmid maps of the human genome.

    PubMed

    Carrano, A V; de Jong, P J; Branscomb, E; Slezak, T; Watkins, B W

    1989-01-01

    A chromosome-specific ordered set of cosmids would be a significant contribution toward understanding human chromosome structure and function. We are developing two parallel approaches for creating an ordered cosmid library of human chromosome 19 and other selected subregions of the human genome. The "bottom up" approach is used to establish sets of overlapping cosmids as islands or "contigs" along the chromosome, while the "top down" approach, using pulsed-field gel electrophoresis and yeast cloning, will establish a large-fragment map and close the inevitable gaps remaining from the "bottom up" approach. Source DNA consists of a single homolog of chromosome 19 from a hamster--human hybrid cell and human fragments cloned in yeast artificial chromosomes. We have constructed cosmid libraries in a vector that facilitates cloning small amounts of DNA, allows transcription of the insert termini, and contains unique sites for partial-digest mapping. Computer simulations of cosmid contig building suggest that near-optimal efficiency can be achieved with high-density restriction fragment digest schemes that can detect 20-30% overlap between cosmids. We developed the chemistry and data analysis tools to compare the ordering efficiencies of several cosmid restriction digest fingerprinting strategies. Restriction fragments from a four-cutter digest are labeled with a fluorochrome, separated by polyacrylamide gel electrophoresis, and detected after laser excitation as they traverse a fixed point in the gel. We have also developed the software to rapidly process the output signal to define and analyze the fragment peaks. Up to three cosmids (or three different digests of the same cosmid) plus a size standard are analyzed simultaneously in a single gel lane.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2698823

  17. Chromosome Connections: Compelling Clues to Common Ancestry

    ERIC Educational Resources Information Center

    Flammer, Larry

    2013-01-01

    Students compare banding patterns on hominid chromosomes and see striking evidence of their common ancestry. To test this, human chromosome no. 2 is matched with two shorter chimpanzee chromosomes, leading to the hypothesis that human chromosome 2 resulted from the fusion of the two shorter chromosomes. Students test that hypothesis by looking for…

  18. X chromosome and suicide.

    PubMed

    Fiori, L M; Zouk, H; Himmelman, C; Turecki, G

    2011-02-01

    Suicide completion rates are significantly higher in males than females in most societies. Although gender differences in suicide rates have been partially explained by environmental and behavioral factors, it is possible that genetic factors, through differential expression between genders, may also help explain gender moderation of suicide risk. This study investigated X-linked genes in suicide completers using a two-step strategy. We first took advantage of the genetic structure of the French-Canadian population and genotyped 722 unrelated French-Canadian male subjects, of whom 333 were suicide completers and 389 were non-suicide controls, using a panel of 37 microsatellite markers spanning the entire X chromosome. Nine haplotype windows and several individual markers were associated with suicide. Significant results aggregated primarily in two regions, one in the long arm and another in the short arm of chromosome X, limited by markers DXS8051 and DXS8102, and DXS1001 and DXS8106, respectively. The second stage of the study investigated differential brain expression of genes mapping to associated regions in Brodmann areas 8/9, 11, 44 and 46, in an independent sample of suicide completers and controls. Six genes within these regions, Rho GTPase-activating protein 6, adaptor-related protein complex 1 sigma 2 subunit, glycoprotein M6B, ribosomal protein S6 kinase 90  kDa polypeptide 3, spermidine/spermine N(1)-acetyltransferase 1 and THO complex 2, were found to be differentially expressed in suicide completers. PMID:20010893

  19. Analysis of Peptidoglycan Fragment Release.

    PubMed

    Schaub, Ryan E; Lenz, Jonathan D; Dillard, Joseph P

    2016-01-01

    Most bacteria break down a significant portion of their cell wall peptidoglycan during each round of growth and cell division. This process generates peptidoglycan fragments of various sizes that can either be imported back into the cytoplasm for recycling or released from the cell. Released fragments have been shown to act as microbe-associated molecular patterns for the initiation of immune responses, as triggers for the initiation of mutualistic host-microbe relationships, and as signals for cell-cell communication in bacteria. Characterizing these released peptidoglycan fragments can, therefore, be considered an important step in understanding how microbes communicate with other organisms in their environments. In this chapter, we describe methods for labeling cell wall peptidoglycan, calculating the rate at which peptidoglycan is turned over, and collecting released peptidoglycan to determine the abundance and species of released fragments. Methods are described for both the separation of peptidoglycan fragments by size-exclusion chromatography and further detailed analysis by HPLC.

  20. Fragment Screening and HIV Therapeutics

    PubMed Central

    Bauman, Joseph D.; Patel, Disha; Arnold, Eddy

    2013-01-01

    Fragment screening has proven to be a powerful alternative to traditional methods for drug discovery. Biophysical methods, such as X-ray crystallography, NMR spectroscopy, and surface plasmon resonance, are used to screen a diverse library of small molecule compounds. Although compounds identified via this approach have relatively weak affinity, they provide a good platform for lead development and are highly efficient binders with respect to their size. Fragment screening has been utilized for a wide-range of targets, including HIV-1 proteins. Here, we review the fragment screening studies targeting HIV-1 proteins using X-ray crystallography or surface plasmon resonance. These studies have successfully detected binding of novel fragments to either previously established or new sites on HIV-1 protease and reverse transcriptase. In addition, fragment screening against HIV-1 reverse transcriptase has been used as a tool to better understand the complex nature of ligand binding to a flexible target. PMID:21972022

  1. Fragment-based drug design.

    PubMed

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process. PMID:20981527

  2. The single mitochondrial chromosome typical of animals has evolved into 18 minichromosomes in the human body louse, Pediculus humanus

    PubMed Central

    Shao, Renfu; Kirkness, Ewen F.; Barker, Stephen C.

    2009-01-01

    The mitochondrial (mt) genomes of animals typically consist of a single circular chromosome that is ∼16-kb long and has 37 genes. Our analyses of the sequence reads from the Human Body Louse Genome Project and the patterns of gel electrophoresis and Southern hybridization revealed a novel type of mt genome in the sucking louse, Pediculus humanus. Instead of having all mt genes on a single chromosome, the 37 mt genes of this louse are on 18 minicircular chromosomes. Each minicircular chromosome is 3–4 kb long and has one to three genes. Minicircular mt chromosomes are also present in the four other species of sucking lice that we investigated, but not in chewing lice nor in the Psocoptera, to which sucking lice are most closely related. We also report unequivocal evidence for recombination between minicircular mt chromosomes in P. humanus and for sequence variation in mt genes generated by recombination. The advantages of a fragmented mt genome, if any, are currently unknown. Fragmentation of mt genome, however, has coevolved with blood feeding in the sucking lice. It will be of interest to explore whether or not life history features are associated with the evolution of fragmented chromosomes. PMID:19336451

  3. The single mitochondrial chromosome typical of animals has evolved into 18 minichromosomes in the human body louse, Pediculus humanus.

    PubMed

    Shao, Renfu; Kirkness, Ewen F; Barker, Stephen C

    2009-05-01

    The mitochondrial (mt) genomes of animals typically consist of a single circular chromosome that is approximately 16-kb long and has 37 genes. Our analyses of the sequence reads from the Human Body Louse Genome Project and the patterns of gel electrophoresis and Southern hybridization revealed a novel type of mt genome in the sucking louse, Pediculus humanus. Instead of having all mt genes on a single chromosome, the 37 mt genes of this louse are on 18 minicircular chromosomes. Each minicircular chromosome is 3-4 kb long and has one to three genes. Minicircular mt chromosomes are also present in the four other species of sucking lice that we investigated, but not in chewing lice nor in the Psocoptera, to which sucking lice are most closely related. We also report unequivocal evidence for recombination between minicircular mt chromosomes in P. humanus and for sequence variation in mt genes generated by recombination. The advantages of a fragmented mt genome, if any, are currently unknown. Fragmentation of mt genome, however, has coevolved with blood feeding in the sucking lice. It will be of interest to explore whether or not life history features are associated with the evolution of fragmented chromosomes.

  4. Chromosomal mapping of the human histone gene H2AZ to 4q24 by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.; Zimonjic, D.; Hatch, C.; Bonner, W. )

    1994-03-15

    The human gene locus H2AZ was assigned to chromosome 4 by challenging a panel of 27 human-hamster hybrid cell lines with oligonucleotide probes specific to two regions of the human gene. The human gene H2AZ locus has three EcoRI sites, yielding 2.9-kb upstream and 4.7-kb downstream fragments after digestion. Commercial Southern blots were obtained with EcoRI-digested DNA preparations from the 27 lines. An oligonucleotide probe, taagagaacgctagagggagctggtgttca, to intron 3 of the gene gave one human-specific band on these blots consistent in size with the expected 4.7-kb downstream EcoRI fragment; this band was mapped to chromosome 4 (2 hybrid lines with chromosome 4, 25 without it; 27 concordances, no discordances). A 5[prime] utr oligonucleotide probe, tgccttgcttgcttgagcttcagcggaatt, to the upstream 2.9-kb fragment yielded two bands on these Southern blots. The smaller band, consistent in size with the expected 2.9-kb EcoRI gene fragment, was also mapped to chromosome 4 (27 concordances, no discordances). The larger, approximately 6-kb band was mapped to chromosome 21 (7 hybrid lines with chromosome 21, 20 without it; 26 concordances, 1 discordance) and may result from a possible pseudogene. From these results, the human gene H2AZ is assigned to chromosome 4; a possible pseudogene is assigned to chromosome 21. Thus, the human gene H2AZ is not part of the clusters of human replication-lined histone genes that have been assigned to chromosome 1, 6 and 12.

  5. Organization of the bacterial chromosome.

    PubMed Central

    Krawiec, S; Riley, M

    1990-01-01

    Recent progress in studies on the bacterial chromosome is summarized. Although the greatest amount of information comes from studies on Escherichia coli, reports on studies of many other bacteria are also included. A compilation of the sizes of chromosomal DNAs as determined by pulsed-field electrophoresis is given, as well as a discussion of factors that affect gene dosage, including redundancy of chromosomes on the one hand and inactivation of chromosomes on the other hand. The distinction between a large plasmid and a second chromosome is discussed. Recent information on repeated sequences and chromosomal rearrangements is presented. The growing understanding of limitations on the rearrangements that can be tolerated by bacteria and those that cannot is summarized, and the sensitive region flanking the terminator loci is described. Sources and types of genetic variation in bacteria are listed, from simple single nucleotide mutations to intragenic and intergenic recombinations. A model depicting the dynamics of the evolution and genetic activity of the bacterial chromosome is described which entails acquisition by recombination of clonal segments within the chromosome. The model is consistent with the existence of only a few genetic types of E. coli worldwide. Finally, there is a summary of recent reports on lateral genetic exchange across great taxonomic distances, yet another source of genetic variation and innovation. PMID:2087223

  6. Cohesin in determining chromosome architecture

    SciTech Connect

    Haering, Christian H.; Jessberger, Rolf

    2012-07-15

    Cells use ring-like structured protein complexes for various tasks in DNA dynamics. The tripartite cohesin ring is particularly suited to determine chromosome architecture, for it is large and dynamic, may acquire different forms, and is involved in several distinct nuclear processes. This review focuses on cohesin's role in structuring chromosomes during mitotic and meiotic cell divisions and during interphase.

  7. Cloning and expression in Escherichia coli of chromosomal mercury resistance genes from a Bacillus sp

    SciTech Connect

    Wang, Y.; Mahler, I.; Levinson, H.S.; Halvorson, H.O.

    1987-10-01

    A 7.9-kilobase (kb) chromosomal fragment was cloned from a mercury-resistant Bacillus sp. In Escherichia coli, in the presence of a second plasmid carrying functional transport genes, resistance to HgCl/sub 2/ and to phenylmercury acetate (PMA) was expressed. Shortening the cloned fragment to 3.8 kb abolished resistance to PMA but not to HgCl/sub 2/. In Bacillus subtilis, the 3.8-kb fragment produced mercuric reductase constitutively but did not produce resistance to HgCl/sub 2/ or to PMA.

  8. Chromosome choreography: the meiotic ballet.

    PubMed

    Page, Scott L; Hawley, R Scott

    2003-08-01

    The separation of homologous chromosomes during meiosis in eukaryotes is the physical basis of Mendelian inheritance. The core of the meiotic process is a specialized nuclear division (meiosis I) in which homologs pair with each other, recombine, and then segregate from each other. The processes of chromosome alignment and pairing allow for homolog recognition. Reciprocal meiotic recombination ensures meiotic chromosome segregation by converting sister chromatid cohesion into mechanisms that hold homologous chromosomes together. Finally, the ability of sister kinetochores to orient to a single pole at metaphase I allows the separation of homologs to two different daughter cells. Failures to properly accomplish this elegant chromosome dance result in aneuploidy, a major cause of miscarriage and birth defects in human beings. PMID:12907787

  9. Higher order structure of chromosomes.

    PubMed

    Okada, T A; Comings, D E

    1979-04-01

    Isolated Chinese hamster metaphase chromosomes were resuspended in 4 M ammonium acetate and spread on a surface of distilled water or 0.15 to 0.5 M ammonium acetate. The DNA was released in the form of a regular series of rosettes connected by interrossette DNA. The mean length of the rosette DNA was 14 micron, similar to the mean length of 10 micron for chromomere DNA of Drosophila polytene chromosomes. The mean interrosette DNA was 4.2 micron. SDS gel electrophoresis of the chromosomal nonhistone proteins showed them to be very similar to nuclear nonhistone proteins except for the presence of more actin and tubulin. Nuclear matrix proteins were present in the chromosomes and may play a role in forming the rosettes. Evidence that the rosette pattern is artifactual versus the possibility that it represents a real organizational substructure of the chromosomes is reviewed.

  10. Schizophrenia and chromosomal deletions

    SciTech Connect

    Lindsay, E.A.; Baldini, A.; Morris, M. A.

    1995-06-01

    Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized. These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.

  11. Reduced Genetic Diversity and Increased Dispersal in Guigna (Leopardus guigna) in Chilean Fragmented Landscapes.

    PubMed

    Napolitano, Constanza; Díaz, Diego; Sanderson, Jim; Johnson, Warren E; Ritland, Kermit; Ritland, Carol E; Poulin, Elie

    2015-01-01

    Landscape fragmentation is often a major cause of species extinction as it can affect a wide variety of ecological processes. The impact of fragmentation varies among species depending on many factors, including their life-history traits and dispersal abilities. Felids are one of the groups most threatened by fragmented landscapes because of their large home ranges, territorial behavior, and low population densities. Here, we model the impacts of habitat fragmentation on patterns of genetic diversity in the guigna (Leopardus guigna), a small felid that is closely associated with the heavily human-impacted temperate rainforests of southern South America. We assessed genetic variation in 1798 base pairs of mitochondrial DNA sequences, 15 microsatellite loci, and 2 sex chromosome genes and estimated genetic diversity, kinship, inbreeding, and dispersal in 38 individuals from landscapes with differing degrees of fragmentation on Chiloé Island in southern Chile. Increased fragmentation was associated with reduced genetic diversity, but not with increased kinship or inbreeding. However, in fragmented landscapes, there was a weaker negative correlation between pairwise kinship and geographic distance, suggesting increased dispersal distances. These results highlight the importance of biological corridors to maximize connectivity in fragmented landscapes and contribute to our understanding of the broader genetic consequences of habitat fragmentation, especially for forest-specialist carnivores. PMID:26245787

  12. Reduced Genetic Diversity and Increased Dispersal in Guigna (Leopardus guigna) in Chilean Fragmented Landscapes.

    PubMed

    Napolitano, Constanza; Díaz, Diego; Sanderson, Jim; Johnson, Warren E; Ritland, Kermit; Ritland, Carol E; Poulin, Elie

    2015-01-01

    Landscape fragmentation is often a major cause of species extinction as it can affect a wide variety of ecological processes. The impact of fragmentation varies among species depending on many factors, including their life-history traits and dispersal abilities. Felids are one of the groups most threatened by fragmented landscapes because of their large home ranges, territorial behavior, and low population densities. Here, we model the impacts of habitat fragmentation on patterns of genetic diversity in the guigna (Leopardus guigna), a small felid that is closely associated with the heavily human-impacted temperate rainforests of southern South America. We assessed genetic variation in 1798 base pairs of mitochondrial DNA sequences, 15 microsatellite loci, and 2 sex chromosome genes and estimated genetic diversity, kinship, inbreeding, and dispersal in 38 individuals from landscapes with differing degrees of fragmentation on Chiloé Island in southern Chile. Increased fragmentation was associated with reduced genetic diversity, but not with increased kinship or inbreeding. However, in fragmented landscapes, there was a weaker negative correlation between pairwise kinship and geographic distance, suggesting increased dispersal distances. These results highlight the importance of biological corridors to maximize connectivity in fragmented landscapes and contribute to our understanding of the broader genetic consequences of habitat fragmentation, especially for forest-specialist carnivores.

  13. [Evolution of differential chromosome banding].

    PubMed

    Rodionov, A V

    1999-03-01

    Specific chromosome banding patterns in different eukaryotic taxons are reviewed. In all eukaryotes, chromosomes are composed of alternating bands, each differing from the adjacent material by the molecular composition and structural characteristics. In minute chromosomes of fungi and Protozoa, these bands are represented by kinetochores (Kt- (Cd-)bands), nucleolus organizers (N-bands), and telomeres as well as the euchromatin. In genomes of most fungi and protists, long clusters of tandem repeats and, consequently, C-bands were not revealed but they are likely to be found out in species with chromosomes visible under a light microscope, which are several tens of million bp in size. Chromosomes of Metazoa are usually larger. Even in Cnidaria, they contain C-bands, which are replicated late in the S phase. In Deuterostomia, chromosome euchromatin regions differ by replication time: bands replicating at the first half of the S phase alternate with bands replicating at the second half of the S phase. Longitudinal differentiation in the replication pattern of euchromatic regions is observed in all classes of Vertebrata beginning with the bony fish although the time when it developed in Deuterostomia is unknown. Apparently, the evolution of early and late replicating subdomains in Vertebrata euchromatin promoted fast accumulation of differences in the molecular composition of nucleoproteid complexes characteristic of early and late replicating bands. As a result, the more contrasting G/R and Q-banding patterns of chromosomes developed especially in Eutheria. The evolution of Protostomia and Plantae followed another path. An increase in chromosome size was not accompanied by the appearance of wide RBE and RBL euchromatin bands. The G/R-like banding within the interstitial chromosome regions observed in some representatives of Invertebrates and higher plants arose independently in different phylogenetic lineages. This banding pattern seems to be closer to that of C

  14. X-Chromosome dosage compensation.

    PubMed

    Meyer, Barbara J

    2005-01-01

    In mammals, flies, and worms, sex is determined by distinctive regulatory mechanisms that cause males (XO or XY) and females (XX) to differ in their dose of X chromosomes. In each species, an essential X chromosome-wide process called dosage compensation ensures that somatic cells of either sex express equal levels of X-linked gene products. The strategies used to achieve dosage compensation are diverse, but in all cases, specialized complexes are targeted specifically to the X chromosome(s) of only one sex to regulate transcript levels. In C. elegans, this sex-specific targeting of the dosage compensation complex (DCC) is controlled by the same developmental signal that establishes sex, the ratio of X chromosomes to sets of autosomes (X:A signal). Molecular components of this chromosome counting process have been defined. Following a common step of regulation, sex determination and dosage compensation are controlled by distinct genetic pathways. C. elegans dosage compensation is implemented by a protein complex that binds both X chromosomes of hermaphrodites to reduce transcript levels by one-half. The dosage compensation complex resembles the conserved 13S condensin complex required for both mitotic and meiotic chromosome resolution and condensation, implying the recruitment of ancient proteins to the new task of regulating gene expression. Within each C. elegans somatic cell, one of the DCC components also participates in the separate mitotic/meiotic condensin complex. Other DCC components play pivotal roles in regulating the number and distribution of crossovers during meiosis. The strategy by which C. elegans X chromosomes attract the condensin-like DCC is known. Small, well-dispersed X-recognition elements act as entry sites to recruit the dosage compensation complex and to nucleate spreading of the complex to X regions that lack recruitment sites. In this manner, a repressed chromatin state is spread in cis over short or long distances, thus establishing the

  15. Gene mapping in marsupials and monotremes. I. The chromosomes of rodent-marsupial (Macropus) cell hybrids, and gene assignments to the X chromosome of the grey kangaroo.

    PubMed

    Dawson, G W; Graves, J A

    1984-01-01

    Somatic cell genetic mapping of marsupial and monotreme species will greatly extend the power of comparative gene mapping to detect ancient mammalian gene arrangements. The use of eutherian-marsupial cell hybrids for such mapping is complicated by the frequent retention of deleted and rearranged marsupial chromosomes. We used staining techniques, involving the fluorochromes Hoechst 33258 and chromomycin A3, to facilitate rapid and unequivocal identification of marsupial chromosomes and chromosome segments and to make chromosome assignment and regional localization of marsupial genes possible. Chromosome segregation in rodent-macropod hybrids was consistent with preferential loss of the marsupial complement. The extent of loss was very variable. Some hybrids retained 30% of the marsupial complement; some retained small centric fragments; and some, no cytologically identifiable marsupial material. We examined the chromosomes and gene products of a number of rodent-grey kangaroo Macropus giganteus hybrids, and have assigned the genes Pgk-A (phosphoglycerate kinase-A), Hpt (Hypoxanthine-phosphoribosyl transferase), and Gpd (Glucose-6-phosphate dehydrogenase) to the long arm of the kangaroo X chromosome, and provisionally established the gene order Pgk-A--Hpt--Gpd.

  16. Androgenetic development of X- and Y-chromosome bearing haploid rainbow trout embryos.

    PubMed

    Michalik, Oliwia; Kowalski, Radosław K; Judycka, Sylwia; Rożyński, Rafał; Dobosz, Stefan; Ocalewicz, Konrad

    2016-09-01

    Haploid fish embryos are important in studies regarding role of the recessive traits during early ontogeny. In fish species with the male heterogamety, androgenetic haploid embryos might be also useful tool in studies concerning role of the sex chromosomes during an embryonic development. Morphologically differentiated X and Y chromosomes have been found in a limited number of fish species including rainbow trout (Oncorhynchus mykiss Walbaum 1792). To evaluate role of the sex chromosomes during rainbow trout embryonic development, survival of the androgenetic haploids in the presence of X or Y sex chromosomes has been examined. Androgenetic haploid rainbow trout were produced by fertilization of X-irradiated eggs with spermatozoa derived from the normal males (XY) and neomales, that is, sex-reversed females (XX) to produce X- and Y-bearing haploids, and all X-bearing haploids, respectively. Survival rates of the androgenetic progenies of normal males and neomales examined during embryogenesis and at hatching did not differ significantly. However, all haploids died within next few days after hatching. Cytogenetic analysis of the androgenetic embryos confirmed their haploid status. Moreover, apart from the intact paternal chromosomes, residues of the irradiated maternal chromosomes observed as chromosome fragments were identified in some of the haploids. Provided results suggested that rainbow trout X and Y chromosomes despite morphological and genetic differences are at the early stage of differentiation and still share genetic information responsible for the proper embryonic development.

  17. Chromosomal characterisation of five lepidopteran cell lines of Malacosoma disstria (Lasiocampidae) and Christoneura fumiferana (Tortricidae).

    PubMed

    Ennis, T J; Sohi, S S

    1976-09-01

    Chromosome number and morphology have been examined in four established cell lines (Md63, Md66, Md108, and Md109) of the forest tent caterpillar, Malacosoma disstria Hübner, and one (Cf124) of the spruce budworm, Choristoneura fumiferana (Clemens). Chromosome number distributions of Md63 (mode = 112) Md108 (mode = 103), Md109 (mode= 103), and Cf124 (mode = 110) overlap sufficiently to prevent identification of individual lines by number alone. However, Md66 is exceptional in possessing a modal number of 157. One large chromosome occurs in cells of all lines. The presence of this chromosome, the lack of any distinct polyploid series among chromosome numbers encountered, and the general inverse relationship between number and size of chromosomes, suggest that the high level of heteroploidy characteristic of these and other lepidopteran cell lines reflects not only a possible polyploid origin but also extensive chromosomal rearrangement and fragmentation. Tolerance for such change is attributed to the holokinetic organisation of lepidopteran chromosomes. A distinct heteropycnotic body is present in about 10% of Cf124 cell nuclei, and can be used as a marker for this line. This body may represent the sex chromatin normally encountered in somatic cells of female C. fumiferana.

  18. Advanced comparative cytogenetic analysis of X chromosomes in river buffalo, cattle, sheep, and human.

    PubMed

    Perucatti, A; Genualdo, V; Iannuzzi, A; Rebl, A; Di Berardino, D; Goldammer, T; Iannuzzi, Leopoldo

    2012-05-01

    Based on a recently generated comprehensive gene map for Ovis aries chromosome X (OARX) with an approximately even locus distribution, we assigned selected bacterial artificial chromosome (BAC) probes corresponding to these OARX loci to Bubalus bubalis (BBU) and Bos taurus (BTA) by comparative fluorescence in-situ hybridization (FISH) to improve cytogenetically the X chromosome maps in these species. Twenty-five added loci in BBUX and BTAX, respectively, contribute to a more detailed description of the cytogenetic organization of these chromosomes. Further seven loci were identified in OARX and two DNA probes were assigned to X and Y chromosomes in river buffalo, cattle, and sheep, respectively, and thus identified loci in the pseudoautosomal region. The additional assignments double the number of cytogenetic loci in BBUX and increase their number in BTAX and OARX. The larger quantity of cytogenetic anchors allows a more precise morphological comparison of bovid X chromosomes among each other and with the Homo sapiens (HSA) X chromosome. The anchor loci confirm and refine syntenic fragments in HSAX and identify several evolutionary breakpoints between the compared chromosomes. The cytogenetic assignments in BBUX, BTAX, and OARX represent useable anchors for the ongoing genome sequence assembly in Bovidae. PMID:22669522

  19. Androgenetic development of X- and Y-chromosome bearing haploid rainbow trout embryos.

    PubMed

    Michalik, Oliwia; Kowalski, Radosław K; Judycka, Sylwia; Rożyński, Rafał; Dobosz, Stefan; Ocalewicz, Konrad

    2016-09-01

    Haploid fish embryos are important in studies regarding role of the recessive traits during early ontogeny. In fish species with the male heterogamety, androgenetic haploid embryos might be also useful tool in studies concerning role of the sex chromosomes during an embryonic development. Morphologically differentiated X and Y chromosomes have been found in a limited number of fish species including rainbow trout (Oncorhynchus mykiss Walbaum 1792). To evaluate role of the sex chromosomes during rainbow trout embryonic development, survival of the androgenetic haploids in the presence of X or Y sex chromosomes has been examined. Androgenetic haploid rainbow trout were produced by fertilization of X-irradiated eggs with spermatozoa derived from the normal males (XY) and neomales, that is, sex-reversed females (XX) to produce X- and Y-bearing haploids, and all X-bearing haploids, respectively. Survival rates of the androgenetic progenies of normal males and neomales examined during embryogenesis and at hatching did not differ significantly. However, all haploids died within next few days after hatching. Cytogenetic analysis of the androgenetic embryos confirmed their haploid status. Moreover, apart from the intact paternal chromosomes, residues of the irradiated maternal chromosomes observed as chromosome fragments were identified in some of the haploids. Provided results suggested that rainbow trout X and Y chromosomes despite morphological and genetic differences are at the early stage of differentiation and still share genetic information responsible for the proper embryonic development. PMID:27125692

  20. Field-flow fractionation of chromosomes

    SciTech Connect

    Giddings, J.C.

    1990-09-01

    Research continued on field flow fractionation of chromosomes. Progress in the past year can be organized into three main categories: (1) chromosome sample preparation; (2) preliminary chromosome fractionation; (3) fractionation of a polystyrene aggregate model which approximates the chromosome shape. We have been successful in isolating metaphase chromosomes from the Chinese hamster. We also received a human chromosome sample from Dr. Carolyn Bell-Prince of Los Alamos National Laboratory. Results are discussed. 2 figs.

  1. Fragmentation and densities of meteoroids

    NASA Technical Reports Server (NTRS)

    Babadzhanov, Pulat B.

    1992-01-01

    Photographic observations of meteors carried out in Dushanbe by the method of instantaneous exposure have shown clearly that meteoroids entering the Earth's atmosphere are subjected to different types of fragmentation. The quasi-continuous fragmentation of meteoroids is mostly widespread. Using the physical theory of meteors which takes into account the quasi-continuous fragmentation of meteoroids and on the basis of light curves of meteors the densities of meteoroids of different streams have been determined. The results enable us to conclude that the densities of meteoroids are over an order of magnitude higher than they have been assumed before. Moreover they are close to the densities of carbonaceous and ordinary chondrites.

  2. Velocity fluctuations of fission fragments

    NASA Astrophysics Data System (ADS)

    Llanes-Estrada, Felipe J.; Carmona, Belén Martínez; Martínez, Jose L. Muñoz

    2016-02-01

    We propose event by event velocity fluctuations of nuclear fission fragments as an additional interesting observable that gives access to the nuclear temperature in an independent way from spectral measurements and relates the diffusion and friction coefficients for the relative fragment coordinate in Kramers-like models (in which some aspects of fission can be understood as the diffusion of a collective variable through a potential barrier). We point out that neutron emission by the heavy fragments can be treated in effective theory if corrections to the velocity distribution are needed.

  3. Mitotic chromosome condensation in vertebrates

    SciTech Connect

    Vagnarelli, Paola

    2012-07-15

    Work from several laboratories over the past 10-15 years has revealed that, within the interphase nucleus, chromosomes are organized into spatially distinct territories [T. Cremer, C. Cremer, Chromosome territories, nuclear architecture and gene regulation in mammalian cells, Nat. Rev. Genet. 2 (2001) 292-301 and T. Cremer, M. Cremer, S. Dietzel, S. Muller, I. Solovei, S. Fakan, Chromosome territories-a functional nuclear landscape, Curr. Opin. Cell Biol. 18 (2006) 307-316]. The overall compaction level and intranuclear location varies as a function of gene density for both entire chromosomes [J.A. Croft, J.M. Bridger, S. Boyle, P. Perry, P. Teague,W.A. Bickmore, Differences in the localization and morphology of chromosomes in the human nucleus, J. Cell Biol. 145 (1999) 1119-1131] and specific chromosomal regions [N.L. Mahy, P.E. Perry, S. Gilchrist, R.A. Baldock, W.A. Bickmore, Spatial organization of active and inactive genes and noncoding DNA within chromosome territories, J. Cell Biol. 157 (2002) 579-589] (Fig. 1A, A'). In prophase, when cyclin B activity reaches a high threshold, chromosome condensation occurs followed by Nuclear Envelope Breakdown (NEB) [1]. At this point vertebrate chromosomes appear as compact structures harboring an attachment point for the spindle microtubules physically recognizable as a primary constriction where the two sister chromatids are held together. The transition from an unshaped interphase chromosome to the highly structured mitotic chromosome (compare Figs. 1A and B) has fascinated researchers for several decades now; however a definite picture of how this process is achieved and regulated is not yet in our hands and it will require more investigation to comprehend the complete process. From a biochemical point of view a vertebrate mitotic chromosomes is composed of DNA, histone proteins (60%) and non-histone proteins (40%) [6]. I will discuss below what is known to date on the contribution of these two different classes of

  4. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  5. Study of aneuploidy and DNA fragmentation in gametes of patients with severe teratozoospermia.

    PubMed

    Perrin, A; Louanjli, N; Ziane, Y; Louanjli, T; Le Roy, C; Gueganic, N; Amice, V; De Braekeleer, M; Morel, F

    2011-02-01

    This study investigated meiotic segregation in spermatozoa to determine if severe teratozoospermia should prevent the use of intracytoplasmic sperm injection (ICSI) because of the high production of gametes with chromosomal aneuploidies and analysed DNA fragmentation in gametes from the same semen to determine if DNA integrity was worse in patients with severe teratozoospermia. Sperm samples from 12 infertile patients were studied by fluorescence in-situ hybridization for chromosomes X, Y, 13, 18 and 21 and by TdT (terminal deoxynucleotidyl transferase)-mediated dUDP nick-end labelling. Four patients with a majority of macrocephalic forms with multiple flagella had more than 99% spermatozoa with abnormal chromosomal content. The other patients (globozoospermia or other abnormalities concerning sperm heads) had no increased aneuploidy or a slightly significant increase (P<0.05). The rate of DNA fragmentation was significantly higher in infertile patients than in the controls (P<0.001; 14.3% versus 1.20%, respectively) but presented important variability. Therefore, ICSI should not be attempted if men have macrocephalic gametes with multiple flagella but morphology is not always a good predictor of chromosomal content, depending upon the kind of teratozoospermia. Evaluation of the rate of aneuploidy and DNA fragmentation in gametes of patients with severe teratozoospermia is recommended.

  6. Chromosome aberrations as biomarkers of radiation exposure: Modelling basic mechanisms

    NASA Astrophysics Data System (ADS)

    Ballarini, F.; Ottolenghi, A.

    The space radiation environment is a mixed field consisting of different particles having different energies, including high charge and energy (HZE) ions. Conventional measurements of absorbed doses may not be sufficient to completely characterise the radiation field and perform reliable estimates of health risks. Biological dosimetry, based on the observation of specific radiation-induced endpoints (typically chromosome aberrations), can be a helpful approach in case of monitored exposure to space radiation or other mixed fields, as well as in case of accidental exposure. Furthermore, various ratios of aberrations (e.g. dicentric chromosomes to centric rings and complex exchanges to simple exchanges) have been suggested as possible fingerprints of radiation quality, although all of them have been subjected to some criticisms. In this context a mechanistic model and a Monte Carlo code for the simulation of chromosome aberration induction were developed. The model, able to provide dose-responses for different aberrations (e.g. dicentrics, rings, fragments, translocations, insertions and other complex exchanges), was further developed to assess the dependence of various ratios of aberrations on radiation quality. The predictions of the model were compared with available data, whose experimental conditions were faithfully reproduced. Particular attention was devoted to the scoring criteria adopted in different laboratories and to possible biases introduced by interphase death and mitotic delay. This latter aspect was investigated by taking into account both metaphase data and data obtained with Premature Chromosome Condensation (PCC).

  7. Chromosome aberrations as biomarkers of radiation exposure: modelling basic mechanisms.

    PubMed

    Ballarini, F; Ottolenghi, A

    2003-01-01

    The space radiation environment is a mixed field consisting of different particles having different energies, including high charge and energy (HZE) ions. Conventional measurements of absorbed doses may not be sufficient to completely characterise the radiation field and perform reliable estimates of health risks. Biological dosimetry, based on the observation of specific radiation-induced endpoints (typically chromosome aberrations), can be a helpful approach in case of monitored exposure to space radiation or other mixed fields, as well as in case of accidental exposure. Furthermore, various ratios of aberrations (e.g. dicentric chromosomes to centric rings and complex exchanges to simple exchanges) have been suggested as possible fingerprints of radiation quality, although all of them have been subjected to some criticisms. In this context a mechanistic model and a Monte Carlo code for the simulation of chromosome aberration induction were developed. The model, able to provide dose-responses for different aberrations (e.g. dicentrics, rings, fragments, translocations, insertions and other complex exchanges), was further developed to assess the dependence of various ratios of aberrations on radiation quality. The predictions of the model were compared with available data, whose experimental conditions were faithfully reproduced. Particular attention was devoted to the scoring criteria adopted in different laboratories and to possible biases introduced by interphase death and mitotic delay. This latter aspect was investigated by taking into account both metaphase data and data obtained with Premature Chromosome Condensation (PCC). PMID:12971411

  8. Human chromosome-specific DNA libraries: construction and availability

    SciTech Connect

    Van Dilla, M.A.; Deaven, L.L.; Albright, K.L.; Allen, N.A.; Aubuchon, M.R.; Bartholdi, M.F.; Brown, N.C.; Campbell, E.W.; Carrano, A.V.; Clark, L.M.; Cram, L.S.

    1986-06-01

    The goal of the National Laboratory Gene Library Project at the Los Alamos and Lawrence Livermore National Laboratories is the production of chromosome-specific human gene libraries and their distribution to the scientific community for studies of the molecular biology of genes and chromosomes, and for the study and diagnosis of genetic disease. The specific aim of Phase I of the project is the production of complete digest (4 kb average insert size) libraries from each of the 24 human chromosomal types purified by flow sorting. The bacteriophage vector is Charon 21A, which has both Eco R1 and Hind III insertion sites accommodating human DNA fragments up to 9.1 kb in size. Each laboratory has undertaken production of a complete set of chromosome-specific libraries, Los Alamos with Eco R1 and Livermore with Hind III; most of this task has now been accomplished. Close to 1200 library aliquots have been sent to about 300 laboratories world-wide through February 1986, at which time repository and distribution functions were transferred to the American Type Culture Collection, Rockville, MD. Following Phase I, libraries will be constructed with large inserts in a more advanced, recently developed bacteriophage vector (about 20 kb inserts) or in a cosmid vector (about 40 kb inserts), and with characteristics better suited to basic studies of gene structure and function.

  9. Fragmentation of drying paint layers

    NASA Astrophysics Data System (ADS)

    Bakos, Katinka; Dombi, András; Járai-Szabó, Ferenc; Néda, Zoltán

    2013-11-01

    Fragmentation of thin layers of drying granular materials on a frictional surface are studied both by experiments and computer simulations. Besides a qualitative description of the fragmentation phenomenon, the dependence of the average fragment size as a function of the layer thickness is thoroughly investigated. Experiments are done using a special nail polish, which forms characteristic crack structures during drying. In order to control the layer thickness, we diluted the nail polish in acetone and evaporated in a controlled manner different volumes of this solution on glass surfaces. During the evaporation process we managed to get an instable paint layer, which formed cracks as it dried out. In order to understand the obtained structures a previously developed spring-block model was implemented in a three-dimensional version. The experimental and simulation results proved to be in excellent qualitative and quantitative agreement. An earlier suggested scaling relation between the average fragment size and the layer thickness is reconfirmed.

  10. Calculus fragmentation in laser lithotripsy.

    PubMed

    Welch, A J; Kang, H W; Lee, H; Teichman, J M H

    2004-03-01

    The intracorporeal treatment of urinary calculi with lasers is presented, which describes laser-calculus interactions associated with lithotripsy. Reliable fragmentation of calculi with diverse compositions and minimal collateral tissue damage are primarily contingent upon laser parameters (wavelength, pulse duration, and pulse energy) and physical properties of calculi (optical, mechanical, and chemical). The pulse duration governs the dominant mechanism in calculi fragmentation, which is either photothermal or photoacoustical/photomechanical. Lasers with long pulse durations (i.e. > tens of micros) induce a temperature rise in the laser-affected zone with minimal acoustic waves; material is removed by means of vaporization, melting, mechanical stress, and/or chemical decomposition. Short-pulsed laser ablation (i.e. < 10 micros), on the other hand, produces shock waves, and the resultant mechanical energy fragments calculi. Work continues throughout the world to evaluate the feasibility of advanced lasers in lithotripsy and to optimize laser parameters and light delivery systems pertinent to efficient fragmentation of calculi.

  11. Analysis of chromosome 21 yeast artificial chromosome (YAC) clones

    SciTech Connect

    Tassone, F. A. Gemelli School of Medicine, Rome ); Cheng, S.; Gardiner, K. )

    1992-12-01

    Chromosome 21 contains genes relevant to several important diseases. Yeast artificial chromosome (YAC) clones, because they span >100 kbp, will provide attractive material for initiating searches for such genes. Twenty-two YAC clones, each of which maps to a region of potential relevance either to aspects of the Down syndrome phenotype or to one of the other chromosome 21-associated genetic diseases, have been analyzed in detail. Clones total [approximately]6,000 kb and derive from all parts of the long arm. Rare restriction-site maps have been constructed for each clone and have been used to determine regional variations in clonability, methylation frequency, CpG island density, and CpG island frequency versus gene density. This information will be useful for the isolation and mapping of new genes to chromosome 21 and for walking in YAC libraries. 48 refs., 3 figs., 4 tabs.

  12. Stable Chromosome Condensation Revealed by Chromosome Conformation Capture.

    PubMed

    Eagen, Kyle P; Hartl, Tom A; Kornberg, Roger D

    2015-11-01

    Chemical cross-linking and DNA sequencing have revealed regions of intra-chromosomal interaction, referred to as topologically associating domains (TADs), interspersed with regions of little or no interaction, in interphase nuclei. We find that TADs and the regions between them correspond with the bands and interbands of polytene chromosomes of Drosophila. We further establish the conservation of TADs between polytene and diploid cells of Drosophila. From direct measurements on light micrographs of polytene chromosomes, we then deduce the states of chromatin folding in the diploid cell nucleus. Two states of folding, fully extended fibers containing regulatory regions and promoters, and fibers condensed up to 10-fold containing coding regions of active genes, constitute the euchromatin of the nuclear interior. Chromatin fibers condensed up to 30-fold, containing coding regions of inactive genes, represent the heterochromatin of the nuclear periphery. A convergence of molecular analysis with direct observation thus reveals the architecture of interphase chromosomes. PMID:26544940

  13. QGP and Modified Jet Fragmentation

    SciTech Connect

    Wang, Xin-Nian

    2005-04-18

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed.

  14. Molecular biology of chromosome function

    SciTech Connect

    Adolph, K.W. )

    1989-01-01

    The structure and function of chromosomes are closely linked since chromosome organization profoundly influences the activity of the genome in replication and transcription. Many fundamental results originated from studies of bacterial and viral systems chosen for their less-complex cycles. However, the processes of replication and transcription show differences between the higher and simpler systems. Three important subjects are covered in this volume: DNA replication and recombination, gene transcription, and chromosome organization. Eukaryotic, prokaryotic, and viral systems are discussed. The information presented is derived from techniques of structural biology and biophysics, including computer graphics and X-ray crystallography, as well as biochemistry, molecular and cell biology.

  15. Numerous transitions of sex chromosomes in Diptera.

    PubMed

    Vicoso, Beatriz; Bachtrog, Doris

    2015-04-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  16. Numerous Transitions of Sex Chromosomes in Diptera

    PubMed Central

    Vicoso, Beatriz; Bachtrog, Doris

    2015-01-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa. PMID:25879221

  17. Repetitive telomeric sequences in chromosomal translocations involving chromosome 21

    SciTech Connect

    Qu, J.; Dallaire, L.; Fetni, R.

    1994-09-01

    Telomeres perform key functions in maintaining chromosome integrity. In some structural rearrangements the structure and polymorphism in human telomeres may play a significant role. However, of all the telomeric and subtelomeric sequences, only the terminal TTAGGG repeats are believed essential for telomere function. During the course of a study on the role of telomere structure and polymorphism in chromosomal rearrangements observed in families referred for prenatal diagnosis, we studied three cases in which chromosome 21 was involved. Repetitive TTAGGG sequences for all human chromosomes were used as probes (Oncor). Case 1, a de novo cryptic translocation (2;21) was initially identified as monosomy 21 in a child with psychomotor delay and mild dysmorphism. Using a cosmid probe specific for region 21q22.3 and whole chromosome 21 specific painting probe, the long arm of 21 was found on the short arm of chromosome 2 with an interstitial telomere at the breakpoint junction. All the cells were monosomic for 21pter{yields}q21. Case 2 is a familial (19;21) translocation. GTG-banding and FISH with a satellite probe showed no apparent loss of material at the end of either 19q or 21q, with an interstitial telomere at the fusion site of the two intact chromosomes. In case 3, a four generation reciprocal (20;21) translocation, there was no interstitial telomere. The persistence of an interstitial telomere is a relatively rare event which can now be observed with in situ hybridization. Its study may lead to a better understanding of the dynamics of translocations and of chromosome imbalance.

  18. Architecture and anatomy of the chromosomal locus in human chromosome 21 encoding the Cu/Zn superoxide dismutase.

    PubMed Central

    Levanon, D; Lieman-Hurwitz, J; Dafni, N; Wigderson, M; Sherman, L; Bernstein, Y; Laver-Rudich, Z; Danciger, E; Stein, O; Groner, Y

    1985-01-01

    The SOD-1 gene on chromosome 21 and approximately 100 kb of chromosomal DNA from the 21q22 region have been isolated and characterized. The gene which is present as a single copy per haploid genome spans 11 kb of chromosomal DNA. Heteroduplex analysis and DNA sequencing reveals five rather small exons and four introns that interrupt the coding region. The donor sequence at the first intron contains an unusual variant dinucleotide 5'-G-C, rather than the highly conserved 5'-GT. The unusual splice junction is functional in vivo since it was detected in both alleles of the SOD-1 gene, which were defined by differences in the length of restriction endonuclease fragments (RFLPs) that hybridize to the cDNA probe. Genomic blots of human DNA isolated from cells trisomic for chromosome 21 (Down's syndrome patients) show the normal pattern of bands. At the 5' end of gene there are the 'TATA' and 'CAT' promoter sequences as well as four copies of the -GGCGGG- hexanucleotide. Two of these -GC- elements are contained within a 13 nucleotide inverted repeat that could form a stem-loop structure with stability of -33 kcal. The 3'-non coding region of the gene contains five short open reading-frames starting with ATG and terminating with stop codons. Images Fig. 1. Fig. 3. Fig. 7. PMID:3160582

  19. Study of aneuploidy rate and sperm DNA fragmentation in large-headed, multiple-tailed spermatozoa.

    PubMed

    Brahem, S; Mehdi, M; Elghezal, H; Saad, A

    2012-04-01

    The aim of this study was to analyse the meiotic segregation and DNA fragmentation rates in ejaculated spermatozoa of Tunisian men who presented the macrocephalic sperm head syndrome and to compare the results with those from 20 fertile men with normal semen profiles. Sperm DNA fragmentation was evaluated by the terminal desoxynucleotidyl transferase-mediated deoxyuridine triphosphate biotin nick-end labelling assay. Fluorescence in situ hybridisation for chromosomes X, Y and 18 was performed for the study of meiotic segregation. Despite a normal blood karyotype, patients with large-headed spermatozoa showed a significantly higher incidence of sperm chromosomal abnormalities compared with the control group. For all the patients, tetraploidy, triploidy and diploidy were the most observed abnormalities. A very high level of DNA fragmentation was shown for these patients. In conclusion, our results demonstrated that patients with large-headed, multiple-tailed spermatozoa had significantly higher incidence of sperm chromosomal abnormalities and very high level of DNA fragmentation. So intracytoplasmic sperm injection should not be recommended to these patients, not only because of its low chances of success rate but also because of its high genetic risk.

  20. Chromosome Aberrations in Astronauts

    NASA Technical Reports Server (NTRS)

    George, Kerry A.; Durante, M.; Cucinotta, Francis A.

    2007-01-01

    A review of currently available data on in vivo induced chromosome damage in the blood lymphocytes of astronauts proves that, after protracted exposure of a few months or more to space radiation, cytogenetic biodosimetry analyses of blood collected within a week or two of return from space provides a reliable estimate of equivalent radiation dose and risk. Recent studies indicate that biodosimetry estimates from single spaceflights lie within the range expected from physical dosimetry and biophysical models, but very large uncertainties are associated with single individual measurements and the total sample population remains low. Retrospective doses may be more difficult to estimate because of the fairly rapid time-dependent loss of "stable" aberrations in blood lymphocytes. Also, biodosimetry estimates from individuals who participate in multiple missions, or very long (interplanetary) missions, may be complicated by an adaptive response to space radiation and/or changes in lymphocyte survival and repopulation. A discussion of published data is presented and specific issues related to space radiation biodosimetry protocols are discussed.

  1. Acquisition of telomere repeat sequences by transfected DNA integrated at the site of a chromosome break

    SciTech Connect

    Murnane, J.P.; Lohchung Yu )

    1993-02-01

    Rearrangement of the human genome is an important element in both cancer biology and genetic disease. Rearrangements that have been observed include deletions, translocations, chromosome breakage or loss, and gene amplification. Transfection of the DNA into mammalian cells can created instability in the genome. The characterization of DNA rearrangement associated with transfected DNA may provide information about the general mechanisms involved in genomic instability. This genomic instability is an important aspect of tumor cell progression. This research examines chromosome breakage and rearrangement that results in interstitial telomere repeat sequences within the human genome. These sequences could promote genomic instability because short repeat sequences can be recombination hotspots. Also, DNA rearrangements involving telomere repeat sequences can be associated with chromosome breaks. The introduction of telomere repeat sequences at spontaneous or ionizing radiation-induced DNA strand breaks may therefore also be a mechanism of chromosome fragmentation. 52 refs., 7 figs.

  2. Fragmentation Pathways in the Uracil Radical Cation

    SciTech Connect

    Zhou, Congyi; Matsika, Spiridoula; Kotur, Marija; Weinacht, Thomas C.

    2012-08-24

    We investigate pathways for fragmentation in the uracil radical cation using ab initio electronic structure calculations. We focus on the main fragments produced in pump–probe dissociative ionization experiments. These are fragments with mass to charge ratios (m/z) of 69, 28, 41, and 42. Barriers to dissociation along the ground ionic surface are reported, which provide an estimate of the energetic requirements for the production of the main fragments. Finally, direct and sequential fragmentation mechanisms have been analyzed, and it is concluded that sequential fragmentation after production of fragment with m/z 69 is the dominant mechanism for the production of the smaller fragments.

  3. Origin and domestication of papaya Yh chromosome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sex in papaya is controlled by a pair of nascent sex chromosomes. Females are XX, and two slightly different Y chromosomes distinguish males (XY) and hermaphrodites (XYh). The hermaphrodite-specific region of the Yh chromosome (HSY) and its X chromosome counterpart were sequenced and analyzed previo...

  4. Human Chromosome 21: Mapping of the chromosomes and cloning of cDNAs

    SciTech Connect

    Antonarakis, S.E.

    1991-09-01

    The objective of the research funded by DOE grant DE-FG02-89ER60857 from 6/15/89 to 8/31/91 was to contribute to the physical mapping of human chromosome 21 (HC21) by cloning large fragments of DNA into Yeast Artificial Chromosomes (YACs) and identify YACs that map on HC21. A total of 54 sequence tagged sites (STS) have been developed and mapped in our laboratory to HC21 and can be used as initial reference points for YAC identification and construction of overlapping clones. A small YAC library was constructed which is HC21 specific. DNA from somatic cell hybrid WAV17 or from flow-sorted HC21 was partially digested with EcoRI, ligated into vectors PJS97, PJS98, and YACs have been obtained with average size insert of more than 300 kb. This library has been deposited in D. Patterson's lab for the Joint YAC screening effort. Additional YAC libraries from ICI Pharmaceuticals or from Los Alamos National Laboratories have been screened with several STS and positive YACs have been identified. Work in progress includes screening of YAC libraries in order to construct overlapping clones, characterization of the cloning ends of YACs, characterization of additional STS and cloning of HC21 specific cDNAs. 15 refs., 2 figs., 5 tabs.

  5. Construction of a yeast artificial chromosome contig encompassing the chromosome 14 Alzheimer`s disease locus

    SciTech Connect

    Sharma, V.; Bonnycastle, L.; Poorkai, P.

    1994-09-01

    We have constructed a yeast artificial chromosome (YAC) contig of chromosome 14q24.3 which encompasses the chromosome 14 Alzheimer`s disease locus (AD3). Determined by linkage analysis of early-onset Alzheimer`s disease kindreds, this interval is bounded by the genetic markers D14S61-D14S63 and spans approximately 15 centimorgans. The contig consists of 29 markers and 74 YACs of which 57 are defined by one or more sequence tagged sites (STSs). The STS markers comprise 5 genes, 16 short tandem repeat polymorphisms and 8 cDNA clones. An additional number of genes, expressed sequence tags and cDNA fragments have been identified and localized to the contig by hybridization and sequence analysis of anonymous clones isolated by cDNA direct selection techniques. A minimal contig of about 15 YACs averaging 0.5-1.5 megabase in length will span this interval and is, at first approximation, in rough agreement with the genetic map. For two regions of the contig, our coverage has relied on L1/THE fingerprint and Alu-PCR hybridization data of YACs provided by CEPH/Genethon. We are currently developing sequence tagged sites from these to confirm the overlaps revealed by the fingerprint data. Among the genes which map to the contig are transforming growth factor beta 3, c-fos, and heat shock protein 2A (HSPA2). C-fos is not a candidate gene for AD3 based on the sequence analysis of affected and unaffected individuals. HSPA2 maps to the proximal edge of the contig and Calmodulin 1, a candidate gene from 4q24.3, maps outside of the region. The YAC contig is a framework physical map from which cosmid or P1 clone contigs can be constructed. As more genes and cDNAs are mapped, a highly resolved transcription map will emerge, a necessary step towards positionally cloning the AD3 gene.

  6. Microelasticity of Single Mitotic Chromosomes

    NASA Astrophysics Data System (ADS)

    Poirier, Michael; Eroglu, Sertac; Chatenay, Didier; Marko, John F.; Hirano, Tatsuya

    2000-03-01

    The force-extension behavior of mitotic chromosomes from the newt TVI tumor cell line was studied using micropipette manipulation and force measuring techniques. Reversible, linear elastic response was observed for extensions up to 5 times the native length; the force required to double chromosome length was 1 nanonewton (nN). For further elongations, the linear response teminates at a force plateau of 15 nN and at an extension of 20x. Beyond this extension, the chromosome breaks at elongations between 20x and 70x. These results will be compared to the similar behavior of mitotic chromosomes from explanted newt cells (Poirier, Eroglu, Chatenay and Marko, Mol. Biol. Cell, in press). Also, the effect of biochemical modifications on the elasticity was studied. Ethidium Bromide, which binds to DNA, induces up to a 10 times increase in the Young's modulus. Anti-XCAP-E, which binds to a putative chromosome folding protein, induces up to a 2 times increase in the Young's modulus. Preliminary results on the dynamical relaxation of chromosomes will also be presented. Support of this research through a Biomedical Engineering Research Grant from The Whitaker Foundation is gratefully acknowledged.

  7. Computational model for chromosomal instabilty

    NASA Astrophysics Data System (ADS)

    Zapperi, Stefano; Bertalan, Zsolt; Budrikis, Zoe; La Porta, Caterina

    2015-03-01

    Faithful segregation of genetic material during cell division requires alignment of the chromosomes between the spindle poles and attachment of their kinetochores to each of the poles. Failure of these complex dynamical processes leads to chromosomal instability (CIN), a characteristic feature of several diseases including cancer. While a multitude of biological factors regulating chromosome congression and bi-orientation have been identified, it is still unclear how they are integrated into a coherent picture. Here we address this issue by a three dimensional computational model of motor-driven chromosome congression and bi-orientation. Our model reveals that successful cell division requires control of the total number of microtubules: if this number is too small bi-orientation fails, while if it is too large not all the chromosomes are able to congress. The optimal number of microtubules predicted by our model compares well with early observations in mammalian cell spindles. Our results shed new light on the origin of several pathological conditions related to chromosomal instability.

  8. Numerically abnormal chromosome constitutions in humans

    SciTech Connect

    1993-12-31

    Chapter 24, discusses numerically abnormal chromosome constitutions in humans. This involves abnormalities of human chromosome number, including polyploidy (when the number of sets of chromosomes increases) and aneuploidy (when the number of individual normal chromosomes changes). Chapter sections discuss the following chromosomal abnormalities: human triploids, imprinting and uniparental disomy, human tetraploids, hydatidiform moles, anomalies caused by chromosomal imbalance, 13 trisomy (D{sub 1} trisomy, Patau syndrome), 21 trisomy (Down syndrome), 18 trisomy syndrome (Edwards syndrome), other autosomal aneuploidy syndromes, and spontaneous abortions. The chapter concludes with remarks on the nonrandom participation of chromosomes in trisomy. 69 refs., 3 figs., 4 tabs.

  9. A method for constructing radiation hybrid maps of whole genomes: Application to physically mapping chromosome 14

    SciTech Connect

    Walter, M.A.; Mirzavans, F.; Tsuji, S.

    1994-09-01

    By reverting to the original protocols of Goss and Harris, we have created a panel of whole genome radiation hybrids (WG-RHs) using a diploid human fibroblast as the chromosome donor, rather than the usual monochromosomal human/rodent somatic cell hybrid. We have analyzed markers from chromosome 14 to test the feasibility of using WG-RH cell lines to generate physical maps of human chromosomes. As WG-RH mapping exploits rodent/human differences, loci need not be polymorphic to be informative. Sixty-one chromosome 14 markers, including 24 STSs and ETSs, were used to create a high resolution radiation hybrid map of human chromosome 14. The average marker retention was found to be 22.4%, very similar to the marker retention frequencies of conventional radiation hybrids. Two point and multipoint statistical analyses of the patterns of chromosome 14 marker retention were used to create a WG-RH map of human chromosome 14 with 4 gaps, corresponding to regions of low marker density. We are currently testing additional markers to close the map. Conventional radiation hybrid mapping requires between 100 and 200 hybrids to map each chromosome. The large number of hybrids (up to 4,000) required to map the whole genome is a major drawback of this method. In contrast, a single panel of 100 to 200 WG-RH cell lines is sufficient to allow the construction of a high resolution map of the whole human genome with a single panel of only 100 to 200 hybrids. Our results demonstrate that chromosome fragmentation by WG-RH can be used to map one chromosome, and by extension, entire genomes.

  10. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    PubMed Central

    Šimková, Hana; Svensson, Jan T; Condamine, Pascal; Hřibová, Eva; Suchánková, Pavla; Bhat, Prasanna R; Bartoš, Jan; Šafář, Jan; Close, Timothy J; Doležel, Jaroslav

    2008-01-01

    Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA). Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA) for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which considerably expands the potential

  11. Extinction of albumin gene expression in a panel of human chromosome 2 microcell hybrids

    SciTech Connect

    Cerosaletti, K.M.; Fournier, R.E.K.

    1996-02-01

    Expression of the serum albumin gene is extinguished in rat hepatoma microcell hybrids that retain mouse chromosome 1. These data define a trans-dominant extinguisher locus, Tse-2, on mouse chromosome 1. To localize the human TSE2 locus, we prepared and characterized rat/human microcell hybrids that contained either human chromosome 1 or chromosome 2, the genetic homologues of mouse chromosome 1. Rat hepatoma microcell hybrids retaining a derivative human chromosome 1 [der 1 t(1;17)(p34.3;q11.2)] expressed their serum albumin genes at levels similar to those of parental hepatoma cells. In contrast, microcell transfer of human chromosome 2 into rat hepatoma recipients produced karyotypically heterogeneous collections of hybrid clones, some of which displayed dramatic albumin extinction phenotypes. For example, albumin mRNA levels in hapatoma x fibroblast whole-cell hybrids. Expression of several other liver genes, including {alpha}1-antitrypsin, aldolase B, alcohol dehydrogenase, and phosphoenolpyruvate carboxykinase, was also affected in some of the microcell hybrids, but expression of these genes was no concordant with expression of albumin. Hybrid segregants were prepared from the albumin-extinguished hybrids, and reexpression of albumin mRNA and protein was observed in sublines that had lost or fragmented human chromosome 2. Finally, expression of mRNAs encoding the liver-enriched transactivators HNF-1, HNF-4, HNF-3{alpha}, and HNF-3{beta} was not affected in any of the chromosome 2-containing hybrids. These data define and map a genetic locus on human chromosome 2 that extinguishes albumin gene expression in trans, and they suggest that TSE2-mediated extinction is independent of HNF-1, -4, -3{alpha}, and -3{beta} expression. 61 refs., 2 figs., 3 tabs.

  12. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat

    PubMed Central

    Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

  13. Rapid cloning and bioinformatic analysis of spinach Y chromosome-specific EST sequences.

    PubMed

    Deng, Chuan-Liang; Zhang, Wei-Li; Cao, Ying; Wang, Shao-Jing; Li, Shu-Fen; Gao, Wu-Jun; Lu, Long-Dou

    2015-12-01

    The genome of spinach single chromosome complement is about 1000 Mbp, which is the model material to study the molecular mechanisms of plant sex differentiation. The cytological study showed that the biggest spinach chromosome (chromosome 1) was taken as spinach sex chromosome. It had three alleles of sex-related X,X(m) and Y. Many researchers have been trying to clone the sex-determining genes and investigated the molecular mechanism of spinach sex differentiation. However,there are no successful cloned reports about these genes. A new technology combining chromosome microdissection with hybridization-specific amplification (HSA) was adopted. The spinach Y chromosome degenerate oligonucleotide primed-PCR (DOP-PCR) products were hybridized with cDNA of the male spinach flowers in florescence. The female spinach genome was taken as blocker and cDNA library specifically expressed in Y chromosome was constructed. Moreover, expressed sequence tag (EST) sequences in cDNA library were cloned, sequenced and bioinformatics was analysed. There were 63 valid EST sequences obtained in this study. The fragment size was between 53 and 486 bp. BLASTn homologous alignment indicated that 12 EST sequences had homologous sequences of nucleic acids, the rest were new sequences. BLASTx homologous alignment indicated that 16 EST sequences had homologous protein-encoding nucleic acid sequence. The spinach Y chromosome-specific EST sequences laid the foundation for cloning the functional genes, specifically expressed in spinach Y chromosome. Meanwhile, the establishment of the technology system in the research provided a reference for rapid cloning of other biological sex chromosome-specific EST sequences.

  14. Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat.

    PubMed

    Lu, Mingjie; Lu, Yuqing; Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2016-01-01

    Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

  15. The combined fragmentation and systematic molecular fragmentation methods.

    PubMed

    Collins, Michael A; Cvitkovic, Milan W; Bettens, Ryan P A

    2014-09-16

    Conspectus Chemistry, particularly organic chemistry, is mostly concerned with functional groups: amines, amides, alcohols, ketones, and so forth. This is because the reactivity of molecules can be categorized in terms of the reactions of these functional groups, and by the influence of other adjacent groups in the molecule. These simple truths ought to be reflected in the electronic structure and electronic energy of molecules, as reactivity is determined by electronic structure. However, sophisticated ab initio quantum calculations of the molecular electronic energy usually do not make these truths apparent. In recent years, several computational chemistry groups have discovered methods for estimating the electronic energy as a sum of the energies of small molecular fragments, or small sets of groups. By decomposing molecules into such fragments of adjacent functional groups, researchers can estimate the electronic energy to chemical accuracy; not just qualitative trends, but accurate enough to understand reactivity. In addition, this has the benefit of cutting down on both computational time and cost, as the necessary calculation time increases rapidly with an increasing number of electrons. Even with steady advances in computer technology, progress in the study of large molecules is slow. In this Account, we describe two related "fragmentation" methods for treating molecules, the combined fragmentation method (CFM) and systematic molecular fragmentation (SMF). In addition, we show how we can use the SMF approach to estimate the energy and properties of nonconducting crystals, by fragmenting the periodic crystal structure into relatively small pieces. A large part of this Account is devoted to simple overviews of how the methods work. We also discuss the application of these approaches to calculating reactivity and other useful properties, such as the NMR and vibrational spectra of molecules and crystals. These applications rely on the ability of these

  16. Fragmentation pathways of protonated peptides.

    PubMed

    Paizs, Béla; Suhai, Sándor

    2005-01-01

    The fragmentation pathways of protonated peptides are reviewed in the present paper paying special attention to classification of the known fragmentation channels into a simple hierarchy defined according to the chemistry involved. It is shown that the 'mobile proton' model of peptide fragmentation can be used to understand the MS/MS spectra of protonated peptides only in a qualitative manner rationalizing differences observed for low-energy collision induced dissociation of peptide ions having or lacking a mobile proton. To overcome this limitation, a deeper understanding of the dissociation chemistry of protonated peptides is needed. To this end use of the 'pathways in competition' (PIC) model that involves a detailed energetic and kinetic characterization of the major peptide fragmentation pathways (PFPs) is proposed. The known PFPs are described in detail including all the pre-dissociation, dissociation, and post-dissociation events. It is our hope that studies to further extend PIC will lead to semi-quantative understanding of the MS/MS spectra of protonated peptides which could be used to develop refined bioinformatics algorithms for MS/MS based proteomics. Experimental and computational data on the fragmentation of protonated peptides are reevaluated from the point of view of the PIC model considering the mechanism, energetics, and kinetics of the major PFPs. Evidence proving semi-quantitative predictability of some of the ion intensity relationships (IIRs) of the MS/MS spectra of protonated peptides is presented. PMID:15389847

  17. Fragmentation and ablation during entry

    SciTech Connect

    Canavan, G.H.

    1997-09-01

    This note discusses objects that both fragment and ablate during entry, using the results of previous reports to describe the velocity, pressure, and fragmentation of entering objects. It shows that the mechanisms used there to describe the breakup of non-ablating objects during deceleration remain valid for most ablating objects. It treats coupled fragmentation and ablation during entry, building on earlier models that separately discuss the entry of objects that are hard, whose high heat of ablation permits little erosion, and those who are strong whose strength prevents fragmentation, which are discussed in ``Radiation from Hard Objects,`` ``Deceleration and Radiation of Strong, Hard, Asteroids During Atmospheric Impact,`` and ``Meteor Signature Interpretation.`` This note provides a more detailed treatment of the further breakup and separation of fragments during descent. It replaces the constraint on mass per unit area used earlier to determine the altitude and magnitude of peak power radiation with a detailed analytic solution of deceleration. Model predictions are shown to be in agreement with the key features of numerical calculations of deceleration. The model equations are solved for the altitudes of maximum radiation, which agree with numerical integrations. The model is inverted analytically to infer object size and speed from measurements of peak power and altitude to provide a complete model for the approximate inversion of meteor data.

  18. Pulse-field electrophoresis indicates full-length Mycoplasma chromosomes range widely in size.

    PubMed Central

    Neimark, H C; Lange, C S

    1990-01-01

    Full-size linear chromosomes were prepared from mycoplasmas by using gamma-irradiation to introduce one (on average) double-strand break in their circular chromosomes. Chromosome sizes were estimated by pulsed-field gel electrophoresis (PFGE) from the mobilities of these full-length molecules relative to DNA size references. Sizes estimated for Ureaplasma urealyticum T960 and 16 Mycoplasma species ranged from 684 kbp (M. hominis) to 1315 kbp (M. iowae). Using this sample, we found no correlation between the mobility of the full-size linear chromosomes and their G + C content. Sizes for A. laidlawii and A. hippikon were within the range expected from renaturation kinetics. PFGE size estimates are in good agreement with sizes determined by other methods, including electron microscopy, an ordered clone library, and summation of restriction fragments. Our estimates also agree with those from renaturation kinetics for both the largest and some of the smallest chromosomes, but in the intermediate size range, renaturation kinetics consistently provides lower values than PFGE or electron microscopy. Our PFGE estimates show that mycoplasma chromosomes span a continual range of sizes, with several intermediate values falling between the previously recognized large and small chromosome size clusters. Images PMID:2216718

  19. Field-flow fractionation of chromosomes. Final technical report, July 1, 1989--January 31, 1993

    SciTech Connect

    Giddings, J.C.

    1993-04-01

    The first topic of this project involved the preparation, fractionation by sedimentation/steric Field Flow Fractionation (FFF), and modeling of metaphase chromosomes. After numerous unsuccessful attempts to prepare chromosomes, we have implemented a procedure (in collaboration with Los Alamos National Laboratory) to prepare metaphase chromosomes from Chinese hamster cells. Extensive experimentation was necessary to identify a suitable FFF channel surface to minimize chromosome adsorption and a carrier liquid to stabilize and disperse the chromosomes. Under suitable operating conditions, the Chinese hamster chromosomes were purified from cell debris and partially fractionated. The purified, preenriched chromosomes that can be prepared by sedimentation/steric FFF or produced continuously by continuous SPLITT fractionation provide an enriched feed material for subsequent flow cytometry. In the second project component, flow FFF permitted successful separations of single- from double-stranded circular DNA, double-stranded circular DNAs of various sizes, and linear double-stranded DNA fragments of various lengths. Diffusion coefficients extracted from retention data agreed well with literature data as well as predictions of major polymer theories. The capacity of FFF separations was evaluated to examine potential applications to long DNA chains.

  20. Development of new PCR-based markers specific for chromosome arms of rye (Secale cereale L.).

    PubMed

    Qiu, Ling; Tang, Zong-xiang; Li, Meng; Fu, Shu-lan

    2016-03-01

    PCR-based rye (Secale cereale L.) chromosome-specific markers can contribute to the effective utilization of elite genes of rye in wheat (Triticum aestivum L.) breeding programs. In the present study, 578 new PCR-based rye-specific markers have been developed by using specific length amplified fragment sequencing (SLAF-seq) technology, and 76 markers displayed different polymorphism among rye Kustro, Imperial, and King II. A total of 427 and 387 markers were, respectively, located on individual chromosomes and chromosome arms of Kustro by using a set of wheat-rye monosomic addition lines and 13 monotelosomic addition lines, which were derived from T. aestivum L. 'Mianyang11' × S. cereale L. 'Kustro'. In addition, two sets of wheat-rye disomic addition lines, which were derived from T. aestivum L. var. Chinese Spring × S. cereale L. var. Imperial and T. aestivum L. 'Holdfast' × S. cereale L. var. King II, were used to test the chromosomal specificity of the 427 markers. The chromosomal locations of 281 markers were consistent among the three sets of wheat-rye addition lines. The markers developed in this study can be used to identify a given segment of rye chromosomes in wheat background and accelerate the utilization of elite genes on rye chromosomes in wheat breeding programs.

  1. Detailed comparative mapping of cereal chromosome regions corresponding to the Ph1 locus in wheat

    SciTech Connect

    Foote, T.; Roberts, M.; Kurata, N.

    1997-10-01

    Detailed physical mapping of markers from rich chromosome 9, and from syntenous (at the genetic level) regions of other cereal genomes, has resulted in rice yeast artificial chromosome (YAC) contigs spanning parts of rice 9. This physical mapping, together with comparative genetic mapping, has demonstrated that synteny has been largely maintained between the genomes of several cereals at the level of contiged YACs. Markers located in one region of rice chromosome 9 encompassed by the YAC contigs have exhibited restriction fragment length polymorphism (RFLP) using deletion lines for the Ph1 locus. This has allowed demarcation of the region of rice chromosome 9 syntenous with the phlb and phlc deletions in wheat chromosome 5B. A group of probes located in wheat homoeologous group 5 and barley chromosome 5H, however, have synteny with rice chromosomes other than 9. This suggests that the usefulness of comparative trait analysis and of the rice genome as a tool to facilitate gene isolation will differ from one region to the next, and implies that the rice genome is more ancestral in structure than those of the Triticeae. 38 refs., 2 figs., 1 tab.

  2. Meiotic chromosome mobility in fission yeast is resistant to environmental stress

    PubMed Central

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  3. Meiotic chromosome mobility in fission yeast is resistant to environmental stress.

    PubMed

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  4. The IPP gene is assigned to human chromosome 1p32-1p22

    SciTech Connect

    Chang-Yeh, A.; Huang, R.C.C. ); Jabs, E.W.; Li, Xiang ); Dracopoli, N.C. )

    1993-01-01

    We previously reported the isolation and characterization of a novel mouse gene that is promoted by an intracisternal A-particle (IAP) LTR and is expressed in placental tissue (mouse IAP-promoted placenta gene, Ipp). Based on restriction fragment length polymorphism (RFLP) studies using inbred strains and recombinant inbred (RI) mice, we have established the linkage between the Ipp gene and several loci on distal mouse chromosome 4. In this publication, we report the partial sequence of a human cDNA clone isolated from a human placental library that has 83% identity to the 3[prime]region of the Ipp cDNA. For human chromosome mapping, two 20-base oligonucleotides within the homologous region were used as primers for polymerase chain reactions (PCR) to chromosome-specific DNAs from two somatic cell hybrid panels and several hybrid cell lines carrying breakpoints on human chromosome 1p. We have assigned this human homolog of the Ipp (IPP) gene to chromosome 1 at 1p32-1p22, based on analysis of PCR products. With this assignment, the homology between mouse chromosome 4 and human chromosome 1 is maintained (5). 7 refs., 1 fig.

  5. The Chromosome Microdissection and Microcloning Technique.

    PubMed

    Zhang, Ying-Xin; Deng, Chuan-Liang; Hu, Zan-Min

    2016-01-01

    Chromosome microdissection followed by microcloning is an efficient tool combining cytogenetics and molecular genetics that can be used for the construction of the high density molecular marker linkage map and fine physical map, the generation of probes for chromosome painting, and the localization and cloning of important genes. Here, we describe a modified technique to microdissect a single chromosome, paint individual chromosomes, and construct single-chromosome DNA libraries. PMID:27511173

  6. Human chromosomes: Structure, behavior, and effects

    SciTech Connect

    Therman, E.; Susman, M.

    1993-12-31

    The book `Human Chromosomes: Structure, Behavior, and Effects` covers the most important topics regarding human chromosomes and current research in cytogenetics. Attention is given both to structure and function of autosomes and sex chromosomes, as well as definitions and causes of chromosomal aberrations. This often involves discussion about various aspects of the cell cycle (both mitosis and meiosis). Methods and techniques involved in researching and mapping human chromosomes are also discussed.

  7. DNA Fragmentation in mammalian cells exposed to various light ions

    NASA Astrophysics Data System (ADS)

    Belli, M.; Cherubini, R.; Dalla Vecchia, M.; Dini, V.; Esposito, G.; Moschini, G.; Sapora, O.; Signoretti, C.; Simone, G.; Sorrentino, E.; Tabocchini, M. A.

    Elucidation of how effects of densely ionizing radiation at cellular level are linked to DNA damage is fundamental for a better understanding of the mechanisms leading to genomic damage (especially chromosome aberrations) and developing biophysical models to predict space radiation effects. We have investigated the DNA fragmentation patterns induced in Chinese hamster V79 cells by 31 keV/μm protons, 123 keV/μm helium-4 ions and γ-rays in the size range 0.023-5.7 Mbp, using calibrated Pulsed Field Gel Electrophoresis (PFGE). The frequency distributions of fragments induced by the charged particles were shifted towards smaller sizes with respct to that induced by comparable doses of γ-rays. The DSB yields, evaluated from the fragments induced in the size range studied, were higher for protons and helium ions than for γ-rays by a factor of about 1.9 and 1.2, respectively. However, these ratios do not adequately reflect the RBE observed on the same cells for inactivation and mutation induced by these beams. This is a further indication for the lack of correlation between the effects exerted at cellular level and the initial yield of DSB. The dependence on radiation quality of the fragmentation pattern suggests that it may have a role in damage reparability. We have analyzed these patterns with a "random breakage" model generalized in order to consider the initial non-random distribution of the DNA molecules. Our results suggest that a random breakage mechanism can describe with a reasonable approximation the DNA fragmentation induced by γ-rays, while the approximation is not so good for light ions, likely due to the interplay between ion tracks and chromatin organization at the loop level.

  8. Fragment-based ligand discovery.

    PubMed

    Fischer, Marcus; Hubbard, Roderick E

    2009-02-01

    From home building and decor to mass production, modular design is a standard feature of the modern age. The concept also promises to define drug discovery efforts in the near future, as a wide range of methodologies, from NMR to X-ray crystallography, are being adapted to high-throughput platforms. In particular, "fragment-based ligand discovery" describes the laboratory-driven evolution of drugs from libraries of chemical building blocks. "Evolution" is an apt word for the process, as a wide array of methods are used to define how compound fragments can be best fit into the binding sites of medically relevant target biomolecules. A number of compounds that evolved from fragments have entered the clinic, and the approach is increasingly accepted as an additional route to identifying new hit compounds in pharmaceutical discovery and inhibitor design. PMID:19299661

  9. Organizing the bacterial chromosome for division

    NASA Astrophysics Data System (ADS)

    Broedersz, Chase

    2014-03-01

    The chromosome is highly organized in space in many bacteria, although the origin and function of this organization remain unclear. This organization is further complicated by the necessity for chromosome replication and segregation. Partitioning proteins of the ParABS system mediate chromosomal and plasmid segregation in a variety of bacteria. This segregation machinery includes a large ParB-DNA complex consisting of roughly 1000 ParB dimers, which localizes around one or a few centromere-like parS sites near the origin of replication. Despite the apparent simplicity of this segregation machinery as compared to eukaryotic segregations systems, puzzles remain: In particular, what is the nature of interactions among DNA-bound ParB proteins, and how do these determine the organizational and functional properties of the ParB-DNA partitioning complex? A crucial aspect of this question is whether ParB spreads along the DNA to form a filamentous protein-DNA complex with a 1D character, or rather assembles to form a 3D complex on the DNA. Furthermore, it remains unclear how the presence of only one or even a few parS sites can lead to robust formation and localization of such a large protein-DNA complex. We developed a simple model for interacting proteins on DNA, and found that a combination of 1D spreading bonds and a 3D bridging bond between ParB proteins constitutes the minimal model for condensation of a 3D ParB-DNA complex. These combined interactions provide an effective surface tension that prevents fragmentation of the ParB-DNA complex. Thus, ParB spreads to form multiple 1D domains on the DNA, connected in 3D by bridging interactions to assemble into a 3D ParB-DNA condensate. Importantly, this model accounts for recent experiments on ParB-induced gene-silencing and the effect of a DNA ``roadblock'' on ParB localization. Furthermore, our model provides a simple mechanism to explain how a single parS site is both necessary and sufficient for the formation and

  10. Restriction maps of the regions coding for methicillin and tobramycin resistances on chromosomal DNA in methicillin-resistant staphylococci.

    PubMed Central

    Ubukata, K; Nonoguchi, R; Matsuhashi, M; Song, M D; Konno, M

    1989-01-01

    Chromosomal BamHI DNA fragments containing both the mecA gene encoding the penicillin-binding protein responsible for methicillin resistance and the aadD gene encoding 4',4"-adenylyltransferase responsible for tobramycin resistance were cloned from three methicillin- and tobramycin-resistant strains of Staphylococcus aureus and one strain of Staphylococcus epidermidis. Physical maps of the fragments were similar, suggesting their unique origin. Images PMID:2817861

  11. Chromosome therapy. Correction of large chromosomal aberrations by inducing ring chromosomes in induced pluripotent stem cells (iPSCs).

    PubMed

    Kim, Taehyun; Bershteyn, Marina; Wynshaw-Boris, Anthony

    2014-01-01

    The fusion of the short (p) and long (q) arms of a chromosome is referred to as a "ring chromosome." Ring chromosome disorders occur in approximately 1 in 50,000-100,000 patients. Ring chromosomes can result in birth defects, mental disabilities, and growth retardation if additional genes are deleted during the formation of the ring. Due to the severity of these large-scale aberrations affecting multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have so far been proposed. Our recent study (Bershteyn et al.) using patient-derived fibroblast lines containing ring chromosomes, found that cellular reprogramming of these fibroblasts into induced pluripotent stem cells (iPSCs) resulted in the cell-autonomous correction of the ring chromosomal aberration via compensatory uniparental disomy (UPD). These observations have important implications for studying the mechanism of chromosomal number control and may lead to the development of effective therapies for other, more common, chromosomal aberrations.

  12. Chromosome therapy. Correction of large chromosomal aberrations by inducing ring chromosomes in induced pluripotent stem cells (iPSCs).

    PubMed

    Kim, Taehyun; Bershteyn, Marina; Wynshaw-Boris, Anthony

    2014-01-01

    The fusion of the short (p) and long (q) arms of a chromosome is referred to as a "ring chromosome." Ring chromosome disorders occur in approximately 1 in 50,000-100,000 patients. Ring chromosomes can result in birth defects, mental disabilities, and growth retardation if additional genes are deleted during the formation of the ring. Due to the severity of these large-scale aberrations affecting multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have so far been proposed. Our recent study (Bershteyn et al.) using patient-derived fibroblast lines containing ring chromosomes, found that cellular reprogramming of these fibroblasts into induced pluripotent stem cells (iPSCs) resulted in the cell-autonomous correction of the ring chromosomal aberration via compensatory uniparental disomy (UPD). These observations have important implications for studying the mechanism of chromosomal number control and may lead to the development of effective therapies for other, more common, chromosomal aberrations. PMID:25482192

  13. Heteromorphic variants of chromosome 9

    PubMed Central

    2013-01-01

    Background Heterochromatic variants of pericentromere of chromosome 9 are reported and discussed since decades concerning their detailed structure and clinical meaning. However, detailed studies are scarce. Thus, here we provide the largest ever done molecular cytogenetic research based on >300 chromosome 9 heteromorphism carriers. Results In this study, 334 carriers of heterochromatic variants of chromosome 9 were included, being 192 patients from Western Europe and the remainder from Easter-European origin. A 3-color-fluorescence in situ hybridization (FISH) probe-set directed against for 9p12 to 9q13~21.1 (9het-mix) and 8 different locus-specific probes were applied for their characterization. The 9het-mix enables the characterization of 21 of the yet known 24 chromosome 9 heteromorphic patterns. In this study, 17 different variants were detected including five yet unreported; the most frequent were pericentric inversions (49.4%) followed by 9qh-variants (23.9%), variants of 9ph (11.4%), cenh (8.2%), and dicentric- (3.8%) and duplication-variants (3.3%). For reasons of simplicity, a new short nomenclature for the yet reported 24 heteromorphic patterns of chromosome 9 is suggested. Six breakpoints involved in four of the 24 variants could be narrowed down using locus-specific probes. Conclusions Based on this largest study ever done in carriers of chromosome 9 heteromorphisms, three of the 24 detailed variants were more frequently observed in Western than in Eastern Europe. Besides, there is no clear evidence that infertility is linked to any of the 24 chromosome 9 heteromorphic variants. PMID:23547710

  14. Biological restorations using tooth fragments.

    PubMed

    Busato, A L; Loguercio, A D; Barbosa, A N; Sanseverino, M do C; Macedo, R P; Baldissera, R A

    1998-02-01

    A "biological" restoration technique using dental fragments and adhesive materials is described. These fragments were obtained from extracted human teeth which had been previously sterilized and stored in a tooth bank. The advantages are: the use of extracted teeth as restorative material, esthetics, and treatment cost. The positive sensation of having back the missing tooth was the most mentioned comment among patients. The disadvantages are: the difficulty of obtaining teeth with the needed characteristics, problems of making an indirect restoration, matching the original color, and the non-acceptance by some patients who consider it strange to have other people's teeth placed in their mouths.

  15. Analysis of unfertilized oocytes subjected to intracytoplasmic sperm injection using two rounds of fluorescence in-situ hybridization and probes to five chromosomes.

    PubMed

    Martini, E; Flaherty, S P; Swann, N J; Payne, D; Matthews, C D

    1997-09-01

    Chromosomal aberrations are the major cause of pre- and post-implantation embryo wastage and some studies suggest that half of all human conception have a chromosomal abnormality. Analysis of gametes provides information on the origin of these chromosomal aberrations. The purpose of this study was to develop a reliable multi-probe fluorescence in-situ hybridization (FISH) procedure that would enable us to investigate aneuploidy in unfertilized oocytes subjected to intracytoplasmic sperm injection (ICSI). Oocytes were spread with HCl and Tween 20 solution, and then two rounds of triple-probe FISH were performed on each oocyte using directly-labelled centromeric probes: chromosomes 1, 7, 15 (overnight hybridization); chromosomes 1, X, Y (2 h hybridization). After the first round, the slides were counterstained and evaluated, and the positions of FISH signals were recorded. For the second round, the counterstain was removed and the second probe cocktail was applied. The chromosome 1 probe was an internal control for the two hybridization procedures, while the Y chromosome probe was used to detect sperm DNA. To evaluate the method, a total of 79 oocytes from 27 patients were studied. Of these, 67 (84.8%) were successfully spread and 97% of these oocytes exhibited discernible FISH signals. Upon lysis, oocytes exhibited one or more DNA fragments (mean 1.9, range 1-3). Of the 65 analysable oocytes, 17 (26.2%) displayed a normal haploid chromosome constitution with paired spots for the two chromatids. A further 23 oocytes (35.4%) showed an ambiguous chromosome complement due to an abnormal number of DNA fragments which may have resulted from loss of DNA during spreading or to an abnormal oocyte, while 25 oocytes (38.4%) displayed aneuploidy for one or more of the chromosomes studied. In conclusion, this new approach is a quick and efficient method with which numerical chromosomal abnormalities in human oocytes can be studied; interpretation of the patterns of DNA fragments

  16. New Advances in Chromosome Architecture.

    PubMed

    Leake, Mark C

    2016-01-01

    Our knowledge of the "architecture" of chromosomes has grown enormously in the past decade. This new insight has been enabled largely through advances in interdisciplinary research methods at the cutting-edge interface of the life and physical sciences. Importantly this has involved several state-of-the-art biophysical tools used in conjunction with molecular biology approaches which enable investigation of chromosome structure and function in living cells. Also, there are new and emerging interfacial science tools which enable significant improvements to the spatial and temporal resolution of quantitative measurements, such as in vivo super-resolution and powerful new single-molecule biophysics methods, which facilitate probing of dynamic chromosome processes hitherto impossible. And there are also important advances in the methods of theoretical biophysics which have enabled advances in predictive modeling of this high quality experimental data from molecular and physical biology to generate new understanding of the modes of operation of chromosomes, both in eukaryotic and prokaryotic cells. Here, I discuss these advances, and take stock on the current state of our knowledge of chromosome architecture and speculate where future advances may lead. PMID:27283297

  17. Chromosomal abnormalities in human sperm

    SciTech Connect

    Martin, R.H.

    1985-01-01

    The ability to analyze human sperm chromosome complements after penetration of zona pellucida-free hamster eggs provides the first opportunity to study the frequency and type of chromosomal abnormalities in human gametes. Two large-scale studies have provided information on normal men. We have studied 1,426 sperm complements from 45 normal men and found an abnormality rate of 8.9%. Brandriff et al. (5) found 8.1% abnormal complements in 909 sperm from 4 men. The distribution of numerical and structural abnormalities was markedly dissimilar in the 2 studies. The frequency of aneuploidy was 5% in our sample and only 1.6% in Brandriff's, perhaps reflecting individual variability among donors. The frequency of 24,YY sperm was low: 0/1,426 and 1/909. This suggests that the estimates of nondisjunction based on fluorescent Y body data (1% to 5%) are not accurate. We have also studied men at increased risk of sperm chromosomal abnormalities. The frequency of chromosomally unbalanced sperm in 6 men heterozygous for structural abnormalities varied dramatically: 77% for t11;22, 32% for t6;14, 19% for t5;18, 13% for t14;21, and 0% for inv 3 and 7. We have also studied 13 cancer patients before and after radiotherapy and demonstrated a significant dose-dependent increase of sperm chromosome abnormalities (numerical and structural) 36 months after radiation treatment.

  18. Dean flow fractionation of chromosomes

    NASA Astrophysics Data System (ADS)

    Hockin, Matt; Sant, Himanshu J.; Capecchi, Mario; Gale, Bruce K.

    2016-03-01

    Efforts to transfer intact mammalian chromosomes between cells have been attempted for more than 50 years with the consistent result being transfer of sub unit length pieces regardless of method. Inertial microfluidics is a new field that has shown much promise in addressing the fractionation of particles in the 2-20 μm size range (with unknown limits) and separations are based upon particles being carried by curving confined flows (within a spiral shaped, often rectangular flow chamber) and migrating to stable "equilibrium" positions of varying distance from a chamber wall depending on the balance of dean and lift forces. We fabricated spiral channels for inertial microfluidic separations using a standard soft lithography process. The concentration of chromosomes, small contaminant DNA and large cell debris in each outlets were evaluated using microscope (60X) and a flow cytometer. Using Dean Flow Fractionation, we were able to focus 4.5 times more chromosomes in outlet 2 compared to outlet 4 where most of the large debris is found. We recover 16% of the chromosomes in outlet #1- 50% in 2, 23% in 3 and 11% in 4. It should be noted that these estimates of recovery do not capture one piece of information- it actually may be that the chromosomes at each outlet are physically different and work needs to be done to verify this potential.

  19. Chromosome segregation in plant meiosis

    PubMed Central

    Zamariola, Linda; Tiang, Choon Lin; De Storme, Nico; Pawlowski, Wojtek; Geelen, Danny

    2014-01-01

    Faithful chromosome segregation in meiosis is essential for ploidy stability over sexual life cycles. In plants, defective chromosome segregation caused by gene mutations or other factors leads to the formation of unbalanced or unreduced gametes creating aneuploid or polyploid progeny, respectively. Accurate segregation requires the coordinated execution of conserved processes occurring throughout the two meiotic cell divisions. Synapsis and recombination ensure the establishment of chiasmata that hold homologous chromosomes together allowing their correct segregation in the first meiotic division, which is also tightly regulated by cell-cycle dependent release of cohesin and monopolar attachment of sister kinetochores to microtubules. In meiosis II, bi-orientation of sister kinetochores and proper spindle orientation correctly segregate chromosomes in four haploid cells. Checkpoint mechanisms acting at kinetochores control the accuracy of kinetochore-microtubule attachment, thus ensuring the completion of segregation. Here we review the current knowledge on the processes taking place during chromosome segregation in plant meiosis, focusing on the characterization of the molecular factors involved. PMID:24987397

  20. Structure and function of eukaryotic chromosomes

    SciTech Connect

    Hennig, W.

    1987-01-01

    Contents: Introduction; Polytene Chromosomel Giant Chromosomes in Ciliates; The sp-I Genes in the Balbiani Rings of Chironomus Salivary Glands; The White Locus of Drosophila Melanogaster; The Genetic and Molecular Organization of the Dense Cluster of Functionally Related Vital Genes in the DOPA Decarboxylase Region of the Drosophila melanogaster Genome; Heat Shock Puffs and Response to Environmental Stress; The Y Chromosomal Lampbrush Loops of Drosophila; Contributions of Electron Microscopic Spreading Preparations (''Miller Spreads'') to the Analysis of Chromosome Structure; Replication of DNA in Eukaryotic Chromosomes; Gene Amplification in Dipteran Chromosomes; The Significance of Plant Transposable Elements in Biologically Relevant Processes; Arrangement of Chromosomes in Interphase Cell Nuclei; Heterochromatin and the Phenomenon of Chromosome Banding; Multiple Nonhistone Protein-DNA Complexes in Chromatin Regulate the Cell- and Stage-Specific Activity of an Eukaryotic Gene; Genetics of Sex Determination in Eukaryotes; Application of Basic Chromosome Research in Biotechnology and Medicine. This book presents an overview of various aspects of chromosome research.

  1. Meiotic chromosome structure and function in plants.

    PubMed

    Mainiero, Samantha; Pawlowski, Wojciech P

    2014-01-01

    Chromosome structure is important for many meiotic processes. Here, we outline 3 main determinants of chromosome structure and their effects on meiotic processes in plants. Cohesins are necessary to hold sister chromatids together until the first meiotic division, ensuring that homologous chromosomes and not sister chromatids separate during anaphase I. During meiosis in maize, Arabidopsis, and rice, cohesins are needed for establishing early prophase chromosome structure and recombination and for aligning bivalents at the metaphase plate. Condensin complexes play pivotal roles in controlling the packaging of chromatin into chromosomes through chromatin compaction and chromosome individualization. In animals and fungi, these complexes establish a meiotic chromosome structure that allows for proper recombination, pairing, and synapsis of homologous chromosomes. In plants, information on the role of condensins in meiosis is limited, but they are known to be required for successful completion of reproductive development. Therefore, we speculate that they play roles similar to animal and fungal condensins during meiosis. Plants generally have large and complex genomes due to frequent polyploidy events, and likely, condensins and cohesins organize chromosomes in such a way as to ensure genome stability. Hexaploid wheat has evolved a unique mechanism using a Ph1 locus-controlled chromosome organization to ensure proper chromosome pairing in meiosis. Altogether, studies on meiotic chromosome structure indicate that chromosome organization is not only important for chromatin packaging but also fulfills specific functions in facilitating chromosome interactions during meiosis, including pairing and recombination. PMID:25096046

  2. The Fragmentation of Outdoor Leadership.

    ERIC Educational Resources Information Center

    Cockrell, David

    Although outdoor leadership does not appear to be coalescing into a unified profession, there are potential solutions to this fragmentation. Six robust approaches to the professional provision of outdoor leadership are: (1) outfitting and guiding; (2) organized camping; (3) adventure education, such as Outward Bound; (4) the outdoor school; (5)…

  3. Fission fragment driven neutron source

    DOEpatents

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  4. Properties of fragmented repulsive condensates

    SciTech Connect

    Streltsov, Alexej I.; Cederbaum, Lorenz S.

    2005-06-15

    Repulsive Bose-Einstein condensates immersed into a double-well trap potential are studied within the framework of the recently introduced mean-field approach which allows for bosons to reside in several different orthonormal orbitals. In the case of a one-orbital mean-field theory (Gross-Pitaevskii) the ground state of the system reveals a bifurcation scenario at some critical values of the interparticle interaction and/or the number of particles. At about the same values of the parameters the two-orbital mean field predicts that the system becomes twofold fragmented. By applying the three-orbital mean field we verify numerically that for the double-well external potential studied here the overall best mean field is achieved with two orbitals. The variational principle minimizes the energy at a vanishing population of the third orbital. To discuss the energies needed to remove a boson from and the energies gained by adding a boson to the condensate, we introduce boson ionization potentials and boson affinities and relate them to the chemical potentials. The impact of the finite number of bosons in the condensate on these quantities is analyzed. We recall that within the framework of the multiorbital mean-field theory each fragment is characterized by its own chemical potential. Finally, the stability of fragmented states is discussed in terms of the boson transfer energy which is the energy needed to transfer a boson from one fragment to another.

  5. Nuclear energy release from fragmentation

    NASA Astrophysics Data System (ADS)

    Li, Cheng; Souza, S. R.; Tsang, M. B.; Zhang, Feng-Shou

    2016-08-01

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting 230,232Th and 235,238U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for 230,232Th and 235,238U are around 0.7-0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  6. Ordered Restriction Maps of Saccharomyces cerevisiae Chromosomes Constructed by Optical Mapping

    NASA Astrophysics Data System (ADS)

    Schwartz, David C.; Li, Xiaojun; Hernandez, Luis I.; Ramnarain, Satyadarshan P.; Huff, Edward J.; Wang, Yu-Ker

    1993-10-01

    A light microscope-based technique for rapidly constructing ordered physical maps of chromosomes has been developed. Restriction enzyme digestion of elongated individual DNA molecules (about 0.2 to 1.0 megabases in size) was imaged by fluorescence microscopy after fixation in agarose gel. The size of the resulting individual restriction fragments was determined by relative fluorescence intensity and apparent molecular contour length. Ordered restriction maps were then created from genomic DNA without reliance on cloned or amplified sequences for hybridization or analytical gel electrophoresis. Initial application of optical mapping is described for Saccharomyces cerevisiae chromosomes.

  7. Chromosome-Encoded Class D β-Lactamase OXA-23 in Proteus mirabilis

    PubMed Central

    Bonnet, R.; Marchandin, H.; Chanal, C.; Sirot, D.; Labia, R.; De Champs, C.; Jumas-Bilak, E.; Sirot, J.

    2002-01-01

    Ten nonrepetitive Proteus mirabilis isolates, which were collected over 4 years (1996 to 1999) at the teaching hospital of Clermont-Ferrand, France, produced class D carbapenemase OXA-23. MICs of imipenem were 0.25 to 0.5 μg/ml for these clinical isolates. Molecular typing revealed that the 10 P. mirabilis isolates originated from the same clonal strain. Hybridization of I-CeuI-generated chromosome fragments with a blaOXA-23 probe showed that the gene was chromosome encoded in the P. mirabilis strain. PMID:12019126

  8. Large-scale polymorphism near the ends of several human chromosomes analyzed by using fluorescence in situ hybridization (FISH)

    SciTech Connect

    Trask, B.J.; Friedman, C.; Giorgi, D.

    1994-09-01

    We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much more rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.

  9. Fragmentation in the First Galaxies

    NASA Astrophysics Data System (ADS)

    Safranek-Shrader, Chalence; Bromm, Volker; Milosavljević, Miloš

    2010-11-01

    Motivated by recent simulations of galaxy formation in which protogalaxies acquire their baryonic content through cold accretion, we study the gravitational fragmentation of cold streams flowing into a typical first galaxy. We use a one-zone hydrodynamical model to examine the thermal evolution of the gas flowing into a 108 M sun dark matter halo at redshift z = 10. The goal is to gain an understanding of the expected fragmentation mass scale and thus the characteristic mass of the first population of stars to form by shock fragmentation. Our model accurately describes the chemical and thermal evolution of the gas as we are specifically concerned with how the chemical abundances and initial conditions of the low-density, metal-enriched, cold accretion streams that pass an accretion shock alter the cooling properties and tendency to fragment in the post-shock gas. Cold accretion flows are not shock heated at the virial radius but instead flow along high-baryonic-density filaments of the cosmic web and penetrate deep into the host halo of the protogalaxy. In this physical regime, if molecular cooling is absent because of a strong Lyman-Werner background, we find there to be a sharp drop in the fragmentation mass at a metallicity of Z ~ 10-4 Z sun. If, however, H2 and HD molecules are present, they dominate the cooling at T < 104 K, and metallicity then has no effect on the fragmentation properties of the cold stream. For a solar abundance pattern of metallicity, O is the most effective metal coolant throughout the evolution, while for a pair instability supernova (PISN) metallicity yield, Si+ is the most effective coolant. PISN abundance patterns also exhibit a slightly smaller critical metallicity. Dust grains are not included in our chemical model, but we argue that their inclusion would not significantly alter the results. We also find that this physical scenario allows for the formation of stellar clusters and large, 104 M sun bound fragments, possibly the

  10. FRAGMENTATION IN THE FIRST GALAXIES

    SciTech Connect

    Safranek-Shrader, Chalence; Bromm, Volker; Milosavljevic, Milos

    2010-11-10

    Motivated by recent simulations of galaxy formation in which protogalaxies acquire their baryonic content through cold accretion, we study the gravitational fragmentation of cold streams flowing into a typical first galaxy. We use a one-zone hydrodynamical model to examine the thermal evolution of the gas flowing into a 10{sup 8} M{sub sun} dark matter halo at redshift z = 10. The goal is to gain an understanding of the expected fragmentation mass scale and thus the characteristic mass of the first population of stars to form by shock fragmentation. Our model accurately describes the chemical and thermal evolution of the gas as we are specifically concerned with how the chemical abundances and initial conditions of the low-density, metal-enriched, cold accretion streams that pass an accretion shock alter the cooling properties and tendency to fragment in the post-shock gas. Cold accretion flows are not shock heated at the virial radius but instead flow along high-baryonic-density filaments of the cosmic web and penetrate deep into the host halo of the protogalaxy. In this physical regime, if molecular cooling is absent because of a strong Lyman-Werner background, we find there to be a sharp drop in the fragmentation mass at a metallicity of Z {approx} 10{sup -4} Z{sub sun}. If, however, H{sub 2} and HD molecules are present, they dominate the cooling at T < 10{sup 4} K, and metallicity then has no effect on the fragmentation properties of the cold stream. For a solar abundance pattern of metallicity, O is the most effective metal coolant throughout the evolution, while for a pair instability supernova (PISN) metallicity yield, Si{sup +} is the most effective coolant. PISN abundance patterns also exhibit a slightly smaller critical metallicity. Dust grains are not included in our chemical model, but we argue that their inclusion would not significantly alter the results. We also find that this physical scenario allows for the formation of stellar clusters and large

  11. Surnames and the Y chromosome.

    PubMed

    Sykes, B; Irven, C

    2000-04-01

    A randomly ascertained sample of males with the surname "Sykes" was typed with four Y-chromosome microsatellites. Almost half the sample shared the same Y-chromosome haplotype, which has not been observed in control samples either from the same geographic region or from the United Kingdom as a whole. This points to a single surname founder for extant Sykes males, even though written sources had predicted multiple origins. The distribution of other Sykes Y-chromosome haplotypes were not significantly different from those in controls and may be accounted for by the historical accumulation of nonpaternity during the past 700 years, in which case the average rate estimate is 1.3%/generation. If this pattern is reproduced with other surnames, it may have important forensic and genealogical applications.

  12. Chromosome demise in the wake of ligase-deficient replication

    PubMed Central

    Kouzminova, Elena A.; Kuzminov, Andrei

    2012-01-01

    Summary Bacterial DNA ligases, NAD+-dependent enzymes, are distinct from eukaryotic ATP-dependent ligases, representing promising targets for broad-spectrum antimicrobials. Yet, the chromosomal consequences of ligase-deficient DNA replication, during which Okazaki fragments accumulate, are still unclear. Using ligA251(Ts), the strongest ligase mutant of Escherichia coli, we studied ligase-deficient DNA replication by genetic and physical approaches. Here we show that replication without ligase kills after a short resistance period. We found that double-strand break repair via RecA, RecBCD, RuvABC and RecG explains the transient resistance, whereas irreparable chromosomal fragmentation explains subsequent cell death. Remarkably, death is mostly prevented by elimination of linear DNA degradation activity of ExoV, suggesting that non-allelic double-strand breaks behind replication forks precipitate DNA degradation that enlarge them into allelic double-strand gaps. Marker frequency profiling of synchronized replication reveals stalling of ligase-deficient forks with subsequent degradation of the DNA synthesized without ligase. The mechanism that converts unsealed nicks behind replication forks first into repairable double-strand breaks and then into irreparable double-strand gaps may be behind lethality of any DNA damaging treatment. PMID:22582878

  13. Escape Artists of the X Chromosome.

    PubMed

    Balaton, Bradley P; Brown, Carolyn J

    2016-06-01

    Inactivation of one X chromosome in mammalian females achieves dosage compensation between XX females and XY males; however, over 15% of human X-linked genes continue to be expressed from the inactive X chromosome. New genomic methodologies have improved our identification and characterization of these escape genes, revealing the importance of DNA sequence, chromatin structure, and chromosome ultrastructure in regulating expression from an otherwise inactive chromosome. Study of these exceptions to the rule of silencing highlights the interconnectedness of chromatin and chromosome structure in X-chromosome inactivation (XCI). Recent advances also demonstrate the importance of these genes in sexually dimorphic disease risk, particularly cancer.

  14. Adults with Chromosome 18 Abnormalities.

    PubMed

    Soileau, Bridgette; Hasi, Minire; Sebold, Courtney; Hill, Annice; O'Donnell, Louise; Hale, Daniel E; Cody, Jannine D

    2015-08-01

    The identification of an underlying chromosome abnormality frequently marks the endpoint of a diagnostic odyssey. However, families are frequently left with more questions than answers as they consider their child's future. In the case of rare chromosome conditions, a lack of longitudinal data often makes it difficult to provide anticipatory guidance to these families. The objective of this study is to describe the lifespan, educational attainment, living situation, and behavioral phenotype of adults with chromosome 18 abnormalities. The Chromosome 18 Clinical Research Center has enrolled 483 individuals with one of the following conditions: 18q-, 18p-, Tetrasomy 18p, and Ring 18. As a part of the ongoing longitudinal study, we collect data on living arrangements, educational level attained, and employment status as well as data on executive functioning and behavioral skills on an annual basis. Within our cohort, 28 of the 483 participants have died, the majority of whom have deletions encompassing the TCF4 gene or who have unbalanced rearrangement involving other chromosomes. Data regarding the cause of and age at death are presented. We also report on the living situation, educational attainment, and behavioral phenotype of the 151 participants over the age of 18. In general, educational level is higher for people with all these conditions than implied by the early literature, including some that received post-high school education. In addition, some individuals are able to live independently, though at this point they represent a minority of patients. Data on executive function and behavioral phenotype are also presented. Taken together, these data provide insight into the long-term outcome for individuals with a chromosome 18 condition. This information is critical in counseling families on the range of potential outcomes for their child.

  15. Chromosomal Behavior during Meiosis in the Progeny of Triticum timopheevii × Hexaploid Wild Oat

    PubMed Central

    An, Hongzhou; Hu, Mei; Li, Pengfei; Geng, Guangdong; Zhang, Qingqin; Zhang, Suqin

    2015-01-01

    The meiotic behavior of pollen mother cells (PMCs) of the F2 and F3 progeny from Triticum timopheevii × hexaploid wild oat was investigated by cytological analysis and sequential C-banding-genomic in situ hybridization (GISH) in the present study. A cytological analysis showed that the chromosome numbers of the F2 and F3 progeny ranged from 28 to 41. A large number of univalents, lagging chromosomes, chromosome bridges and micronuclei were found at the metaphase I, anaphase I, anaphase II and tetrad stages in the F2 and F3 progeny. The averages of univalents were 3.50 and 2.73 per cell, and those of lagging chromosomes were 3.37 and 1.87 in the F2 and F3 progeny, respectively. The PMC meiotic indices of the F2 and F3 progeny were 12.22 and 20.34, respectively, indicating considerable genetic instability. A sequential C-banding-GISH analysis revealed that some chromosomes and fragments from the hexaploid wild oat were detected at metaphase I and anaphase I in the progeny, showing that the progeny were of true intergeneric hybrid origin. The alien chromosomes 6A, 7A, 3C and 2D were lost during transmission from F2 to F3. In addition, partial T. timopheevii chromosomes appeared in the form of univalents or lagging chromosomes, which might result from large genome differences between the parents, and the wild oat chromosome introgression interfered with the wheat homologues’ normally pairing. PMID:25950431

  16. Fertility of CMS wheat is restored by two Rf loci located on a recombined acrocentric chromosome

    PubMed Central

    Castillo, Almudena; Atienza, Sergio G.; Martín, Azahara C.

    2014-01-01

    Cytoplasmic male sterility (CMS) results from incompatibility between nuclear and cytoplasmic genomes, and is characterized by the inability to produce viable pollen. The restoration of male fertility generally involves the introgression of nuclear genes, termed restorers of fertility (Rf). CMS has been widely used for hybrid seed production in many crops but not in wheat, partly owing to the complex genetics of fertility restoration. In this study, an acrocentric chromosome that restores pollen fertility of CMS wheat in Hordeum chilense cytoplasm (msH1 system) is studied. The results show that this chromosome, of H. chilense origin and named Hchac, originated from a complex reorganization of the short arm of chromosomes 1Hch (1HchS) and 6Hch (6HchS). Diversity arrays technology (DArT) markers and cytological analysis indicate that Hchac is a kind of `zebra-like′ chromosome composed of chromosome 1HchS and alternate fragments of interstitial and distal regions of chromosome 6HchS. PCR-based markers together with FISH, GISH, and meiotic pairing analysis support this result. A restorer of fertility gene, named Rf 6H ch S, has been identified on the short arm of chromosome 6HchS. Moreover, restoration by the addition of chromosome 1HchS has been observed at a very low frequency and under certain environmental conditions. Therefore, the results indicate the presence of two Rf genes on the acrocentric chromosome: Rf 6H ch S and Rf 1H ch S, the restoration potential of Rf 6H ch S being greater. The stable and high restoration of pollen fertility in the msH1 system is therefore the result of the interaction between these two restorer genes. PMID:25271260

  17. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    PubMed Central

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  18. Origin and spread of the SRY gene on the X and Y chromosomes of the rodent Microtus cabrerae: role of L1 elements.

    PubMed

    Marchal, Juan A; Acosta, Manuel J; Bullejos, Mónica; Díaz de la Guardia, Rafael; Sánchez, Antonio

    2008-02-01

    In the rodent species Microtus cabrerae, males as well as females present several copies of the SRY gene, a single-copy gene located on the Y chromosome in most mammals. Using different PCR approaches, we have characterized the sequence, structure, and organization of the SRY copies and their flanking regions distributed on the X and Y chromosomes of this species. All copies of SRY analyzed, including those from the Y chromosome, proved to be nonfunctional pseudogenes, as they have internal stop codons. In addition, we demonstrated the association of SRY pseudogenes with different fragments of L1 and LTR retroelements in both sex chromosomes of M. cabrerae. Examining the possible origin of SRY pseudogene and retroposons association, we propose that retroposons could have been involved in the mechanism of SRY gene amplification on the Y chromosome and in the transference of the Y-linked SRY copies to the X-chromosome heterochromatin.

  19. Making chromosome abnormalities treatable conditions.

    PubMed

    Cody, Jannine DeMars; Hale, Daniel Esten

    2015-09-01

    Individuals affected by the classic chromosome deletion syndromes which were first identified at the beginning of the genetic age, are now positioned to benefit from genomic advances. This issue highlights five of these conditions (4p-, 5p-, 11q-, 18p-, and 18q-). It focuses on the increased in understanding of the molecular underpinnings and envisions how these can be transformed into effective treatments. While it is scientifically exciting to see the phenotypic manifestations of hemizygosity being increasingly understood at the molecular and cellular level, it is even more amazing to consider that we are now on the road to making chromosome abnormalities treatable conditions.

  20. Fragments

    ERIC Educational Resources Information Center

    Moreira, Claudio

    2008-01-01

    This performance autoethnography shows the author's struggle in finding his place, scholarship, voice, and body, into the academic setting. Mixing together memories of his lived experience with sugar cane workers, notes, and leftovers of different fieldworks, plus 6 years of life as grad student at the University of Illinois, the author looks for…

  1. Ring chromosomes in dermatofibrosarcoma protuberans are composed of interspersed sequences from chromosomes 17 and 22.

    PubMed Central

    Naeem, R.; Lux, M. L.; Huang, S. F.; Naber, S. P.; Corson, J. M.; Fletcher, J. A.

    1995-01-01

    Ring chromosomes are found in most dermatofibrosarcoma protuberans (DFSPs), and recent reports demonstrate that portions of the DFSP ring chromosomes derive from chromosome 17. In this study we characterized ring chromosomes in three DFSPs using a combined approach of karyotyping, chromosome painting, and comparative genomic hybridization. Chromosome painting demonstrated that the ring chromosomes in each DFSP were composed of discontinuous, interwoven sequences from chromosomes 17 and 22. Amplification of chromosomes 17 and 22 sequences was confirmed in each of these cases by comparative genomic hybridization, and over-representation of chromosomes 17 and 22 sequences was also demonstrated by comparative genomic hybridization in 1 of 2 cytogenetically unremarkable DFSPs. We conclude that amplification of chromosomes 17 and 22 sequences, in ring form, is a characteristic aberration in DFSP. Images Figure 1 Figure 2 PMID:7495279

  2. Multiscale image enhancement of chromosome banding patterns

    NASA Astrophysics Data System (ADS)

    Wu, Qiang; Castleman, Kenneth R.

    1996-10-01

    Visual examination of chromosome banding patterns is an important means of chromosome analysis. Cytogeneticists compare their patient's chromosome image against the prototype normal/abnormal human chromosome banding patterns. Automated chromosome analysis instruments facilitate this by digitally enhancing the chromosome images. Currently available systems employing traditional highpass/bandpass filtering and/or histogram equalization are approximately equivalent to photomicroscopy in their ability to support the detection of band pattern alterations. Improvements in chromosome image display quality, particularly in the detail of the banding pattern, would significantly increase the cost-effectiveness of these systems. In this paper we present our work on the use of multiscale transform and derivative filtering for image enhancement of chromosome banding patterns. A steerable pyramid representation of the chromosome image is generated by a multiscale transform. The derivative filters are designed to detect the bands of a chromosome, and the steerable pyramid transform is chosen based on its desirable properties of shift and rotation invariance. By processing the transform coefficients that correspond to the bands of the chromosome in the pyramid representation, contrast enhancement of the chromosome bands can be achieved with designed flexibility in scale, orientation and location. Compared with existing chromosome image enhancement techniques, this new approach offers the advantage of selective chromosome banding pattern enhancement that allows designated detail analysis. Experimental results indicate improved enhancement capabilities and promise more effective visual aid to comparison of chromosomes to the prototypes and to each other. This will increase the ability of automated chromosome analysis instruments to assist the evaluation of chromosome abnormalities in clinical samples.

  3. Anchoring linkage groups of the Rosa genetic map to physical chromosomes with tyramide-FISH and EST-SNP markers.

    PubMed

    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila

    2014-01-01

    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb-1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria. PMID:24755945

  4. Anchoring Linkage Groups of the Rosa Genetic Map to Physical Chromosomes with Tyramide-FISH and EST-SNP Markers

    PubMed Central

    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila

    2014-01-01

    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb–1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria. PMID:24755945

  5. Anchoring linkage groups of the Rosa genetic map to physical chromosomes with tyramide-FISH and EST-SNP markers.

    PubMed

    Kirov, Ilya; Van Laere, Katrijn; De Riek, Jan; De Keyser, Ellen; Van Roy, Nadine; Khrustaleva, Ludmila

    2014-01-01

    In order to anchor Rosa linkage groups to physical chromosomes, a combination of the Tyramide-FISH technology and the modern molecular marker system based on High Resolution Melting (HRM) is an efficient approach. Although, Tyramide-FISH is a very promising technique for the visualization of short DNA probes, it is very challenging for plant species with small chromosomes such as Rosa. In this study, we successfully applied the Tyramide-FISH technique for Rosa and compared different detection systems. An indirect detection system exploiting biotinylated tyramides was shown to be the most suitable technique for reliable signal detection. Three gene fragments with a size of 1100 pb-1700 bp (Phenylalanine Ammonia Lyase, Pyrroline-5-Carboxylate Synthase and Orcinol O-Methyl Transferase) have been physically mapped on chromosomes 7, 4 and 1, respectively, of Rosa wichurana. The signal frequency was between 25% and 40%. HRM markers of these 3 gene fragments were used to include the gene fragments on the existing genetic linkage map of Rosa wichurana. As a result, three linkage groups could be anchored to their physical chromosomes. The information was used to check for synteny between the Rosa chromosomes and Fragaria.

  6. Cloning of a very virulent plus, 686 strain of Marek’s disease virus as a bacterial artificial chromosome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek’s disease virus (MDV) is a highly oncogenic herpe...

  7. RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

    EPA Science Inventory

    A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

  8. Chromosome 16-specific repetitive DNA sequences that map to chromosomal regions known to undergo breakage/rearrangement in leukemia cells.

    PubMed

    Stallings, R L; Doggett, N A; Okumura, K; Ward, D C

    1992-06-01

    Human chromosome 16-specific low-abundance repetitive (CH16LAR) DNA sequences have been identified during the course of constructing a physical map of this chromosome. At least three CH16LAR sequences exist and they are interspersed, in small clusters, over four regions that constitute more than 5% of the chromosome. CH16LAR sequences were observed in one unusually large cosmid contig (number 55), where the ordering of clones was difficult because these sequences led to false overlaps between noncontiguous clones. Contig 55 contains 78 clones, or approximately 2% of all the clones contained within the present cosmid contig physical map. Fluorescent in situ hybridization of multiple clones, including cosmid and YAC contig 55 clones, mapped the four CH16LAR-rich regions to bands p13, p12, p11, and q22. These regions are of biological interest since the pericentric inversion and the interhomologue translocation breakpoints commonly found in acute nonlymphocytic leukemia (ANLL) subtype M4 fall within these bands. Sequence analysis of a 2.2-kb HindIII fragment from a cosmid containing a CH16LAR sequence indicated that one of the CH16LAR elements is similar to a minisatellite sequence in that the core repeat is only 40 bp in length. Additional characterization of other repetitive elements is in progress.

  9. Detection of amplified or deleted chromosomal regions

    DOEpatents

    Stokke, T.; Pinkel, D.; Gray, J.W.

    1995-12-05

    The present invention relates to in situ hybridization methods for the identification of new chromosomal abnormalities associated with various diseases. In particular, it provides probes which are specific to a region of amplification in chromosome 20. 3 figs.

  10. Detection of amplified or deleted chromosomal regions

    SciTech Connect

    Stokke, Trond; Pinkel, Daniel; Gray, Joe W.

    1995-01-01

    The present invention relates to in situ hybridization methods for the identification of new chromosomal abnormalities associated with various diseases. In particular, it provides probes which are specific to a region of amplification in chromosome 20.

  11. An Automated System for Chromosome Analysis

    NASA Technical Reports Server (NTRS)

    Castleman, K. R.; Melnyk, J. H.

    1976-01-01

    The design, construction, and testing of a complete system to produce karyotypes and chromosome measurement data from human blood samples, and to provide a basis for statistical analysis of quantitative chromosome measurement data are described.

  12. Detection Of Amplified Or Deleted Chromosomal Regions

    SciTech Connect

    Stokke, Trond , Pinkel, Daniel , Gray, Joe W.

    1997-05-27

    The present invention relates to in situ hybridization methods for the identification of new chromosomal abnormalities associated with various diseases. In particular, it provides probes which are specific to a region of amplification in chromosome 20.

  13. Mathematical glimpse on the Y chromosome degeneration

    NASA Astrophysics Data System (ADS)

    Lobo, M. P.

    2006-04-01

    The Y chromosomes are genetically degenerate and do not recombine with their matching partners X. Non-recombination of XY pairs has been pointed out as the key factor for the degeneration of the Y chromosome. The aim here is to show that there is a mathematical asymmetry in sex chromosomes which leads to the degeneration of Y chromosomes even in the absence of XX and XY recombination. A model for sex-chromosome evolution in a stationary regime is proposed. The consequences of their asymmetry are analyzed and lead us to a couple of conclusions. First, Y chromosome degeneration shows up sqrt{2} more often than X chromosome degeneration. Second, if nature prohibits female mortalities from beeing exactly 50%, then Y chromosome degeneration is inevitable.

  14. Workflow Design Using Fragment Composition

    NASA Astrophysics Data System (ADS)

    Mosser, Sébastien; Blay-Fornarino, Mireille; France, Robert

    The Service-Oriented Architecture (Soa) paradigm supports the assembly of atomic services to create applications that implement complex business processes. Assembly can be accomplished by service orchestrations defined by Soa architects. The Adore method allows Soa architects to model complex orchestrations of services by composing models of smaller orchestrations called orchestration fragments. The Adore method can also be used to weave fragments that address new concerns into existing application models. In this paper we illustrate how the Adore method can be used to separate and compose process aspects in a Soa design of the Car Crash Crisis Management System. The paper also includes a discussion of the benefits and limitations of the Adore method.

  15. Fragmentation of suddenly heated liquids

    SciTech Connect

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion.

  16. Fragmentation of the Chelyabinsk Fireball

    NASA Astrophysics Data System (ADS)

    Melosh, J.

    2013-12-01

    The most intense bolide since the 1908 Tunguska event occurred in the early morning hours of 15 February 2013 near the Russian town of Chelyabinsk. The impacting asteroid ranged between 17 and 20 m diameter with a mass of about 10,000 tons. Its estimated pre-atmospheric velocity was about 18.6 km/sec at a low angle of 20° from the horizontal. The resulting airburst occurred at an altitude of about 23 km and released an estimated total energy of about 440 kT (1.7 x 1015 J). The blast wave shattered windows on the ground over a wide area and collapsed the roof of a zinc factory. In spite of the size of the initital asteroid, only small fragments (a few kg, so far) have been recovered. The entry of an asteroid into Earth's atmosphere and its aerodynamic fragmentation and deceleration has been modeled by a number of authors over the past few decades. Full-featured numerical simulations are presently limited in their ability to simultaneously incorporate fragmentation, energy coupling between solid fragments and the atmosphere, and thermal radiation, but an approximate treatment of the fragmentation and dispersion of a large entering meteoroid called the 'pancake model' has achieved good fits to other observed events, including the Tunguska explosion, the 1947 Shikote-Alin fall and strewn fields from larger iron meteorite falls, such as the Henbury craters. Simulations using the pancake model can fit the overall observations of the Chelyabinsk event using an 18 m diameter asteroid of density 3000 kg/m3 following the observed trajectory and possessing an initial strength of about 7 MPa, which is relatively high for a stony meteoroid. This suggests that the asteroid was not a strengthless rubble pile, but in fact possessed considerable strength, compared to other stony meteorites of similar type. Aerodynamic breakup begins at an altitude of 31 km and the final airburst occurs at 22 km, releasing about 250 kT at this time. Subsequent to this airburst, large fragments

  17. Asymmetry effects in fragment production

    NASA Astrophysics Data System (ADS)

    Kaur, Manpreet; Kaur, Varinderjit

    2016-05-01

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping Atotal fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of 197Au+27Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  18. Induction of chromosome damage by ultraviolet light and caffeine: correlation of cytogenetic evaluation and flow karyotype

    SciTech Connect

    Cremer, C.; Cremer, T.; Gray, J.W.

    1982-03-01

    Asynchronously growing cells of a M3-1 Chinese hamster line were ultraviolet (UV) irradiated (lambda . 254 nm) with UV fluences up to 7.5 J/m(2). After irradiation cells were incubated with or without 2 mM caffeine for 20 hr, then mitotic cells were selected by mechanical shaking. Their chromosomes were isolated, stained with Hoechst 33258 and chromomycin A3, and measured flow cytometrically. While the fluorescence distributions of chromosomes (flow karyo-types) from cells treated with UV alone or with caffeine alone were very similar to those of untreated controls, the flow karyo-types of UV + caffeine-treated cells showed a debris continuum that increased with increasing UV fluence suggesting an increased number of chromosome fragments. Visual evaluation of metaphase plates revealed that the percentage of cells with chromosome damage also increased steadily with increasing UV fluence. A high degree of correlation was observed between the relative magnitude of the debris level from flow karyotypes and the percentage of cells with chromosome damage and with generalized chromosomes shattering, respectively, as determined from metaphase spreads.

  19. Induction of chromosome damage by ultraviolet light and caffeine: correlation of cytogenetic evaluation and flow karyotype

    SciTech Connect

    Cremer, C.; Cremer, T.; Gray, J.W.

    1982-01-01

    Asynchronously growing cells of a M3-1 Chinese hamster line were ultraviolet (uv) irradiated (lambda = 254 nm) with uv fluences up to 7.5 J/m/sup 2/. After irradiation, cells were incubated with or without 2 mM caffeine for 20 hr, then mitotic cells were selected by mechanical shaking. Their chromosomes were isolated, stained with Hoechst 33258 and chromomycin A3, and measured flow cytometrically. While the fluorescence distributions of chromosomes (flow karyotypes) from cells treated with uv alone or with caffeine alone were very similar to those of untreated controls, the flow karyotypes of uv + caffeine-treated cells showed a debris continuum that increased with increasing uv fluence suggesting an increased number of chromosome fragments. Visual evaluation of metaphase plates revealed that the percentage of cells with chromosome damage also increased steadily with increasing uv fluence. A high degree of correlation was observed between the relative magnitude of the debris level from flow karyotypes and the percentage of cells with chromosome damage and with generalized chromosome shattering, respectively, as determined from metaphase spreads.

  20. Chromosome instability induced in vitro with mitomycin C in five Seckel syndrome patients.

    PubMed

    Bobabilla-Morales, Lucina; Corona-Rivera, Alfredo; Corona-Rivera, J Román; Buenrostro, C; García-Cobián, Teresa A; Corona-Rivera, Enrique; Cantú-Garza, José María; García-Cruz, Diana

    2003-12-01

    Seckel syndrome (SS) is an autosomal recessive entity characterized by proportionate pre- and post-natal growth retardation, microcephaly, typical facial appearance with beak-like protrusion, and severe mental retardation. A heterogeneous basis for SS was proposed since around 25% of SS patients have hematological anomalies, suggesting a subgroup of SS with chromosome instability and hematological disorders. Chromosome instability induced by mitomycin C (MMC) has been observed in previous reports. The purpose of this study is to report cytogenetic features in five patients with SS. The patients had low birth weight (mean 1,870 g), short stature (SD = 6.36), microcephaly (OFC, SD = 8.1), typical facial appearance, and multiple articular dislocations. None of them had anemia at the time of examination. In all cases their parents were healthy and non-consanguineous. Lymphocytes of SS patients and a control group (n = 9) matched by age and sex were cultured with and without MMC, and harvested at 72 and 96 hr. Chromosomal aberrations (chromatid and chromosomal gaps and breaks, deletions, fragments, and exchanges) were scored in 100 metaphases per culture. A statistical increase of chromosomal aberrations was observed in 96 hr MMC cultures in all patients (40.2% vs. 2.8%). Sister chromatid exchanges were also performed with no differences between groups. Clinical and cytogenetic findings support the idea that SS may correspond to a chromosome instability syndrome. PMID:14598338

  1. Chromosomal Replication Complexity: A Novel DNA Metrics and Genome Instability Factor

    PubMed Central

    Kuzminov, Andrei

    2016-01-01

    As the ratio of the copy number of the most replicated to the unreplicated regions in the same chromosome, the definition of chromosomal replication complexity (CRC) appears to leave little room for variation, being either two during S-phase or one otherwise. However, bacteria dividing faster than they replicate their chromosome spike CRC to four and even eight. A recent experimental inquiry about the limits of CRC in Escherichia coli revealed two major reasons to avoid elevating it further: (i) increased chromosomal fragmentation and (ii) complications with subsequent double-strand break repair. Remarkably, examples of stable elevated CRC in eukaryotic chromosomes are well known under various terms like "differential replication," "underreplication," "DNA puffs," "onion-skin replication," or "re-replication" and highlight the phenomenon of static replication fork (sRF). To accurately describe the resulting "amplification by overinitiation," I propose a new term: "replification" (subchromosomal overreplication). In both prokaryotes and eukaryotes, replification, via sRF processing, causes double-strand DNA breaks and, with their repair elevating chromosomal rearrangements, represents a novel genome instability factor. I suggest how static replication bubbles could be stabilized and speculate that some tandem duplications represent such persistent static bubbles. Moreover, I propose how static replication bubbles could be transformed into tandem duplications, double minutes, or inverted triplications. Possible experimental tests of these models are discussed. PMID:27711112

  2. Chromosome instability induced in vitro with mitomycin C in five Seckel syndrome patients.

    PubMed

    Bobabilla-Morales, Lucina; Corona-Rivera, Alfredo; Corona-Rivera, J Román; Buenrostro, C; García-Cobián, Teresa A; Corona-Rivera, Enrique; Cantú-Garza, José María; García-Cruz, Diana

    2003-12-01

    Seckel syndrome (SS) is an autosomal recessive entity characterized by proportionate pre- and post-natal growth retardation, microcephaly, typical facial appearance with beak-like protrusion, and severe mental retardation. A heterogeneous basis for SS was proposed since around 25% of SS patients have hematological anomalies, suggesting a subgroup of SS with chromosome instability and hematological disorders. Chromosome instability induced by mitomycin C (MMC) has been observed in previous reports. The purpose of this study is to report cytogenetic features in five patients with SS. The patients had low birth weight (mean 1,870 g), short stature (SD = 6.36), microcephaly (OFC, SD = 8.1), typical facial appearance, and multiple articular dislocations. None of them had anemia at the time of examination. In all cases their parents were healthy and non-consanguineous. Lymphocytes of SS patients and a control group (n = 9) matched by age and sex were cultured with and without MMC, and harvested at 72 and 96 hr. Chromosomal aberrations (chromatid and chromosomal gaps and breaks, deletions, fragments, and exchanges) were scored in 100 metaphases per culture. A statistical increase of chromosomal aberrations was observed in 96 hr MMC cultures in all patients (40.2% vs. 2.8%). Sister chromatid exchanges were also performed with no differences between groups. Clinical and cytogenetic findings support the idea that SS may correspond to a chromosome instability syndrome.

  3. Fertilization and Uniparental Chromosome Elimination during Crosses with Maize Haploid Inducers1[C][W

    PubMed Central

    Zhao, Xin; Xu, Xiaowei; Xie, Hongxia; Chen, Shaojiang; Jin, Weiwei

    2013-01-01

    Producing maternal haploids via a male inducer can greatly accelerate maize (Zea mays) breeding process. However, the mechanism underlying haploid formation remains unclear. In this study, we constructed two inducer lines containing cytogenetic marker B chromosome or alien centromeric histone H3 variant-yellow fluorescent protein vector to investigate the mechanism. The two inducer lines as the pollinators were crossed with a hybrid ZhengDan958. B chromosomes were detected in F1 haploids at a low frequency, which was direct evidence to support the occurrence of selective chromosome elimination during haploid formation. We found that most of the inducer chromosomes were eliminated in haploid embryonic cells during the first week after pollination. The gradual elimination of chromosomes was also detected in the endosperm of defective kernels, although it occurred only in some endosperm cells as late as 15 d after pollination. We also performed a genome-wide identification of single nucleotide polymorphism markers in the inducers, noninducer inbred lines, and 42 derived haploids using a 50K single nucleotide polymorphism array. We found that an approximately 44-Mb heterozygous fragment from the male parent was detected in a single haploid, which further supported the occurrence of paternal introgression. Our results suggest that selective elimination of uniparental chromosomes leads to the formation of haploid and possible defective kernels in maize as well, which is accompanied with unusual paternal introgression in haploid cells. PMID:24014577

  4. Chromosome Territory Modeller and Viewer.

    PubMed

    Tkacz, Magdalena A; Chromiński, Kornel; Idziak-Helmcke, Dominika; Robaszkiewicz, Ewa; Hasterok, Robert

    2016-01-01

    This paper presents ChroTeMo, a tool for chromosome territory modelling, accompanied by ChroTeVi-a chromosome territory visualisation software that uses the data obtained by ChroTeMo. These tools have been developed in order to complement the molecular cytogenetic research of interphase nucleus structure in a model grass Brachypodium distachyon. Although the modelling tool has been initially created for one particular species, it has universal application. The proposed version of ChroTeMo allows for generating a model of chromosome territory distribution in any given plant or animal species after setting the initial, species-specific parameters. ChroTeMo has been developed as a fully probabilistic modeller. Due to this feature, the comparison between the experimental data on the structure of a nucleus and the results obtained from ChroTeMo can indicate whether the distribution of chromosomes inside a nucleus is also fully probabilistic or is subjected to certain non-random patterns. The presented tools have been written in Python, so they are multiplatform, portable and easy to read. Moreover, if necessary they can be further developed by users writing their portions of code. The source code, documentation, and wiki, as well as the issue tracker and the list of related articles that use ChroTeMo and ChroTeVi, are accessible in a public repository at Github under GPL 3.0 license. PMID:27505434

  5. Chromosomal disorders and male infertility.

    PubMed

    Harton, Gary L; Tempest, Helen G

    2012-01-01

    Infertility in humans is surprisingly common occurring in approximately 15% of the population wishing to start a family. Despite this, the molecular and genetic factors underlying the cause of infertility remain largely undiscovered. Nevertheless, more and more genetic factors associated with infertility are being identified. This review will focus on our current understanding of the chromosomal basis of male infertility specifically: chromosomal aneuploidy, structural and numerical karyotype abnormalities and Y chromosomal microdeletions. Chromosomal aneuploidy is the leading cause of pregnancy loss and developmental disabilities in humans. Aneuploidy is predominantly maternal in origin, but concerns have been raised regarding the safety of intracytoplasmic sperm injection as infertile men have significantly higher levels of sperm aneuploidy compared to their fertile counterparts. Males with numerical or structural karyotype abnormalities are also at an increased risk of producing aneuploid sperm. Our current understanding of how sperm aneuploidy translates to embryo aneuploidy will be reviewed, as well as the application of preimplantation genetic diagnosis (PGD) in such cases. Clinical recommendations where possible will be made, as well as discussion of the use of emerging array technology in PGD and its potential applications in male infertility. PMID:22120929

  6. Chromosome synteny in cucumis species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cucumber, Cucumis sativus L. (2n = 2x = 14) and melon, C. melo L. (2n = 2x = 24) are two important vegetable species in the genus Cucumis (family Cucurbitaceae). Two inter-fertile botanical varieties with 14 chromosomes, the cultivated C. sativus var. sativus L. and the wild C. sativus var. hardwick...

  7. CHROMOSOMAL MULTIPLICITY IN BURKHOLDERIA CEPACIA

    EPA Science Inventory

    We have used CHEF gel electrophoresis to screen preparations of large DNA from different Burkholderia cepacia isolates for the presence of DNA species corresponding to the linearized forms of the three chromosomes of 3.4,2.5, and 0.9 Mb identified in B. cepacia strain 17616. DNA ...

  8. The XXXXY Sex Chromosome Abnormality

    PubMed Central

    Barr, M. L.; Carr, D. H.; Pozsonyi, J.; Wilson, R. A.; Dunn, H. G.; Jacobson, T. S.; Miller, J. R.; Chown, B.

    1962-01-01

    The most common sex chromosome complex in sex chromatin-positive males with Klinefelter's syndrome is XXY. When the complex is XXYY or XXXY, the clinical findings do not seem to differ materially from those seen in XXY subjects, although more patients with these intersexual chromosome complements need to be studied to establish possible phenotypical expressions of the chromosomal variants. Two male children with an XXXXY sex chromosome abnormality are described. The data obtained from the study of these cases and five others described in the literature suggest that the XXXXY patient is likely to have congenital defects not usually seen in the common form of the Klinefelter syndrome. These include a triad of (1) skeletal anomalies (including radioulnar synostosis), (2) hypogenitalism (hypoplasia of penis and scrotum, incomplete descent of testes and defective prepubertal development of seminiferous tubules), and (3) greater risk of severe mental deficiency. That the conclusions are based on data from a small number of patients is emphasized, together with the need for a cytogenetic survey of a large control or unselected population. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6Fig. 7Fig. 8Fig. 9Fig. 10 PMID:13969480

  9. Chromosome Territory Modeller and Viewer

    PubMed Central

    Idziak-Helmcke, Dominika; Robaszkiewicz, Ewa; Hasterok, Robert

    2016-01-01

    This paper presents ChroTeMo, a tool for chromosome territory modelling, accompanied by ChroTeVi–a chromosome territory visualisation software that uses the data obtained by ChroTeMo. These tools have been developed in order to complement the molecular cytogenetic research of interphase nucleus structure in a model grass Brachypodium distachyon. Although the modelling tool has been initially created for one particular species, it has universal application. The proposed version of ChroTeMo allows for generating a model of chromosome territory distribution in any given plant or animal species after setting the initial, species-specific parameters. ChroTeMo has been developed as a fully probabilistic modeller. Due to this feature, the comparison between the experimental data on the structure of a nucleus and the results obtained from ChroTeMo can indicate whether the distribution of chromosomes inside a nucleus is also fully probabilistic or is subjected to certain non-random patterns. The presented tools have been written in Python, so they are multiplatform, portable and easy to read. Moreover, if necessary they can be further developed by users writing their portions of code. The source code, documentation, and wiki, as well as the issue tracker and the list of related articles that use ChroTeMo and ChroTeVi, are accessible in a public repository at Github under GPL 3.0 license. PMID:27505434

  10. Characterization of the NTRK1 genomic region involved in chromosomal rearrangements generating TRK oncogenes

    SciTech Connect

    Greco, A.; Mariani, C.; Miranda, C.; Pagliardini, S.; Pierotti, M.A. )

    1993-11-01

    TRK oncogenes are created by chromosomal rearrangements linking the tyrosine-kinase domain of the NTRK1 gene (encoding one of the receptors for the nerve growth factor) to foreign activating sequences. TRK oncogenes are frequently detected in human papillary thyroid carcinoma, as a result of rearrangements involving at least three different activating genes. The authors have found that the rearrangements creating all the TRK oncogenes so far characterized fall within a 2.9-kb XbaI/SmaI restriction fragment of the NTRK1 gene. Here they report the nucleotide sequence and the exon organization of this fragment. 13 refs., 2 figs.

  11. A highly conserved repeated chromosomal sequence in the radioresistant bacterium Deinococcus radiodurans SARK.

    PubMed

    Lennon, E; Gutman, P D; Yao, H L; Minton, K W

    1991-03-01

    A DNA fragment containing a portion of a DNA damage-inducible gene from Deinococcus radiodurans SARK hybridized to numerous fragments of SARK genomic DNA because of a highly conserved repetitive chromosomal element. The element is of variable length, ranging from 150 to 192 bp, depending on the absence or presence of one or two 21-bp sequences located internally. A putative translational start site of the damage-inducible gene is within the reiterated element. The element contains dyad symmetries that suggest modes of transcriptional and/or translational control.

  12. Fragmentation: Is the message clear?

    USGS Publications Warehouse

    Bissonette, J.A.; Storch, Ilse

    2002-01-01

    In this paper, we briefly discuss some of the fundamental problems arising from the inherent complexity of larger-scale ecological systems. We examine the tenuous assumption of a direct correspondence between ecological data and theory, we comment on a recent report that evaluated the efficacy of fragmentation experiments, and we briefly assess its implications for ecological research and conservation practice on the landscape scale. Copyright ?? 2002 by the author(s). Published here under licence by The Resilience Alliance.

  13. Modeling of Fragmentation of Asteroids

    NASA Technical Reports Server (NTRS)

    Agrawal, Parul; Prabhu, Dinesh K.; Carlozzi, Alexander; Hart, Kenneth; Bryson, Katie; Sears, Derek

    2015-01-01

    The objective of this study is to understand fragmentation and fracture of a given asteroid and mechanisms of break-up. The focus of the present work is to develop modeling techniques for stony asteroids in 10m-100m range to answer two questions: 1) What is the role of material makeup of an asteroid in the stress distribution? 2)How is stress distribution altered in the presence of pre-existing defects?

  14. Chromosome Aberrations by Heavy Ions

    NASA Astrophysics Data System (ADS)

    Ballarini, Francesca; Ottolenghi, Andrea

    It is well known that mammalian cells exposed to ionizing radiation can show different types of chromosome aberrations (CAs) including dicentrics, translocations, rings, deletions and complex exchanges. Chromosome aberrations are a particularly relevant endpoint in radiobiology, because they play a fundamental role in the pathways leading either to cell death, or to cell conversion to malignancy. In particular, reciprocal translocations involving pairs of specific genes are strongly correlated (and probably also causally-related) with specific tumour types; a typical example is the BCR-ABL translocation for Chronic Myeloid Leukaemia. Furthermore, aberrations can be used for applications in biodosimetry and more generally as biomarkers of exposure and risk, that is the case for cancer patients monitored during Carbon-ion therapy and astronauts exposed to space radiation. Indeed hadron therapy and astronauts' exposure to space radiation represent two of the few scenarios where human beings can be exposed to heavy ions. After a brief introduction on the main general features of chromosome aberrations, in this work we will address key aspects of the current knowledge on chromosome aberration induction, both from an experimental and from a theoretical point of view. More specifically, in vitro data will be summarized and discussed, outlining important issues such as the role of interphase death/mitotic delay and that of complex-exchange scoring. Some available in vivo data on cancer patients and astronauts will be also reported, together with possible interpretation problems. Finally, two of the few available models of chromosome aberration induction by ionizing radiation (including heavy ions) will be described and compared, focusing on the different assumptions adopted by the authors and on how these models can deal with heavy ions.

  15. A Plain English Map of the Human Chromosomes.

    ERIC Educational Resources Information Center

    Offner, Susan

    1992-01-01

    Presents a chromosome map for 19 known chromosomes in human genetics. Describes the characteristics attributed to the genetic codes for each of the chromosomes and discusses the teaching applications of the chromosome map. (MDH)

  16. Final report. Human artificial episomal chromosome (HAEC) for building large genomic libraries

    SciTech Connect

    Jean-Michael H. Vos

    1999-12-09

    Collections of human DNA fragments are maintained for research purposes as clones in bacterial host cells. However for unknown reasons, some regions of the human genome appear to be unclonable or unstable in bacteria. Their team has developed a system using episomes (extrachromosomal, autonomously replication DNA) that maintains large DNA fragments in human cells. This human artificial episomal chromosomal (HAEC) system may prove useful for coverage of these especially difficult regions. In the broader biomedical community, the HAEC system also shows promise for use in functional genomics and gene therapy. Recent improvements to the HAEC system and its application to mapping, sequencing, and functionally studying human and mouse DNA are summarized. Mapping and sequencing the human genome and model organisms are only the first steps in determining the function of various genetic units critical for gene regulation, DNA replication, chromatin packaging, chromosomal stability, and chromatid segregation. Such studies will require the ability to transfer and manipulate entire functional units into mammalian cells.

  17. Genomics of Sex and Sex Chromosomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sex chromosomes are distinctive, not only because of their gender determining role, but also for genomic features that reflect their evolutionary history. The genomic sequences in the ancient sex chromosomes of humans and in the incipient sex chromosomes of medaka, stickleback, and papaya exhibit u...

  18. Bimodal Behavior of the Heaviest Fragment Distribution in Projectile Fragmentation

    SciTech Connect

    Bonnet, E.; Borderie, B.; Rivet, M. F.; Dayras, R.; Gagnon-Moisan, F.; Guinet, D.; Lautesse, P.; Parlog, M.; Rosato, E.; Vigilante, M.

    2009-08-14

    The charge distribution of the heaviest fragment detected in the decay of quasiprojectiles produced in intermediate energy heavy-ion collisions has been observed to be bimodal. This feature is expected as a generic signal of phase transition in nonextensive systems. In this Letter, we present new analyses of experimental data from Au on Au collisions at 60, 80, and 100 MeV/nucleon showing that bimodality is largely independent of the data selection procedure and of entrance channel effects. An estimate of the latent heat of the transition is extracted.

  19. Fluorescent in situ hybridization shows DIPLOSPOROUS located on one of the NOR chromosomes in apomictic dandelions (Taraxacum) in the absence of a large hemizygous chromosomal region.

    PubMed

    Vašut, Radim J; Vijverberg, Kitty; van Dijk, Peter J; de Jong, Hans

    2014-11-01

    Apomixis in dandelions (Taraxacum: Asteraceae) is encoded by two unlinked dominant loci and a third yet undefined genetic factor: diplosporous omission of meiosis (DIPLOSPOROUS, DIP), parthenogenetic embryo development (PARTHENOGENESIS, PAR), and autonomous endosperm formation, respectively. In this study, we determined the chromosomal position of the DIP locus in Taraxacum by using fluorescent in situ hybridization (FISH) with bacterial artificial chromosomes (BACs) that genetically map within 1.2-0.2 cM of DIP. The BACs showed dispersed fluorescent signals, except for S4-BAC 83 that displayed strong unique signals as well. Under stringent blocking of repeats by C0t-DNA fragments, only a few fluorescent foci restricted to defined chromosome regions remained, including one on the nucleolus organizer region (NOR) chromosomes that contains the 45S rDNAs. FISH with S4-BAC 83 alone and optimal blocking showed discrete foci in the middle of the long arm of one of the NOR chromosomes only in triploid and tetraploid diplosporous dandelions, while signals in sexual diploids were lacking. This agrees with the genetic model of a single dose, dominant DIP allele, absent in sexuals. The length of the DIP region is estimated to cover a region of 1-10 Mb. FISH in various accessions of Taraxacum and the apomictic sister species Chondrilla juncea, confirmed the chromosomal position of DIP within Taraxacum but not outside the genus. Our results endorse that, compared to other model apomictic species, expressing either diplospory or apospory, the genome of Taraxacum shows a more similar and less diverged chromosome structure at the DIP locus. The different levels of allele sequence divergence at apomeiosis loci may reflect different terms of asexual reproduction. The association of apomeiosis loci with repetitiveness, dispersed repeats, and retrotransposons commonly observed in apomictic species may imply a functional role of these shared features in apomictic reproduction, as is

  20. Fluorescent in situ hybridization shows DIPLOSPOROUS located on one of the NOR chromosomes in apomictic dandelions (Taraxacum) in the absence of a large hemizygous chromosomal region.

    PubMed

    Vašut, Radim J; Vijverberg, Kitty; van Dijk, Peter J; de Jong, Hans

    2014-11-01

    Apomixis in dandelions (Taraxacum: Asteraceae) is encoded by two unlinked dominant loci and a third yet undefined genetic factor: diplosporous omission of meiosis (DIPLOSPOROUS, DIP), parthenogenetic embryo development (PARTHENOGENESIS, PAR), and autonomous endosperm formation, respectively. In this study, we determined the chromosomal position of the DIP locus in Taraxacum by using fluorescent in situ hybridization (FISH) with bacterial artificial chromosomes (BACs) that genetically map within 1.2-0.2 cM of DIP. The BACs showed dispersed fluorescent signals, except for S4-BAC 83 that displayed strong unique signals as well. Under stringent blocking of repeats by C0t-DNA fragments, only a few fluorescent foci restricted to defined chromosome regions remained, including one on the nucleolus organizer region (NOR) chromosomes that contains the 45S rDNAs. FISH with S4-BAC 83 alone and optimal blocking showed discrete foci in the middle of the long arm of one of the NOR chromosomes only in triploid and tetraploid diplosporous dandelions, while signals in sexual diploids were lacking. This agrees with the genetic model of a single dose, dominant DIP allele, absent in sexuals. The length of the DIP region is estimated to cover a region of 1-10 Mb. FISH in various accessions of Taraxacum and the apomictic sister species Chondrilla juncea, confirmed the chromosomal position of DIP within Taraxacum but not outside the genus. Our results endorse that, compared to other model apomictic species, expressing either diplospory or apospory, the genome of Taraxacum shows a more similar and less diverged chromosome structure at the DIP locus. The different levels of allele sequence divergence at apomeiosis loci may reflect different terms of asexual reproduction. The association of apomeiosis loci with repetitiveness, dispersed repeats, and retrotransposons commonly observed in apomictic species may imply a functional role of these shared features in apomictic reproduction, as is

  1. Detection of chromosomal imbalances in transitional cell carcinoma of the bladder by comparative genomic hybridization.

    PubMed Central

    Voorter, C.; Joos, S.; Bringuier, P. P.; Vallinga, M.; Poddighe, P.; Schalken, J.; du Manoir, S.; Ramaekers, F.; Lichter, P.; Hopman, A.

    1995-01-01

    Comparative genomic hybridization (CGH) was applied for a comprehensive screening of chromosomal aberrations in 14 transitional cell carcinomas of the bladder of different grade and stage. The results were compared in a number of selected cases with those obtained by restriction fragment length polymorphism analyses and targeted fluorescence in situ hybridization. Distinct amplifications, found with CGH, were located on 3p22-24, 10p13-14, 12q13-15, 17q22-23, 18p11, and 22q11-13. These high copy number amplifications and the frequency of imbalances involving chromosome 5, occurring in 4 of 14 cases, have not yet been identified in transitional cell carcinomas. Apart from these new aberrations, imbalances were detected in 3 or more cases for chromosomes 9 and 11, as already described previously in the literature. In four tumors, the copy number of specific chromosomal regions was also analyzed by interphase cytogenetics. Although in most instances the CGH data were confirmed, in one tumor, distinct differences were observed, possibly a result of heterogeneity of the tumor cell population. Furthermore, the CGH data were compared with loss of heterozygosity as revealed by restriction fragment length polymorphism analysis in the same tumors. In 80% of informative cases, no loss was detected by restriction fragment length polymorphism or by CGH. Of the 15 cases of loss of heterozygosity, 7 showed a loss also with CGH, whereas in 8 cases no loss was observed. In summary, CGH is a fast method to obtain a comprehensive picture of chromosomal imbalances in transitional cell carcinomas, including a number of previously unknown genomic alterations such as high level amplifications. Images Figure 2 Figure 2 Figure 5 PMID:7778674

  2. Micromanipulation studies of chromosome movement. II. Birefringent chromosomal fibers and the mechanical attachment of chromosomes to the spindle

    PubMed Central

    1979-01-01

    The degree of mechanical coupling of chromosomes to the spindles of Nephrotoma and Trimeratropis primary spermatocytes varies with the stage of meiosis and the birefringent retardation of the chromosomal fibers. In early prometaphase, before birefringent chromosomal fibers have formed, a bivalent can be displaced toward a spindle pole by a single, continuous pull with a microneedle. Resistance to poleward displacement increases with increased development of the chromosomal fibers, reaching a maximum at metaphase. At this stage kinetochores cannot be displaced greater than 1 micrometer toward either spindle pole, even by a force which is sufficient to displace the entire spindle within the cell. The abolition of birefringence with either colcemid or vinblastine results in the loss of chromosome-spindle attachment. In the absence of birefringent fibers a chromosome can be displaced anywhere within the cell. The photochemical inactivation of colcemid by irradiation with 366-nm light results in the reformation of birefringent chromosomal fibers and the concomitant re-establishment of chromosome attachment to the spindle. These results support the hypothesis that the birefringent chromosomal fibers anchor the chromosomes to the spindle and transmit the force for anaphase chromosome movement. PMID:479316

  3. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  4. Generation of a Restriction Fragment Length Polymorphism Linkage Map for Toxoplasma Gondii

    PubMed Central

    Sibley, L. D.; LeBlanc, A. J.; Pfefferkorn, E. R.; Boothroyd, J. C.

    1992-01-01

    We have constructed a genetic linkage map for the parasitic protozoan, Toxoplasma gondii, using randomly selected low copy number DNA markers that define restriction fragment length polymorphisms (RFLPs). The inheritance patterns of 64 RFLP markers and two phenotypic markers were analyzed among 19 recombinant haploid progeny selected from two parallel genetic crosses between PLK and CEP strains. In these first successful interstrain crosses, these RFLP markers segregated into 11 distinct genetic linkage groups that showed close correlation with physical linkage groups previously defined by molecular karyotype. Separate linkage maps, constructed for each of the 11 chromosomes, indicated recombination frequencies range from approximately 100 to 300 kb per centimorgan. Preliminary linkage assignments were made for the loci regulating sinefungin resistance (snf-1) on chromosome IX and adenine arabinoside (ara-1) on chromosome V by linkage to RFLP markers. Despite random segregation of separate chromosomes, the majority of chromosomes failed to demonstrate internal recombination events and in 3/19 recombinant progeny no intramolecular recombination events were detected. The relatively low rate of intrachromosomal recombination predicts that tight linkage for unknown genes can be established with a relatively small set of markers. This genetic linkage map should prove useful in mapping genes that regulate drug resistance and other biological phenotypes in this important opportunistic pathogen. PMID:1360931

  5. Fragmentation of cosmic-string loops

    NASA Technical Reports Server (NTRS)

    York, Thomas

    1989-01-01

    The fragmentation of cosmic string loops is discussed, and the results of a simulation of this process are presented. The simulation can evolve any of a large class of loops essentially exactly, including allowing fragments that collide to join together. Such reconnection enhances the production of small fragments, but not drastically. With or without reconnections, the fragmentation process produces a collection of nonself-intersecting loops whose typical length is on the order of the persistence length of the initial loop.

  6. Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin.

    PubMed

    Matsunaga, Fujihiko; Norais, Cédric; Forterre, Patrick; Myllykallio, Hannu

    2003-02-01

    Although archaeal genomes encode proteins similar to eukaryotic replication factors, the hyperthermophilic archaeon Pyrococcus abyssi replicates its circular chromosome at a high rate from a single origin (oriC) as in Bacteria. In further elucidating the mechanism of archaeal DNA replication, we have studied the elongation step of DNA replication in vivo. We have detected, in two main archaeal phyla, short RNA-primed replication intermediates whose structure and length are very similar to those of eukaryotic Okazaki fragments. Mapping of replication initiation points further showed that discontinuous DNA replication in P. abyssi starts at a well-defined site within the oriC recently identified in this hyperthermophile. Short Okazaki fragments and a high replication speed imply a very efficient turnover of Okazaki fragments in Archaea. Archaea therefore have a unique replication system showing mechanistic similarities to both Bacteria and Eukarya.

  7. Isolation and characterization of matrix associated region DNA fragments in rice (Oryza sativa L.).

    PubMed

    Nomura, K; Saito, W; Ono, K; Moriyama, H; Takahashi, S; Inoue, M; Masuda, K

    1997-09-01

    To investigate the interactions between chromosomal DNA and nuclear matrices in higher plants, matrix associated regions (MARs) of rice (Oryza sativa L.) DNAs were cloned. First, we prepared nuclear matrices from isolated nuclei by digesting them with EcoRI and then extracting with 2 M NaCl. About 6% of the total DNA remained in the nuclear matrices after this digestion and extraction. The residual DNA fragments in the nuclear matrices were cloned. Some of the cloned DNA fragments showed binding to certain nuclear proteins. One of the MAR fragments contained sequences related to known consensus motifs and a hairpin loop structure. A method is presented for isolation of matrix associated region (MAR) DNAs from plant cells.

  8. Microdissection and Chromosome Painting of the Alien Chromosome in an Addition Line of Wheat - Thinopyrum intermedium

    PubMed Central

    Yin, Weibo; Zhang, Yingxin; Chen, Yuhong; Wang, Richard R.-C.; Zhang, Xiangqi; Han, Fangpu; Hu, Zanmin

    2013-01-01

    In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat - Thinopyrumintermedium addition line, and the chromosomes of the three different genomes of Th. Intermedium. The smallest alien chromosome of TAi-27 was microdissected and its DNA amplified by DOP-PCR was used as a probe to hybridize with metaphase chromosomes of TAi-27 and Th. intermedium. Results showed that hybridization signals were observed in all regions of a pair of the smallest alien chromosomes and the pericentromeric area of another pair of alien chromosomes in TAi-27, indicating that the probe from microdissected chromosome is species specific. In Th. intermedium, 14 chromosomes had wide and strong hybridization signals distributed mainly on the pericentromere area and 9 chromosomes with narrow and weak signals on the pericentromere area. The remaining chromosomes displayed a very weak or no signal. Sequential FISH/GISH on Th. intermedium chromosomes using the DNAs of microdissected chromosome, Pseudoroegneriaspicata (St genome) and pDbH12 (a Js genome specific probe) as the probes indicated that the microdissected chromosome belonged to the St genome, three genomes (Js, J and St) in Th. intermedium could be distinguished, in which there is no hybridization signal on J genome that is similar to the genome of Th. bessarabicum. Our results showed that the smallest alien chromosomes may represent a truncated chromosome and the repetitive sequence distribution might be similar in different chromosomes within the St genome. However, the repetitive sequence distributions are different within the Js genome, within a single chromosome, and among different genomes in Th. intermedium. Our results suggested that chromosome painting could be feasible in some plants and useful in detecting chromosome variation and repetitive sequence distribution in different genomes of polyploidy plants, which is helpful for understanding the evolution of different genomes in

  9. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    SciTech Connect

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-09-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence.

  10. Organization of a 117-kb circular mitochondrial chromosome in IR36 rice.

    PubMed

    Narayanan, K K; André, C P; Yang, J; Walbot, V

    1993-03-01

    The organization of the mitochondrial genome in the IR36 indica variety of rice was analyzed using constant-field and CHEF gel electrophoresis. The minimum complexity of the genome is estimated to be 300 kb. There was no evidence for a master circular molecule of this size. The genome exists in vivo in multiple subgenomic circular molecules or mitochondrial chromosomes. Using several rare-cutting restriction enzymes a restriction map was constructed for a 117-kb circular chromosome. Six genetic loci have been placed on this chromosome; cox1 and atp1 have been assigned precise positions while four additional genes (rrn26, cob2, atp6 and rrn18) were mapped to restriction fragments.

  11. Identification of an origin of bidirectional DNA replication in mammalian chromosomes.

    PubMed

    Burhans, W C; Vassilev, L T; Caddle, M S; Heintz, N H; DePamphilis, M L

    1990-09-01

    Mechanistically, an origin of bidirectional DNA replication (OBR) can be defined by the transition from discontinuous to continuous DNA synthesis that must occur on each template strand at the site where replication forks originate. This results from synthesis of Okazaki fragments predominantly on the retrograde arms of forks. We have identified these transitions at a specific site within a 0.45 kb sequence approximately 17 kb downstream from the 3' end of the dihydrofolate reductase gene in Chinese hamster ovary chromosomes. At least 80% of the replication forks in a 27 kb region emanated from this OBR. Thus, initiation of DNA replication in mammalian chromosomes uses the same replication fork mechanism previously described in a variety of prokaryotic and eukaryotic genomes, suggesting that mammalian chromosomes also utilize specific cis-acting sequences as origins of DNA replication.

  12. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  13. Rapid assessment of high-dose radiation exposures through scoring of cell-fusion-induced premature chromosome condensation and ring chromosomes.

    PubMed

    Lamadrid Boada, A I; Romero Aguilera, I; Terzoudi, G I; González Mesa, J E; Pantelias, G; García, O

    2013-09-18

    Analysis of premature chromosome condensation (PCC) mediated by fusion of G0-lymphocytes with mitotic CHO cells in combination with rapid visualization and quantification of rings (PCC-Rf) is proposed as an alternative technique for dose assessment of radiation-exposed individuals. Isolated lymphocytes or whole blood from six individuals were γ-irradiated with 5, 10, 15 and 20Gy at a dose rate of 0.5Gy/min. Following either 8- or 24-h post-exposure incubation of irradiated samples at 37°C, chromosome spreads were prepared by standard PCC cytogenetic procedures. The protocol for PCC fusion proved to be effective at doses as high as 20Gy, enabling the analysis of ring chromosomes and excess PCC fragments. The ring frequencies remained constant during the 8-24-h repair time; the pooled dose relationship between ring frequency (Y) and dose (D) was linear: Y=(0.088±0.005)×D. During the repair time, excess fragments decreased from 0.91 to 0.59 chromatid pieces per Gy, revealing the importance of information about the exact time of exposure for dose assessment on the basis of fragments. Compared with other cytogenetic assays to estimate radiation dose, the PCC-Rf method has the following benefits: a 48-h culture time is not required, allowing a much faster assessment of dose in comparison with conventional scoring of dicentrics and rings in assays for chemically-induced premature chromosome condensation (PCC-Rch), and it allows the analysis of heavily irradiated lymphocytes that are delayed or never reach mitosis, thus avoiding the problem of saturation at high doses. In conclusion, the use of the PCC fusion assay in conjunction with scoring of rings in G0-lymphocytes offers a suitable alternative for fast dose estimation following accidental exposure to high radiation doses.

  14. Isolation, characterization, and regional mapping of microclones from a human chromosome 21 microdissection library

    SciTech Connect

    Yu, J.; Hartz, J.; Yisheng Xu; Gemmill, R.M.; Patterson, D.; Kao, Faten ); Gemmill, R.M.; Patterson, D.; Kao, Fa-Ten ); Korenberg, J.R. )

    1992-08-01

    Thirty-four unique-sequence microclones were isolated from a previously described microdissection library of human chromosome 21 and were regionally mapped using a cell hybrid mapping panel which consists of six cell hybrids and divides chromosome 21 into eight regions. The mapping results showed that the microclones were unevenly distributed along chromosome 21, with the majority of microclones located in the distal half portion of the long arm, between 21q21.3 and 21qter. The number of unique-sequence clones began to decrease significantly from 21q21.2 to centromere and extending to the short arm. This finding is consistent with those reported in other chromosome 21 libraries. Thus, it may be inferred that the proximal portion of the long arm of chromosome 21 contains higher proportions of repetitive sequences, rather than unique sequences of genes. The microclones were also characterized for insert size and were used to identify the corresponding genomic fragments generated by HindIII. In addition, the authors demonstrated that the microclones with short inserts can be efficiently used to identify YAC (yeast artificial chromosome) clones with large inserts, for increased genomic coverage for high-resolution physical mapping. They also used 200 unique-sequence microclones to screen a human liver cDNA library and identified two cDNA clones which were regionally assigned to the 21q21.3-q22.1 region. Thus, generation of unique-sequence microclones from chromosome 21 appears to be useful to isolate and regionally map many cDNA clones, among which will be candidate genes for important diseases on chromosome 21, including Down syndrome, Alzheimer disease, amyotrophic lateral sclerosis, and one form of epilepsy.

  15. A novel method for sex determination by detecting the number of X chromosomes.

    PubMed

    Nakanishi, Hiroaki; Shojo, Hideki; Ohmori, Takeshi; Hara, Masaaki; Takada, Aya; Adachi, Noboru; Saito, Kazuyuki

    2015-01-01

    A novel method for sex determination, based on the detection of the number of X chromosomes, was established. Current methods, based on the detection of the Y chromosome, can directly identify an unknown sample as male, but female gender is determined indirectly, by not detecting the Y chromosome. Thus, a direct determination of female gender is important because the quality (e.g., fragmentation and amelogenin-Y null allele) of the Y chromosome DNA may lead to a false result. Thus, we developed a novel sex determination method by analyzing the number of X chromosomes using a copy number variation (CNV) detection technique (the comparative Ct method). In this study, we designed a primer set using the amelogenin-X gene without the CNV region as the target to determine the X chromosome copy number, to exclude the influence of the CNV region from the comparative Ct value. The number of X chromosomes was determined statistically using the CopyCaller software with real-time PCR. All DNA samples from participants (20 males, 20 females) were evaluated correctly using this method with 1-ng template DNA. A minimum of 0.2-ng template DNA was found to be necessary for accurate sex determination with this method. When using ultraviolet-irradiated template DNA, as mock forensic samples, the sex of the samples could not be determined by short tandem repeat (STR) analysis but was correctly determined using our method. Thus, we successfully developed a method of sex determination based on the number of X chromosomes. Our novel method will be useful in forensic practice for sex determination.

  16. Mapping strategies: Chromosome 16 workshop. Final technical report

    SciTech Connect

    Not Available

    1989-12-31

    The following topics from a workshop on chromosome 16 are briefly discussed: genetic map of chromosome 16; chromosome breakpoint map of chromosome 16; integrated physical/genetic map of chromosome 16; pulsed field map of the 16p13.2--p13.3 region (3 sheets); and a report of the HGM10 chromosome 16 committee.

  17. Y-chromosome polymorphism: Possible largest Y chromosome in man?

    SciTech Connect

    Murthy, D.S.K.; Al-Awadi, S.A.; Bastaki, L.

    1994-09-01

    The role of variations (inversions/deletion or duplication) in the heterochromatin in gonadal development and function, reproductive fitness, and malignant disease has been extensively studied. However, the causal-relationship of large Y (Yqh+) and repeated fetal loss has not been established unequivocally. An Arab couple (?Bedouin origin) with a history of repeated abortions were investigated. Karyotype analysis of the husband showed a very large Y chromosome, confirmed by GTG-, QFQ- and CBG-banding techniques. C-banding showed discontinuous distribution of the heterochromatin blocks separated by pale bands. The origin of the large heterochromatin segment could be due to tandem duplication of the Yq region or translocation (Yq:Yq). No other relatives (males) of the propositus have been available for investigation. Polymorphism of the Y chromosome could be attributed to evolutionary changes from an ancestral type, either by deletion or duplication of the heterochromatin segment. More detailed studies on isolated, aboriginal/tribal human populations will enable us to better understand the significance of the Y chromosome polymorphism.

  18. Systematically fragmented genes in a multipartite mitochondrial genome

    PubMed Central

    Vlcek, Cestmir; Marande, William; Teijeiro, Shona; Lukeš, Julius; Burger, Gertraud

    2011-01-01

    Arguably, the most bizarre mitochondrial DNA (mtDNA) is that of the euglenozoan eukaryote Diplonema papillatum. The genome consists of numerous small circular chromosomes none of which appears to encode a complete gene. For instance, the cox1 coding sequence is spread out over nine different chromosomes in non-overlapping pieces (modules), which are transcribed separately and joined to a contiguous mRNA by trans-splicing. Here, we examine how many genes are encoded by Diplonema mtDNA and whether all are fragmented and their transcripts trans-spliced. Module identification is challenging due to the sequence divergence of Diplonema mitochondrial genes. By employing most sensitive protein profile search algorithms and comparing genomic with cDNA sequence, we recognize a total of 11 typical mitochondrial genes. The 10 protein-coding genes are systematically chopped up into three to 12 modules of 60–350 bp length. The corresponding mRNAs are all trans-spliced. Identification of ribosomal RNAs is most difficult. So far, we only detect the 3′-module of the large subunit ribosomal RNA (rRNA); it does not trans-splice with other pieces. The small subunit rRNA gene remains elusive. Our results open new intriguing questions about the biochemistry and evolution of mitochondrial trans-splicing in Diplonema. PMID:20935050

  19. Novel insights into mitotic chromosome condensation

    PubMed Central

    Piskadlo, Ewa; Oliveira, Raquel A.

    2016-01-01

    The fidelity of mitosis is essential for life, and successful completion of this process relies on drastic changes in chromosome organization at the onset of nuclear division. The mechanisms that govern chromosome compaction at every cell division cycle are still far from full comprehension, yet recent studies provide novel insights into this problem, challenging classical views on mitotic chromosome assembly. Here, we briefly introduce various models for chromosome assembly and known factors involved in the condensation process (e.g. condensin complexes and topoisomerase II). We will then focus on a few selected studies that have recently brought novel insights into the mysterious way chromosomes are condensed during nuclear division. PMID:27508072

  20. Automatic segmentation of overlapping and touching chromosomes

    NASA Astrophysics Data System (ADS)

    Yuan, Zhiqiang; Chen, Xiaohua; Zhang, Renli; Yu, Chang

    2001-09-01

    This paper describes a technique to segment overlapping and touching chromosomes of human metaphase cells. Automated chromosome classification has been an important pattern recognition problem for decades, numerous attempts were made in the past to characterize chromosome band patterns. But successful separation between touching and overlapping chromosomes is vital for correct classification. Since chromosomes are non-rigid objects, common methods for separation between touching chromosomes are not usable. We proposed a method using shape concave and convex information, topology analysis information, and band pale paths for segmentation of touching and overlapping chromosomes. To detect shape concave and convex information, we should first pre-segment the chromosomes and get the edge of overlapping and touching chromosomes. After filtering the original image using edge-preserving filter, we adopt the Otsu's segmentation method and extract the boundary of chromosomes. Hence the boundary can be used for segment the overlapping and touching chromosomes by detecting the concave and convex information based on boundary information. Most of the traditional boundary-based algorithms detect corners based on two steps: the first step is to acquire the smoothed version of curvature at every point along the contour, and the second step is to detect the positions where curvature maximal occur and threshold the curvature as corner points. Recently wavelet transform has been adopted into corner detection algorithms. Since the metaphase overlapping chromosomes has multi-scale corners, we adopt a multi-scale corner detection method based on Hua's method for corner detection. For touching chromosomes, it is convenient to split them using pale paths. Starting from concave corner points, a search algorithm is represented. The searching algorithm traces three pixels into the object in the direction of the normal vector in order to avoid stopping at the initial boundary until it

  1. Automated clinical system for chromosome analysis

    NASA Technical Reports Server (NTRS)

    Castleman, K. R.; Friedan, H. J.; Johnson, E. T.; Rennie, P. A.; Wall, R. J. (Inventor)

    1978-01-01

    An automatic chromosome analysis system is provided wherein a suitably prepared slide with chromosome spreads thereon is placed on the stage of an automated microscope. The automated microscope stage is computer operated to move the slide to enable detection of chromosome spreads on the slide. The X and Y location of each chromosome spread that is detected is stored. The computer measures the chromosomes in a spread, classifies them by group or by type and also prepares a digital karyotype image. The computer system can also prepare a patient report summarizing the result of the analysis and listing suspected abnormalities.

  2. Method for obtaining chromosome painting probes

    DOEpatents

    Lucas, Joe N.

    2000-01-01

    A method is provided for determining a clastogenic signature of a sample of chromosomes by quantifying a frequency of a first type of chromosome aberration present in the sample; quantifying a frequency of a second, different type of chromosome aberration present in the sample; and comparing the frequency of the first type of chromosome aberration to the frequency of the second type of chromosome aberration. A method is also provided for using that clastogenic signature to identify a clastogenic agent or dosage to which the cells were exposed.

  3. Polymer models of chromosome (re)organization

    NASA Astrophysics Data System (ADS)

    Mirny, Leonid

    Chromosome Conformation Capture technique (Hi-C) provides comprehensive information about frequencies of spatial interactions between genomic loci. Inferring 3D organization of chromosomes from these data is a challenging biophysical problem. We develop a top-down approach to biophysical modeling of chromosomes. Starting with a minimal set of biologically motivated interactions we build ensembles of polymer conformations that can reproduce major features observed in Hi-C experiments. I will present our work on modeling organization of human metaphase and interphase chromosomes. Our works suggests that active processes of loop extrusion can be a universal mechanism responsible for formation of domains in interphase and chromosome compaction in metaphase.

  4. Analysis of α-particle-induced chromosomal aberrations by chemically-induced PCC. Elaboration of dose-effect curves.

    PubMed

    Puig, Roser; Pujol, Mònica; Barrios, Leonardo; Caballín, María Rosa; Barquinero, Joan-Francesc

    2016-09-01

    In a similar way to high-dose exposures to low-LET radiations, cells show difficulties reaching mitosis after high-LET radiation exposure. For this reason, techniques have been proposed that are able to analyze chromosome aberrations in interphase by prematurely condensing the chromosomes (PCC-techniques). Few dose-effect curves for high-LET radiation types have been reported, and none for α-particles. The aim of this study was to evaluate, by chemically-induced PCC, the chromosome aberrations induced by several doses of α-particles. Monolayers of peripheral lymphocytes were exposed to an α-source of Americium-241 with a mean energy entering the cells of 2.7 MeV. Lymphocytes were exposed to 10 doses, from 0-2.5 Gy, and then cultured for 48 h. Colcemid and Calyculin-A were added at 24 and 1 h before harvesting, respectively. During microscope analysis, chromosome rings and extra chromosome pieces were scored in G2/M-PCC and M cells, while dicentric chromosomes were only scored in M cells. As the dose increased, fewer cells were able to reach mitosis and the proportion of G2/M-PCC cells increased. Chromosome rings were hardly observed in M cells when compared to G2/M-PCC cells. Extra fragments were more frequent than rings in both G2/M-PCC and M cells, but with lower frequencies than in G2/M-PCC cells. The distribution of dicentrics and extra fragments showed a clear overdispersion; this was not so evident for rings. The dose-effect curves obtained fitted very well to a linear model. Damaged cells after α-particle irradiation show more difficulties in reaching mitosis than cells exposed to γ-rays. After α-particle irradiation the frequency of all the chromosome aberrations considered increased linearly with the dose, and α-particles clearly produced more dicentrics and extra chromosome pieces with respect to γ-rays. After α-particle exposure, the existence of extra chromosome fragments in PCC cells seems to be a good candidate for use as a biomarker

  5. Analysis of α-particle-induced chromosomal aberrations by chemically-induced PCC. Elaboration of dose-effect curves.

    PubMed

    Puig, Roser; Pujol, Mònica; Barrios, Leonardo; Caballín, María Rosa; Barquinero, Joan-Francesc

    2016-09-01

    In a similar way to high-dose exposures to low-LET radiations, cells show difficulties reaching mitosis after high-LET radiation exposure. For this reason, techniques have been proposed that are able to analyze chromosome aberrations in interphase by prematurely condensing the chromosomes (PCC-techniques). Few dose-effect curves for high-LET radiation types have been reported, and none for α-particles. The aim of this study was to evaluate, by chemically-induced PCC, the chromosome aberrations induced by several doses of α-particles. Monolayers of peripheral lymphocytes were exposed to an α-source of Americium-241 with a mean energy entering the cells of 2.7 MeV. Lymphocytes were exposed to 10 doses, from 0-2.5 Gy, and then cultured for 48 h. Colcemid and Calyculin-A were added at 24 and 1 h before harvesting, respectively. During microscope analysis, chromosome rings and extra chromosome pieces were scored in G2/M-PCC and M cells, while dicentric chromosomes were only scored in M cells. As the dose increased, fewer cells were able to reach mitosis and the proportion of G2/M-PCC cells increased. Chromosome rings were hardly observed in M cells when compared to G2/M-PCC cells. Extra fragments were more frequent than rings in both G2/M-PCC and M cells, but with lower frequencies than in G2/M-PCC cells. The distribution of dicentrics and extra fragments showed a clear overdispersion; this was not so evident for rings. The dose-effect curves obtained fitted very well to a linear model. Damaged cells after α-particle irradiation show more difficulties in reaching mitosis than cells exposed to γ-rays. After α-particle irradiation the frequency of all the chromosome aberrations considered increased linearly with the dose, and α-particles clearly produced more dicentrics and extra chromosome pieces with respect to γ-rays. After α-particle exposure, the existence of extra chromosome fragments in PCC cells seems to be a good candidate for use as a biomarker

  6. Chromosome painting of Z and W sex chromosomes in Characidium (Characiformes, Crenuchidae).

    PubMed

    Pazian, Marlon F; Shimabukuro-Dias, Cristiane Kioko; Pansonato-Alves, José Carlos; Oliveira, Claudio; Foresti, Fausto

    2013-03-01

    Some species of the genus Characidium have heteromorphic ZZ/ZW sex chromosomes with a totally heterochromatic W chromosome. Methods for chromosome microdissection associated with chromosome painting have become important tools for cytogenetic studies in Neotropical fish. In Characidium cf. fasciatum, the Z chromosome contains a pericentromeric heterochromatin block, whereas the W chromosome is completely heterochromatic. Therefore, a probe was produced from the W chromosome through microdissection and degenerate oligonucleotide-primed polymerase chain reaction amplification. FISH was performed using the W probe on the chromosomes of specimens of this species. This revealed expressive marks in the pericentromeric region of the Z chromosome as well as a completely painted W chromosome. When applying the same probe on chromosome preparations of C. cf. gomesi and Characidium sp., a pattern similar to C. cf. fasciatum was found, while C. cf. zebra, C. cf. lagosantense and Crenuchus spilurus species showed no hybridization signals. Structural changes in the chromosomes of an ancestral sexual system in the group that includes the species C. cf. gomesi, C. cf. fasciatum and Characidium sp., could have contributed to the process of speciation and could represent a causal mechanism of chromosomal diversification in this group. The heterochromatinization process possibly began in homomorphic and homologous chromosomes of an ancestral form, and this process could have given rise to the current patterns found in the species with sex chromosome heteromorphism.

  7. Fragmentation methods in laser lithotripsy

    NASA Astrophysics Data System (ADS)

    Jiang, Zhi X.; Whitehurst, Colin; King, Terence A.

    1991-07-01

    Following a series of opto-acoustic-mechanical and spectroscopic studies into the basic mechanisms of laser lithotripsy, a plasma-mediated opto-mechanical energy transfer model is presented. Laser energy, first absorbed by the calculi material at the surface and couples into the initiated plasma following ionization of vaporized material, is finally transformed into destructive mechanical energy via a shock wave induced by the impulsive expansion of the resulting plasma. This leads to the fragmentation of the calculi. The laser-plasma energy coupling gives a new definition for the fluence threshold to laser induced breakdown, which agrees with shock wave detection and analysis. A laser pulse shape with initial low intensity and sufficient fluence to vaporize a required amount of target material (lasting a few microsecond(s) ) and terminating in a short, intense pulse of about 1microsecond(s) or less, to couple most of the laser energy into the dense young plasma and so create high pressures, is required to produce optimum effect for laser lithotripsy. An opto-mechanical coupler has been designed which transfers the maximum laser energy into mechanically destructive energy, and successfully fragments various types of urinary and biliary calculi even including those calculi with poor surface absorptance, like pure white cystine. A solid state laser, Ho:YAG (2.1 micrometers wavelength and 150 microsecond(s) pulse width), has also been tested as an alternative to the flashlamp-excited dye laser. The underwater shock wave induced by this laser has been measured and has successfully fragmented calculi with poor absorptance in the visible region.

  8. Impact fragmentation of model flocks

    NASA Astrophysics Data System (ADS)

    Miller, Pearson W.; Ouellette, Nicholas T.

    2014-04-01

    Predicting the bulk material properties of active matter is challenging since these materials are far from equilibrium and standard statistical-mechanics approaches may fail. We report a computational study of the surface properties of a well known active matter system: aggregations of self-propelled particles that are coupled via an orientational interaction and that resemble bird flocks. By simulating the impact of these models flocks on an impermeable surface, we find that they fragment into subflocks with power-law mass distributions, similar to shattering brittle solids but not to splashing liquid drops. Thus, we find that despite the interparticle interactions, these model flocks do not possess an emergent surface tension.

  9. Fragmentation in massive star formation.

    PubMed

    Beuther, Henrik; Schilke, Peter

    2004-02-20

    Studies of evolved massive stars indicate that they form in a clustered mode. During the earliest evolutionary stages, these regions are embedded within their natal cores. Here we present high-spatial-resolution interferometric dust continuum observations disentangling the cluster-like structure of a young massive star-forming region. The derived protocluster mass distribution is consistent with the stellar initial mass function. Thus, fragmentation of the initial massive cores may determine the initial mass function and the masses of the final stars. This implies that stars of all masses can form via accretion processes, and coalescence of intermediate-mass protostars appears not to be necessary.

  10. Fission fragment excited laser system

    DOEpatents

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  11. [The evolution of human Y chromosome].

    PubMed

    Yang, Xianrong; Wang, Meiqin; Li, Shaohua

    2014-09-01

    The human Y chromosome is always intriguing for researchers, because of its role in gender determination and its unusual evolutionary history. The Y chromosome evolves from an autosome, and its evolution has been characterized by massive gene decay. The lack of recombination and protein-coding genes and high content of repetitive sequences have hindered the progress in our understanding of the Y chromosome biology. Recently, with the advances in comparative genomics and sequencing technology, the research on Y chromosome has become a hotspot, with an intensified debate about Y-chromosome final destination resulting from degeneration. This review focuses on the structure, inheritance characteristics, gene content, and the origin and evolution of Y chromosome. We also discuss the long-term destiny of Y chromosome.

  12. Mitosis. Microtubule detyrosination guides chromosomes during mitosis.

    PubMed

    Barisic, Marin; Silva e Sousa, Ricardo; Tripathy, Suvranta K; Magiera, Maria M; Zaytsev, Anatoly V; Pereira, Ana L; Janke, Carsten; Grishchuk, Ekaterina L; Maiato, Helder

    2015-05-15

    Before chromosomes segregate into daughter cells, they align at the mitotic spindle equator, a process known as chromosome congression. Centromere-associated protein E (CENP-E)/Kinesin-7 is a microtubule plus-end-directed kinetochore motor required for congression of pole-proximal chromosomes. Because the plus-ends of many astral microtubules in the spindle point to the cell cortex, it remains unknown how CENP-E guides pole-proximal chromosomes specifically toward the equator. We found that congression of pole-proximal chromosomes depended on specific posttranslational detyrosination of spindle microtubules that point to the equator. In vitro reconstitution experiments demonstrated that CENP-E-dependent transport was strongly enhanced on detyrosinated microtubules. Blocking tubulin tyrosination in cells caused ubiquitous detyrosination of spindle microtubules, and CENP-E transported chromosomes away from spindle poles in random directions. Thus, CENP-E-driven chromosome congression is guided by microtubule detyrosination.

  13. Regulation of chromosome speeds in mitosis

    PubMed Central

    Betterton, M. D.; McIntosh, J. Richard

    2015-01-01

    When chromosome are being separated in preparation for cell division, their motions are slow (~16 nm/s) relative to the speed at which many motor enzymes can move their cellular cargoes (160–1000 nm/s and sometimes even faster) and at which microtubules (MTs) depolymerize (~200 nm/s). Indeed, anaphase chromosome speeds are so slow that viscous drag puts little load on the mechanisms that generate the relevant forces [35]. Available evidence suggests that chromosome speed is due to some form of regulation. For example, big and little chromosomes move at about the same speed, chromosomes that have farther to go move faster than others, and chromosome speed is affected by both temperature and an experimentally applied load. In this essay we review data on these phenomena and present our ideas about likely properties of the mechanisms that regulate chromosome speed. PMID:26405462

  14. Microtubule detyrosination guides chromosomes during mitosis

    PubMed Central

    Barisic, Marin; Silva e Sousa, Ricardo; Tripathy, Suvranta K.; Magiera, Maria M.; Zaytsev, Anatoly V.; Pereira, Ana L.; Janke, Carsten; Grishchuk, Ekaterina L.; Maiato, Helder

    2015-01-01

    Before chromosomes segregate into daughter cells they align at the mitotic spindle equator, a process known as chromosome congression. CENP-E/Kinesin-7 is a microtubule plus-end-directed kinetochore motor required for congression of pole-proximal chromosomes. Because the plus-ends of many astral microtubules in the spindle point to the cell cortex, it remains unknown how CENP-E guides pole-proximal chromosomes specifically towards the equator. Here we found that congression of pole-proximal chromosomes depended on specific post-translational detyrosination of spindle microtubules that point to the equator. In vitro reconstitution experiments demonstrated that CENP-E-dependent transport was strongly enhanced on detyrosinated microtubules. Blocking tubulin tyrosination in cells caused ubiquitous detyrosination of spindle microtubules and CENP-E transported chromosomes away from spindle poles in random directions. Thus, CENP-E-driven chromosome congression is guided by microtubule detyrosination. PMID:25908662

  15. Mitosis. Microtubule detyrosination guides chromosomes during mitosis.

    PubMed

    Barisic, Marin; Silva e Sousa, Ricardo; Tripathy, Suvranta K; Magiera, Maria M; Zaytsev, Anatoly V; Pereira, Ana L; Janke, Carsten; Grishchuk, Ekaterina L; Maiato, Helder

    2015-05-15

    Before chromosomes segregate into daughter cells, they align at the mitotic spindle equator, a process known as chromosome congression. Centromere-associated protein E (CENP-E)/Kinesin-7 is a microtubule plus-end-directed kinetochore motor required for congression of pole-proximal chromosomes. Because the plus-ends of many astral microtubules in the spindle point to the cell cortex, it remains unknown how CENP-E guides pole-proximal chromosomes specifically toward the equator. We found that congression of pole-proximal chromosomes depended on specific posttranslational detyrosination of spindle microtubules that point to the equator. In vitro reconstitution experiments demonstrated that CENP-E-dependent transport was strongly enhanced on detyrosinated microtubules. Blocking tubulin tyrosination in cells caused ubiquitous detyrosination of spindle microtubules, and CENP-E transported chromosomes away from spindle poles in random directions. Thus, CENP-E-driven chromosome congression is guided by microtubule detyrosination. PMID:25908662

  16. [Chromosome abnormalities in human cancer].

    PubMed

    Salamanca-Gómez, F

    1995-01-01

    Recent investigation on the presence of chromosome abnormalities in neoplasias has allowed outstanding advances in the knowledge of malignant transformation mechanisms and important applications in the clinical diagnosis and prognosis of leukaemias, lymphomas and solid tumors. The purpose of the present paper is to discuss the most relevant cytogenetic aberrations, some of them described at the Unidad de Investigación Médica en Genética Humana, Instituto Mexicano del Seguro Social, and to correlate these abnormalities with recent achievements in the knowledge of oncogenes, suppressor genes or antioncogenes, their chromosome localization, and their mutations in human neoplasia; as well as their perspectives in prevention and treatment of cancer that such findings permit to anticipate.

  17. Interphase Chromosome Flow-FISH.

    PubMed

    Keyvanfar, Keyvan; Weed, Jason; Swamy, Prashanth; Kajigaya, Sachiko; Calado, Rodrigo T; Young, Neal S

    2012-10-11

    A 2-day method using flow cytometry and FISH for interphase cells was developed to detect monosomy 7 cells in myelodysplastic syndrome patients. The method, Interphase Chromosome Flow-FISH (IC Flow-FISH), involves fixation of leukocytes from blood, membrane permeabilization, hybridization of cellular DNA with peptide nucleic acid probes with cells intact, and analysis by flow cytometry. Hundreds to thousands of monosomy 7 cells were consistently detected from 10-20 mL of blood in patients with monosomy 7. Proportions of monosomy 7 cells detected in IC Flow-FISH were compared with results from conventional cytogenetics; identification of monosomy 7 populations was verified with FACS; and patient and donor cells were mixed to test for sensitivity. IC Flow-FISH allows for detecting monosomy 7 without requiring bone marrow procurement or the necessity of metaphase spreads, and wider applications to other chromosomal abnormalities are in development. PMID:22932794

  18. International workshop of chromosome 19

    SciTech Connect

    Pericak-Vance, M.A. . Div. of Neurology); Carrano, A.J. )

    1991-09-16

    This document summarizes the workshop on physical and genetic mapping of chromosome 19. The first session discussed the major disease loci found on the chromosome. The second session concentrated on reference families, markers and linkage maps. The third session concentrated on radiation hybrid mapping, somatic cell hybrid panels, macro restriction maps and YACs, followed by cDNA and long range physical maps. The fourth session concentrated on compiling consensus genetic and physical maps as well as discussing regions of conflict. The final session dealt with the LLNL cosmid contig database and comparative mapping of homologous regions of the human and mouse genomes, and ended with a discussion of resource sharing. 18 refs., 2 figs. (MHB)

  19. Microdissection and chromosome painting of the alien chromosome in an addition line of wheat-Thinopyrum intermedium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The chromosome painting is an efficient tool for chromosome research. However, plant chromosome painting is relatively underdeveloped. In this study, chromosome painting was developed and used to identify alien chromosomes in TAi-27, a wheat-Thinopyrum intermedium addition line, and chromosomes of...

  20. Identification of aberrant chromosomes on the basis of morphometry of synaptonemal complexes in the sterile male mouse

    SciTech Connect

    Kalinskaya, E.I.; Chepyzhov, V.V.; Bogdanov, Yu.F.

    1989-01-01

    The results of an investigation of the synaptonemal complexes (SCs) of spermatocytes of sterile males of the house mouse from the progeny of parents subjected to the action of a mutagen are presented in this study. A nonreciprocal translocation was readily identified by the configuration of the SCs. The translocation was observed at pachytene in 100% of cells; at diakinesis-metaphase I, in 58% of cells. A different pattern of association of the X chromosome with the rearrangement region was found in pachytene spermatocytes. Computer analysis of the relative lengths of the synaptonemal complex during the pachytene stage permitted the determination that the translocation took place from the 4th autosome to the 16th. The translocated segment was 66-75% of chromosome 4. In chromosome 16 the point of rupture is close to the distal end, and it was not possible to find the broken-off telomeric fragment of this chromosome in the male under study.

  1. Environmental pollution, chromosomes, and health

    NASA Astrophysics Data System (ADS)

    Bell, Peter M.

    In mid-May, 1980, President Carter declared a state of emergency at the Love Canal area, near Niagara Falls, New York. The reason for this was for the U.S. to underwrite the relocation costs ($3-5 million) of some 2500 residents who, according to a report by the EPA (Environmental Protection Agency) may have suffered damaged chromosomes. These injuries were apparently caused by contact with toxic wastes that had been dumped in the area in the years prior to development for housing.That the toxic compounds exist in the Love Canal and Niagara Falls subsurface zones, including public water supplies, appears to be established fact. That the residents of the Love Canal area suffered chromosomal damage may be established fact as well. Whether or not these two findings can be linked to ill health of the residents is another matter. Recently, the EPA report has been described as having ‘close to zero scientific significance,’ and has been ‘discredited’(Science, 208, 123a, 1980). The reasons for this disparity go beyond differences of opinion, beyond possible inadequacies of the EPA study, and even beyond problems that probably will arise from future studies, including those now in the planning stages. The problem is that even if victims have easily recognizable injuries from toxic substances (injury that apparently has not occurred to Love Canal residents), medical science usually cannot show a causal relationship. Even chromosomal damage is, at best, difficult to interpret. In ideal studies of significant populations and control groups, the association of toxic chemical to chromosome damage and to cancer and birth defects is indirect and, up to now, has been shown to have little or no significance to an individual member of the exposed population.

  2. Ternary fission of nuclei into comparable fragments

    SciTech Connect

    Karpeshin, F. F.

    2015-07-15

    The problem of nuclear fission into three comparable fragments is considered. A mechanism of true ternary fission is proposed. In contrast to sequential fission, where the three fragments arise upon two sequential events of binary fission, the mechanism in question relies on a scenario that originally involves fission into three fragments. This mechanism is driven by a hexadecapole deformation of the fissioning nucleus, in contrast to binary fission associated with quadrupole vibrations of the nuclear surface. The fragment-mass ratios are estimated. The dynamics of formation of collinear fragments and their subsequent motion in opposite directions is traced. The calculated probability of true ternary fission complies with observed values.

  3. Polarization phenomena in projectile fragmentation process

    SciTech Connect

    Matsuta, K.; Ozawa, A.; Nojiri, Y.; Minamisono, T.; Fukuda, M.; Kitagawa, A.; Momota, S.; Ohtsubo, T.; Matsuo, Y.; Takechi, H.; Fukuda, S.; Minami, I.; Sugimoto, K.; Tanihata, I.; Omata, K.; Alonso, J.R.; Krebs, G.F.; Symons, T.J.M.

    1992-03-01

    The nuclear spin polarization of beta-emitting fragments {sup 37}K and {sup 39} Ca has been measured at around the grazing angle of the {sup 40}Ca + Au collision at 106 MeV/u. Momentum dependence of the observed fragment polarization supports the idea that the origin of the polarization is the orbital angular momentum held by the fragment part of the projectile before the collision takes place. The sizable polarization of about 5% that was observed for the fragments will be a powerful tool for NMR study of the fragments.

  4. Ternary fission of nuclei into comparable fragments

    NASA Astrophysics Data System (ADS)

    Karpeshin, F. F.

    2015-07-01

    The problem of nuclear fission into three comparable fragments is considered. A mechanism of true ternary fission is proposed. In contrast to sequential fission, where the three fragments arise upon two sequential events of binary fission, the mechanism in question relies on a scenario that originally involves fission into three fragments. This mechanism is driven by a hexadecapole deformation of the fissioning nucleus, in contrast to binary fission associated with quadrupole vibrations of the nuclear surface. The fragment-mass ratios are estimated. The dynamics of formation of collinear fragments and their subsequent motion in opposite directions is traced. The calculated probability of true ternary fission complies with observed values.

  5. Chromosome segregation and aneuploidy. I

    SciTech Connect

    Vig, B.K.

    1993-12-31

    Of all genetic afflictions of man, aneuploidy ranks as the most prevalent. Among liveborn babies aneuploidy exist to the extent of about 0.3%, to about 0.5% among stillborns and a dramatic 25% among miscarriages. The burden is too heavy to be taken lightly. Whereas cytogeneticists are capable of tracing the origin of the extra or missing chromosome to the contributing parent, it is not certain what factors are responsible for this {open_quote}epidemic{close_quote} affecting the human genome. The matter is complicated by the observation that, to the best of our knowledge, all chromosomes do not malsegregate with equal frequency. Chromosome number 16, for example, is the most prevalent among abortuses - one-third of all aneuploid miscarriages are due to trisomy 16 - yet it never appears in aneuploid constitution among the liveborn. Some chromsomes, number 1, for example, appear only rarely, if at all. In the latter case painstaking efforts have to be made to karyotype very early stages of embryonic development, as early as the 8-cell stage. Even though no convincing data are yet available, it is conceivable that the product of most aneuploid zygotes is lost before implantation.

  6. Fragmentation in filamentary molecular clouds

    NASA Astrophysics Data System (ADS)

    Contreras, Yanett; Garay, Guido; Rathborne, Jill M.; Sanhueza, Patricio

    2016-02-01

    Recent surveys of dust continuum emission at sub-mm wavelengths have shown that filamentary molecular clouds are ubiquitous along the Galactic plane. These structures are inhomogeneous, with overdensities that are sometimes associated with infrared emission and active of star formation. To investigate the connection between filaments and star formation, requires an understanding of the processes that lead to the fragmentation of filaments and a determination of the physical properties of the overdensities (clumps). In this paper, we present a multiwavelength study of five filamentary molecular clouds, containing several clumps in different evolutionary stages of star formation. We analyse the fragmentation of the filaments and derive the physical properties of their clumps. We find that the clumps in all filaments have a characteristic spacing consistent with the prediction of the `sausage' instability theory, regardless of the complex morphology of the filaments or their evolutionary stage. We also find that most clumps have sufficient mass and density to form high-mass stars, supporting the idea that high-mass stars and clusters form within filaments.

  7. Automated glass-fragmentation analysis

    NASA Astrophysics Data System (ADS)

    Gordon, Gaile G.

    1996-02-01

    This paper describes a novel automated inspection process for tempered safety glass. The system is geared toward the European Community (EC) import regulations which are based on fragment count and dimensions in a fractured glass sample. The automation of this test presents two key challenges: image acquisition, and robust particle segmentation. The image acquisition must perform well both for clear and opaque glass. Opaque regions of glass are common in the American auto industry due to painted styling or adhesives (e.g. defroster cables). The system presented uses a multiple light source, reflected light imaging technique, rather than transmitted light imaging which is often used in manual versions of this inspection test. Segmentation of the glass fragments in the resulting images must produce clean and completely connected crack lines in order to compute the correct particle count. Processing must therefore be robust with respect to noise in the imaging process such as dust and glint on the glass. The system presented takes advantage of mathematical morphology algorithms, in particular the watershed algorithm, to perform robust preprocessing and segmentation. Example images and image segmentation results are shown for tempered safety glass which has been painted on the outside edges for styling purposes.

  8. Heavy Ion Fragmentation Experiments at the Bevatron

    NASA Technical Reports Server (NTRS)

    Heckman, H. H.

    1975-01-01

    Fragmentation processes of heavy nuclei in matter using the heavy-ion capability of the Bevatron were studied. The purpose was to obtain the single particle inclusive spectra of secondary nuclei produced at 0 deg by the fragmentation of heavy ion beam projectiles. The process being examined is B+T yields F + anything, where B is the beam nucleus, T is the target nucleus, and F is the detected fragment. The fragments F are isotopically identified by experimental procedures involving magnetic analysis, energy loss and time-of-flight measurements. Attempts were also made to: (1) measure the total and partial production cross section for all isotopes, (2) test the applicability of high-energy multi-particle interaction theory to nuclear fragmentation, (3) apply the cross-section data and fragmentation probabilities to cosmic ray transport theory, and (4) search for systematic behavior of fragment production as a means to improve existing semi-empirical theories of cross sections.

  9. Reframing landscape fragmentation's effects on ecosystem services.

    PubMed

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services.

  10. B chromosomes in Nierembergia aristata (Solanaceae): nucleolar activity and competition with the A chromosomes.

    PubMed

    Acosta, M C; Moscone, E A

    2011-01-01

    B chromosomes are additional dispensable chromosomes that may be present in some individuals, populations, or species, which have probably arisen from the A chromosomes but follow their own evolutionary pathway. Supposedly, B chromosomes do not contain major genes except for ribosomal DNA (rDNA) sequences that have been mapped on the supernumerary chromosomes of many plants and animals. This paper is a new report of B chromosome occurrence in plants. B chromosomes with nucleolar organizing regions (NORs) were found in a diploid sample of Nierembergiaaristata D. Don (sub nom. N. stricta Miers) (2n = 2x = 16). This is an extreme case in which B chromosomes possess not only strong nucleolar activity, as revealed by conventional staining methods, AgNOR and fluorescence banding, and fluorescent in situ hybridization (FISH), but also show nucleolar competition with the A chromosomes. The observed phenomenon could be analogous to the nucleolar dominance or 'differential amphiplasty' phenomenon that occurs in interspecific hybrids.

  11. Single Origin of Sex Chromosomes and Multiple Origins of B Chromosomes in Fish Genus Characidium

    PubMed Central

    Pansonato-Alves, José Carlos; Serrano, Érica Alves; Utsunomia, Ricardo; Camacho, Juan Pedro M.; da Costa Silva, Guilherme José; Vicari, Marcelo Ricardo; Artoni, Roberto Ferreira; Oliveira, Cláudio; Foresti, Fausto

    2014-01-01

    Chromosome painting with DNA probes obtained from supernumerary (B) and sex chromosomes in three species of fish genus Characidium (C. gomesi, C. pterostictum and C. oiticicai) showed a close resemblance in repetitive DNA content between B and sex chromosomes in C. gomesi and C. pterostictum. This suggests an intraspecific origin for B chromosomes in these two species, probably deriving from sex chromosomes. In C. oiticicai, however, a DNA probe obtained from its B chromosome hybridized with the B but not with the A chromosomes, suggesting that the B chromosome in this species could have arisen interspecifically, although this hypothesis needs further investigation. A molecular phylogenetic analysis performed on nine Characidium species, with two mtDNA genes, showed that the presence of heteromorphic sex chromosomes in these species is a derived condition, and that their origin could have been unique, a conclusion also supported by interspecific chromosome painting with a CgW probe derived from the W chromosome in C. gomesi. Summing up, our results indicate that whereas heteromorphic sex chromosomes in the genus Characidium appear to have had a common and unique origin, B chromosomes may have had independent origins in different species. Our results also show that molecular phylogenetic analysis is an excellent complement for cytogenetic studies by unveiling the direction of evolutionary chromosome changes. PMID:25226580

  12. Whole chromosome painting of B chromosomes of the red-eye tetra Moenkhausia sanctaefilomenae (Teleostei, Characidae)

    PubMed Central

    Scudeler, Patricia Elda Sobrinho; Diniz, Débora; Wasko, Adriane Pinto; Oliveira, Claudio; Foresti, Fausto

    2015-01-01

    Abstract B chromosomes are dispensable genomic elements found in different groups of animals and plants. In the present study, a whole chromosome probe was generated from a specific heterochromatic B chromosome occurring in cells of the characidae fish Moenkhausia sanctaefilomenae (Steindachner, 1907). The chromosome painting probes were used in fluorescence in situ hybridization (FISH) experiments for the assessment of metaphase chromosomes obtained from individuals from three populations of Moenkhausia sanctaefilomenae. The results revealed that DNA sequences were shared between a specific B chromosome and many chromosomes of the A complement in all populations analyzed, suggesting a possible intra-specific origin of these B chromosomes. However, no hybridization signals were observed in other B chromosomes found in the same individuals, implying a possible independent origin of B chromosome variants in this species. FISH experiments using 18S rDNA probes revealed the presence of non-active ribosomal genes in some B chromosomes and in some chromosomes of the A complement, suggesting that at least two types of B chromosomes had an independent origin. The role of heterochromatic segments and ribosomal sequences in the origin of B chromosomes were discussed. PMID:26753081

  13. Whole chromosome painting of B chromosomes of the red-eye tetra Moenkhausia sanctaefilomenae (Teleostei, Characidae).

    PubMed

    Scudeler, Patricia Elda Sobrinho; Diniz, Débora; Wasko, Adriane Pinto; Oliveira, Claudio; Foresti, Fausto

    2015-01-01

    B chromosomes are dispensable genomic elements found in different groups of animals and plants. In the present study, a whole chromosome probe was generated from a specific heterochromatic B chromosome occurring in cells of the characidae fish Moenkhausia sanctaefilomenae (Steindachner, 1907). The chromosome painting probes were used in fluorescence in situ hybridization (FISH) experiments for the assessment of metaphase chromosomes obtained from individuals from three populations of Moenkhausia sanctaefilomenae. The results revealed that DNA sequences were shared between a specific B chromosome and many chromosomes of the A complement in all populations analyzed, suggesting a possible intra-specific origin of these B chromosomes. However, no hybridization signals were observed in other B chromosomes found in the same individuals, implying a possible independent origin of B chromosome variants in this species. FISH experiments using 18S rDNA probes revealed the presence of non-active ribosomal genes in some B chromosomes and in some chromosomes of the A complement, suggesting that at least two types of B chromosomes had an independent origin. The role of heterochromatic segments and ribosomal sequences in the origin of B chromosomes were discussed. PMID:26753081

  14. Whole chromosome painting of B chromosomes of the red-eye tetra Moenkhausia sanctaefilomenae (Teleostei, Characidae).

    PubMed

    Scudeler, Patricia Elda Sobrinho; Diniz, Débora; Wasko, Adriane Pinto; Oliveira, Claudio; Foresti, Fausto

    2015-01-01

    B chromosomes are dispensable genomic elements found in different groups of animals and plants. In the present study, a whole chromosome probe was generated from a specific heterochromatic B chromosome occurring in cells of the characidae fish Moenkhausia sanctaefilomenae (Steindachner, 1907). The chromosome painting probes were used in fluorescence in situ hybridization (FISH) experiments for the assessment of metaphase chromosomes obtained from individuals from three populations of Moenkhausia sanctaefilomenae. The results revealed that DNA sequences were shared between a specific B chromosome and many chromosomes of the A complement in all populations analyzed, suggesting a possible intra-specific origin of these B chromosomes. However, no hybridization signals were observed in other B chromosomes found in the same individuals, implying a possible independent origin of B chromosome variants in this species. FISH experiments using 18S rDNA probes revealed the presence of non-active ribosomal genes in some B chromosomes and in some chromosomes of the A complement, suggesting that at least two types of B chromosomes had an independent origin. The role of heterochromatic segments and ribosomal sequences in the origin of B chromosomes were discussed.

  15. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    PubMed

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  16. Micromechanical study of mitotic chromosome structure

    NASA Astrophysics Data System (ADS)

    Marko, John

    2011-03-01

    Our group has developed micromanipulation techniques for study of the highly compacted mitotic form of chromosome found in eukaryote cells during cell division. Each metaphase chromosome contains two duplicate centimeter-long DNA molecules, folded up by proteins into cylindrical structures several microns in length. Native chromosomes display linear and reversible stretching behavior over a wide range of extensions (up to 5x native length for amphibian chromosomes), described by a Young modulus of about 300 Pa. Studies using DNA-cutting and protein-cutting enzymes have revealed that metaphase chromosomes behave as a network of chromatin fibers held together by protein-based isolated crosslinks. Our results are not consistent with the more classical model of loops of chromatin attached to a protein-based structural organizer or ``scaffold". In short, our experiments indicate that metaphase chromosomes can be considered to be ``gels" of chromatin; the stretching modulus of a whole chromosome is consistent with stretching of the chromatin fibers contained within it. Experiments using topoisomerases suggest that topological constraints may play an appreciable role in confining chromatin in the metaphase chromosome. Finally, recent experiments on human chromosomes will be reviewed, including results of experiments where chromosome-folding proteins are specifically depleted using siRNA methods. Supported by NSF-MCB-1022117, DMR-0715099, PHY-0852130, DMR-0520513, NCI 1U54CA143869-01 (NU-PS-OC), and the American Heart Association.

  17. The importance of having two X chromosomes.

    PubMed

    Arnold, Arthur P; Reue, Karen; Eghbali, Mansoureh; Vilain, Eric; Chen, Xuqi; Ghahramani, Negar; Itoh, Yuichiro; Li, Jingyuan; Link, Jenny C; Ngun, Tuck; Williams-Burris, Shayna M

    2016-02-19

    Historically, it was thought that the number of X chromosomes plays little role in causing sex differences in traits. Recently, selected mouse models have been used increasingly to compare mice with the same type of gonad but with one versus two copies of the X chromosome. Study of these models demonstrates that mice with one X chromosome can be strikingly different from those with two X chromosomes, when the differences are not attributable to confounding group differences in gonadal hormones. The number of X chromosomes affects adiposity and metabolic disease, cardiovascular ischaemia/reperfusion injury and behaviour. The effects of X chromosome number are likely the result of inherent differences in expression of X genes that escape inactivation, and are therefore expressed from both X chromosomes in XX mice, resulting in a higher level of expression when two X chromosomes are present. The effects of X chromosome number contribute to sex differences in disease phenotypes, and may explain some features of X chromosome aneuploidies such as in Turner and Klinefelter syndromes.

  18. Chromosomal Aberrations in Normal and AT Cells Exposed to High Dose of Low Dose Rate Irradiation

    NASA Technical Reports Server (NTRS)

    Kawata, T.; Shigematsu, N.; Kawaguchi, O.; Liu, C.; Furusawa, Y.; Hirayama, R.; George, K.; Cucinotta, F.

    2011-01-01

    Ataxia telangiectasia (A-T) is a human autosomally recessive syndrome characterized by cerebellar ataxia, telangiectases, immune dysfunction, and genomic instability, and high rate of cancer incidence. A-T cell lines are abnormally sensitive to agents that induce DNA double strand breaks, including ionizing radiation. The diverse clinical features in individuals affected by A-T and the complex cellular phenotypes are all linked to the functional inactivation of a single gene (AT mutated). It is well known that cells deficient in ATM show increased yields of both simple and complex chromosomal aberrations after high-dose-rate irradiation, but, less is known on how cells respond to low-dose-rate irradiation. It has been shown that AT cells contain a large number of unrejoined breaks after both low-dose-rate irradiation and high-dose-rate irradiation, however sensitivity for chromosomal aberrations at low-dose-rate are less often studied. To study how AT cells respond to low-dose-rate irradiation, we exposed confluent normal and AT fibroblast cells to up to 3 Gy of gamma-irradiation at a dose rate of 0.5 Gy/day and analyzed chromosomal aberrations in G0 using fusion PCC (Premature Chromosomal Condensation) technique. Giemsa staining showed that 1 Gy induces around 0.36 unrejoined fragments per cell in normal cells and around 1.35 fragments in AT cells, whereas 3Gy induces around 0.65 fragments in normal cells and around 3.3 fragments in AT cells. This result indicates that AT cells can rejoin breaks less effectively in G0 phase of the cell cycle? compared to normal cells. We also analyzed chromosomal exchanges in normal and AT cells after exposure to 3 Gy of low-dose-rate rays using a combination of G0 PCC and FISH techniques. Misrejoining was detected in the AT cells only? When cells irradiated with 3 Gy were subcultured and G2 chromosomal aberrations were analyzed using calyculin-A induced PCC technique, the yield of unrejoined breaks decreased in both normal and AT

  19. Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae.

    PubMed Central

    Shirahige, K; Iwasaki, T; Rashid, M B; Ogasawara, N; Yoshikawa, H

    1993-01-01

    We have reported the isolation of linking clones of HindIII and EcoRI fragments, altogether spanning a 230-kb continuous stretch of chromosome VI. The presence or absence of autonomously replicating sequence (ARS) activities in all of these fragments has been determined by using ARS searching vectors containing CEN4. Nine ARS fragments were identified, and their positions were mapped on the chromosome. Structures essential for and/or stimulative to ARS activity were determined for the ARS fragments by deletions and mutations. The organization of functional elements composed of core and stimulative sequences was found to be variable. Single core sequences were identified in eight of nine ARSs. The remaining ARS (ARS603) essential element is composed of two core-like sequences. The lengths of 3'- and 5'-flanking stimulative sequences required for the full activity of ARSs varied from ARS to ARS. Five ARSs required more than 100 bp of the 3'-flanking sequence as stimulative sequences, while not more than 79 bp of the 3' sequence was required by the other three ARSs. In addition, five ARSs had stimulative sequences varying from 127 to 312 bp in the 5'-flanking region of the core sequence. In general, these stimulative activities were correlated with low local delta Gs of unwinding, suggesting that the low local delta G of an ARS is an important element for determining the efficiency of initiation of replication of ARS plasmids. PMID:8336734

  20. Genomic in situ hybridization identifies parental chromosomes in hybrid scallop (Bivalvia, Pectinoida, Pectinidae) between female Chlamys farreri and male Argopecten irradians irradians

    PubMed Central

    Huang, Xiaoting; Bi, Ke; Lu, Wei; Wang, Shi; Zhang, Lingling; Bao, Zhenmin

    2015-01-01

    Abstract Interspecific crossing was artificially carried out between Chlamys farreri (Jones & Preston, 1904) ♀ and Argopecten irradians irradians (Lamarck, 1819) ♂, two of the dominant cultivated scallop species in China. Genomic in situ hybridization (GISH) was used to examine the chromosome constitution and variation in hybrids at early embryonic stage. The number of chromosomes in 66.38% of the metaphases was 2n = 35 and the karyotype was 2n = 3 m + 5 sm + 16 st + 11 t. After GISH, two parental genomes were clearly distinguished in hybrids, most of which comprised 19 chromosomes derived from their female parent (Chlamys farreri) and 16 chromosomes from their male parent (Argopecten irradians irradians). Some chromosome elimination and fragmentation was also observed in the hybrids. PMID:26140161

  1. A large inversion in the linear chromosome of Streptomyces griseus caused by replicative transposition of a new Tn3 family transposon.

    PubMed

    Murata, M; Uchida, T; Yang, Y; Lezhava, A; Kinashi, H

    2011-04-01

    We have comprehensively analyzed the linear chromosomes of Streptomyces griseus mutants constructed and kept in our laboratory. During this study, macrorestriction analysis of AseI and DraI fragments of mutant 402-2 suggested a large chromosomal inversion. The junctions of chromosomal inversion were cloned and sequenced and compared with the corresponding target sequences in the parent strain 2247. Consequently, a transposon-involved mechanism was revealed. Namely, a transposon originally located at the left target site was replicatively transposed to the right target site in an inverted direction, which generated a second copy and at the same time caused a 2.5-Mb chromosomal inversion. The involved transposon named TnSGR was grouped into a new subfamily of the resolvase-encoding Tn3 family transposons based on its gene organization. At the end, terminal diversity of S. griseus chromosomes is discussed by comparing the sequences of strains 2247 and IFO13350.

  2. Transmission of maize chromosome 9 rearrangements in oat-maize radiation hybrids.

    PubMed

    Vales, M Isabel; Riera-Lizarazu, Oscar; Rines, Howard W; Phillips, Ronald L

    2004-12-01

    Oat-maize radiation hybrids are oat (Avena sativa L.) plants carrying radiation-induced subchromosome fragments of a given maize (Zea mays L.) chromosome. Since first-generation radiation hybrids contain various maize chromosome rearrangements in a hemizygous condition, variation might be expected in the transmission of these rearrangements to subsequent generations. The transmission and integrity of maize chromosome 9 rearrangements were evaluated in progenies of 30 oat-maize radiation hybrids by using a series of DNA-based markers and by genomic in situ hybridization. Maize chromosome 9 rearrangements were reisolated by self-fertilization in 24 of the 30 radiation hybrid lineages. Normal and deleted versions of maize chromosome 9 were transmitted at similar frequencies of 9.1% and 7.6%, respectively, while intergenomic translocations were transmitted at a significantly higher frequency of 47.6%. Most lines (93%) that inherited a rearrangement had it in the hemizygous condition. Lines with a rearrangement in the homozygous state (7%) were only identified in lineages with intergenomic translocations. Homozygous lines are more desirable from the perspective of stock maintenance, since they may stably transmit a given rearrangement to a subsequent generation. However, their isolation is not strictly required, since hemizygous lines can also be used for genome mapping studies.

  3. Mouse Y-specific repeats isolated by whole chromosome representational difference analysis

    SciTech Connect

    Navin, A.; Prekeris, R.; Sonti, M.M.

    1996-09-01

    Representational difference analysis (RDA) was used to generate Y-specific probes by enriching for and cloning the differences between the male (XY) and the female (XX) C57BL/6J mouse genomes. Characterization of 35 clones revealed 12 families related by sequence similarity. One clone from each family was chosen for detailed analysis by Southern blot hybridization, polymerase chain reaction (PCR) on normal and aberrant genomes (Sxr), and fluorescence in situ hybridization. From one difference product we have characterized 12 Y-specific probes for hybridization, created seven male-specific PCR assays, mapped all repeat families, and identified one repeat with a distinct XY homology. We report the first cloning of a Y-specific long interspersed repeat element (LINE) fragment. In total, RDA has identified six novel Y Chromosome repeat families and allowed us to extend the characterization of six known Y repeats. We conclude that this novel use of RDA for whole chromosome subtraction successfully enriches chromosome subtraction successfully enriches chromosome-specific sequences and it suitable for the rapid generation of new Y Chromosome-specific probes. 16 refs., 2 figs., 1 tab.

  4. Construction of a general human chromosome jumping library, with application to cystic fibrosis

    SciTech Connect

    Collins, F.S.; Drumm, M.L.; Cole, J.L.; Lockwood, W.K.; Woude, G.F.V.; Iannuzzi, M.C.

    1987-02-27

    In many genetic disorders, the responsible gene and its protein product are unknown. The technique known as reverse genetics, in which chromosomal map positions and genetically linked DNA markers are used to identify and clone such genes, is complicated by the fact that the molecular distances from the closest DNA markers to the gene itself are often too large to traverse by standard cloning techniques. To address this situation, a general human chromosome jumping library was constructed that allows the cloning of DNA sequences approximately 100 kilobases away from any starting point in genomic DNA. As an illustration of its usefulness, this library was searched for a jumping clone, starting at the met oncogene, which is a marker tightly linked to the cystic fibrosis gene that is located on human chromosome 7. Mapping of the new genomic fragment by pulsed field gel electrophoresis confirmed that it resides on chromosome 7 within 240 kilobases downstream of the met gene. The use of chromosome jumping should be applicable to any genetic locus for which a closely linked DNA marker is available.

  5. Direct preparation protocol to obtain mitotic chromosomes from canine mammary tumors.

    PubMed

    Morais, C S D; Affonso, P R A M; Bitencourt, J A; Wenceslau, A A

    2015-12-29

    Currently, mammary neoplasms in female canines are a serious problem in veterinary clinics. In addition, the canine species is an excellent disease model for human oncology because of the biological and genetic similarities between the species. Cytogenetics has allowed further study of the characterization of neoplasms in canines. We hypothesized that the use of a direct preparation protocol for mitotic chromosome analysis would provide a simple and low cost protocol for use in all laboratories. The objective of this method is to display in a few hours of dividing cells just like the time of collection since cell division in tissue can be obtained. Ten female canines with the spontaneous occurrence of mammary neoplasia were used to test a pioneering direct preparation protocol to obtain mitotic chromosomes. The excised breast tumor tissue fragments were subjected to the protocol consisting of treatment with colchicine, treatment with hypotonic solution, and fixation. Mitotic chromosomes were absent in cell suspensions of only two samples among the 10 materials analyzed, based on the analysis of five blades for each preparation obtained. So, the cell suspension obtained allowed for the observation of eight tissue samples viable for cytogenetic analysis, five of which had excellent numbers of mitotic chromosomes. However, the technique was unsuccessful in producing high-quality cell suspensions because of inadequate condensation and scattering of chromosomes. While adjustments to methodological procedures are needed, this protocol represents a low cost and simplified method to study the cytogenetics of canine tumors.

  6. New tools for the study of chromosome segregation and aneuploidy at the molecular level

    SciTech Connect

    Charlieu, J.P.; Marcais, B.; Laurent, A.M.; Roizes, G.

    1993-12-31

    The molecular mechanisms which allow the correct distribution of chromosomes during cell division are not yet well known. The centromere, because of its possible involvement in the attachment of sister chromatids and its participation in the formation of the kinetochore, may play an important role in these mechanisms. Trisomy 21 (down syndrome, DS) provides a good model for studying aneuploidy resulting from the dysfunction of the chromosome distribution process. A possible means of analyzing the mechanisms leading to non-disjunction (NDJ) could be to determine the origin of the supernumerary chromosome 21 and to attempt to find some structural or physical characteristics of the potentially responsible centromere. This could be performed by using molecular tools which allow each of the two parental chromosomes 21 to be distinguished. Possible markers suitable for this purpose are DNA fragments that exhibit length polymorphisms. We present here some examples of such molecular tools, and discuss ways to use them in order to study the parental origin and the meiotic stage of nondisjunction, and we propose an hypothesis suggesting a possible cause of nondisjunction in human chromosomes.

  7. Biodosimetry of ionizing radiation by selective painting of prematurely condensed chromosomes in human lymphocytes

    NASA Technical Reports Server (NTRS)

    Durante, M.; George, K.; Yang, T. C.

    1997-01-01

    Painting of interphase chromosomes can be useful for biodosimetric purposes in particular cases such as radiation therapy, accidental exposure to very high radiation doses and exposure to densely ionizing radiation, for example during space missions. Biodosimetry of charged-particle radiation is analyzed in the present paper. Target cells were human peripheral blood lymphocytes irradiated in vitro with gamma rays, protons and iron ions. After exposure, lymphocytes were incubated for different times to allow repair of radiation-induced damage and then fused to mitotic hamster cells to promote premature condensation in the interphase chromosomes. Chromosome spreads were then hybridized with whole-chromosome DNA probes labeled with fluorescent stains. Dose-response curves for the induction of chromatin fragments shortly after exposure, as well as the kinetics of rejoining and misrejoining, were not markedly dependent on linear energy transfer. However, after exposure to heavy ions, more aberrations were scored in the interphase cells after incubation for repair than in metaphase samples harvested at the first postirradiation mitosis. On the other hand, no significant differences were observed in the two samples after exposure to sparsely ionizing radiation. These results suggest that interphase chromosome painting can be a useful tool for biodosimetry of particle radiation.

  8. High-resolution mapping of YACs and the single-copy gene Hs1(pro-1) on Beta vulgaris chromosomes by multi-colour fluorescence in situ hybridization.

    PubMed

    Desel, C; Jung, C; Cai, D; Kleine, M; Schmidt, T

    2001-01-01

    Fluorescence in situ hybridization (FISH) is a powerful approach for physical mapping of DNA sequences along plant chromosomes. Nematode-resistant sugar beets (Beta vulgaris) carrying a Beta procumbens translocation were investigated by FISH with two differentially labelled YACs originating from the translocation. At mitotic metaphases, the translocation was identified with both YACs in the terminal region on a pair of chromosomes. Meiotic chromosomes, representing a far more extended hybridization target, were used to determine the orientation of YACs with respect to chromosomal domains in combination with chromosomal landmark probes for telomeres and centromeres. The in situ detection of plant single-copy sequences is technically difficult, and the wild beet translocation was used to explore the potential resolution of the FISH approach and to introduce the chromosomal mapping of single-copy genes into genome analysis of Beta species. An internal fragment of the nematode resistance gene Hs1(pro-1), 684 bp long, was detected on both chromatids of different Beta chromosomes and represents one of the shortest unique DNA sequences localized on mitotic plant chromosomes so far. Comparative chromosomal mapping of the 684 bp Hs1(pro-1) probe in the translocation line, a monosomic addition line and in B. procumbens revealed the origin of the wild beet translocation leading to nematode-resistant sugar beets.

  9. Bub3–BubR1-dependent sequestration of Cdc20Fizzy at DNA breaks facilitates the correct segregation of broken chromosomes

    PubMed Central

    Derive, Nicolas; Landmann, Cedric; Montembault, Emilie; Claverie, Marie-Charlotte; Pierre-Elies, Priscillia; Goutte-Gattat, Damien; Founounou, Nabila; McCusker, Derek

    2015-01-01

    The presence of DNA double-strand breaks during mitosis is particularly challenging for the cell, as it produces broken chromosomes lacking a centromere. This situation can cause genomic instability resulting from improper segregation of the broken fragments into daughter cells. We recently uncovered a process by which broken chromosomes are faithfully transmitted via the BubR1-dependent tethering of the two broken chromosome ends. However, the mechanisms underlying BubR1 recruitment and function on broken chromosomes were largely unknown. We show that BubR1 requires interaction with Bub3 to localize on the broken chromosome fragments and to mediate their proper segregation. We also find that Cdc20, a cofactor of the E3 ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C), accumulates on DNA breaks in a BubR1 KEN box–dependent manner. A biosensor for APC/C activity demonstrates a BubR1-dependent local inhibition of APC/C around the segregating broken chromosome. We therefore propose that the Bub3–BubR1 complex on broken DNA inhibits the APC/C locally via the sequestration of Cdc20, thus promoting proper transmission of broken chromosomes. PMID:26553926

  10. Bub3-BubR1-dependent sequestration of Cdc20Fizzy at DNA breaks facilitates the correct segregation of broken chromosomes.

    PubMed

    Derive, Nicolas; Landmann, Cedric; Montembault, Emilie; Claverie, Marie-Charlotte; Pierre-Elies, Priscillia; Goutte-Gattat, Damien; Founounou, Nabila; McCusker, Derek; Royou, Anne

    2015-11-01

    The presence of DNA double-strand breaks during mitosis is particularly challenging for the cell, as it produces broken chromosomes lacking a centromere. This situation can cause genomic instability resulting from improper segregation of the broken fragments into daughter cells. We recently uncovered a process by which broken chromosomes are faithfully transmitted via the BubR1-dependent tethering of the two broken chromosome ends. However, the mechanisms underlying BubR1 recruitment and function on broken chromosomes were largely unknown. We show that BubR1 requires interaction with Bub3 to localize on the broken chromosome fragments and to mediate their proper segregation. We also find that Cdc20, a cofactor of the E3 ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C), accumulates on DNA breaks in a BubR1 KEN box-dependent manner. A biosensor for APC/C activity demonstrates a BubR1-dependent local inhibition of APC/C around the segregating broken chromosome. We therefore propose that the Bub3-BubR1 complex on broken DNA inhibits the APC/C locally via the sequestration of Cdc20, thus promoting proper transmission of broken chromosomes.

  11. Deciphering evolutionary strata on plant sex chromosomes and fungal mating-type chromosomes through compositional segmentation.

    PubMed

    Pandey, Ravi S; Azad, Rajeev K

    2016-03-01

    Sex chromosomes have evolved from a pair of homologous autosomes which differentiated into sex determination systems, such as XY or ZW system, as a consequence of successive recombination suppression between the gametologous chromosomes. Identifying the regions of recombination suppression, namely, the "evolutionary strata", is central to understanding the history and dynamics of sex chromosome evolution. Evolution of sex chromosomes as a consequence of serial recombination suppressions is well-studied for mammals and birds, but not for plants, although 48 dioecious plants have already been reported. Only two plants Silene latifolia and papaya have been studied until now for the presence of evolutionary strata on their X chromosomes, made possible by the sequencing of sex-linked genes on both the X and Y chromosomes, which is a requirement of all current methods that determine stratum structure based on the comparison of gametologous sex chromosomes. To circumvent this limitation and detect strata even if only the sequence of sex chromosome in the homogametic sex (i.e. X or Z chromosome) is available, we have developed an integrated segmentation and clustering method. In application to gene sequences on the papaya X chromosome and protein-coding sequences on the S. latifolia X chromosome, our method could decipher all known evolutionary strata, as reported by previous studies. Our method, after validating on known strata on the papaya and S. latifolia X chromosome, was applied to the chromosome 19 of Populus trichocarpa, an incipient sex chromosome, deciphering two, yet unknown, evolutionary strata. In addition, we applied this approach to the recently sequenced sex chromosome V of the brown alga Ectocarpus sp. that has a haploid sex determination system (UV system) recovering the sex determining and pseudoautosomal regions, and then to the mating-type chromosomes of an anther-smut fungus Microbotryum lychnidis-dioicae predicting five strata in the non

  12. Deciphering evolutionary strata on plant sex chromosomes and fungal mating-type chromosomes through compositional segmentation.

    PubMed

    Pandey, Ravi S; Azad, Rajeev K

    2016-03-01

    Sex chromosomes have evolved from a pair of homologous autosomes which differentiated into sex determination systems, such as XY or ZW system, as a consequence of successive recombination suppression between the gametologous chromosomes. Identifying the regions of recombination suppression, namely, the "evolutionary strata", is central to understanding the history and dynamics of sex chromosome evolution. Evolution of sex chromosomes as a consequence of serial recombination suppressions is well-studied for mammals and birds, but not for plants, although 48 dioecious plants have already been reported. Only two plants Silene latifolia and papaya have been studied until now for the presence of evolutionary strata on their X chromosomes, made possible by the sequencing of sex-linked genes on both the X and Y chromosomes, which is a requirement of all current methods that determine stratum structure based on the comparison of gametologous sex chromosomes. To circumvent this limitation and detect strata even if only the sequence of sex chromosome in the homogametic sex (i.e. X or Z chromosome) is available, we have developed an integrated segmentation and clustering method. In application to gene sequences on the papaya X chromosome and protein-coding sequences on the S. latifolia X chromosome, our method could decipher all known evolutionary strata, as reported by previous studies. Our method, after validating on known strata on the papaya and S. latifolia X chromosome, was applied to the chromosome 19 of Populus trichocarpa, an incipient sex chromosome, deciphering two, yet unknown, evolutionary strata. In addition, we applied this approach to the recently sequenced sex chromosome V of the brown alga Ectocarpus sp. that has a haploid sex determination system (UV system) recovering the sex determining and pseudoautosomal regions, and then to the mating-type chromosomes of an anther-smut fungus Microbotryum lychnidis-dioicae predicting five strata in the non

  13. Scaling Chromosomes for an Evolutionary Karyotype: A Chromosomal Tradeoff between Size and Number across Woody Species

    PubMed Central

    Liang, Guolu; Chen, Hong

    2015-01-01

    This study aims to examine the expected scaling relationships between chromosome size and number across woody species and to clarify the importance of the scaling for the maintenance of chromosome diversity by analyzing the scaling at the inter- & intra-chromosomal level. To achieve for the goals, chromosome trait data were extracted for 191 woody species (including 56 evergreen species and 135 deciduous species) from the available literature. Cross-species analyses revealed a tradeoff among chromosomes between chromosome size and number, demonstrating there is selective mechanism crossing chromosomes among woody species. And the explanations for the result were presented from intra- to inter-chromosome contexts that the scaling may be compromises among scale symmetry, mechanical requirements, and resource allocation across chromosomes. Therein, a 3/4 scaling pattern was observed between total chromosomes and m-chromosomes within nucleus which may imply total chromosomes may evolve from more to less. In addition, the primary evolutionary trend of karyotype and the role of m-chromosomes in the process of karyotype evolution were also discussed. PMID:26657837

  14. Microdissection and chromosome painting of X and B chromosomes in Locusta migratoria.

    PubMed

    Teruel, María; Cabrero, Josefa; Montiel, Eugenia E; Acosta, Manuel J; Sánchez, Antonio; Camacho, Juan Pedro M

    2009-01-01

    Acquisition of knowledge of the nature and DNA content of B chromosomes has been triggered by a collection of molecular techniques, one of which, microdissection, has provided interesting results in a number of B chromosome systems. Here we provide the first data on the molecular composition of B chromosomes in Locusta migratoria, after microdissection of the B and X chromosomes, DNA amplification by one (B) or two (X) different methods, and chromosome painting. The results showed that B chromosomes share at least two types of repetitive DNA sequences with the A chromosomes, suggesting that Bs in this species most likely arose intraspecifically. One of these repetitive DNAs is located on the heterochromatic distal half of the B chromosome and in the pericentromeric regions of about half of the A chromosomes, including the X. The other type of repetitive DNA is located interspersedly over the non-centromeric euchromatic regions of all A chromosomes and in an interstitial part of the proximal euchromatic half of the B chromosome. Chromosome painting, however, did not provide results sufficiently reliable to determine, in this species, which A chromosome gave rise to the B; this might be done by detailed analysis of the microdissected DNA sequences.

  15. [Rearrangement and inference of chromosome structures].

    PubMed

    Gorbunov, K Yu; Gershgorin, R A; Lyubetsky, V A

    2015-01-01

    The chromosome structure is defined as a set of chromosomes that consist of genes assigned to one of the DNA strands and represented in a circular or linear arrangement. A widely investigated problem is to define the shortest algorithmic path of chromosome rearrangements that transforms one chromosome structure into another. When equal rearrangement costs and constant gene content are considered, the solution to the problem is known. In this work, a principally novel approach was developed that presents an exact algorithm with linear time complexity for both equal and unequal costs, in which chromosome structures defined on the same set of genes were considered. In addition, to solve the problem of the inference of ancestral chromosome structures containing different sets of genes when the original structures are fixed in leaves, exact and heuristic algorithms were developed.

  16. Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

    PubMed

    Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

    2014-11-01

    Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute. PMID:24628982

  17. Chromosome-specific physical localisation of expressed sequence tag loci in Corchorus olitorius L.

    PubMed

    Joshi, A; Das, S K; Samanta, P; Paria, P; Sen, S K; Basu, A

    2014-11-01

    Jute (Corchorus spp.), as a natural fibre-producing species, ranks next only to cotton. Inadequate understanding of its genetic architecture is a major lacuna for genetic improvement of this crop in terms of yield and quality. Establishment of a physical map provides a genomic tool that helps in positional cloning of valuable genes. In this report, an attempt was initiated to study association and localisation of single copy expressed sequence tag (EST) loci in the genome of Corchorus olitorius. The chromosome-specific association of EST was determined based on the appearance of an extra signal for a single copy cDNA probe in mitotic interphase nuclei of specific trisomic(s) for fluorescence in situ hybridisation, and validated using a cDNA fragment of the 26S rRNA gene (600 bp) as molecular probe. The probe exhibited three signals in meiotic interphase nuclei of trisomic 5, instead of two as observed in diploids and other trisomics, indicating its association with chromosome 5. Subsequent hybridisation of the same probe on the pachytene chromosomes of diploids confirmed that 26S rRNA occupies the terminal end of the short arm of chromosome 5 in C. olitorius. Subsequently, chromosome-specific association of 63 single copy EST and their physical localisation were determined on chromosomes 2, 4, 5 and 7. The study describes chromosome-specific physical localisation of genes in jute. The approach used here could be a step towards construction of genome-wide physical maps for any recalcitrant plant species like jute.

  18. A FISH approach for mapping the human genome using Bacterial Artificial Chromosomes (BACs)

    SciTech Connect

    Hubert, R.S.; Chen, X.N.; Mitchell, S.

    1994-09-01

    As the Human Genome Project progresses, large insert cloning vectors such as BACs, P1, and P1 Artificial Chromosomes (PACs) will be required to complement the YAC mapping efforts. The value of the BAC vector for physical mapping lies in the stability of the inserts, the lack of chimerism, the length of inserts (up to 300 kb), the ability to obtain large amounts of pure clone DNA and the ease of BAC manipulation. These features helped us design two approaches for generating physical mapping reagents for human genetic studies. The first approach is a whole genome strategy in which randomly selected BACs are mapped, using FISH, to specific chromosomal bands. To date, 700 BACs have been mapped to single chromosome bands at a resolution of 2-5 Mb in addition to BACs mapped to 14 different centromeres. These BACs represent more than 90 Mb of the genome and include >70% of all human chromosome bands at the 350-band level. These data revealed that >97% of the BACs were non-chimeric and have a genomic distribution covering most gaps in the existing YAC map with excellent coverage of gene-rich regions. In the second approach, we used YACs to identify BACs on chromosome 21. A 1.5 Mb contig between D21S339 and D21S220 nears completion within the Down syndrome congenital heart disease (DS-CHD) region. Seventeen BACs ranging in size from 80 kb to 240 kb were ordered using 14 STSs with FISH confirmation. We have also used 40 YACs spanning 21q to identify, on average, >1 BAC/Mb to provide molecular cytogenetic reagents and anchor points for further mapping. The contig generated on chromosome 21 will be helpful in isolating the genes for DS-CHD. The physical mapping reagents generated using the whole genome approach will provide cytogenetic markers and mapped genomic fragments that will facilitate positional cloning efforts and the identification of genes within most chromosomal bands.

  19. Actinophage R4 integrase-based site-specific chromosomal integration of non-replicative closed circular DNA.

    PubMed

    Miura, Takamasa; Nishizawa, Akito; Nishizawa, Tomoyasu; Asayama, Munehiko; Shirai, Makoto

    2016-06-01

    The actinophage R4 integrase (Sre)-based molecular genetic engineering system was developed for the chromosomal integration of multiple genes in Escherichia coli. A cloned DNA fragment containing two attP sites, green fluorescent protein (gfp) as a first transgene, and an antibiotic resistance gene as a selection marker was self-ligated to generate non-replicative closed circular DNA (nrccDNA) for integration. nrccDNA was introduced into attB-inserted E. coli cells harboring the plasmid expressing Sre by electroporation. The expressed Sre catalyzed site-specific integration between one of the two attP sites on nrccDNA and the attB site on the E. coli chromosome. The integration frequency was affected by the chromosomal location of the target site. A second nrccDNA containing two attB sites, lacZα encoding the alpha fragment of β-galactosidase as a transgene, and another antibiotic resistance gene was integrated into the residual attP site on the gfp-integrated E. coli chromosome via one of the two attB sites according to reiterating site-specific recombination. The integrants clearly exhibited β-galactosidase activity and green fluorescence, suggesting the simultaneous expression of multiple recombinant proteins in E. coli. The results of the present study showed that a step-by-step integration procedure using nrccDNA achieved the chromosomal integration of multiple genes. PMID:26870903

  20. Complete DNA sequence of yeast chromosome XI.

    PubMed

    Dujon, B; Alexandraki, D; André, B; Ansorge, W; Baladron, V; Ballesta, J P; Banrevi, A; Bolle, P A; Bolotin-Fukuhara, M; Bossier, P; Bou, G; Boyer, J; Bultrago, M J; Cheret, G; Colleaux, L; Dalgnan-Fornler, B; del Rey, F; Dlon, C; Domdey, H; Düsterhoft, A; Düsterhus, S; Entlan, K D; Erfle, H; Esteban, P F; Feldmann, H; Fernandes, L; Robo, G M; Fritz, C; Fukuhara, H; Gabel, C; Gaillon, L; Carcia-Cantalejo, J M; Garcia-Ramirez, J J; Gent, N E; Ghazvini, M; Goffeau, A; Gonzaléz, A; Grothues, D; Guerreiro, P; Hegemann, J; Hewitt, N; Hilger, F; Hollenberg, C P; Horaitis, O; Indge, K J; Jacquier, A; James, C M; Jauniaux, C; Jimenez, A; Keuchel, H; Kirchrath, L; Kleine, K; Kötter, P; Legrain, P; Liebl, S; Louis, E J; Maia e Silva, A; Marck, C; Monnier, A L; Möstl, D; Müller, S; Obermaier, B; Oliver, S G; Pallier, C; Pascolo, S; Pfeiffer, F; Philippsen, P; Planta, R J; Pohl, F M; Pohl, T M; Pöhlmann, R; Portetelle, D; Purnelle, B; Puzos, V; Ramezani Rad, M; Rasmussen, S W; Remacha, M; Revuelta, J L; Richard, G F; Rieger, M; Rodrigues-Pousada, C; Rose, M; Rupp, T; Santos, M A; Schwager, C; Sensen, C; Skala, J; Soares, H; Sor, F; Stegemann, J; Tettelin, H; Thierry, A; Tzermia, M; Urrestarazu, L A; van Dyck, L; Van Vliet-Reedijk, J C; Valens, M; Vandenbo, M; Vilela, C; Vissers, S; von Wettstein, D; Voss, H; Wiemann, S; Xu, G; Zimmermann, J; Haasemann, M; Becker, I; Mewes, H W

    1994-06-01

    The complete DNA sequence of the yeast Saccharomyces cerevisiae chromosome XI has been determined. In addition to a compact arrangement of potential protein coding sequences, the 666,448-base-pair sequence has revealed general chromosome patterns; in particular, alternating regional variations in average base composition correlate with variations in local gene density along the chromosome. Significant discrepancies with the previously published genetic map demonstrate the need for using independent physical mapping criteria.

  1. Chromosome Conformation Capture in Drosophila.

    PubMed

    Li, Hua-Bing

    2016-01-01

    Linear chromatin fiber is packed inside the nuclei as a complex three-dimensional structure, and the organization of the chromatin has important roles in the appropriate spatial and temporal regulation of gene expression. To understand how chromatin organizes inside nuclei, and how regulatory proteins physically interact with genes, chromosome conformation capture (3C) technique provides a powerful and sensitive tool to detect both short- and long-range DNA-DNA interaction. Here I describe the 3C technique to detect the DNA-DNA interactions mediated by insulator proteins that are closely related to PcG in Drosophila, which is also broadly applicable to other systems. PMID:27659987

  2. Coal char fragmentation during pulverized coal combustion

    SciTech Connect

    Baxter, L.L.

    1995-07-01

    A series of investigations of coal and char fragmentation during pulverized coal combustion is reported for a suite of coals ranging in rank from lignite to low-volatile (lv) bituminous coal under combustion conditions similar to those found in commercial-scale boilers. Experimental measurements are described that utilize identical particle sizing characteristics to determine initial and final size distributions. Mechanistic interpretation of the data suggest that coal fragmentation is an insignificant event and that char fragmentation is controlled by char structure. Chars forming cenospheres fragment more extensively than solid chars. Among the chars that fragment, large particles produce more fine material than small particles. In all cases, coal and char fragmentation are seen to be sufficiently minor as to be relatively insignificant factors influencing fly ash size distribution, particle loading, and char burnout.

  3. Fragmentation statistics from Eulerian hydrocode calculations

    SciTech Connect

    Trucano, T.G.; Grady, D.E.; McGlaun, J.M.

    1989-01-01

    In this paper, we discuss a procedure for computing discrete fragmentation information for terminal ballistics events from the continuum data that emerges from two-dimensional Eulerian hydrocode simulations of these events. The present examples deal with the normal impact of lead cylinders on lead plates at velocities below 1600 m/s. In this regime, the resulting debris is almost exclusively solid lead fragments. We have experimental data of sufficient accuracy to evaluate the extraction of such fragmentation information from code simulations. The problem is interesting because the observed distribution of fragment size would require extreme subgrid resolution in the hydrocode if the statistics were computed directly. Our approach is different. We ask whether or not the general continuum description predicted by the code contains enough information to allow coupling of an analytic fragmentation theory that successfully predicts fragmentation statistics. We believe that this approach is valid, and discuss our current success in matching experimental data. 10 refs., 7 figs., 5 tabs.

  4. Impact failure and fragmentation properties of metals

    SciTech Connect

    Grady, D.E.; Kipp, M.E.

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  5. Chromosome Map of Xanthomonas campestris pv. campestris 17 with Locations of Genes Involved in Xanthan Gum Synthesis and Yellow Pigmentation

    PubMed Central

    Tseng, Yi-Hsiung; Choy, Ka-Tim; Hung, Chih-Hsin; Lin, Nien-Tsung; Liu, Jane-Yu; Lou, Chih-Hong; Yang, Bih-Ying; Wen, Fu-Shyan; Weng, Shu-Fen; Wu, Jung-Rung

    1999-01-01

    No plasmid was detected in Xanthomonas campestris pv. campestris 17, a strain of the causative agent of black rot in cruciferous plants isolated in Taiwan. Its chromosome was cut by PacI, PmeI, and SwaI into five, two, and six fragments, respectively, and a size of 4.8 Mb was estimated by summing the fragment lengths in these digests. Based on the data obtained from partial digestion and Southern hybridization using probes common to pairs of the overlapping fragments or prepared from linking fragments, a circular physical map bearing the PacI, PmeI, and SwaI sites was constructed for the X. campestris pv. campestris 17 chromosome. Locations of eight eps loci involved in exopolysaccharide (xanthan gum) synthesis, two rrn operons each possessing an unique I-CeuI site, one pig cluster required for yellow pigmentation, and nine auxotrophic markers were determined, using mutants isolated by mutagenesis with Tn5(pfm)CmKm. This transposon contains a polylinker with sites for several rare-cutting restriction endonucleases located between the chloramphenicol resistance and kanamycin resistance (Kmr) genes, which upon insertion introduced additional sites into the chromosome. The recA and tdh genes, with known sequences, were mapped by tagging with the polylinker-Kmr segment from Tn5(pfm)CmKm. This is the first map for X. campestris and would be useful for genetic studies of this and related Xanthomonas species. PMID:9864320

  6. New Y chromosomes and early stages of sex chromosome differentiation: sex determination in Megaselia.

    PubMed

    Traut, Walther

    2010-09-01

    The phorid fly Megaselia scalaris is a laboratory model for the turnover and early differentiation of sex chromosomes. Isolates from the field have an XY sex-determining mechanism with chromosome pair 2 acting as X and Y chromosomes. The sex chromosomes are homomorphic but display early signs of sex chromosome differentiation: a low level of molecular differences between X and Y. The male-determining function (M), maps to the distal part of the Y chromosome's short arm. In laboratory cultures, new Y chromosomes with no signs of a molecular differentiation arise at a low rate, probably by transposition of M to these chromosomes. Downstream of the primary signal, the homologue of the Drosophila doublesex (dsx) is part of the sex-determining pathway while Sex-lethal (Sxl), though structurally conserved, is not.

  7. Meiotic Crossing over between Nonhomologous Chromosomes Affects Chromosome Segregation in Yeast

    PubMed Central

    Jinks-Robertson, S.; Sayeed, S.; Murphy, T.

    1997-01-01

    Meiotic recombination between artificial repeats positioned on nonhomologous chromosomes occurs efficiently in the yeast Saccharomyces cerevisiae. Both gene conversion and crossover events have been observed, with crossovers yielding reciprocal translocations. In the current study, 5.5-kb ura3 repeats positioned on chromosomes V and XV were used to examine the effect of ectopic recombination on meiotic chromosome segregation. Ura(+) random spores were selected and gene conversion vs. crossover events were distinguished by Southern blot analysis. Approximately 15% of the crossover events between chromosomes V and XV were associated with missegregation of one of these chromosomes. The missegregation was manifest as hyperploid spores containing either both translocations plus a normal chromosome, or both normal chromosomes plus one of the translocations. In those cases where it could be analyzed, missegregation occurred at the first meiotic division. These data are discussed in terms of a model in which ectopic crossovers compete efficiently with normal allelic crossovers in directing meiotic chromosome segregation. PMID:9136001

  8. Filter for interpretation of fragmentation during entry

    SciTech Connect

    Canavan, G.H.

    1997-10-01

    Objects that fragment cascade and decelerate abruptly, producing short, bright, signatures which can be used to estimate object diameter and speed. Other objects can be incorporated into a generalized fragmentation filter. This note summarizes the results of previous reports on the prediction and inversion of signatures from objects that radiate, ablate, and fragment during entry and uses them to produce models for the parameters of entering objects.

  9. Effects of asymmetry in string fragmentation

    SciTech Connect

    Balazs, N.L. ); Csoergoe, T.; Lukacs, B.; Zimanyi, J. )

    1991-06-01

    The general solution of the one flavor integral equation for string fragmentation is presented and is approximated by a finite sum. The N pion phase space distribution is calculated for the emission points; thence the hadronic fragmentation function, the number density, and the energy density vs. rapidity are obtained. The authors discuss the effects of the left-right asymmetry embedded into the integral equation, and present numerical results based on the Lund fragmentation function.

  10. Complex fragment emission from hot compound nuclei

    SciTech Connect

    Moretto, L.G.

    1986-03-01

    The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs.

  11. Exceptional Complex Chromosomal Rearrangements in Three Generations

    PubMed Central

    Kartapradja, Hannie; Marzuki, Nanis Sacharina; Pertile, Mark D.; Francis, David; Suciati, Lita Putri; Anggaratri, Helena Woro; Ambarwati, Debby Dwi; Idris, Firman Prathama; Lesmana, Harry; Trimarsanto, Hidayat; Paramayuda, Chrysantine; Harahap, Alida Roswita

    2015-01-01

    We report an exceptional complex chromosomal rearrangement (CCR) found in three individuals in a family that involves 4 chromosomes with 5 breakpoints. The CCR was ascertained in a phenotypically abnormal newborn with additional chromosomal material on the short arm of chromosome 4. Maternal karyotyping indicated that the mother carried an apparently balanced CCR involving chromosomes 4, 6, 11, and 18. Maternal transmission of the derivative chromosome 4 resulted in partial trisomy for chromosomes 6q and 18q and a partial monosomy of chromosome 4p in the proband. Further family studies found that the maternal grandmother carried the same apparently balanced CCR as the proband's mother, which was confirmed using the whole chromosome painting (WCP) FISH. High resolution whole genome microarray analysis of DNA from the proband's mother found no evidence for copy number imbalance in the vicinity of the CCR translocation breakpoints, or elsewhere in the genome, providing evidence that the mother's and grandmother's CCRs were balanced at a molecular level. This structural rearrangement can be categorized as an exceptional CCR due to its complexity and is a rare example of an exceptional CCR being transmitted in balanced and/or unbalanced form across three generations. PMID:25722897

  12. Polytene chromosomes: 70 years of genetic research.

    PubMed

    Zhimulev, I F; Belyaeva, E S; Semeshin, V F; Koryakov, D E; Demakov, S A; Demakova, O V; Pokholkova, G V; Andreyeva, E N

    2004-01-01

    Polytene chromosomes were described in 1881 and since 1934 they have served as an outstanding model for a variety of genetic experiments. Using the polytene chromosomes, numerous biological phenomena were discovered. First the polytene chromosomes served as a model of the interphase chromosomes in general. In polytene chromosomes, condensed (bands), decondensed (interbands), genetically active (puffs), and silent (pericentric and intercalary heterochromatin as well as regions subject to position effect variegation) regions were found and their features were described in detail. Analysis of the general organization of replication and transcription at the cytological level has become possible using polytene chromosomes. In studies of sequential puff formation it was found for the first time that the steroid hormone (ecdysone) exerts its action through gene activation, and that the process of gene activation upon ecdysone proceeds as a cascade. Namely on the polytene chromosomes a new phenomenon of cellular stress response (heat shock) was discovered. Subsequently chromatin boundaries (insulators) were discovered to flank the heat shock puffs. Major progress in solving the problems of dosage compensation and position effect variegation phenomena was mainly related to studies on polytene chromosomes. This review summarizes the current status of studies of polytene chromosomes and of various phenomena described using this successful model. PMID:15548421

  13. [A search for a "Genghis Khan chromosome"].

    PubMed

    Zakharov, I A

    2010-09-01

    Zerial et al. (2003) have shown that a special variant of the Y chromosome, characterized by a set of microsatellite markers occurs at high frequency in the number of human populations of Central Asia. This variant was attributed to the descendants of Genghis Khan and its accumulation, to social selection. A search of this Y chromosome variant in Russian populations was conducted. The "Genghis Khan Y chromosome" has been found among Altaians, Altai Kazakhs, Buryats, Kalmyks, Nogaits, and Tuvinians. Its highest frequency (13.8%) was observed in Nogaits. In the examined cases the carriers of the "Genghis Khan Y chromosome" possessed no information on their origin.

  14. Movement of chromosomes with severed kinetochore microtubules.

    PubMed

    Forer, Arthur; Johansen, Kristen M; Johansen, Jørgen

    2015-05-01

    Experiments dating from 1966 and thereafter showed that anaphase chromosomes continued to move poleward after their kinetochore microtubules were severed by ultraviolet microbeam irradiation. These observations were initially met with scepticism as they contradicted the prevailing view that kinetochore fibre microtubules pulled chromosomes to the pole. However, recent experiments using visible light laser microbeam irradiations have corroborated these earlier experiments as anaphase chromosomes again were shown to move poleward after their kinetochore microtubules were severed. Thus, multiple independent studies using different techniques have shown that chromosomes can indeed move poleward without direct microtubule connections to the pole, with only a kinetochore 'stub' of microtubules. An issue not yet settled is: what propels the disconnected chromosome? There are two not necessarily mutually exclusive proposals in the literature: (1) chromosome movement is propelled by the kinetochore stub interacting with non-kinetochore microtubules and (2) chromosome movement is propelled by a spindle matrix acting on the stub. In this review, we summarise the data indicating that chromosomes can move with severed kinetochore microtubules and we discuss proposed mechanisms for chromosome movement with severed kinetochore microtubules. PMID:25576435

  15. Mechanisms of chromosome behaviour during mitosis

    PubMed Central

    Walczak, Claire E.; Cai, Shang; Khodjakov, Alexey

    2010-01-01

    For over a century, scientists have strived to understand the mechanisms that govern the accurate segregation of chromosomes during mitosis. The most intriguing feature of this process, which is particularly prominent in higher eukaryotes, is the complex behaviour exhibited by the chromosomes. This behaviour is based on specific and highly regulated interactions between the chromosomes and spindle microtubules. Recent discoveries, enabled by high-resolution imaging combined with the various genetic, molecular, cell biological and chemical tools, support the idea that establishing and controlling the dynamic interaction between chromosomes and microtubules is a major factor in genomic fidelity. PMID:20068571

  16. Cognitive and medical features of chromosomal aneuploidy.

    PubMed

    Hutaff-Lee, Christa; Cordeiro, Lisa; Tartaglia, Nicole

    2013-01-01

    This chapter describes the physical characteristics, medical complications, and cognitive and psychological profiles that are associated with chromosomal aneuploidy conditions, a group of conditions in which individuals are born with one or more additional chromosome. Overall, chromosomal aneuploidy conditions occur in approximately 1 in 250 children. Information regarding autosomal disorders including trisomy 21 (Down syndrome), trisomy 13 (Patau syndrome), and trisomy 18 (Edward syndrome) are presented. Sex chromosome aneuploidy conditions such as Klinefelter syndrome (47,XXY), XYY, trisomy X, and Turner syndrome (45,X), in addition to less frequently occurring tetrasomy and pentasomy conditions are also covered. Treatment recommendations and suggestions for future research directions are discussed.

  17. Movement of chromosomes with severed kinetochore microtubules.

    PubMed

    Forer, Arthur; Johansen, Kristen M; Johansen, Jørgen

    2015-05-01

    Experiments dating from 1966 and thereafter showed that anaphase chromosomes continued to move poleward after their kinetochore microtubules were severed by ultraviolet microbeam irradiation. These observations were initially met with scepticism as they contradicted the prevailing view that kinetochore fibre microtubules pulled chromosomes to the pole. However, recent experiments using visible light laser microbeam irradiations have corroborated these earlier experiments as anaphase chromosomes again were shown to move poleward after their kinetochore microtubules were severed. Thus, multiple independent studies using different techniques have shown that chromosomes can indeed move poleward without direct microtubule connections to the pole, with only a kinetochore 'stub' of microtubules. An issue not yet settled is: what propels the disconnected chromosome? There are two not necessarily mutually exclusive proposals in the literature: (1) chromosome movement is propelled by the kinetochore stub interacting with non-kinetochore microtubules and (2) chromosome movement is propelled by a spindle matrix acting on the stub. In this review, we summarise the data indicating that chromosomes can move with severed kinetochore microtubules and we discuss proposed mechanisms for chromosome movement with severed kinetochore microtubules.

  18. C-Banding of Plant Chromosomes.

    PubMed

    Jellen, Eric N

    2016-01-01

    C-banding is used to differentially stain metaphase chromosomes in organisms having appreciable amounts of constitutive heterochromatin. Its primary benefits are that it is an inexpensive and a relatively fast method of identifying individual chromosomes and morphological or karyotypic variation, including large chromosomal rearrangements and aneuploidies. We currently employ this technique with considerable effect in genome analysis of oat (Avena sativa) and related grass species, though it has been most extensively used for chromosome analysis of wheat (Triticum aestivum) and its relatives of the Triticeae. PMID:27511162

  19. Chromosome region-specific libraries for human genome analysis

    SciTech Connect

    Kao, Fa-Ten.

    1991-01-01

    We have made important progress since the beginning of the current grant year. We have further developed the microdissection and PCR- assisted microcloning techniques using the linker-adaptor method. We have critically evaluated the microdissection libraries constructed by this microtechnology and proved that they are of high quality. We further demonstrated that these microdissection clones are useful in identifying corresponding YAC clones for a thousand-fold expansion of the genomic coverage and for contig construction. We are also improving the technique of cloning the dissected fragments in test tube by the TDT method. We are applying both of these PCR cloning technique to human chromosomes 2 and 5 to construct region-specific libraries for physical mapping purposes of LLNL and LANL. Finally, we are exploring efficient procedures to use unique sequence microclones to isolate cDNA clones from defined chromosomal regions as valuable resources for identifying expressed gene sequences in the human genome. We believe that we are making important progress under the auspices of this DOE human genome program grant and we will continue to make significant contributions in the coming year. 4 refs., 4 figs.

  20. Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ

    DOEpatents

    Gray, J.W.; Weier, H.U.

    1998-11-24

    A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.

  1. Y chromosome specific nucleic acid probe and method for identifying the Y chromosome in SITU

    DOEpatents

    Gray, Joe W.; Weier, Heinz-Ulrich

    1999-01-01

    A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.

  2. Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ

    DOEpatents

    Gray, Joe W.; Weier, Heinz-Ulrich

    1998-01-01

    A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.

  3. Y chromosome specific nucleic acid probe and method for identifying the Y chromosome in SITU

    DOEpatents

    Gray, J.W.; Weier, H.U.

    1999-03-30

    A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences. 9 figs.

  4. Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ

    DOEpatents

    Gray, Joe W.; Weier, Heinz-Ulrich

    2001-01-01

    A method for producing a Y chromosome specific probe selected from highly repeating sequences on that chromosome is described. There is little or no nonspecific binding to autosomal and X chromosomes, and a very large signal is provided. Inventive primers allowing the use of PCR for both sample amplification and probe production are described, as is their use in producing large DNA chromosome painting sequences.

  5. Saturation transfer difference NMR for fragment screening.

    PubMed

    Begley, Darren W; Moen, Spencer O; Pierce, Phillip G; Zartler, Edward R

    2013-01-01

    Fragment screening by saturation transfer difference nuclear magnetic resonance (STD-NMR) is a robust method for identifying small molecule binders and is well suited to a broad set of biological targets. STD-NMR is exquisitely sensitive for detecting weakly binding compounds (a common characteristic of fragments), which is a crucial step in finding promising compounds for a fragment-based drug discovery campaign. This protocol describes the development of a library suitable for STD-NMR fragment screening, as well as preparation of protein samples, optimization of experimental conditions, and procedures for data collection and analysis. PMID:24391096

  6. The mechanisms of stone fragmentation in ESWL.

    PubMed

    Eisenmenger, W

    2001-05-01

    Currently, several mechanisms of kidney stone fragmentation in extracorporal shockwave lithotripsy (ESWL) are under discussion. As a new mechanism, the circumferential quasistatic compression or "squeezing" by evanescent waves in the stone has been introduced. In fragmentation experiments with self-focussing electromagnetic shock-wave generators with focal diameters comparable to or larger than the stone diameter, we observed first cleavage surfaces either parallel or perpendicular to the wave propagation direction. This is in agreement with the expectation of the "squeezing" mechanism. Because, for positive pulse pressures below 35 MPa and stones with radii of 15 mm or smaller, cleavage into only two fragments was observed, we developed a quantitative model of binary fragmentation by "quasistatic squeezing." This model predicts the ratio of the number of pulses for the fragmentation to 2-mm size and of the number of pulses required for the first cleavage into two parts. This "fragmentation-ratio" depends linearly alone on the stone radius and on the final size of the fragments. The experimental results for spherical artificial stones of 5 mm, 12 mm and 15 mm diameter at a pulse pressure of 11 MPa are in good agreement with the theoretical prediction. Thus, binary fragmentation by quasistatic squeezing in ESWL as a new efficient fragmentation mechanism is also quantitatively verified.

  7. The dihadron fragmentation function and its evolution

    SciTech Connect

    Majumder, Abhijit; Wang, Xin-Nian

    2004-02-24

    Dihadron fragmentation functions and their evolution arestudied in the process of e+e- annihilation. Under the collinearfactorization approximation and facilitated by the cut-vertex technique,the two hadron inclusive cross section at leading order (LO) is shown tofactorize into a short distance parton cross section and a long distancedihadron fragmentation function. We provide the definition of such adihadron fragmentation function in terms of parton matrix elements andderive its DGLAP evolution equation at leading log. The evolutionequation for the non-singlet quark fragmentation function is solvednumerically with a simple ansatz for the initial condition and resultsare presented for cases of physical interest.

  8. Electron-impact-induced tryptophan molecule fragmentation

    NASA Astrophysics Data System (ADS)

    Tamuliene, Jelena; Romanova, Liudmila G.; Vukstich, Vasyl S.; Papp, Alexander V.; Snegursky, Alexander V.

    2015-01-01

    The fragmentation of a gas-phase tryptophan molecule by a low-energy (<70 eV) electron impact was studied both experimentally and theoretically. Various positively charged fragments were observed and analyzed. A special attention was paid to the energy characteristics of the ionic fragment yield. The geometrical parameters of the initial molecule rearrangement were also analyzed. The fragmentation observed was due to either a simple bond cleavage or more complex reactions involving molecular rearrangements. Contribution to the Topical Issue "Elementary Processes with Atoms and Molecules in Isolated and Aggregated States", edited by Friedrich Aumayr, Bratislav Marinkovic, Stefan Matejcik, John Tanis and Kurt H. Becker.

  9. Fragment-Based Screen against HIV Protease

    PubMed Central

    Perryman, A. L.; Zhang, Q.; Soutter, H. H.; Rosenfeld, R.; McRee, D. E.; Olson, A. J.; Elder, J. E.; Stout, C. D.

    2009-01-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 Å resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the ‘exo site’ adjacent to the Gly16Gly17Gln18 loop where the amide of Gly17 is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys14 and Leu63. Another fragment, indole-6-carboxylic acid, binds on the ‘outside/top of the flap’ via hydrophobic contacts with Trp42, Pro44, Met46, and Lys55, a hydrogen bond with Val56, and a salt-bridge with Arg57. 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target. PMID:20659109

  10. Fragment-based screen against HIV protease.

    PubMed

    Perryman, Alexander L; Zhang, Qing; Soutter, Holly H; Rosenfeld, Robin; McRee, Duncan E; Olson, Arthur J; Elder, John E; Stout, C David

    2010-03-01

    We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 A resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the 'exo site' adjacent to the Gly(16)Gly(17)Gln(18)loop where the amide of Gly(17)is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys(14)and Leu(63). Another fragment, indole-6-carboxylic acid, binds on the 'outside/top of the flap' via hydrophobic contacts with Trp(42), Pro(44), Met(46), and Lys(55), a hydrogen bond with Val(56), and a salt-bridge with Arg(57). 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target.

  11. Chromosomal instability determines taxane response

    PubMed Central

    Swanton, Charles; Nicke, Barbara; Schuett, Marion; Eklund, Aron C.; Ng, Charlotte; Li, Qiyuan; Hardcastle, Thomas; Lee, Alvin; Roy, Rajat; East, Philip; Kschischo, Maik; Endesfelder, David; Wylie, Paul; Kim, Se Nyun; Chen, Jie-Guang; Howell, Michael; Ried, Thomas; Habermann, Jens K.; Auer, Gert; Brenton, James D.; Szallasi, Zoltan; Downward, Julian

    2009-01-01

    Microtubule-stabilizing (MTS) agents, such as taxanes, are important chemotherapeutics with a poorly understood mechanism of action. We identified a set of genes repressed in multiple cell lines in response to MTS agents and observed that these genes are overexpressed in tumors exhibiting chromosomal instability (CIN). Silencing 22/50 of these genes, many of which are involved in DNA repair, caused cancer cell death, suggesting that these genes are involved in the survival of aneuploid cells. Overexpression of these “CIN-survival” genes is associated with poor outcome in estrogen receptor–positive breast cancer and occurs frequently in basal-like and Her2-positive cases. In diploid cells, but not in chromosomally unstable cells, paclitaxel causes repression of CIN-survival genes, followed by cell death. In the OV01 ovarian cancer clinical trial, a high level of CIN was associated with taxane resistance but carboplatin sensitivity, indicating that CIN may determine MTS response in vivo. Thus, pretherapeutic assessment of CIN may optimize treatment stratification and clinical trial design using these agents. PMID:19458043

  12. Chromosomal instability determines taxane response.

    PubMed

    Swanton, Charles; Nicke, Barbara; Schuett, Marion; Eklund, Aron C; Ng, Charlotte; Li, Qiyuan; Hardcastle, Thomas; Lee, Alvin; Roy, Rajat; East, Philip; Kschischo, Maik; Endesfelder, David; Wylie, Paul; Kim, Se Nyun; Chen, Jie-Guang; Howell, Michael; Ried, Thomas; Habermann, Jens K; Auer, Gert; Brenton, James D; Szallasi, Zoltan; Downward, Julian

    2009-05-26

    Microtubule-stabilizing (MTS) agents, such as taxanes, are important chemotherapeutics with a poorly understood mechanism of action. We identified a set of genes repressed in multiple cell lines in response to MTS agents and observed that these genes are overexpressed in tumors exhibiting chromosomal instability (CIN). Silencing 22/50 of these genes, many of which are involved in DNA repair, caused cancer cell death, suggesting that these genes are involved in the survival of aneuploid cells. Overexpression of these "CIN-survival" genes is associated with poor outcome in estrogen receptor-positive breast cancer and occurs frequently in basal-like and Her2-positive cases. In diploid cells, but not in chromosomally unstable cells, paclitaxel causes repression of CIN-survival genes, followed by cell death. In the OV01 ovarian cancer clinical trial, a high level of CIN was associated with taxane resistance but carboplatin sensitivity, indicating that CIN may determine MTS response in vivo. Thus, pretherapeutic assessment of CIN may optimize treatment stratification and clinical trial design using these agents. PMID:19458043

  13. Chromosomal replicons of higher plants

    SciTech Connect

    Van't Hof, J.

    1987-03-16

    This brief discussion of replicons of higher plants offers a glimpse into the properties of chromosomal DNA replication. It gives evidence that the S phase of unrelated plant species is comprised of temporally ordered replicon families that increase in number with genome size. This orderly process, which assures a normal inheritance of genetic material to recipient daughter cells, is maintained at the level of replicon clusters by two mutually exclusive mechanisms, one involving the rate at which single replicons replicate their allotment of DNA, and another by means of the tempo-pause. The same two mechanisms are used by cells to alter the pattern of chromosomal DNA replication just prior to and during normal development. Both mechanisms are genetically determined and produce genetic effects when disturbed of disrupted by additional non-conforming DNAs. Further insight into how these two mechanisms operate requires more molecular information about the nature of replicons and the factors that govern when a replicon family replicates. Plant material is a rich and ideal source for this information just awaiting exploitation. 63 refs.

  14. The X chromosome of monotremes shares a highly conserved region with the eutherian and marsupial X chromosomes despite the absence of X chromosome inactivation

    SciTech Connect

    Watson, J.M.; Spencer, J.A.; Graves, J.A.M. ); Riggs, A.D. )

    1990-09-01

    Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. The authors conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which is G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.

  15. The X chromosome of monotremes shares a highly conserved region with the eutherian and marsupial X chromosomes despite the absence of X chromosome inactivation.

    PubMed

    Watson, J M; Spencer, J A; Riggs, A D; Graves, J A

    1990-09-01

    Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. We conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which is G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.

  16. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900) (Hemiptera: Reduviidae: Hammacerinae)

    PubMed Central

    Poggio, María Georgina; Bressa, María José; Papeschi, Alba Graciela

    2011-01-01

    Abstract In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900) by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y), including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in Microtomus conspicillaris (Drury, 1782) (2n=28+XY). However, Microtomus lunifer has a multiple sex chromosome system X1X2Y (male) that could have originated by fragmentation of the ancestral X chromosome. Taking into account that Microtomus conspicillaris and Microtomus lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in Microtomus lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity. PMID:24260616

  17. The role of thermodynamics in disc fragmentation

    NASA Astrophysics Data System (ADS)

    Stamatellos, Dimitris; Whitworth, Anthony P.

    2009-12-01

    Thermodynamics play an important role in determining the way a protostellar disc fragments to form planets, brown dwarfs and low-mass stars. We explore the effect that different treatments of radiative transfer have in simulations of fragmenting discs. Three prescriptions for the radiative transfer are used: (i) the diffusion approximation of Stamatellos et al.; (ii) the barotropic equation of state (EOS) of Goodwin et al. and (iii) the barotropic EOS of Bate et al. The barotropic approximations capture the general evolution of the density and temperature at the centre of each proto-fragment but (i) they do not make any adjustments for particular circumstances of a proto-fragment forming in the disc and (ii) they do not take into account thermal inertia effects that are important for fast-forming proto-fragments in the outer disc region. As a result, the number of fragments formed in the disc and their properties are different, when a barotropic EOS is used. This is important not only for disc studies but also for simulations of collapsing turbulent clouds, as in many cases in such simulations stars form with discs that subsequently fragment. We also examine the difference in the way proto-fragments condense out in the disc at different distances from the central star using the diffusion approximation and following the collapse of each proto-fragment until the formation of the second core (ρ ~= 10-3gcm-3). We find that proto-fragments forming closer to the central star tend to form earlier and evolve faster from the first to the second core than proto-fragments forming in the outer disc region. The former have a large pool of material in the inner disc region that they can accrete from and grow in mass. The latter accrete more slowly and they are hotter because they generally form in a quick abrupt event.

  18. Sequence, genomic structure, and chromosomal assignment of human DOC-2

    SciTech Connect

    Albertsen, H.M.; Williams, B.; Smith, S.A.

    1996-04-15

    DOC-2 is a human gene originally identified as a 767-bp cDNA fragment isolated from normal ovarian epithelial cells by differential display against ovarian carcinoma cells. We have now determined the complete cDNA sequence of the 3.2-kb DOC-2 transcript and localized the gene to chromosome 5. A 12.5-kb genomic fragment at the 5{prime}-end of DOC-2 has also been sequenced, revealing the intron-exon structure of the first eight exons (788 bases) of the DOC-2 gene. Translation of the DOC-2 cDNA predicts a hydrophobic protein of 770 amino acid residues with a molecular weight of 82.5 kDa. Comparison of the DNA and amino acid sequences of DOC-2 to publicly accessible sequence data-bases revealed 83% identity to p96, a murine-responsive phosphoprotein. In addition, about 45% identity was observed between the first 140 N-terminal residues of DOC-2 and the Caenorhabditas elegans M110.5 and Drosophila melanoaster Dab genes. 14 refs., 3 figs.

  19. Chromosomal Allocation of DNA Sequences in Wheat Using Flow-Sorted Chromosomes.

    PubMed

    Cápal, Petr; Vrána, Jan; Kubaláková, Marie; Endo, Takashi R; Doležel, Jaroslav

    2016-01-01

    Flow cytometry enables chromosomes to be sorted into different groups based on their characteristics, such as relative DNA content and the presence of repetitive DNA sequences. Despite the recent progress in the analysis of plant genome organization and chromosome structure, there is a need for easy methods to assign DNA sequences to individual chromosomes. Here, we describe an easy way to allocate genes or DNA sequences to chromosomes in wheat using flow-sorted chromosomes combined with fluorescence in situ hybridization and PCR analyses. PMID:27557693

  20. Baculovirus display of functional antibody Fab fragments.

    PubMed

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.