Sample records for acetabular cup positioning

  1. The Divergence of Wear Propagation and Stress at Steep Acetabular Cup Positions Using Ceramic Heads and Sequentially Cross-Linked Polyethylene Liners.


    Zietz, Carmen; Fabry, Christian; Baum, Felix; Bader, Rainer; Kluess, Daniel


    The aim of the present wear simulator study was to assess the effect of steep acetabular cup positions on the wear propagation of highly cross-linked-PE (HX-PE) liners. Furthermore, a finite element analysis (FEA) was performed in order to calculate the stress within the HX-PE material in case of steep cup positions under physiological loadings. The higher stress in the HX-PE at a steep acetabular cup position did not result in increased wear in the present wear simulator study. The gravimetrical wear rates at normal (45°) and steep cup inclinations (75°) showed wear amounts of 3.15±0.27mg and 2.18±0.31mg per million cycles (p=0.028), respectively. However, FEA revealed clear increase in stress at the HX-PE liners with respect to steep cup positions.

  2. Does Robotic-Assisted Computer Navigation Affect Acetabular Cup Positioning in Total Hip Arthroplasty in the Obese Patient? A Comparison Study.


    Gupta, Asheesh; Redmond, John M; Hammarstedt, Jon E; Petrakos, Alexandra E; Vemula, S Pavan; Domb, Benjamin G


    Obese populations present challenges for acetabular cup placement during total hip arthroplasty (THA). This study examines the accuracy of acetabular cup inclination and version in the obese patient with robotic-assisted computer navigation. A total of 105 patients underwent robotic-assisted computer navigation THA with a posterior approach. Groups were divided on body mass index (BMI, kg/m(2)) of <30, 30-35, and >35. There was no statistical difference between the BMI <30 (n=59), BMI 30-35 (n=34) and BMI >35 (n=12) groups for acetabular inclination (P=0.43) or version (P=0.95). Robotic-assisted computer navigation provided accurate and reproducible placement of the acetabular cup within safe zones for inclination and version in the obese patient.

  3. Improving acetabular cup orientation in total hip arthroplasty by using smartphone technology.


    Peters, Frank M; Greeff, Richard; Goldstein, Neal; Frey, Chris T


    Acetabular cup placement in total hip arthroplasty is often difficult to assess, especially in the lateral position and using the posterior approach. Conventional techniques and computer-assisted surgery are the 2 most popular methods for proper placement of the acetabular cup in Lewinnek's safe zone of orientation (anteversion 15° ± 10° and lateral inclination 40° ± 10°). We developed a system that uses the accelerometer and camera function of the iPhone. A level indicator application and protractor application were downloaded to the iPhone and used to improve acetabular cup placement. This system has proven to be accurate and quick. Our series of 50 prospective cases showed good results with all our acetabular cups being placed within a narrow range in the safe zone and with less than 5% difference between the preoperative, intraoperative, and postoperative acetabular inclinations. PMID:22245126

  4. Photoelastic analysis of stresses produced by different acetabular cups.


    Ries, M D; Salehi, A; Shea, J


    Porous-coated acetabular components can provide long-term biologic fixation to bone. However, the periacetabular stress patterns and mechanisms by which different types of cementless acetabular cups obtain initial stability is not clear. In the current study, periacetabular stresses produced by different cementless acetabular cup geometries were quantitated using a three-dimensional photoelastic model. The cup geometries consisted of trispiked, finned, hemispherical, and nonhemispherical (wider than a hemisphere at the periphery) geometries. The cup models were loaded incrementally in the photoelastic material to simulate periacetabular stress distributions at the time of implantation during surgery rather than under physiologic weightbearing loads. The peripheral stress distributions and their magnitudes induced by the trispiked and oversized hemispherical cups were similar, but the trispiked cup induced localized high stress regions where the spikes penetrate the bone model. The fins separated the periacetabular material into quadrants, which was associated with decreased peripheral stresses. A nonhemispherical geometry with a wider diameter at the rim than a hemisphere increased peripheral stresses more than an oversized hemispherical geometry and required less force to seat the implant. Although various cementless acetabular cups can perform well clinically, they produce different periacetabular stresses and appear to obtain initial fixation by different mechanisms. PMID:10611871

  5. Comparison of flanged and unflanged acetabular cup design

    PubMed Central


    Background and purpose Adequate depth of cement penetration and cement mantle thickness is important for the durability of cemented cups. A flanged cup, as opposed to unflanged, has been suggested to give a more uniform cement mantle and superior cement pressurization, thus improving the depth of cement penetration. This hypothesis was tested experimentally. Materials and methods The same cup design with and without flange (both without cement spacers) was investigated regarding intraacetabular pressure, cement mantle thickness, and depth of cement penetration. With machine control, the cups were inserted into open-pore ceramic acetabular models (10 flanged, 10 unflanged) and into paired cadaver acetabuli (10 flanged, 10 unflanged) with prior pressurization of the cement. Results No differences in intraacetabular pressures during cup insertion were found, but unflanged cups tended to migrate more towards the acetabular pole. Flanged cups resulted in thicker cement mantles because of less bottoming out, whereas no differences in cement penetration into the bone were observed. Interpretation Flanged cups do not generate higher cementation pressure or better cement penetration than unflanged cups. A possible advantage of the flange, however, may be to protect the cup from bottoming out, and there is possibly better closure of the periphery around the cup, sealing off the cement-bone interface. PMID:20860522

  6. [Wear and periprosthetic osteolysis of modular, hemispheric acetabular cups].


    Blacha, Jan; Bogacz, Alina


    Osteolysis associated with polyethylene wear has become one of the most prevalent complications associated with uncemented modular, hemispherical cups. Sixty-five consecutive total hip arthroplasties (ABG i, Howmedica, Stryker) were followed 6-12 years. Cumulative survivorship for the cup was 55.7% after 10 years. There were 20 cups revisions because of polyethylene wear and periprosthetic osteolysis (14 cups) or cup loosening (6 cups). Stability was assessed intraoperatively, 14 cups were revised, whereas 6 new polyethylene cups were cemented into stable metal-back of acetabular component. The average annual wear of revised cups was 0.32 mm. The annual wear of not revised cups was 0.12 mm. The differences were statistically significant (p = 0.002). The mean area of osteolysis was 472 mm2 (SD 257 mm2). There was no significant correlation between wear and area of osteolysis. There was significant correlation R = 0.54, p = 0.014) between time to revision and area of osteolysis. There were no significant differences of wear of polyethylene inlay or area of osteolysis between stable and unstable acetabular cups.

  7. Navigated Acetabular Cup Fixation for Acetabular Deformity or Revision Total Hip Arthroplasty

    PubMed Central

    Yoon, Jung-Ro; Yu, Jung Jin; Seo, Hyo-Sung


    Purpose To evaluate the usefulness of navigated acetabular cup fixation for total hip arthroplasty in patients with acetabular deformity or revision total hip arthroplasty. Materials and Methods This study enrolled 28 patients with at least 12 months' follow-up. The safe zone of the acetabular cup was defined as 40°±10°in inclination and 15°±10°in anteversion. The authors used the navigation and radiographic data to determine whether the acetabular cup was located within the safe zone or not. To evaluate the clinical outcomes, preoperative and last follow-up Harris hip scores were checked, and the occurrence of complications was evaluated. Results According to the navigation data, the mean inclination and anteversion were 38.5°±4.7°(range, 32°-50°) and 16.6°±4.0°(range, 8°-23°), respectively. According to the radiographic data the mean inclination and anteversion were 40.5°±4.6°(range, 32°-50°) and 19.4°±4.2°(range, 8°-25°), respectively. In both cases, all values were within the safe zone. Harris hip score was improved in all patients from preoperative 52.3±14.4 points (range, 29-87 points) to 88.0±9.0 points (range, 65-99 points) at the last follow-up. There was no dislocation or loosening of both cases. Conclusion Navigated acetabular cup fixation is a useful technique for total hip arthroplasty in patients with acetabular deformity or revision total hip arthroplasty because it prevents the malposition and related complications. PMID:27536573

  8. Clinical and radiological results of hydroxyapatite-coated acetabular cups.


    Blacha, J; Gagała, J


    We prospectively studied a consecutive series of 60 primary total hip arthroplasties in 52 patients. All patients had a hydroxyapatite-coated hemispherical acetabular cup (OCTOFIT). Mean patient age was 52.5 (34-73) years. In 38 hips, a 28-mm and in 22 hips a 32-mm diameter cobalt-chrome femoral head was used. We could follow 53 hips for a mean of 81 (28-125) months. Four cups were revised because of osteolysis, and in another six cups, slight osteolysis without migration was seen. The average annual linear wear rate was 0.05 mm (+/-0.05) for 28-mm heads and 0.16 mm (+/-0.09) for 32-mm heads (p<0.0001). Survivorship analysis predicted a survival rate of 86+/-6.7% at 10 years.

  9. Effect of acetabular cup abduction angle on wear of ultrahigh-molecular-weight polyethylene in hip simulator testing.


    Korduba, Laryssa A; Essner, Aaron; Pivec, Robert; Lancin, Perry; Mont, Michael A; Wang, Aiguo; Delanois, Ronald E


    The effect of acetabular component positioning on the wear rates of metal-on-polyethylene articulations has not been extensively studied. Placement of acetabular cups at abduction angles of more than 40° has been noted as a possible reason for early failure caused by increased wear. We conducted a study to evaluate the effects of different acetabular cup abduction angles on polyethylene wear rate, wear area, contact pressure, and contact area. Our in vitro study used a hip joint simulator and finite element analysis to assess the effects of cup orientation at 4 angles (0°, 40°, 50°, 70°) on wear and contact properties. Polyethylene bearings with 28-mm cobalt-chrome femoral heads were cycled in an environment mimicking in vivo joint fluid to determine the volumetric wear rate after 10 million cycles. Contact pressure and contact area for each cup abduction angle were assessed using finite element analysis. Results were correlated with cup abduction angles to determine if there were any differences among the 4 groups. The inverse relationship between volumetric wear rate and acetabular cup inclination angle demonstrated less wear with steeper cup angles. The largest abduction angle (70°) had the lowest contact area, largest contact pressure, and smallest head coverage. Conversely, the smallest abduction angle (0°) had the most wear and most head coverage. Polyethylene wear after total hip arthroplasty is a major cause of osteolysis and aseptic loosening, which may lead to premature implant failure. Several studies have found that high wear rates for cups oriented at steep angles contributed to their failure. Our data demonstrated that larger cup abduction angles were associated with lower, not higher, wear. However, this potentially "protective" effect is likely counteracted by other complications of steep cup angles, including impingement, instability, and edge loading. These factors may be more relevant in explaining why implants fail at a higher rate if

  10. Effect of acetabular cup abduction angle on wear of ultrahigh-molecular-weight polyethylene in hip simulator testing.


    Korduba, Laryssa A; Essner, Aaron; Pivec, Robert; Lancin, Perry; Mont, Michael A; Wang, Aiguo; Delanois, Ronald E


    The effect of acetabular component positioning on the wear rates of metal-on-polyethylene articulations has not been extensively studied. Placement of acetabular cups at abduction angles of more than 40° has been noted as a possible reason for early failure caused by increased wear. We conducted a study to evaluate the effects of different acetabular cup abduction angles on polyethylene wear rate, wear area, contact pressure, and contact area. Our in vitro study used a hip joint simulator and finite element analysis to assess the effects of cup orientation at 4 angles (0°, 40°, 50°, 70°) on wear and contact properties. Polyethylene bearings with 28-mm cobalt-chrome femoral heads were cycled in an environment mimicking in vivo joint fluid to determine the volumetric wear rate after 10 million cycles. Contact pressure and contact area for each cup abduction angle were assessed using finite element analysis. Results were correlated with cup abduction angles to determine if there were any differences among the 4 groups. The inverse relationship between volumetric wear rate and acetabular cup inclination angle demonstrated less wear with steeper cup angles. The largest abduction angle (70°) had the lowest contact area, largest contact pressure, and smallest head coverage. Conversely, the smallest abduction angle (0°) had the most wear and most head coverage. Polyethylene wear after total hip arthroplasty is a major cause of osteolysis and aseptic loosening, which may lead to premature implant failure. Several studies have found that high wear rates for cups oriented at steep angles contributed to their failure. Our data demonstrated that larger cup abduction angles were associated with lower, not higher, wear. However, this potentially "protective" effect is likely counteracted by other complications of steep cup angles, including impingement, instability, and edge loading. These factors may be more relevant in explaining why implants fail at a higher rate if

  11. Failure of dual radius hydroxyapatite-coated acetabular cups

    PubMed Central

    D'Angelo, Fabio; Molina, Mauro; Riva, Giacomo; Zatti, Giovanni; Cherubino, Paolo


    Introduction Many kind of hydroxyapatite-coated cups were used, with favorable results in short term studies; it was supposed that its use could improve osteointegration of the cup, enhancing thus stability and survivorship. The purpose of this study is to analyze the long term behavior of the hemispheric HA coated, Dual Radius Osteonics cup and to discuss the way of failure through the exam of the revised components and of both periacetabular and osteolysis tissue. Materials and Methods Between 1994 and 1997, at the Department of Orthopedic Sciences of the Insubria University, using the posterolateral approach, were implanted 276 Dual Radius Osteonics® in 256 patients, with mean age of 63 years. Results At a mean follow-up of 10 years (range 8–12 years), 183 cups in 165 patients, were available for clinical and radiographical evaluation. 22 Cups among the 183 were revised (11%). The cause of revision was aseptic loosening in 17 cases, septic loosening in one case, periprosthetic fracture in another case, osteolysis and polyethylene wear in two cases and, finally, recurrent dislocations in the last one. In the remaining patients, mean HHS increased from a preoperative value of 50,15 to a postoperative value of 92,69. The mean polyethylene wear was 1,25 mm (min. 0,08, max. 3,9 mm), with a mean annual wear of 0,17 mm. The mean acetabular migration on the two axis was 1,6 mm and 1,8 mm. Peri-acetabular osteolysis were recorded in 89% of the implants (163 cases). The cumulative survivorship (revision as endpoint) at the time was 88,9%. Conclusion Our study confirms the bad behavior of this type of cup probably related to the design, to the method of HA fixation. The observations carried out on the revised cup confirm these hypotheses but did not clarify if the third body wear could be a further problem. Another interesting aspect is the high incidence of osteolysis, which are often asymptomatic becoming a problem for the surgeon as the patient refuses the

  12. Experimental evidence of impingement induced strains at the interface and the periphery of an embedded acetabular cup implant.


    Arndt, Christoph; Voigt, Christian; Steinke, Hanno; Salis-Soglio, Georg V; Scholz, Roger


    After total hip arthroplasty, impingement of implant components may occur during every-day patient activities causing increased shear stresses at the acetabular implant-bone interface. In the literature, impingement related lever-out moments were noted for a number of acetabular components. But there is little information about pelvic load transfer. The aim of the current study was to measure the three-dimensional strain distribution at the macrostructured hemispherical interface and in the periphery of a standard acetabular press-fit cup in an experimental implant-bone substitute model. An experimental setup was developed to simulate impingement loading via a lever arm representing the femoral component and the lower limb. In one experimental setup 12 strain gauges were embedded at predefined positions in the periphery of the acetabular cup implant inside a tray, using polyurethane composite resin as a bone substitute material. By incremental rotation of the implant tray in steps of 10 and 30 deg, respectively, the strains were measured at evenly distributed positions. With the described method 288 genuine strain values were measured in the periphery of an embedded acetabular cup implant in one experimental setup. In two additional setups the strains were evaluated at different distances from the implant interface. Both in radial and meridional interface directions strain magnitudes reach their peak near the rim of the cup below the impingement site. Values of equatorial strains vary near zero and reach their peaks near the rim of the cup on either side and in some distance from the impingement site. Interestingly, the maximum of averaged radial strains does not occur, as expected, close to the interface but at an interface offset of 5.6 mm. With the described experimental setup it is now possible to measure and display the three-dimensional strain distribution in the interface and the periphery of an embedded acetabular cup implant. The current study provides the

  13. The effect of dynamic hip motion on the micromotion of press-fit acetabular cups in six degrees of freedom.


    Crosnier, Emilie A; Keogh, Patrick S; Miles, Anthony W


    The hip joint is subjected to cyclic loading and motion during activities of daily living and this can induce micromotions at the bone-implant interface of cementless total hip replacements. Initial stability has been identified as a crucial factor to achieve osseointegration and long-term survival. Whilst fixation of femoral stems achieves good clinical results, the fixation of acetabular components remains a challenge. In vitro methods assessing cup stability keep the hip joint in a fixed position, overlooking the effect of hip motion. The effect of hip motion on cup micromotion using a hip motion simulator replicating hip flexion-extension and a six degrees of freedom measurement system was investigated. The results show an increase in cup micromotion under dynamic hip motion compared to Static Flexion. This highlights the need to incorporate hip motion and measure all degrees of freedom when assessing cup micromotion. In addition, comparison of two press-fit acetabular cups with different surface coatings suggested similar stability between the two cups. This new method provides a basis for a more representative protocol for future pre-clinical evaluation of different cup designs.

  14. The effect of dynamic hip motion on the micromotion of press-fit acetabular cups in six degrees of freedom.


    Crosnier, Emilie A; Keogh, Patrick S; Miles, Anthony W


    The hip joint is subjected to cyclic loading and motion during activities of daily living and this can induce micromotions at the bone-implant interface of cementless total hip replacements. Initial stability has been identified as a crucial factor to achieve osseointegration and long-term survival. Whilst fixation of femoral stems achieves good clinical results, the fixation of acetabular components remains a challenge. In vitro methods assessing cup stability keep the hip joint in a fixed position, overlooking the effect of hip motion. The effect of hip motion on cup micromotion using a hip motion simulator replicating hip flexion-extension and a six degrees of freedom measurement system was investigated. The results show an increase in cup micromotion under dynamic hip motion compared to Static Flexion. This highlights the need to incorporate hip motion and measure all degrees of freedom when assessing cup micromotion. In addition, comparison of two press-fit acetabular cups with different surface coatings suggested similar stability between the two cups. This new method provides a basis for a more representative protocol for future pre-clinical evaluation of different cup designs. PMID:27210567

  15. Displacement and Stress Analysis around the Artificial Acetabular Cup in a Total Hip Replacement

    NASA Astrophysics Data System (ADS)

    Kakunai, Satoshi; Tachibana, Hiroyuki; Sakamoto, Tohru; Abo, Masayoshi; Ikeda, Daisaku; Fujiwara, Hiroo

    In order to improve the service life of the artificial acetabular cup in a total hip replacement, it is important to determine the best material and design, and to assess the mechanical behavior around the cup. In this study, electronic speckle interferometry (ESPI) and the two-dimensional finite element method (FEM) are employed to investigate the mechanical behavior. The influence of the cancellous bone and cup thickness on mechanical behavior around the cup was investigated. Good agreement of the cup model was found between the ESPI measurements and FEM predictions. The following results were obtained. (1) Cancellous bone with a porous structure can be measured by the ESPI method. (2) There are discontinuities of the displacement distribution in the transverse direction in each boundary region of the cup, bone cement and cancellous bone. (3) The maximum shear stress exists in the boundary region of the cup and bone cement.

  16. A technique to remove a well-fixed titanium-coated RM acetabular cup in revision hip arthroplasty.


    Judas, Fernando M J; Dias, Rui F; Lucas, Francisco M


    A major concern during revision hip arthroplasty is acetabular bone loss and bleeding during the extraction of well-fixed cementless acetabular cup, because no interface exists between the host bone and the cup. Forceful removal of such component using curved gouges and osteotomes often leads to extended bone loss and compromises reimplantation of a new socket. In the following case report, we removed a well-fixed polyethylene titanium-coated RM acetabular cup with 20 years of follow-up, by significant wear of the polyethylene layer. The isoelastic femoral stem was also removed by mechanical failure. We report a technique for removal of the cementless acetabular cup using powered acetabular reamers. The RM cup was sequentially reamed and when the polyethylene layer was thin enough, the remaining cup was removed easily by hand tools. The acetabular bone stock is preserved and the risks of bone fractures and bleeding are minimized. To our knowledge, these principles were applied only in cemented cups. We have used this technique in 10 cases with excellent results and no complications were noted. This is a simple, reproducible, non-costly, non-timing consuming, safe and successful technique to remove well-fixed titanium-coated RM acetabular cups.

  17. [Mecring threaded cup in total arthroplasty of the hip with acetabular protrusion].


    Bednarek, A; Blacha, J; Gagała, J


    Results of total arthroplasty of the hip with acetabular protrusion with the use of Mecring cup in 21 patients (25 hips) aged 25-75 years (mean 62) are reported. Morsalised impacted autografts were used to fill acetabular defect in all cases. There were 14 rheumatoid arthritis patients, 4 cases of osteoarthritis and 3 cases of Otto-Chrobak disease. Mean follow-up was 2.5 years (range 6 months-5 years). All autografts were incorporated after 6-9 months. Only one loosening and migration of the cup occurred. One patient died because of pulmonary embolism. Harris Hip Score increased from 37 points (22-49) preoperatively to 81 points (65-89) at the latest follow-up. Incorporation of autografts reinforced acetabular bottom and prevented recurrence of protrusion. Bone remodeling indicates restoring normal biomechanics of the hip.

  18. Revisions of Extensive Acetabular Defects with Impaction Grafting and a Cement Cup

    PubMed Central

    van Egmond, Nienke; De Kam, Daniel C. J.; Gardeniers, Jean W. M.


    Background Loosening of acetabular components often leads to bony defects. Management of extensive acetabular bone loss in hip revision arthroplasty can be a tremendous challenge. Questions/purposes We asked whether a reconstruction with impacted bone grafts will provide a durable and pain-free function in extensive acetabular defects. We specifically determined the (1) survival rates with the end point of revision for any reason, aseptic revision, and radiographic loosening; (2) visual analog scale (VAS) pain score, Harris hip score (HHS), and the Oxford Hip Questionnaire score (OHQS); (3) number of repeat revisions; (4) complications; and (5) radiographic loosening, wear, and radiolucencies. Patients and Methods We retrospectively followed 25 patients (27 hips) with extensive acetabular defects. No patient was lost to followup. Two patients died during followup. Minimum followup was 3 years (mean, 8.8 years; range, 3–14.1 years). Results Three patients (three hips) underwent repeat revision surgery and another two patients (two hips) had radiographically loose hips. The 10-year survival rate was 88% (95% confidence interval, 74.2%–100%) with the end point acetabular revision for any reason and 95% (95% confidence interval, 86.0%–100%) with the end point acetabular revision for aseptic loosening. The mean HHSs were 55 points before surgery and 72 points postoperatively. Conclusions Acetabular reconstruction with impaction bone grafting and a cemented cup is a reliable technique with a 10-year survival rate of 88% in patients with extensive acetabular deficiencies. Level of Evidence Level IV, case series. See the Guidelines for Authors for a complete description of levels of evidence. PMID:20931308

  19. Advanced material modelling in numerical simulation of primary acetabular press-fit cup stability.


    Souffrant, R; Zietz, C; Fritsche, A; Kluess, D; Mittelmeier, W; Bader, R


    Primary stability of artificial acetabular cups, used for total hip arthroplasty, is required for the subsequent osteointegration and good long-term clinical results of the implant. Although closed-cell polymer foams represent an adequate bone substitute in experimental studies investigating primary stability, correct numerical modelling of this material depends on the parameter selection. Material parameters necessary for crushable foam plasticity behaviour were originated from numerical simulations matched with experimental tests of the polymethacrylimide raw material. Experimental primary stability tests of acetabular press-fit cups consisting of static shell assembly with consecutively pull-out and lever-out testing were subsequently simulated using finite element analysis. Identified and optimised parameters allowed the accurate numerical reproduction of the raw material tests. Correlation between experimental tests and the numerical simulation of primary implant stability depended on the value of interference fit. However, the validated material model provides the opportunity for subsequent parametric numerical studies.

  20. Early failure of a polyethylene acetabular liner cemented into a metal cup.


    Wilson, David A J; Corkum, Joseph P; Teeter, Matthew G; Holdsworth, David W; Dunbar, Michael J


    In 2002, a patient underwent revision total hip arthroplasty for polyethylene wear. The acetabular cup was well fixed, and it was decided to cement a new polyethylene liner into the existing cup. In 2006, the patient presented with inability to weight bear and easy subluxation of the hip. Revision surgery was performed, and all components were examined postoperatively. Investigation with microcomputed tomography revealed that the liner had plastically deformed at the superior pole resulting in the hip instability. The reasons for this are suspected to be related to the abducted nature of the original cup and an uneven cement mantle. This report suggests that cementation of polyethylene liners into metal cups has limitations and is not appropriate in all circumstances.

  1. Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up)

    PubMed Central

    Livesley, Peter


    We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7–12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup .The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92–97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61–78%) and survival of the acetabular liner for wear was 62% (95% CI: 48–74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups. PMID:16283307

  2. The effect of acetabular cup size on the short-term stability of revision hip arthroplasty: a finite element investigation.


    Phillips, A T M; Pankaj; Usmani, A S; Howie, C R


    The study uses idealized two-dimensional finite element models to examine the behaviour of the acetabular construct following revision hip arthroplasty, carried out using the Slooff-Ling impaction grafting technique. The behaviour of bone graft was considered in detail, with non-linear elasticity and non-associated plasticity being adopted. Load was applied to the acetabular construct through a femoral head using smooth sliding surfaces. In particular, four models were subjected to two idealized cyclic load cases to investigate the effect of acetabular cup size on the short-term stability of the acetabular construct. The study suggests that benefits may be gained by using the largest practical size of acetabular cup. PMID:15376726

  3. The effect of acetabular cup size on the short-term stability of revision hip arthroplasty: a finite element investigation.


    Phillips, A T M; Pankaj; Usmani, A S; Howie, C R


    The study uses idealized two-dimensional finite element models to examine the behaviour of the acetabular construct following revision hip arthroplasty, carried out using the Slooff-Ling impaction grafting technique. The behaviour of bone graft was considered in detail, with non-linear elasticity and non-associated plasticity being adopted. Load was applied to the acetabular construct through a femoral head using smooth sliding surfaces. In particular, four models were subjected to two idealized cyclic load cases to investigate the effect of acetabular cup size on the short-term stability of the acetabular construct. The study suggests that benefits may be gained by using the largest practical size of acetabular cup.

  4. Constrained captive acetabular cup for recurrent dislocation of hemiarthroplasty in elderly: A case series

    PubMed Central

    Rajeev, Aysha; Banaszkiewicz, Paul


    Introduction Hemiarthroplasty of the hip is one of the commonest procedures done for intracapsular fractures of the neck of femur in elderly. Dislocation of the hemiarthroplasty is a recognised and significant complication. This is associated with considerable morbidity and mortality. The treatment options include closed manipulation, skin and skeletal traction, conversion to total hip replacement, exploration and open reduction and leaving it out of the acetabulum. Presentation of case A retrospective review of ten patients with recurrent and failed closed manipulative reduction of hemiarthroplasty who underwent revision using a cemented captive acetabular cup and cement to cement revision of femoral component with Exeter CDH stem was carried out. The follow up period was two years and the functional outcomes were assessed using Harris hip scores. Discussion The management of recurrent dislocations of hemiarthroplasty in elderly patient are very challenging. Even though various treatment options are described most of them are associated with increased morbidity and mortality and prevent these patients from early mobilisation. The use of captive acetabular avoid repeated dislocations, prolonged bed rest, wearing of a brace and all the complications associated with sustained immobilization. The drawbacks of using constrained cups are hip pain, limited hip movements and loosening. Conclusion We describe a new method of treatment of this difficult condition with a cemented constrained acetabular captive cup and cement to cement revision using a CDH femoral stem. This method prevents further dislocations and will give good functional outcomes thus reducing the high morbidity and mortality. PMID:27129135

  5. Assessment of Accuracy and Reliability in Acetabular Cup Placement Using an iPhone/iPad System.


    Kurosaka, Kenji; Fukunishi, Shigeo; Fukui, Tomokazu; Nishio, Shoji; Fujihara, Yuki; Okahisa, Shohei; Takeda, Yu; Daimon, Takashi; Yoshiya, Shinichi


    Implant positioning is one of the critical factors that influences postoperative outcome of total hip arthroplasty (THA). Malpositioning of the implant may lead to an increased risk of postoperative complications such as prosthetic impingement, dislocation, restricted range of motion, polyethylene wear, and loosening. In 2012, the intraoperative use of smartphone technology in THA for improved accuracy of acetabular cup placement was reported. The purpose of this study was to examine the accuracy of an iPhone/iPad-guided technique in positioning the acetabular cup in THA compared with the reference values obtained from the image-free navigation system in a cadaveric experiment. Five hips of 5 embalmed whole-body cadavers were used in the study. Seven orthopedic surgeons (4 residents and 3 senior hip surgeons) participated in the study. All of the surgeons examined each of the 5 hips 3 times. The target angle was 38°/19° for operative inclination/anteversion angles, which corresponded to radiographic inclination/anteversion angles of 40°/15°. The simultaneous assessment using the navigation system showed mean±SD radiographic alignment angles of 39.4°±2.6° and 16.4°±2.6° for inclination and anteversion, respectively. Assessment of cup positioning based on Lewinnek's safe zone criteria showed all of the procedures (n=105) achieved acceptable alignment within the safe zone. A comparison of the performances by resident and senior hip surgeons showed no significant difference between the groups (P=.74 for inclination and P=.81 for anteversion). The iPhone/iPad technique examined in this study could achieve acceptable performance in determining cup alignment in THA regardless of the surgeon's expertise. [Orthopedics. 2016; 39(4):e621-e626.]. PMID:27322169

  6. Assessment of Accuracy and Reliability in Acetabular Cup Placement Using an iPhone/iPad System.


    Kurosaka, Kenji; Fukunishi, Shigeo; Fukui, Tomokazu; Nishio, Shoji; Fujihara, Yuki; Okahisa, Shohei; Takeda, Yu; Daimon, Takashi; Yoshiya, Shinichi


    Implant positioning is one of the critical factors that influences postoperative outcome of total hip arthroplasty (THA). Malpositioning of the implant may lead to an increased risk of postoperative complications such as prosthetic impingement, dislocation, restricted range of motion, polyethylene wear, and loosening. In 2012, the intraoperative use of smartphone technology in THA for improved accuracy of acetabular cup placement was reported. The purpose of this study was to examine the accuracy of an iPhone/iPad-guided technique in positioning the acetabular cup in THA compared with the reference values obtained from the image-free navigation system in a cadaveric experiment. Five hips of 5 embalmed whole-body cadavers were used in the study. Seven orthopedic surgeons (4 residents and 3 senior hip surgeons) participated in the study. All of the surgeons examined each of the 5 hips 3 times. The target angle was 38°/19° for operative inclination/anteversion angles, which corresponded to radiographic inclination/anteversion angles of 40°/15°. The simultaneous assessment using the navigation system showed mean±SD radiographic alignment angles of 39.4°±2.6° and 16.4°±2.6° for inclination and anteversion, respectively. Assessment of cup positioning based on Lewinnek's safe zone criteria showed all of the procedures (n=105) achieved acceptable alignment within the safe zone. A comparison of the performances by resident and senior hip surgeons showed no significant difference between the groups (P=.74 for inclination and P=.81 for anteversion). The iPhone/iPad technique examined in this study could achieve acceptable performance in determining cup alignment in THA regardless of the surgeon's expertise. [Orthopedics. 2016; 39(4):e621-e626.].

  7. Long-term Radiographic Assessment of Cemented Polyethylene Acetabular Cups

    PubMed Central

    Isaac, Graham; Porter, Neil; Fisher, John; Older, John


    In vitro studies demonstrating excessive wear in polyethylene cups sterilized using gamma irradiation and stored in air led to the abandonment of this sterilization technique. We evaluated the clinical wear performance of a metal femoral component on a polyethylene cup in a hip prosthesis from a selected subset of implants in a group of patients followed for at least 20 years and assessed the time dependency of variation in penetration rates. We measured penetration in 33 polyethylene cups in 25 patients who had a Charnley low-friction arthroplasty between 1982 and 1984. All patients had Charnley Ogee® cups implanted for more than 20 years and sterilized using the gamma irradiation in air technique. If degradation occurred over time in vivo, it was not reflected by an increased penetration rate with increasing time in vivo; even after 20 years of implantation, the degree of wear remained low. This suggests gamma irradiation affects wear on ultra-high-molecular-weight polyethylene by reducing wear secondary to the crosslinking, by increasing wear as shown through in vitro studies of heavily oxidized samples, or by oxidation resulting from prolonged shelf life. The effect of progressive oxidation in vivo does not appear to affect wear in vivo. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18196419

  8. The biological approach in acetabular revision surgery: impaction bone grafting and a cemented cup.


    Colo, Ena; Rijnen, Wim H C; Schreurs, Berend Willem


    Acetabular impaction bone grafting (IBG) in combination with a cemented cup in revision total hip arthroplasty (THA) is a proven and well-recognised technique which has been used in clinical practice for more than 35 years. Nowadays, with cemented prostheses tending to lose a larger part of the THA market every year in primary and revision cases, and many young surgeons being only trained in implanting uncemented prostheses, this technique is considered by many as technically demanding and time consuming, making its use less appealing. Despite this image and many new innovative techniques using uncemented implants in acetabular revisions over the last 25 years, IBG with a cemented cup is still one of the few techniques that really can reconstitute bone and respects human biology. In this era of many biologically-based breakthroughs in medicine, it is hard to explain that the solution of most orthopaedic surgeons for the extensive bone defects as frequently seen during acetabular revision surgery, consists of implanting bigger and larger metal implants. This review aims to put the IBG method into a historical perspective, to describe the surgical technique and present the clinical results.

  9. Short-term survival of the trabecular metal cup is similar to that of standard cups used in acetabular revision surgery

    PubMed Central

    Mohaddes, Maziar; Rolfson, Ola; Kärrholm, Johan


    Background and purpose The use of trabecular metal (TM) cups in revision surgery has increased worldwide during the last decade. Since the introduction of the TM cup in Sweden in 2006, this design has gradually replaced other uncemented designs used in Sweden. According to data from the Swedish Hip Arthroplasty Register (SHAR) in 2012, one-third of all uncemented first-time cup revisions were performed using a TM cup. We compared the risk of reoperation and re-revision for TM cups and the 2 other most frequently used cup designs in acetabular revisions reported to the SHAR. The hypothesis was that the performance of TM cups is as good as that of established designs in the short term. Patients and methods The study population consisted of 2,384 patients who underwent 2,460 revisions during the period 2006 through 2012. The most commonly used cup designs were the press-fit porous-coated cup (n = 870), the trabecular metal cup (n = 805), and the cemented all-polyethylene cup (n = 785). 54% of the patients were female, and the median age at index revision was 72 (19–95) years. Reoperation was defined as a second surgical intervention, and re-revision—meaning exchange or removal of the cup—was used as endpoint. The mean follow-up time was 3.3 (0–7) years. Results There were 215 reoperations, 132 of which were re-revisions. The unadjusted and adjusted risk of reoperation or re-revision was not significantly different for the TM cup and the other 2 cup designs. Interpretation Our data support continued use of TM cups in acetabular revisions. Further follow-up is necessary to determine whether trabecular metal cups can reduce the re-revision rate in the long term, compared to the less costly porous press-fit and cemented designs. PMID:25399966


    PubMed Central

    Clarke, S G; Phillips, A T M; Bull, A M J; Cobb, J P


    The impact of anatomical variation and surgical error on excessive wear and loosening of the acetabular component of large diameter metal on metal hip arthroplasties was measured using a multi-factorial analysis through 112 different simulations. Each surgical scenario was subject to eight different daily loading activities using finite element analysis. Excessive wear appears to be predominantly dependent on cup orientation, with inclination error having a higher influence than version error, according to the study findings. Acetabular cup loosening, as inferred from initial implant stability, appears to depend predominantly on factors concerning the area of cup-bone contact, specifically the level of cup seating achieved and the individual patient’s anatomy. The extent of press fit obtained at time of surgery did not appear to influence either mechanism of failure in this study. PMID:22513086

  11. Wear patterns of, and wear volume formulae for, cylindrically elongated acetabular cup liners.


    Wu, James Shih-Shyn; Hsu, Shu-Ling; Chen, Jian-Horng


    This study analyzed the wear patterns of, and wear volume formulae for, cylindrically elongated acetabular cup liners. The geometric patterns of the wear surface were first classified, then wear volume formulae were derived by integral calculus. SolidWorks((R)) software or published formulae were used to verify the accuracy of the proposed formulae. The analytical results showed that the wear shape of the liner can be categorized into seven wear patterns, including the special case of wear at 90 degrees , and the seven corresponding wear formulae were derived. In addition, wear of the cylindrical elongation might add considerably to the volume loss of the liner, depending on the height and shape of the elongation and the depth and direction of the linear penetration, being maximally 21% in the investigated model. The proposed wear formulae and patterns will be useful for more accurate performance evaluation of existing hip components implanted in patients and for the designing of new hip components.

  12. [Acetabular Osteolysis in Total Hip Replacement - When to Retain the Cup?].


    Lutz, B; Faschingbauer, M; Bieger, R; Reichel, H; Kappe, T


    Periacetabular osteolysis is a frequent long-term complication of cementless total hip arthroplasty. The decision whether to retain or to revise a cup in the presence of osteolysis remains a challenge. The options are regular clinical and radiological check-ups, isolated liner exchange with and without bone grafting, and complete cup revision. Thorough preoperative diagnostics, including a medical history, examination and imaging, are mandatory for correct decision making. In most patients, computed tomography is useful to assess periacetabular osteolysis. If the cup is well-fixed and positioned in an asymptomatic patient without progressive osteolysis and no implant defect or higher grade polyethylene wear and no signs of infection, continuous clinical and radiological monitoring is preferred. If imaging reveals cup loosening, malposition, osteolysis localised in a weight-bearing area, imminent or present periprosthetic fractures, rapid progressive osteolysis, implant defects or massive inlay wear, surgical treatment may be preferred. Cup revision is usually performed in such patients. If the cup is well-positioned and well-fixed in the X-ray, the procedure has to be discussed with the patient individually. Apart from patient-specific risk factors, the risk of further progression has to be assessed. Isolated liner exchange can be performed if the patient is asymptomatic and the cup proves to be stable intraoperatively. It is still unclear whether filling osteolyses through screw holes or osseous windows is of long-term benefit. PMID:27249047

  13. Accuracy of the modified Hardinge approach in acetabular positioning

    PubMed Central

    Goyal, Prateek; Lau, Adrian; McCalden, Richard; Teeter, Matthew G.; Howard, James L.; Lanting, Brent A.


    Background The surgical approach chosen for total hip arthroplasty (THA) may affect the positioning of the acetabular component. The purpose of this study was to examine the accuracy in orienting the acetabular component using the modified Hardinge approach. Methods We used our institutional arthroplasty database to identify patients with primary, press-fit, hemispherical acetabular components of a metal-on-polyethylene THA performed between 2003 and 2011. Patients with radiographs obtained 1–3 years after the index procedure were included for measurement of anteversion and inclination angles. Acceptable values of anteversion and abduction angles were defined as 15° ± 10° and 40° ± 10°, respectively. Results We identified 1241 patients from the database, and the modified Hardinge approach was used in 1010 of the patients included in our analysis. The acetabular component was anteverted in the acceptable zone in 54.1% of patients. The abduction angle was within the defined range in 79.2% of patients. Combined anteversion and abduction angles within the defined zone were present in 43.6% of patients. Conclusion Consistent with studies examining accuracy from other approaches, our study reveals that the modified Hardinge approach was only moderately accurate in positioning the acetabular component in the acceptable zone. PMID:27240130

  14. The efficacy of a "double-D-shaped" wire marker for radiographic measurement of acetabular cup orientation and wear.


    Derbyshire, Brian; Raut, Videshnandan V


    Historically, wire markers were attached to cemented all-plastic acetabular cups to demarcate the periphery and to measure socket wear. The wire shape was either a semi-circle passing over the pole of the cup, or a circle around the cup equator. More recently, "double-D" shaped markers were introduced with a part-circular aspect passing over the pole and a semi-circular aspect parallel to the equatorial plane. This configuration enabled cup retroversion to be distinguished from anteversion. In this study, the accuracy of radiographic measurement of cup orientation and wear was assessed for cups with "double-D" and circular markers. Each cup was attached to a measurement jig which could vary the anteversion/retroversion and internal/external rotation of the cup. A metal femoral head was fixed within the socket and radiographic images were created for all combinations of cup orientation settings. The images were measured using software with automatic edge detection, and cup orientation and zero-wear accuracies were determined for each setting. The median error for cup version measurements was similar for both types of wire marker (0.2° double-D marker, -0.24° circular marker), but measurements of the circular marker were more repeatable. The median inclination errors were 2.05° (double-D marker) and 0.23° (circular marker). The median overall "zero wear" errors were 0.19 mm (double-D marker) and 0.03 mm (circular marker). Measurements of the circular wire marker were much more repeatable.

  15. Surface-gradient cross-linked polyethylene acetabular cups: oxidation resistance and wear against smooth and rough femoral balls.


    Shen, Fu-Wen; McKellop, Harry


    Two methods were developed and evaluated for cross-linking the bearing surface of a polyethylene acetabular cup to a limited depth, in order to improve its resistance to wear without degrading the mechanical properties of the bulk of the component. In the first method, low-energy electron beams were used to cross-link only the bearing surface of the cups to a maximum depth of about 2 mm. The cups then were annealed at 100 degrees C in vacuum for 3 or 6 days to reduce the residual free radicals, and the resultant resistance to oxidation was compared by artificially aging the cups at 80 degrees C in air. Chemically cross-linked surface layers were produced by coating the bearing surfaces of the cups with a thin layer of polyethylene powder mixed with 1% weight peroxide, and compressing them at 6.9 MPa (1000 psi) and 170 degrees C. This resulted in a cross-linked surface layer that extended about 3 mm deep, with a gradual transition to conventional (noncross-linked) polyethylene in the bulk of the implant. In hip simulator wear tests with highly polished (implant quality) femoral balls, both types of surface cross-linking were found to improve markedly the wear resistance of the acetabular cups. In tests with roughened femoral balls, the wear rates were much higher and were comparable to those obtained with similarly roughened balls against noncross-linked polyethylene cups in a previous study, indicating that the full benefit of cross-linking may not be realized under conditions of severe third-body abrasion. Nevertheless, these results show a promising approach for optimizing the wear resistance and the bulk mechanical properties of polyethylene components in total joint arthroplasty.

  16. Accuracy and Precision of Three-Dimensional Low Dose CT Compared to Standard RSA in Acetabular Cups: An Experimental Study

    PubMed Central

    Olivecrona, Henrik; Maguire, Gerald Q.; Noz, Marilyn E.; Zeleznik, Michael P.


    Background and Purpose. The gold standard for detection of implant wear and migration is currently radiostereometry (RSA). The purpose of this study is to compare a three-dimensional computed tomography technique (3D CT) to standard RSA as an alternative technique for measuring migration of acetabular cups in total hip arthroplasty. Materials and Methods. With tantalum beads, we marked one cemented and one uncemented cup and mounted these on a similarly marked pelvic model. A comparison was made between 3D CT and standard RSA for measuring migration. Twelve repeated stereoradiographs and CT scans with double examinations in each position and gradual migration of the implants were made. Precision and accuracy of the 3D CT were calculated. Results. The accuracy of the 3D CT ranged between 0.07 and 0.32 mm for translations and 0.21 and 0.82° for rotation. The precision ranged between 0.01 and 0.09 mm for translations and 0.06 and 0.29° for rotations, respectively. For standard RSA, the precision ranged between 0.04 and 0.09 mm for translations and 0.08 and 0.32° for rotations, respectively. There was no significant difference in precision between 3D CT and standard RSA. The effective radiation dose of the 3D CT method, comparable to RSA, was estimated to be 0.33 mSv. Interpretation. Low dose 3D CT is a comparable method to standard RSA in an experimental setting. PMID:27478832

  17. Accuracy and Precision of Three-Dimensional Low Dose CT Compared to Standard RSA in Acetabular Cups: An Experimental Study.


    Brodén, Cyrus; Olivecrona, Henrik; Maguire, Gerald Q; Noz, Marilyn E; Zeleznik, Michael P; Sköldenberg, Olof


    Background and Purpose. The gold standard for detection of implant wear and migration is currently radiostereometry (RSA). The purpose of this study is to compare a three-dimensional computed tomography technique (3D CT) to standard RSA as an alternative technique for measuring migration of acetabular cups in total hip arthroplasty. Materials and Methods. With tantalum beads, we marked one cemented and one uncemented cup and mounted these on a similarly marked pelvic model. A comparison was made between 3D CT and standard RSA for measuring migration. Twelve repeated stereoradiographs and CT scans with double examinations in each position and gradual migration of the implants were made. Precision and accuracy of the 3D CT were calculated. Results. The accuracy of the 3D CT ranged between 0.07 and 0.32 mm for translations and 0.21 and 0.82° for rotation. The precision ranged between 0.01 and 0.09 mm for translations and 0.06 and 0.29° for rotations, respectively. For standard RSA, the precision ranged between 0.04 and 0.09 mm for translations and 0.08 and 0.32° for rotations, respectively. There was no significant difference in precision between 3D CT and standard RSA. The effective radiation dose of the 3D CT method, comparable to RSA, was estimated to be 0.33 mSv. Interpretation. Low dose 3D CT is a comparable method to standard RSA in an experimental setting. PMID:27478832

  18. Difference in the acetabular cup orientation in standing and supine radiographs.


    Khan, Munir; Beckingsale, Tom; Marsh, Martin; Holland, Jim


    Acetabular orientation changes with that of the pelvis during lying and standing. This study was designed to measure these changes. We assessed 17 BHR replacements using EBRA software. The mean acetabular anteversion was more (p = 0.02) on erect than supine radiographs. Linear regression analysis showed that anteversion and inclination increased in some while decreased in others, and Bland and Altman analysis showed wide limits of agreement. The changes in acetabular orientation are thus subject to significant variations between the patients. We suggest studying the factors affecting acetabular orientation in standing to help reduce joint reaction forces and improve outcomes. PMID:27408490

  19. Oxidation in ultrahigh molecular weight polyethylene and cross-linked polyethylene acetabular cups tested against roughened femoral heads in a hip joint simulator.


    Taddei, Paola; Affatato, Saverio; Fagnano, Concezio; Toni, Aldo


    This study was aimed at comparing the oxidative degradation of commercial acetabular cups made of cross-linked polyethylene (XLPE) and conventional ultrahigh molecular weight polyethylene (UHMWPE). After testing against deliberately scratched CoCrMo femoral heads in a hip joint simulator, the cups, microtomed parallel to the articulating surface, were analyzed by IR spectroscopy. Due to the potential for artifacts caused by absorbed contaminants, the IR spectra were compared only after hexane extraction; actually, XLPE was found to absorb more serum than UHMWPE. The two sets of unworn acetabular cups showed different oxidation patterns with consequently different distributions of carbonyl species; unworn XLPE was characterized by lower contents of carbonyl species and hydrogen-bonded alcohols and higher contents of trans-vinylene species than unworn UHMWPE. Upon simulator testing, UHMWPE showed more significant changes in oxidation indexes and distribution of carbonyl compounds than XLPE, confirming a better wear behavior for XLPE under the adopted testing conditions.

  20. Accuracy of navigation-assisted acetabular component positioning studied by computed tomography measurements: methods and results.


    Ybinger, Thomas; Kumpan, W; Hoffart, H E; Muschalik, B; Bullmann, W; Zweymüller, K


    The postoperative position of the acetabular component is key for the outcome of total hip arthroplasty. Various aids have been developed to support the surgeon during implant placement. In a prospective study involving 4 centers, the computer-recorded cup alignment of 37 hip systems at the end of navigation-assisted surgery was compared with the cup angles measured on postoperative computerized tomograms. This comparison showed an average difference of 3.5 degrees (SD, 4.4 degrees ) for inclination and 6.5 degrees (SD, 7.3 degrees ) for anteversion angles. The differences in inclination correlated with the thickness of the soft tissue overlying the anterior superior iliac spine (r = 0.44; P = .007), whereas the differences in anteversion showed a correlation with the thickness of the soft tissue overlying the pubic tubercles (r = 0.52; P = .001). In centers experienced in the use of navigational tools, deviations were smaller than in units with little experience in their use. PMID:17826270

  1. Importance of maintaining the basic stress pathway above the acetabular dome during acetabular reconstruction.


    Nie, Yong; Pei, Fuxing; Shen, Bin; Kang, Pengde; Li, Zongming


    The basic stress pathway above the acetabular dome is important for the maintenance of implant stability in press-fit acetabular reconstruction of total hip arthroplasty. However, information on the basic stress pathway and its impact factors remains unclear. The objective of this study was to investigate the effects of the orientations and positions of the acetabular component on the basic stress pathway. The basic stress pathway above the acetabular dome was defined as two parts: 3D basic trabecular bone stress distribution and quantified basic cortical bone stress level, using two subject-specific finite element normal hip models. The effects were then analysed by generating 32 reconstructed acetabular cases with different cup abduction and anteversion angles within a range of 35-50° and 10-25°, respectively, and 12 cases with different hip centre heights within a range of 0-15 mm above the acetabular dome. The 3D trabecular stress distribution decreased remarkably in all cases, while the 80% of the basic cortical bone stress level was maintained in cases when the acetabular component was positioned at 10° or 15° anteversion and 40° or 45° abduction angles. The basic stress pathway above the acetabular dome was disturbed when the superior displacement of the hip centre exceeded 5 mm above the anatomical hip centre. Positioning the acetabular component correctly contributes to maintain the stress balance between the acetabular cup and the bone during acetabular reconstruction, thus helping restore the normal hip biomechanics and preserve the stability of the implants.

  2. Comparison of wear of ultra-high molecular weight polyethylene acetabular cups against surface-engineered femoral heads.


    Galvin, A; Brockett, C; Williams, S; Hatto, P; Burton, A; Isaac, G; Stone, M; Ingham, E; Fisher, J


    Alumina ceramic heads have been previously shown to reduce polyethylene wear in comparison to cobalt chrome (CoCr) heads in artificial hip joints. However, there are concerns about the brittle nature of ceramics. It is therefore of interest to investigate ceramic-like coatings on metallic heads. The aim of this study was to compare the friction and wear of ultra-high molecular weight polyethylene (UHMWPE) against alumina ceramic, CoCr, and surface-engineered ceramic-like coatings in a friction simulator and a hip joint simulator. All femoral heads tested were 28 mm diameter and included: Biolox Forte alumina, CoCr, arc evaporative physical vapour deposition (AEPVD) chromium nitride (CrN) coated CoCr, plasma-assisted chemical vapour deposition (PACVD) amorphous diamond-like carbon (aDLC) coated CoCr, sputter CrN coated CoCr, reactive gas controlled arc (RGCA) AEPVD titanium nitride (TiN) coated CoCr, and Graphit-iC coated CoCr. These were articulated against UHMWPE acetabular cups in a friction simulator and a hip joint simulator. Alumina and CoCr gave the lowest wear volumes whereas the sputter coated CrN gave the highest. Alumina also had the lowest friction factor. There was an association between surface parameters and wear. This study indicates that surface topography of surface-engineered femoral heads is more important than friction and wettability in controlling UHMWPE wear.

  3. Visual intraoperative estimation of cup and stem position is not reliable in minimally invasive hip arthroplasty

    PubMed Central

    Woerner, Michael; Sendtner, Ernst; Springorum, Robert; Craiovan, Benjamin; Worlicek, Michael; Renkawitz, Tobias; Grifka, Joachim; Weber, Markus


    Background and purpose In hip arthroplasty, acetabular inclination and anteversion—and also femoral stem torsion—are generally assessed by eye intraoperatively. We assessed whether visual estimation of cup and stem position is reliable. Patients and methods In the course of a subgroup analysis of a prospective clinical trial, 65 patients underwent cementless hip arthroplasty using a minimally invasive anterolateral approach in lateral decubitus position. Altogether, 4 experienced surgeons assessed cup position intraoperatively according to the operative definition by Murray in the anterior pelvic plane and stem torsion in relation to the femoral condylar plane. Inclination, anteversion, and stem torsion were measured blind postoperatively on 3D-CT and compared to intraoperative results. Results The mean difference between the 3D-CT results and intraoperative estimations by eye was −4.9° (−18 to 8.7) for inclination, 9.7° (−16 to 41) for anteversion, and −7.3° (−34 to 15) for stem torsion. We found an overestimation of > 5° for cup inclination in 32 hips, an overestimation of > 5° for stem torsion in 40 hips, and an underestimation < 5° for cup anteversion in 42 hips. The level of professional experience and patient characteristics had no clinically relevant effect on the accuracy of estimation by eye. Altogether, 46 stems were located outside the native norm of 10–20° as defined by Tönnis, measured on 3D-CT. Interpretation Even an experienced surgeon’s intraoperative estimation of cup and stem position by eye is not reliable compared to 3D-CT in minimally invasive THA. The use of mechanical insertion jigs, intraoperative fluoroscopy, or imageless navigation is recommended for correct implant insertion. PMID:26848628

  4. Comparison of Head Center Position and Screw Fixation Options Between a Jumbo Cup and an Offset Center of Rotation Cup in Revision Total Hip Arthroplasty: A Computer Simulation Study.


    Faizan, Ahmad; Black, Brandon J; Fay, Brian D; Heffernan, Christopher D; Ries, Michael D


    Jumbo acetabular cups are commonly used in revision total hip arthroplasty (THA). A straightforward reaming technique is used which is similar to primary THA. However, jumbo cups may also be associated with hip center elevation, limited screw fixation options, and anterior soft tissue impingement. A partially truncated hemispherical shell was designed with an offset center of rotation, thick superior rim, and beveled anterior and superior rims as an alternative to a conventional jumbo cup. A three dimensional computer simulation was used to assess head center position and safe screw trajectories. Results of this in vitro study indicate that a modified hemispherical implant geometry can reduce head center elevation while permitting favorable screw fixation trajectories into the pelvis in comparison to a conventional jumbo cup.

  5. Compliant layer acetabular cups: friction testing of a range of materials and designs for a new generation of prosthesis that mimics the natural joint.


    Scholes, S C; Burgess, I C; Marsden, H R; Unsworth, A; Jones, E; Smith, N


    Total joint replacements (TJRs) have a limited lifetime, but the introduction of components that exhibit good lubricating properties with low friction and low wear could extend the life of TJRs. A novel acetabular cup design using polyurethane (PU) as a compliant layer (to mimic the natural joint) has been developed. This study describes a series of friction tests that have been used to select the most appropriate material, optimize the design parameters, and fine-tune the manufacturing processes of these joints. To determine accurately the mode of lubrication under which these joints operate, a synthetic lubricant was used in all these tests. Friction tests were carried out to assess the lubrication of four PU bearing materials. Corethane 80A was the preferred material and was subjected to subsequent testing. Friction tests conducted on acetabular cups, manufactured using Corethane 80A articulating against standard, commercially available femoral heads, demonstrated friction factors approaching those for full-fluid-film lubrication with only approximately 1 per cent asperity contact. As the joint produces these low friction factors within less than half a walking cycle after prolonged periods of loading, start-up friction was not considered to be a critical factor. Cups performed well across the full range of femoral head sizes, but a number of samples manufactured with reduced radial clearances performed with higher than expected friction. This was caused by the femoral head being gripped around the equator by the low clearance cup. To avoid this, the cup design was modified by increasing the flare at the rim. In addition to this the radial clearance was increased. As the material is incompressible, a radial clearance of 0.08 mm was too small for a cup diameter of 32 mm. A clearance of between 0.10 and 0.25 mm produced a performance approaching full-fluid-film lubrication. This series of tests acted as a step towards the optimization of the design of these joints

  6. Precision of robotic guided instrumentation for acetabular component positioning.


    Kanawade, Vaibhav; Dorr, Lawrence D; Banks, Scott A; Zhang, Zenan; Wan, Zhinian


    Robotic computerized instrumentation that guides bone preparation and cup implantation in total hip arthroplasty was studied. In 38 patients (43 hips) intraoperative cup inclination and anteversion were validated by postoperative CT scans. Planned inclination was 39.9°±0.8° and with robotic instrumentation was 38. 0°±1.6° with no outliers of 5°; on the postoperative CT scan there were 5 outliers (12%). Planned anteversion was 21.2°±2.4° and intraoperatively was 20.7°±2.4° with no outlier of 5°; on the CT there were 7 outliers (16%). The center of rotation (COR) was superior by a mean 0.9±4.2 mm and medial by 2.7±2.9 mm. This robotic instrumentation achieved precision of inclination in 88%, anteversion in 84% and COR in 81.5%.

  7. [Progressive intra-acetabular dislocation of bipolar hip prostheses: four cases].


    Tabutin, J; Damotte, A


    Certain complications, such as acetabular erosion or cup dissociation, are specific to bipolar prostheses. Progressive intra-acetabular dislocation has not been reported to date. We report 4 cases. Four elderly women developed progressive intra-acetabular dislocation after implantation of a bipolar prosthesis for femoral neck fractures. The metal-backed cup verticalized progressively and the ball gradually dislocated into the acetabulum, eroding it. Revision was undertaken with a hemispheric bone ingrowth cup and partial grafting. Follow-up was then uneventful. This phenomenon is different from the acute intra-acetabular dislocation that may occur after rupture of the anti-dissociation mechanism (polyethylene ring) incorporated in the design of new implant models, or after dissociation between the ball and the cup during closed reduction of a dislocation, the cup catching on the acetabular rim. It is not due to a variation in the neck-head angles (we observed varus, valgus, and neutral angles) nor to a problem between the modular head and the neck (at the morse cone taper). For us, the cause of this progressive intra-acetabular dislocation is poor cup design associated with a weak retention system. If the centers of the inner and outer spheres are superimposed, the cup has a natural tendency to drop into varus because of its weight. This becomes even worse if the center of the outer sphere is medial to the ball center. The cup should be designed so that the center of the outer sphere (bipolar cup) lies lateral to the center of the inner sphere (ball) creating a valgus torque for the cup. Designing a bipolar cup is not as a simple matter as it may seem. We emphasize the importance of the position of the rotation centers.

  8. [A simulative biomechanical experiment on different position of none-cement acetabular components influencing the load distribution around acetabulum].


    Li, Dongsong; Liu, Jianguo; Li, Shuqiang; Fan, Honghui; Guan, Jikui


    In the present study, a three dimensional finite-element model of the human pelvic was reconstructed, and then, under different acetabular component position (the abduction angle ranges from 30 degrees to 70 degrees and the anteversion ranges from 5 degrees to 30degrees) the load distribution around the acetabular was evaluated by the computer biomechanical analysis program (Solidworks). Through the obtained load distribution results, the most even and reasonable range of the distribution was selected; therefore the safe range of the acetabular component implantation can be validated from the biomechanics aspect.

  9. Clinical and radiographic results and wear performance in different generations of a cementless porous-coated acetabular cup

    PubMed Central

    García-Cimbrelo, E.


    We compared clinical results and wear performance in two different generations of a cementless porous-coated cup, analysing the long-term results of 83 uncemented Harris-Galante I cups (32-mm femoral head) and 93 uncemented Harris-Galante II cups (28-mm femoral head). All polyethylene liners were gamma irradiated in air. Polyethylene linear wear was estimated using a software package. The minimum follow-up was 10 years. Nine Harris-Galante I cups and two Harris-Galante II cups were revised due to aseptic loosening or polyethylene problems. The mean femoral head penetration at 6 weeks after surgery was 0.15 ± 0.05 mm for the Harris-Galante I cups and 0.12 ± 0.03 for the Harris-Galante II cups (p < 0.001);but mean wear was 0.13 ± 0.23 mm per year for the Harris-Galante I cups and 0.11 ± 0.10 for the Harris-Galante II cups (p = 0.740). Most of the metallic shells in both groups showed stable fixation. The so-called second-generation cups had lower initial polyethylene wear that resulted in less polyethylene wear at the latest the follow-up, but the overall wear rate was similar in both groups despite the different femoral head sizes and the improved locking mechanism. PMID:17265157

  10. Acetabular reconstruction with impaction bone-grafting and a cemented cup in patients younger than fifty years old: a concise follow-up, at twenty to twenty-eight years, of a previous report.


    Busch, Vincent J J F; Gardeniers, Jean W M; Verdonschot, Nico; Slooff, Tom J J H; Schreurs, B Willem


    In a previous report, we presented our results of forty-two acetabular reconstructions, performed with use of impaction bone-grafting and a cemented polyethylene cup, in thirty-seven patients who were younger than fifty years and had a minimum of fifteen years of follow-up. The present update study shows the results after twenty to twenty-eight years. Eight additional cups had to be revised--four because of aseptic loosening, three because of wear, and one during a revision of the stem. Three additional cups were considered loose on radiographs. Survivorship of the acetabular reconstructions, with an end point of revision for any reason, was 73% after twenty years and 52% after twenty-five years. With revision for aseptic loosening as the end point, survival was 85% after twenty years and 77% after twenty-five years; for signs of loosening on radiographs, survival was 71% at twenty years and 62% at twenty-five years. In conclusion, our previous results have declined but the technique of using impacted morselized bone graft and a cemented cup is useful for the purpose of restoring bone stock in young patients whose acetabular defects require primary or revision total hip arthroplasty.

  11. Case report: analysis of an ultra-high-molecular-weight polyethylene acetabular cup retrieval at 41 years.


    Kummer, Frederick J; Herrera, Lizeth; Weir, Alec; Le, Kim-Phuong; Jaffe, William L


    A polyethylene cup explanted after 41 years was examined using several analytical techniques to determine whether there was a material cause for the extremely low wear observed. Neither the amount of polyethylene oxidation nor crystallinity appeared to be a factor.

  12. Hip arthroplasty by matching cups.


    Gerard, Y


    A total hip surface arthroplasty consisting of matching cups and uncemented prosthetic components is a noteworthy operation. The femoral cup obtains cylindrical support from the femoral head which is reamed in the shape of a cylinder. The acetabular cup is metallic with a polyethylene liner. It is mobile over the bone but its position is constrained by contact with the femoral cup and therefore "self-centering." On the femoral side, the cup must be placed strictly in the axis of the femoral neck. The main consideration in femoral head surface replacement is the vitality of the underlying bone. Necrosis was observed in the earliest clinical trials but there have been no cases of necrosis in the past 3 1/2 years. This is attributed to a more limited surgical approach in which only the anterior part of the gluteus medius is divided and all the posterior elements of the hip are preserved. The acetabulum is sufficiently reamed to receive the cup, which protrudes beyond the external margins of the acetabulum in all positions. Errors have been committed while perfecting the prosthetic material, but the results as determined by a 6 1/2 year follow-up on purely metallic cups are encouraging. Metal-polyethylene cups presently under investigation have almost a 2 year follow-up. The reaction of the acetabulum to an uncemented cup is not yet known. However, the existence of 2 sliding surfaces and the fact that the acetabular cup moves only during the extremes of hip movement, is reason to assume that if the acetabulum is not reamed to expose cancellous bone, the risks of protrusion are minimal or delayed. Total surface arthroplasty by concentric cups has been performed in 335 hips to date. The operation is especially recommended when osteotomy is no longer possible and disabling coxarthrosis is present in relatively young patients. PMID:729253

  13. Acquisition of cup drinking using previously refused foods as positive and negative reinforcement.


    Kelley, Michael E; Piazza, Cathleen C; Fisher, Wayne W; Oberdorff, Amanda J


    We used previously refused foods as positive and negative reinforcement in the acquisition of cup drinking. Cup drinking increased with positive and negative reinforcement, both alone and in combination (without escape extinction), indicating that treatment of food refusal can establish some foods as appetitive stimuli whereas others remain aversive.

  14. Initial Results of an Acetabular Center Axis Registration Technique in Navigated Hip Arthroplasty with Deformed Acetabular Rims

    PubMed Central

    Wada, Hiroshi; Mishima, Hajime; Yoshizawa, Tomohiro; Sugaya, Hisashi; Nishino, Tomofumi; Yamazaki, Masashi


    Background In cementless total hip arthroplasty, imageless computer-assisted navigation is usually used to register the anterior pelvic plane (APP). The accuracy of this method is influenced by the subcutaneous tissues overlying the registration landmarks. On the other hand, the acetabular center axis (ACA) is determined from the acetabular rim. Precise registration of the ACA is possible because of direct palpation using a pointer. Imageless navigation using the ACA usually targets patients with normal acetabular morphology. The aim of this study was to investigate the accuracy of imageless navigation using the ACA instead of the APP in patients with normal or deformed acetabular rims. Methods The intraoperative cup position was compared with that obtained from the postoperative computed tomography (CT) images in 18 cases. Results The inclination angle derived from the navigation system was 3.4 ± 5.3 degrees smaller and the anteversion angle was 1.4 ± 3.1 degrees larger than those derived from the CT images. Conclusion The inclination cup angle of the navigation system was significantly inferior to the true value, particularly in cases with large anterior osteophytes. PMID:27073586

  15. A Novel Method for Assessment of Polyethylene Liner Wear in Radiopaque Tantalum Acetabular Cups: Clinical Validation in Patients Enrolled in a Randomized Controlled Trial.


    Troelsen, Anders; Greene, Meridith E; Ayers, David C; Bragdon, Charles R; Malchau, Henrik


    Conventional radiostereometric analysis (RSA) for wear is not possible in patients with tantalum cups. We propose a novel method for wear analysis in tantalum cups. Wear was assessed by gold standard RSA and the novel method in total hip arthroplasty patients enrolled in a randomized controlled trial receiving either titanium or tantalum cups (n=46). The novel method estimated the center of the head using a model based on identification of two proximal markers on the stem and knowledge of the stem/head configuration. The novel method was able to demonstrate a pattern of wear that was similar to the gold standard in titanium cups. The novel method offered accurate assessment and is a viable solution for assessment of wear in studies with tantalum cups.

  16. A Novel Method for Assessment of Polyethylene Liner Wear in Radiopaque Tantalum Acetabular Cups: Clinical Validation in Patients Enrolled in a Randomized Controlled Trial.


    Troelsen, Anders; Greene, Meridith E; Ayers, David C; Bragdon, Charles R; Malchau, Henrik


    Conventional radiostereometric analysis (RSA) for wear is not possible in patients with tantalum cups. We propose a novel method for wear analysis in tantalum cups. Wear was assessed by gold standard RSA and the novel method in total hip arthroplasty patients enrolled in a randomized controlled trial receiving either titanium or tantalum cups (n=46). The novel method estimated the center of the head using a model based on identification of two proximal markers on the stem and knowledge of the stem/head configuration. The novel method was able to demonstrate a pattern of wear that was similar to the gold standard in titanium cups. The novel method offered accurate assessment and is a viable solution for assessment of wear in studies with tantalum cups. PMID:26216229

  17. Acetabular Reconstruction in Total Hip Arthroplasty.


    Shon, Won Yong; Santhanam, Siva Swaminathan; Choi, Jung Woo


    The difficulties encountered in dealing with the bone deficient acetabulum are amongst the greatest challenges in hip surgery. Acetabular reconstruction in revision total hip arthroplasty can successfully be achieved with hemispherical components featuring a porous or roughened ingrowth surface and options for placement of multiple screws for minor acetabular defect. Acetabular component selection is mostly based on the amount of bone loss present. In the presence of combined cavitary and segmental defects without superior acetabular coverage, reconstructions with a structural acetabular allograft protected by a cage or a custom-made triflange cage have been one of preferred surgical options. The use of a cage or ring over structural allograft bone for massive uncontained defects in acetabular revision can restore host bone stock and facilitate subsequent rerevision surgery to a certain extent. But high complication rates have been reported including aseptic loosening, infection, dislocation and metal failure. On the other hand, recent literature is reporting satisfactory outcomes with the use of modular augments combined with a hemispherical shell for major acetabular defect. Highly porous metals have been introduced for clinical use in arthroplasty surgery over the last decade. Their higher porosity and surface friction are ideal for acetabular revision, optimizing biological fixation. The use of trabecular metal cups in acetabular revision has yielded excellent clinical results. This article summarizes author's experience regarding revision acetabular reconstruction options following failed hip surgery including arthroplasty. PMID:27536638

  18. Dilemmas in imaging for peri-acetabular osteotomy: the influence of patient position and imaging technique on the radiological features of hip dysplasia.


    Kosuge, D; Cordier, T; Solomon, L B; Howie, D W


    Peri-acetabular osteotomy is an established surgical treatment for symptomatic acetabular dysplasia in young adults. An anteroposterior radiograph of the pelvis is commonly used to assess the extent of dysplasia as well as to assess post-operative correction. Radiological prognostic factors include the lateral centre-edge angle, acetabular index, extrusion index and the acetabular version. Standing causes a change in the pelvis tilt which can alter certain radiological measurements relative to the supine position. This article discusses the radiological indices used to assess dysplasia and reviews the effects of patient positioning on these indices with a focus on assessment for a peri-acetabular osteotomy. Intra-operatively, fluoroscopy is commonly used and the implications of using fluoroscopy as a modality to assess the various radiological indices along with the effects of using an anteroposterior or posteroanterior fluoroscopic view are examined. Each of these techniques gives rise to a slightly different image of the pelvis as the final image is sensitive to the position of the pelvis and the projection of the x-ray beam. PMID:25183583

  19. Pelvic Incidence: A Predictive Factor for Three-Dimensional Acetabular Orientation—A Preliminary Study

    PubMed Central

    Bollini, Gérard; Legaye, Jean; Tardieu, Christine; Prat-Pradal, Dominique; Chabrol, Brigitte; Jouve, Jean-Luc; Duval-Beaupère, Ginette; Pélissier, Jacques


    Acetabular cup orientation (inclination and anteversion) is a fundamental topic in orthopaedics and depends on pelvis tilt (positional parameter) emphasising the notion of a safe range of pelvis tilt. The hypothesis was that pelvic incidence (morphologic parameter) could yield a more accurate and reliable assessment than pelvis tilt. The aim was to find out a predictive equation of acetabular 3D orientation parameters which were determined by pelvic incidence to include in the model. The second aim was to consider the asymmetry between the right and left acetabulae. Twelve pelvic anatomic specimens were measured with an electromagnetic Fastrak system (Polhemus Society) providing 3D position of anatomical landmarks to allow measurement of acetabular and pelvic parameters. Acetabulum and pelvis data were correlated by a Spearman matrix. A robust linear regression analysis provided prediction of acetabulum axes. The orientation of each acetabulum could be predicted by the incidence. The incidence is correlated with the morphology of acetabula. The asymmetry of the acetabular roof was correlated with pelvic incidence. This study allowed analysis of relationships of acetabular orientation and pelvic incidence. Pelvic incidence (morphologic parameter) could determine the safe range of pelvis tilt (positional parameter) for an individual and not a group. PMID:25006461

  20. Analysis of wear of polyethylene hip joint cup related to its positioning in patient's body.


    Rońda, Jacek; Wojnarowski, Paweł


    Polyethylene parts of endoprosthesis are the weakest parts of each medical implant. They can be worn out within several years. During this period, a patient can enjoy good physical efficiency until the wear of polyethylene part limits his/her mobility. Then the reoperation is necessary and positioning of all parts of endoprosthesis has an effect on future patient's mobility and durability of implant. Elements of endoprosthesis during exploitation are heavily loaded both by normal and tangential forces and moments. In this paper, the dependence of wear of polyethylene cup on its positioning in pelvis is the major problem. Wear of the cup is determined by two measures: the depth and volume of a material rubbed off from the contact surface. The sensitivity of the depth of rubbing off is evaluated relative to two angles of anteversion and abduction, and radii of the cup. Numerical results are obtained by using Abaqus FE system with data related to patient's activity identified on the basis of medical reports. PMID:23957232

  1. Analysis of wear of polyethylene hip joint cup related to its positioning in patient's body.


    Rońda, Jacek; Wojnarowski, Paweł


    Polyethylene parts of endoprosthesis are the weakest parts of each medical implant. They can be worn out within several years. During this period, a patient can enjoy good physical efficiency until the wear of polyethylene part limits his/her mobility. Then the reoperation is necessary and positioning of all parts of endoprosthesis has an effect on future patient's mobility and durability of implant. Elements of endoprosthesis during exploitation are heavily loaded both by normal and tangential forces and moments. In this paper, the dependence of wear of polyethylene cup on its positioning in pelvis is the major problem. Wear of the cup is determined by two measures: the depth and volume of a material rubbed off from the contact surface. The sensitivity of the depth of rubbing off is evaluated relative to two angles of anteversion and abduction, and radii of the cup. Numerical results are obtained by using Abaqus FE system with data related to patient's activity identified on the basis of medical reports.

  2. Optimization of acetabular component orientation using DOE

    NASA Astrophysics Data System (ADS)

    Krepelka, Mircea; Toth-Taşcǎu, Mirela


    Stress shielding is increasingly recognized as an important cause of acetabular component failure. Several studies have been focused on improving the acetabular component placement to reduce the risk of dislocation, impingement and range of motion but little is known of its influence on implant-bone interface pressures. This study employs experimental design, 3D reconstruction and FE simulation to identify the most significant factors for acetabular component behavior and predict the best configuration of acetabular spatial orientation angles within the constraints of the Lewinnek's safe zone in order to minimize peak contact pressures. Data analysis by response surface method revealed that the magnitude of periacetabular pressures was significantly reduced by the anteversion angle at its lowest value as well as the abduction angle located at the central point value, which corresponded to a 40° abduction and 5° anteversion of cup orientation.

  3. Total Hip Arthroplasty Using Modular Trabecular Metal Acetabular Components for Failed Treatment of Acetabular Fractures: A Mid-term Follow-up Study

    PubMed Central

    Huang, De-Yong; Zhang, Liang; Zhou, Yi-Xin; Zhang, Chun-Yu; Xu, Hui; Huang, Yong


    Background: Porous-coated cups have been widely used in acetabular reconstruction after failed treatment of acetabular fractures, and good results have been reported with the use of these cups; however, the durability and functionality of modular trabecular metal (TM) acetabular components in acetabular reconstruction after failed treatment of acetabular fractures remain unclear. This study aimed to examine the radiographic and clinical outcomes associated with the use of modular TM acetabular components for failed treatment of acetabular fractures to assess the durability and functionality of these components in acetabular reconstruction after failed treatment of acetabular fractures. Methods: A total of 41 patients (41 hips) underwent total hip arthroplasty (THA) using modular TM acetabular components for failed treatment of acetabular fractures at our hospital between January 2007 and December 2012. Among these patients, two were lost to follow-up. Therefore, 39 patients (39 hips) were finally included in this study. The Harris hip score before and after the surgery, satisfaction level of the patients, and radiographic results were assessed. Results: The mean Harris hip score increased from 34 (range, 8–52) before surgery to 91 (range, 22–100) at the latest follow-up examination (P < 0.001). The results were excellent for 28 hips, good for six, fair for three, and poor for two. Among the 39 patients, 25 (64%) and 10 (26%) were very satisfied and somewhat satisfied, respectively. All cups were found to be fully incorporated, and no evidence of cup migration or periacetabular osteolysis was noted. Conclusions: Despite the technically demanding nature of the procedure, THA using modular TM acetabular components showed good durability and functionality and may be an effective reconstruction option for failed treatment of acetabular fractures. PMID:27064033

  4. Comparison of one-dimensional and two-dimensional functionally graded materials for the backing shell of the cemented acetabular cup.


    Hedia, H S


    Among the factors that have been suggested as contributing to the failure of a total joint replacement are stress shielding and the subsequent bone resorption. Recent studies have shown that when a backing shell made from a Ti alloy is used, high stresses are generated in the cement at the edges of the cup, and low stresses are generated at the dome of the bone in the acetabulum; thus, the bone at the dome suffers stress shielding and the cement edge suffers high stresses. The aim of this study was to investigate the effect of using a functionally graded material (FGM), instead of Ti alloy, for the backing shell (BS) on the stress distribution in the BS-cement-bone system. Finite-element and optimization techniques were used to obtain the optimal distribution of materials in the tangential direction only of the backing (1D FGM) as well as in the tangential and radial directions of the backing (2D FGM). It was found that the stress distribution in the BS-cement-bone system was about the same, regardless of whether the BS was fabricated from a 1D or 2D FGM. The stress-shielding factor in the bone at the dome of the acetabulum and the maximum von Mises stress in cement at the cement interfaces for 1D and 2D FGM were reduced by about 51%, 69%, and 50%, respectively, compared to the case when the shell was fabricated from a Ti alloy. The optimal elastic modulus of the 1D FGM was obtained with the materials graded from HA at the dome of the acetabulum to a Ti alloy at the rim of the shell. The optimal elastic modulus of the 2D FGM was obtained with the materials graded from Ti alloy at the right edge of the rim, to Bioglass 45S5 at the left edge of the rim, and to HA at the dome of the shell.

  5. Fixation strength analysis of cup to bone material using finite element simulation

    NASA Astrophysics Data System (ADS)

    Anwar, Iwan Budiwan; Saputra, Eko; Ismail, Rifky; Jamari, J.; van der Heide, Emile


    Fixation of acetabular cup to bone material is an important initial stability for artificial hip joint. In general, the fixation in cement less-type acetabular cup uses press-fit and screw methods. These methods can be applied alone or together. Based on literature survey, the additional screw inside of cup is effective; however, it has little effect in whole fixation. Therefore, an acetabular cup with good fixation, easy manufacture and easy installation is required. This paper is aiming at evaluating and proposing a new cup fixation design. To prove the strength of the present cup fixation design, the finite element simulation of three dimensional cup with new fixation design was performed. The present cup design was examined with twist axial and radial rotation. Results showed that the proposed cup design was better than the general version.

  6. Dual-mobility cup and cemented femoral component: 6 year follow-up results.


    Prudhon, Jean Louis


    Use of a dual-mobility acetabular cup is associated with a lower risk of dislocation compared with conventional hip implants. The seleXys® DS acetabular cup combines the advantages of Charnley low-friction arthroplasty with those of dual mobility. We performed a non-randomised, prospective study of patients receiving primary hip arthroplasty, including an uncemented seleXys® DS dual-mobility acetabular cup with hydroxyapatite coating (Mathys AG, Bettlach, Switzerland) and a cemented femoral component (Stallion femoral stem Groupe Lepine, Lyon, France). The objective of the study was to evaluate longevity of the implant and the risk of dislocation. All operations were performed by a single surgeon using a posterior approach, with patients lying in the lateral decubitus position. The stem had a modular head diameter of 22.2 mm and was cemented in all patients. A total of 53 patients were studied, and the median duration of follow-up was 78.9 months. Implant survival 6 years after surgery was 98.4% (n=47; 95% CI: 89.3-99.8). There was one revision for sepsis 29 months after surgery, and one dislocation. The results of this study appear to demonstrate excellent implant survival and a low rate of dislocation using the chosen implants.

  7. Relationship between cup position and obturator externus muscle in total hip arthroplasty

    PubMed Central


    Background It is often challenging to find the causes for postoperative pain syndromes after total hip replacement, since they can be very allotropic. One possible cause is the muscular impingement syndrome. The most commonly known impingement syndrome is the psoas impingement. Another recently described impingement syndrome is the obturator externus muscle impingement. The aim of this study is to analyze pathological conditions of the Obturator externus and to show possible causes. Methods 40 patients who had undergone a total hip replacement were subjected to clinical and MRI examinations 12 months after the surgery. The Harris Hip Score (HHS) was used to analyze pain and function. Additionally, a satisfaction score and a pain score (VAS) were determined. The MRI allowed for the assessment of the spatial relation between the obturator externus muscle and the acetabulum. Also measured were the acetabular inclination angle as well as the volume and cross-sectional area of the obturator externus muscle. Results The patients were assigned to 3 groups in accordance with their MRI results. Group 1 patients (n = 18) showed no contact between the obturator externus and the acetabulum. Group 2 (n = 13) showed contact, and group 3 (n = 9) an additional clear displacement of the muscle in its course. It was not possible to establish a connection between the imaging findings, the HHS, the VAS, and patient satisfaction. What was striking, however, was a significant difference between the median inclination angle in group 1 (40° ± 5.4°) and group 3 (49° ± 4.7°) (p < 0.05), and the corresponding image-morphological pathology. The average inclination angle in group 2 was 43.3° ± 3.8° Conclusion Contact between the obturator externus muscle and the caudal acetabula border occurs frequently, but is only rarely accompanied by a painful muscular impingement. The position of the acetabula must be seen as one of the main risk factors for contact between the acetabula border

  8. Outcomes of polyethylene liner cementation into a fixed metal acetabular shell with minimum follow-up of 7 years.


    Park, Myung-Sik; Yoon, Sun-Jung; Lee, Ju Rang


    Cementation of a polyethylene liner into the well-fixed shell is a convenient option for revision total hip arthroplasty. We retrospectively reviewed 45 patients who had liner cementation to investigate the risk factors which gave rise to major complications and reoperation. Patients were observed for a minimum of 7 years (range 7.8-14 years). Relevant risk factors (age, BMI, surgical approach, previous cup size and position, types of coated surface) were assessed with Cox regression analysis. The mean Harris Hip Score was improved from 62.5 (range 57-68) preoperatively to 87.1 (range 70-97). A total of 7 hips (15.5%) had acetabular component loosening that was treated with reoperation. Prevalence of acetabular component loosening was statistically significantly higher in hydroxyapatite-coated group (5 of 13) than in the Ti-coated group (2 of 32, p = 0.015). All recurrent dislocations occurred in patients treated with a posterior approach. Diameter of the previous metal shell of below 54 mm showed a lower 10-year survival rate than those greater than 54 mm in diameter. PE liner cementation in stable metal cup is a useful alternative option for carefully selected patients. Pre-existing HA-coated cups as well as small sized cups were indicative of poor outcomes.

  9. Non-destructively differentiating the roles of creep, wear and oxidation in long-term in vivo exposed polyethylene cups.


    Pezzotti, Giuseppe; Takahashi, Yasuhito; Takamatsu, Seita; Puppulin, Leonardo; Nishii, Takashi; Miki, Hidenobu; Sugano, Nobuhiko


    Wear of polyethylene acetabular cups in patients of total hip arthroplasty is routinely deduced from the penetration of the femoral head into the acetabular liner as observed in the radiographs. However, the linear penetration thus measured represents the cumulative contribution of two components, one due to wear, and the other due to creep or irreversible deformation of the polyethylene structure. The erroneous attribution to wear of the entire penetration displacement of the head in the cup might lead to misinterpretation of the actual performance of acetabular cups. The aim of this study was to quantify the head displacement components due to wear and to creep, as they occur in vivo in acetabular cups, and to relate them to the oxidation state of the material by means of advanced Raman spectroscopy procedures. Throughout the investigation, we compared the behaviors on the molecular scale of acetabular cups subjected to different sterilization methods (i.e., γ-irradiation and ethylene oxide treatment). PMID:21067657

  10. Early Experience with a New Porous Hemispheric Acetabular Component.


    Berend, Keith R; Adams, Joanne B; Morris, Michael J; Lombardi, Adolph V


    A third-generation cementless acetabular system has been designed, building on the successes of a second-generation system that featured good congruity between the liner and hemispheric shell, and proven porous plasma-sprayed coating on titanium alloy substrate, by designing a ringless barb and groove locking mechanism and optimizing range of motion. These design features are amenable to modern, highly crosslinked polyethylenes. A retrospective review was performed to assess early outcomes. A query of our practice registry revealed 534 patients (576 hips) who underwent cementless total hip arthroplasty performed by three surgeons with the G7™ Acetabular System (Biomet, Warsaw, Indiana) between April 2013 and March 2014. All liners were vitamin E infused, highly crosslinked polyethylene with a neutral face. Heads used were 463 BIOLOX® delta (81%; CeramTec AG, Plochingen, Germany) and 112 cobalt-chromium (19%), with diameters of 32 mm in 238 (41%), 36 mm in 331 (58%), and 40 mm in 6. Minimum one-year follow-up was available for 400 hips. Mean follow-up was 15 months (range 10-24, SD 3.0). Harris hip scores improved from 50.7 preoperatively to 86.5 most recently. UCLA activity scale improved from 4.5 preoperatively to 5.4 most recently. Two patients required cup revision secondary to failure of biological fixation at 8.4 and 15.1 months respectively. Radiographic findings in all cases were satisfactory position and alignment with no radiolucencies observed. In this group, with very early follow-up, good results with a low rate of acetabular revision and no dislocations were achieved using a new hemispheric porous shell with ringless barb and groove locking mechanism and geometry. PMID:26680408

  11. Do the cup surface properties influence the initial stability?


    Goriainov, Vitali; Jones, Andrew; Briscoe, Adam; New, Andrew; Dunlop, Douglas


    This project tests the relationship between the acetabular cup surface characteristics and their initial stability by comparing uncemented (Trabecular Metal (TM) and Trilogy) and cemented polyethylene shells. We hypothesised that different surface properties of uncemented cups will influence the cup stability. Mounted directly onto host bone, TM and cemented cups were significantly more stable than Trilogy cups (P < 0.01), with minimal difference between TM and cemented cups (P > 0.1). On 100% graft bed, there was marginal difference between all three cup types (P > 0.1). Incremental cavitary and segmental defects resulted in reducing stability, with cemented cups being minimally more stable (P > 0.1). TM cups possess satisfactory initial stability in bone graft constructs. This study demonstrates that TM shells are marginally less stable than cemented cups in the absence of significant host bone contact.

  12. The use of cementless acetabular component in revision surgery without pelvic discontinuity.


    Cherubino, Paolo; D'Angelo, Fabio; Surace, Michele Francesco; Murena, Luigi; Vulcano, Ettore


    Reconstruction of the failed acetabular component in total hip arthroplasty (THA) can be challenging. Although there are multiple reconstructive options available, a cementless acetabular component inserted with screws has been shown to have good intermediate-term results and is the reconstructive method of choice for the majority of acetabular revisions This reconstruction is feasible provided at least 50% of the implant contacts host bone. When such contact is not possible, and there is adequate medial and peripheral bone, techniques using alternative uncemented implants can be used for acetabular reconstruction. An uncemented cup can be placed at a "high hip center." Alternatively, the acetabular cavity can be progressively reamed to accommodate extra-large cups. Oblong cups, which take advantage of the oval-shaped cavity resulting from many failed acetabular components, can also be used. The success of these cementless techniques depends on the degree and location of bone loss. The correct indication to revision and the choice of the correct implant is the keystone for the success of this type of surgery and follows an accurate preoperative planning in order to understand the specific pathologic scenario. The aim of this paper is to review some technical options for the revision of the acetabular component also taking into account our personal experiences and series. PMID:21082580

  13. The Results of Long-term Follow-up of Total Hip Arthroplasty Using Hydroxyapatite-coated Cups

    PubMed Central

    Han, Chang-Dong; Shin, Keun-Young; Lee, Hyun-Hee; Park, Kwan-Kyu; Yang, Ick-Hwan


    Purpose The aim of this study was to report the long-term outcome and the failure mechanism of cementless total hip arthroplasty (THA) using hydroxyapatite (HA)-coated acetabular cup. Materials and Methods From January 1992 to May 1994, a total of 123 consecutive cementless primary THAs were performed using a HA-coated acetabular cup with metal-on-polyethylene articulation. We retrospectively evaluated 66 hips available for follow-up at a mean 18.3 years (range, 10.4-23.6 years). The survival analysis was performed by the Kaplan-Meier method. We defined end point as any failure that required a reoperation of acetabular component. Results Thirty-nine of 66 hips (59.1%) were defined as a failure for progressive acetabular osteolysis or aseptic loosening of the cup. Acetabular osteolysis was observed in 47 hips (71.2%) and 33 hips (50.0%) were revised because of cup loosening. The Kaplan-Meier method showed the survival rate of the acetabular cup to be 46.3% at 15 years and 34.8% at 20 years for any failure that required a reoperation of acetabular component. Conclusion The long-term survival rate of THA using HA-coated acetabular cup was unsatisfactory, and it was attributed to vulnerable property of HA coating and progressive osteolysis. PMID:27536628

  14. Implication of acetabular width on the anteroposterior pelvic radiograph of patients with developmental dysplasia of the hip.


    Nie, Yong; Pei, Fuxing; Shen, Bin; Kang, Pengde; Li, Zongming


    Radiographic parameters that can help acetabular reconstruction during total hip arthroplasty (THA) for patients with developmental dysplasia of the hip (DDH) are few. The radiographs of 138 dysplastic hips that had undergone cementless THA were evaluated regarding the acetabular width above the acetabular component and the coverage of the component by native bone. The acetabular reconstruction process was simulated using 3D models from CT data, and the acetabular component coverage was calculated in 3D space based on the measurement and algorithm we proposed. Significant positive correlation between the acetabular width and the acetabular component coverage was found. Our study introduced a useful parameter, which can mark the superior reference position of the acetabular component for acetabular reconstruction in DDH patients. PMID:25311162

  15. Natural acetabular orientation in arthritic hips

    PubMed Central

    Goudie, S. T.; Deakin, A. H.; Deep, K.


    Objectives Acetabular component orientation in total hip arthroplasty (THA) influences results. Intra-operatively, the natural arthritic acetabulum is often used as a reference to position the acetabular component. Detailed information regarding its orientation is therefore essential. The aim of this study was to identify the acetabular inclination and anteversion in arthritic hips. Methods Acetabular inclination and anteversion in 65 symptomatic arthritic hips requiring THA were measured using a computer navigation system. All patients were Caucasian with primary osteoarthritis (29 men, 36 women). The mean age was 68 years (SD 8). Mean inclination was 50.5° (SD 7.8) in men and 52.1° (SD 6.7) in women. Mean anteversion was 8.3° (SD 8.7) in men and 14.4° (SD 11.6) in women. Results The difference between men and women in terms of anteversion was significant (p = 0.022). In 75% of hips, the natural orientation was outside the safe zone described by Lewinnek et al (anteversion 15° ± 10°; inclination 40° ± 10°). Conclusion When using the natural acetabular orientation to guide component placement, it is important to be aware of the differences between men and women, and that in up to 75% of hips natural orientation may be out of what many consider to be a safe zone. Cite this article: Bone Joint Res 2015;4:6–10. PMID:25628463

  16. Expression of keratan sulfate at the arthroplasty surface after cup arthroplasty.


    Yamada, H; Kikuchi, T; Morita, M; Henmi, O; Fujikawa, K; Washimi, O; Terada, N; Seki, T


    Fibrous tissue which regenerated on the acetabular arthroplasty surface was obtained from a 52-year-old woman who underwent total hip replacement after cup arthroplasty. The histological features of this newly formed fibrous tissue and expression of keratan sulfate, which is a characteristic matrix component of articular cartilage, were studied. Microscopic observation revealed that the arthroplasty surface consisted mainly of fibrous tissue which did not show metachromasia with toluidine blue staining, but there were many nodular structures communicating with the bone marrow. Immunostaining for keratan sulfate revealed clear positive staining around the cells of the nodular structures communicating with the bone marrow, while only weakly positive staining was observed in the superficial layer of the loose fibrous tissue. The present study revealed marked formation of articular cartilaginous tissue in areas having good communication with the bone marrow, which indicates that maintenance of this communication may be necessary to improve the outcome of cup arthroplasty.

  17. The potential for bone loss in acetabular structures following THA.


    Manley, Michael T; Ong, Kevin L; Kurtz, Steven M


    Attempts to preserve periacetabular bone stock following total hip replacement have largely ignored the potential for stress shielding in the acetabulum. We sought to quantify the change in stress distribution in acetabular bone with components of varying material stiffness by developing a high-resolution 3-D finite element model from CT scans of a young female donor. Periprosthetic bone stresses and strains on the left pelvis were compared with hemispherical cups of various material properties and with a horseshoe shaped polymeric design described in the recent literature. We observed unphysiologic periacetabular bone stress and strain fields for all designs tested. For hemispherical components, reduction of the acetabular shell material modulus caused modest changes in bone stress compared to the changes in implant geometry. The horseshoe shaped cup more effectively loaded the acetabular structures than the hemispherical design. Our results suggest stress and strain fields in pelvic structures after introduction of hemispherical acetabular components predict inevitable bone adaptation that can not be resolved by changes in implant material properties alone. Radical changes in implant design may be necessary for long-term maintenance of supporting structures in the reconstructed acetabulum.

  18. [Hemispheric hydroxyapatite coated cups in total hip arthroplasty].


    Blacha, J; Bednarek, A; Gagała, J


    The paper presents principles of implantation as well as clinical and radiological results of hemispheric hydroxyapatite coated cups use in total hip replacement. Eighty-seven patients (60 females, 27 males) aged from 16 to 72 years (mean 49 years) underwent 96 total hip replacements with the use of 51 ABG and 45 OCTOFIT hemispheric cups. Clinical results were satisfactory with an average Harris Hip Score of 89 to 91 at final follow-up. We have found total ingrowth and osteointegration of nearly all cups. In one case of acetabular reconstruction with bone grafts cup migration has been observed and revision was necessary.

  19. Cup-cage construct for acute fractures of the acetabulum, re-defining indications.


    Chana-Rodríguez, Francisco; Villanueva-Martínez, Manuel; Rojo-Manaute, Jose; Sanz-Ruíz, Pablo; Vaquero-Martín, Javier


    Acetabular fractures in the elderly are challenging injuries. The use of a trabecular metal acetabular cage was investigated as the treatment option in a series of elderly patients with acetabular fractures. At a 2-year follow up, 6 elderly patients were found to have mimimum pain, increased function, and increased scores using the Merle d'Aubigné and Postel system modified by Charnley. Radiographically, the areas of morsellised autograft that surrounded the cups were seen to have incorporated uniformly well, and the acetabular fractures were healed within six months after surgery. No mechanical failure, screw breakage, loosening, or migration was noticed. This novel indication of the cup-cage construction that uses revision techniques, for selected patients and fractures, to achieve an acute stable reconstruction, should be considered as an alternative reconstruction option in elderly patients presenting with acetabular fractures.

  20. Influences of player nationality, playing position, and height on relative age effects at women's under-17 FIFA World Cup.


    Romann, Michael; Fuchslocher, Jörg


    Previous research has shown that young male soccer players who are born early in a cohort are overrepresented on elite soccer teams. Selection advantages such as this have been termed 'relative age effects' (RAEs). Few studies have examined RAEs in elite women's youth soccer. Therefore, the aim of this study is to investigate the occurrence of RAEs in the Fédération Internationale de Football Association (FIFA) U-17 Women's World Cup competition and their link to playing positions. In the entire cohort of 672 players, we found significant RAEs in the geographical zones of Europe and North and Central America, no RAEs in the zones of Asia, Oceania, and South America, and significant inverse RAEs in the zone of Africa. Additionally, significant RAEs were found for goalkeepers and defenders from Europe and North and Central America. Inverse RAEs occurred for African goalkeepers, defenders, and strikers. Goalkeepers of all zones were significantly taller than players of all other playing positions. The results of this study show that remarkable RAEs do exist at elite women's youth soccer. Similar to men's soccer, there is a bias toward the inclusion of relatively older players, and a link between RAEs and playing positions.

  1. Quantification of clearance and creep in acetabular wear measurements

    PubMed Central

    Gregory, Thomas; Vandenbussche, Eric


    Background This study aimed to measure femoral head penetration before occurrence of real wear, and to quantify the portions attributable respectively to clearance and plastic deformations in various acetabular designs. Methods We analyzed CT scans from 15 patients at ‘day five’ after total hip arthroplasty (THA). All patients received Exafit® femoral stems and 28 mm heads: 5 patients had cemented Durasul® all-PE cups, 5 patients had un-cemented Allofit® metal-backed cups, and 5 patients had un-cemented Stafit® dual-mobility cups. We also analyzed CT scans of samples of the three head-cup combinations to compare in vivo and in vitro measurements. Results The mean femoral head penetration measured on ‘day five’ was lower for all-PE cups (0.196 mm) than for metal-backed cups (0.551 mm) and dual-mobility cups (0.634 mm). Conclusions The present study indicates that isolated measurements of femoral head penetration include 0.15–0.46 mm of radial clearance and 0.05–0.27 mm of creep, and confirms that the majority of so-called bedding-in observed in the first post-operative months is not entirely due to wear. PMID:27162781

  2. Wear versus Thickness and Other Features of 5-Mrad Crosslinked UHMWPE Acetabular Liners

    PubMed Central

    Shen, Fu-Wen; Lu, Zhen


    Background The low wear rates of crosslinked polyethylenes provide the potential to use larger diameters to resist dislocation. However, this requires the use of thinner liners in the acetabular component, with concern that higher contact stresses will increase wear, offsetting the benefits of the crosslinking. Questions/purposes We asked the following questions: Is the wear of conventional and crosslinked polyethylene liners affected by ball diameter, rigidity of backing, and liner thickness? Are the stresses in the liner affected by thickness? Methods Wear rates were measured in a hip simulator and stresses were calculated using finite element modeling. Results Without crosslinking, the wear rate was 4% to 10% greater with a 36-mm diameter than a 28-mm diameter. With crosslinking, wear was 9% lower with a 36-mm diameter without metal backing and 4% greater with metal backing. Reducing the thickness from 6 mm to 3 mm increased the contact stress by 46%, but the wear rate decreased by 19%. Conclusions The reduction in wear with 5 Mrad of crosslinking was not offset by increasing the diameter from 28 mm to 36 mm or by using a liner as thin as 3 mm. Clinical Relevance The results indicate, for a properly positioned 5-Mrad crosslinked acetabular component and within the range of dimensions evaluated, neither wear nor stresses in the polyethylene are limiting factors in the use of larger-diameter, thinner cups to resist dislocation. PMID:20848244

  3. Current concept in dysplastic hip arthroplasty: Techniques for acetabular and femoral reconstruction.


    Bicanic, Goran; Barbaric, Katarina; Bohacek, Ivan; Aljinovic, Ana; Delimar, Domagoj


    Adult patients with developmental dysplasia of the hip develop secondary osteoarthritis and eventually end up with total hip arthroplasty (THA) at younger age. Because of altered anatomy of dysplastic hips, THA in these patients represents technically demanding procedure. Distorted anatomy of the acetabulum and proximal femur together with conjoined leg length discrepancy present major challenges during performing THA in patients with developmental dysplasia of the hip. In addition, most patients are at younger age, therefore, soft tissue balance is of great importance (especially the need to preserve the continuity of abductors) to maximise postoperative functional result. In this paper we present a variety of surgical techniques available for THA in dysplastic hips, their advantages and disadvantages. For acetabular reconstruction following techniques are described: Standard metal augments (prefabricated), Custom made acetabular augments (3D printing), Roof reconstruction with vascularized fibula, Roof reconstruction with pedicled iliac graft, Roof reconstruction with autologous bone graft, Roof reconstruction with homologous bone graft, Roof reconstruction with auto/homologous spongious bone, Reinforcement ring with the hook in combination with autologous graft augmentation, Cranial positioning of the acetabulum, Medial protrusion technique (cotyloplasty) with chisel, Medial protrusion technique (cotyloplasty) with reaming, Cotyloplasty without spongioplasty. For femoral reconstruction following techniques were described: Distraction with external fixator, Femoral shortening through a modified lateral approach, Transtrochanteric osteotomies, Paavilainen osteotomy, Lesser trochanter osteotomy, Double-chevron osteotomy, Subtrochanteric osteotomies, Diaphyseal osteotomies, Distal femoral osteotomies. At the end we present author's treatment method of choice: for acetabulum we perform cotyloplasty leaving only paper-thin medial wall, which we break during acetabular

  4. Uncemented porous tantalum acetabular components: early follow-up and failures in 613 primary total hip arthroplasties.


    Noiseux, Nicolas O; Long, William J; Mabry, Tad M; Hanssen, Arlen D; Lewallen, David G


    Uncemented tantalum acetabular components were introduced in 1997. The purpose was to determine the 2- to 10-year results with this implant material in primary total hip arthroplasty. Our registry identified all primary total hip cases with porous tantalum cups implanted from 1997 to 2004. Clinical outcomes and radiographs were studied. 613 cases were identified. Seventeen percent of patients were lost to follow-up. Twenty-five reoperations were performed (4.4%). Acetabular cup removal occurred in 6 cases (1.2%). No cups were revised for aseptic loosening. Incomplete radiolucent lines were found on 9.3% of initial postoperative radiographs. At 2 years, 67% had resolved. Zero new radiolucent lines were detected. Two- to 10-year results of porous tantalum acetabular components for primary total hip arthroplasty demonstrate high rates of initial stability and apparent ingrowth.

  5. Influence of cementless cup surface on stability and bone fixation 2 years after total hip arthroplasty.


    Urbański, Wiktor; Krawczyk, Artur; Dragan, Szymon Ł; Kulej, Mirosław; Dragan, Szymon F


    Loss of fixation between bone and implant surface is one of the main treatment problems in total hip arthroplasty. It might lead to implant instability, bone loss and treatment failure resulting in revision surgery. Surface modification is a method for improving bone response to implant and increasing implant osseointegration. However, the currently applied modifications such as hydroxyapatite coatings do not meet expectation and do not provide good clinical result. The object of the study was to evaluate the influence of acetabular cup surface modification on fixation and bone remodelling in total hip arthroplasty. Clinical and radiological outcomes were evaluated in patients two years after cementless total hip replacement. Two groups were compared: patients with acetabular component with uncoated titanium surface and patients with hydroxyapatite-coated acetabular surface. Hips X-rays were analysed for early signs of losing stability of acetabular cups. Two years after surgery the analysis of X-rays did not reveal any statistical differences in stability, migration of acetabular components of endoprosthesis between both groups. No differences were also observed in bone remodelling around implants. Particularly high percentage of cups, i.e. 17.64%, were classified into the group with high risk of early implant loosening, i.e., the group with HA coatings. Hydroxyapatite coatings on titanium cementless acetabular cups implanted by press-fit technique have no influence on their stability, bone-implant fixation and the remodelling of bone surrounding an implant two years after surgery.

  6. Porous Tantalum Buttress Augments for Severe Acetabular Posterior Column Deficiency.


    Meneghini, R Michael; Hull, Jason R; Russo, Glenn S; Lieberman, Jay R; Jiranek, William A


    In revision total hip arthroplasty (THA), consensus is lacking regarding the optimal method for reconstruction of the most severe acetabular defects. Porous tantalum (TM) buttress augments were designed for the most severe postero-superior defects. The purpose of this study was to report the results of a consecutive series of acetabular reconstructions utilizing TM buttress augments. Eight complex acetabular reconstructions utilizing a TM buttress augment were performed at two centers. All were Paprosky 3A or Paprosky 3B bone loss classification, with severe superior and posterior column deficiency where wedge augments were insufficient for mechanical support. The acetabular cup sizes ranged from 64-78, and a buttress shim was used in 7 of 8 cases. Clinical and radiographic follow-up averaged 16.5 months (range, 10-28) and no cases were lost to follow-up. There were no cases of clinical or radiographic loosening, and no case had required reoperation or revision. All patients except one were ambulating with either no assist device or a single cane at final follow-up. There was one complication of an iliac wing fracture noted incidentally on postoperative x-rays in the lone patient in whom a buttress shim was not used. At short-term follow-up, TM acetabular buttress augments appear to effectively substitute for the use of structural allografts or cages, which would otherwise be used in this challenging setting. The potential for biologic fixation is promising for the durability of these reconstructions; however, longer-term follow-up is required for full evaluation.

  7. Modern dual-mobility cup implanted with an uncemented stem: about 100 cases with 12-year follow-up.


    Philippot, Remi; Meucci, Jean Francois; Boyer, Bertrand; Farizon, Frederic


    We report the results of a 12-year follow-up retrospective series of 100 total hip arthroplasties using cementless, press-fit, dual-mobility acetabular cups. The aim of our study was to evaluate the clinical and radiographic results of this acetabular cup at last follow-up. This continuous and homogeneous series included 100 primary total hip arthroplasties performed during the year 2000. The THA combined a Corail® stem (Corail®, Depuy, Warsaw, IN) with a stainless steel Novae Sunfit® (Serf, Decines, France) acetabular cup. Fifteen patients died and 2 were lost to follow-up. Two cases of early dislocation were observed, and 3 cases of aseptic loosening of the acetabular component were reported. The mean stem subsidence was 0.71 mm, the mean craniopodal acetabular migration was 1.37 mm, and the mean medio-lateral acetabular migration was 1.52 mm. The 12-year survivorship is comparable to the data from the literature. The low dislocation rate at 12 years confirms the long-term, high stability of dual mobility, which should be recommended in primary THA for patients at risk for postoperative instability. The absence of true intraprosthetic dislocation events at 12-year follow-up provides evidence of the good quality of the latest generation of polyethylene liners and the necessity of combining thin-mirror, polished femoral necks with dual-mobility cups.

  8. Late fiber metal shedding of the first and second-generation Harris Galante acetabular component. A report of 5 cases.


    Mayman, David J; González Della Valle, Alejandro; Lambert, Edward; Anderson, John; Wright, Timothy; Nestor, Bryan; Sculco, Thomas P; Salvati, Eduardo A


    Five patients presented with fiber metal mesh shedding of a Harris Galante II acetabular cup detected between 11 and 15 years after implantation. All patients presented with hip pain and 4 demonstrated gross acetabular loosening and fiber metal separation on preoperative radiographs. The remaining patient underwent revision surgery because of a liner dislodgment and had a radiographically well fixed shell. Loosening and fiber metal separation were detected intraoperatively. Scanning electron microscopy of the retrieved shells demonstrated isolated diffusion bonding marks in the areas where the mesh separated from the substrate and no evidence of corrosion. Progressive osteolysis in the iliac bone was evident in 4 of our cases. Progressive iliac osteolysis may lead to loss of bone support in well-fixed cups and excessive stresses transferred to the interface between the fiber metal mesh and the titanium substrate leading to the separation of the 2 layers. Fiber metal separation may contribute to long-term loosening in the Harris Galante acetabular component.

  9. Open-configuration MRI study of femoro-acetabular impingement.


    Yamamura, Mitsuyoshi; Miki, Hidenobu; Nakamura, Nobuo; Murai, Masakazu; Yoshikawa, Hideki; Sugano, Nobuhiko


    Femoro-acetabular impingement has been proposed as a causative factor of primary hip osteoarthritis. However, primary osteoarthritis of the hip is infrequent in Japan and other Asian countries, even though the hips of Asians frequently sustain impingement, since the Asian lifestyle commonly requires a larger range of hip motion than the Western lifestyle. Therefore, using open-configuration MRI, we investigated whether impingement actually occurs during some traditional Japanese hip positions. The hips of 5 healthy Japanese females were examined in 5 sitting postures: 1) sitting straight; 2) bowing while sitting straight; 3) sitting cross-legged; 4) W-sitting; and 5) squatting. The impingement point was detected by multiple plane reconstructed (MPR) views along with the acetabular rim depicted circumferentially. Impingement was considered to have occurred when, on MRI, the anterior femoral head-neck junction approached the acetabular rim and the femoral head was seen to float from the bottom of the acetabulum with the acetabular rim acting as a fulcrum. Impingement was observed in all volunteers in the W-sitting position, and in 2 of 5 volunteers during squatting. These findings show that impingement occurs frequently during daily Japanese activities. Thus, depending on race, femoro-acetabular impingement might not always cause primary osteoarthritis of the hip. (c) 2007 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 25:1582-1588, 2007. PMID:17600811

  10. Traumatic Periprosthetic Acetabular Fracture Treated with One-Stage Exchange and Bone Reconstruction Using a Synthetic Bone Graft Substitute

    PubMed Central


    A case of a traumatic periprosthetic acetabular fracture in an elderly patient, which was treated by one-stage hip exchange with implantation of an antiprotrusio cage and reconstruction of the acetabular bone loss with an injectable calcium sulphate/hydroxyapatite bone graft substitute, is reported. The paste-like bone graft substitute was injected through the holes of the antiprotrusio cage. After a setting time of 15 minutes, a low-profile cup was cemented onto the cage using polymethylmethacrylate and a new stem was inserted. The patient was encouraged to ambulate three days postoperatively weight-bearing as tolerated. At the one-year follow-up visit the patient was ambulatory and full weight-bearing without any walking aids. The follow-up radiographs demonstrated stable position and articulation of the revision hip arthroplasty with no signs of loosening of the antiprotrusio cage. However, the most interesting finding was that the bone graft substitute had remodelled to a great extent into bone. This calcium sulphate/hydroxyapatite composite shows high osteoconductive potential and can be used to regenerate bone stock in revision arthroplasty. PMID:27446621

  11. Uncemented acetabular components with femoral head autograft for acetabular reconstruction in developmental dysplasia of the hip: a concise follow-up report at a mean of twenty years.


    Abdel, Matthew P; Stryker, Louis S; Trousdale, Robert T; Berry, Daniel J; Cabanela, Miguel E


    We previously reported the five to twelve-year results of total hip arthroplasty with an uncemented acetabular component and an autogenous femoral head graft in forty-four consecutive hips with developmental dysplasia. The goal of the present study was to report the implant survival rate, status of bone grafts, and clinical outcomes in thirty-five of these hips (in twenty-nine patients) followed for a mean of 21.3 years. Functional, radiographic, and survivorship results were examined. Radiographic analysis revealed an average cup inclination angle of 43° and a mean arc of cup coverage by the graft of 30°. The twenty-year survivorship free from acetabular revision was 66% (twelve acetabular revisions; eight since our previous report). Of the twelve revisions, nine were for liner wear and/or osteolysis, one was for a liner fracture, one was for aseptic loosening, and one was for instability. All bone grafts healed to the pelvis. The graft facilitated revision cup placement as no additional structural grafts or metal augments were required. We concluded that an uncemented porous-coated socket used in conjunction with a bulk femoral head autograft provides good long-term fixation and restores bone stock. PMID:25410505

  12. Evaluating the accuracy of wear formulae for acetabular cup liners.


    Wu, James Shih-Shyn; Hsu, Shu-Ling; Chen, Jian-Horng


    This study proposes two methods for exploring the wear volume of a worn liner. The first method is a numerical method, in which SolidWorks software is used to create models of the worn out regions of liners at various wear directions and depths. The second method is an experimental one, in which a machining center is used to mill polyoxymethylene to manufacture worn and unworn liner models, then the volumes of the models are measured. The results show that the SolidWorks software is a good tool for presenting the wear pattern and volume of a worn liner. The formula provided by Ilchmann is the most suitable for computing liner volume loss, but is not accurate enough. This study suggests that a more accurate wear formula is required. This is crucial for accurate evaluation of the performance of hip components implanted in patients, as well as for designing new hip components.

  13. Targeting a New Safe Zone: A Step in the Development of Patient-Specific Component Positioning for Total Hip Arthroplasty.


    McLawhorn, Alexander S; Sculco, Peter K; Weeks, K Durham; Nam, Denis; Mayman, David J


    Surgeons often target the Lewinnek zone, with its mean (SD) inclination of 40° (10°) and mean (SD) anteversion of 15° (10°), for acetabular orientation during total hip arthroplasty (THA). However, matching native anteversion (20°-25°) may achieve optimal stability. We conducted a study in a large single-surgeon patient cohort to determine the incidence of early postoperative dislocation with increased acetabular anteversion and the accuracy of imageless navigation in achieving target acetabular position. Soft-tissue repair through a posterolateral approach was performed in 553 THAs that met the inclusion criteria. Mean (SD) target acetabular orientation was 40° (10°) of inclination and 25° (10°) of anteversion. Software was used to measure acetabular positioning on postoperative radiographs. Incidence of dislocation within 6 months after surgery was determined. Mean (SD) inclination was 42.2° (4.9°), and mean (SD) anteversion was 23.9° (6.5°). Approximately 82% of cups were placed in the target zone. Variation in anteversion accounted for 67.3% of outliers. Only body mass index was associated with inclination outside the target range (P = .017), and only female sex was associated with anteversion outside the target range (P = .030). Six THAs (1.1%) experienced early dislocation, and 3 (0.54%) of these were revised for multiple dislocations. There was no relationship between dislocation and component placement in either the Lewinnek zone (P = .224) or the target zone (P = .287). PMID:26046997

  14. Use of porous tantalum for acetabular reconstruction in revision hip arthroplasty.


    Issack, Paul S


    ➤ Over the past decade, porous tantalum has emerged as a powerful tool for reconstruction of the failed acetabular component.➤ The increased porosity, high coefficient of friction, and favorable elastic modulus of porous tantalum compared with traditional titanium mesh or cobalt chromium acetabular components allow for greater bone ingrowth potential, implant stability, and host bone preservation, respectively, in porous tantalum shells.➤ Several studies have confirmed the excellent early and midterm results of porous tantalum reconstruction for revision hip arthroplasty.➤ Depending on the degree of bone loss, excellent results have been achieved with modular or revision porous tantalum shells, tantalum shells with tantalum augments, and cup-cage constructs.➤ These implants and techniques are greatly changing the approach to acetabular revision surgery and are providing constructs with greater stability and more physiologic biomechanical properties than those achieved through the use of traditional reconstructive methods.

  15. Improving the detection of acetabular osteolysis using oblique radiographs.


    Southwell, D G; Bechtold, J E; Lew, W D; Schmidt, A H


    Visualisation of periacetabular osteolysis by standard anteroposterior (AP) radiographs underestimates the extent of bone loss around a metal-backed acetabular component. We have assessed the effectiveness of standard radiological views in depicting periacetabular osteolysis, and recommend additional projections which make these lesions more visible. This was accomplished using a computerised simulation of radiological views and a radiological analysis of simulated defects placed at regular intervals around the perimeter of a cadaver acetabulum. The AP view alone showed only 38% of the defects over all of the surface of the cup and failed to depict a 3 mm lesion over 83% of the cup. When combined with the AP view, additional 45 degree obturator-oblique and iliac-oblique projections increased the depiction, showing 81% of the defects. The addition of the 60 degree obturator-oblique view further improved the visualisation of posterior defects, increasing the rate of detection to 94%. Based on this analysis, we recommend using at least three radiographic views when assessing the presence and extent of acetabular osteolysis. PMID:10204936

  16. Direct high-resolution ion beam-profile imaging using a position-sensitive Faraday cup array.


    Panitzsch, Lauri; Stalder, Michael; Wimmer-Schweingruber, Robert F


    Ion sources have wide-spread use in a multitude of applications. For many, an accurate knowledge, or better, an accurate imaging, of the beam profile and intensity is an important criterion. We are developing an ion source to calibrate instruments for space-based measurements of solar wind and suprathermal particles in the energy range from below 1 keV/nuc to above 200 keV/nuc. In order to establish accurate beam profiles for calibration purposes, we have developed a new method based on an array of very small (diameter = 0.3 mm) Faraday cups. Here, we describe the experimental setup and discuss how to achieve several requirements such as a large thermal load due to the approximately 40 W of beam power.

  17. Direct high-resolution ion beam-profile imaging using a position-sensitive Faraday cup array

    SciTech Connect

    Panitzsch, Lauri; Stalder, Michael; Wimmer-Schweingruber, Robert F.


    Ion sources have wide-spread use in a multitude of applications. For many, an accurate knowledge, or better, an accurate imaging, of the beam profile and intensity is an important criterion. We are developing an ion source to calibrate instruments for space-based measurements of solar wind and suprathermal particles in the energy range from below 1 keV/nuc to above 200 keV/nuc. In order to establish accurate beam profiles for calibration purposes, we have developed a new method based on an array of very small (diameter = 0.3 mm) Faraday cups. Here, we describe the experimental setup and discuss how to achieve several requirements such as a large thermal load due to the {approx}40W of beam power.

  18. Acetabular rim and surface segmentation for hip surgery planning and dysplasia evaluation

    NASA Astrophysics Data System (ADS)

    Tan, Sovira; Yao, Jianhua; Yao, Lawrence; Summers, Ronald M.; Ward, Michael M.


    Knowledge of the acetabular rim and surface can be invaluable for hip surgery planning and dysplasia evaluation. The acetabular rim can also be used as a landmark for registration purposes. At the present time acetabular features are mostly extracted manually at great cost of time and human labor. Using a recent level set algorithm that can evolve on the surface of a 3D object represented by a triangular mesh we automatically extracted rims and surfaces of acetabulae. The level set is guided by curvature features on the mesh. It can segment portions of a surface that are bounded by a line of extremal curvature (ridgeline or crestline). The rim of the acetabulum is such an extremal curvature line. Our material consists of eight hemi-pelvis surfaces. The algorithm is initiated by putting a small circle (level set seed) at the center of the acetabular surface. Because this surface distinctively has the form of a cup we were able to use the Shape Index feature to automatically extract an approximate center. The circle then expands and deforms so as to take the shape of the acetabular rim. The results were visually inspected. Only minor errors were detected. The algorithm also proved to be robust. Seed placement was satisfactory for the eight hemi-pelvis surfaces without changing any parameters. For the level set evolution we were able to use a single set of parameters for seven out of eight surfaces.

  19. Design optimization of cementless metal-backed cup prostheses using the concept of functionally graded material.


    Hedia, H S; El-Midany, T T; Shabara, M A N; Fouda, N


    Metal backing has been widely used in acetabular cup design. A stiff backing for a polyethylene liner was initially believed to be mechanically favourable. Yet, recent studies of the load transfer around acetabular cups have shown that a stiff backing causes two problems. It generates higher stress peaks around the acetabular rim than those caused by full polyethylene cups and reduces the stresses transferred to the dome of the acetabulum causing stress shielding. The aim of this study is to overcome these two problems by improving the design of cementless metal-backed acetabular cups using the two-dimensional functionally graded material (FGM) concept through finite-element analysis and optimization techniques. It is found that the optimal 2D FGM model must have three bioactive materials of hydroxyapatite, Bioglass and collagen. This optimal material reduces the stress shielding at the dome of the acetabulum by 40% and 37% compared with stainless steel and titanium metal backing shells, respectively. In addition, using the 2D FGM model reduces the maximum interface shear stress in the bone by 31% compared to the titanium metal backing shell.

  20. Cross-sectional Anatomy of Ilium for Guiding Acetabular Component Placement Using High Hip Center Technique in Asian Population

    PubMed Central

    Xiao, Jian-Lin; Zuo, Jian-Lin; Liu, Peng; Qin, Yan-Guo; Li, Xue-Zhou; Liu, Tong; Gao, Zhong-Li


    Background: Many clinical studies have been published involving the use of a high hip center (HHC), achieved good follow-up. However, there is a little anatomic guidance in the literature regarding the amount of bone stock available for initial implant coverage in this area of the ilium. The purpose of this study was to evaluate the thickness and width of the human ilium and related acetabular cup coverage for guiding acetabular component placement in HHC. Methods: A total of 120 normal hips in 60 cases of adult patients from lower extremities computer tomographic angiography Digital Imaging and Communications in Medicine data were chosen for the study. After importing the data to the mimics software, we chose the cross sections every 5-mm increments from the rotational center of the hip to the cephalic of the ilium according the body sagittal axis, then we measured the thickness and width of the ilium for each cross section in axial plane, calculated the cup coverage at each chosen section. Results: At the acetabular dome, the mean thickness and width of the ilium were 49.71 ± 4.88 mm and 38.92 ± 3.67 mm, respectively, whereas at 1 cm above the dome, decreased to 41.35 ± 5.13 and 31.13 ± 3.37 respectively, and 2 cm above the dome, decreased to 31.25 ± 4.04 and 26.65 ± 3.43, respectively. Acetabular cup averaged coverage for 40-, 50-, and 60-mm hemispheric shells, was 100%, 89%, and 44% at the acetabular dome, 100%, 43.7%, and 27.5% for 1 cm above the dome, and 37.5%, 21.9%, and 14.2% for 2 cm above the dome. Conclusions: HHC reconstructions within 1 cm above the acetabular dome will be an acceptable and smaller diameter prosthesis would be better. PMID:26063357

  1. The effect of cup outer sizes on the contact mechanics and cement fixation of cemented total hip replacements.


    Hua, Xijin; Li, Junyan; Wang, Ling; Wilcox, Ruth; Fisher, John; Jin, Zhongmin


    One important loosening mechanism of the cemented total hip arthroplasty is the mechanical overload at the bone-cement interface and consequent failure of the cement fixation. Clinical studies have revealed that the outer diameter of the acetabular component is a key factor in influencing aseptic loosening of the hip arthroplasty. The aim of the present study was to investigate the influence of the cup outer diameter on the contact mechanics and cement fixation of a cemented total hip replacement (THR) with different wear penetration depths and under different cup inclination angles using finite element (FE) method. A three-dimensional FE model was developed based on a typical Charnley hip prosthesis. Two acetabular cup designs with outer diameters of 40 and 43 mm were modelled and the effect of cup outer diameter, penetration depth and cup inclination angle on the contact mechanics and cement fixation stresses in the cemented THR were studied. The results showed that for all penetration depths and cup inclination angles considered, the contact mechanics in terms of peak von Mises stress in the acetabular cup and peak contact pressure at the bearing surface for the two cup designs were similar (within 5%). However, the peak von Mises stress, the peak maximum principal stress and peak shear stress in the cement mantle at the bone-cement interface for the 43 mm diameter cup design were predicted to be lower compared to those for the 40 mm diameter cup design. The differences were predicted to be 15-19%, 15-22% and 18-20% respectively for different cup penetration depths and inclination angles, which compares to the clinical difference of aseptic loosening incidence of about 20% between the two cup designs.

  2. The effect of cup outer sizes on the contact mechanics and cement fixation of cemented total hip replacements.


    Hua, Xijin; Li, Junyan; Wang, Ling; Wilcox, Ruth; Fisher, John; Jin, Zhongmin


    One important loosening mechanism of the cemented total hip arthroplasty is the mechanical overload at the bone-cement interface and consequent failure of the cement fixation. Clinical studies have revealed that the outer diameter of the acetabular component is a key factor in influencing aseptic loosening of the hip arthroplasty. The aim of the present study was to investigate the influence of the cup outer diameter on the contact mechanics and cement fixation of a cemented total hip replacement (THR) with different wear penetration depths and under different cup inclination angles using finite element (FE) method. A three-dimensional FE model was developed based on a typical Charnley hip prosthesis. Two acetabular cup designs with outer diameters of 40 and 43 mm were modelled and the effect of cup outer diameter, penetration depth and cup inclination angle on the contact mechanics and cement fixation stresses in the cemented THR were studied. The results showed that for all penetration depths and cup inclination angles considered, the contact mechanics in terms of peak von Mises stress in the acetabular cup and peak contact pressure at the bearing surface for the two cup designs were similar (within 5%). However, the peak von Mises stress, the peak maximum principal stress and peak shear stress in the cement mantle at the bone-cement interface for the 43 mm diameter cup design were predicted to be lower compared to those for the 40 mm diameter cup design. The differences were predicted to be 15-19%, 15-22% and 18-20% respectively for different cup penetration depths and inclination angles, which compares to the clinical difference of aseptic loosening incidence of about 20% between the two cup designs. PMID:26343226

  3. Options for acetabular fixation surfaces.


    Klika, Alison K; Murray, Trevor G; Darwiche, Hussein; Barsoum, Wael K


    Aseptic loosening is the most common cause for revision total hip arthroplasty (THA). Due to poor long-term results with cemented acetabular components, cementless implants that rely on biologic fixation became popular in the United States for both primary and revision procedures in the early 1980s. Cementless acetabular components used in THA have been reported to have superior radiographic performance compared with cemented fixation, although the optimal method of acetabular fixation remains controversial. Cementless acetabular components require initial implant stability to allow for bone ingrowth and remodeling into the acetabular shell, providing long-term durability of the prosthesis. Many improved implant materials are available to facilitate bone growth and remodeling, including the 3 most common surface treatments; fibermesh, sintered beads, and plasma spray coatings. Recently added to these are porous metal surfaces, which have increased porosity and optimal pore sizes when compared with titanium fibermesh. The most studied of these materials is the titanium fibermesh fixation surface, which has demonstrated a mechanical failure rate of 1% at 10 to 15 years. This technology utilizes the diffusion bonding process to attach fiber metal pads to a titanium substrate using heat and pressure. The sintered bead fixation surface offers a porous coating of various sizes of spherical beads, achieved by the sintering process, and has been shown to provide long-term fixation. While there are less long-term published data regarding the titanium plasma spray surface, its early results have provided evidence of its durability, even in the face of significant osteolysis. The most recently added alternative fixation surface is porous tantalum metal, which offers potentially greater bone ingrowth and bone graft incorporation due to its high porosity (80%) and low modulus of elasticity (3 MPa). Porous tantalum implants have shown early favorable clinical results and have

  4. Exploring Volumetrically Indexed Cups

    ERIC Educational Resources Information Center

    Jones, Dustin L.


    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup "n" is equal to "n" times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to…

  5. Wear of polyethylene cups in total hip arthroplasty: a parametric mathematical model.


    Pietrabissa, R; Raimondi, M; Di Martino, E


    This paper presents a parametric mathematical model of the head-cup wear coupling in total hip arthroplasty (THA). The model evaluates the dependence of acetabular volumetric wear upon the characteristic parameters of patient and hip prosthesis. Archard's law is assumed to calculate the wear coupling behaviour. The wear factor is taken from pin-on-disc wear tests as a function of materials and finishing of the articular joint. The forces acting on the hip joint are taken from experimental data found in the literature whilst the load distribution is calculated under the hypotheses of perfectly rigid ideal wear coupling. The sliding distance is obtained by combining the three elementary displacements -- due to rotations around the three axes -- at the generic bearing surface location. The simulations show that the polymeric wear volume per step cycle decreases ranging from fast walking speeds to low running speeds, it increases linearly with patient body weight and with femoral head diameter, it decreases slightly for positive variations of the socket inclination angle and it increases exponentially with femoral head roughness. The volumetric wear rate per year calculated for a standard reference patient is 5.8 mm3. The relevant iso-wear maps show a marginal pattern with the maximum located near the cup superior borderline. At the instant of peak load, the iso-stress maps show a paracentral pattern with the maximum superior to the cup polar point, and the iso-sliding distance maps show a marginal pattern with two maxima located near the cup's superior and inferior borderlines. PMID:9690490

  6. Higher wear-rate of third-generation metal-backed Reflection cups with eto-sterilised UHMWPE at a mean 13 years follow-up.


    Hengst, David M; Thomsen, Per B; Homilius, Morten; Hansen, Torben B; Stilling, Maiken


    Polyethylene (PE) wear and osteolysis is a recognised problem with non-cross linked PE liners and first generation modular cup designs. Wear particles induce osteolysis leading to aseptic loosening. We retrospectively compared the linear PE wear and implant survival and revision rates of the Reflection Cup and the Duraloc 300. After a mean clinical follow-up of 13 years (range 11-15 years), the 2D linear PE wear-rate of the Reflection liner (n = 68) was 0.23 mm/year, with a mean total wear of 3.14 mm (1.04-7.36), SD 1.45. The wear-rate of the Duraloc 300 cups (n = 32) was 0.14 mm/year, with a mean total wear of 1.84 mm (0.55-4.63), SD 1.07. The difference in PE wear-rate as well as mean total wear was highly significant (p = 0.0001). There was a positive correlation between wear-rate and both Oxford Hip Score and Harris Hip Score (p = 0.02). Large acetabular cup size (>54 mm), HA coating on the stem and age <50 years did not influence PE wear. The higher wear-rate in the Reflection liners could be related to the EtO sterilisation. Intermediate and long-term follow-up is advisable.

  7. Uncemented Porous Tantalum Acetabular Components: Early Follow-Up and Failures in 599 Revision Total Hip Arthroplasties

    PubMed Central

    Long, William J.; Noiseux, Nicolas O.; Mabry, Tad M.; Hanssen, Arlen D.; Lewallen, David G.


    Background The purpose of this study was to determine the early outcomes of 599 cases of revision THA performed using a porous tantalum cup. Methods Clinical and radiographic data was sought in all patients at a minimum two years follow-up, after acetabular revision performed with a porous tantalum cup. Results Of the 599 cases identified, there were 51 re-operations in 47 patients (7.8 percent). Cup removal was required in 14 of these cases (2.3 percent). The most common cause for cup removal was a septic joint (12). No cups were revised for aseptic loosening during the study period. There was one case of early cup migration. There were 17 incomplete lucencies not initially seen on post-operative films, but identified later, all were non-progressive on subsequent x-rays. Conclusions Early results of porous tantalum acetabular components in the revision setting demonstrate good initial stability and low re-operation rates at two years follow-up. Level of Evidence Level 4: Case series PMID:26361451

  8. Impaction grafted bone chip size effect on initial stability in an acetabular model: Mechanical evaluation

    PubMed Central

    Holton, Colin; Bobak, Peter; Wilcox, Ruth; Jin, Zhongmin


    Introduction Acetabular bone defect reconstruction is an increasing problem for surgeons with patients undergoing complex primary or revision total hip replacement surgery. Impaction bone grafting is one technique that has favourable long-term clinical outcome results for patients who undergo this reconstruction method for acetabular bone defects. Creating initial mechanical stability of the impaction bone graft in this technique is known to be the key factor in achieving a favourable implant survival rate. Different sizes of bone chips were used in this technique to investigate if the size of bone chips used affected initial mechanical stability of a reconstructed acetabulum. Methodology Twenty acetabular models were created in total. Five control models were created with a cemented cup in a normal acetabulum. Then five models in three different groups of bone chip size were constructed. The three groups had an acetabular protrusion defect reconstructed using either; 2–4 mm3, 10 mm3 or 20 mm3 bone chip size for impaction grafting reconstruction. The models underwent compression loading up to 9500 N and displacement within the acetabular model was measured indicating the initial mechanical stability. Results This study reveals that, although not statistically significant, the largest (20 mm3) bone chip size grafted models have an inferior maximum stiffness compared to the medium (10 mm3) bone chip size. Interpretations Our study suggests that 10 mm3 size of bone chips provide better initial mechanical stability compared to smaller or larger bone chips. We dismissed the previously held opinion that the biggest practically possible graft is best for acetabular bone graft impaction. PMID:24396238

  9. Long-term results of the threaded Mecron cup in primary total hip arthroplasty

    PubMed Central

    Clarius, Michael; Jung, Alexander W.; Streit, Marcus R.; Merle, Christian; Raiss, Patric


    In the 1970s, high failure rates of cemented acetabular components, especially in young patients, in the middle- and long-term prompted a search for alternatives. The Mecring was one of the most popular first generation uncemented, threaded cups widely used in the 1980s for arthroplasty of the hip. First generation threaded cups commonly had smooth surface treatment and showed unacceptably high failure rates in the mid-term. In a consecutive series of 209 patients, 221 threaded uncemented acetabular cups with smooth surface treatment (Mecring) had been implanted in combination with one type of uncemented stem. Patients were followed up clinically and radiographically. The mean time of follow-up was 17 (range 15–20) years. In 91 (41%) hips the acetabular component had been revised or was awaiting revision: two hips for infection and 84 (38%) for aseptic loosening. Five hips were awaiting revision. The survival rate for all revisions including hips awaiting revision was 49% (95% CI: 41–57%) at 17 years. These results support the view that smooth, threaded acetabular components do not provide satisfactory long-term fixation and should be abandoned. Patients with these components must be closely monitored as the failure rate remains high in the long-term. PMID:19629481

  10. Imaging of the acetabular labrum.


    Thomas, James D; Li, Zhi; Agur, Anne M; Robinson, Philip


    The evaluation and proposed relevance of acetabular labral tears has rapidly evolved over the last decade due to the recognition of femoroacetabular impingement, an increase in the number of surgical options, and improved imaging of the hip with MR arthrography and 3-T MR protocols. The acetabular labrum, stabilizing the hip joint, provides a seal, enhancing fluid lubrication, maintains synovial pressure, and prevents direct contact of the articular surfaces. The labrum takes on a weightbearing role at the extremes of motion with excessive forces seen in a great number of athletic activities thought to contribute to tearing. Approximately 25% of labral tears are not associated with any specific injury or traumatic event with the underlying etiology thought to be repetitive microtrauma. This article reviews the anatomy of the acetabular labrum and discusses the five most commonly occurring etiologies of labral tears: trauma, femoroacetabular impingement, hip hypermobility, dysplasia, and degeneration. We also review the surgical and MR classification of labral tears and describe potential pitfalls in image interpretation. PMID:23787979

  11. Acetabular protrusio: surgical technique of dealing with a problem in depth.


    Mullaji, A B; Shetty, G M


    There are few reports describing the technique of managing acetabular protrusio in primary total hip replacement. Most are small series with different methods of addressing the challenges of significant medial and proximal migration of the joint centre, deficient medial bone and reduced peripheral bony support to the acetabular component. We describe our technique and the clinical and radiological outcome of using impacted morsellised autograft with a porous-coated cementless cup in 30 primary THRs with mild (n = 8), moderate (n = 10) and severe (n = 12) grades of acetabular protrusio. The mean Harris hip score had improved from 52 pre-operatively to 85 at a mean follow-up of 4.2 years (2 to 10). At final follow-up, 27 hips (90%) had a good or excellent result, two (7%) had a fair result and one (3%) had a poor result. All bone grafts had united by the sixth post-operative month and none of the hips showed any radiological evidence of recurrence of protrusio, osteolysis or loosening. By using impacted morsellised autograft and cementless acetabular components it was possible to achieve restoration of hip mechanics, provide a biological solution to bone deficiency and ensure long-term fixation without recurrence in arthritic hips with protrusio undergoing THR. PMID:24187349

  12. Exploring volumetrically indexed cups

    NASA Astrophysics Data System (ADS)

    Jones, Dustin L.


    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup n is equal to n times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to geometry, algebra and differential calculus. Students with an understanding of these topics should be able to complete the analysis and related exercises contained herein.

  13. Computer-Assisted Rotational Acetabular Osteotomy for Patients with Acetabular Dysplasia

    PubMed Central

    Kobayashi, Naomi; Ike, Hiroyuki; Kubota, So; Saito, Tomoyuki


    Rotational acetabular osteotomy (RAO) is a well-established surgical procedure for patients with acetabular dysplasia, and excellent long-term results have been reported. However, RAO is technically demanding and precise execution of this procedure requires experience with this surgery. The usefulness of computer navigation in RAO includes its ability to perform three-dimensional (3D) preoperative planning, enable safe osteotomy even with a poor visual field, reduce exposure to radiation from intraoperative fluoroscopy, and display the tip position of the chisel in real time, which is educationally useful as it allows staff other than the operator to follow the progress of the surgery. In our results comparing 23 hips that underwent RAO with navigation and 23 hips operated on without navigation, no significant difference in radiological assessment was observed. However, no perioperative complications were observed in the navigation group whereas one case of transient femoral nerve palsy was observed in non-navigation group. A more accurate and safer RAO can be performed using 3D preoperative planning and intraoperative assistance with a computed tomography-based navigation system. PMID:26929806

  14. Computer-Assisted Rotational Acetabular Osteotomy for Patients with Acetabular Dysplasia.


    Inaba, Yutaka; Kobayashi, Naomi; Ike, Hiroyuki; Kubota, So; Saito, Tomoyuki


    Rotational acetabular osteotomy (RAO) is a well-established surgical procedure for patients with acetabular dysplasia, and excellent long-term results have been reported. However, RAO is technically demanding and precise execution of this procedure requires experience with this surgery. The usefulness of computer navigation in RAO includes its ability to perform three-dimensional (3D) preoperative planning, enable safe osteotomy even with a poor visual field, reduce exposure to radiation from intraoperative fluoroscopy, and display the tip position of the chisel in real time, which is educationally useful as it allows staff other than the operator to follow the progress of the surgery. In our results comparing 23 hips that underwent RAO with navigation and 23 hips operated on without navigation, no significant difference in radiological assessment was observed. However, no perioperative complications were observed in the navigation group whereas one case of transient femoral nerve palsy was observed in non-navigation group. A more accurate and safer RAO can be performed using 3D preoperative planning and intraoperative assistance with a computed tomography-based navigation system.

  15. Acetabular liner fixation by cement.


    Jiranek, William A


    Many situations in revision THA require the exchange of a PE liner in the setting of a well-fixed cementless acetabular shell. Unfortunately, a replacement liner is not always available, the locking mechanism of the metal shell may be damaged or incompatible with the desired liner, or the shell is malpositioned. Revision of a well-fixed cementless acetabular shell has been associated with considerable morbidity. This raises several questions: can a new PE liner be fixed in the existing shell using bone cement, and if so, which techniques can improve the end result, and in which patients should they be used? Biomechanical testing of cemented PE liners has shown initial fixation strengths that exceed conventional locking mechanisms. It is not known during what period this initial fixation will fail, but clinical reports with followup of as many as 6 years have shown survival in approximately 90% of cases. These studies have shown the importance of proper patient selection, accurate sizing of the PE liner, careful preparation of the substrate of the liner and the shell, and good cement technique. The potential advantages of this technique are less surgical morbidity, more rapid surgery and patient recovery, the ability to incorporate antibiotics in the cement, and more liner options.

  16. Do abnormal hemipelvic bone stresses contribute to loosening and migration of screw-threaded cups?


    Learmonth, I D; Spirakis, A


    Excellent long-term results have been reported with the Charnley low-friction arthroplasty. Failure of the cemented acetabular component has been identified as a problem in the longer term, while cemented hip replacements in active young patients have exhibited a disconcerting incidence of early clinical or radiological failure. This resulted in the development of the cementless arthroplasty. Bone responds favourably to an optimal stress window and reacts dynamically to metal implants that have a greatly differing modulus of elasticity. This study represents a comparative qualitative analysis of the peri-acetabular hemipelvic stresses after loading two cementless (press-fit and screw-threaded) acetabular components inserted into identical bone models. A simplified model of the artificial hip joint was constructed and the very sensitive stress analysis technique of holographic interferometry was used for the investigation. Peri-acetabular stress concentrations were noted with the screw-threaded cup. This may predispose to bone resorption and it is suggested that these could be implicated in the migration of these cups described in published reports.

  17. Long-term results of the threaded Weill cup in primary total hip arthroplasty

    PubMed Central

    Clarius, Michael; Jung, Alexander W.; Raiss, Patric; Streit, Marcus R.; Merle, Christian


    Uncemented, threaded acetabular components with smooth surface treatment were widely used in continental Europe in the 1970s and 1980s for primary total hip arthroplasty (THA). Previously published studies showed high failure rates in the mid-term. In a consecutive series of 116 patients, 127 threaded cups with smooth surface treatment (Weill cup; Zimmer, Winterthur, Switzerland) were implanted in combination with one type of uncemented stem. Patients were followed up clinically and radiographically. Mean time of follow-up was 17 years (range 15–20). At the time of follow-up, the acetabular component had been revised or was awaiting revision in 30 hips (24%). Two hips were revised for infection and 23 for aseptic loosening. Four polyethylene liners were exchanged because of excessive wear. One hip was awaiting revision. The survival rate for all acetabular revisions including one hip awaiting revision was 75% (95%CI: 65–85%) at 17 years. These results support the view that smooth, threaded acetabular components do not provide satisfactory long-term fixation and should be abandoned. It is important to closely monitor patients with these components as the failure rate remains high in the long-term. PMID:19629480

  18. Dual mobility cups in total hip arthroplasty

    PubMed Central

    De Martino, Ivan; Triantafyllopoulos, Georgios Konstantinos; Sculco, Peter Keyes; Sculco, Thomas Peter


    Total hip arthroplasty (THA) is considered one of the most successful surgical procedures in orthopaedics. With the increase in the number of THAs performed in the world in the next decades, reducing or preventing medical and mechanical complications such as post-operative THA instability will be of paramount importance, particularly in an emerging health care environment based on quality control and patient outcome. Dual mobility acetabular component (also known as unconstrained tripolar implant) was introduced in France at the end of the 1970s as an alternative to standard sockets, to reduce the risk of THA dislocation in patients undergoing primary THA in France. Dual mobility cups have recently gained wider attention in the United States as an alternative option in the prevention and treatment of instability in both primary and revision THA and offer the benefit of increased stability without compromising clinical outcomes and implant longevity. In this article, we review the use of dual mobility cup in total hip arthroplasty in terms of its history, biomechanics, outcomes and complications based on more than 20 years of medical literature. PMID:25035820

  19. Good stability and minimal osteolysis with a biconical threaded cup at 10 years.


    Zweymüller, Karl A; Steindl, Martin; Schwarzinger, Ulrike


    In the literature there is no consensus on the value of threaded cementless cups. We primarily asked whether the newly constructed threaded double-cone cup without additional screw fixation would provide high survival at intermediate followup. We retrospectively reviewed 365 patients (376 hips) who underwent primary total hip arthroplasty using this cup made of pure titanium with ceramic-on-polyethylene articulating surfaces. At a minimum followup of 10.0 years (mean, 10.3 years; range, 10.0-13.1 years), 232 cups (61.7%) were available for analysis. We performed two revisions for early infection and cup breakage. No polyethylene liner was exchanged because of wear or instability. Three of the cup shells were radiographically loose at followup; one had periacetabular osteolysis. The mean liner wear rate was 0.13 mm per year. The Kaplan-Meier 10-year survivorship with revision of the cup shell for any reason was 99.3% (95% confidence interval, 96.9-99.8%) and with revision and radiographic loosening of the cup shell 98.6% (95% confidence interval, 96.0-99.5%). These intermediate results compare favorably with survivorship and periacetabular bone reaction data observed with the best cementless acetabular implant designs. PMID:17960675

  20. The Zweymüller threaded cup: a choice in revision? Migration analysis and follow-up after 6 years.


    Schröder, Jörg Hartmut; Matziolis, Georg; Tuischer, Jens; Leutloff, Dirk; Duda, Georg Norbert; Perka, Carsten


    Excellent long-term results are reported for threaded cups with an osteointegrable surface in primary interventions. So far, little data are available on the use of such implants in revision cases. We investigated 30 loosened Aesculap PM threaded cups (Tuttlingen, Germany) with a smooth surface, revised with a conical, corundum-blasted Zweymüller threaded cup (Zweymüller Alloclassic CSF cup, Zimmer, Warsaw, Ind). Aseptic radiological loosening was seen in 8% of cases, and a survival rate of 95% was achieved after 6.1 years. Average migration was 1.4 mm cranially and 0.7 mm medially. The Harris hip score improved from 42 points preoperatively to 75 points at follow-up. Good medium-term results are possible after revision using a threaded cup with an osteointegrable surface, but not if segmental acetabular margin defects are present. PMID:16781400

  1. Outcome of porous tantalum acetabular components for Paprosky type 3 and 4 acetabular defects.


    Batuyong, Eldridge D; Brock, Hugh S; Thiruvengadam, Nikhil; Maloney, William J; Goodman, Stuart B; Huddleston, James I


    Porous tantalum acetabular implants provide a potential solution for dealing with significant acetabular bone loss. This study reviews 24 acetabular revisions using tantalum implants for Paprosky type 3 and 4 defects. The mean Harris Hip Score improved from 35 ± 19 (range, 4-71) to 88 ± 14 (range, 41-100), p < 0.0001. Postoperative radiographs showed radiolucent lines in 14 hips with a mean width of 1.3 ± 1.0 mm (range, 0.27-4.37 mm). No gaps enlarged and 71% of them disappeared at a mean of 13 ± 10 months (range, 3-29 months). At a mean follow-up of 37 ± 14 months (range, 24-66 months), 22 reconstructions showed radiograpic evidence of osseointegration (92%). The two failures were secondary to septic loosening. When dealing with severe acetabular bone loss, porous tantalum acetabular components show promising short-term results.

  2. Rotary cup slurry atomization

    NASA Astrophysics Data System (ADS)

    Sommer, H. T.; Marnicio, R. J.


    The theory of a two-phase flow in a rotating cup atomizer is described. The analysis considers the separation of the solid and liquid media thus realistically modeling the flow of two layers along the inner cup wall: a slurry of increasing solids concentration and a supernatent liquid layer. The analysis is based on the earlier work of Hinze and Milborn (1950) which addressed the flow within a rotary cup for a homogeneous liquid. The superimposition of a settling velocity under conditions of high centrifugal acceleration permits the extended analysis of the separation of the two phases. Appropriate boundary conditions have been applied to the film's free surface and the cup wall and to match the flow characteristics at the liquid-slurry interface. The changing slurry viscosity, increasing nonlinearly with growing solid loading, was also considered. A parameter study illustrates the potential for a cup design to provide optimal slurry and liquid film thicknesses for effective atomization.

  3. Early acetabular cartilage degeneration in a rabbit model of developmental dysplasia of the hip

    PubMed Central

    Zhang, Xiangxin; Meng, Qingxia; Ma, Ruixue; Chen, Guangxiang; Cheng, Liang; Shen, Jun


    Background: Mild developmental dysplasia of hip (DDH) causes high morbidity of osteoarthritis (OA) on adult. It is thought that change of collagen and proteoglycans in cartilage may be the direct reasons for osteoarthritis. Objective: To detect the changes of the expressions of type II collagen of acetabular cartilage in early DDH and to investigate the relevance between type II collagen and the degeneration mechanism of the acetabular cartilage. Methods: The rabbit model of DDH was successfully established by applying the method of knee extending and fixing with cylinder cast in which left lower extremity as experimental group and right one as control group, checking with X-ray after 5 weeks. The stains of H&E and toluidine blue were applied on the samples of acetabular cartilage to observe the morphological changes of chondrocytes and extracellular matrix (ECM). The immunohistochemical staining and Western-blot were employed to respectively qualify and quantitate the expression of type II collagen. Results: Pathohistology observing indicated the signs of retrogressive changes of acetabular cartilage in experimental group. Also, the positive stained cells in type II collagen in experimental group was higher based on immunohistochemiscal staining. The quantitative amounts of type II collagen by Western-blot in experimental group was higher significant difference existed between two groups (t = 2.18, P < 0.05). Conclusions: The expression of type II collagen is correlated to a degeneration of acetabular cartilage and increase obviously in early DDH. PMID:26550441

  4. Deformation of the Durom Acetabular Component and Its Impact on Tribology in a Cadaveric Model—A Simulator Study

    PubMed Central

    Gu, Yanqing; Wang, Qing; Cui, Weiding; Fan, Weimin


    Background Recent studies have shown that the acetabular component frequently becomes deformed during press-fit insertion. The aim of this study was to explore the deformation of the Durom cup after implantation and to clarify the impact of deformation on wear and ion release of the Durom large head metal-on-metal (MOM) total hips in simulators. Methods Six Durom cups impacted into reamed acetabula of fresh cadavers were used as the experimental group and another 6 size-paired intact Durom cups constituted the control group. All 12 Durom MOM total hips were put through a 3 million cycle (MC) wear test in simulators. Results The 6 cups in the experimental group were all deformed, with a mean deformation of 41.78±8.86 µm. The average volumetric wear rate in the experimental group and in the control group in the first million cycle was 6.65±0.29 mm3/MC and 0.89±0.04 mm3/MC (t = 48.43, p = 0.000). The ion levels of Cr and Co in the experimental group were also higher than those in the control group before 2.0 MC. However there was no difference in the ion levels between 2.0 and 3.0 MC. Conclusions This finding implies that the non-modular acetabular component of Durom total hip prosthesis is likely to become deformed during press-fit insertion, and that the deformation will result in increased volumetric wear and increased ion release. Clinical Relevance This study was determined to explore the deformation of the Durom cup after implantation and to clarify the impact of deformation on wear and ion release of the prosthesis. Deformation of the cup after implantation increases the wear of MOM bearings and the resulting ion levels. The clinical use of the Durom large head prosthesis should be with great care. PMID:23144694

  5. Revision Total Hip Arthroplasty Using Tantalum Augment in Patients with Paprosky III or IV Acetabular Bone Defects: A Minimum 2-year Follow Up Study

    PubMed Central

    Jeong, Min; Kim, Hyung-Joo; Lim, Seung-Jae; Moon, Young-Wan


    Purpose The purpose of this study is to report the short-term outcomes of revision total hip arthroplasty (THA) using tantalum augments in patients with severe acetabular bone defects. Materials and Methods We retrospectively analyzed 15 revision THAs performed in 15 patients using tantalum augments between June 2010 and December 2013. Acetabular bone defects were Paprosky type IIIA in 7 hips, type IIIB in 7, and type IV in 1. The causes of revision surgery were aseptic loosening in 12 hips and deep infection in 3. Revisions were first in 1 hip, second in 3, and third in 11. Six patients were male and 9 female with a mean age of 59 years (range, 48-75 years). Mean follow-up was 29 months (range, 24-48 months). Results Mean Harris hip score was improved from 34 points (range, 12-54 points) preoperatively to 84 points (range, 38-90 points) at final follow-up. On the final follow-up radiographs, there were 12 hips (80.0%) with stable fixation of the acetabular cup, 2 (13.3%) with secondary stability after mild acetabular protrusion, and 1 (6.7%) with radiolucency around the acetabular cup without mechanical symptoms. Complications included one patient with acute hematogenous infection managed by surgical debridement and long-term antibiotic therapy. There were no cases with nerve palsy or dislocation during the follow-up period. Conclusion The present study showed satisfactory clinical and radiographic outcomes of revision THA using tantalum augments due to severe acetabular bone defects of Paprosky type III or IV at a minimum follow-up of 2 years. PMID:27536651

  6. Mid-term clinical results of total hip arthroplasty using a Wagner standard cup for dysplastic hip

    PubMed Central

    Maezawa, Katsuhiko; Nozawa, Masahiko; Yuasa, Takahito; Aritomi, Kentaro; Ogawa, Seiki; Maruyama, Yuichiro; Kaneko, Kazuo


    Background The outcome of cementless total hip arthroplasty depends on many factors. We must not forget fundamental things those are design of outer surface of the component, that leads bone ingrowth into the prosthesis, better initial stability, and better insertional techniques. The purpose of this study was to review our experience with metal-on-metal total hip arthroplasty with a Wagner standard cup for patients who had acetabular dysplasia. Patients and methods Fifty-four patients with 55 hips underwent primary metal-on-metal total hip arthroplasty (Metasul prosthesis) with a Wagner standard cup (44–48 mm in outer diameter) and were followed for a minimum of 10 years. All patients received the same type of cementless femoral component (Natural hip stem) and femoral head (28 mm in diameter). Results Seventeen of the 55 Wagner standard cups (30.9%) showed aseptic loosening over a mean period of 3.6 years after surgery, and there were no bone anchors on the outer surface of the 16 retrieved cups. Conclusion From our experience, the small Wagner standard cup does not achieve sufficient osteointegration and we do not recommend the use of this cup, especially for patients with acetabular dysplasia and/or those with a small stature. PMID:25561751

  7. Bleeding and cupping.

    PubMed Central

    Turk, J. L.; Allen, E.


    Bleeding and cupping have been used in medicine since ancient times in the treatment of fevers and local inflammatory disorders. Local bleeding, by 'wet cupping', was effected by a scarificator or by leeches. John Hunter recommended venesection in moderation but preferred leeches for local bleeding. Bleeding as an accepted therapeutic practice went out of vogue in the middle of the nineteenth century as a result of the introduction of modern scientific methods. Dry cupping and the use of leeches, as counter irritants, persisted until the middle of this century. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:6338802

  8. Osteopathic diagnosis of an acetabular injury.


    Morthland, Tim; Cote, Nicholas S; Humphrey, Jon; Fulk, Doug


    Physical findings demarking pathologic somatovisceral reflex activity and fascial strain patterns may lead the osteopathic physician to diagnoses that are masked within the initial presentation of a patient. The authors present a case report that demonstrates the use of osteopathic principles in the diagnosis of a chronic acetabular fracture and acetabular labral tear in a 19-year-old man. The injuries resulted from a posterior hip dislocation sustained during a basketball game more than 1 year before presentation. Osteopathic manipulative treatment and diagnostic techniques also relieved the patient's persistent thoracic pain, nausea, and vomiting. Subsequent orthopedic repair had the potential to avert or delay degenerative hip disease in the patient.

  9. The acetabular point: a morphological and ontogenetic study

    PubMed Central



    The acetabular point was analysed by studying human pelvic bones from 326 individuals ranging from newborns to age 97 y. The bones were categorised into 3 groups according to the degree of fusion for the 3 elements of the pelvis: nonfused (59), semifused (5) and fused (262). The acetabular point in immature pelvic bones is clearly represented by the point of the fusion lines for each bony element at the level of the acetabular fossa. In adult pelvic bones the acetabular fossa has an irregular clover-leaf shape, the superior lobe being smaller than the anterior and posterior lobes. Cross-sectional analysis of acetabular morphology suggested that the acetabular point in adult pelvic bones is always represented by the indentation between the superior and the anterior lobes of the acetabular fossa. PMID:11465866

  10. Mathematical analysis of the effect of rotor geometry on cup anemometer response.


    Sanz-Andrés, Ángel; Pindado, Santiago; Sorribes-Palmer, Félix


    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance. PMID:25110735

  11. Mathematical Analysis of the Effect of Rotor Geometry on Cup Anemometer Response

    PubMed Central

    Sanz-Andrés, Ángel; Sorribes-Palmer, Félix


    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance. PMID:25110735

  12. Mathematical analysis of the effect of rotor geometry on cup anemometer response.


    Sanz-Andrés, Ángel; Pindado, Santiago; Sorribes-Palmer, Félix


    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance.

  13. Engineering considerations in the design of double-cup hip replacement prostheses.


    Swanson, S A


    The diameter of the femoral neck ought not to be reduced, and to provide sufficient ranges of motion without impingement requires the largest practicable articular surface radius and perhaps a less than hemispherical acetabular articular surface. Wear is less with plastic cups and metallic balls than vice versa, and wearing life requires some minimum acetabular wall thickness, which depends on the diameter of the articular surface. Fixation grooves etc. should not reduce the effective wall thickness in highly-stressed regions. In practice, a nearly hemispherical acetabular component will often protrude medially or (preferably) laterally; such a protrusion is unlikely to weaken the fixation but could cause impingement, and could be removed with no loss. The available volume is best used by having the thickest acetabular wall where the wear should be greatest. For the femoral component, the simplest internal surface, a flat-ended cylinder, is also the best. A part-spherical inner surface cannot easily be filled with cement, and a skirt surrounding part or all of the femoral neck offers no advantages and some disadvantages.

  14. Automated measurement of anterior and posterior acetabular sector angles

    NASA Astrophysics Data System (ADS)

    Ibragimov, Bulat; Likar, Boštjan; Pernuš, Franjo; Vrtovec, Tomaž


    In this paper, we propose a segmentation algorithm by which anatomical landmarks on the pelvis are extracted from computed tomography (CT) images. The landmarks are used to automatically define the anterior (AASA) and posterior acetabular sector angles (PASA) describing the degree of hip misalignment. The center of each femoral head is obtained by searching for the point at which most intensity gradient vectors defined at edge points intersect. The radius of each femoral head is computed by finding the sphere, positioned at the center of the femoral head, for which the normalized sum of gradient vector magnitudes on the sphere surface is maximal. The anterior and posterior corners of each acetabulum are searched for on a curve representing the acetabulum and defined by dynamic programming. The femoral head centers and anterior and posterior corners are used to calculate the AASA and PASA. The algorithm was applied to CT images of 120 normal subjects and the results were compared to ground truth values obtained by manual segmentation. The mean absolute difference (+/- standard deviation) between the obtained and ground truth values was 1.3 +/- 0.3 mm for the femoral head centers and 2.1 +/- 1.3 degrees for the acetabular angles.

  15. Perceptual elements in Penn & Teller's "Cups and Balls" magic trick.


    Rieiro, Hector; Martinez-Conde, Susana; Macknik, Stephen L


    Magic illusions provide the perceptual and cognitive scientist with a toolbox of experimental manipulations and testable hypotheses about the building blocks of conscious experience. Here we studied several sleight-of-hand manipulations in the performance of the classic "Cups and Balls" magic trick (where balls appear and disappear inside upside-down opaque cups). We examined a version inspired by the entertainment duo Penn & Teller, conducted with three opaque and subsequently with three transparent cups. Magician Teller used his right hand to load (i.e. introduce surreptitiously) a small ball inside each of two upside-down cups, one at a time, while using his left hand to remove a different ball from the upside-down bottom of the cup. The sleight at the third cup involved one of six manipulations: (a) standard maneuver, (b) standard maneuver without a third ball, (c) ball placed on the table, (d) ball lifted, (e) ball dropped to the floor, and (f) ball stuck to the cup. Seven subjects watched the videos of the performances while reporting, via button press, whenever balls were removed from the cups/table (button "1") or placed inside the cups/on the table (button "2"). Subjects' perception was more accurate with transparent than with opaque cups. Perceptual performance was worse for the conditions where the ball was placed on the table, or stuck to the cup, than for the standard maneuver. The condition in which the ball was lifted displaced the subjects' gaze position the most, whereas the condition in which there was no ball caused the smallest gaze displacement. Training improved the subjects' perceptual performance. Occlusion of the magician's face did not affect the subjects' perception, suggesting that gaze misdirection does not play a strong role in the Cups and Balls illusion. Our results have implications for how to optimize the performance of this classic magic trick, and for the types of hand and object motion that maximize magic misdirection.

  16. Complementary Coffee Cups

    ERIC Educational Resources Information Center

    Banchoff, Thomas


    What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.

  17. Cups and Downs

    ERIC Educational Resources Information Center

    Stewart, Ian


    Martin Gardner wrote about a coin-flipping trick, performed by a blindfolded magician. The paper analyses this trick, and compares it with a similar trick using three cups flipped in pairs. Several different methods of analysis are discussed, including a graphical analysis of the state space and a representation in terms of a matrix. These methods…

  18. Meralgia Paresthetica and Femoral Acetabular Impingement: A Possible Association

    PubMed Central

    Ahmed, Aiesha


    Meralgia paresthetica consists of pain and dysesthesia in the anterolateral thigh. Etiology is divided into spontaneous and iatrogenic causes. To my knowledge this has never been attributed to femoral acetabular impingement. This case highlights the presence of lateral femoral cutaneous neuropathy in the setting of femoral acetabular impingement syndrome thus raising the possibility of an association. Keywords Femoral acetabular impingement; Lateral femoral cutaneous nerve; Dysesthesia; Nerve conduction studies PMID:22043261

  19. Miniature modified Faraday cup for micro electron beams


    Teruya, Alan T.; Elmer, John W.; Palmer, Todd A.; Walton, Chris C.


    A micro beam Faraday cup assembly includes a refractory metal layer with an odd number of thin, radially positioned traces in this refractory metal layer. Some of the radially positioned traces are located at the edge of the micro modified Faraday cup body and some of the radially positioned traces are located in the central portion of the micro modified Faraday cup body. Each set of traces is connected to a separate data acquisition channel to form multiple independent diagnostic networks. The data obtained from the two diagnostic networks are combined and inputted into a computed tomography algorithm to reconstruct the beam shape, size, and power density distribution.

  20. Dual mobility bearings withstand loading from steeper cup-inclinations without substantial wear.


    Loving, LaQuawn; Herrera, Lizeth; Banerjee, Samik; Heffernan, Christopher; Nevelos, Jim; Markel, David C; Mont, Michael A


    Steep cup abduction angles with adverse joint loading may increase traditional polyethylene bearing wear in total hip arthroplasties. However, there have been few reports evaluating the effect of cup inclination on the wear of dual-mobility devices. In a hip joint simulation, we compared the short-term wear of two-sizes of modular highly cross-linked dual-mobility bearings (28 mm femoral head diameter/42 mm polyethylene insert outer diameter/54 mm acetabular shell diameter; 22.2 mm femoral head diameter/36 mm polyethylene insert outer diameter/48 mm acetabular shell diameter) at 50 and 65° of cup inclination with modular 28 mm femoral head on 54 mm cup diameter metal-on-highly cross-linked polyethylene bearings. Increasing inclination from 50-65° had no changes in volumetric wear of 28/42/54 mm (mean, 1.7 vs. 1.2 mm3 /million cycles, respectively; p = 0.50) and 22.2/36/48 mm (mean, 1.7 vs. 1.2 mm3/million cycles, respectively; p = 0.48) dual mobility bearings. At 65°, 22.2/36/48 mm dual-mobility bearings had lower volumetric loss (mean, 2.2 vs. 6.3 mm(3) ; p = 0.03) and wear rates (mean, 1.2 vs. 2.7 mm3/million cycles; p = 0.02) compared to metal-on-highly cross-linked polyethylene bearings. Modern-generation dual-mobility designs with highly cross-linked polyethylenes may potentially withstand edge-loading from steeper cup-inclinations without substantial decreases in wear.

  1. Hijama (Wet Cupping or Dry Cupping) for Diabetes Treatment

    PubMed Central

    Vakilinia, Seyed Reza; Bayat, Davood; Asghari, Majid


    Background: Diabetes is known as one of the most common diseases in the world and its treatment is one of the most important healthcare issues. Consequently, different treatment methods of complementary medicine and recent medicine have been used by scientific communities to control and predict the disease. This article considered the effects of dry cupping and wet cupping, based on traditional medicine and recent studies. Methods: At first, the benefits of dry cupping and wet cupping were taken from some original books of Iranian traditional medicine, such as Canon of Medicine, Kholasat-al-hekma, Tib-e-Akbari and Exir-e-Azam. Then, the information about scientific articles was obtained by studying some of the Iranian traditional medicine journals and searching through PubMed, SID and Google Scholar. Results: In traditional medicine, Hijama is divided into two kinds, namely wet cupping (with sharat, with incision, and blood giving) and dry cupping (without sharat, without incision). Dry cupping causes organ blood absorption, organ warming, and loss of organ humidity. The texts of Iranian traditional medicine refer to the Ziabites disease that its symptoms are like diabetes. This disease is divided into two types including warm and cold ziabetes. The treatments that are recommended for both types are dry cupping for cold ziabetes and wet cupping for warm ziabetes. In addition, according to scientific studies, dry cupping and wet cupping have been recommended for diabetes treatment. Conclusion: Dry cupping and wet cupping can be introduced as the complementary treatment methods beside other treatment methods. PMID:26722143

  2. Modified Faraday cup


    Elmer, John W.; Teruya, Alan T.; O'Brien, Dennis W.


    A tomographic technique for measuring the current density distribution in electron beams using electron beam profile data acquired from a modified Faraday cup to create an image of the current density in high and low power beams. The modified Faraday cup includes a narrow slit and is rotated by a stepper motor and can be moved in the x, y and z directions. The beam is swept across the slit perpendicular thereto and controlled by deflection coils, and the slit rotated such that waveforms are taken every few degrees form to and the waveforms are recorded by a digitizing storage oscilloscope. Two-din-tensional and three-dimensional images of the current density distribution in the beam can be reconstructed by computer tomography from this information, providing quantitative information about the beam focus and alignment.

  3. Modified Faraday cup


    Elmer, J.W.; Teruya, A.T.; O`Brien, D.W.


    A tomographic technique for measuring the current density distribution in electron beams using electron beam profile data acquired from a modified Faraday cup to create an image of the current density in high and low power beams is disclosed. The modified Faraday cup includes a narrow slit and is rotated by a stepper motor and can be moved in the x, y and z directions. The beam is swept across the slit perpendicular thereto and controlled by deflection coils, and the slit rotated such that waveforms are taken every few degrees from 0{degree} to 360{degree} and the waveforms are recorded by a digitizing storage oscilloscope. Two-dimensional and three-dimensional images of the current density distribution in the beam can be reconstructed by computer tomography from this information, providing quantitative information about the beam focus and alignment. 12 figs.

  4. [Squeaking as a cause for revision of a composite ceramic cup].


    Schlegel, U J; Bishop, N; Sobottke, R; Perka, C; Eysel, P; Morlock, M M


    Squeaking in total hip arthroplasty (THA) has been observed only in hard-on-hard bearings, such as ceramic-on-ceramic or metal-on-metal. We report the case of a patient with a squeaking THA who had undergone multiple femoral head revisions combined with a composite ceramic cup (polyurethane, ceramic). Squeaking started 6 years postoperatively and acetabular revision was necessary to resolve the issue. Secondary deformation of the inlay resulted in clamping of the femoral head and increased friction. This should be considered when assessing and advising patients with squeaking THA when composite ceramic components are involved.

  5. Longevity® constrained cup: an operative technical tip for prevention of metallic ring disassembly.


    Ferrero Manzanal, Francisco; Murcia Asensio, Antonio; Lax Pérez, Raquel; Gil Gómez, José Eduardo; Fernández Fairén, Mariano


    Constrained liners are a salvage procedure for treating or preventing recurrent dislocations. The Longevity® constrained liner (Zimmer) has a special design with cut-outs on its circumference for avoiding impingement in certain areas and a metallic constraining ring that has to be impacted. The ring impaction may be technical demanding. We recommend preassembly with the head component prior to seating into the acetabular cup, thus avoiding the soft tissue or cement interference and malposition due to bad angle of incidence of impaction force. PMID:26980240

  6. Medium-term results of cementation of a highly cross-linked polyethylene liner into a well-fixed acetabular shell in revision hip arthroplasty.


    Lim, Seung-Jae; Lee, Keun-Ho; Park, Shin-Hyung; Park, Youn-Soo


    The present study was undertaken to document outcomes of cementation of a highly cross-linked polyethylene (PE) liner into a well-fixed acetabular metal shell in 36 hips. All operations were performed by a single surgeon using only one type of liner. Patients were followed for a mean of 6.1 years (range, 3-8 years). Mean Harris hip score improved from 58 points preoperatively to 91 points postoperatively. There were no cases of PE liner dislodgement or progressive osteolysis. 1 hip (2.8%) required revision surgery for acetabular cup loosening with greater trochanteric fracture. Complications included 1 peroneal nerve palsy and 1 dislocation. The results of this study and previous reports demonstrated that cementation of highly cross-linked PE liner into well-fixed metal shell could provide good midterm durability.

  7. Osteonecrosis and femoro-acetabular impingement: sequelae of developmental dysplasia of the hip

    PubMed Central

    Cheung, Jason Pui Yin; Chow, Wang; To, Michael


    A 2-year-old girl with developmental dysplasia of the right hip underwent open reduction and capsulorrhaphy via the anterior approach with hip spica casting in an internally rotated position. During her 26 years of follow-up, she was found to have osteonecrosis and subsequently cam-type femoro-acetabular impingement at 28 years of age. She was treated with surgical dislocation of the hip and osteochondroplasty to recreate the normal contour of the head and neck offset. PMID:22605717

  8. Unusual Cause of Hip Pain: Intrusion of the Acetabular Labrum

    PubMed Central

    Jang, Se-Ang; Byun, Young-Soo; Jeong, Dae-Geun; Han, In-Ho; Kim, Min-Guek


    Femoroacetabular impingement and dysplatic hip joint is well known cause of osteoarthritis. In these diseases, labral tear and subsequent cartilage damage is thought to be main pathophysiology of development of osteoarthritis. If there are no known bony abnormalities, we called it as idiopathic osteoarthritis. Normal appearance of acetabular labrum is a continuous, usually triangular structure that attaches to the bony rim of the acetabulum and is completed at the inferior portion by the transverse acetabular ligament over the acetabular notch. A few authors reported intra-articular labrum and its relation to the development of osteoarthritis. But they didn't comment the primary bony abnormality especially acetabulum. We'd like to report x-ray, computed tomogram, magnetic resonance arthrogram and arthroscopic findings of a case had double contour sign of acetabular dome combined with intrusion of acetabular labrum. PMID:27536602

  9. The jumbo acetabular component for acetabular revision: Curtain Calls and Caveats.


    Lachiewicz, P F; Watters, T S


    The 'jumbo' acetabular component is now commonly used in acetabular revision surgery where there is extensive bone loss. It offers high surface contact, permits weight bearing over a large area of the pelvis, the need for bone grafting is reduced and it is usually possible to restore centre of rotation of the hip. Disadvantages of its use include a technique in which bone structure may not be restored, a risk of excessive posterior bone loss during reaming, an obligation to employ screw fixation, limited bone ingrowth with late failure and high hip centre, leading to increased risk of dislocation. Contraindications include unaddressed pelvic dissociation, inability to implant the component with a rim fit, and an inability to achieve screw fixation. Use in acetabulae with < 50% bone stock has also been questioned. Published results have been encouraging in the first decade, with late failures predominantly because of polyethylene wear and aseptic loosening. Dislocation is the most common complication of jumbo acetabular revisions, with an incidence of approximately 10%, and often mandates revision. Based on published results, a hemispherical component with an enhanced porous coating, highly cross-linked polyethylene, and a large femoral head appears to represent the optimum tribology for jumbo acetabular revisions. PMID:26733644



    Brobeck, W.W.


    The problems of confining a charge material in a calutron and uniformly distributing heat to the charge is described. The charge is held in a cup of thermally conductive material removably disposed within the charge chamber of the ion source block. A central thermally conducting stem is incorporated within the cup for conducting heat to the central portion of the charge contained within the cup.

  11. Importance of head diameter, clearance, and cup wall thickness in elastohydrodynamic lubrication analysis of metal-on-metal hip resurfacing prostheses.


    Liu, Feng; Jin, Zhongmin; Roberts, P; Grigoris, P


    The main design features of metal-on-metal (MOM) hip resurfacing prostheses in promoting elastohydrodynamic lubrication were investigated in the present study, including the femoral head diameter, the clearance, and the cup wall thickness. Simplified conceptual models were developed, based on equivalent uniform wall thicknesses for both the cup and the head as well as the support materials representing bone and cement, and subsequently used for elastohydrodynamic lubrication analysis. Both typical first- and second-generation MOM hip resurfacing prostheses with different clearances and cup wall thicknesses were considered with a fixed large bearing diameter of 50 mm, as well as a 28 mm diameter MOM total hip replacement bearing for the purpose of comparison. The importance of the head diameter and the clearance in promoting elastohydrodynamic lubrication was confirmed. Furthermore, it was also predicted that a relatively thin acetabular cup in the more recently introduced second-generation MOM hip resurfacing prostheses would be capable of improving elastohydrodynamic lubrication even further.

  12. The Frank Stinchfield Award: Morphologic features of the acetabulum and femur: anteversion angle and implant positioning.


    Maruyama, M; Feinberg, J R; Capello, W N; D'Antonio, J A


    Morphologic features of the hips, in particular those features germane to determination of acetabular and femoral anteversion angles and femoral head offset, were studied in 50 male and 50 female human skeletons with bilateral normal joints. Four distinct configurations were identified relative to the anterior acetabular ridge. The majority (121, 60.5%) were curved; 51 (25.5%) were angular; 19 (9.5%) were irregular; and nine (4.5%) were straight. The acetabular anteversion angle measured 19.9 degrees +/- 6.6 degrees (range, 7 degrees-42 degrees) and was significantly larger in females (21.3 degrees +/- 7.1 degrees) versus males (18.5 degrees +/- 5.8 degrees). The notch acetabular angle, which can be identified easily intraoperatively, was defined as the angle created at the intersection of a line from the sciatic notch along the posterior acetabular ridge and a line from the posterior to the anterior acetabular wall. This angle is almost perpendicular (89.0 degrees +/- 3.5 degrees) and, therefore, may provide an accurate estimate of acetabular anteversion during cup placement. Awareness of the anatomic differences between genders for acetabular anteversion angle, anterolateral bowing of the femur, and neck shaft angle may help reduce the relatively higher incidence of dislocation in females and may lead to different implant designs for male and female patients. PMID:11764371

  13. The influence of acetabular inclination angle on the penetration of polyethylene and migration of the acetabular component: a prospective, radiostereometric study on cemented acetabular components.


    Kadar, T; Furnes, O; Aamodt, A; Indrekvam, K; Havelin, L I; Haugan, K; Espehaug, B; Hallan, G


    In this prospective study we studied the effect of the inclination angle of the acetabular component on polyethylene wear and component migration in cemented acetabular sockets using radiostereometric analysis. A total of 120 patients received either a cemented Reflection All-Poly ultra-high-molecular-weight polyethylene or a cemented Reflection All-Poly highly cross-linked polyethylene acetabular component, combined with either cobalt-chrome or Oxinium femoral heads. Femoral head penetration and migration of the acetabular component were assessed with repeated radiostereometric analysis for two years. The inclination angle was measured on a standard post-operative anteroposterior pelvic radiograph. Linear regression analysis was used to determine the relationship between the inclination angle and femoral head penetration and migration of the acetabular component. We found no relationship between the inclination angle and penetration of the femoral head at two years' follow-up (p = 0.9). Similarly, our data failed to reveal any statistically significant correlation between inclination angle and migration of these cemented acetabular components (p = 0.07 to p = 0.9).

  14. Intraoperative Fluoroscopy Improves Component Position During Anterior Hip Arthroplasty.


    Jennings, John D; Iorio, Justin; Kleiner, Matthew T; Gaughan, John P; Star, Andrew M


    The goal of this retrospective review was to determine whether fluoroscopic guidance improves acetabular cup abduction and anteversion alignment during anterior total hip arthroplasty. The authors retrospectively reviewed 199 patients (fluoroscopy group, 98; nonfluoroscopy group, 101) who underwent anterior total hip arthroplasty at a single center with and without C-arm fluoroscopy guidance. Included in the study were patients of any age who underwent primary anterior approach total hip arthroplasty performed by a single surgeon, with 6-month postoperative anteroposterior pelvis radiographs. Acetabular cup abduction and anteversion angles were measured and compared between groups. Mean acetabular cup abduction and anteversion angles were 43.4° (range, 26.0°-57.4°) and 23.1° (range, 17°-28°), respectively, in the fluoroscopy group. Mean abduction and anteversion angles were 45.9° (range, 29.7°-61.3°) and 23.1° (range, 17°-28°), respectively, after anterior total hip arthroplasty without the use of C-arm guidance (nonfluoroscopy group). The use of fluoroscopy was associated with a statistically significant difference in cup abduction (P=.002) but no statistically significant difference in anteversion angles. In the fluoroscopy group, 80% of implants were within the combined safe zone compared with 63% in the nonfluoroscopy group. A significantly higher percentage of both acetabular cup abduction angles and combined anteversion and abduction angles were in the safe zone in the fluoroscopy group. Fluoroscopy is not required for proper anteversion placement of acetabular components, but it may increase ideal safe zone placement of components.

  15. [Analysis of the Basic Stress Pathway Above Acetabular Dome].


    Nie, Yong; Ma, Jun; Haung, Qiang; Hu, Qinsheng; Shi, Xiaojun; Pei, Fuxing


    The basic stress pathway above the acetabular dome is important for the maintenance of implant stability in acetabular reconstruction of total hip arthroplasty (THA). The purpose of this study was to describe the basic stress pathway to provide evidence for clinical acetabular reconstruction guidance of THA. A subject-specific finite element (FE) model was developed from CT data to generate 3 normal hip models and a convergence study was conducted to determine the number of pelvic trabecular bone material properties using 5 material assignment plans. In addition, in the range of 0 to 20 mm above the acetabular dome, the models were sectioned and the stress pathway was defined as two parts, i.e., 3D, trabecular bone stress distribution and quantified cortical bone stress level. The results showed that using 100 materials to define the material property of pelvic trabecular bone could assure both the accuracy and efficiency of the FE model. Under the same body weight condition, the 3D trabecular bone stress distributions above the acetabular dome were consistent, and especially the quantified cortical bone stress levels were all above 20 MPa and showed no statistically significant difference (P>0.05). Therefore, defining the basic stress pathway above the acetabular dome under certain body weight condition contributes to design accurate preoperative plan for acetabular reconstruction, thus helping restore the normal hip biomechanics and preserve the stability of the implants. PMID:26710451

  16. World Cup Hopes

    NASA Technical Reports Server (NTRS)


    From May 31 to June 30 the biggest single-sport event in the world, the 2002 FIFA World Cup (tm), will be taking place in Asia. South Korea and Japan are acting as hosts for the event which is being held in Asia for the first time. This true-color image of the southern Korean peninsula and southern Japan was acquired on May 25, 2002, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. Thirty-two nations are represented at this year's Finals including the 1998 champion France, European powers England and Italy, tournament favorite Argentina, and the United States. The finals are the culmination of a 2-year qualifying process which started with 132 nations competing in regional qualification tournaments. In the round-robin first round of the World Cup, the U.S. team will be competing against teams from Portugal, Poland, and South Korea. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  17. Biomechanical analysis of the acetabular buttress-plate: are complex acetabular fractures in the quadrilateral area stable after treatment with anterior construct plate-1/3 tube buttress plate fixation?

    PubMed Central

    Wu, Yong-De; Cai, Xian-Hua; Liu, Xi-Ming; Zhang, Hong-Xi


    OBJECTIVE: The acetabular buttress-plate has been widely used in treating difficult cases with satisfying clinical results. However, the biomechanical properties of a postoperative acetabular fracture fixed by the buttress-plate are not clear. The purpose of this study was to evaluate the biomechanical properties of stability after the anterior tube buttress-plate fixation of complex acetabular fractures in the quadrilateral area. METHODS: A construct was proposed based on anterior construct plate - 1/3 tube buttress plate fixation for acetabular both-column fractures. Two groups of six formalin-preserved cadaveric pelvises were analyzed: (1) group A, the normal pelvis and (2) group B, anterior construct plate-1/3 tube buttress plate with quadrilateral area fixation. The displacements were measured, and cyclical loads were applied in both standing and sitting simulations. RESULTS: As the load was added, the displacements were Aposition: p = 0.013; sitting position: p = 0.009) between groups A and B. CONCLUSION: The anterior construct plate - 1/3 tube buttress plate fixation provided a better stable construct for early sitting. The standing mode yielded more significant differences between the groups. Placing a 1/3 tube buttress-plate via an anterior approach is a novel method of providing quadrilateral area support in this setting. PMID:23917670

  18. Welding torch gas cup extension

    NASA Technical Reports Server (NTRS)

    Gordon, Stephen S. (Inventor)


    The invention relates to a gas shielded electric arc welding torch having a detachable gas cup extension which may be of any desired configuration or length. The gas cup extension assembly is mounted on a standard electric welding torch gas cup to enable welding in areas with limited access. The gas cup assembly has an upper tubular insert that fits within the gas cup such that its lower portion protrudes thereform and has a lower tubular extension that is screwed into the lower portion. The extension has a rim to define the outer perimeter of the seat edge about its entrance opening so a gasket may be placed to effect an airtight seal between the gas cup and extension. The tubular extension may be made of metal or cermaic material that can be machined. The novelty lies in the use of an extension assembly for a standard gas cup of an electric arc welding torch which extension assembly is detachable permitting the use of a number of extensions which may be of different configurations and materials and yet fit the standard gas cup.

  19. Captain James Cook's antimony cup.


    McCallum, R I


    Medicinal cups made of pure antimony metal were once common but are now rare and only about ten have been described. An unusual cup which belonged to Captain James Cook, the explorer, which has not previously been reported in the medical literature is described here. PMID:11958223

  20. Protrusio of a ceramic femoral head through the acetabular metallic shell, extensive metallosis and 'bubble sign'.


    Malizos, Konstantinos; Roidis, Nikolaos T; Poultsides, Lazaros; Basdekis, George; Moraitis, Theofanis; Xenakis, Theodoros


    A 24-year-old patient with a history of juvenile rheumatoid arthritis underwent a primary cementless left total hip arthroplasty (THA). The original THA consisted of an Optifix 54 cup with a 3-mm thick polyethylene liner, an Optifix size 4 stem (Smith & Nephew Richards, Memphis, Tennessee) and a Biolox aluminum 32-mm femoral head. Fourteen years later, radiographs demonstrated extensive wear of the polyethylene liner resulting in direct articulation and abrasion wear of the ceramic femoral head on the cup and a bubble sign. This article presents a case of a catastrophic failure of a ceramic/polyethylene bearing with destruction of the polyethylene liner and the metallic shell and protrusio of the nonfractured ceramic head through the metallic shell. To our knowledge this is the first description of extensive metallosis and subsequent radiograph bubble sign not presenting as a result of wear of a metal-on-metal articulation. At the time of revision surgery-Hydrocel TNT Monoblock 58 cup (Zimmer, Warsaw, Indiana), Wagner 265/14 stem (Zimmer), and a Co/Cr 28-mm head-copious metallic debris was seen both macroscopically and histologically, with the ceramic head protruding behind the metallic shell. Multiple factors may have been responsible for this failure including a thin polyethylene shell, a suboptimal locking mechanism, gamma in air sterilization for polyethylene, multiple screw-holes that reduce the contact surface between shell and polyethylene, the rough surface on the inside of the shell and non-articular wear at the metal polyethylene interface within the acetabular component and the high demands of this active young patient. PMID:19301791

  1. Cup loosening after cemented Metasul® total hip replacement: a retrieval analysis.


    Nich, Christophe; Hamadouche, Moussa


    Small-diameter cemented Metasul® cups have been previously identified to be at high risk of early loosening. We asked whether this particular mode of failure was associated with a specific histological feature. Periprosthetic tissues were obtained at the time of revision of two aseptically loose cemented Metasul® cups. Each tissue sample was processed for routine histological analysis. A slight metallosis was visible microscopically in all tissue samples. Metallic wear-debris particles were present both extracellularly and within the cytoplasm of macrophages. We noted a perivascular infiltration of lymphocytes accompanied by mature plasma cells. Our observations are compatible with the hypersensitivity-like reaction previously reported, described as an aseptic lymphocyte-dominated vasculitis-associated lesion (ALVAL). Although wear was within normal reported range limits, this tissue reaction appeared as a consequence of continuous release of metallic ions from the prosthetic articulation. We hypothesise that ALVAL was involved in acetabular component failure, although acetabular loosening may have been initiated by high mechanical stress.

  2. The Dislocating Hip Replacement – Revision with a Dual Mobility Cup in 56 Consecutive Patients

    PubMed Central

    Jakobsen, Thomas; Kappel, Andreas; Hansen, Flemming; Krarup, Niels


    Introduction: Recurrent dislocations of hip replacements are a difficult challenge. One treatment option for recurrent dislocations is the use of a dual mobility cup. The aim of this study was to retrospective investigate the effect of dual mobility cups as a treatment for recurrent dislocations in a consecutive series. Materials and Methods: 56 consecutive patients were revised in the period November 2000 to December 2010. The mean age at revision was 72 years (SD 11, range 37-92)) and median number of dislocations before revision surgery were 4 (IQR, 2-11). In all cases, revision was made with a Saturne dual mobility cup (Amplitude, Neyron, France). The mean follow-up period was 44 months (SD 30, range 0.1-119). Results: One patient (1.8%) experienced a re-dislocation. Three patients (5.3%) had to be revised. One due to disintegration between the femoral head and inner shell, one due to loosening of the acetabular component, and one due to infection. Harris Hip Score improved from a mean of 76 before index surgery to 87 within one year after index surgery. Conclusion: This study advocates the use of a dual mobility cup for treatment of recurrent dislocations of THR. However, studies with a longer follow up are needed in order to evaluate implant survival. PMID:25246992

  3. Total hip arthroplasty after rotational acetabular osteotomy.


    Ito, Hideya; Takatori, Yoshio; Moro, Toru; Oshima, Hirofumi; Oka, Hiroyuki; Tanaka, Sakae


    In this study, we aimed to determine whether the outcomes of total hip arthroplasty (THA) after rotational acetabular osteotomy (RAO) are equal to those of primary THA, and to elucidate the characteristics of THA after RAO. The clinical and radiographic findings of THA after RAO (44 hips), with minimum 24 months of follow-up, were compared with a matched control group of 58 hips without prior RAO. We found that the outcomes in terms of functional scores and complication rates did not differ between THA after RAO and THA without previous pelvic osteotomy, indicating that the results of THA after RAO are equivalent to those of primary THA. Although THA after RAO requires technical considerations, similar clinical outcomes to primary THA can be expected. PMID:25456635

  4. Wear of highly crosslinked polyethylene acetabular components

    PubMed Central

    Callary, Stuart A; Solomon, Lucian B; Holubowycz, Oksana T; Campbell, David G; Munn, Zachary; Howie, Donald W


    Background and purpose Wear rates of highly crosslinked polyethylene (XLPE) acetabular components have varied considerably between different published studies. This variation is in part due to the different techniques used to measure wear and to the errors inherent in measuring the relatively low amounts of wear in XLPE bearings. We undertook a scoping review of studies that have examined the in vivo wear of XLPE acetabular components using the most sensitive method available, radiostereometric analysis (RSA). Methods A systematic search of the PubMed, Scopus, and Cochrane databases was performed to identify published studies in which RSA was used to measure wear of XLPE components in primary total hip arthroplasty (THA). Results 18 publications examined 12 primary THA cohorts, comprising only 260 THAs at 2–10 years of follow-up. The mean or median proximal wear rate reported ranged from 0.00 to 0.06 mm/year. However, differences in the manner in which wear was determined made it difficult to compare some studies. Furthermore, differences in RSA methodology between studies, such as the use of supine or standing radiographs and the use of beaded or unbeaded reference segments, may limit future meta-analyses examining the effect of patient and implant variables on wear rates. Interpretation This scoping review confirmed the low wear rates of XLPE in THA, as measured by RSA. We make recommendations to enhance the standardization of reporting of RSA wear results, which will facilitate early identification of poorly performing implants and enable a better understanding of the effects of surgical and patient factors on wear. PMID:25301435

  5. On Cup Anemometer Rotor Aerodynamics

    PubMed Central

    Pindado, Santiago; Pérez, Javier; Avila-Sanchez, Sergio


    The influence of anemometer rotor shape parameters, such as the cups' front area or their center rotation radius on the anemometer's performance was analyzed. This analysis was based on calibrations performed on two different anemometers (one based on magnet system output signal, and the other one based on an opto-electronic system output signal), tested with 21 different rotors. The results were compared to the ones resulting from classical analytical models. The results clearly showed a linear dependency of both calibration constants, the slope and the offset, on the cups' center rotation radius, the influence of the front area of the cups also being observed. The analytical model of Kondo et al. was proved to be accurate if it is based on precise data related to the aerodynamic behavior of a rotor's cup. PMID:22778638

  6. On cup anemometer rotor aerodynamics.


    Pindado, Santiago; Pérez, Javier; Avila-Sanchez, Sergio


    The influence of anemometer rotor shape parameters, such as the cups' front area or their center rotation radius on the anemometer's performance was analyzed. This analysis was based on calibrations performed on two different anemometers (one based on magnet system output signal, and the other one based on an opto-electronic system output signal), tested with 21 different rotors. The results were compared to the ones resulting from classical analytical models. The results clearly showed a linear dependency of both calibration constants, the slope and the offset, on the cups' center rotation radius, the influence of the front area of the cups also being observed. The analytical model of Kondo et al. was proved to be accurate if it is based on precise data related to the aerodynamic behavior of a rotor's cup.

  7. Differences in Acetabular Rim Thickness in Patients with Unilateral Symptomatic Pincer-Type Femoroacetabular Impingement

    PubMed Central

    Weber, Alexander E.; Kuhns, Benjamin; Cvetanovich, Gregory; Inoue, Nozomu; Nho, Shane Jay


    Objectives: The objective of this study was to identify the location and magnitude of difference in acetabular rim morphology between the symptomatic and asymptomatic acetabula in a cohort of patients with symptomatic unilateral pincer-type FAI. Methods: After IRB approval, computed tomography (CT) scans of 43 patients (22 males, 21 females) diagnosed with unilateral pincer-type FAI were obtained. CT images of both hips were imported in DICOM format and segmented into 3-dimensional (3D) hemi-pelvises using 3D reconstruction software (Mimics, Materialise, Leuven, Belgium). The point-cloud data of the asymptomatic hemi-pelvis was mirrored onto the symptomatic side. Protrusion of the symptomatic side was recorded as a positive value and appeared as red on the color map (Figure 1). Data was collected in 3° intervals and analyzed by quadrant using the clock face method; reflecting the 12-3, 3-6, 6-9, and 9-12 o’clock positions. Results: The symptomatic acetabular rim was on average 0.39 ± 0.36 mm thicker than the corresponding location on the asymptomatic rim. When the acetabular clock face was broken up into quadrants, reflecting the 12-3, 3-6, 6-9, and 9-12 o’clock positions, the 12-3 o’clock position demonstrated the greatest difference between symptomatic and asymptomatic sides (Table 1). The 12-3 o’clock quadrant demonstrated significantly greater difference between symptomatic and asymptomatic sides (0.53±0.22 mm) as compared to the 3-6 o’clock position (0.39±0.27 mm; p=0.006), the 6-9 o’clock position (0.34±0.05 mm; p<0.001), and the 9-12 o’clock position (0.33±0.03; p<0.001). There was no correlation between gender and magnitude of difference at any location. Conclusion: Small changes in acetabular rim morphology, on the order of 0.5 mm or less can be the difference between symptomatic pincer-type FAI and the asymptomatic state. Knowledge of the healthy, unaffected side in unilateral FAI may provide a better template for rim recession rather

  8. Comparison of 3.0-T MR vs 3.0-T MR arthrography of the hip for detection of acetabular labral tears and chondral defects in the same patient population

    PubMed Central


    Objective: We report our experience in diagnostic sensitivity of 3.0-T conventional MR vs 3.0-T MR arthrography of the hip for detection of acetabular labral tears and chondral defects in the same patient population. Methods: 43 consecutive patients had both conventional hip MR and MR arthrography examinations performed. These examinations were reviewed retrospectively by independent reading of two musculoskeletal radiologists who read the MR and MR arthrogram examinations in a randomized fashion (i.e. MR and MR arthrogram examinations were read at separate sittings and in a randomized fashion so as not to bias reviewers). Scans were assessed for acetabular labral tears and chondral defects. All patients went on to arthroscopy. Results: Of these 43 patients, 40 had acetabular labral tears read by Reader 1 and 39 had acetabular labral tears read by Reader 2 on MR arthrogram, 39 had acetabular labral tears read by Reader 1 and 38 had acetabular labral tears read by Reader 2 on conventional MR examination. There were 42 labral tears in 43 patients at arthroscopy. There were four false-negative labral tears compared with arthroscopy on MR and three false negatives on MR arthrography for Reader 1 and five false negatives on MR and four false negatives on MR arthrography for Reader 2. Each reader had one false-positive labral tear compared with arthroscopy on both MR and MR arthrography. There were 32 acetabular chondral defects at arthroscopy. Reader 1 saw 21 acetabular chondral defects on conventional MR and 27 chondral defects at MR arthrography. Reader 2 saw 19 acetabular chondral defects at conventional MR and 25 acetabular chondral defects on MR arthrography. There were no false-positive readings of chondral defects compared with arthroscopy on MR and one false positive for Reader 1 and two false positives for Reader 2 on MR arthrography as compared with arthroscopy. On conventional MR examination, sensitivities and specificities as compared with arthroscopy were

  9. From Baby Bottle to Cup: Choose Training Cups Carefully, Use Them Temporarily


    ... DENTAL PATIENT ... From baby bottle to cup Choose training cups carefully, use them temporarily T ooth decay ... you make the change from baby bottle to training cup, be very careful about d what kind ...

  10. Spoon-to-cup fading as treatment for cup drinking in a child with intestinal failure.


    Groff, Rebecca A; Piazza, Cathleen C; Zeleny, Jason R; Dempsey, Jack R


    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. PMID:22219546


    PubMed Central

    Groff, Rebecca A; Piazza, Cathleen C; Zeleny, Jason R; Dempsey, Jack R


    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. PMID:22219546

  12. Spoon-to-Cup Fading as Treatment for Cup Drinking in a Child with Intestinal Failure

    ERIC Educational Resources Information Center

    Groff, Rebecca A.; Piazza, Cathleen C.; Zeleny, Jason R.; Dempsey, Jack R.


    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. (Contains 2…

  13. [The initial CUP situation and CUP syndrome: pathological diagnostics].


    Moll, R


    "Cancer of unknown primary (site)" (CUP) represents a frequent and often difficult task for diagnostic histopathology. In the initial CUP situation, immunohistochemistry, which is relatively cost-efficient and non-burdensome for the patient, contributes substantially to the targeted search for and identification of the primary tumor. It may be performed in a two-step algorithm (keratins as the first step, group and selective markers as the second step). However, in true CUP syndrome--a heterogeneous disease whose etiology and pathogenesis is still poorly understood--the primary tumor is rarely identified, and the immunohistochemical marker profile is often anomalous. Nevertheless, immunohistochemistry remains the most important special method, aiming at the phenotypical classification and particularly the identification of certain favorable therapy-responsive subsets. Novel methods for subtyping of CUP based on the analysis of gene expression profiles need to be further evaluated before their possible diagnostic application. Future basic and clinical research is required to unravel the still enigmatic tumor biology of the CUP syndrome and to improve the hitherto very unfavorable prognosis by developing new efficient therapy regimens.

  14. World Cup Final

    NASA Technical Reports Server (NTRS)


    On July 9, hundreds of millions of fans worldwide will be glued to their television sets watching the final match of the 2006 FIFA World Cup, played in Berlin's Olympic stadium (Olympiastadion). The stadium was originally built for the 1936 Summer Olympics. The Olympic Stadium seats 76,000,; its roof rises 68 meters over the seats and is made up of transparent panels that allow sunlight to stream in during the day.

    With its 14 spectral bands from the visible to the thermal infrared wavelength region, and its high spatial resolution of 15 to 90 meters (about 50 to 300 feet), ASTER images Earth to map and monitor the changing surface of our planet.

    ASTER is one of five Earth-observing instruments launched December 18, 1999, on NASA's Terra satellite. The instrument was built by Japan's Ministry of Economy, Trade and Industry. A joint U.S./Japan science team is responsible for validation and calibration of the instrument and the data products.

    The broad spectral coverage and high spectral resolution of ASTER provides scientists in numerous disciplines with critical information for surface mapping, and monitoring of dynamic conditions and temporal change. Example applications are: monitoring glacial advances and retreats; monitoring potentially active volcanoes; identifying crop stress; determining cloud morphology and physical properties; wetlands evaluation; thermal pollution monitoring; coral reef degradation; surface temperature mapping of soils and geology; and measuring surface heat balance.

    The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

    Size: 12.1 by 15.9 kilometers (7.5 by 9.5 miles) Location: 52.5 degrees North latitude, 13.3 degrees East longitude Orientation: North at top Image Data: ASTER bands 3, 2, and 1 Original Data Resolution: 15 meters (49.2 feet) Dates Acquired: October 15, 2005

  15. Arthroscopic Reduction and Transportal Screw Fixation of Acetabular Posterior Wall Fracture: Technical Note.


    Park, Jin Young; Chung, Woo Chull; Kim, Che Keun; Huh, Soon Ho; Kim, Se Jin; Jung, Bo Hyun


    Acetabular fractures can be treated with variable method. In this study, acetabular posterior wall fracture was treated with arthroscopic reduction and fixation using cannulated screw. The patient recovered immediately and had a satisfactory outcome. In some case of acetabular fracture could be good indication with additional advantages of joint debridement and loose body removal. So, we report our case with technical note. PMID:27536654

  16. Arthroscopic Reduction and Transportal Screw Fixation of Acetabular Posterior Wall Fracture: Technical Note

    PubMed Central

    Park, Jin young; Kim, Che Keun; Huh, Soon Ho; Kim, Se Jin; Jung, Bo Hyun


    Acetabular fractures can be treated with variable method. In this study, acetabular posterior wall fracture was treated with arthroscopic reduction and fixation using cannulated screw. The patient recovered immediately and had a satisfactory outcome. In some case of acetabular fracture could be good indication with additional advantages of joint debridement and loose body removal. So, we report our case with technical note. PMID:27536654

  17. A Novel Approach for Treatment of Acetabular Fractures

    PubMed Central

    Xue, Zichao; Qin, Hui; Ding, Haoliang; An, Zhiquan


    Background There is no single approach that provides adequate exposure for treatment of all types of acetabular fractures. We describe our experience with an easier, relatively less invasive pubic symphysis approach (PSA) for the treatment of acetabular fractures. Material/Methods Between March 2011 and March 2012, fifteen patients with acetabular fracture underwent surgery using the PSA technique. Fracture reduction and treatment outcomes were assessed by clinical and radiological examination. Operation time, intraoperative blood loss and postoperative complications were documented. Results Mean operative time was 222±78 minutes. Average blood loss was 993±361 mL. Anatomical reduction was achieved in all patients. Minimum follow-up period was 31 months. Postoperative hypoesthesia in the area of innervation of the lateral femoral cutaneous nerve was reported in one patient, with spontaneous recovery at one month after surgery. No complications were reported during the follow-up period. At the most recent follow up, clinical outcomes were graded as “excellent” in six patients, “good” in eight patients and “fair” in one patient based on the modified Merle d’Aubigné-Postel score. Conclusions PSA appears to be a timesaving and safe approach for treatment of acetabular fractures that affords good visual access and allows for excellent fracture reduction. Our preliminary results revealed a much lower incidence of complications than traditional approaches, suggesting PSA is an alternative for treatment of acetabular fractures. PMID:27734825

  18. Three Year RSA Evaluation of Vitamin E Diffused Highly Cross-linked Polyethylene Liners and Cup Stability.


    Sillesen, Nanna H; Greene, Meridith E; Nebergall, Audrey K; Nielsen, Poul T; Laursen, Mogens B; Troelsen, Anders; Malchau, Henrik


    Vitamin E diffusion into highly cross-linked polyethylene (E-XLPE) is a method for enhancing oxidative stability of acetabular liners. The purpose of this study was to evaluate in vivo penetration of E-XLPE using radiostereometric analysis (RSA). Eighty-four hips were recruited into a prospective 10-year RSA. This is the first evaluation of the multicenter cohort after 3-years. All patients received E-XLPE liners (E1, Biomet) and porous-titanium coated cups (Regenerex, Biomet). There was no difference (P=0.450) in median femoral head penetration into the E-XLPE liners at 3-years comparing cobalt-chrome heads (-0.028mm; inter-quartile range (IQR) - 0.065 to 0.047) with ceramic heads (-0.043mm, IQR - 0.143to0.042). The 3-year follow-up indicates minimal E-XLPE liner penetration regardless of head material and minimal early cup movement.

  19. Versatile, high-sensitivity faraday cup array for ion implanters


    Musket, Ronald G.; Patterson, Robert G.


    An improved Faraday cup array for determining the dose of ions delivered to a substrate during ion implantation and for monitoring the uniformity of the dose delivered to the substrate. The improved Faraday cup array incorporates a variable size ion beam aperture by changing only an insertable plate that defines the aperture without changing the position of the Faraday cups which are positioned for the operation of the largest ion beam aperture. The design enables the dose sensitivity range, typically 10.sup.11 -10.sup.18 ions/cm.sup.2 to be extended to below 10.sup.6 ions/cm.sup.2. The insertable plate/aperture arrangement is structurally simple and enables scaling to aperture areas between <1 cm.sup.2 and >750 cm.sup.2, and enables ultra-high vacuum (UHV) applications by incorporation of UHV-compatible materials.

  20. Total hip arthroplasty for acute acetabular fractures: a review of the literature.


    Jauregui, Julio J; Clayton, Adrian; Kapadia, Bhaveen H; Cherian, Jeffrey J; Issa, Kimona; Mont, Michael A


    There have been many advances in the treatment of acetabular fractures; however, the role of total hip arthroplasty (THA) as part of acute fracture management is not well-defined. The indications to acutely manage an acetabular fracture with THA include patients who were older than 65 years of age, who had extensive intra-articular comminution, impaction of the acetabular dome, a displaced-impacted femoral neck fracture, presented with severe osteopenia or osteoporosis, or preexisting osteoarthritis. Implant survivorship and clinical outcomes were favorable with low complications when managing an acetabular fracture with THA. THA may be an effective option for treating acetabular fractures in appropriately selected patients.

  1. Multiple Acetabular Revisions in THA - Poor Outcome Despite Maximum Effort

    PubMed Central

    Bischel, O; Seeger, JB; Krüge, M; Bitsch, BG


    A consecutive series of 52 acetabular revisions was evaluated retrospectively. Inclusion criteria for all patients were at least one former exchange of the acetabular component. Reconstruction was performed with reliable techniques and implants other than extensively porous coated device (e.g. tantalum). The mean follow up was 5.63 (0.01-14.05) years. Cumulative survival at 14.05 years with removal of the acetabular component due to aseptic loosening or the worst case criterion (removal of the acetabular component for any cause and/or lost to follow-up) as the end point was 66.38 (95 % C.-I.: 47.80-84.96) % and 58.42 (95 % C.-I.: 41.01-75.83) %, respectively. The cumulative survival rate with mechanical failure of the acetabular reconstruction as the endpoint was significantly lower in patients with two or more previous revisions in comparison to those with only one former procedure (log rank test: p=0,0112 respectively). The mean Merle d’Aubignée-score improved from 7.3 (0-14) preoperatively to 10.6 (0-17) points at latest follow up examination. Survival of acetabular reconstructions with common techniques and implants is decreasing with the number of previous revisions. This may cause major concerns with regard to the rising number of patients needing repeated revisions. Maximizing durability of primary THA, precise preoperative planning as well as improved techniques and implants for revision may decrease this problem in the long term. PMID:23193432

  2. Does Cupping = Success for Olympic Athletes?


    ... cupping actually help? There's an Eastern and a Western explanation for how this suction may help reduce pain, promote healing and improve flexibility, experts said. Traditional Chinese medicine holds that cupping helps improve the flow of ...

  3. Arthroscopic Technique for Acetabular Labral Reconstruction Using Iliotibial Band Autograft.


    Chahla, Jorge; Soares, Eduardo; Bhatia, Sanjeev; Mitchell, Justin J; Philippon, Marc J


    The dynamic function of the acetabular labrum makes it an important structure for both hip stability and motion. Because of this, injuries to the labrum can cause significant dysfunction, leading to altered hip kinematics. Labral repair is the gold standard for symptomatic labral tears to keep as much labral tissue as possible; however, in cases where the labrum has been injured to such a degree that it is either deficient or repair is not possible, arthroscopic labral reconstruction is preferred. This article describes our preferred approach for reconstruction of the acetabular labrum using iliotibial band autograft.

  4. Arthroscopic Technique for Acetabular Labral Reconstruction Using Iliotibial Band Autograft.


    Chahla, Jorge; Soares, Eduardo; Bhatia, Sanjeev; Mitchell, Justin J; Philippon, Marc J


    The dynamic function of the acetabular labrum makes it an important structure for both hip stability and motion. Because of this, injuries to the labrum can cause significant dysfunction, leading to altered hip kinematics. Labral repair is the gold standard for symptomatic labral tears to keep as much labral tissue as possible; however, in cases where the labrum has been injured to such a degree that it is either deficient or repair is not possible, arthroscopic labral reconstruction is preferred. This article describes our preferred approach for reconstruction of the acetabular labrum using iliotibial band autograft. PMID:27656395

  5. Acetabular Labral Tears in Patients with Sports Injury

    PubMed Central

    Kang, Chan; Cha, Soo-Min


    Background We wanted to investigate acetabular labral tears and their correlation with femoroacetabular impingement in patients with sports injury. Methods Among 111 patients who were diagnosed with the acetabular labral tears after arthroscopic treatment from January 2004 to December 2007, we selected 41 patients with sports injury. There were 12 cases of Taekwondo injury, 5 of golf injury, 4 of soccer injury, 3 of gymnastics injury, 2 of Hapkido injury, 2 of aerobics injury, 2 of rock-climbing injury, 2 of fitness training injury and 9 of other sports injuries. We checked the subtypes of acetabular labral tears and the accompanying femoroacetabular impingement. For the cases with accompanying femoroacetabular impingement, we investigated the subtypes according to the types of sports, gender and age. At last follow-up, we checked the Harris Hip Score (HHS), the Hip Outcome Score (HOS) sports scale and the percentage of patients who returned to their sports activity. Results The average age of symptomatic onset was 26 years (range, 12 to 65 years). The ratio of males to females was 29 : 12. An average duration of the hip pain was 17 months (range, 1 to 60 months). The degenerative type of acetabular labral tears was the most prevalent with 32 cases (78%), and there were 9 cases (22%) of the partial tear type. Thirty cases (73%) were accompanied by femoroacetabular impingement. The average age of the 23 cases (56%) of the cam-type was 23 years (range, 12 to 48 years), and it was more likely to occur in men (87%) and for people practicing martial arts such as Taekwondo or Hapkido. An average age of the 5 cases (12%) of the pincer-type was 26 (range, 16 to 43 years), it usually occurred in women (60%) and for non-martial arts such as golf and gymnastics. There were 2 cases of the mixed type (cam + pincer-type). At 27 months follow-up, the HHS was 61 to 92 points, the HOS sports scale increased 43 to 75%, and the rate of returning to sports was 71%. Conclusions In

  6. Cup tool use by squirrel monkeys.


    Buckmaster, Christine L; Hyde, Shellie A; Parker, Karen J; Lyons, David M


    Captive-born male and female squirrel monkeys spontaneously 'invented' a cup tool use technique to Contain (i.e., hold and control) food they reduced into fragments for consumption and to Contain water collected from a valve to drink. Food cup use was observed more frequently than water cup use. Observations indicate that 68% (n = 39/57) of monkeys in this population used a cup (a plastic slip cap) to Contain food, and a subset of these monkeys, 10% (n = 4/39), also used a cup to Contain water. Cup use was optional and did not replace, but supplemented, the hand/arm-to-mouth eating and direct valve drinking exhibited by all members of the population. Strategies monkeys used to bring food and cups together for food processing activity at preferred upper-level perching areas, in the arboreal-like environment in which they lived, provides evidence that monkeys may plan food processing activity with the cups. Specifically, prior to cup use monkeys obtained a cup first before food, or obtained food and a cup from the floor simultaneously, before transporting both items to upper-level perching areas. After food processing activity with cups monkeys rarely dropped the cups and more often placed the cups onto perching. Monkeys subsequently returned to use cups that they previously placed on perching after food processing activity. The latter behavior is consistent with the possibility that monkeys may keep cups at preferred perching sites for future food processing activity and merits experimental investigation. Reports of spontaneous tool use by squirrel monkeys are rare and this is the first report of population-level tool use. These findings offer insights into the cognitive abilities of squirrel monkeys and provide a new context for behavior studies with this genus and for comparative studies with other primates.

  7. Dummy Cup Helps Robot-Welder Programmers

    NASA Technical Reports Server (NTRS)

    Gordon, Stephen S.


    Dummy gas cup used on torch of robotic welder during programming and practice runs. Made of metal or plastic, dummy cup inexpensive and durable. Withstands bumps caused by programming errors, and is sized for special welding jobs within limited clearances. After robot satisfactorily programmed, replaced by ceramic cup of same dimensions for actual welding.

  8. Coffee Cup Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ashkenaz, David E.; Hall, W. Paige; Haynes, Christy L.; Hicks, Erin M.; McFarland, Adam D.; Sherry, Leif J.; Stuart, Douglas A.; Wheeler, Korin E.; Yonzon, Chanda R.; Zhao, Jing; Godwin, Hilary A.; Van Duyne, Richard P.


    In this activity, students use a model created from a coffee cup or cardstock cutout to explore the working principle of an atomic force microscope (AFM). Students manipulate a model of an AFM, using it to examine various objects to retrieve topographic data and then graph and interpret results. The students observe that movement of the AFM…

  9. Anatomy, histologic features, and vascularity of the adult acetabular labrum.


    Seldes, R M; Tan, V; Hunt, J; Katz, M; Winiarsky, R; Fitzgerald, R H


    Acetabular labrum tears have been implicated as a cause of hip pain in adult patients. Few studies describe the anatomy, histologic features, and microvasculature of the acetabular labrum and labral tears. Fifty-five embalmed and 12 fresh-frozen adult hips with a mean age of 78 years (range, 61-98 years) were studied. Of these, 96 % (53 of 55) of the hips had labral tears, with 74% of the tears located in the anterosuperior quadrant. Histologically, the fibrocartilaginous labrum was contiguous with the acetabular articular cartilage through a 1- to 2-mm zone of transition. A consistent projection of bone extends from the bony acetabulum into the substance of the labrum that is attached via a zone of calcified cartilage with a well-defined tidemark. Two distinct types of tears of the labrum were identified histologically. The first consisted of a detachment of the fibrocartilaginous labrum from the articular hyaline cartilage at the transition zone. The second consisted of one or more cleavage planes of variable depth within the substance of the labrum. Both types of labral tears were associated with increased microvessel formation seen within the tear. The acetabular labrum tear appears to be an acquired condition that is highly prevalent in aging adult hips. Labral tears occur early in the arthritic process of the hip and may be one of the causes of degenerative hip disease.

  10. Pharmacological treatment of heterotopic ossification following hip and acetabular surgery.


    Macfarlane, Robert J; Ng, Boon Han; Gamie, Zakareya; El Masry, Mohamed A; Velonis, Stylianos; Schizas, Constantin; Tsiridis, Eleftherios


    Heterotopic ossification is a common complication following total hip arthroplasty and surgery following acetabular trauma. It is associated with pain and a decreased range of movement. Prophylaxis is achieved by either non-steroidal anti-inflammatory drug treatment or localised irradiation therapy. The objective of this study was to evaluate the evidence for pharmacological agents used for the prophylaxis of heterotopic ossification following hip and acetabular surgery. The study used a comprehensive literature search to identify all major clinical studies investigating the pharmacological agents used in the prophylaxis of heterotopic ossification following hip and acetabular surgery. It was concluded that indometacin remains the 'gold standard' for heterotopic ossification prophylaxis following total hip arthroplasty and is the only drug proven to be effective against heterotopic ossification following acetabular surgery. Following total hip arthroplasty, other non-steroidal anti-inflammatory drugs, including naproxen and diclofenac, are equally as effective as indometacin and can be considered as alternative first-line treatments. Celecoxib is also of equal efficacy to indometacin and is associated with significantly fewer gastrointestinal side effects. However, serious concerns were raised over the safety of selective cyclooxygenase-2 inhibitors for the cardiovascular system and these should be used cautiously.

  11. Tritanium acetabular wedge augments: short-term results

    PubMed Central

    Restrepo, Camilo; Heller, Snir


    Background Reconstruction of acetabular defects in total hip arthroplasty (THA) presents a great challenge to orthopaedic surgeons. Previous studies have reported on the use and outcomes of trabecular metal acetabular augments for the reconstruction of acetabular defects. However, no study has been conducted evaluating the short-term results of tritanium acetabular wedge augments for the reconstruction of acetabular defects in THA. Methods A retrospective study was conducted using a prospective database at a single institution including primary and revision THA patients from January 2013 to December 2014. Patients were included if they received a tritanium acetabular wedge augment system and had a minimum of 2-year follow-up (average 2.2 years ±0.3, range, 2–2.6 years). Demographic data and outcomes data [Harris Hip Score—HHS and Short Form (SF)-36] was collected. Radiographic data was also collected on THA revision cases (Paprosky classification), developmental dysplasia of the hip (DDH) cases (Crowe classification), and radiographic follow-up using DeLee and Charnley’s classification system. Results There were 4 revision THA patients, 3 DDH patients, and 1 patient with posttraumatic arthritis. At the latest radiographic follow-up, there were no lucent lines in DeLee and Charnley Zones I, II or III. During the follow-up period, there was no open revision surgery. The SF-36 physical score significantly improved from preoperative measurement (29.6±2.2) to postoperative measurement (52.2±8.7, P=0.003), and the SF-36 mental score also significantly improved from preoperative assessment (34.5±4.5) to postoperative assessment (52.2±7.5, P=0.003). Total HHS scores also significantly improved postoperatively (P=0.02), with significant improvements in both the pain score (P=0.01) and function score (P=0.02). Conclusions Tritanium acetabular wedge augments in this short follow-up case series exhibit high clinical outcome scores, no radiographic lucency, and no

  12. Validation of neck axis distance as a radiographic measure for acetabular anteversion

    PubMed Central

    Nitschke, Ashley; Petersen, Brian; Lambert, Jeffery R.; Glueck, Deborah H.; Jesse, Mary Kristen; Strickland, Colin; Mei-Dan, Omer


    Excessive acetabular anteversion is an important treatment consideration in hip preservation surgery. There is currently no reliable quantitative method for determining acetabular anteversion utilizing radiographs alone. The three main purposes of this study were to: (i) define and validate the neck axis distance (NAD) as a new visual and reproducible semi-quantitative radiographic parameter used to measure acetabular anteversion; (ii) determine the degree of correlation between NAD and computed tomography (CT)-measured acetabular anteversion; (iii) establish a sensitive and specific threshold value for NAD to identify excessive acetabular anteversion. This retrospective cohort study included all patients presenting to a single institution over a 14-month period who had undergone a dedicated musculoskeletal CT pelvis along with a standardized anteroposterior (AP) pelvis radiograph. Trained observers measured the NAD on the AP pelvis radiograph and equatorial acetabular anteversion on CT for all hips. Mixed model analysis was used to find prediction equations, and ROC analysis was used to evaluate the diagnostic accuracy of NAD. NAD is a valid semi-quantitative predictor of acetabular anteversion and strongly correlates with CT-measured equatorial acetabular anteversion (P  <  0.0001). A NAD measurement of greater than 14 mm predicts excessive acetabular anteversion with 76% sensitivity and 78% specificity. NAD is an accurate radiographic predictor of acetabular anteversion, which may be readily used as an effective screening tool during the evaluation of patients with hip pain. PMID:27026824

  13. Acetabular UHMWPE Survival and Wear Changes With Different Manufacturing Techniques

    PubMed Central

    Keating, E. Michael; Davis, Kenneth E.


    Background Polyethylene wear may be affected by the type of polyethylene resin, manufacturing technique, degree of thermal stabilization, and sterilization technique. Questions/purposes We therefore compared femoral head penetration into the PE and cup survival using the same cup system with different PE resins, manufacturing, and sterilization techniques. Methods Our study group consisted of 1912 THAs performed using the same uncemented cup and identical 28-mm cobalt-chrome heads. The polyethylene varied as follows: Group 1 (94 cups), GUR 4150 resin, ram-extruded, sterilized in air, no barrier packaging; Group 2 (74 cups), same as Group 1 but sterilized in argon; Group 3 (75 cups), Himont 1900 resin, compression-molded bar stock, sterilized in argon, no barrier packaging; Group 4 (620 cups), same as Group 3 except with barrier packing; Group 5 (711 cups), GUR 1050 resin, compression-molded bar stock, sterilized in argon gas with barrier packaging; and Group 6 (338 cups), GUR 1050 resin, compression-molded bar stock, sterilized in argon with barrier packaging, irradiated with 50 kGy, heated below melting temperature, machined, and finally placed in nonbarrier packaging with gas plasma sterilization. Minimum followup was 2 years (average, 7 years; range, 2–17 years). Results Femoral head penetration averaged 0.05 mm per year for Groups 5 and 6 and was substantially lower than for Groups 1 to 4. Cup survival was higher at seven years in Groups 3, 4, and 5, and at 10 years in group 4 when compared to groups 1, 2, and 3. Conclusions We observed lower FHP rates and higher cup survival with polyethylene machined from direct compression-molded bar stock, sterilized in argon gas, with barrier packaging. Level of Evidence Level III Therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. PMID:20852973

  14. Lateral acetabular labral length is inversely related to acetabular coverage as measured by lateral center edge angle of Wiberg

    PubMed Central

    Petersen, Brian D.; Wolf, Bryan; Lambert, Jeffrey R.; Clayton, Carolyn W.; Glueck, Deborah H.; Jesse, Mary Kristen; Mei-Dan, Omer


    Patients with developmental dysplasia of the hip often have compensatory labral hypertrophy, which presumably lends stability to an unstable joint. Conversely, patients with acetabular overcoverage may have small or ossified labra. The purpose of this study is to explore the interaction of labral length with the degree of acetabular hip coverage. A retrospective cohort of patients with hip pain presenting to a hip preservation center, who had undergone hip magnetic resonance imaging and AP pelvis radiographs were studied. General linear multivariate models were used to assess the association between three measures of labral length (lateral, anterior and anterior inferior locations along the acetabular rim) and the X-ray derived lateral center edge angle (LCEA) of Wiberg. Of the three acetabular labral locations measured, only the lateral labrum was associated with LCEA Wiberg (P = 0.0008). Lateral labral length increases as LCEA of Wiberg decreases. The anterior and anterior inferior labral locations did not show a predictable increase in labral length as LCEA Wiberg decreased. PMID:27583157

  15. Lateral acetabular labral length is inversely related to acetabular coverage as measured by lateral center edge angle of Wiberg.


    Petersen, Brian D; Wolf, Bryan; Lambert, Jeffrey R; Clayton, Carolyn W; Glueck, Deborah H; Jesse, Mary Kristen; Mei-Dan, Omer


    Patients with developmental dysplasia of the hip often have compensatory labral hypertrophy, which presumably lends stability to an unstable joint. Conversely, patients with acetabular overcoverage may have small or ossified labra. The purpose of this study is to explore the interaction of labral length with the degree of acetabular hip coverage. A retrospective cohort of patients with hip pain presenting to a hip preservation center, who had undergone hip magnetic resonance imaging and AP pelvis radiographs were studied. General linear multivariate models were used to assess the association between three measures of labral length (lateral, anterior and anterior inferior locations along the acetabular rim) and the X-ray derived lateral center edge angle (LCEA) of Wiberg. Of the three acetabular labral locations measured, only the lateral labrum was associated with LCEA Wiberg (P = 0.0008). Lateral labral length increases as LCEA of Wiberg decreases. The anterior and anterior inferior labral locations did not show a predictable increase in labral length as LCEA Wiberg decreased. PMID:27583157

  16. In vitro experiments with an injection technique for cup fixation in total hip arthroplasty.


    Somville, J M; Moldenaers, P F; Mulier, J C; Mewis, J J


    A new technique has been developed to position the cup rigidly into the acetabulum during total hip joint replacement. After positioning the flanged cup on the acetabulum by means of screws, a low-viscosity cement is injected through a hole in the rim of the cup. A comparison with the standard cementing technique was made on the basis of in vitro experiments. For this purpose a mold was constructed to produce castings simulating the human acetabulum. The distribution of the cement, the pressure developed in the acetabulum, and the penetration of the cement are compared for the two cementing techniques. PMID:3606358

  17. Effect of cup inclination on predicted contact stress-induced volumetric wear in total hip replacement.


    Rijavec, B; Košak, R; Daniel, M; Kralj-Iglič, V; Dolinar, D


    In order to increase the lifetime of the total hip endoprosthesis, it is necessary to understand mechanisms leading to its failure. In this work, we address volumetric wear of the artificial cup, in particular the effect of its inclination with respect to the vertical. Volumetric wear was calculated by using mathematical models for resultant hip force, contact stress and penetration of the prosthesis head into the cup. Relevance of the dependence of volumetric wear on inclination of the cup (its abduction angle ϑA) was assessed by the results of 95 hips with implanted endoprosthesis. Geometrical parameters obtained from standard antero-posterior radiographs were taken as input data. Volumetric wear decreases with increasing cup abduction angle ϑA. The correlation within the population of 95 hips was statistically significant (P = 0.006). Large cup abduction angle minimises predicted volumetric wear but may increase the risk for dislocation of the artificial head from the cup in the one-legged stance. Cup abduction angle and direction of the resultant hip force may compensate each other to achieve optimal position of the cup with respect to wear and dislocation in the one-legged stance for a particular patient.

  18. Reproducibility of Acetabular Landmarks and a Standardized Coordinate System Obtained from 3D Hip Ultrasound.


    Mabee, Myles; Dulai, Sukhdeep; Thompson, Richard B; Jaremko, Jacob L


    Two-dimensional (2D) ultrasound detection of developmental dysplasia of the hip (DDH) is limited by variation in acetabular appearance and alpha angle measurements, which change with position of the ultrasound probe. Three-dimensional (3D) ultrasound captures the entire acetabular shape, and a reproducible "standard central plane" may be generated, from two landmarks located on opposite ends of the acetabulum, for measurement of alpha angle and other indices. Two users identified landmarks on 51 3D ultrasounds, with ranging severity of disease, and inter- and intra-observer reproducibility of landmark and "standard plane" locations was compared; landmarks were chosen within 2 mm, and the "standard plane" rotation was reproducible within 10° between observers. We observed no difference in variability between alpha angles measured on the "standard plane" in comparison with 2D ultrasound. Applications of the standardized 3D ultrasound central plane will be to fuse serial ultrasounds for follow-up and development of new indices of 3D deformity. PMID:25394808

  19. Debonding of porous coating of a threaded acetabular component: retrieval analysis.


    Łapaj, Łukasz; Markuszewski, Jacek; Rybak, Tomasz; Wierusz-Kozłowska, Małgorzata


    This report presents a case of debonding of plasma sprayed porous titanium coating from a threaded acetabular component which caused aseptic loosening of the implant. Weight bearing after delamination caused abrasive damage of the acetabular shell, and particles of the coating embedded in the acetabular liner. Microscopic examination of periprosthetic tissues showed presence of metal particles and macrophage infiltration. Despite microscopic examination of the retrieved component the cause of debonding remains unclear. PMID:23127634

  20. Evaluation of the NexScreen and DrugCheck Waive RT urine drug detection cups.


    Lin, Chia-Ni; Nelson, Gordon J; McMillin, Gwendolyn A


    Urine drug testing is an important tool that is commonly used to assess patient compliance with prescription regimens. Point-of-collection immunoassay devices allow for timely availability of laboratory test results to guide therapy during the same office visit. Two waived immunoassay-based urine drug screen cups were evaluated in this study. The NexScreen cup and the DrugCheck Waive RT cup claim to detect 10-12 drug classes of commonly used and/or abused drugs. This study included a sensitivity and precision challenge with 4-6 replicates at concentrations 0-150% of the manufacture's claimed cutoff, using drug-free urine spiked with purified reference standards. The stability of test results was evaluated by reading the results at intervals between five and 1,440 min. Specificity was evaluated by parallel comparison of pooled patients' specimens, representing 56 patients and 41 known drug compounds. When comparing results to validated liquid chromatography-mass spectrometry results, false positives were observed in the NexScreen cups for benzodiazepine, methamphetamine, methadone, opiates and tricyclic antidepressant tests, but there were no false negatives. The DrugCheck Waive RT cups showed false negative results for barbiturates and opiates, but no false positives. Overall, the NexScreen cup demonstrated better sensitivity than claimed, whereas the sensitivity of the DrugCheck Waive RT cup did not meet claims.

  1. Late sciatic nerve axonotmesis following acetabular reconstruction plate.


    Moreta, J; Foruria, X; Labayru, F


    Sciatic nerve injuries associated with acetabular fractures can be post-traumatic, perioperative or postoperative. Late postoperative injury is very uncommon and can be due to heterotopic ossifications, muscular scarring, or implant migration. A case is presented of a patient with a previous transverse acetabular fracture treated with a reconstruction plate for the posterior column. After 17 years, she presented with progressive pain and motor deficit in the sciatic territory. Radiological and neurophysiological assessments were performed and the patient underwent surgical decompression of the sciatic nerve. A transection of the nerve was observed that was due to extended compression of one of the screws. At 4 years postoperatively, her pain had substantially diminished and the paresthesias in her leg had resolved. However, her motor symptoms did not improve. This case report could be relevant due to this uncommon delayed sciatic nerve injury due to prolonged hardware impingement.

  2. Acetabular Paralabral Cyst: An Unusual Cause of Femoral Vein Compression

    PubMed Central

    Kullar, Raj S.; Kapron, Ashley L.; Ihnat, Daniel; Aoki, Stephen K.; Maak, Travis G.


    Acetabular labral tears are a known cause of hip pain in the young, active patient. Labral tears can be due to trauma, femoroacetabular impingement, capsular laxity, dysplasia, and degenerative pathology. Paralabral cysts are relatively common in association with labral tears of the hip, with cysts seen on magnetic resonance imaging studies in as many as 50% to 70% of patients with labral tears. In some cases the cysts can become sizeable and cause neurovascular compression. Nonoperative interventions for the management of paralabral cysts in the shoulder and knee have shown high recurrence rates. In the shoulder and knee, arthroscopic debridement of paralabral cysts has shown good results with lower recurrence rates and resolution of neurovascular function. In the hip there is limited literature regarding surgical management of paralabral cysts. We present a surgical technique for arthroscopic decompression of acetabular paralabral cysts combined with labral repair. PMID:25973371

  3. Nonunion of acetabular fractures: evaluation with interactive multiplanar CT

    SciTech Connect

    Kuhlman, J.E.; Fishman, E.K.; Ney, D.R.; Brooker, A.F. Jr.; Magid, D.


    Nonunions involving fractures of the acetabulum are reportedly rare, with few citings and little discussion in the literature. It is possible that acetabular nonunions go undetected because imaging of the acetabulum is difficult by conventional radiography. We report two cases of fracture nonunion involving the weight-bearing surface of the acetabulum diagnosed with the aid of computed tomography (CT) and a newly developed interactive 2D/3D orthotool that uniquely processes and reformats routine CT data. The interactive 2D/3D orthotool is a sophisticated computer program that allows dynamic viewing of standard multiplanar reconstructions in the axial, coronal, and sagittal planes as well as multiple oblique projections. The 2D/3D orthotool provides on screen correlation of two-dimensional multiplanar images with three-dimensional reconstructions of the pelvis. The authors found this capability ideally suited for studying fractures with off-axis orientation such as those through the acetabular dome, greatly facilitating the diagnosis of nonunion.

  4. The cryptic enhancer elements of the tCUP promoter.


    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian


    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  5. Clinical and radiographic outcomes of acetabular impaction grafting without cage reinforcement for revision hip replacement: a minimum ten-year follow-up study.


    Gilbody, J; Taylor, C; Bartlett, G E; Whitehouse, S L; Hubble, M J W; Timperley, A J; Howell, J R; Wilson, M J


    Impaction bone grafting for the reconstitution of bone stock in revision hip surgery has been used for nearly 30 years. Between 1995 and 2001 we used this technique in acetabular reconstruction, in combination with a cemented component, in 304 hips in 292 patients revised for aseptic loosening. The only additional supports used were stainless steel meshes placed against the medial wall or laterally around the acetabular rim to contain the graft. All Paprosky grades of defect were included. Clinical and radiographic outcomes were collected in surviving patients at a minimum of ten years after the index operation. Mean follow-up was 12.4 years (sd 1.5) (10.0 to 16.0). Kaplan-Meier survival with revision for aseptic loosening as the endpoint was 85.9% (95% CI 81.0 to 90.8) at 13.5 years. Clinical scores for pain relief remained satisfactory, and there was no difference in clinical scores between cups that appeared stable and those that appeared radiologically loose. PMID:24493183

  6. Cheaper Custom Shielding Cups For Arc Welding

    NASA Technical Reports Server (NTRS)

    Morgan, Gene E.


    New way of making special-purpose shielding cups for gas/tungsten arc welding from hobby ceramic greatly reduces cost. Pattern machined in plastic. Plaster-of-paris mold made, and liquid ceramic poured into mold. Cost 90 percent less than cup machined from lava rock.

  7. 21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Hip joint (hemi-hip) acetabular metal cemented... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3370 Hip joint (hemi-hip) acetabular metal cemented prosthesis. (a) Identification. A hip joint (hemi-hip)...

  8. 21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Hip joint (hemi-hip) acetabular metal cemented... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3370 Hip joint (hemi-hip) acetabular metal cemented prosthesis. (a) Identification. A hip joint (hemi-hip)...

  9. 21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Hip joint (hemi-hip) acetabular metal cemented... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3370 Hip joint (hemi-hip) acetabular metal cemented prosthesis. (a) Identification. A hip joint (hemi-hip)...

  10. 21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hip joint (hemi-hip) acetabular metal cemented... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3370 Hip joint (hemi-hip) acetabular metal cemented prosthesis. (a) Identification. A hip joint (hemi-hip)...

  11. 21 CFR 888.3370 - Hip joint (hemi-hip) acetabular metal cemented prosthesis.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Hip joint (hemi-hip) acetabular metal cemented... HUMAN SERVICES (CONTINUED) MEDICAL DEVICES ORTHOPEDIC DEVICES Prosthetic Devices § 888.3370 Hip joint (hemi-hip) acetabular metal cemented prosthesis. (a) Identification. A hip joint (hemi-hip)...

  12. Solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus.


    Korste, Annika; Wulfhorst, Hannes; Ikegami, Takahisa; Nowaczyk, Marc M; Stoll, Raphael


    The cyanobacterial multi-subunit membrane protein complex NDH-1 is both structurally and functionally related to Complex I of eubacteria and mitochondria. In addition to functions in respiration and cyclic electron transfer around photosystem I (PSI), the cyanobacterial NDH-1 complex is involved in a unique mechanism for inorganic carbon concentration. Although the crystal structures of the similar respiratory Complex I from Thermus thermophilus and Escherichia coli are known, atomic structural information is not available for the cyanobacterial NDH-1 complex yet. In particular, the structures of those subunits that are not homologous to Complex I will help to understand their distinct functions. The 15.7kDa protein CupS is a small soluble subunit of the complex variant NDH-1MS, which is thought to play a role in CO2 conversion. Here, we present the NMR structure of CupS from Thermosynechococcus elongatus, which is the very first structure of a specific cyanobacterial NDH-1 complex subunit. CupS shares a structural similarity with members of the Fasciclin protein superfamily. The structural comparison to Fasciclin type proteins based on known NMR structures and protein sequences of human TGFBIp, MPB70 from Mycobacterium bovis, and Fdp from Rhodobacter sphaeroides, together with a virtual docking model of CupS and NdhF3, provide first insight into the specific binding of CupS to the NDH-1MS complex at atomic resolution.

  13. Acetabular shell deformation as a function of shell stiffness and bone strength.


    Dold, Philipp; Pandorf, Thomas; Flohr, Markus; Preuss, Roman; Bone, Martin C; Joyce, Tom J; Holland, James; Deehan, David


    Press-fit acetabular shells used for hip replacement rely upon an interference fit with the bone to provide initial stability. This process may result in deformation of the shell. This study aimed to model shell deformation as a process of shell stiffness and bone strength. A cohort of 32 shells with two different wall thicknesses (3 and 4 mm) and 10 different shell sizes (44- to 62-mm outer diameter) were implanted into eight cadavers. Shell deformation was then measured in the cadavers using a previously validated ATOS Triple Scan III optical system. The shell-bone interface was then considered as a spring system according to Hooke's law and from this the force exerted on the shell by the bone was calculated using a combined stiffness consisting of the measured shell stiffness and a calculated bone stiffness. The median radial stiffness for the 3-mm wall thickness was 4192 N/mm (range, 2920-6257 N/mm), while for the 4-mm wall thickness the median was 9633 N/mm (range, 6875-14,341 N/mm). The median deformation was 48 µm (range, 3-187 µm), while the median force was 256 N (range, 26-916 N). No statistically significant correlation was found between shell stiffness and deformation. Deformation was also found to be not fully symmetric (centres 180° apart), with a median angle discrepancy of 11.5° between the two maximum positive points of deformation. Further work is still required to understand how the bone influences acetabular shell deformation.

  14. Is labral hypotrophy correlated with increased acetabular depth?

    PubMed Central

    Toft, Felix; Anliker, Elmar; Beck, Martin


    Labral hypertrophy is a distinct feature in hip dysplasia. Occasionally, very small, hypotrophic labra are observed. However, there is no literature concerning this pathology. We investigated if the size of the labrum correlated with any radiologic parameters reflecting the amount of acetabular coverage. It was hypothezised that there is a negative correlation between labrum size and acetabular coverage. Labra were categorized into three groups depending on the relation between length of the articular sided surface and height of bony attachment. Labra with a height:length ratio of 2 were classified as hypotrophic, with a height:length ratio of 1 as normal and with a ratio of 0.5 as hypertrophic. Labral cross-sectional areas (CSA) were measured on radial magnetic resonance imaging-arthrography slices using the measuring tool of the PACS system of 20 hips with hypotrophic labra (group 1), 20 hips with normal labral appearance (group 2) and 10 hips with hypertrophic labra (group 3). These values were then analyzed against following parameters: neck-shaft-angle (NSA), lateral center-edge angle (LCE), acetabular index (AI), femoral extrusion index (FEI) and acetabular retroversion index (ARI). Analyses of variance were used to determine differences in mean values between the three groups. Mean labral CSA differed significantly between all groups (group 1: 12.1 ± 2.9 mm2; group 2: 25.2 ± 6.2 mm2; group 3: 41.1 ± 12.3 mm2; P < 0.001). NSA, LCE, AI and FEI all showed a significant difference between group 3 and 1 or 2. The ARI showed no difference between groups. Stepwise linear regression analyses showed a significant correlation between LCE angle and labral CSA with a corrected R2-value of 0.301. Labral CSA correlates with the LCE. No statistically significant difference between groups 1 and 2 concerning the LCE, AI or FEI could be identified. Nevertheless, group 1 had the highest mean coverage of all groups, hips with hypertrophic labra

  15. Etiology and severity of impingement injuries of the acetabular labrum: what is the role of femoral morphology?


    Dy, Christopher J; Schroder, Steven J; Thompson, Matthew T; Alexander, Jerry W; Noble, Philip C


    Injuries to the acetabular labrum have been seen in association with femoroacetabular impingement, but recent studies have reported labral pathology in patients with normal hip morphology. The hypothesis of the current study was that labral lesions could occur without femoroacetabular impingement but that labral pathology would occur more commonly and more severely in hip joints that exhibit reduced head-neck offset. The presence, location, and severity of labral injury were recorded in 22 cadaveric specimens. Computed tomography was used to define the anatomic parameters of proximal femoral morphology. Three-dimensional modeling was used to simulate hip positions that typically cause labral impingement, including high flexion and internal rotation. Femoral morphology was compared between specimens with and without labral pathology using descriptive statistics. Labral pathology was seen in 15 of 22 specimens and was located in the anterosuperior portion of the labrum. No difference existed in age, femoral neck shaft angle, anteversion, acetabular depth, head diameter, alpha angle, or beta angle between specimens with and without labral pathology. The severity of labral pathology correlated with the alpha angle of the proximal femur. This study demonstrates that damage to the labrum may occur in hips with normal proximal femur morphology. However, the findings also indicate that the presence of morphologic features that increase the risk of impingement may predispose the hip joint to a characteristic pattern or severity of labral pathology. The results confirm the importance of considering both femoral morphology and athletic-type activities of the hip when determining the mechanism responsible for injury of the acetabular labrum.

  16. An uncemented iso-elastic monoblock acetabular component: preliminary results.


    Halma, Jelle J; Eshuis, Rienk; Vogely, H Charles; van Gaalen, Steven M; de Gast, Arthur


    Little is known about the clinical application of highly cross-linked polyethylene (HXLPE) blended with vitamin E. This study evaluates an uncemented iso-elastic monoblock cup with vitamin E blended HXLPE. 112 patients were followed up for 2years. 95.5% completed the follow-up. The mean VAS score for patient satisfaction was 8.8 and the mean Harris Hip Score was 94.2. In 7 cases initial gaps behind the cup were observed, which disappeared completely during follow-up in 6 cases. The mean femoral head penetration rate was 0.055mm/year. No adverse reactions or abnormal mechanical behavior was observed with the short term use of vitamin E blended HXLPE. This study shows the promising performance of this cup and confirms the potential of vitamin E blended HXLPE.

  17. Clear plastic cups: a childhood choking hazard.


    Weiss, R L; Goldstein, M N; Dharia, A; Zahtz, G; Abramson, A L; Patel, M


    The disposable plastic beverage cup is not usually regarded as hazardous to young children. Certain varieties of these products however, are manufactured from a brittle, clear plastic that easily cracks and fragments. While most conscientious parents keep their children safe from peanuts, balloons, and other known choking hazards, a child can surreptitiously bite a cup edge and aspirate the fragment. We report two cases of foreign body aspiration involving clear plastic cups that went undetected one of which remained 21 months following a negative rigid bronchoscopy. Diagnostic difficulties are related to the transparency and radiolucency of these objects. When suspicious of foreign body aspiration in children, otolaryngologists should inquire about the availability of clear plastic cups in the household and be mindful of the diagnostic pitfalls. Further investigations including CT scanning and repeat bronchoscopy may be helpful in cases of suspected missed foreign bodies. An educational campaign aimed at prevention and placement of product package warning labels should be established.

  18. Role of the Acetabular Labrum in Load Support Across the Hip Joint

    PubMed Central

    Henak, Corinne R.; Ellis, Benjamin J.; Harris, Michael D.; Anderson, Andrew E.; Peters, Christopher L.; Weiss, Jeffrey A.


    The relatively high incidence of labral tears among patients presenting with hip pain suggests that the acetabular labrum is often subjected to injurious loading in vivo. However, it is unclear whether the labrum participates in load transfer across the joint during activities of daily living. This study examined the role of the acetabular labrum in load transfer for hips with normal acetabular geometry and acetabular dysplasia using subject-specific finite element analysis. Models were generated from volumetric CT data and analyzed with and without the labrum during activities of daily living. The labrum in the dysplastic model supported 4-11% of the total load transferred across the joint, while the labrum in the normal model supported only 1-2% of the total load. Despite the increased load transferred to the acetabular cartilage in simulations without the labrum, there were minimal differences in cartilage contact stresses. This was because the load supported by the cartilage correlated to the cartilage contact area. A higher percentage of load was transferred to the labrum in the dysplastic model because the femoral head achieved equilibrium near the lateral edge of the acetabulum. The results of this study suggest that the labrum plays a larger role in load transfer and joint stability in hips with acetabular dysplasia than in hips with normal acetabular geometry. PMID:21757198

  19. Decreased Lumbar Lordosis and Deficient Acetabular Coverage Are Risk Factors for Subchondral Insufficiency Fracture

    PubMed Central


    Subchondral insufficiency fracture (SIF) of the femoral head occurs in the elderly and recipients of organ transplantation. Osteoporosis and deficient lateral coverage of the acetabulum are known risk factors for SIF. There has been no study about relation between spinopelvic alignment and anterior acetabular coverage with SIF. We therefore asked whether a decrease of lumbar lordosis and a deficiency in the anterior acetabular coverage are risk factors. We investigated 37 patients with SIF. There were 33 women and 4 men, and their mean age was 71.5 years (59-85 years). These 37 patients were matched with 37 controls for gender, age, height, weight, body mass index and bone mineral density. We compared the lumbar lordosis, pelvic incidence, pelvic tilt, sacral slope, acetabular index, acetabular roof angle, acetabular head index, anterior center-edge angle and lateral center-edge angle. Lumbar lordosis, pelvic tilt, sacral slope, lateral center edge angle, anterior center edge angle, acetabular index and acetabular head index were significantly different between SIF group and control group. Lumbar lordosis (OR = 1.11), lateral center edge angle (OR = 1.30) and anterior center edge angle (OR = 1.27) had significant associations in multivariate analysis. Decreased lumbar lordosis and deficient anterior coverage of the acetabulum are risk factors for SIF as well as decreased lateral coverage of the acetabulum. PMID:27550496

  20. Enhanced modified faraday cup for determination of power density distribution of electron beams


    Elmer, John W.; Teruya, Alan T.


    An improved tomographic technique for determining the power distribution of an electron or ion beam using electron beam profile data acquired by an enhanced modified Faraday cup to create an image of the current density in high and low power ion or electron beams. A refractory metal disk with a number of radially extending slits, one slit being about twice the width of the other slits, is placed above a Faraday cup. The electron or ion beam is swept in a circular pattern so that its path crosses each slit in a perpendicular manner, thus acquiring all the data needed for a reconstruction in one circular sweep. The enlarged slit enables orientation of the beam profile with respect to the coordinates of the welding chamber. A second disk having slits therein is positioned below the first slit disk and inside of the Faraday cup and provides a shield to eliminate the majority of secondary electrons and ions from leaving the Faraday cup. Also, a ring is located below the second slit disk to help minimize the amount of secondary electrons and ions from being produced. In addition, a beam trap is located in the Faraday cup to provide even more containment of the electron or ion beam when full beam current is being examined through the center hole of the modified Faraday cup.

  1. Subchondral Insufficiency Fracture of the Femoral Head Caused by Excessive Lateralization of the Acetabular Rim

    PubMed Central

    Kimura, Tetsuya; Goto, Tomohiro; Hamada, Daisuke; Tsutsui, Takahiko; Wada, Keizo; Fukuta, Shoji; Nagamachi, Akihiro; Sairyo, Koichi


    We present a case of a 53-year-old woman with subchondral insufficiency fracture (SIF) of the femoral head without history of severe osteoporosis or overexertion. Plain radiographs showed acetabular overcoverage with excessive lateralization of the acetabular rim. A diagnosis of SIF was made by typical MRI findings of SIF. The lesion occurred at the antipodes of the extended rim. Increased mechanical stress over the femoral head due to impingement against the excess bone was suspected as a cause of SIF. The distinct femoral head deformity is consistent with this hypothesis. This is the first report of SIF associated with acetabular overcoverage. PMID:27293935

  2. The effect of 3-column spinal osteotomy on anterior pelvic plane and acetabulum position.


    Schroeder, Josh E; Jerabek, Seth; Sama, Andrew; Kaplan, Leon; Girardi, Federico; Lebl, Darren R


    Because the spine and pelvis are integrated, changes in spine sagittal balance affect relative acetabulum position. A 1° change of the anterior pelvic plane changes acetabulum anteversion by 0.8°. Three-column spine osteotomies correct fixed sagittal plane deformity. Twenty patients with kyphotic deformity and associated sagittal imbalance underwent corrective 3-column osteotomy. We reviewed upright pelvic and spine radiographs preoperatively and postoperatively and documented the changes in angles. The average sagittal vertical axis was 11.07 cm preoperatively and 4.8 cm postoperatively. Lumbar lordosis changed (on average) from 39° preoperatively to 55° postoperatively (P < .05). Sacral slope increased an average of 6.7° (P = .015). Pelvic tilt decreased by 5.4° (P = .001). The anterior pelvic plane increased by 8.23° (P < .0001). This correction of the sagittal balance is associated with a concomitant increase in sacral slope, pelvic tilt, and the anterior pelvic plane angles. These changes will increase acetabulum anteversion by a predicted 6.54°. This increase will change acetabular cup position and must be considered in patients with spine and pelvic osteoarthritis that requires hip surgery.

  3. Long Term Results of Liner Polyethylene Cementation Technique in Revision for Peri-acetabular Osteolysis.


    Rivkin, Gurion; Kandel, Leonid; Qutteineh, Bilal; Liebergall, Meir; Mattan, Yoav


    Patients with peri-acetabular osteolysis around a well fixed cementless acetabular component may be treated with liner exchange. When the locking mechanism is unreliable or unavailable, cementing the liner into the fixed acetabular component is a feasible option. The purpose of this study was to evaluate the clinical and radiographic long term results of this technique. Forty hip revisions with liner cementation in 37 patients were performed. The minimum follow up was 10 years. Modified Harris Hip Score and recent x rays were reviewed. Four hips were re-revised. Two patients were diagnosed with exacerbation of osteolysis but refused revision. Dislocation rate was relatively high (16%). Liner cementation technique in revision hip surgery is useful in patients with a well fixed metal backed acetabular component.

  4. Total arthroplasty in displaced dysplastic hips with acetabular reconstruction and femoral shortening - technical note.


    Silva, Paulo; de Oliveira, Leandro Alves; Coelho, Danilo Lopes; do Amaral, Rogério Andrade; Rebello, Percival Rosa; de Moraes, Frederico Barra


    To describe a new procedure of total hip replacement in patient with severe developmental dysplasia of the left hip, using technique of acetabular reconstruction with autogenous bone grafts and subtrochanteric shortening femoral osteotomy. Total hip replacement done in January of 2003. The Eftekhar's classification was used and included type D, neglected dislocations. Bone graft incorporated in acetabular shelf and femoral osteotomy. Our contribution is the use of an Allis plate to better fix acetabular grafts, avoiding loosening, and cerclage around bone graft in femoral osteotomy site, which diminish pseudoarthrosis risk. This technique shows efficiency, allowing immediately resolution for this case with pain and range of motion of hip improvement. It also allows the acetabular dysplasia reconstruction, equalization of the limb length (without elevated risk of neurovascular lesion) and repairs the normal hip biomechanics due to the correction of the hip's center of rotation.

  5. Minimal backside surface changes observed in retrieved acetabular liners.


    Akbari, Abtin; Roy, Marcel E; Whiteside, Leo A; Katerberg, Brian J; Schnettgoecke, Daniel J


    Modular polyethylene liners offer versatility in total hip arthroplasty, but the locking mechanism may allow micromotion and backside wear. We evaluated the backside surface of 56 retrieved acetabular liners (mean 5.54 years in vivo, range 0.003-13.1 years) to determine whether damage correlated with liner age in vivo, patient factors associated with higher activity, and polyethylene quality. Half of the liners exhibited minimal damage, half exhibited no damage and none exhibited severe damage. Backside damage significantly correlated only to liner age in vivo. Ten of the 28 liners revised for osteolysis exhibited no backside damage, but the osteolytic cysts were peripheral and did not originate from screw holes. The results suggest that modular polyethylene liners in a porous titanium-coated shell with screw holes can be designed such that clinically significant backside wear is minimal. PMID:20875939

  6. Back-side wear in HexLoc cups clinico-radiological, immunohistopathological, finite element, and retrieval analysis studies.


    Kawaji, Hiroyuki; Koistinen, Arto; Korhonen, Rami; Lappalainen, Reijo; Lohman, Martina; Soininen, Antti; Gomez Barrena, Enrique; Konttinen, Yrjo T; Ylinen, Pekka; Tallroth, Kaj


    The HexLoc locking system was designed to prevent back-side wear of the polyethylene liner in the modular cementless metal-backed acetabular cup, but failed. Back-side wear was analyzed using clinico-radiological data, immunohistopathology, finite element modeling (FEM, and retrieval analysis. Screw holes allowed entry of titanium oxide and exit of polyethylene particles. Birefringent polyethylene wear particles were found behind the metal cup in macrophages containing pro-inflammatory tumor necrosis factor-α and interleukin-1β, whereas fibroblast-like cells stained for osteoclastogenic receptor activator of nuclear factor kappa B ligand (RANKL). Computerized tomography revealed granulomas (83% versus 17 %) and cortical destruction (50% versus 5%) better than radiographs. In FEM, a change of the abduction angle from 45 to 60 deg, and liner thickness from 4.8 mm to 2.5 mm, increased the back-side wear by 90% and 120%, respectively. Screw holes were stress concentration areas; their removal decreased wear by 40%. Modeling results were validated in retrieved implants, which demonstrated extensive back-side wear damage of liners with a high abduction angle. Combined clinico-radiological, immunohistopathological, FEM, and retrieval analysis disclosed that back-side wear in the HexLoc design is sensitive to the abduction angle, liner thickness, and presence of screw holes. PMID:25747033

  7. The concentric all-polyethylene Exeter acetabular component in primary total hip replacement.


    Veitch, S W; Whitehouse, S L; Howell, J R; Hubble, M J W; Gie, G A; Timperley, A J


    We report the outcome of the flangeless, cemented all-polyethylene Exeter acetabular component at a mean of 14.6 years (10 to 17) after operation. Of the 263 hips in 243 patients, 122 prostheses are still in situ; 112 patients (119 hips) have died, 18 hips have been revised, and three patients (four hips) were lost to follow-up. Radiographs at the final review were available for 110 of the 122 surviving hips. There were acetabular radiolucent lines in 54 hips (49%). Two acetabular components had migrated but neither patient required revision. The Kaplan-Meier survivorship at 15 years with 61 hips at risk with revision for any cause as the endpoint was 89.9% (95% confidence interval (CI) 84.6 to 95.2) and for aseptic loosening of the acetabular component or lysis 91.7% (95% CI 86.6 to 96.8). In 210 hips with a diagnosis of primary osteoarthritis, survivorship with revision for any cause as the endpoint was 93.2% (95% CI 88.1 to 98.3), and for aseptic loosening of the acetabular component 95.0% (95% CI 90.3 to 99.7). The cemented all-polyethylene Exeter acetabular component has an excellent long-term survivorship.

  8. Hip Arthroscopy in the Presence of Acetabular Dysplasia

    PubMed Central

    Jayasekera, Narlaka; Aprato, Alessandro; Villar, Richard N


    Purpose : Hip arthroscopy is a well established therapeutic intervention for an increasing number of painful hip conditions. Developmental dysplasia of the hip (DDH) is commonly associated with intra-articular hip pathology. However, some surgeons perceive patients with hip dysplasia as poor candidates for hip arthroscopy. Our aim was to describe early outcomes of arthroscopic treatment for patients with DDH, who also had femoroacetabular impingement (FAI) treated when necessary, and to compare these outcomes against a control group of patients without DDH. Methods : Prospective case-control study of 68 consecutive hip arthroscopy patients assessed with a modified Harris Hip Score (mHHS) preoperatively and at six weeks, six months, and one year after surgery. Presence of DDH was determined using a standard anteroposterior (AP) pelvic radiograph to measure the centre-edge angle (CEA) of Wiberg, with a CEA < 20º used as threshold for diagnosis of DDH. Results : 12 patients (eight female and four male) with acetabular dysplasia and mean CEA of 15.4º (9º to 19º). The control, nondysplastic group comprised 54 patients (23 females and 31 males) with a mean CEA of 33.1º (22º to 45º). All patients in the dysplastic group had a labral tear and 11 (91.7%) had associated femoral cam impingement lesion addressed at arthroscopy. Our study demonstrates a significant (p=0.02) improvement in outcome in the dysplastic group at one year using the mHHS. Conclusion : Hip arthroscopy in the presence of DDH is effective in relieving pain for at least one year after surgery although does not address underlying acetabular abnormality. PMID:26069512

  9. Failure analysis of retrieved PE-UHMW acetabular liners.


    Laska, Anna; Archodoulaki, Vasiliki-Maria; Duscher, Bernadette


    Ultra-high molecular weight polyethylene (PE-UHMW) acetabular liners have a limited lifespan in a patient's body. There are many factors affecting the performance of the implant and furthermore the properties of the polymeric material are changing after implantation. In this work material changes according to structure and morphology and their implication on mechanical properties are in focus. The physical and mechanical properties of ten crosslinked (xL) PE-UHMW and nine conventional (conv) gamma-sterilized PE-UHMW hip components, used as sliding surface in total hip joint replacement, with different in-vivo times are compared. The evaluation of the retrieved acetabular liners is performed in view of crosslinking and conventional gamma-sterilization but also in terms of the influence of gender concerning alteration in properties. The oxidative degradation in the PE-UHMW is investigated by means of Fourier Transformed Infrared Spectroscopy (FTIR). The characterization of the morphology is carried out via differential scanning calorimetry (DSC). A depth profile of the micro-hardness and elastic modulus is taken over the cross-section of the components in order to find the influence of chemical constitution and morphology on the micro-mechanical properties. It could be shown that crosslinking and oxidative degradation influence the degree of crystallinity of the polymer. Oxidation occurs for both types of the material due to in-vivo time. Higher degree of crystallinity can be correlated to higher hardness and indentation modulus. No unequivocal superiority of crosslinked over conventional liners can be observed. The influence of sex concerning alteration of the evaluated properties matters but need to be further investigated. PMID:26849029

  10. Failure analysis of retrieved PE-UHMW acetabular liners.


    Laska, Anna; Archodoulaki, Vasiliki-Maria; Duscher, Bernadette


    Ultra-high molecular weight polyethylene (PE-UHMW) acetabular liners have a limited lifespan in a patient's body. There are many factors affecting the performance of the implant and furthermore the properties of the polymeric material are changing after implantation. In this work material changes according to structure and morphology and their implication on mechanical properties are in focus. The physical and mechanical properties of ten crosslinked (xL) PE-UHMW and nine conventional (conv) gamma-sterilized PE-UHMW hip components, used as sliding surface in total hip joint replacement, with different in-vivo times are compared. The evaluation of the retrieved acetabular liners is performed in view of crosslinking and conventional gamma-sterilization but also in terms of the influence of gender concerning alteration in properties. The oxidative degradation in the PE-UHMW is investigated by means of Fourier Transformed Infrared Spectroscopy (FTIR). The characterization of the morphology is carried out via differential scanning calorimetry (DSC). A depth profile of the micro-hardness and elastic modulus is taken over the cross-section of the components in order to find the influence of chemical constitution and morphology on the micro-mechanical properties. It could be shown that crosslinking and oxidative degradation influence the degree of crystallinity of the polymer. Oxidation occurs for both types of the material due to in-vivo time. Higher degree of crystallinity can be correlated to higher hardness and indentation modulus. No unequivocal superiority of crosslinked over conventional liners can be observed. The influence of sex concerning alteration of the evaluated properties matters but need to be further investigated.

  11. An Updated Review of the Efficacy of Cupping Therapy

    PubMed Central

    Cao, Huijuan; Li, Xun; Liu, Jianping


    Background Since 1950, traditional Chinese medicine (TCM) cupping therapy has been applied as a formal modality in hospitals throughout China and elsewhere in the world. Based on a previous systematic literature review of clinical studies on cupping therapy, this study presents a thorough review of randomized controlled trials (RCTs) to evaluate the therapeutic effect of cupping therapy. Method Six databases were searched for articles published through 2010. RCTs on cupping therapy for various diseases were included. Studies on cupping therapy combined with other TCM treatments versus non-TCM therapies were excluded. Results 135 RCTs published from 1992 through 2010 were identified. The studies were generally of low methodological quality. Diseases for which cupping therapy was commonly applied were herpes zoster, facial paralysis (Bell palsy), cough and dyspnea, acne, lumbar disc herniation, and cervical spondylosis. Wet cupping was used in most trials, followed by retained cupping, moving cupping, and flash cupping. Meta-analysis showed cupping therapy combined with other TCM treatments was significantly superior to other treatments alone in increasing the number of cured patients with herpes zoster, facial paralysis, acne, and cervical spondylosis. No serious adverse effects were reported in the trials. Conclusions Numerous RCTs on cupping therapy have been conducted and published during the past decades. This review showed that cupping has potential effect in the treatment of herpes zoster and other specific conditions. However, further rigorously designed trials on its use for other conditions are warranted. PMID:22389674

  12. The capsular ligaments provide more hip rotational restraint than the acetabular labrum and the ligamentum teres

    PubMed Central

    van Arkel, R. J.; Amis, A. A.; Cobb, J. P.; Jeffers, J. R. T.


    In this in vitro study of the hip joint we examined which soft tissues act as primary and secondary passive rotational restraints when the hip joint is functionally loaded. A total of nine cadaveric left hips were mounted in a testing rig that allowed the application of forces, torques and rotations in all six degrees of freedom. The hip was rotated throughout a complete range of movement (ROM) and the contributions of the iliofemoral (medial and lateral arms), pubofemoral and ischiofemoral ligaments and the ligamentum teres to rotational restraint was determined by resecting a ligament and measuring the reduced torque required to achieve the same angular position as before resection. The contribution from the acetabular labrum was also measured. Each of the capsular ligaments acted as the primary hip rotation restraint somewhere within the complete ROM, and the ligamentum teres acted as a secondary restraint in high flexion, adduction and external rotation. The iliofemoral lateral arm and the ischiofemoral ligaments were primary restraints in two-thirds of the positions tested. Appreciation of the importance of these structures in preventing excessive hip rotation and subsequent impingement/instability may be relevant for surgeons undertaking both hip joint preserving surgery and hip arthroplasty. Cite this article: Bone Joint J 2015; 97-B:484–91. PMID:25820886

  13. Steady-state elastohydrodynamic lubrication analysis of a metal-on-metal hip implant employing a metallic cup with an ultra-high molecular weight polyethylene backing.


    Liu, F; Wang, F C; Jin, Z M; Hirt, F; Rieker, C; Grigoris, P


    The elastohydrodynamic lubrication (EHL) analysis was carried out in this study for a 28 mm diameter metal-on-metal hip prosthesis employing a metallic cup with an ultra-high molecular weight polyethylene (UHMWPE) backing under a simple steady state rotation representing the flexion/extension during walking. Both Reynolds and elasticity equations were coupled and solved numerically by the finite difference method. The elastic deformation was determined by means of the fast Fourier transform (FFT) technique using the displacement coefficients obtained from the finite element method. Excellent agreement of the predicted elastic deformation was obtained between the FFT technique and the conventional direct summation method. The number of grid points used in the lubrication analysis was found to be important in predicting accurate film thicknesses, particularly at low viscosities representative of physiological lubricants. The effect of the clearance between the femoral head and the acetabular cup on the predicted lubricant film thickness was shown to be significant, while the effect of load was found to be negligible. Overall, the UHMWPE backing was found not only to reduce the contact pressure as identified in a previous study by the authors (Liu et al., 2003) but also significantly to increase the lubricant film thickness for the 28 mm diameter metal-on-metal hip implant, as compared with a metallic mono-block cup.

  14. Wear and migration of highly cross-linked and conventional cemented polyethylene cups with cobalt chrome or Oxinium femoral heads: a randomized radiostereometric study of 150 patients.


    Kadar, Thomas; Hallan, Geir; Aamodt, Arild; Indrekvam, Kari; Badawy, Mona; Skredderstuen, Arne; Havelin, Leif Ivar; Stokke, Terje; Haugan, Kristin; Espehaug, Birgitte; Furnes, Ove


    This randomized study was performed to compare wear and migration of five different cemented total hip joint articulations in 150 patients. The patients received either a Charnley femoral stem with a 22.2 mm head or a Spectron EF femoral stem with a 28 mm head. The Charnley articulated with a γ-sterilized Charnley Ogee acetabular cup. The Spectron EF was used with either EtO-sterilized non-cross-linked polyethylene (Reflection All-Poly) or highly cross-linked (Reflection All-Poly XLPE) cups, combined with either cobalt chrome (CoCr) or Oxinium femoral heads. The patients were followed with repeated RSA measurements for 2 years. After 2 years, the EtO-sterilized non-cross-linked Reflection All-Poly cups had more than four times higher proximal penetration than its highly cross-linked counterpart. Use of Oxinium femoral heads did not affect penetration at 2 years compared to heads made of CoCr. Further follow-up is needed to evaluate the benefits, if any, of Oxinium femoral heads in the clinical setting. The Charnley Ogee was not outperformed by the more recently introduced implants in our study. We conclude that this prostheses still represents a standard against which new implants can be measured.

  15. Degrees with Almost Universal Cupping Property

    NASA Astrophysics Data System (ADS)

    Liu, Jiang; Wu, Guohua

    The notion of cupping/noncupping has played an essential role in the study of various degree structures in the Ershov hierarchy. As an approach to refute Shoenfield conjecture, Yates (see [2]) proved the existence of a nonzero noncuppable r.e. degree, a degree cupping no incomplete r.e. degree to 0'. In contrast to this, Arslanov proved in [1] that nonzero noncuppable degrees do not exist in the structure of d.r.e. degrees, which shows that the structures of r.e. degrees and d.r.e. degrees are not elementary equivalent.

  16. Fast-response cup anemometer features cosine response

    NASA Technical Reports Server (NTRS)

    Frenzen, P.


    Six-cup, low-inertia anemometer combines high resolution and fast response with a unique ability to sense only the horizontal component of the winds fluctuating rapidly in three dimensions. Cup assemblies are fabricated of expanded polystyrene plastic.

  17. Migration and head penetration of Vitamin-E diffused cemented polyethylene cup compared to standard cemented cup in total hip arthroplasty: study protocol for a randomised, double-blind, controlled trial (E1 HIP)

    PubMed Central

    Sköldenberg, Olof; Rysinska, Agata; Chammout, Ghazi; Salemyr, Mats; Muren, Olle; Bodén, Henrik; Eisler, Thomas


    Introduction In vitro, Vitamin-E-diffused, highly cross-linked polyethylene (PE) has been shown to have superior wear resistance and improved mechanical properties when compared to those of standard highly cross-linked PE liners used in total hip arthroplasty (THA). The aim of the study is to evaluate the safety of a new cemented acetabular cup with Vitamin-E-doped PE regarding migration, head penetration and clinical results. Methods and analysis In this single-centre, double-blinded, randomised controlled trial, we will include 50 patients with primary hip osteoarthritis scheduled for THA and randomise them in a 1:1 ratio to a cemented cup with either argon gas-sterilised PE (control group) or Vitamin-E-diffused PE (vitamin-e group). All patients and the assessor of the primary outcome will be blinded and the same uncemented stem will be used for all participants. The primary end point will be proximal migration of the cup at 2 years after surgery measured with radiostereometry. Secondary end points include proximal migration at other follow-ups, total migration, femoral head penetration, clinical outcome scores and hip-related complications. Patients will be followed up at 3 months and at 1, 2, 5 and 10 years postoperatively. Results Results will be analysed using 95% CIs for the effect size. A regression model will also be used to adjust for stratification factors. Ethics and dissemination The ethical committee at Karolinska Institutet has approved the study. The first results from the study will be disseminated to the medical community via presentations and publications in relevant medical journals when the last patient included has been followed up for 2 years. Trial registration number NCT02254980. PMID:27388352

  18. High Cup Angle and Microseparation Increase the Wear of Hip Surface Replacements

    PubMed Central

    Williams, Sophie; Isaac, Graham; Ingham, Eileen; Fisher, John


    High wear rates and high patient ion levels have been associated with high (> 55°) cup inclination angles for metal-on-metal surface replacements. Wear rates and patterns have been simulated for ceramic-on-ceramic bearings by applying microseparation to replicate head offset deficiency. We tested 39-mm metal-on-metal surface replacements (n = 5) in a hip simulator with (A) an increased cup inclination angle of 60° and (B) an increased cup inclination angle and microseparation over 2 million cycles. (A) resulted in a ninefold increase in wear rate and (B) resulted in a 17-fold increase in wear rate compared to a standard gait condition study. Wear particles produced under microseparation conditions were larger than those produced under standard conditions but of similar shape (round to oval). The data suggest both head and cup position influence the wear of surface replacements; we believe it likely bearings with high wear either have a high cup inclination angle, an offset deficient head, or a combination of both. PMID:19363640

  19. Recycling disposable cups into paper plastic composites.


    Mitchell, Jonathan; Vandeperre, Luc; Dvorak, Rob; Kosior, Ed; Tarverdi, Karnik; Cheeseman, Christopher


    The majority of disposable cups are made from paper plastic laminates (PPL) which consist of high quality cellulose fibre with a thin internal polyethylene coating. There are limited recycling options for PPLs and this has contributed to disposable cups becoming a high profile, problematic waste. In this work disposable cups have been shredded to form PPL flakes and these have been used to reinforce polypropylene to form novel paper plastic composites (PPCs). The PPL flakes and polypropylene were mixed, extruded, pelletised and injection moulded at low temperatures to prevent degradation of the cellulose fibres. The level of PPL flake addition and the use of a maleated polyolefin coupling agent to enhance interfacial adhesion have been investigated. Samples have been characterised using tensile testing, dynamic mechanical analysis (DMA) and thermogravimetric analysis. Use of a coupling agent allows composites containing 40 wt.% of PPL flakes to increase tensile strength of PP by 50% to 30 MPa. The Young modulus also increases from 1 to 2.5 GPa and the work to fracture increases by a factor of 5. The work demonstrates that PPL disposable cups have potential to be beneficially reused as reinforcement in novel polypropylene composites.

  20. Fast Faraday Cup With High Bandwidth

    SciTech Connect

    Deibele, Craig E


    A circuit card stripline Fast Faraday cup quantitatively measures the picosecond time structure of a charged particle beam. The stripline configuration maintains signal integrity, and stitching of the stripline increases the bandwidth. A calibration procedure ensures the measurement of the absolute charge and time structure of the charged particle beam.

  1. Nuclear Physics in a Coffee Cup

    ERIC Educational Resources Information Center

    Higbie, J.


    Discusses physical phenomena which can be demonstrated by using a coffee cup, involving the short-range field, alpha-particle scattering, standing waves, and Bohr's closed electron orbits. Indicates that observation of the physics of the classroom in everyday objects can attract student interest in physics learning. (CC)

  2. Direct reduction technique for superomedial dome impaction in geriatric acetabular fractures.


    Laflamme, G-Yves; Hebert-Davies, Jonah


    The treatment of acetabular fractures in the elderly patients remains challenging. The "Gull Sign," which was recently described, was 100% predictive of failure of reduction and/or fixation. However, we believe that adequate reduction can be achieved and lead to good functional outcomes. Our technique differs from classic methods because it uses an anterior intrapelvic approach (the modified Stoppa) to obtain direct reduction of the impacted fragments. Access to the impacted superomedial dome is achieved by mobilizing the quadrilateral fragment, thus allowing direct visualization of the impacted articular surface. After reduction, definitive fixation is obtained with 3.5-mm cortical screws positioned in the subchondral bone directly over the Gull fragment. Our technique was performed in 9 patients, with a mean follow-up of 2.8 years. The quality of reduction was within 3 mm in 7 patients (78%). The overall conversion rate to total hip arthroplasty was 33%. All patients undergoing total hip arthroplasty either had initial malreduction or suffered an early loss of reduction. Other complications included 1 case of heterotopic ossification (Brooker type II) and 1 case of deep vein thrombosis. There were no infections. The average Harris Hip Score was 81. Good reduction of superior medial dome impaction can be obtained and maintained in the well-selected geriatric patient. We believe that, appropriately used, this direct reduction technique can be an important adjunct to surgeons dealing with this troublesome fracture.

  3. The Standardization of Bra Cup Measurements: Redefining Bra Sizing Language.


    Bengtson, Bradley P; Glicksman, Caroline A


    There are many challenges in developing a standardized bra cup system, the most significant being that bra cup sizes are a continuum. Women's breasts occur as a fluid range of shapes, sizes, and volumes. Patients have specific expectations regarding bra cup size, and failure to achieve expectations remains the leading cause of patient dissatisfaction. Implant selection that determines eventual bra cup size is critical in patient education and management of patient expectations; however, this is not achievable until all speak the same bra cup language. Patient and surgeon perceptions may never be exact, but it is important to establish guidelines and standards to bridge this gap. PMID:26408432

  4. The Standardization of Bra Cup Measurements: Redefining Bra Sizing Language.


    Bengtson, Bradley P; Glicksman, Caroline A


    There are many challenges in developing a standardized bra cup system, the most significant being that bra cup sizes are a continuum. Women's breasts occur as a fluid range of shapes, sizes, and volumes. Patients have specific expectations regarding bra cup size, and failure to achieve expectations remains the leading cause of patient dissatisfaction. Implant selection that determines eventual bra cup size is critical in patient education and management of patient expectations; however, this is not achievable until all speak the same bra cup language. Patient and surgeon perceptions may never be exact, but it is important to establish guidelines and standards to bridge this gap.

  5. Radiological evaluation of the metal-bone interface of a porous tantalum monoblock acetabular component.


    Macheras, G A; Papagelopoulos, P J; Kateros, K; Kostakos, A T; Baltas, D; Karachalios, T S


    Between January 1998 and December 1998, 82 consecutive patients (86 hips) underwent total hip arthroplasty using a trabecular metal monoblock acetabular component. All patients had a clinical and radiological follow-up evaluation at six, 12 and 24 weeks, 12 months, and then annually thereafter. On the initial post-operative radiograph 25 hips had a gap between the outer surface of the component and the acetabular host bed which ranged from 1 to 5 mm. All patients were followed up clinically and radiologically for a mean of 7.3 years (7 to 7.5). The 25 hips with the 1 to 5 mm gaps were studied for component migration at two years using the Einzel-Bild-Roentgen-Analyse (EBRA) digital measurement method. At 24 weeks all the post-operative gaps were filled with bone and no acetabular component had migrated. The radiographic outcome of all 86 components showed no radiolucent lines and no evidence of lysis. No acetabular implant was revised. There were no dislocations or other complications. The bridging of the interface gaps (up to 5 mm) by the trabecular metal monoblock acetabular component indicates the strong osteoconductive, and possibly osteoinductive, properties of trabecular metal.

  6. An in vivo comparison of the orientation of the transverse acetabular ligament and the acetabulum.


    Griffin, Andrew R; Perriman, Diana M; Bolton, Claire J; Smith, Paul N


    Aligning the acetabular component with the Transverse Acetabular Ligament (TAL) to ensure optimal anteversion has been reported to reduce dislocation rates. However, to our knowledge in vivo measurement of the TAL angle has not yet been reported in a large cohort of normal hips. CT scans of 218 normal hips were analyzed. The TAL and four acetabular rim anteversion angles were measured (superiorly to inferiorly) relative to the anterior pelvic plane. The mean TAL anteversion angle was 20.5° ± 7.0°, and the acetabular rim angles from superior to inferior were 11.0° ± 12.9°, 19.9° ± 8.8°, 20.9° ± 6.2° and 25.1° ± 6.2° respectively. Both the TAL and the acetabular rim were significantly more anteverted in females than in males. The TAL anteversion angle was comparable to the predominant orientation (central rim section) of the native acetabulum while the superior acetabulum was comparatively retroverted and the inferior was relatively more anteverted.

  7. Wear, bone density, functional outcome and survival in vitamin E-incorporated polyethylene cups in reversed hybrid total hip arthroplasty: design of a randomized controlled trial

    PubMed Central


    Background Aseptic loosening of total hip arthroplasties is generally caused by periprosthetic bone resorption due to tissue reactions on polyethylene wear particles. In vitro testing of polyethylene cups incorporated with vitamin E shows increased wear resistance. The objective of this study is to compare vitamin E-stabilized highly cross-linked polyethylene with conventional cross-linked polyethylene in “reversed hybrid” total hip arthroplasties (cemented all-polyethylene cups combined with uncemented femoral stems). We hypothesize that the adjunction of vitamin E leads to a decrease in polyethylene wear in the long-term. We also expect changes in bone mineral density, less osteolysis, equal functional scores and increased implant survival in polyethylene cemented cups incorporated with vitamin E in the long-term. Design A double-blinded randomized controlled trial will be conducted. Patients to be included are aged under 70, suffer from non-inflammatory degenerative joint disease of the hip and are scheduled for a primary total hip arthroplasty. The study group will receive a reversed hybrid total hip arthroplasty with a vitamin E-stabilized highly cross-linked polyethylene cemented cup. The control group will receive a reversed hybrid total hip arthroplasty with a conventional cross-linked polyethylene cemented cup. Radiological follow-up will be assessed at 6 weeks and at 1, 3, 5, 7 and 10 years postoperatively, to determine polyethylene wear and osteolysis. Patient-reported functional status (HOOS), physician-reported functional status (Harris Hip Score) and patients’ physical activity behavior (SQUASH) will also be assessed at these intervals. Acetabular bone mineral density will be assessed by dual energy X-ray absorptiometry (DEXA) at 6 weeks and at 1 year and 2 years postoperatively. Implant survival will be determined at 10 years postoperatively. Discussion In vitro results of vitamin E-stabilized polyethylene are promising, showing increased wear

  8. Magnetic resonance evaluation of acetabular residual dysplasia in developmental dysplasia of the hip: a preliminary study of 27 patients.


    Douira-Khomsi, Wièm; Smida, Mahmoud; Louati, Hela; Hassine, Lilia Ben; Bouchoucha, Sami; Saied, Walid; Ladeb, Mohamed-Fethi; Ghachem, Maher Ben; Bellagha, Ibtissem


    Thirty-one hips in 27 young girls, treated for developmental dysplasia of the hip in the authors' institute since 2003, showed persistent radiographic evidence of residual acetabular dysplasia. These hips were registered as candidates for pelvic osteotomy. A prospective study was conducted and these hips were evaluated by magnetic resonance imaging (MRI); the average age of the patients was 5 years. MRI measurement of acetabular angle and acetabular head index in 2 different landmarks (bone and cartilage) was performed. The results were correlated with plain radiographic film evolution. MRI studies revealed sufficient cartilaginous acetabular coverage in 27 hips, cartilaginous acetabular dysplasia in 2 hips, and short acetabulum in 2 others. The 27 hips with thick cartilage of the acetabular roof were subsequently followed up by plain radiographs. The average follow-up period was 2.1 years. The authors observed a spontaneous progressive ossification of the cartilaginous acetabular roof in all the 27 cases. In 4 cases, the correction of the acetabular angle was complete. They concluded that MRI promotes more accurate selection of patients for pelvic osteotomy and aids in the choice of the most appropriate type of osteotomy. Clinical imaging examples are presented and need to be further evaluated.

  9. Wear of a sequentially annealed polyethylene acetabular liner

    PubMed Central

    Gascoyne, Trevor C; Petrak, Martin J; Turgeon, Thomas R; Bohm, Eric R


    Background and purpose We previously reported on a randomized controlled trial (RCT) that examined the effect of adding tobramycin to bone cement after femoral stem migration. The present study examined femoral head penetration into both conventional and highly crosslinked polyethylene acetabular liners in the same group of RCT patients, with a minimum of 5 years of postoperative follow-up. Patients and methods Linear penetration of the femoral head into an X3 (Stryker) crosslinked polyethylene (XLPE) liner was measured in 18 patients (19 hips) using radiostereometric analysis (RSA). Femoral head penetration was also measured in 6 patients (6 hips) with a conventional polyethylene liner (CPE), which served as a control group. Results The median proximal femoral head penetration in the XLPE group after 5.5 years was 0.025 mm with a steady-state penetration rate of 0.001 mm/year between year 1 and year 5. The CPE liner showed a median proximal head penetration of 0.274 mm after 7.2 years, at a rate of 0.037 mm/year. Interpretation The Trident X3 sequentially annealed XLPE liner shows excellent in vivo wear resistance compared to non-crosslinked CPE liners at medium-term implantation. The rate of linear head penetration in the XLPE liners after > 5 years of follow-up was 0.001 mm/year, which is in close agreement with the results of previous studies. PMID:25140986

  10. Fluid-sorption phenomena in sterilized polyethylene acetabular prostheses.


    Clarke, I C; Starkebaum, W; Hosseinian, A; McGuire, P; Okuda, R; Salovey, R; Young, R


    The weight changes due to fluid-sorption were measured in 62 radiation-sterilized acetabular sockets and 10 unsterilized discs. The materials included two types of ultra-high molecular weight (UHMW) polyethylene (RCH 1000; Hi-Fax 1900) and a carbon-fibre-reinforced polyethylene (CFPE). The fluid absorption curve was consistently biphasic. In the first 30 d soak-period (Phase 1), the initial rate of fluid absorption averaged 153 micrograms/d for conventional UHMW polyethylene and 278 micrograms/d for carbon-fibre-reinforced polyethylene. In Phase 2, beyond 30 d and up to 400 d, fluid absorption reduced to linear rates of 27 micrograms/d for UHMW polyethylene and 43 micrograms/d for CFPE. The latter soak-weight-gain values corresponded to only 0.00016%/d and 0.00034%/d respectively. There was little difference in absorption rates between sterilized and unsterilized samples. However soak rates were generally higher in water compared to serum.

  11. Property changes of UHMW polyethylene hip cup endoprostheses during implantation.


    Eyerer, P; Ke, Y C


    In this study it is demonstrated that the combined chemical and mechanical influences of the implant situation cause property changes of ultra-high-molecular-weight polyethylene (UHMW PE) hip joint cups. Nearly 30 out of 48 loosened cups, retrieved 3 weeks to 11 years after implantation, were investigated. Density measurements show a density increase with implantation time and a dependence of these changes from implant position and loading conditions. The rate of extractable constituents also increases with course of time. An increased in vivo conditioned oxidation of the UHMW PE can be demonstrated by infrared (IR) spectrometry. The density increase can be explained by post-crystallization, which is the result of oxidative chain scission. This leads to a reduction of the average molecular weight of the PE and to an increased extractability of constituents. Since these changes have been recognized as the reasons for aging and failing of UHMW PE, the methods of material characterization used in this study for retrieved implants will help to develop suitable in vitro testing and simulating methods. They are the prerequisite for the necessary improvements of the material properties of UHMW PE. PMID:6544798

  12. The results of acetabular impaction grafting in 129 primary cemented total hip arthroplasties.


    Wilson, Matthew J; Whitehouse, Sarah L; Howell, Jonathan R; Hubble, Matthew J W; Timperley, A John; Gie, Graham A


    Between 1995 and 2003, 129 cemented primary THAs were performed using full acetabular impaction grafting to reconstruct acetabular deficiencies. These were classified as cavitary in 74 and segmental in 55 hips. Eighty-one patients were reviewed at mean 9.1 (6.2-14.3) years post-operatively. There were seven acetabular component revisions due to aseptic loosening, and a further 11 cases that had migrated >5mm or tilted >5° on radiological review - ten of which reported no symptoms. Kaplan-Meier analysis of revisions for aseptic loosening demonstrates 100% survival at nine years for cavitary defects compared to 82.6% for segmental defects. Our results suggest that the medium-term survival of this technique is excellent when used for purely cavitary defects but less predictable when used with large rim meshes in segmental defects. PMID:23523217

  13. Central acetabular fracture with dislocation treated by minimally invasive plate osteosynthesis.



    Central acetabular fractures with dislocation are usually the result of high-energy trauma, resulting in joint incongruity, and are frequently associated with other injuries. Open reduction and internal fixation has been the standard treatment for acetabular fractures, but it is associated with extensive surgical trauma, and complications such as haematoma formation, iatrogenic nerve injury, and heterotopic ossification. We present the case of a 63-year-old female who sustained a central acetabular fracture of the hip with dislocation as a result of an automobile collision. Closed reduction of the dislocation was performed, and the fracture was managed by minimally invasive plate osteosynthesis using a specially prepared plate. At 01 year postoperatively, radiographs showed the fracture to have been well-healed with good congruity of the joint. However, heterotopic ossification of the joint was noted. The technique allowed reduction of the fracture with minimal surgical trauma.

  14. Biomechanical Analysis of the Fixation System for T-Shaped Acetabular Fracture.


    Fan, Yanping; Lei, Jianyin; Zhu, Feng; Li, Zhiqiang; Chen, Weiyi; Liu, Ximing


    This study aims to evaluate the biomechanical mechanism of fixation systems in the most frequent T-shaped acetabular fracture using finite element method. The treatment of acetabular fractures was based on extensive clinical experience. Three commonly accepted rigid fixation methods (double column reconstruction plates (P × 2), anterior column plate combined with posterior column screws (P + PS), and anterior column plate combined with quadrilateral area screws (P + QS)) were chosen for evaluation. On the basis of the finite element model, the biomechanics of these fixation systems were assessed through effective stiffness levels, stress distributions, force transfers, and displacements along the fracture lines. All three fixation systems can be used to obtain effective functional outcomes. The third fixation system (P + QS) was the optimal method for T-shaped acetabular fracture. This fixation system may reduce many of the risks and limitations associated with other fixation systems.

  15. Central acetabular fracture with dislocation treated by minimally invasive plate osteosynthesis.



    Central acetabular fractures with dislocation are usually the result of high-energy trauma, resulting in joint incongruity, and are frequently associated with other injuries. Open reduction and internal fixation has been the standard treatment for acetabular fractures, but it is associated with extensive surgical trauma, and complications such as haematoma formation, iatrogenic nerve injury, and heterotopic ossification. We present the case of a 63-year-old female who sustained a central acetabular fracture of the hip with dislocation as a result of an automobile collision. Closed reduction of the dislocation was performed, and the fracture was managed by minimally invasive plate osteosynthesis using a specially prepared plate. At 01 year postoperatively, radiographs showed the fracture to have been well-healed with good congruity of the joint. However, heterotopic ossification of the joint was noted. The technique allowed reduction of the fracture with minimal surgical trauma. PMID:26060171

  16. Oxidation and other property changes of retrieved sequentially annealed UHMWPE acetabular and tibial bearings.


    Reinitz, Steven D; Currier, Barbara H; Van Citters, Douglas W; Levine, Rayna A; Collier, John P


    This investigation analyzed retrieved sequentially crosslinked and annealed (SXL) ultra-high molecular weight polyethylene bearings to determine whether the material is chemically stable in vivo. A series of retrieved tibial and acetabular components were analyzed for changes in ketone oxidation, crosslink density, and free radical concentration. Oxidation was observed to increase with in vivo duration, and the rate of oxidation in tibial inserts was significantly greater than in acetabular liners. SXL acetabular bearings oxidized at a rate comparable to gamma-sterilized liners, while SXL tibial inserts oxidized at a significantly faster rate than their gamma-sterilized counterparts. A significant decrease in crosslink density with increased mean ketone oxidation index was observed, suggesting that in vivo oxidation may be causing material degradation. Furthermore, a subsurface whitened damage region was also found in a subset of the bearings, indicating the possibility of a clinically relevant decrease in mechanical properties of these components.

  17. Corrosion of Metal Modular Cup Liners.


    Hothi, Harry S; Ilo, Kevin; Whittaker, Robert K; Eskelinen, Antti; Skinner, John A; Hart, Alister J


    Numerous studies have reported on corrosion at the modular head taper, however less is known about the interface between the metal shell and liner of modular cups. This study examined the backside of a series of metal modular cup liners of two designs (DePuy Pinnacle and Smith & Nephew R3), retrieved from 67 patients. Visual inspection found evidence of corrosion in virtually all liners, with the engaging rim surface significantly more corroded than the polar regions (P<0.001). EDX confirmed that black surface deposits were chromium rich corrosion debris, while SEM analysis revealed considerable pitting in the vicinity of the black debris. The R3 liners were significantly more corroded that the Pinnacles (P<0.001); this may help to explain the higher revision rates of this design. PMID:25890504

  18. Corrosion of Metal Modular Cup Liners.


    Hothi, Harry S; Ilo, Kevin; Whittaker, Robert K; Eskelinen, Antti; Skinner, John A; Hart, Alister J


    Numerous studies have reported on corrosion at the modular head taper, however less is known about the interface between the metal shell and liner of modular cups. This study examined the backside of a series of metal modular cup liners of two designs (DePuy Pinnacle and Smith & Nephew R3), retrieved from 67 patients. Visual inspection found evidence of corrosion in virtually all liners, with the engaging rim surface significantly more corroded than the polar regions (P<0.001). EDX confirmed that black surface deposits were chromium rich corrosion debris, while SEM analysis revealed considerable pitting in the vicinity of the black debris. The R3 liners were significantly more corroded that the Pinnacles (P<0.001); this may help to explain the higher revision rates of this design.

  19. Analysis of Earing in Deep Drawn Cups

    NASA Astrophysics Data System (ADS)

    Aretz, Holger; Aegerter, Johannes; Engler, Olaf


    The cup-drawing of a strongly anisotropic sheet metal is simulated using a commercial finite element software along with a user material subroutine. In order to accurately describe the plastic anisotropy of the material the well-known recent yield function `Yld2004-18p' is extended. Regarding the experimental characterization of the considered material the occurrence of dynamic strain aging lead to an oscillating signal of the width change of the tensile samples, which prevented a reliable determination of plastic strain ratios (r-values). Thus, an improved measurement concept was developed that leads to a very robust and reproducible determination of r-values. Furthermore, a novel plane-strain tensile test sample is presented which is used for the characterization of the plastic anisotropy in biaxial loading states. A quantitative comparison with measured earing profiles of deep drawn cups illustrates the predictive capabilities of the numerical simulation.

  20. [Acetabular fractures in the elderly. Outcome of open reduction and internal fixation].


    Tosounidis, G; Culemann, U; Bauer, M; Holstein, J H; Garcia, P; Kurowski, R; Pizanis, A; Aghayev, E; Pohlemann, T


    The aim of this study was to analyze the clinical outcome and incidence of hip arthritis in elderly patients with acetabular fractures. Because of poor bone quality in the elderly, even a low-energy trauma may lead to an acetabular fracture. An anatomical reconstruction of the acetabulum is necessary to achieve sufficient stability also for a potential hip arthroplasty. So far, there is very limited information on the outcome of acetabular fractures in the elderly. During a period of 6 years (2001-2006), 48 patients older than 60 years were admitted to our department with an acetabular fracture. Thirty-nine patients were treated operatively and nine patients non-operatively. Twenty-nine operatively treated patients were followed up. Nineteen of them were assessed using EQ-5D, SF-12 and Merle d'Aubigné questionnaires in addition to their clinical examination. Ten other surgical patients were only examined using the questionnaires. Of the 29 patients that were followed up, 5 underwent total hip arthroplasty due to secondary post-traumatic hip arthritis after open reduction and internal fixation (ORIF). The range of motion of the operated hip was comparable to that of the non-operated contralateral side. However, the internal rotation was found to be slightly decreased at the operated side when compared to the non-operated contralateral side. Merle d'Aubigné score and physical and mental SF-12 score components as well as quality of life were better in patients treated with ORIF compared to those patients that were treated by secondary hip arthroplasty. Regarding the different treatment strategies (ORIF vs primary hip arthroplasty vs non-operative treatment) of acetabular fractures in the elderly, data from the literature are conflicting. Our results indicate that ORIF represents a good treatment option for acetabular fractures in the elderly. In patients that did not develop secondary hip arthritis, a good clinical outcome and quality of life was documented. PMID

  1. Backside Wear Analysis of Retrieved Acetabular Liners with a Press-Fit Locking Mechanism in Comparison to Wear Simulation In Vitro

    PubMed Central

    Jäger, Marcus; Floerkemeier, Thilo; Frecher, Sven; Delank, Karl-Stefan


    Backside wear due to micromotion and poor conformity between the liner and its titanium alloy shell may contribute to the high rates of retroacetabular osteolysis and consequent aseptic loosening. The purpose of our study was to understand the wear process on the backside of polyethylene liners from two acetabular cup systems, whose locking mechanism is based on a press-fit cone in combination with a rough titanium conical inner surface on the fixation area. A direct comparison between in vitro wear simulator tests (equivalent to 3 years of use) and retrieved liners (average 13.1 months in situ) was done in order to evaluate the backside wear characteristics and behavior of these systems. Similar wear scores between in vitro tested and retrieved liners were observed. The results showed that this locking mechanism did not significantly produce wear marks at the backside of the polyethylene liners due to micromotion. In all the analyzed liners, the most common wear modes observed were small scratches at the cranial fixation zone directly below the rough titanium inner surface of the shell. It was concluded that most of the wear marks were produced during the insertion and removal of the liner, rather than during its time in situ. PMID:27722174

  2. Early Polyethylene Wear and Excessive Acetabular Granuloma in an Uncemented HA-Coated Total Hip Arthroplasty—Midterm Results of a Prospective Study

    PubMed Central

    Davis, Jack; Maus, Uwe; Saklak, Muharrem; Weisskopf, Markus; Wirtz, Dieter Christian


    This is a prospective review of 135 HA-coated ABG I total hip arthroplasty (THA) systems with a mean clinical and radiographic follow-up of 8.5 years. The 5-year survival rate was 85%, but 22% of the patients were dissatisfied. Revision THA was already indicated in 28% of the patients, with 26% indicated for cup loosening. PE wear was detected by x-ray in 42%. Disproportionate substantial wear with an average linear loss of 2.6 mm at the inner rim of the insert was observed in 23% of the cases. The mean annual wear rate was calculated 0.1–0.25 mm/year. Laboratory examination of the retrieved PE revealed polishing, cracks, and subsurface delamination. Radiographic evidence of acetabular cysts were found to be excessive granuloma during surgery. Polarization microscopy revealed debris particles phagocytized by reticuloendothelial cells. Results confirm the general opinion that aseptic osteolysis is a cell-mediated process driven by the presence of particles generated from wear debris. The findings also suggest that the main reasons for the failure of the first-generation ABG hip system were an insufficient locking mechanism and poor PE congruency, and not solely poor PE quality. PMID:18751822

  3. Methods and Guidelines for Venous Thromboembolism Prevention in Polytrauma Patients with Pelvic and Acetabular Fractures

    PubMed Central

    Chana-Rodríguez, Francisco; Mañanes, Rubén Pérez; Rojo-Manaute, José; Haro, José Antonio Calvo; Vaquero-Martín, Javier


    Sequential compression devices and chemical prophylaxis are the standard venous thromboembolism (VTE) prevention for trauma patients with acetabular and pelvic fractures. Current chemical pharmacological contemplates the use of heparins or fondaparinux. Other anticoagulants include coumarins and aspirin, however these oral agents can be challenging to administer and may need monitoring. When contraindications to anticoagulation in high-risk patients are present, prophylactic inferior vena cava filters can be an option to prevent pulmonary emboli. Unfortunately strong evidence about the most effective method, and the timing of their commencement, in patients with pelvic and acetabular fractures remains controversial. PMID:26312115

  4. Acetabular labral tears: focused review of anatomy, diagnosis, and current management.


    Huang, Ronald; Diaz, Claudio; Parvizi, Javad


    Acetabular labral tears have become an increasingly common diagnosis with the advancement of imaging techniques and hip arthroscopy. Therefore, understanding the anatomic significance, healing potential, and associated pathologies of labral tears is helpful. Furthermore, recognizing the clinical picture and understanding appropriate imaging techniques, such as magnetic resonance arthrography, are essential to making a correct diagnosis. This article reviews the relevant anatomy, diagnosis, and management of acetabular labral tears for physicians of all specialties who may be involved in the care of patients with labral tears. Short-term results of labral repair have been promising, but further studies are needed to clarify appropriate indications and long-term results of treatment. PMID:22759609

  5. Heterotopic ossification prophylaxis following operative treatment of acetabular fracture.


    Johnson, E E; Kay, R M; Dorey, F J


    Eighty seven patients with 88 fractures were retrospectively reviewed to assess the effect of postoperative prophylaxis on the formation of heterotopic ossification (HO). Sixty eight patients with 69 acetabular fractures were followed for an average of 21 months (range, 3-98 months). The grade of HO was assessed using the Brooker classification system. Thirty four fractures had no prophylactic treatment, 30 were treated prophylactically with indomethacin, two with radiation therapy, and three with both indomethacin and radiation. Twenty (59%) of 34 untreated fractures developed HO, of which nine (26%) were Grade III or IV. Thirteen (43%) of 30 fractures treated with indomethacin developed HO, of which 5 (16%) were Grade III and none were Grade IV. Twenty one of 24 fractures were stabilized through the extended iliofemoral approach; 13 of these had no prophylaxis. Eleven of the 13 developed HO; eight were Grade III or IV (62%). Seven of eight fractures treated with indomethacin following the extended iliofemoral approach developed HO; one was Grade III (13%) and non Grade IV. There was no significant difference between 13 patients who were not treated prophylactically and 18 indomethacin treated patients stabilized through the Kocher-Langenbeck approach. Only one of 11 patients had HO (Grade I) following an ilioinguinal approach. Postoperative radiation therapy, with or without indomethacin, resulted in three patients with Grade 0 HO (all radiated 1-4 days post surgery), one with Grade II (radiated postoperative Day 8), and one with Grade III HO (significant delay in surgery with preoperative Grade III HO of the hip).(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Biomechanical Study of Acetabular Tridimensional Memoryalloy Fixation System

    NASA Astrophysics Data System (ADS)

    Liu, Xin-Wei; Xu, Shuo-Gui; Zhang, Yun-Tong; Zhang, Chun-Cai


    We developed the acetabular tridimensional memoryalloy fixation system (ATMFS), which is made of NiTi shape memory alloy, according to the specific mechanical properties of biological memory material, NiTi shape memory alloy and measured distribution of contact area and pressure between the acetabulum and the femoral head of cadaveric pelvis. Seven formalin-preserved cadaveric pelves were used for this investigation. Pressure-sensitive film was used to measure contact area and pressure within the anterior, superior, and posterior regions of the acetabulum. The pelves were loaded under the following four conditions: (1) intact; (2) following a creation posterior wall fracture defect; (3) following reduction and standard internal fixation with reconstruction plate; and (4) following reduction and internal fixation with a new shape memory alloy device named ATMFS. A posterior wall fracture was created along an arc of 40° to 90° about the acetabulur rim. Creation of a posterior wall defect resulted in increased load in the superior acetabulum (1485 N) as compared to the intact condition (748 N, P = 0.009). Following reduction and internal fixation, the load distributed to the superior acetabulum (1545 N) was not statistically different from the defect condition. Following the fixation with ATMFS, the load seen at the superior region of the actabulum (964 N) was familiar with fixation with reconstruction plate and was not different from intact state ( P = 0.45). These data indicate that the use of ATMFS as a fracture internal fixation device resulted a partial restoration of joint loading parameters toward the intact state. ATMFS fixation may result in a clinical benefit.

  7. Femtoliter silver cups as surface enhanced Raman scattering active containers.


    Bhuvana, T; Kulkarni, G U


    Femtoliter capacity Ag cups formed by the pulsed laser ablation of an Ag foil have been tried out as substrates for surface enhanced Raman scattering (SERS) measurements. The cups are formed as the impinging droplets from the laser plume undergo a flow pattern before freezing into cup-like structures, resulting in a surface roughness (approximately 35 nm) that makes them ideal for SERS studies. The internal volume of the cups is in the femtoliter (10(-15) l) range, well suited for small-scale reactions, particularly in biological studies. The cups exhibit enhancement factors of the order of 10(6) with the analyte molecule thiophenol. Individual cups have been dosed attoliter quantities (10(-18) l) of the analyte and detected. PMID:19417320

  8. Inducible displacements of the cup and the femoral head during active range of motion: dynamic RSA studies of cemented total hip replacements.


    Digas, Georgios; Johansson, Per-Erik; Kärrholm, Johan


    We evaluated changes in position of the femoral head relative to the cup and of the cup relative to the pelvis in total hip replacement patients during hip motion 2 years postoperatively. Two patient groups with nine patients in each group were studied. Hip motions, translations of the femoral head center, and cup displacements were recorded with dynamic radiostereometric examination (RSA, 2 exposures/s) during abduction in Group 1 and with use of static RSA exposures at increasing flexion of the hip in Group 2. Conventional radiographic examinations were used to evaluate any radiolucent lines around the cups at 2 years. During active abduction the femoral head center moved medially (median 0.04 mm) and the cup tilted anteriorly (median 0.09 mm). Increments in radiolucent lines at 2 years correlated to medial femoral head penetration, posterior tilt, and retroversion of the cup at 20° of abduction. The extension of radiolucent lines at 2 years showed a positive correlation with proximal inducible displacement of the cup and posterior translation of the femoral head center at maximum hip flexion. Our observations may be of value in understanding the pathogenesis of the loosening process and may be used to facilitate the development of prosthetic designs that optimize hip kinematics.

  9. Aerodynamic Analysis of Cup Anemometers Performance: The Stationary Harmonic Response

    PubMed Central

    Pindado, Santiago; Cubas, Javier; Sanz-Andrés, Ángel


    The effect of cup anemometer shape parameters, such as the cups' shape, their size, and their center rotation radius, was experimentally analyzed. This analysis was based on both the calibration constants of the transfer function and the most important harmonic term of the rotor's movement, which due to the cup anemometer design is the third one. This harmonic analysis represents a new approach to study cup anemometer performances. The results clearly showed a good correlation between the average rotational speed of the anemometer's rotor and the mentioned third harmonic term of its movement. PMID:24381512

  10. [The manipulation technique and clinical application of kinetic cupping].


    Luo, Rong; Liu, Qi; Sun, Dan


    The characteristic of kinetic cupping is explained from treatment principles, manipulation and clinical application. The kinetic cupping is a new particular therapy that combines traditional cupping and kinetic therapy. With cups on the patient, limb action like flexion-extension, adduction-abduction and rotation is made to reinforce clinical effects, which has simple and safe manipulation, obvious efficacy and is well accepted by patient. It has more obvious advantage for pain that was caused by large-area soft tissue injury and discomfort where acupuncture is not appropriate. PMID:24032211

  11. Offside decision making in the 2002 and 2006 FIFA World Cups.


    Catteeuw, Peter; Gilis, Bart; García-Aranda, José-María; Tresaco, Fernando; Wagemans, Johan; Helsen, Werner


    The first objective of the present study was to examine the accuracy of offside judgements of assistant referees during the 2006 World Cup and to compare overall results with performances of assistant referees during the 2002 World Cup. Second, we also examined underlying mechanisms leading to incorrect decisions. According to the definition used for the 2002 World Cup, the results revealed a decrease in the number of incorrect flag signals during the 2006 (24/240 or 10.0%) compared with the 2002 World Cup (58/222 or 26.1%) (P < 0.001). For accuracy of all potential offside situations, according to a new definition (with the attacker 2 m in front or behind the second-last defender), the error percentage was 7.6% (17 flag errors and 9 non-flag errors out of 342 situations). Overall, quality of offside decisions was not influenced by the position of the assistant referee relative to the offside line. In addition, flag errors can best be explained by the perceptual illusion induced by the flash-lag effect. PMID:20686996

  12. Empirical cupping correction: A first-order raw data precorrection for cone-beam computed tomography

    SciTech Connect

    Kachelriess, Marc; Sourbelle, Katia; Kalender, Willi A.


    We propose an empirical cupping correction (ECC) algorithm to correct for CT cupping artifacts that are induced by nonlinearities in the projection data. The method is raw data based, empirical, and requires neither knowledge of the x-ray spectrum nor of the attenuation coefficients. It aims at linearizing the attenuation data using a precorrection function of polynomial form. The coefficients of the polynomial are determined once using a calibration scan of a homogeneous phantom. Computing the coefficients is done in image domain by fitting a series of basis images to a template image. The template image is obtained directly from the uncorrected phantom image and no assumptions on the phantom size or of its positioning are made. Raw data are precorrected by passing them through the once-determined polynomial. As an example we demonstrate how ECC can be used to perform water precorrection for an in vivo micro-CT scanner (TomoScope 30 s, VAMP GmbH, Erlangen, Germany). For this particular case, practical considerations regarding the definition of the template image are given. ECC strives to remove the cupping artifacts and to obtain well-calibrated CT values. Although ECC is a first-order correction and cannot compete with iterative higher-order beam hardening or scatter correction algorithms, our in vivo mouse images show a significant reduction of bone-induced artifacts as well. A combination of ECC with analytical techniques yielding a hybrid cupping correction method is possible and allows for channel-dependent correction functions.

  13. Relationship Between Developmental Dislocation of the Hip in Infant and Acetabular Dysplasia at Skeletal Maturity

    PubMed Central

    Okano, Kunihiko; Yamaguchi, Kazumasa; Ninomiya, Yoshikazu; Matsubayashi, Shohei; Aoyagi, Kiyoshi; Osaki, Makoto; Enomoto, Hiroshi; Takahashi, Katsuro


    Abstract Previous reports demonstrated 8–60% patients treated for developmental dislocation of hip (DDH) in infancy have residual acetabular dysplasia (AD) at skeletal maturity. AD patients reportedly exhibit abnormal morphology of the pelvis, high rates of comorbid spinal congenital anomalies and high bone mineral density. These physical findings suggest that AD patients have genetic background. We examined the percentage of AD patients with hip pain at skeletal maturity having a history of DDH in infancy and the correlation between the severity of AD at skeletal maturity and history of DDH treatment to investigate the relationship between AD and DDH. A total of 245 patients were radiographically examined for any history of DDH treatment in infancy. The study included 226 women and 19 men with a mean age at examination of 40.7 years (range 17–59 years). Eighty-eight patients (36%) had a history of DDH treatment (DDH group) and the remaining 157 patients (64%) had no history of DDH treatment (non-DDH group). The average age was lower and acetabular angle was larger in the DDH group. There was a significant increasing trend of the percentage of DDH patients associated with the severity of AD classified with CE, acetabular angle, and acetabular roof angle. Our data suggest that there are several AD patients without a history of DDH in Japan, and AD in patients without a history of DDH has different characteristics from AD in patients with a history of DDH. PMID:25569642

  14. Development of a non-invasive diagnostic technique for acetabular component loosening in total hip replacements.


    Alshuhri, Abdullah A; Holsgrove, Timothy P; Miles, Anthony W; Cunningham, James L


    Current techniques for diagnosing early loosening of a total hip replacement (THR) are ineffective, especially for the acetabular component. Accordingly, new, accurate, and quantifiable methods are required. The aim of this study was to investigate the viability of vibrational analysis for accurately detecting acetabular component loosening. A simplified acetabular model was constructed using a Sawbones(®) foam block. By placing a thin silicone layer between the acetabular component and the Sawbones block, 2- and 4-mm soft tissue membranes were simulated representing different loosening scenarios. A constant amplitude sinusoidal excitation with a sweep range of 100-1500 Hz was used. Output vibration from the model was measured using an accelerometer and an ultrasound probe. Loosening was determined from output signal features such as the number and relative strength of observed harmonic frequencies. Both measurement methods were sufficient to measure the output vibration. Vibrational analysis reliably detected loosening corresponding to both 2 and 4 mm tissue membranes at driving frequencies between 100 and 1000 Hz (p < 0.01) using the accelerometer. In contrast, ultrasound detected 2-mm loosening at a frequency range of 850-1050 Hz (p < 0.01) and 4-mm loosening at 500-950 Hz (p < 0.01). PMID:26054805

  15. Relationship between developmental dislocation of the hip in infant and acetabular dysplasia at skeletal maturity.


    Okano, Kunihiko; Yamaguchi, Kazumasa; Ninomiya, Yoshikazu; Matsubayashi, Shohei; Aoyagi, Kiyoshi; Osaki, Makoto; Enomoto, Hiroshi; Takahashi, Katsuro


    Previous reports demonstrated 8-60% patients treated for developmental dislocation of hip (DDH) in infancy have residual acetabular dysplasia (AD) at skeletal maturity. AD patients reportedly exhibit abnormal morphology of the pelvis, high rates of comorbid spinal congenital anomalies and high bone mineral density. These physical findings suggest that AD patients have genetic background. We examined the percentage of AD patients with hip pain at skeletal maturity having a history of DDH in infancy and the correlation between the severity of AD at skeletal maturity and history of DDH treatment to investigate the relationship between AD and DDH.A total of 245 patients were radiographically examined for any history of DDH treatment in infancy. The study included 226 women and 19 men with a mean age at examination of 40.7 years (range 17-59 years).Eighty-eight patients (36%) had a history of DDH treatment (DDH group) and the remaining 157 patients (64%) had no history of DDH treatment (non-DDH group). The average age was lower and acetabular angle was larger in the DDH group. There was a significant increasing trend of the percentage of DDH patients associated with the severity of AD classified with CE, acetabular angle, and acetabular roof angle.Our data suggest that there are several AD patients without a history of DDH in Japan, and AD in patients without a history of DDH has different characteristics from AD in patients with a history of DDH. PMID:25569642

  16. Demonstrated Performance of the Solar Probe Cup

    NASA Astrophysics Data System (ADS)

    Case, A. W.; Kasper, J. C.; Korreck, K. E.; Stevens, M. L.; Daigneau, P.; Freeman, M.; Caldwell, D.; Gauron, T.; Wright, K. H.; Bergner, H.; Cirtain, J. W.; Larson, D.; Brodu, E.; Balat-Pichelin, M.


    The Solar Probe Cup (SPC) is a Faraday Cup being developed for the Solar Probe Plus (SPP) mission. SPP will be the first spacecraft to directly measure the solar environment near the Alfven point in the atmosphere of the Sun, approaching to within 10 solar radii of the center of the Sun. In order to make the observations of radially flowing solar wind needed to address questions of coronal and solar wind heating and acceleration, SPC must operate while looking directly at the Sun. As a result, SPC will face a harsh and unprecidented environment, with component temperatures exceeding 1000C at closest approach. SPC is similar in design and operation to the two Faraday Cup instruments on the Wind spacecraft, which have been making stable measurements of the solar wind near Earth for two decades, with two key differences. SPC must survive and operate at extreme temperatures due to the levels of solar flux near the Sun, and it must record the solar wind approximately one thousand times faster than the instruments on Wind to keep up with the rapid variations expected near the Sun. We present results of a demonstration model of SPC operated in laboratory reproductions of the near-Sun environment. In the last year, SPC has been exposed to simulated encounter solar fluxes and resulting temperature profiles using a vaccum chamber and modified IMAX film projectors. In addition, SPC has been exposed to realistic ion beams. We show that SPC can operate in these environments, and make the measurements required for the sucess of the Solar Probe mission. Based on the performance of our prototype, the expected cadence and sensitivity of SPC will be discussed, with a focus on its ability to distinguish between models of heating in the solar corona.

  17. NCI Holds on to Defelice Cup | Poster

    NCI kept the Defelice Cup trophy this year after beating Leidos Biomedical Research, 15 to 9, at the 10th annual Ronald H. Defelice Golf Tournament held on Columbus Day. Sixteen players on each team battled it out at the yearly contractor vs. government tournament held at Rattlewood Golf Course in Mount Airy, Md. NCI leads the series 6–4. “The score was the highest NCI margin of victory in the 10-year series,” said Denny Dougherty, retired senior subcontracts advisor at what was formerly SAIC-Frederick. “The intensity of the annual competition has increased each year and has become...

  18. A novel classification to guide total hip arthroplasty for adult acetabular dysplasia

    PubMed Central



    In the field of hip arthroplasties, the secondary fixation of the implants depends directly on the quality of the primary stability. A good acetabular fit and metaphyseal filling between the prostheses and implants improve the initial stabilization, and optimize the transmission of forces to the bone. A precise knowledge of the three-dimensional acetabular or femoral shape is essential to the selection of adapted implants. A total of 63 patients diagnosed with developmental dysplasia were analyzed by three-dimensional computed tomography (3DCT), and the preoperative radiographic and 3DCT images were used to assess the acetabular/femoral deformities and variations of the hips. All joints were classified as Crowe type I, and bilateral measurements were taken for 10 patients. The acetabular abnormalities were classified according to the type of deficiency and the section angles of the acetabulum, with 26 hips (36%) classified as an anterior deficiency, 13 hips (18%) as a posterior deficiency and 34 hips (46%) as a lateral deficiency. The femoral side deformities were divided into three types according to the anteversion angle of the femur. A gradual increase in anteversion angle led to secondary rotational anomalies, and a narrowing of the canal at the isthmus. A total of 35 hips (48%) were classified as an F1 type deficiency, femur anteversion angle (FAVA) <30°; 32 hips (44%) as F2-type, 30°≤ FAVA ≤40°, with mild abnormalities of the femoral canal rotation and the diameter of the isthmus; and 6 hips (8%) as F3 type, FAVA >40°, with significant abnormalities of the femoral canal rotation and the diameter of the isthmus. This novel classification for adult acetabular dysplasia may provide a useful guide for surgery, and enable an improved selection of a suitable prosthesis. PMID:23935749

  19. A critical comparison of ten disposable cup LCAs

    SciTech Connect

    Harst, Eugenie van der; Potting, José


    Disposable cups can be made from conventional petro-plastics, bioplastics, or paperboard (coated with petro-plastics or bioplastics). This study compared ten life cycle assessment (LCA) studies of disposable cups with the aim to evaluate the robustness of their results. The selected studies have only one impact category in common, namely climate change with global warming potential (GWP) as its category indicator. Quantitative GWP results of the studies were closer examined. GWPs within and across each study show none of the cup materials to be consistently better than the others. Comparison of the absolute GWPs (after correction for the cup volume) also shows no consistent better or worse cup material. An evaluation of the methodological choices and the data sets used in the studies revealed their influence on the GWP. The differences in GWP can be attributed to a multitude of factors, i.e., cup material and weight, production processes, waste processes, allocation options, and data used. These factors basically represent different types of uncertainty. Sensitivity and scenario analyses provided only the influence of one factor at once. A systematic and simultaneous use of sensitivity and scenario analyses could, in a next research, result in more robust outcomes. -- Highlights: • Conflicting results from life cycle assessment (LCA) on disposable cups • GWP results of LCAs did not point to a best or worst cup material. • Differences in GWP results are due to methodological choices and data sets used. • Standardized LCA: transparency of LCA studies, but still different in approaches.

  20. Tantalum acetabular augments in one-stage exchange of infected total hip arthroplasty: a case-control study.


    Klatte, Till Orla; Kendoff, Daniel; Sabihi, Reza; Kamath, Atul F; Rueger, Johannes M; Gehrke, Thorsten


    During the one-stage exchange procedure for periprosthetic joint infection (PJI) after total hip arthroplasty (THA), acetabular defects challenge reconstructive options. Porous tantalum augments are an established tool for addressing acetabular destruction in aseptic cases, but their utility in septic exchange is unknown. This retrospective case-control study presents the initial results of tantalum augmentation during one-stage exchange for PJI. Primary endpoints were rates of re-infection and short-term complications associated with this technique. Study patients had no higher risk of re-infection with equivalent durability at early follow-up with a re-infection rate in both groups of 4%. In conclusion, tantalum augments are a viable option for addressing acetabular defects in one-stage exchange for septic THA. Further study is necessary to assess long-term durability when compared to traditional techniques for acetabular reconstruction.

  1. [Aseptic, simultaneous and bilateral mobilisation due to an acetabular shell fracture in a 43 year-old patient].


    Ceretti, M; Fanelli, M; Pappalardo, S


    The acetabular shell mobilization is the main long-term complication in total hip replacement. Metal-back fracture has also to be considered among the possible causes of shell mobilization. A case is presented of bilateral acetabular shell mobilization due to the trabecular covering de-soldering from the metal-back in a 43 year-old patient, 13-14 years after the first surgery. PMID:24360788

  2. [Aseptic, simultaneous and bilateral mobilisation due to an acetabular shell fracture in a 43 year-old patient].


    Ceretti, M; Fanelli, M; Pappalardo, S


    The acetabular shell mobilization is the main long-term complication in total hip replacement. Metal-back fracture has also to be considered among the possible causes of shell mobilization. A case is presented of bilateral acetabular shell mobilization due to the trabecular covering de-soldering from the metal-back in a 43 year-old patient, 13-14 years after the first surgery.

  3. Augmentation of the transverse acetabular ligament in canine caudoventral hip luxation.


    Venzin, C; Montavon, P M


    Open surgical fixation was performed on four hip joints in three dogs who were suffering from caudoventral hip luxations for which closed reduction had previously failed. Stabilization of the joint was achieved with a ventral coxofemoral approach, which augmented the function of the transverse acetabular ligament using a sling implant through a bone tunnel (n = 1), a sling implant around two pelvic screws (n = 1), or an internal fixator plate (n = 2). Transverse acetabular ligament augmentation resulted in successful joint stabilization in all cases, and should be considered for the surgical reduction of caudoventral hip luxations in dogs. The use of an internal fixator plate, while preserving soft-tissue blood supply and resulting in minimal to no long-term arthritic changes, may provide an optimal outcome. PMID:18038012

  4. An increase in cranial acetabular version with age: implications for femoroacetabular impingement.


    Kopydlowski, Nathan J; Tannenbaum, Eric P; Bedi, Asheesh; Smith, Matthew V; Sekiya, Jon K


    This cadaveric study aimed to determine if acetabular retroversion demonstrates predictable changes with age that could inform understanding of factors that may contribute to the pathophysiology of femoroacetabular impingement. Two-hundred forty pelves were divided into young and old groups. Version was measured at the cranial (5mm below superior rim), central (transverse of acetabulum), and caudal (5mm above inferior rim) locations. The data showed a significant difference between young (10±10°) and old (13±9°) cranial version (P=.02). Cranial retroversion increases with age and may reflect a developmental component in the etiology of the focal rim impingement lesion or ossification of the damaged labrum. Global acetabular retroversion does not appear to change with age and may reflect a congenital etiology.

  5. Corrosion on the acetabular liner taper from retrieved modular metal-on-metal total hip replacements.


    Gascoyne, Trevor C; Dyrkacz, Richard M; Turgeon, Thomas R; Burnell, Colin D; Wyss, Urs P; Brandt, Jan-M


    Eight retrieved metal-on-metal total hip replacements displayed corrosion damage along the cobalt-chromium alloy liner taper junction with the Ti alloy acetabular shell. Scanning electron microscopy indicated the primary mechanism of corrosion to be grain boundary and associated crevice corrosion, which was likely accelerated through mechanical micromotion and galvanic corrosion resulting from dissimilar alloys. Coordinate measurements revealed up to 4.3mm(3) of the cobalt-chromium alloy taper surface was removed due to corrosion, which is comparable to previous reports of corrosion damage on head-neck tapers. The acetabular liner-shell taper appears to be an additional source of metal corrosion products in modular total hip replacements. Patients with these prostheses should be closely monitored for signs of adverse reaction towards corrosion by-products.

  6. Pelvic, acetabular and hip fractures: What the surgeon should expect from the radiologist.


    Molière, S; Dosch, J-C; Bierry, G


    Pelvic ring fractures when caused by trauma, either violent or in demineralized bone, generally consist of injuries in both the anterior (pubic symphysis and rami) and posterior (iliac wing, sacrum, sacroiliac joint) portions. Injury classifications are based on injury mechanism and pelvic stability, and are used to determine treatment. Acetabular fractures, associated or not to pelvic ring disruption, are classified on the basis of fracture line, into elementary fractures of the acetabular walls, columns and roof, and into complex fractures. Fractures of the proximal end of the femur occur often on demineralized bone following low-energy trauma. The fractures are categorized by anatomic location (neck, trochanter and subtrochanteric region) and degree of displacement. These variables determine the risk of osteonecrosis of the femoral head, which is the main complication of such fractures.

  7. Feeding Neonates by Cup: A Systematic Review of the Literature.


    McKinney, Christy M; Glass, Robin P; Coffey, Patricia; Rue, Tessa; Vaughn, Matthew G; Cunningham, Michael


    Objective WHO and UNICEF recommend cup feeding for neonates unable to breastfeed in low-resource settings. In developed countries, cup feeding in lieu of bottle feeding in the neonatal period is hypothesized to improve breastfeeding outcomes for those initially unable to breastfeed. Our aim was to synthesize the entire body of evidence on cup feeding. Methods We searched domestic and international databases for original research. Our search criteria required original data on cup feeding in neonates published in English between January 1990 and December 2014. Results We identified 28 original research papers. Ten were randomized clinical trials, 7 non-randomized intervention studies, and 11 observational studies; 11 were conducted in developing country. Outcomes evaluated included physiologic stability, safety, intake, duration, spillage, weight gain, any and exclusive breastfeeding, length of hospital stay, compliance, and acceptability. Cup feeding appears to be safe though intake may be less and spillage greater relative to bottle or tube feeding. Overall, slightly higher proportions of cup fed versus bottle fed infants report any breastfeeding; a greater proportion of cup fed infants reported exclusive breastfeeding at discharge and beyond. Cup feeding increases breastfeeding in subgroups (e.g. those who intend to breastfeed or women who had a Caesarean section). Compliance and acceptability is problematic in certain settings. Conclusions Further research on long-term breastfeeding outcomes and in low-resource settings would be helpful. Research data on high risk infants (e.g. those with cleft palates) would be informative. Innovative cup feeding approaches to minimize spillage, optimize compliance, and increase breastfeeding feeding are needed. PMID:27016350

  8. Retrograde Transpubic Approach for Percutaneous Radiofrequency Ablation and Cementoplasty of Acetabular Metastasis

    PubMed Central

    Bauones, Salem; Freire, Veronique; Moser, Thomas P.


    We report a case of painful and disabling anterior acetabular bone metastasis treated with bipolar radiofrequency ablation and cementoplasty. Due to the high risk of complications related to the proximity of the femoral neurovascular structures with a direct approach, we successfully performed a retrograde transpubic approach under combined CT and fluoroscopic guidance. In the present report, we describe this approach detailing its indications, advantages, and the technical tips to achieve a safe and satisfactory procedure. PMID:26491595

  9. Discrepancies in measuring acetabular coverage: revisiting the anterior and lateral center edge angles

    PubMed Central

    Hanson, Joey A.; Kapron, Ashley L.; Swenson, Kathryn M.; Maak, Travis G.; Peters, Christopher L.; Aoki, Stephen K.


    The lateral center edge angle (LCEA) and the anterior center edge angle (ACEA) are commonly used to assess acetabular coverage of the femoral head. There are two distinct methods found in the literature to obtain these angles, specifically, measuring to the most lateral bone edge versus the sclerotic lateral sourcil edge. A difference between these two methods may contribute to inconsistent estimates of acetabular coverage, and potentially lead to clinical misdiagnosis and treatment mismanagement. The objectives of this study were to quantify the difference between bone edge and sourcil edge measurements and to determine how the difference influences the classification of acetabular coverage in adult patients with suspected hip pathomorphology. Two observers completed the measurements independently using preoperative anteroposterior and false profile radiographs. Bland–Altman plots and paired t-tests were used to compare measurement methods. Bone and sourcil measurements of the LCEA and ACEA were significantly different (both P < 0.001). On average, the bone LCEA was 4° (95% limits of agreement = −2° to 10°) greater than the sourcil LCEA. The bone ACEA was, on average, 10° (95% limit of agreement = −2° to 22°) greater than the sourcil ACEA. The differences often led to different clinical classifications for the same hip. With a statistically and clinically significant difference in the quantification of acetabular coverage using bone edge versus sourcil edge methods for measuring the LCEA and ACEA in adult patients, it should be mandatory to clearly identify which method was used in each study. PMID:27011850

  10. Modified Kocher-Langenbeck approach in combined surgical exposures for acetabular fractures management

    PubMed Central

    Magu, Narender Kumar; Rohilla, Rajesh; Singh, Amanpreet; Wadhwani, Jitendra


    Background: Displaced fractures of the acetabulum are best treated with anatomical reduction and rigid internal fixation. Adequate visualization of some acetabular fracture types may necessitate extensile or combined anterior and posterior approaches. Simultaneous anterior iliofemoral and posterior Kocher-Langenbeck (K-L) exposures with two surgical teams have also been described. To assess whether modified Kocher-Langenbeck (K-L) approach can substitute standard K-L approach in the management of elementary acetabular fractures other than the anterior wall and anterior column fractures and complement anterior surgical approaches in the management of complex acetabular fractures. Materials and Methods: 20 patients with transverse and associated acetabular fractures requiring posterior exposure were included in this prospective study. In 9 cases (7 transverse, 1 transverse with posterior wall, and 1 posterior column with posterior wall), stabilization was done through modified K-L approach. In 11 cases (3 transverse and 8 associated fractures), initial stabilization through iliofemoral approach was followed by modified K-L approach. Results: The average operative time was 183 min for combined approach and 84 min for modified K-L approach. The postoperative reduction was anatomical in 17 patients and imperfect in 3 patients. The radiological outcome was excellent in 15, good in 4, and poor in one patient. The clinical outcome was excellent in 15, good in 3 and fair and poor in 1 each according to modified Merle d’Aubigne and Postel scoring system. Conclusion: We believe that modified K-L approach may be a good alternative for the standard K-L approach in the management of elementary fractures and associated fractures of the acetabulum when combined with an anterior surgical approach. It makes the procedure less invasive, shortens the operative time, minimizes blood loss and overcomes the exhaustion and fatigue of the surgical team. PMID:27053812

  11. Postural correction reduces hip pain in adult with acetabular dysplasia: a case report

    PubMed Central

    Lewis, Cara L.; Khuu, Anne; Marinko, Lee


    Developmental dysplasia of the hip is often diagnosed in infancy, but less severe cases of acetabular dysplasia are being detected in young active adults. The purpose of this case report is to present a non-surgical intervention for a 31-year-old female with mild acetabular dysplasia and an anterior acetabular labral tear. The patient presented with right anterior hip and groin pain, and she stood with the trunk swayed posterior to the pelvis (swayback posture). The hip pain was reproduced with the anterior impingement test. During gait, the patient maintained the swayback posture and reported 6/10 hip pain. Following correction of the patient’s posture, the patient’s pain rating was reduced to a 2/10 while walking. The patient was instructed to maintain the improved posture. At the 1 year follow-up, she demonstrated significantly improved posture in standing and walking. She had returned to recreational running and was generally pain-free. The patient demonstrated improvement on self-reported questionnaires for pain, function and activity. These findings suggest that alteration of posture can have an immediate and lasting effect on hip pain in persons with structural abnormality and labral pathology. PMID:25731688

  12. The Retroacetabular Angle Determines the Safe Angle for Screw Placement in Posterior Acetabular Fracture Fixation

    PubMed Central

    Tadros, Ayman M. A.; Oxland, Thomas R.; O'Brien, Peter


    Introduction. A method for the determination of safe angles for screws placed in the posterior acetabular wall based on preoperative computed tomography (CT) is described. It defines a retroacetabular angle and determines its variation in the population. Methods. The retroacetabular angle is the angle between the retroacetabular surface and the tangent to the posterior acetabular articular surface. Screws placed through the marginal posterior wall at an angle equal to the retroacetabular angle are extraarticular. Medial screws can be placed at larger angles whose difference from the retroacetabular angle is defined as the allowance angles. CT scans of all patients with acetabular fractures treated in our institute between September 2002 to July 2007 were used to measure the retroacetabular angle and tangent. Results. Two hundred thirty one patients were included. The average (range) age was 42 (15–74) years. The average (range) retroacetabular angle was 39 (30–47) degrees. The average (range) retroacetabular tangent was 36 (30–45) mm. Conclusions. Placing the screws at an average (range) angle of 39 (33–47) degrees of anterior inclination with the retroacetabular surface makes them extraarticular. Angles for medial screws are larger. Safe angles can be calculated preoperatively with a computer program. PMID:24959359


    PubMed Central

    Guimarães, Rodrigo Pereira; Kaleka, Camila Cohen; Cohen, Carina; Daniachi, Daniel; Keiske Ono, Nelson; Honda, Emerson Kiyoshi; Polesello, Giancarlo Cavalli; Riccioli, Walter


    Objective: Correlate the postoperative radiographic evaluation with variables accompanying acetabular fractures in order to determine the predictive factors for segmental impaction of femoral head. Methods: Retrospective analysis of medial files of patients submitted to open reduction surgery with internal acetabular fixation. Within approximately 35 years, 596 patients were treated for acetabular fractures; 267 were followed up for at least two years. The others were excluded either because their follow up was shorter than the minimum time, or as a result of the lack of sufficient data reported on files, or because they had been submitted to non-surgical treatment. The patients were followed up by one of three surgeons of the group using the Merle d'Aubigné and Postel clinical scales as well as radiological studies. Results: Only tow studied variables-age and amount of postoperative reductionshowed statistically significant correlation with femoral head impaction. Conclusions: The quality of reduction-anatomical or with up to 2mm residual deviation-presents a good radiographic evolution, reducing the potential for segmental impaction of the femoral head, a statistically significant finding. PMID:27004191

  14. Articular cartilage friction increases in hip joints after the removal of acetabular labrum.


    Song, Yongnam; Ito, Hiroshi; Kourtis, Lampros; Safran, Marc R; Carter, Dennis R; Giori, Nicholas J


    The acetabular labrum is believed to have a sealing function. However, a torn labrum may not effectively prevent joint fluid from escaping a compressed joint, resulting in impaired lubrication. We aimed to understand the role of the acetabular labrum in maintaining a low friction environment in the hip joint. We did this by measuring the resistance to rotation (RTR) of the hip, which reflects the friction of the articular cartilage surface, following focal and complete labrectomy. Five cadaveric hips without evidence of osteoarthritis and impingement were tested. We measured resistance to rotation of the hip joint during 0.5, 1, 2, and 3 times body weight (BW) cyclic loading in the intact hip, and after focal and complete labrectomy. Resistance to rotation, which reflects articular cartilage friction in an intact hip was significantly increased following focal labrectomy at 1-3 BW loading, and following complete labrectomy at all load levels. The acetabular labrum appears to maintain a low friction environment, possibly by sealing the joint from fluid exudation. Even focal labrectomy may result in increased joint friction, a condition that may be detrimental to articular cartilage and lead to osteoarthritis.

  15. Temporary Balloon Occlusion of the Abdominal Aorta in Treatment of Complex Acetabular Fracture

    PubMed Central

    Hao, Zhenhai; Zhou, Dongsheng; Wang, Fu; Li, Lianxin; He, Jiliang


    Background The aim of this study was to explore the efficacy of temporary balloon occlusion of the abdominal aorta assisting open reduction and internal fixation (ORIF) in the treatment of complex acetabular fracture. Material/Methods From August 2000 to October 2011, a total of 48 patients with complex acetabular fracture were enrolled in this study. Average operative time, intraoperative blood loss volume, blood transfusion volume, satisfactory reduction, and postoperative functional recovery rate were recorded and compared between the 2 groups. Results A significant difference was observed between the 2 groups in operative time (P=0.003). For intraoperative blood loss and blood transfusion, ORIF combined with temporary balloon occlusion of abdominal aorta techniques appeared to be superior to normal ORIF (blood loss: P=0.007; and blood transfusion: P=0.019, respectively). However, no differences were observed in postoperative blood loss or transfusion (P>0.05). Patients in group A showed better hip function than those in group B (group A: a good-to-excellent rate of 77.8%; group B: a good-to-excellent rate of 78.3%; P>0.05). With regard to the incidence of postoperative complications, there were no significant differences between the 2 groups (group A: 9/18; group B: 11/23; P=0.890). Conclusions In the treatment of complex acetabular fracture, temporary balloon occlusion of the abdominal aorta is a reliable technique to assist ORIF surgery to staunch the flow of blood. PMID:27367975

  16. Evaluation and treatment of young adults with femoro-acetabular impingement secondary to Perthes' disease.


    Eijer, H; Podeszwa, D A; Ganz, R; Leunig, M


    Hip pain and loss of motion in young adults with previous Legg-Calve-Perthes-Disease may be caused by anterior femoro-acetabular impingement. Eleven patients (12 hips) with the chief complaint of groin pain and significant proximal femoral deformity were treated. Gadolinium-enhanced magnetic resonance arthrography in ten patients indicated labral injury and adjacent acetabular cartilage lesions in nine hips. A surgical dislocation of each hip confirmed that there was impingement induced intra-articular injury consistent with the pathology indicated on the MRI. Reshaping of the femoral head, with correction of the femoral head/neck offset, and treatment of the acetabular rim pathology was performed for each hip in conjunction with other procedures for the proximal femur. Correction of the impingement and increased range of motion could be visualized intra-operatively. At a mean follow-up of 33 months, half of all patients were pain-free and all had improvement in pain compared with preoperatively. Ten patients had an improved range of motion and two a slight decrease. No additional necrosis following the dislocation of the femoral head was seen.; PMID:19219805

  17. The Burch-Schneider antiprotrusio cage in revision hip arthroplasty with acetabular bone defect.


    Blacha, Jan; Gagała, Jacek


    Background. This article presents early outcome of revision hip arthroplasties with massive defects of acetabular bone stock using the Burch-Schneider (B-S) antiprotrusio cage. Materials and methods. We prospectively followed 28 hips in 27 patients (17 women and 10 men). The average age of the patients was 68 years (range 40-82). Follow-up ranged from 12 to 53 months (ave. 25 months). Combined bone loss (type III according to the AAOS classification) was the most common (75% of the patients). Bone grafts (morselized and solid) were used to reconstruct deficient acetabula in 25 hips. Results. The patients were satisfied with the surgical result. The mean Harris Hip Score increased 36 points one year after operation and reached 80 points (range 56-93). The antiprotrusio cages were stable in all hips, even in 4 cases of inferior flange malposition. We found no measurable implant migration or graft resorption in any patient. Postoperative dislocation occurred in 3 hips (11%), two of them developed recurrent dislocations. There were no deep infections. Conclusions. Acetabular reconstruction using the Burch-Schneider antiprotrusio cage can be successfully used in managing massive acetabular defects in revision hip arthroplasty. The cage provides the basis for bone repair and protects grafts from excessive stress. Postoperative dislocation is the most common complication.

  18. Coronal Acetabular Fractures: The Anterior Approach in Computed Tomography-Navigated Minimally Invasive Percutaneous Fixation

    SciTech Connect

    Jacob, Augustinus Ludwig; Suhm, Norbert; Kaim, Achim; Regazzoni, Pietro; Steinbrich, Wolfgang; Messmer, Peter


    Purpose: To demonstrate the technical feasibility of the anterior approach to the coronal roof component of carefully selected acetabular fractures in computed tomography (CT)-navigated closed reduction and percutaneous fixation (CRPF).Methods: Four patients with nondisplaced or slightly displaced coronal fractures of the acetabular roof were treated with percutaneous screw fixation. Screws were implanted over guidepins placed under CT navigation. Mean clinical and radiological follow-up was 16 months.Results: All screws could be placed as intended. There were no peri- or postoperative complications. Radiological follow-up showed primary osseous union. Clinical results were excellent according to a median Merle-d'Aubigne score of 18.Conclusion: Nondisplaced or slightly displaced coronally oriented fractures of the acetabular roof can be treated by minimally invasive percutaneous CT-navigated fixation through an anterior approach that does not endanger the sciatic nerve. Early clinical results are encouraging. Close cooperation between trauma surgeons and radiologists and careful selection of cases is mandatory.

  19. A Comparison of the Contact Force Distributions on the Acetabular Surface Due to Orthopedic Treatments for Developmental Hip Dysplasia.


    Márquez-Flórez, Kalenia M; Silva, Octavio; Narváez-Tovar, Carlos A; Garzón-Alvarado, Diego A


    We used a three-dimensional rigid body spring model (RBSM) to compare the contact force distributions on the acetabular surface of the infant hip joint that are produced by three orthopedic treatments for developmental dysplasia of the hip (DDH). We analyzed treatments using a Pavlik harness, a generic rigid splint, and a spica cast. The joint geometry was modeled from tomography images of a 1-year-old female. The articular cartilage was modeled as linear springs connecting the surfaces of the acetabulum and the femoral head, whereas the femur and the hip bone were considered as rigid bodies. The hip muscles were modeled as tensile-only preloaded springs. The treatments with the Pavlik harness and the generic rigid splint were modeled for an infant in supine position with a hip flexion angle of 90 deg. Also, since rigid splints are often recommended when children are initiating their gait phase, we modeled the treatment with the infant in standing position. For the spica cast, we only considered the infant in standing position with a flexion angle of 0 deg, and the fixation bar at two heights: at the ankle and at the knee. In order to analyze the effect of the hip abduction angle over the contact force distribution, different abduction angles were used for all the treatments modeled. We have found that the treatments with the infant in supine position, with a flexion angle of 90 deg and abduction angles between 60 deg and 80 deg, produce a more homogenous contact force distribution compared to those obtained for the treatments with the infant in standing position. PMID:27150210

  20. A Comparison of the Contact Force Distributions on the Acetabular Surface Due to Orthopedic Treatments for Developmental Hip Dysplasia.


    Márquez-Flórez, Kalenia M; Silva, Octavio; Narváez-Tovar, Carlos A; Garzón-Alvarado, Diego A


    We used a three-dimensional rigid body spring model (RBSM) to compare the contact force distributions on the acetabular surface of the infant hip joint that are produced by three orthopedic treatments for developmental dysplasia of the hip (DDH). We analyzed treatments using a Pavlik harness, a generic rigid splint, and a spica cast. The joint geometry was modeled from tomography images of a 1-year-old female. The articular cartilage was modeled as linear springs connecting the surfaces of the acetabulum and the femoral head, whereas the femur and the hip bone were considered as rigid bodies. The hip muscles were modeled as tensile-only preloaded springs. The treatments with the Pavlik harness and the generic rigid splint were modeled for an infant in supine position with a hip flexion angle of 90 deg. Also, since rigid splints are often recommended when children are initiating their gait phase, we modeled the treatment with the infant in standing position. For the spica cast, we only considered the infant in standing position with a flexion angle of 0 deg, and the fixation bar at two heights: at the ankle and at the knee. In order to analyze the effect of the hip abduction angle over the contact force distribution, different abduction angles were used for all the treatments modeled. We have found that the treatments with the infant in supine position, with a flexion angle of 90 deg and abduction angles between 60 deg and 80 deg, produce a more homogenous contact force distribution compared to those obtained for the treatments with the infant in standing position.

  1. Figuring out the Statistics of the ICC World Cup 2011

    ERIC Educational Resources Information Center

    Shiwalkar, Jyoti P.; Deshpande, M. N.


    This paper deals with the analysis of cricket match results from the ICC World Cup 2011. We believe that such data provide good material for interesting classroom exercises. (Contains 7 tables and 1 figure.)

  2. Space Coffee Cup: Capillary Flow Driven Fluids in Space

    NASA Video Gallery

    Interested in learning more about how fluids react in Space? In this video, Professor Mark Weislogel, and Dr. Marshall Porterfield will discuss the Space Coffee Cup and Capillary Flow Driven Fluids...

  3. Sound of a cup with and without instant coffee

    NASA Astrophysics Data System (ADS)

    Morrison, Andrew; Rossing, Thomas D.


    An empty coffee cup, like an ancient Chinese two-tone bell, emits two distinctly different tones, depending upon where it is tapped. When it is filled with hot water, and some instant coffee is added, however, a whole new set of sounds is heard when the cup is tapped. The pitch rises an octave or more as the foam clears due to the dramatic change in the speed of sound in the bubble-filled liquid. A similar, but smaller, effect was noted in beer by Bragg [The World of Sound (1968)] and in hot chocolate by Crawford [Am. J. Phys. (1982)]. We describe the modes of vibration in a coffee cup and the sound emitted by a coffee cup as filled with instant coffee as the bubble density changes.

  4. Degradation of protective organic coatings after cupping test

    SciTech Connect

    Deflorian, F.; Fedrizzi, L.; Rossi, S.


    Coil coating products generally are shaped by deforming and bending after coating. These deformations can produce defects inducing a significant deterioration of the protective properties of the organic coating. An empirical method for the evaluation of the deformation effects is the cupping test. in the present work, effects of the cupping test were studied by using electrochemical impedance spectroscopy (EIS) measurements to study the influence of deformation conditions on the mechanisms of degradation of the protective properties. The materials studied were environmentally friendly coatings based on ion exchange pigments. In addition to the electrochemical characterizations, a finite element model was developed for the estimation of the strain after the cupping test and some adhesion measurements were performed. The cupping test with an electrochemical characterization with EIS is a valid method for the evaluation of the protective behavior of coil coating products after deformation.

  5. Magnetic resonance imaging evaluation of acetabular orientation in normal Chinese children.


    Li, YiQiang; Liu, YuanZhong; Zhou, QingHe; Chen, WeiDong; Li, JingChun; Yu, LingJia; Xu, HongWen; Xie, DengHui


    There are no data regarding the acetabular orientation on magnetic resonance imaging (MRI); this study investigates the changes of acetabular orientation with age in normal Chinese children.We retrospectively analyzed the medical records of children who underwent hip MRI examination at our hospital from January 2009 to December 2015. A total of 180 patients with normal MRI reading of the hip joints were included and were divided into 14 groups according to age: from 6 months of age and then for each year from 1 to 16 years. The bony and cartilage acetabular anteversion angle (AAA), acetabular inclination angle (AIA), and acetabular index (AI) were measured. Total bony and cartilage femoral head coverage angles were measured on axial section total femoral head coverage angle (a-TCA) and coronal section total femoral head coverage angle (c-TCA).The mean bony AAA and AIA were 12.2 ± 2.5° and 50.9 ± 2.5°, respectively; both of them stayed constant from the age of 6 months to 16 years. Similar results were found in cartilage AAA (12.1 ± 2.5°) and AIA (41.2 ± 3.0°). There was no difference between bony and cartilage AAA, but bony AIA was significantly larger than cartilage AIA. Bony AI was 24.1 ± 2.4° at the age of 6 months, decreasing to 12.5 ± 2.3° by 12 to 13 years of age; cartilage AI (5.9 ± 1.7°) maintained a steady value with age. The mean bony a-TCA and c-TCA at 6 months were 117.0 ± 5.8° and 127.5 ± 5.1°, increasing to 144.5 ± 4.6° and 140.7 ± 2.5° at the age of 16 years. However, the cartilage a-TCA (145.2 ± 7.2°) and c-TCA (154.1 ± 5.7°) did not change significantly with age.Both bony and cartilage AAA and AIA remain constant up to the age of 16 years in normal Chinese pediatric population. Although the cartilage coverage of femoral head by the acetabulum remains unchanged with age, the bony coverage of femoral head increases. PMID:27631258

  6. Characterization of Human Anterosuperior Acetabular Depression in Correlation With Labral Tears

    PubMed Central

    Kopydlowski, Nathan J.; Tannenbaum, Eric P.; Smith, Matthew V.; Sekiya, Jon K.


    Background: Labral tears often occur in the same quadrant of the acetabulum at a small depression previously referred to as the psoas valley. Understanding the anatomic variations of this depression could help us understand the etiology of labral tears. Purpose: To describe the location and dimensions of the depression located in the anterosuperior acetabular rim. The hypothesis was that the location of this depression would be consistent with the common location of acetabular labral tears described in the literature. Study Design: Controlled laboratory study. Methods: A total of 240 pelvic specimens were divided into 2 groups (n = 120 for each) according to age (younger age group: 21.36 ± 3.12 years [range, 14-24 years]; older age group: 42.30 ± 10.27 years, [range, 25-60 years]).Specimens were also categorized based on sex (mean age: 31.93 ± 12.31 years [male]; 32.08 ± 13.66 years [female]) and race (mean age: 31.45 ± 13.16 years [black]; 32.57 ± 12.82 years [white]). The depth and width of the acetabular depression were measured using a digital caliper, and the location was measured using a goniometer. Results: The psoas valley was observed in every specimen and was located in the anterosuperior quadrant of the acetabulum. Its depth was significantly greater (P < .001) in males (5.35 ± 1.60 mm) than in females (3.95 ± 1.31 mm). The width of the psoas valley was also greater (P < .001) in males (29.39 ± 3.98 mm) than in females (24.49 ± 4.80 mm). There were no differences in size or location of the depression between races or age groups. The psoas valley was located between 3.92 ± 0.42 o’clock anteriorly and 2.12 ± 0.77 o’clock posteriorly. Conclusion: The differences observed in the study data are believed to be a result of the different anatomic morphologies of the pelvis in males and females. This loss of bony support, caused by the depression, could be the underlying cause of weakening of the acetabular labrum as people age. Clinical Relevance

  7. Prevalence of disc cupping in non-glaucomatous eyes.


    Chiappe, José Pablo; Nahum, Pablo; Casiraghi, Javier F; Iribarren, Rafael


    This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter < 1.0, 1.0-1.5, or > 1.5 times (respectively) the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81%) were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg). There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p < 0.001); therefore, for simplicity only the data for right eyes are presented. According to our definition, the optic discs in these eyes comprised 27 (14.7%) small, 141 (76.6%) medium and 16 (8.7%) large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist. PMID:25637893

  8. Space Experiment Concepts: Cup-Burner Flame Extinguishment

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki


    Space Fire Suppression Processes & Technology. Space experiment concepts of cup-burner flame extinguishment have been conceived to address to the key issues (i.e., organizing questions) in space fire suppression. Cup-burner flame extinguishment experiment can reveal physical and chemical suppression processes and provide agent effectiveness data useful for technology development of space fire suppression systems in various reduced-gravity platforms.

  9. Prevalence of disc cupping in non-glaucomatous eyes.


    Chiappe, José Pablo; Nahum, Pablo; Casiraghi, Javier F; Iribarren, Rafael


    This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter < 1.0, 1.0-1.5, or > 1.5 times (respectively) the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81%) were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg). There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p < 0.001); therefore, for simplicity only the data for right eyes are presented. According to our definition, the optic discs in these eyes comprised 27 (14.7%) small, 141 (76.6%) medium and 16 (8.7%) large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist.

  10. An investigation of home disadvantage in Davis Cup tennis.


    Gayton, William F; Steinroeder, William; Bonnica, Corrine; Loignon, Andrew C


    Occurrence of the home disadvantage in Davis Cup tennis matches was examined by analyzing the outcome of Davis Cup finals matches from 1900 to 2007. There was no significant home disadvantage when Matches 1 and 2 were compared with Matches 4 and 5. However, there was a significant home disadvantage when Matches 1 and 2 were compared with Match 5. These findings are compared with those from earlier studies in which data from professional basketball and baseball were examined.

  11. Collective efficacy at the Rugby World Cup 2015--The role of imagery and observation.


    Shearer, David A


    The Rugby World Cup in 2015 will present each competing team with unique psychological challenges not usually encountered in normal international fixtures. In the "pressure-pot" environment of the tournament, teams that have the strongest sense of collective efficacy will most likely perform to their best and respond positively to the outside stressors (e.g., media interest, public expectations). In this review, the importance of collective efficacy to team performance at the World Cup in terms of team resiliency and minimising process losses is discussed. In addition, the relationship between collective efficacy and other psychological factors such as team cohesion is highlighted. From a practical perspective, an introduction to interventions to develop collective efficacy is provided. In particular, the neuroscience evidence for the use of imagery and observation interventions to improve individual collective efficacy perceptions is highlighted. It is emphasised how these interventions are particularly suited to international teams who compete together sporadically. Finally, specific recommendations are made such that practitioners might be able to implement these strategies with their teams before the World Cup. PMID:25913269

  12. Infusing pleasure: Mood effects of the consumption of a single cup of tea.


    Einöther, Suzanne J L; Rowson, Matthew; Ramaekers, Johannes G; Giesbrecht, Timo


    Tea has historically been associated with mood benefits. Nevertheless, few studies have empirically investigated mood changes after tea consumption. We explored immediate effects of a single cup of tea up to an hour post-consumption on self-reported valence, arousal, discrete emotions, and implicit measures of mood. In a parallel group design, 153 participants received a cup of tea or placebo tea, or a glass of water. Immediately (i.e. 5 min) after consumption, tea increased valence but reduced arousal, as compared to the placebo. There were no differences at later time points. Discrete emotions did not differ significantly between conditions, immediately or over time. Water consumption increased implicit positivity as compared to placebo. Finally, consumption of tea and water resulted in higher interest in activities overall and in specific activity types compared to placebo. The present study shows that effects of a single cup of tea may be limited to an immediate increase in pleasure and decrease in arousal, which can increase interest in activities. Differences between tea and water were not significant, while differences between water and placebo on implicit measures were unexpected. More servings over a longer time may be required to evoke tea's arousing effects and appropriate tea consumption settings may evoke more enduring valence effects. PMID:27059832

  13. A Zero-Gravity Cup for Drinking Beverages in Microgravity

    NASA Technical Reports Server (NTRS)

    Pettit, Donald R.; Weislogel, Mark; Concus, Paul; Finn, Robert


    To date, the method for astronauts to drink liquids in microgravity or weightless environments is to suck the liquid from a bag or pouch through a straw. A new beverage cup works in microgravity and allows astronauts to drink liquids from a cup in a manner consistent with that on Earth. The cup is capable of holding beverages with an angled channel running along the wall from the bottom to the lip. In microgravity, a beverage is placed into the cup using the galley dispenser. The angled channel acts as an open passage that contains only two sides where capillary forces move the liquid along the channel until it reaches the top lip where the forces reach an equilibrium and the flow stops. When one sips the liquid at the lip of the channel, the capillary force equilibrium is upset and more liquid flows to the lip from the reservoir at the bottom to re-establish the equilibrium. This sipping process can continue until the total liquid contents of the cup is consumed, leaving only a few residual drops about the same quantity as in a ceramic cup when it is drunk dry on Earth.

  14. Splash-cup plants accelerate raindrops to disperse seeds

    PubMed Central

    Amador, Guillermo J.; Yamada, Yasukuni; McCurley, Matthew; Hu, David L.


    The conical flowers of splash-cup plants Chrysosplenium and Mazus catch raindrops opportunistically, exploiting the subsequent splash to disperse their seeds. In this combined experimental and theoretical study, we elucidate their mechanism for maximizing dispersal distance. We fabricate conical plant mimics using three-dimensional printing, and use high-speed video to visualize splash profiles and seed travel distance. Drop impacts that strike the cup off-centre achieve the largest dispersal distances of up to 1 m. Such distances are achieved because splash speeds are three to five times faster than incoming drop speeds, and so faster than the traditionally studied splashes occurring upon horizontal surfaces. This anomalous splash speed is because of the superposition of two components of momentum, one associated with a component of the drop's motion parallel to the splash-cup surface, and the other associated with film spreading induced by impact with the splash-cup. Our model incorporating these effects predicts the observed dispersal distance within 6–18% error. According to our experiments, the optimal cone angle for the splash-cup is 40°, a value consistent with the average of five species of splash-cup plants. This optimal angle arises from the competing effects of velocity amplification and projectile launching angle. PMID:23235266

  15. The effectiveness of wet cupping vs. venesection on arterial O2 saturation level of cigarette smokers: A randomized controlled clinical trial

    PubMed Central

    D, Hekmatpou; L, Moeini; S, Haji-Nadali


    Objective: Wet cupping is a traditional bloodletting method recommended for controlling of respiratory disease complications. This study aimed to compare the efficacy of wet cupping vs. venesection on arterial O2 saturation level of smokers. Methods: This is a randomized controlled clinical trial which started with simple sampling of smokers. After administering spirometery, participants (N = 110 male smokers) with positive pulmonary function test (PFT), who manifested Chronic Obstructive Pulmonary Disease (COPD), were randomly assigned to intervention and control groups. The two groups were assessed in terms of demographic data, rate of hemoglobin (Hb), hematocrit (Hct), and arterial O2 saturation. Then, the intervention participants underwent wet cupping whereas venesection was performed on the control participants. At four stages after the two treatments, pulse oximetery was performed. Data was analyzed using SPSS (Version 17). Results: Result shows that mean arterial O2 sat level increased at three stages, namely before, immediately after, and 6 and 12 hrs after these two treatments (p ≤ 0.001). This indicates that wet cupping and venesection alike were effective on O2 sat level in the two groups, but the increasing pattern was maintained 12 hrs afterward only in those participants who had received wet cupping (p ≤ 0.001). Moreover, the results of repeated measure ANOVA between the two groups at the four stages showed that there were significant differences between the means of O2 saturation level at the 6- and 12-hrs stages (F = 66.92, p ≤ 0.001). Conclusion: Wet cupping caused a continued O2 saturation in the intervention group even up to 12 hrs afterward. Participants expressed liveliness and improved respiration after wet cupping. Therefore, wet cupping is recommended for promoting the health of cigarette smokers. PMID:24550951

  16. New is the well-forgotten old: The use of dry cupping in musculoskeletal medicine.


    Rozenfeld, Evgeni; Kalichman, Leonid


    Cupping is an ancient technique used in treating pain and various disorders. Different techniques have been developed over time, however, applying a cup to create suction over a painful area, is common to all. Dry or fire cupping, used on the intact skin, leaves bluish circular hematomas. Recently, interest in cupping has re-emerged and subsequently, several studies have begun to investigate the mechanisms of cupping therapy. Mechanically, cupping increases blood circulation, whereas physiologically it activates the immune system and stimulates the mechanosensitive fibers, thus leading to a reduction in pain. There is initial scientific evidence that dry cupping is able to reduce musculoskeletal pain. Since cupping is an inexpensive, noninvasive and low-risk (if performed by a trained practitioner) therapeutic modality, we believe that it should be included in the arsenal of musculoskeletal medicine. It is essential to perform additional studies clarifying the biological mechanism and clinical effects of cupping. PMID:26891653

  17. Periprosthetic fractures of the acetabulum during cup insertion: posterior column stability is crucial.


    Laflamme, G-Yves; Belzile, Etienne L; Fernandes, Julio C; Vendittoli, Pascal A; Hébert-Davies, Jonah


    Periprosthetic hip fractures around acetabular components are rare with little information available to guide surgical management of these complex injuries. A retrospective review of intraoperative isolated acetabular periprosthetic fractures from three tertiary surgical units was done. A total of 32 patients were identified with 9 initially missed. Acetabular components were stable (type 1) in 11 patients with no failures; unstable (type 2) in 12 patients and treated with supplemental fixation. Non-union and displacement were correlated with absent posterior column plating. Missed fractures (type 3) had the highest reoperation rate. Anterior patterns all healed, whereas fractures with posterior column instability had a 67% failure rate. Periprosthetic acetabular fracture can heal successfully with posterior column stability. Plating is mandatory for large posterior wall fragments to achieve osteointegration.

  18. Examination and treatment of a professional ballet dancer with a suspected acetabular labral tear: A case report.


    Khoo-Summers, Lynnette; Bloom, Nancy J


    Dancers are at risk for developing groin pain that is due to acetabular labral tears. Although surgical management of labral tears has been reported extensively, conservative management has been poorly described. This case report describes the examination, diagnosis, and treatment of groin pain in a professional ballet dancer with a suspected acetabular labral tear. Treatment focused on decreasing anterior hip joint stresses and improving the precision of hip motion through correction of alignment and movement impairments noted during functional activities and dance. Successful outcomes included a reduction in pain and return to professional ballet dancing. PMID:25725589

  19. Occult internal iliac arterial injury identified during open reduction internal fixation of an acetabular fracture: a report of two cases.


    Chaus, George W; Heng, Marilyn; Smith, Raymond M


    We present two cases of occult internal iliac arterial injury identified during operative reduction of a widely displaced posterior column posterior wall acetabular fracture. This complication was not recognised until reduction of the column fracture. There were no preoperative signs or symptoms indicative of a vascular injury. These cases emphasise the heightened awareness one must have when treating widely displaced posterior column fractures of the acetabulum, especially those fractures with extension into the greater sciatic notch, as previously formed clot can become dislodged and hemostasis lost. We also present management options when this complication occurs. We believe any surgeon treating acetabular fractures should be aware of this serious and potentially fatal complication.

  20. Modified ilioinguinal approach in combined surgical exposures for displaced acetabular fractures involving two columns.


    Wang, Peng; Zhu, Xiaodong; Xu, Peng; Zhang, Yan; Wang, Lubo; Liu, Xiangyan; Mu, Weidong


    The purpose of this study is to assess the advantages of modified ilioinguinal approach in combined surgical exposures for displaced acetabular fractures involving two columns management. 73 patients with displaced acetabular fractures involving two columns underwent open reduction and internal fixation through combined surgical approaches between 2006 and 2014 in our hospital. The modified ilioinguinal approach combined with Kocher-Langenbeck approach group (group A) included 46 patients. The standard ilioinguinal approach combined with Kocher-Langenbeck approach group (group B) included 27 patients. Outcome was assessed in operative time, blood loss, function outcomes and complications. In group A, the average operative time was 123.2 min, and the average blood loss was 586.2 ml. Anatomic reduction was achieved in 39 patients (84.8 %). The functional recovery was good in 37 patients (80.4 %). Complications related to the approach were observed in 10 patients (21.7 %). In group B, the average operative time was 161.5 min, and the average blood loss was 830 ml. Anatomic reduction was achieved in 24 patients (88.9 %). The functional recovery was good in 22 patients (81.5 %). Complications related to the approach were observed in 9 patients (33.3 %). This study demonstrates that both combined approaches permits good postoperative function results for treatment of acetabular fractures involving two columns. However, the modified ilioinguinal approach combined with Kocher-Langenbeck approach provides less operative time, blood loss and complications. PMID:27652175

  1. Analysis of spinal alignment and pelvic parameters on upright radiographs: implications for acetabular development

    PubMed Central

    Pytiak, Andrew; Bomar, James D.; Peterson, Jonathan B.; Schmitz, Matthew R.; Pennock, Andrew T.; Wenger, Dennis R.; Upasani, Vidyadhar V.


    The purpose of this study was to correlate measures of sagittal spinopelvic alignment [lumbar lordosis (LL), sacral slope (SS), pelvic tilt (PT) and pelvic incidence (PI)] and measures of acetabular coverage [lateral center edge angle (LCEA) and Tonnis angle] in asymptomatic adolescents on standing biplanar radiographs. We hypothesized that subjects with increased pelvic incidence and LL would have increased anterior PT and increased measures of acetabular coverage. Upright anteroposterior and lateral spinopelvic radiographs were obtained using EOS imaging technique. LCEA and Tonnis angle were calculated on the anteroposterior images and the lateral images were analyzed for LL, PI, PT and SS. LL was found to have a strong correlation with SS (rs = 0.786, P  <  0.001), moderate correlation with PI (rs  =  0.529, P  <  0.001), and a poor inverse correlation with PT (rs  = −0.167, P  =  0.018). However, LCEA was not found to be significantly correlated with PT (rs  =  0.084, P  =  0.238) and Tonnis angle was not found to be correlated with any of the sagittal spinopelvic measures. Healthy, asymptomatic adolescents with increased pelvic incidence and lumbar lordosis did not have increased anterior PT or increased measures of acetabular coverage. The correlations identified in previous cadaveric studies or clinical studies evaluating changes between supine and standing radiographs are not supported in this healthy adolescent population. Our findings may suggest that an individual’s acetabulum develops as a dynamic adaptation to one's particular sagittal spinopelvic alignment to optimize femoral head coverage. Level III. Diagnostic – Investigating a diagnostic test. PMID:27583160

  2. Dielectric elastomer actuators for octopus inspired suction cups.


    Follador, M; Tramacere, F; Mazzolai, B


    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms.

  3. Octopus-like suction cups: from natural to artificial solutions.


    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B


    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance.

  4. Octopus-like suction cups: from natural to artificial solutions.


    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B


    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance. PMID:25970079

  5. Dielectric elastomer actuators for octopus inspired suction cups.


    Follador, M; Tramacere, F; Mazzolai, B


    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms. PMID:25253019

  6. Development of cup shaped microneedle array for transdermal drug delivery.


    Vinayakumar, Kadayar B; Hegde, Gopal M; Ramachandra, Subbaraya G; Nayak, Mangalore M; Dinesh, Narasimhian S; Rajanna, Konandur


    Microneedle technology is one of the attractive methods in transdermal drug delivery. However, the clinical applications of this method are limited owing to: complexity in the preparation of multiple coating solutions, drug leakage while inserting the microneedles into the skin and the outer walls of the solid microneedle can hold limited quantity of drug. Here, the authors present the fabrication of an array of rectangular cup shaped silicon microneedles, which provide for reduced drug leakage resulting in improvement of efficiency of drug delivery and possibility of introducing multiple drugs. The fabricated solid microneedles with rectangular cup shaped tip have a total height of 200 μm. These cup shaped tips have dimensions: 60 × 60 μm (length × breadth) with a depth of 60 μm. The cups are filled with drug using a novel in-house built drop coating system. Successful drug dissolution was observed when the coated microneedle was used on mice. Also, using the above method, it is possible to fill the cups selectively with different drugs, which enables simultaneous multiple drug delivery. PMID:25956180

  7. New tool for applying traction during open reduction and internal fixation of acetabular fractures.


    Lien, Fang-Chieh


    Open reduction and internal fixation is used to treat complex acetabular fractures. Traction on the femur is necessary to reduce the acetabulum and is accomplished by surgical assistants or with mechanical devices. To overcome the disadvantages of various traction methods, the author designed a simple, novel traction device that can be used on an ordinary orthopedic or radiolucent operating table and has advantages over manual traction and commercial traction tables. The device consists of a horizontal cross-bar supported over the patient by 2 free-standing legs and is constructed from commercially available parts.

  8. Assessment of failure of cemented polyethylene acetabular component due to bone remodeling: A finite element study.


    Ghosh, Rajesh


    The aim of the study is to determine failure of the cemented polyethylene acetabular component, which might occur due to excessive bone resorption, cement-bone interface debonding and fatigue failure of the cement mantle. Three-dimensional finite element models of intact and implanted pelvic bone were developed and bone remodeling algorithm was implemented for present analysis. Soderberg fatigue failure diagram was used for fatigue assessment of the cement mantle. Hoffman failure criterion was considered for prediction of cement-bone interface debonding. Results indicate fatigue failure of the cement mantle and implant-bone interface debonding might not occur due to bone remodeling.

  9. Hip Arthroscopy for Incarcerated Acetabular Labrum following Reduction of Traumatic Hip Dislocation: Three Case Reports

    PubMed Central

    Hwang, Jung-Mo; Lee, Woo-Yong; Noh, Chang-Kyun; Zheng, Long


    Traumatic hip fracture-dislocations are associated with chondral and labral pathology as well as loose bodies that can be incarcerated in the hip joint. Incarceration, such as interposed labrum between acetabulum and femoral head that is not readily visualized preoperatively, is a rare but important cause of pain and can potentially be a source for early degeneration and progression to osteoarthritis. We present three cases, arthroscopic surgery of incarcerated acetabular osseo-labral fragment following reduction of traumatic hip fracture-dislocation. PMID:27777919

  10. The Equine Endometrial Cup Reaction: A Fetomaternal Signal of Significance

    PubMed Central

    Antczak, D. F.; de Mestre, Amanda M.; Wilsher, Sandra; Allen, W. R.


    A remarkable feature of equine pregnancy is the development of the invasive trophoblast of the chorionic girdle and its formation of the gonadotrophin-secreting endometrial cup cells in early gestation. The details of this process have been revealed only slowly over the past century, since the first description of the endometrial cups in 1912. This centennial presents an opportunity to review the characteristics of the cells and molecules involved in this early, critical phase of placentation in the mare. The invasiveness of the chorionic girdle trophoblast appears to represent an atavistic attribute more commonly associated with the hemochorial placentae of primates and rodents but not with the more recently derived epitheliochorial placentae of the odd-toed ungulates. The nature of and raison d’etre for the strong fetal signals transmitted to the mare by the endometrial cup reaction, and her responses to these messages, are the subject of the present review. PMID:25387026

  11. Fabrication of silica nanocomposite-cups using electrospraying

    NASA Astrophysics Data System (ADS)

    Deotare, P. B.; Kameoka, J.


    We have investigated a new process for the fabrication of nanocomposite cups by electrospraying blended polymer-sol-gel solutions followed by calcination. Due to the low viscosity and high surface tension of the blended polymer-sol-gel solutions, the electrostatically extruded continuous liquid jet from the spray source became tiny droplets with diameters of less than 1 µm. These droplets dried in transit and were collected at the counter electrode. To eliminate polymers, as well as cross-link sol-gel material, they were calcined at 850 °C for 3 h. We also investigated a probable method to control the morphology of the nanocups by changing the ionic concentration of the polymer solution. This is a simple and efficient approach for producing nanocomposite cups, which cannot be made by the aggregation method. These nanocomposite cups may find applications in drug delivery and filtration media.

  12. The response function of modulated grid Faraday cup plasma instruments

    NASA Technical Reports Server (NTRS)

    Barnett, A.; Olbert, S.


    Modulated grid Faraday cup plasma analyzers are a very useful tool for making in situ measurements of space plasmas. One of their great attributes is that their simplicity permits their angular response function to be calculated theoretically. An expression is derived for this response function by computing the trajectories of the charged particles inside the cup. The Voyager Plasma Science (PLS) experiment is used as a specific example. Two approximations to the rigorous response function useful for data analysis are discussed. The theoretical formulas were tested by multi-sensor analysis of solar wind data. The tests indicate that the formulas represent the true cup response function for all angles of incidence with a maximum error of only a few percent.

  13. Earliest Directly-Dated Human Skull-Cups

    PubMed Central

    Bello, Silvia M.; Parfitt, Simon A.; Stringer, Chris B.


    Background The use of human braincases as drinking cups and containers has extensive historic and ethnographic documentation, but archaeological examples are extremely rare. In the Upper Palaeolithic of western Europe, cut-marked and broken human bones are widespread in the Magdalenian (∼15 to 12,000 years BP) and skull-cup preparation is an element of this tradition. Principal Findings Here we describe the post-mortem processing of human heads at the Upper Palaeolithic site of Gough's Cave (Somerset, England) and identify a range of modifications associated with the production of skull-cups. New analyses of human remains from Gough's Cave demonstrate the skilled post-mortem manipulation of human bodies. Results of the research suggest the processing of cadavers for the consumption of body tissues (bone marrow), accompanied by meticulous shaping of cranial vaults. The distribution of cut-marks and percussion features indicates that the skulls were scrupulously 'cleaned' of any soft tissues, and subsequently modified by controlled removal of the facial region and breakage of the cranial base along a sub-horizontal plane. The vaults were also ‘retouched’, possibly to make the broken edges more regular. This manipulation suggests the shaping of skulls to produce skull-cups. Conclusions Three skull-cups have been identified amongst the human bones from Gough's Cave. New ultrafiltered radiocarbon determinations provide direct dates of about 14,700 cal BP, making these the oldest directly dated skull-cups and the only examples known from the British Isles. PMID:21359211

  14. Cohesive suction-cup force in cell separation dynamics

    NASA Astrophysics Data System (ADS)

    Vasseur, H.


    When an external pulling force is applied onto a cell stuck to its substrate, a reacting "suction-cup" force, due to the slow penetration of the surrounding fluid between the cell and the substrate, opposes to the separation. It can overcome other known adhesive forces when the process is sufficiently violent (typically 105 N/m2). The physical origin of this effect may be compared with that leaning a suction-cup against a bathroom wall. We address the consequences of this effect on i) the separation energy, ii) the fluid motion surrounding the cell, and iii) the inhibition of cell motion.

  15. Calibration and Lag of a Friez Type Cup Anemometer

    NASA Technical Reports Server (NTRS)

    Pinkerton, Robert M


    Tests on a Friez type cup anemometer have been made in the variable density wind tunnel of the Langley Memorial Aeronautical Laboratory to calibrate the instrument and to determine its suitability for velocity measurements of wind gusts. The instrument was calibrated against a Pitot-static tube placed directly above the anemometer at air densities corresponding to sea level, and to an altitude of approximately 6000 feet. Air-speed acceleration tests were made to determine the lag in the instrument reading. The calibration results indicate that there should be an altitude correction. It is concluded that the cup anemometer is too sluggish for velocity measurements of wind gusts.

  16. Preliminary analysis on the MD-4® plasma-sprayed titanium acetabular component☆

    PubMed Central

    de Araújo Loures, Elmano; Simoni, Leandro Furtado; Leite, Isabel Cristina Gonçalves; Loures, Daniel Naya; Loures, Clarice Naya


    Objectives To evaluate the short-term performance of a type of implant manufactured in Brazil. Methods This study analyzed a cohort of 60 patients who underwent implantation of MD-4® acetabular components during primary hip arthroplasty procedures performed between January 1, 2010, and August 1, 2012. The patients were studied retrospectively with regard to clinical behavior, stability and radiological osseointegration. The patients were followed up for a minimum of 12 months and a maximum of 42 months (mean: 27) and were evaluated by means of the Harris Hip Score, SF-36 questionnaire and serial conventional radiographs. Results All the components were radiologically stable, without evidence of migration or progressive radiolucency lines. On average, the Harris Hip Score evolved from 36.1 to 92.1 (p < 0.001) and the SF-36 showed significant increases in all its domains (p < 0.001). No differences were observed among patients with osteoarthrosis, osteonecrosis, hip dysplasia or other conditions. Conclusions The short-term results showed clinical and radiological signs of stability and osseointegration of the implants, which may represent a predictive factor regarding medium-term survival of this acetabular component. PMID:26229918

  17. Validation of an optical system to measure acetabular shell deformation in cadavers.


    Dold, Philipp; Bone, Martin C; Flohr, Markus; Preuss, Roman; Joyce, Tom J; Deehan, David; Holland, James


    Deformation of the acetabular shell at the time of surgery can result in poor performance and early failure of the hip replacement. The study aim was to validate an ATOS III Triple Scan optical measurement system against a co-ordinate measuring machine using in vitro testing and to check repeatability under cadaver laboratory conditions. Two sizes of custom-made acetabular shells were deformed using a uniaxial/two-point loading frame and measured at different loads. Roundness measurements were performed using both the ATOS III Triple Scan optical system and a co-ordinate measuring machine and then compared. The repeatability was also tested by measuring shells pre- and post-insertion in a cadaver laboratory multiple times. The in vitro comparison with the co-ordinate measuring machine demonstrated a maximum difference of 5 µm at the rim and 9 µm at the measurement closest to the pole of the shell. Maximum repeatability was below 1 µm for the co-ordinate measuring machine and 3 µm for the ATOS III Triple Scan optical system. Repeatability was comparable between the pre-insertion (below 2 µm) and post-insertion (below 3 µm) measurements in the cadaver laboratory. This study supports the view that the ATOS III Triple Scan optical system fulfils the necessary requirements to accurately measure shell deformation in cadavers.

  18. The role of acetabular and femoral osteotomies in reconstructive surgery of the hip: 2005 and beyond.


    Turgeon, Thomas R; Phillips, William; Kantor, Stephen R; Santore, Richard F


    Femoral and acetabular osteotomies have enduring and useful roles in the ongoing surgical treatment of patients with various hip conditions. The classic indication for intertrochanteric valgus osteotomy is to induce healing of femoral neck nonunions. Additional indications include posttraumatic deformity, limb-length inequality, certain cases of osteonecrosis, and adult sequelae of Legg-Calve-Perthes disease, and slipped capital femoral epiphysis. Isolated intertrochanteric osteotomy is only occasionally indicated for the treatment of arthritis secondary to dysplasia. Rotational osteotomies of the pelvis have overtaken the role once historically played by intertrochanteric osteotomy in the treatment of dysplasia-related hip anomalies. Ideal candidates have prearthritic, activity-related pain associated with radiographic dysplasia. It is imperative that the hip joint be congruous, free of fixed subluxation, and located in the natural acetabulum. Surgical treatment of associated acetabular labral tears and/or detachments and impingement lesions can be done at the same time through antecedent hip arthroscopy (same anesthetic) or open arthrotomy. The direction and magnitude of correction need to be customized to fit the nature of the dysplasia. A standard method of correction likely is to result in unwanted iatrogenic retroversion in some cases. Intertrochanteric osteotomy now is used as a complement to rotational osteotomy for the indications outlined above. PMID:16331002

  19. Acetabular Reconstruction with Human and Bovine Freeze- Dried Bone Grafts and a Reinforcement Device

    PubMed Central

    Rosito, Ricardo; Galia, Carlos Roberto; Macedo, Carlos Alberto Souza; Moreira, Luis Fernando; Quaresma, Lourdes Maria Araújo C.; Palma, Humberto Moreira


    BACKGROUND This is a cohort trial (1997–2005) of 49 patients submitted to an acetabular component revision of a total hip arthroplasty, using impacted human and bovine freeze-dried cancellous bone grafts (H&FDBG) and a reinforcement device. OBJECTIVE To compare clinical/radiographic graft incorporation capability between cancellous bone grafts. PATIENTS/METHODS There were two groups: I (n=26) receiving human grafts and II (n=25) receiving bovine grafts. The average follow-up times were 55 and 49 months, respectively. Clinical analysis was based on the Merle d’Aubigné and Postel score, and the radiographic analysis involved an established score based on Conn’s et al. criteria for radiographic bone incorporation. RESULTS No clinical/radiographic differences were found between the groups and both showed an overall rate of 88.5% and 76% of graft incorporation (p=0.424). CONCLUSION The results presented here are comparable to those in the literature with the use of deep-FG. Therefore, cancellous bone grafts can be safely and adequately used in acetabular component revision in total hip arthroplasty. PMID:18719763

  20. The Association of Femoral Neck Stress Fractures with Femoral Acetabular Impingement

    PubMed Central

    Safran, Marc R.; Goldin, Michael; Anderson, Christian; Fredericson, Michael; Stevens, Kathryn J.


    Objectives: To determine if there is an increased incidence of femoral acetabular impingement (FAI) in patients presenting with stress fractures of the femoral neck. Methods: After IRB approval, the imaging studies of 25 athletes (22 females, 3 males, mean age 26, range 19 - 39 years) with femoral neck stress injuries were assessed for the presence of features suggesting FAI, including acetabular retroversion, coxa profunda, abnormal femoral head-neck junction, fibrocystic change, os acetabulae, labral tear and chondral injury. All subjects had to have an adequate AP Pelvis radiograph, a lateral radiograph of the affected hip, and an MRI of the affected hip. The alpha angle, anterior offset ratio, and center to edge (CE) angle were measured on radiographs. The grade of stress injury was determined on MR images. All images and measurements were made by a musculoskeletal fellowship trained radiologist, a fellowship trained orthopaedic surgeon, an orthopaedic sports medicine fellow and a physical medicine and rehabilitation resident. Charts were reviewed to determine treatment of the stress fracture, outcome and final follow up, as well as to determine if the patient had any further treatment for their hip. Results: Of the 25 hips (18 right, 7 left) with femoral neck stress reactions, 9 were grade 2 (bone marrow edema), 5 were grade 3 (high T2 and low T1 marrow signal), and 11 were grade 4 (stress fracture). Twenty patients (80%) had coxa profunda - where the floor of the cotyloid fossa touches or extends beyond the ilioischial line (incidence in general population is 15.2% of males, and 19.4% of females). Coxa profunda, defined by the floor of the cotyloid fossa touching or extending beyond the ilioischial line and a center edge angle of more than 35o, was present in 28% of subjects. Acetabular retroversion as assessed by the crossover sign was present in 42% (normal incidence is 5% of population). Center edge angle was greater than 35o in 20% and greater than 40 o

  1. The influence of the strength of bone on the deformation of acetabular shells: a laboratory experiment in cadavers.


    Bone, M C; Dold, P; Flohr, M; Preuss, R; Joyce, T J; Aspden, R M; Holland, J; Deehan, D


    Concerns have been raised that deformation of acetabular shells may disrupt the assembly process of modular prostheses. In this study we aimed to examine the effect that the strength of bone has on the amount of deformation of the acetabular shell. The hypothesis was that stronger bone would result in greater deformation. A total of 17 acetabular shells were inserted into the acetabula of eight cadavers, and deformation was measured using an optical measuring system. Cores of bone from the femoral head were taken from each cadaver and compressed using a materials testing machine. The highest peak modulus and yield stress for each cadaver were used to represent the strength of the bone and compared with the values for the deformation and the surgeon's subjective assessment of the hardness of the bone. The mean deformation of the shell was 129 µm (3 to 340). No correlation was found between deformation and either the maximum peak modulus (r² = 0.011, t = 0.426, p = 0.676) or the yield stress (r² = 0.024, t = 0.614, p = 0.549) of the bone. Although no correlation was found between the strength of the bone and deformation, the values for the deformation observed could be sufficient to disrupt the assembly process of modular acetabular components.

  2. 21 CFR 888.3320 - Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Hip joint metal/metal semi-constrained, with a... Devices § 888.3320 Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with a cemented...

  3. 21 CFR 888.3330 - Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Hip joint metal/metal semi-constrained, with an... Devices § 888.3330 Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with an uncemented...

  4. 21 CFR 888.3330 - Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Hip joint metal/metal semi-constrained, with an... Devices § 888.3330 Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with an uncemented...

  5. 21 CFR 888.3320 - Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Hip joint metal/metal semi-constrained, with a... Devices § 888.3320 Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with a cemented...

  6. 21 CFR 888.3330 - Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hip joint metal/metal semi-constrained, with an... Devices § 888.3330 Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with an uncemented...

  7. 21 CFR 888.3320 - Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hip joint metal/metal semi-constrained, with a... Devices § 888.3320 Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with a cemented...

  8. 21 CFR 888.3330 - Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Hip joint metal/metal semi-constrained, with an... Devices § 888.3330 Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with an uncemented...

  9. 21 CFR 888.3330 - Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Hip joint metal/metal semi-constrained, with an... Devices § 888.3330 Hip joint metal/metal semi-constrained, with an uncemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with an uncemented...

  10. 21 CFR 888.3320 - Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Hip joint metal/metal semi-constrained, with a... Devices § 888.3320 Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with a cemented...

  11. 21 CFR 888.3320 - Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Hip joint metal/metal semi-constrained, with a... Devices § 888.3320 Hip joint metal/metal semi-constrained, with a cemented acetabular component, prosthesis. (a) Identification. A hip joint metal/metal semi-constrained, with a cemented...

  12. Femoroacetabular impingement with chronic acetabular rim fracture - 3D computed tomography, 3D magnetic resonance imaging and arthroscopic correlation

    PubMed Central

    Chhabra, Avneesh; Nordeck, Shaun; Wadhwa, Vibhor; Madhavapeddi, Sai; Robertson, William J


    Femoroacetabular impingement is uncommonly associated with a large rim fragment of bone along the superolateral acetabulum. We report an unusual case of femoroacetabular impingement (FAI) with chronic acetabular rim fracture. Radiographic, 3D computed tomography, 3D magnetic resonance imaging and arthroscopy correlation is presented with discussion of relative advantages and disadvantages of various modalities in the context of FAI. PMID:26191497

  13. Custom 3D-printed acetabular implants in hip surgery--innovative breakthrough or expensive bespoke upgrade?


    Wyatt, Michael C


    Custom 3D-printed triflange acetabular cages are a new option in the armamentarium of the revision hip surgeon. This review article defines this technology, its indications, surgical method, advantages, disadvantages, use, current published literature and future applications. PMID:26351112

  14. Effect of methotrexate exposure at middle gestation on the inner plate of the ocular cup and lens in the rat fetus

    PubMed Central

    Zu, Cheng Zhe; Kuroki, Masato; Hirako, Ayano; Takeuchi, Takashi; Furukawa, Satoshi; Sugiyama, Akihiko


    Pregnant rats were treated intraperitoneally with a single dose of methotrexate (MTX) 90 mg/kg on gestation day (GD) 13, and fetal eyeballs were examined time-dependently from GD 13.5 to 15.5. Throughout the experimental period, the inner plate of the ocular cup in the MTX group was significantly thinner than that in the control group. In the inner plate of the ocular cup on GD 15 and 15.5, whereas a developed ganglion cell layer was observed in the control group, the ganglion cell layer in the MTX group was undeveloped and indistinguishable. Disturbance of the arrangement of lens fiber cells, narrowing of the hyaloid cavity of the optic cup, and hypoplasia of optic nerve fibers were observed in the MTX group on GD 15 and 15.5. Increase of pyknosis and decrease of mitosis were induced in the optic cup and the lens epithelium of the MTX group. In the inner plate of the optic cup and the lens epithelium of the MTX group, the cleaved caspase-3- and TUNEL-positive rates increased significantly throughout the experimental period. The phospho-histone H3-positive rate in the inner plate of the optic cup decreased significantly from GD 13.5 to 14.5, and it recovered on GD 15. On the other hand, the phospho-histone H3-positive rate in the lens epithelium decreased significantly throughout the experimental period. These results suggested that optic tissue on GD 13 in rats was sensitive to MTX. PMID:27559242

  15. Effect of methotrexate exposure at middle gestation on the inner plate of the ocular cup and lens in the rat fetus.


    Zu, Cheng Zhe; Kuroki, Masato; Hirako, Ayano; Takeuchi, Takashi; Furukawa, Satoshi; Sugiyama, Akihiko


    Pregnant rats were treated intraperitoneally with a single dose of methotrexate (MTX) 90 mg/kg on gestation day (GD) 13, and fetal eyeballs were examined time-dependently from GD 13.5 to 15.5. Throughout the experimental period, the inner plate of the ocular cup in the MTX group was significantly thinner than that in the control group. In the inner plate of the ocular cup on GD 15 and 15.5, whereas a developed ganglion cell layer was observed in the control group, the ganglion cell layer in the MTX group was undeveloped and indistinguishable. Disturbance of the arrangement of lens fiber cells, narrowing of the hyaloid cavity of the optic cup, and hypoplasia of optic nerve fibers were observed in the MTX group on GD 15 and 15.5. Increase of pyknosis and decrease of mitosis were induced in the optic cup and the lens epithelium of the MTX group. In the inner plate of the optic cup and the lens epithelium of the MTX group, the cleaved caspase-3- and TUNEL-positive rates increased significantly throughout the experimental period. The phospho-histone H3-positive rate in the inner plate of the optic cup decreased significantly from GD 13.5 to 14.5, and it recovered on GD 15. On the other hand, the phospho-histone H3-positive rate in the lens epithelium decreased significantly throughout the experimental period. These results suggested that optic tissue on GD 13 in rats was sensitive to MTX. PMID:27559242

  16. Plastic Straining of Iridium Alloy DOP-26 During Cup Sizing Operations

    SciTech Connect

    Ohriner, Evan Keith; Ulrich, George B; Sabau, Adrian S


    DOP-26 iridium alloy cups are used for fuel cladding for radioisotope power systems. The cups are deep drawn and recrystallized prior to final fabrication operations. This study characterizes the plastic deformation of cups during a sizing operation following the recrystallization heat treatment. The purpose of the sizing operation is to achieve the specified roundness, diameter, and radius dimensions of the cup. The operation introduces various levels of plastic strain in the cup. Plastic strain can be a cause of inhomogeneous or abnormal grain growth during subsequent exposure to elevated temperature during the service life of the fueled clad. This is particularly true in the case of cups which have irregularities in the cup walls from the deep drawing operations. Diameter and roundness measurements were made on two cups both before and after sizing. Plastic strain levels were calculated using the ABAQUSTM finite element software. The calculated plastic strain levels in both cups were below 0.025, a value shown to be below the critical strain for abnormal grain growth during a simulated service exposure. The calculated maximum plastic strain was found to increase with increased applied sizing load and was not sensitive to the input value for the clearance between the cup and the sizing die. The calculated geometry of the sized cups was in good agreement with the measurements on the finished cups.

  17. 77 FR 14423 - Certain Food Containers, Cups, Plates, Cutlery, and Related Items, and Packaging Thereof; Notice...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Certain Food Containers, Cups, Plates, Cutlery, and Related Items, and Packaging Thereof; Notice... Trade Commission has received a complaint entitled Certain Food Containers, Cups, Plates, Cutlery, and... containers, cups, plates, cutlery, and related items, and packaging thereof. The complaint names...

  18. Cup Stacking: Does It Deserve a Place in Physical Education Curricula?

    ERIC Educational Resources Information Center

    Udermann, Brian E.; Murray, Steven R.


    Cup stacking has become commonplace in today's physical education nomenclature. Proponents make claims that cup stacking improves cognitive, affective, and psychomotor abilities. At physical education conferences, scores of professional physical educators eagerly watch cup stacking representatives construct and deconstruct a variety of pyramids…

  19. 77 FR 46285 - Special Local Regulation and Safety Zone; America's Cup Sailing Events, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... associated with the ``2012 America's Cup World Series'' regatta scheduled for August 21-26, 2012, on the... zone regulate the on-water activities associated with the ``2012 America's Cup World Series'' regatta... published in association with the ``2012 America's Cup World Series'' regattas. This program calendar...

  20. 77 FR 20846 - Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... COMMISSION Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof by... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof...

  1. Teaching Transport Phenomena around a Cup of Coffee

    ERIC Educational Resources Information Center

    Condoret, Jean Stephane


    The very common situation of waiting for the cooling of a cup of coffee is addressed through a conventional engineering approach, where several important concepts of heat and mass transfer are used. A numerical and analytical solution of the differential equations of the problem are proposed, and assessed by comparing to simple experiments.…

  2. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    ERIC Educational Resources Information Center

    Petracco, Marino


    Coffee consumption has spread worldwide and differences in the raw bean consumption, in roasting conditions and in the extraction procedures used to prepare coffee brews result in a great diversity of chemical composition in the final product, the cup of coffee. Hence, beverage preparation is a fundamental step for enjoying the benefits of this…

  3. Leidos Reclaims Defelice Cup at Annual Golf Tournament | Poster

    By Ashley DeVine, Staff Writer Leidos Biomedical Research reclaimed the Defelice Cup trophy from NCI at the eighth annual Ronald H. Defelice golf tournament, held October 14. The final score was 15–7, with Leidos Biomed tying the series 4 to 4. Fourteen players on each team battled it out at Rattlewood golf course in Mount Airy, Md.

  4. Adsorption of serum calcium by plastic sample cups.


    Hall, R A; Whitehead, T P


    Sera left overnight in plastic AutoAnalyzer sample cups may give low calcium values; the effect is attributed to adsorption of calcium onto the walls of the vessel. The adsorption is brought about by a rise in the pH of the sera, and factors which promote the rise in pH increase the adsorption. This phenomenon is of practical importance because as much as 10% of the calcium in the serum may be adsorbed. Adsorption occurs particularly onto the walls of polystyrene cups, and when polypropylene cups were used the adsorption was reduced. The phenomenon cannot be evaluated or controlled by the use of control sera. In order to avoid the sampling error, serum for calcium analysis should be used fresh or stored at 4 degrees C under conditions such that any change in pH is minimal. Sera should not be left to stand in AutoAnalyzer cups at room temperature for longer than three hours before analysis.

  5. Infant Nutrition: Drinking from a Cup, Eating from a Spoon.

    ERIC Educational Resources Information Center

    Texas Child Care, 1994


    Discusses the developmental stages of infants' and children's eating habits. Provides directions for introducing cup and spoon to babies and for making homemade infant foods. Includes information on breast feeding and how child caregivers can support breast-feeding mothers. (HTH)

  6. Technology. The Hot Cup Caper. Probing for Scientific Knowledge.

    ERIC Educational Resources Information Center

    Ramondetta, June


    Students can explore temperature and heat conductivity by examining materials that make good cups for hot cocoa. Using temperature probes from computer-based science packages, students can measure gradual change in the liquid's temperature, watch as data are plotted on the computer, and explain why they chose a specific material. (SM)

  7. NASCAR Winston Cup Race Results for 1975-2003

    ERIC Educational Resources Information Center

    Winner, Larry


    Stock car racing has seen tremendous growth in popularity in recent years. We introduce two datasets containing results from all Winston Cup races between 1975 and 2003, inclusive. Students can use any number of statistical methods and applications of basic probability on the data to answer a wide range of practical questions. Instructors and…

  8. Suction Cup Sampler Bias in Leaching Characterization of an Undisturbed Field Soil

    NASA Astrophysics Data System (ADS)

    Brandi-Dohrn, Florian M.; Dick, Richard P.; Hess, Mario; Selker, John S.


    An accurate assessment of leaching losses in the vadose zone requires measurement of both solute and water flux to compute flux concentrations (CF). Leachate collected at a depth of 1.2 m in 32 passive capillary samplers (PCAPS), which sample soil-pore water continuously at tensions of 0-50 cm H2O was compared to that collected in 32 suction cup samplers operated under a falling head vacuum of 530-cm H2O over a 2-year period. There was evidence that PCAPS collected CF and suction cup samplers collected resident concentrations (CR) as shown by the earlier breakthrough of a bromide tracer in the PCAPS as compared to the suction cup samplers. CR was up to 100% lower than CF during the rising branch of Br tracer breakthrough and up to 78% greater during the declining branch of breakthrough. Br content and water flux into PCAPS were correlated with correlation coefficients changing from positive to negative values with the advancement of the tracer breakthrough peak through the profile indicating the declining importance of preferential flow on Br transport. CR and CF differed significantly (P < 0.05) for 35% of the sampling events for NO3, but seasonal means were mostly insignificantly different for this regularly applied and therefore more uniformly distributed anion. The early breakthrough of Rhodamine WT and Brilliant Blue FCF, which was applied with the Br, was very low with 0.15% and 0.08% of the initial concentration C0, respectively, with CR differing from CF by up to -100%. For all tracers, mass leached using CR is therefore prone to bias for short-term (<0.6 pore volumes) monitoring.

  9. Football injuries during the 2014 FIFA World Cup

    PubMed Central

    Junge, Astrid; Dvořák, Jiri


    Background FIFA has surveyed match injuries in its tournaments since 1998. Aim To analyse the incidence and characteristics of match injuries incurred during the 2014 FIFA World Cup in comparison to previous FIFA World Cups. Methods The chief physicians of the participating teams reported all newly incurred injuries of their players after the match on a standardised report form. 124 (97%) forms were returned. Results A total of 104 injuries were reported, equivalent to an incidence of 1.68 injuries per match (95% CI 1.36 to 2.00). 64 (63.4%) injuries were caused by contact with another player. Thigh (26; 25%) and head (19; 18%) were the most frequently injured body parts. The most frequent diagnosis was thigh strain (n=18). Five concussions and three fractures to the head were reported. While most thigh strains (15/17; 88.2%) occurred without contact, almost all head injuries (18/19; 94.7%) were caused by contact. 0.97 injuries per match (95% CI 0.72 to 1.22) were expected to result in absence from training or match. Eight injuries were classified as severe. The incidence of match injuries in the 2014 FIFA World Cup was significantly lower than the average of the four preceding FIFA World Cups, both for all injuries (2.34; 95% CI 2.15 to 2.53) and time-loss injuries (1.51; 95% CI 1.37 to 1.65). Conclusions The overall incidence of injury during the FIFA World Cups decreased from 2002 to 2014 by 37%. A detailed analysis of the injury mechanism is recommended to further improve prevention strategies. PMID:25878077

  10. Histogram-driven cupping correction (HDCC) in CT

    NASA Astrophysics Data System (ADS)

    Kyriakou, Y.; Meyer, M.; Lapp, R.; Kalender, W. A.


    Typical cupping correction methods are pre-processing methods which require either pre-calibration measurements or simulations of standard objects to approximate and correct for beam hardening and scatter. Some of them require the knowledge of spectra, detector characteristics, etc. The aim of this work was to develop a practical histogram-driven cupping correction (HDCC) method to post-process the reconstructed images. We use a polynomial representation of the raw-data generated by forward projection of the reconstructed images; forward and backprojection are performed on graphics processing units (GPU). The coefficients of the polynomial are optimized using a simplex minimization of the joint entropy of the CT image and its gradient. The algorithm was evaluated using simulations and measurements of homogeneous and inhomogeneous phantoms. For the measurements a C-arm flat-detector CT (FD-CT) system with a 30×40 cm2 detector, a kilovoltage on board imager (radiation therapy simulator) and a micro-CT system were used. The algorithm reduced cupping artifacts both in simulations and measurements using a fourth-order polynomial and was in good agreement to the reference. The minimization algorithm required less than 70 iterations to adjust the coefficients only performing a linear combination of basis images, thus executing without time consuming operations. HDCC reduced cupping artifacts without the necessity of pre-calibration or other scan information enabling a retrospective improvement of CT image homogeneity. However, the method can work with other cupping correction algorithms or in a calibration manner, as well.

  11. Extremely high fracture rate of a modular acetabular component with a sandwich polyethylene ceramic insertion for THA: a preliminary report.


    Kircher, Jörn; Bader, Rainer; Schroeder, Bettina; Mittelmeier, Wolfram


    Improvements of ceramic components and design changes have reduced failure rates over the past 30 years in total hip arthroplasty. We present a series of n = 11 cases with ceramic failure out of n = 113 implantations, from which n = 66 were ceramic-on-ceramic (n = 50 with ceramic insert with sandwich in polyethylene and n = 16 with directly fixed ceramic inlay) and n = 47 ceramic on polyethylene bearings, between 1999 and 2001 after introduction of a new implantation system to the market. The overall fracture rate of ceramic for the whole series (n = 113) was 9.7%. For the combination ceramic head with UHMW-PE (n = 47) the fracture rate was 2.1%. For the combination ceramic with ceramic (n = 66) the fracture rate was 15.2%. For the combination ceramic with ceramic sandwich in PE (n = 50) the failure rate was 18%. Only three patients experienced a trauma. Demography of patients (age, gender, body weight and BMI) was not statistically different between patients with failed ceramics and the rest of the patients making patient-specific risk factors unlikely to be an explanation for the failures. Retrospective X-ray analysis of the cup positioning did not show significant difference between failed and non-failed implants in terms of mean cup inclination and version making also operation-specific factors unlikely to be the only reason of this high failure rate. Therefore, manufacturer-specific factors such as design features may have contributed to this high failure rate. Further analysis of the whole series with biomechanical testing of the retrieved material needs to be performed. PMID:18568354

  12. Usefulness of Arthroscopic Treatment of Painful Hip after Acetabular Fracture or Hip Dislocation

    PubMed Central

    Hwang, Jung-Taek; Lee, Woo-Yong; Kang, Chan; Kim, Dong-Yeol; Zheng, Long


    Background Painful hip following hip dislocation or acetabular fracture can be an important signal for early degeneration and progression to osteoarthritis due to intraarticular pathology. However, there is limited literature discussing the use of arthroscopy for the treatment of painful hip. The purpose of this retrospective study was to analyze the effectiveness and benefit of arthroscopic treatment for patients with a painful hip after major trauma. Methods From July 2003 to February 2013, we reviewed 13 patients who underwent arthroscopic treatment after acetabular fracture or hip dislocation and were followed up for a minimum of 2 postoperative years. The degree of osteoarthritis based on the Tonnis classification pre- and postoperatively at final follow-up was determined. Clinical outcomes were evaluated using visual analogue scale for pain (VAS) and modified Harris hip score (MHHS), and range of motion (ROM) of the hip pre- and postoperatively at final follow-up. Results There were nine male and four female patients with a mean age at surgery of 28 years (range, 20 to 50 years). The mean follow-up period of the patients was 59.8 months (range, 24 to 115 months), and the mean interval between initial trauma and arthroscopic treatment was 40.8 months (range, 1 to 144 months). At the final follow-up, VAS and MHHS improved significantly from 6.3 and 53.4 to 3.0 and 88.3, respectively (p = 0.002 and p < 0.001, respectively). However, there were no significant differences in hip flexion, abduction, adduction, external rotation, and internal rotation as minor improvements from 113.1°, 38.5°, 28.5°, 36.5°, and 22.7° to 118.5°, 39.0°, 29.2°, 38.9°, and 26.5° were observed, respectively (p = 0.070, p = 0.414, p = 0.317, p = 0.084, and p = 0.136, respectively). None of the patients exhibited progression of osteoarthritis of the hip at the final follow-up. Conclusions Arthroscopic treatment after acetabular fracture or hip dislocation is effective and delays

  13. A confirmed case of toxic shock syndrome associated with the use of a menstrual cup

    PubMed Central

    Mitchell, Michael A; Bisch, Steve; Arntfield, Shannon; Hosseini-Moghaddam, Seyed M


    Menstrual cups have been reported to be an acceptable substitute for tampons. These flexible cups have also been reported to provide a sustainable solution to menstrual management, with modest cost savings and no significant health risk. The present article documents the first case of toxic shock syndrome associated with the use of a menstrual cup in a woman 37 years of age, using a menstrual cup for the first time. Toxic shock syndrome and the literature on menstrual cups is reviewed and a possible mechanism for the development of toxic shock syndrome in the patient is described. PMID:26361491

  14. Polyethylene sterilized without irradiation in a polished uncemented acetabular component-a clinical and radiographic analysis.


    Crockarell, John R


    Clinical and radiographic analysis of the Reflection uncemented acetabular component was performed. Features of this component include a polished inner shell and ethylene oxide sterilization. Clinical information was available for 158 hips (mean, 4.6 years follow-up). A total of 19 hips have undergone or were recommended revision, 8 for aseptic loosening or wear (5%). Wear analysis was performed for 38 hips with more than 5 years of follow-up (mean, 6.7 years). Osteolysis was present in 20 of these patients. Penetration rate averaged 0.15 mm/y. Patients with uncemented femoral fixation (vs cemented) had a significantly higher penetration rate. Increased volumetric wear was seen with uncemented femoral fixation, thin liners, and ceramic heads. This component demonstrated relatively high penetration and osteolysis rates. Continued surveillance is recommended, particularly for active patients with thin liners. PMID:18534518

  15. A feasibility study into the use of three-dimensional printer modelling in acetabular fracture surgery.


    Yu, A W; Duncan, J M; Daurka, J S; Lewis, A; Cobb, J


    There are a number of challenges associated with the operative treatment of acetabular fractures. The approach used is often extensive, while operative time and perioperative blood loss can also be significant. With the proliferation of 3D printer technology, we present a fast and economical way to aid the operative planning of complex fractures. We used augmented stereoscopic 3D CT reconstructions to allow for an appreciation of the normal 3D anatomy of the pelvis on the fractured side and to use the models for subsequent intraoperative contouring of pelvic reconstruction plates. This leads to a reduction in the associated soft tissue trauma, reduced intraoperative time and blood loss, minimal handling of the plate, and reduced fluoroscopic screening times. We feel that the use of this technology to customize implants, plates, and the operative procedure to a patient's unique anatomy can only lead to improved outcomes.

  16. Association of oestrogen receptor gene polymorphism with the long-term results of rotational acetabular osteotomy.


    Yamanaka, Makoto; Ishijima, Muneaki; Tokita, Akifumi; Sakamoto, Yuko; Kaneko, Haruka; Maezawa, Katsuhiko; Nozawa, Masahiko; Kurosawa, Hisashi


    Acetabular dysplasia (AD) contributes to the development of osteoarthritis of the hip. A rotational acetabular osteotomy (RAO) is one of the methods of pelvic osteotomy to prevent or treat secondary osteoarthritis of the hip. Although most of the patients that undergo RAO show satisfactory results, some have poor results. This study investigated whether gene polymorphisms of both the vitamin D receptor (VDR) and oestrogen receptor (ER) are involved in both AD and the postoperative results following RAOs. Sixty-four Japanese patients with AD who were treated by an RAO were enrolled in this study (59 women and 5 men, aged 13-59, with an average age of 40.3). Gene polymorphisms of the VDR [ApaI and TaqI restriction fragment length polymorphisms (RFLPs)] and ER (PvuII and XbaI RFLPs) were determined in these patients. The relationship between both the AD and radiographic postoperative changes of the hip joint after an RAO with these gene polymorphisms were examined. The frequencies of ER gene polymorphism coded as pp (RFLP/PvuII) in patients with AD were statistically significantly different (p = .011) from those coded as both PP and Pp. The joint space width narrowed even after RAO in 90% of the patients with the pp gene polymorphism, while it narrowed in only 35% of the patients with either PP or Pp seven years or longer after an RAO. The PvuII polymorphism in the ER gene was associated with the postoperative result of an RAO, while no association was observed between the AD with VDR and ER gene polymorphisms.

  17. Indomethacin versus radiation therapy for prophylaxis against heterotopic ossification in acetabular fractures: a randomised, prospective study.


    Moore, K D; Goss, K; Anglen, J O


    We report a prospective, randomised, blinded clinical comparison of the use of indomethacin or radiation therapy for the prevention of heterotopic ossification (HO) in 75 adults who had open reduction and internal fixation of acetabular fractures through either a Kocher-Langenbeck, a combined ilioinguinal and Kocher-Langenbeck, or an extended iliofemoral approach. Indomethacin, 25 mg, was given three times daily for six weeks. Radiation with 800 cGy was delivered within three days of operation. Plain radiographs were reviewed and given Brooker classification scores by three independent observers who were unaware of the method of prophylaxis. One patient died from unrelated causes and two were lost to follow-up, leaving 72, 33 in the radiation group and 39 in the indomethacin group, available for evaluation at a mean of 12 months (6 to 48). There was no significant difference in the two groups in terms of age, gender, injury severity score, estimated blood loss, delay to surgery, head injury, presence of femoral head dislocation, or operating time, and no complications due to either method of treatment. The final extent of HO was already present by six weeks in all patients who were followed up. Three patients in the radiation group and five who received indomethacin developed HO of Brooker grade III. Two patients in the indomethacin group developed Brooker IV changes; both had failed to receive proper doses of the drug. Cochran-Armitage analysis showed no significant difference between the two treatment groups as regards the formation of HO. Indomethacin and single-dose radiation therapy are both safe and effective for the prevention of HO after operation for acetabular fractures. Radiation therapy is, however, approximately 200 times more expensive than indomethacin therapy at our institution and has other risks.

  18. Prophylactic radiotherapy against heterotopic ossification following internal fixation of acetabular fractures: a comparative estimate of risk

    PubMed Central

    Nasr, P; Yip, G; Scaife, J E; House, T; Thomas, S J; Harris, F; Owen, P J; Hull, P


    Objective: Radiotherapy (RT) is effective in preventing heterotopic ossification (HO) around acetabular fractures requiring surgical reconstruction. We audited outcomes and estimated risks from RT prophylaxis, and alternatives of indometacin or no prophylaxis. Methods: 34 patients underwent reconstruction of acetabular fractures through a posterior approach, followed by a 8-Gy single fraction. The mean age was 44 years. The mean time from surgery to RT was 1.1 days. The major RT risk is radiation-induced fatal cancer. The International Commission on Radiological Protection (ICRP) method was used to estimate risk, and compared with a method (Trott and Kemprad) specifically for estimating RT risk for benign disease. These were compared with risks associated with indometacin and no prophylaxis. Results: 28 patients (82%) developed no HO; 6 developed Brooker Class I; and none developed Class II–IV HO. The ICRP method suggests a risk of fatal cancer in the range of 1 in 1000 to 1 in 10,000; the Trott and Kemprad method suggests 1 in 3000. For younger patients, this may rise to 1 in 2000; and for elderly patients, it may fall to 1 in 6000. The risk of death from gastric bleeding or perforation from indometacin is 1 in 180 to 1 in 900 in older patients. Without prophylaxis risk of death from reoperation to remove HO is 1 in 4000 to 1 in 30,000. Conclusion: These results are encouraging, consistent with much larger series and endorse our multidisciplinary management. Risk estimates can be used in discussion with patients. Advances in knowledge: The risk from RT prophylaxis is small, it is safer than indometacin and substantially overlaps with the range for no prophylaxis. PMID:25089852

  19. A double mobility acetabular implant for primary hip arthroplasty in patients at high risk of dislocation

    PubMed Central

    Middleton, RG; Young, P; Uzoigwe, C; Barkham, B; Yusoff, S; Minhas, THA


    Introduction Dislocation following total hip replacement continues to be a problem for which no completely satisfactory solution has been found. Several methods have been proposed to reduce the incidence of hip dislocations with varying degrees of success, including elevated rim liners, constrained liners and large diameter bearings. We present our experience with the double mobility acetabular component in patients at high risk of instability. Methods This was a retrospective review of 65 primary total hip arthroplasties in 55 patients (15 men, 40 women), performed between October 2005 and November 2009. The majority (80%) of patients had at least two and 26% had at least three risk factors for instability. The mean age was 76 years (range: 44–92 years). The patients were followed up for a mean duration of 60 months (range: 36–85 months). Results Fourteen patients died and one was lost to follow-up, leaving fifty hips for final assessment. Until the final follow-up appointment, no patients had dislocation and none required revision surgery. The mean Oxford hip score improved from 45.0 to 26.5 (p<0.0001). The mean Merle d’Aubigné pain score improved from 1.4 to 4.9 (p<0.0001), the walking score from 2.3 to 3.1 (p<0.07) and the absolute hip function score from 5.4 to 10.8 (p<0.0001). There were no clinical or radiographic signs of loosening. Conclusions The double mobility acetabular component was successful at preventing dislocation during early to medium-term follow-up. However, as data are still lacking with regard to polyethylene wear rates at the additional bearing surface, it would be prudent to restrict the use of this implant to selected patients at high risk of instability. PMID:25350182

  20. Measurement of lateral acetabular coverage: a comparison between CT and plain radiography

    PubMed Central

    Chadayammuri, Vivek; Garabekyan, Tigran; Jesse, Mary-Kristen; Pascual-Garrido, Cecilia; Strickland, Colin; Milligan, Kenneth; Mei-Dan, Omer


    We prospectively evaluated the degree of absolute agreement between measurements of lateral center-edge angle (LCEA) on plain radiography (XR) and computed tomography (CT) in a consecutive cohort of 205 patients (410 hips) undergoing hip arthroscopy. Preoperative measurements of the LCEA were performed bilaterally utilizing standardized anteroposterior radiographs and coronal reformatted CT scans. Demographic variables including age, gender, height, weight, BMI and clinical diagnosis were recorded for all patients. Overall, measured values of the LCEA were 2.1° larger on CT compared with XR (32.9° versus 30.8°, P < 0.001). Subgroup analysis revealed the highest mean difference in hips with acetabular dysplasia and concomitant cam-type femoroacetabular impingement (FAI) [mean difference (CT–XR) 5.5°, 95% confidence interval (CI) 3.7°–7.3°, P = 0.011], followed by hips with isolated acetabular dysplasia (mean difference [CT–XR] 4.9°, 95% CI 2.7°–7.0°, P < 0.001). In contrast, 119 (29.0%) of the hips demonstrated larger measurements of the LCEA on 25 XR relative to CT. Of these hips, 20 (16.8%) had pincer-FAI and 25 had cam-FAI (21.0%), representing a significantly higher proportion compared with all other clinical subgroups (P = 0.045 and 0.036, respectively). Our study demonstrates measured values of the LCEA are consistently inflated on CT relative to XR for a wide variety of hip pathologies, highlighting the need for standardization and validation of CT-based measurements to improve the quality of clinical decision making. Level of Evidence: Diagnostic Level II. PMID:27011864

  1. Socket and cup surface replacement of the hip.


    Nishio, A; Eguchi, M; Kaibara, N


    To improve the surgical results of severe osteoarthritis of the hip, surface replacement of the hip using a double cup without cement was employed on 75 hips during the period from 1972 to 1977. The results of the procedures have been analyzed on 67 hips followed for more than 6 months. The most dramatic improvement following the procedure has been pain relief, observed in 58 of 67 hips (86%). Three reoperations were necessary. Failures were treated satisfactorily either by total hip replacement, or by arthrodesis and/or by placing a new cup on the head respectively. There was no operative death, pulmonary embolism, thrombophlebitis, nor deep infection. We do not think this procedure replaces more definitive surgery such as the Charnley-type total hip replacement, but it is a good adjunctive procedure particularly in patients younger than 60 years of age.

  2. A new approach for miniaturization of multiple faraday cup collectors.

    SciTech Connect

    Banar, J. C.; Chamberlin, E. P.; Poths, J.; Perrin, R. E.; Chastagner, P.


    The mass spectrometry section in CST-7 has been working for several years on a novel so0lution to overcome the size and placement restrictions of multiple Faraday cup collectors. Use of simultaneous collection of multiple isotopes both increases precision in the isotopic measurements and shortens the data collection time. Our application is for the measurement of the isotopic composition of Xe, ionized in a source that produces a large (10{sup -11} amp) but variable ion beam.

  3. Acetabular revision with impaction bone grafting and a cemented polyethylene acetabular component: comparison of the Kaplan-Meier analysis to the competing risk analysis in 62 revisions with 25 to 30 years follow-up.


    Te Stroet, M A J; Keurentjes, J C; Rijnen, W H C; Gardeniers, J W M; Verdonschot, N; Slooff, T J J H; Schreurs, B W


    We present the results of 62 consecutive acetabular revisions using impaction bone grafting and a cemented polyethylene acetabular component in 58 patients (13 men and 45 women) after a mean follow-up of 27 years (25 to 30). All patients were prospectively followed. The mean age at revision was 59.2 years (23 to 82). We performed Kaplan-Meier (KM) analysis and also a Competing Risk (CR) analysis because with long-term follow-up, the presence of a competing event (i.e. death) prevents the occurrence of the endpoint of re-revision. A total of 48 patients (52 hips) had died or had been re-revised at final review in March 2011. None of the deaths were related to the surgery. The mean Harris hip score of the ten surviving hips in ten patients was 76 points (45 to 99). The KM survivorship at 25 years for the endpoint 're-revision for any reason' was 58.0% (95% confidence interval (CI) 38 to 73) and for 're-revision for aseptic loosening' 72.1% (95% CI 51 to 85). With the CR analysis we calculated the KM analysis overestimates the failure rate with respectively 74% and 93% for these endpoints. The current study shows that acetabular impaction bone grafting revisions provide good clinical results at over 25 years.

  4. NOE distance and dihedral angle restraints to calculate the solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus

    PubMed Central

    Korste, Annika; Wulfhorst, Hannes; Ikegami, Takahisa; Nowaczyk, Marc M.; Stoll, Raphael


    Here, we have compiled a nuclear magnetic resonance (NMR)-derived set of nuclear Overhauser enhancement (NOE) distance and dihedral angle restraints that allow for the calculation of the structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus in solution. These restraints to calculate the structure in solution of CupS have been deposited to the Protein Data Bank ( under PDB-ID accession number 2MXA. This is the first experimental data set published to compute the three-dimensional structure of CupS. This structure is presented in the research article “Solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus” published by Korste et al. in Biochim. Biophys. Acta 1847(2015)1212–1219 [1]. The cyanobacterial multi-subunit membrane protein complex NDH-1 structurally and functionally relates to Complex I of eubacteria and mitochondria. The NDH-1 complex is mechanistically involved in respiration and cyclic electron transfer around photosystem I (PSI) as well as in a unique mechanism for inorganic carbon concentration. PMID:26862566

  5. From Tonic-cups to Bitter-cups: Kwasi bita beker from Suriname Determination, past and present use of an ancient galenic artefact.


    Odonne, G; Bourdy, G; Beauchêne, J; Houël, E; Stien, D; Chevolot, L; Deharo, E


    In the main markets of Paramaribo (Suriname), many stands offer what is locally called "Bitter-cups", or "Kwasi bita beker", small footed-cups, roughly carved from a whitish wood. The use of these cups is strictly medicinal and it seems to be restricted to Suriname, as they are not found in neighbouring countries (Guyana, French Guiana). The aim of this study was to identify the botanical origin of Bitter-cups still in use in the Saramaka traditional medicine (as information from field people was controversial), and document the ethnopharmacology of this original galenical artefact. Microscopic and high performance liquid chromatography (HPLC) analyses were carried out on Bitter-cup, and anatomical criteria (marginal parenchyma band, size of intervessel and vessel-ray pits, rays width and rays composition, vessels clustering, frequency and size of parenchyma pits) together with HPLC profiles of the macerates showed that the wood cup was similar to Quassia amara L. (Simaroubaceae) wood. Ethnopharmacological investigation indicates that the use of these cups is simply due to the pharmacological properties attributed to "bitters", and is strongly linked to tradition and cultural attitudes. This study also emphasizes the long lasting use of these cups, now restricted to Suriname only, with almost no variation over one century.

  6. Technology development for the Solar Probe Plus Faraday Cup

    NASA Astrophysics Data System (ADS)

    Freeman, Mark D.; Kasper, Justin; Case, Anthony W.; Daigneau, Peter; Gauron, Thomas; Bookbinder, Jay; Brodu, Étienne; Balat-Pichelin, Marianne; Wright, Kenneth


    The upcoming Solar Probe Plus (SPP) mission requires novel approaches for in-situ plasma instrument design. SPP's Solar Probe Cup (SPC) instrument will, as part of the Solar Wind Electrons, Alphas, and Protons (SWEAP) instrument suite, operate over an enormous range of temperatures, yet must still accurately measure currents below 1 pico-amp, and with modest power requirements. This paper discusses some of the key technology development aspects of the SPC, a Faraday Cup and one of the few instruments on SPP that is directly exposed to the solar disk, where at closest approach to the Sun (less than 10 solar radii (Rs) from the center of the Sun) the intensity is greater than 475 earth-suns. These challenges range from materials characterization at temperatures in excess of 1400°C to thermal modeling of the behavior of the materials and their interactions at these temperatures. We discuss the trades that have resulted in the material selection for the current design of the Faraday Cup. Specific challenges include the material selection and mechanical design of insulators, particularly for the high-voltage (up to 8 kV) grid and coaxial supply line, and thermo-optical techniques to minimize temperatures in the SPC, with the specific intent of demonstrating Technology Readiness Level 6 by the end of 2013.

  7. Design and characterization of a versatile Faraday cup

    NASA Astrophysics Data System (ADS)

    Seamans, J. F.; Kimura, W. D.


    The design and characterization of a Faraday cup utilizing modular components are presented. Design specifications were primarily tailored to satisfy the specific electron beam (e-beam) energy (˜375 keV), rise time (˜60 ns), and magnitude (30 A/cm2, peak) used in this work and permit convenient sampling of large e-beam areas up to 7 cm×7 cm. Characterization during evacuated conditions included Z-dependence measurements using beryllium, carbon, aluminum, and lead collector plates. Electron beam transmission measurements were made utilizing combinations of various metal screens and Kapton foils in both gas and evacuated conditions. Gas environments tested were air, krypton, and a Kr/Ar mixture. An attacher gas, SF6, was also added inside the Faraday cup. Results reveal decreasing current densities with increasing gas stopping power and increasing electron propagation distance in a gas. Employing a carbon collector plate and a 25-μm Kapton foil insulator, current densities measured through a 3.6-cm thick 760 Torr air slab are reduced ≤6% from the evacuated Kapton-free condition. Applying profile and full-aperture Faraday cup measurements, a consistent description of the e-beam is also presented.

  8. 'Cup cell disease' in the colonial tunicate Botryllus schlosseri.


    Moiseeva, Elisabeth; Rabinowitz, Claudette; Yankelevich, Irena; Rinkevich, Baruch


    A new progressive, fatal disease called 'cup cell disease' was characterized in ex situ cultures of Botryllus schlosseri, a colonial tunicate. The disease originated as a few dark spots growing within zooids. The infected colonies then started to deteriorate, morphologically diagnosed by ampullar retraction, lethargic blood circulation and by a swollen and soft tunic matrix. In later stages of the disease, developed buds were also affected. Many large black dots were scattered within the tunic matrix, and zooids were transformed to opaque, dilated, sac-like structures, signaling impending death. Colonies were infected periodically, even without direct tissue contact. The time course from first appearance to colony death ranged between 30 and 45 d. Histological studies, in vitro culturing of blood cells and blood smears revealed the existence of numerous cup-like cells (up to 4.8 microm diameter on average) with a yellowish cell wall and transparent cytoplasm that was not stained by various dyes (except azocarmine-G). Cells were refractive under bright-field illumination and revealed a flattened wall with flanges, characteristic of species of the phylum Haplosporidia. Cup cells aggregated in blood vessels and in internal parts of zooids and buds and were phagocytosed by blood cells. In a single case, plasmodia-like structures were found only in the tunic matrix of an infected colony. This is the first record in botryllid ascidians of an infectious lethal disease associated with haplosporidian protists.

  9. Oxidative unzipping of stacked nitrogen-doped carbon nanotube cups.


    Dong, Haifeng; Zhao, Yong; Tang, Yifan; Burkert, Seth C; Star, Alexander


    We demonstrate a facile synthesis of different nanostructures by oxidative unzipping of stacked nitrogen-doped carbon nanotube cups (NCNCs). Depending on the initial number of stacked-cup segments, this method can yield graphene nanosheets (GNSs) or hybrid nanostructures comprised of graphene nanoribbons partially unzipped from a central nanotube core. Due to the stacked-cup structure of as-synthesized NCNCs, preventing complete exposure of graphitic planes, the unzipping mechanism is hindered, resulting in incomplete unzipping; however, individual, separated NCNCs are completely unzipped, yielding individual nitrogen-doped GNSs. Graphene-based materials have been employed as electrocatalysts for many important chemical reactions, and it has been proposed that increasing the reactive edges results in more efficient electrocatalysis. In this paper, we apply these graphene conjugates as electrocatalysts for the oxygen reduction reaction (ORR) to determine how the increase in reactive edges affects the electrocatalytic activity. This investigation introduces a new method for the improvement of ORR electrocatalysts by using nitrogen dopants more effectively, allowing for enhanced ORR performance with lower overall nitrogen content. Additionally, the GNSs were functionalized with gold nanoparticles (GNPs), resulting in a GNS/GNP hybrid, which shows efficient surface-enhanced Raman scattering and expands the scope of its application in advanced device fabrication and biosensing.

  10. Treatment of postoperative sciatic nerve palsy after total hip arthroplasty for postoperative acetabular fracture: A case report.


    Kanda, Akio; Kaneko, Kazuo; Obayashi, Osamu; Mogami, Atsuhiko; Morohashi, Itaru


    Acetabular fracture is usually treated with osteosynthesis. However, in the case of an intra-articular fracture, osteosynthesis can result in arthropathy of the hip joint and poor long-term results, hence, total hip arthroplasty is required. However, in total hip arthroplasty for postoperative acetabular fracture, sciatic nerve palsy tends to develop more commonly than after primary total hip arthroplasty. This is a case report of a 57-year-old Japanese male who had internal skeletal fixation for a left acetabular fracture that had occurred 2 years earlier. One year later, he developed coxarthrosis and severe pain of the hip joint and total hip arthroplasty was performed. After the second surgery, he experienced pain along the distribution of the sciatic nerve and weakness of the muscles innervated by the peroneal nerve, indicating sciatic nerve palsy. We performed a third operation, and divided adhesions around the sciatic nerve. Postoperatively, the anterior hip joint pain and the buttocks pain when the hip was flexed were improved. Abduction of the fifth toe was also improved. However, the footdrop and sensory disturbance were not improved. A year after the third operation, sensory disturbance was slightly improved but the footdrop was not improved. We believe the sciatic nerve palsy developed when we dislocated the hip joint as the sciatic nerve was excessively extended as the hip joint flexed and internally rotated. Sciatic nerve adhesion can occur easily in total hip replacement for postoperative acetabular fracture; hence, adhesiotomy should be conducted before performing hip dislocation to prevent injury caused by nerve tension. The patient agreed that the details of this case could be submitted for publication. The work has been reported in line with the CARE criteria and cite. PMID:27672438

  11. Study of the three-dimensional orientation of the labrum: its relations with the osseous acetabular rim

    PubMed Central

    Bonneau, Noémie; Bouhallier, July; Baylac, Michel; Tardieu, Christine; Gagey, Olivier


    Understanding the three-dimensional orientation of the coxo-femoral joint remains a challenge as an accurate three-dimensional orientation ensure an efficient bipedal gait and posture. The quantification of the orientation of the acetabulum can be performed using the three-dimensional axis perpendicular to the plane that passes along the edge of the acetabular rim. However, the acetabular rim is not regular as an important indentation in the anterior rim was observed. An innovative cadaver study of the labrum was developed to shed light on the proper quantification of the three-dimensional orientation of the acetabulum. Dissections on 17 non-embalmed corpses were performed. Our results suggest that the acetabular rim is better represented by an anterior plane and a posterior plane rather than a single plane along the entire rim as it is currently assumed. The development of the socket from the Y-shaped cartilage was suggested to explain the different orientations in these anterior and posterior planes. The labrum forms a plane that takes an orientation in between the anterior and posterior parts of the acetabular rim, filling up inequalities of the bony rim. The vectors VL, VA2 and VP, representing the three-dimensional orientation of the labrum, the anterior rim and the posterior rim, are situated in a unique plane that appears biomechanically dependent. The three-dimensional orientation of the acetabulum is a fundamental parameter to understand the hip joint mechanism. Important applications for hip surgery and rehabilitation, as well as for physical anthropology, were discussed. PMID:22360458

  12. An Effective and Feasible Method, “Hammering Technique,” for Percutaneous Fixation of Anterior Column Acetabular Fracture

    PubMed Central

    Zhang, Lihai; Zhang, Wei; Li, Tongtong; Li, Jiantao; Chen, Hua


    Objective. The objective of this study was to evaluate the effectiveness and advantages of percutaneous fixation of anterior column acetabular fracture with “hammering technique.” Materials and Methods. We retrospectively reviewed 16 patients with percutaneous fixation of anterior column acetabular fracture with “hammering technique.” There were 11 males and 5 females with an average age of 38.88 years (range: 24–54 years) in our study. Our study included 7 nondisplaced fractures, 6 mild displaced fractures (<2 mm), and 5 displaced fractures (>2 mm). The mean time from injury to surgery was 4.5 days (range: 2–7 days). Results. The average of operation time was 27.56 minutes (range: 15–45 minutes), and the mean blood loss was 55.28 mL (range: 15–100 mL). The mean fluoroscopic time was 54.78 seconds (range: 40–77 seconds). The first pass of the guide wire was acceptable without cortical perforation or intra-articular perforation in 88.89% (16/18) of the procedures, and the second attempt was in 11.11% (2/18). Conclusion. Our study suggested that percutaneous fixation of anterior column acetabular fracture with “hammering technique” acquired satisfying surgical and clinical outcomes. It may be an alternative satisfying treatment for percutaneous fixation of anterior column acetabular fracture by 2D fluoroscopy using a C-arm with less fluoroscopic time. PMID:27493962

  13. Temporal and spatial distributions of directional counterface motion at the acetabular bearing surface in total hip arthroplasty.

    PubMed Central

    Pedersen, D. R.; Brown, T. D.; Maxian, T. A.; Callaghan, J. J.


    The motions of counterface articulation against the bearing surface of the acetabular liner strongly influence polyethylene wear debris production in contemporary total hip arthroplasty. However, the available body of relevant articular force and motion information is largely confined to resultant load excursions measured relative to instrumented femoral components, and/or to global angular motions (flexion, adduction, endorotation) of the joint. Analytical frameworks are here developed to transform such information into temporal and spatial variations of the resultant load and of the local counterface sliding velocity relative to an ordered set of discrete locations (e.g., finite element nodes) on the acetabular bearing surface. Whole-duty-cycle time histories of acetabular resultant load and counterface velocity distributions are presented for two important practical situations: human level walking gait, and a 23 degrees biaxial rocking hip simulation machine. The local counterface motions occurring in the simulator are characterized by higher velocities, smoother motion patterns, and wider directional variation than those occurring in human gait. PMID:9807707

  14. Investigation of a cup-shaped ultrasonic transducer operated in the full-wave vibrational mode.


    Xu, Long


    Cup-shaped horn has significant applications in ultrasonic machining, such as continuous bonding of plastic sheet or strips. Generally, it is excited by a sandwich piezoelectric transducer and both together constitute a cup-shaped ultrasound transducer (CUT). To provide a concise theoretical model for its engineering applications, the equivalent circuit of the cup-shaped ultrasonic transducer is deduced and the resonance/anti-resonance frequency equations are obtained. Meanwhile, the vibrational characteristics of the cup-shaped ultrasonic transducer have been investigated by using the analytical and numerical methods, and then confirmed by the experiment. The results show that the cup-shaped horn has a distinctive equivalent circuit, and the cup-shaped ultrasonic transducer has a good vibrational performance.

  15. Slit disk for modified faraday cup diagnostic for determining power density of electron and ion beams


    Teruya, Alan T.; Elmer; John W.; Palmer, Todd A.


    A diagnostic system for characterization of an electron beam or an ion beam includes an electrical conducting disk of refractory material having a circumference, a center, and a Faraday cup assembly positioned to receive the electron beam or ion beam. At least one slit in the disk provides diagnostic characterization of the electron beam or ion beam. The at least one slit is located between the circumference and the center of the disk and includes a radial portion that is in radial alignment with the center and a portion that deviates from radial alignment with the center. The electron beam or ion beam is directed onto the disk and translated to the at least one slit wherein the electron beam or ion beam enters the at least one slit for providing diagnostic characterization of the electron beam or ion beam.

  16. Design and Construction of a Fast Ion Loss Faraday Cup Array Diagnostic for JET

    SciTech Connect

    D.S. Darrow; S. Bauumel; F.E. Cecil; V. Kiptily; R. Ellis; L. Pedrick; A. Werner


    A thin foil Faraday cup array is being built to measure the loss of 3.5 MeV alpha particles and MeV ion cyclotron heating (ICH) tail ions on JET. It will consist of nine detectors spread over five different poloidal locations and three radial positions. They will measure the poloidal distribution and radial scrape off of the losses. The detectors will be comprised of four layers of thin (2.5 micron) Ni foil, giving some resolution of the lost particle energy distribution as different ranges of energies will stop in different layers of the detector. One detector will utilize eight thinner (1.0 micron) foils to obtain a better resolved energy distribution. These detectors will accept particles incident up to 45{sup o} from the normal to the foils.

  17. Equally good fixation of cemented and uncemented cups in total trapeziometacarpal joint prostheses

    PubMed Central


    Background and purpose Cup failure is a recognized problem in total trapeziometacarpal (TM) joint prostheses; it may be related to poor fixation, which can be revealed by radiostereometric analysis (RSA). We compared the early implant migration of cemented trapezium cups to that of uncemented screw cups. Patients and methods In a prospective, parallel-group, randomized patient-blinded clinical trial, we included 32 hands in 28 patients (5 males) with a mean age of 58 (40–77) years and with Eaton stage-2 or -3 osteoarthritis of the trapeziometacarpal joint. Patients were randomized to surgery with a cemented DLC all-polyethylene cup (C) (n = 16) or an uncemented hydroxyapatite-coated chrome-cobalt Elektra screw cup (UC) (n = 16). Uncemented cups were inserted without threading of the bone. Stereoradiographs for evaluation of cup migration (primary effect size) and DASH and pain scores were obtained during 2 years of follow-up. Results The 2-year total translation (TT) was similar (p = 0.2): 0.24 mm (SD 0.10) for the C (n = 11) and 0.19 mm (SD 0.16) for the UC (n = 11). Variances were similar (p = 0.4). Judged by RSA, 2 UC cups and 1 C cup became loose (TT > 1 mm). Both UC cups were found to be loose at revision. Grip strength, pain, and DASH scores were similar between groups at all measurement points. Interpretation Early implant fixation and clinical outcome were equally good with both cup designs. This is the first clinical RSA study on trapezium cups, and the method appears to be clinically useful for detection of loose implants. PMID:23343372

  18. Multiple data sets and modelling choices in a comparative LCA of disposable beverage cups.


    van der Harst, Eugenie; Potting, José; Kroeze, Carolien


    This study used multiple data sets and modelling choices in an environmental life cycle assessment (LCA) to compare typical disposable beverage cups made from polystyrene (PS), polylactic acid (PLA; bioplastic) and paper lined with bioplastic (biopaper). Incineration and recycling were considered as waste processing options, and for the PLA and biopaper cup also composting and anaerobic digestion. Multiple data sets and modelling choices were systematically used to calculate average results and the spread in results for each disposable cup in eleven impact categories. The LCA results of all combinations of data sets and modelling choices consistently identify three processes that dominate the environmental impact: (1) production of the cup's basic material (PS, PLA, biopaper), (2) cup manufacturing, and (3) waste processing. The large spread in results for impact categories strongly overlaps among the cups, however, and therefore does not allow a preference for one type of cup material. Comparison of the individual waste treatment options suggests some cautious preferences. The average waste treatment results indicate that recycling is the preferred option for PLA cups, followed by anaerobic digestion and incineration. Recycling is slightly preferred over incineration for the biopaper cups. There is no preferred waste treatment option for the PS cups. Taking into account the spread in waste treatment results for all cups, however, none of these preferences for waste processing options can be justified. The only exception is composting, which is least preferred for both PLA and biopaper cups. Our study illustrates that using multiple data sets and modelling choices can lead to considerable spread in LCA results. This makes comparing products more complex, but the outcomes more robust.

  19. The Cup'ik People of the Western Tundra: A Curriculum.

    ERIC Educational Resources Information Center

    Pingayak, John

    The Cup'ik people are a group of Yup'ik Eskimos who live in southwest Alaska. This curriculum aims to enhance Cup'ik students' interest in their own culture by making that culture a part of their daily activities; to teach students to practice the traditional Cup'ik respect for elders, fellow students, and others in the community; and to teach…

  20. Multiple data sets and modelling choices in a comparative LCA of disposable beverage cups.


    van der Harst, Eugenie; Potting, José; Kroeze, Carolien


    This study used multiple data sets and modelling choices in an environmental life cycle assessment (LCA) to compare typical disposable beverage cups made from polystyrene (PS), polylactic acid (PLA; bioplastic) and paper lined with bioplastic (biopaper). Incineration and recycling were considered as waste processing options, and for the PLA and biopaper cup also composting and anaerobic digestion. Multiple data sets and modelling choices were systematically used to calculate average results and the spread in results for each disposable cup in eleven impact categories. The LCA results of all combinations of data sets and modelling choices consistently identify three processes that dominate the environmental impact: (1) production of the cup's basic material (PS, PLA, biopaper), (2) cup manufacturing, and (3) waste processing. The large spread in results for impact categories strongly overlaps among the cups, however, and therefore does not allow a preference for one type of cup material. Comparison of the individual waste treatment options suggests some cautious preferences. The average waste treatment results indicate that recycling is the preferred option for PLA cups, followed by anaerobic digestion and incineration. Recycling is slightly preferred over incineration for the biopaper cups. There is no preferred waste treatment option for the PS cups. Taking into account the spread in waste treatment results for all cups, however, none of these preferences for waste processing options can be justified. The only exception is composting, which is least preferred for both PLA and biopaper cups. Our study illustrates that using multiple data sets and modelling choices can lead to considerable spread in LCA results. This makes comparing products more complex, but the outcomes more robust. PMID:25037049

  1. Performance of Porous Tantalum vs. Titanium Cup in Total Hip Arthroplasty: Randomized Trial with Minimum 10-Year Follow-Up.


    Wegrzyn, Julien; Kaufman, Kenton R; Hanssen, Arlen D; Lewallen, David G


    Porous tantalum monoblock cups have been proposed to improve survivorship of cementless primary THA. However, there are few direct comparative trials to established implants such as porous-coated titanium cups. 113 patients were randomized into two groups according to the cup: a porous tantalum monoblock cup (TM) or a porous-coated titanium monoblock cup (control). At a mean of 12 years after THA, no implants migrated in both groups. Two TM patients (4%) and 13 control patients (33%) presented with radiolucency around the cup (P<0.001). In the control group, 1 cup (2%) was revised for aseptic loosening. At 12 years post-implantation, porous tantalum monoblock cups demonstrated 100% survivorship, and significantly less radiolucency as compared to porous-coated titanium monoblock cups.

  2. Cupping as a part of living finnish traditional healing. A remedy against pain.


    Hänninen, O; Vaskilampi, T


    Wet cupping appears to be a living reminiscence of the traditional Finnish healing methods. Fifteen persons practicing or having practiced cupping were interviewed in Savo Province, Eastern Finland. The knowledge and skills of cupping appear to be transferred by personal apprenticeship within a family or from a neighbour. No written material is nowadays available and known to be used in learning. Cupping is considered by healers to be useful in the treatment of aching and pains of teeth, head, neck, shoulders, back and legs. Cuppers report cupping effective also in hypertension and skin diseases. On the other hand, the method is not regarded to be useful in problems of internal organs. Cupping is done after a sauna and bathing of the patient in a warm environment (in sauna). It is often preceded by massage. The small wounds in the cupping sites are made with the aid of a small knife. The healers have the opinion that bad blood must be removed from the superficial areas of the ailing parts of the body, The cupping sites were more or less specific to the ailments of the patient and the number of cups varied from patient to patient depending on the condition and size.

  3. Plastic cup traps equipped with light-emitting diodes for monitoring adult Bemisia tabaci (Homoptera: Aleyrodidae).


    Chu, Chang-Chi; Jackson, Charles G; Alexander, Patrick J; Karut, Kamil; Henneberry, Thomas J


    Equipping the standard plastic cup trap, also known as the CC trap, with lime-green light-emitting diodes (LED-plastic cup trap) increased its efficacy for catching Bemisia tabaci by 100%. Few Eretmocerus eremicus Rose and Zolnerowich and Encarsia formosa Gahan were caught in LED-plastic cup traps. The LED-plastic cup traps are less expensive than yellow sticky card traps for monitoring adult whiteflies in greenhouse crop production systems and are more compatible with whitefly parasitoids releases for Bemisia nymph control.

  4. Electroviscous contribution to the rheology of colloidal unimolecular polymer (CUP) particles in water.


    Chen, Minghang; Riddles, Cynthia J; Van De Mark, Michael R


    The rheological characteristics of anionic colloidal unimolecular polymer (CUP) particles in water were investigated. The intrinsic viscosities were determined for CUPs with different molecular weights as a function of volume fraction. The specific viscosities were measured and fit with models considering hydrodynamic interaction and electroviscous effects. The rheological characteristics were consistent with a surface layer of water which increases with the particle size or molecular weight of CUPs. The effective charges on the surface of particle were calculated and correlated with the rheological behavior of the CUP particles from the dilute to semidilute range, a volume fraction of 0.0001-0.08.

  5. A reliability-based particle filter for humanoid robot self-localization in RoboCup Standard Platform League.


    Munera Sánchez, Eduardo; Muñoz Alcobendas, Manuel; Blanes Noguera, Juan Fco; Benet Gilabert, Ginés; Simó Ten, José E


    This paper deals with the problem of humanoid robot localization and proposes a new method for position estimation that has been developed for the RoboCup Standard Platform League environment. Firstly, a complete vision system has been implemented in the Nao robot platform that enables the detection of relevant field markers. The detection of field markers provides some estimation of distances for the current robot position. To reduce errors in these distance measurements, extrinsic and intrinsic camera calibration procedures have been developed and described. To validate the localization algorithm, experiments covering many of the typical situations that arise during RoboCup games have been developed: ranging from degradation in position estimation to total loss of position (due to falls, 'kidnapped robot', or penalization). The self-localization method developed is based on the classical particle filter algorithm. The main contribution of this work is a new particle selection strategy. Our approach reduces the CPU computing time required for each iteration and so eases the limited resource availability problem that is common in robot platforms such as Nao. The experimental results show the quality of the new algorithm in terms of localization and CPU time consumption.

  6. A Reliability-Based Particle Filter for Humanoid Robot Self-Localization in RoboCup Standard Platform League

    PubMed Central

    Sánchez, Eduardo Munera; Alcobendas, Manuel Muñoz; Noguera, Juan Fco. Blanes; Gilabert, Ginés Benet; Simó Ten, José E.


    This paper deals with the problem of humanoid robot localization and proposes a new method for position estimation that has been developed for the RoboCup Standard Platform League environment. Firstly, a complete vision system has been implemented in the Nao robot platform that enables the detection of relevant field markers. The detection of field markers provides some estimation of distances for the current robot position. To reduce errors in these distance measurements, extrinsic and intrinsic camera calibration procedures have been developed and described. To validate the localization algorithm, experiments covering many of the typical situations that arise during RoboCup games have been developed: ranging from degradation in position estimation to total loss of position (due to falls, ‘kidnapped robot’, or penalization). The self-localization method developed is based on the classical particle filter algorithm. The main contribution of this work is a new particle selection strategy. Our approach reduces the CPU computing time required for each iteration and so eases the limited resource availability problem that is common in robot platforms such as Nao. The experimental results show the quality of the new algorithm in terms of localization and CPU time consumption. PMID:24193098

  7. A reliability-based particle filter for humanoid robot self-localization in RoboCup Standard Platform League.


    Munera Sánchez, Eduardo; Muñoz Alcobendas, Manuel; Blanes Noguera, Juan Fco; Benet Gilabert, Ginés; Simó Ten, José E


    This paper deals with the problem of humanoid robot localization and proposes a new method for position estimation that has been developed for the RoboCup Standard Platform League environment. Firstly, a complete vision system has been implemented in the Nao robot platform that enables the detection of relevant field markers. The detection of field markers provides some estimation of distances for the current robot position. To reduce errors in these distance measurements, extrinsic and intrinsic camera calibration procedures have been developed and described. To validate the localization algorithm, experiments covering many of the typical situations that arise during RoboCup games have been developed: ranging from degradation in position estimation to total loss of position (due to falls, 'kidnapped robot', or penalization). The self-localization method developed is based on the classical particle filter algorithm. The main contribution of this work is a new particle selection strategy. Our approach reduces the CPU computing time required for each iteration and so eases the limited resource availability problem that is common in robot platforms such as Nao. The experimental results show the quality of the new algorithm in terms of localization and CPU time consumption. PMID:24193098

  8. The DHL EuroCup: shots on goal.


    Hemp, Paul


    Deutsche Post World Net, the German postal monopoly, faced significant challenges as it began the process of integrating three businesses: Deutsche Post Euro Express, its own ground-based parcel delivery service, and two companies it had acquired-DHL, the worldwide express delivery service, and Danzas, a worldwide air and ocean freight company. The cultural differences alone were imposing. For example, DHL was a privately held, entrepreneurial company in which most managers had international experience; Deutsche Post was until recently a state-owned monopoly in which few managers had worked outside their home country. Enter EuroCup. For 20 years, DHL employees had held a soccer tournament to strengthen company culture across national boundaries. Canceled the previous year due to budget constraints, the EuroCup tournament was revived in 2003-in part to help with the postmerger integration. But did the event really help? HBR senior editor Paul Hemp attended EuroCup 2003, joining nearly 2,500 DHL employees--about 600 of them players, the rest cheerleaders and other supporters--in the small Belgian town of Lommel. He set out to answer a number of questions relevant to any company staging an ambitious off-site intended to encourage teamwork and boost morale. How does a company determine whether such a large-scale event, even one that generates goodwill, is worth the investment? Does the team building extend to those back home who don't get to attend? Can intense competition between teams begin to overshadow the spirit of cooperation that such an event is meant to engender? In short, can a soccer tournament help a company achieve its corporate goal of creating a strong common culture?

  9. Analysis of bone ingrowth on a tantalum cup

    PubMed Central

    D'Angelo, F; Murena, L; Campagnolo, M; Zatti, G; Cherubino, P


    Background: Trabecular Metal (TM) is a new highly porous material made of tantalum (Zimmer, Warsaw, Indiana, USA). Its three-dimensional structure is composed of a series of interconnected dodecahedron pores that are on average 550 μm in diameter. This size is considered optimal for bone ingrowth and is similar to trabecular bone. The elastic modulus of TM (3 GPa) is more similar to that of cancellous (0,1-1,5 GPa) or cortical (112-18 GPa) bone and is significantly less similar to that of Titanium (110 GPa) and Co-Cr alloys (220 GPa). These features enable bone apposition and remodeling. The purpose of the present study was to evaluate the histology of the bone-implant interface in a human specimen. Materials and Methods: A highly porous tantalum cup (Zimmer, Warsaw, Indiana, USA) was removed for recurrent dislocations three years after implantation. In order to obtain a slice of the cup, two cuts were made on the centre using an Exakt cutting machine. Then the slice was embedded in a Technovit resin and a Hematoxylin-eosin stain was used to study the bone tissue. Bone ingrowth was calculated using a method based on simple calculations of planar geometry. Results: The histological evaluation of the periprosthetic tissues revealed a typical chronic inflammation with few particles of polyethylene that were birefringent using polarized light. The quantitative evaluation of bone ingrowth revealed that more than 95% of voids were filled with bone. Discussion: In the literature, a lot of studies focused on tantalum were carried on animal model. Up to now little information is available about the histology of the bone-tantalum interface in a human artificial joint. We had an opportunity to remove a well integrated cup hence this study. The histology confirmed the strong relationship between the structure of this material and bone. The morphometric analysis revealed a high percentage of bone ingrowth. PMID:19753152

  10. Power output during women's World Cup road cycle racing.


    Ebert, Tammie R; Martin, David T; McDonald, Warren; Victor, James; Plummer, John; Withers, Robert T


    Little information exists on the power output demands of competitive women's road cycle racing. The purpose of our investigation was to document the power output generated by elite female road cyclists who achieved success in FLAT and HILLY World Cup races. Power output data were collected from 27 top-20 World Cup finishes (19 FLAT and 8 HILLY) achieved by 15 nationally ranked cyclists (mean +/- SD; age: 24.1+/-4.0 years; body mass: 57.9+/-3.6 kg; height: 168.7+/-5.6 cm; VO2max 63.6+/-2.4 mL kg(-1) min(-1); peak power during graded exercise test (GXT(peak power)): 310+/-25 W). The GXT determined GXT(peak power), VO2peak lactate threshold (LT) and anaerobic threshold (AT). Bicycles were fitted with SRM powermeters, which recorded power (W), cadence (rpm), distance (km) and speed (km h(-1)). Racing data were analysed to establish time in power output and metabolic threshold bands and maximal mean power (MMP) over different durations. When compared to HILLY, FLAT were raced at a similar cadence (75+/-8 vs. 75+/-4 rpm, P=0.93) but higher speed (37.6+/-2.6 vs. 33.9+/-2.7 km h(-1), P=0.008) and power output (192+/-21 vs. 169+/-17 W, P=0.04; 3.3+/-0.3 vs. 3.0+/-0.4 W kg(-1), P=0.04). During FLAT races, riders spent significantly more time above 500 W, while greater race time was spent between 100 and 300 W (LT-AT) for HILLY races, with higher MMPs for 180-300 s. Racing terrain influenced the power output profiles of our internationally competitive female road cyclists. These data are the first to define the unique power output requirements associated with placing well in both flat and hilly women's World Cup cycling events.

  11. Missed opportunities: HIV and the 2010 FIFA World Cup.


    Beres, L K


    The international community missed opportunities to raise HIV awareness and reduce transmission risk during the World Cup held in South Africa from 11 June-11 July 2010. With the tournament captivating the entire region, the public health community should have better applied our knowledge and evidence-based interventions to raise the profile of HIV prevention, care and treatment. More should have been done to prevent possible new infections fueled by visitors, alcohol and sports celebrations. Considering the impact of HIV in southern Africa and the amount of funds and effort that go into addressing the problem each year, we cannot afford to miss these opportunities for action.

  12. Untreated acetabular dysplasia of the hip in the Navajo. A 34 year case series followup.


    Schwend, R M; Pratt, W B; Fultz, J


    Patients born in the Many Farms District of the Navajo Indian Reservation from 1955 to 1961 were studied. Five hundred forty-eight of the 628 infants born (87%) received clinical examinations and pelvic radiographs at some time during the first 4 years of their lives. Eighteen (3.3%) of the 548 infants examined had acetabular dysplasia. Because of traditional cultural beliefs, none of these children received medical treatment. Followup evaluations and radiographs were obtained in these 18 patients during early adolescence. In 10 of the original 18 patients followup evaluations and radiographs were obtained at an average age of 35 years. None of the dysplastic hips progressed to frank dislocation. The mean center edge angle improved from 7 degrees when the patients were 1 year of age, to 29 degrees when the patients were 12 years of age, to 30 degrees when the patients were 35 years of age. Despite overall improvement of hip measurements with maturity, eight hips in five of the 10 patients who were in their fourth decade of life and who were available for examination, had radiographic evidence of residual abnormalities. The hips in patients with subluxation during infancy were less likely to be normal as adults. The results of this 34-year followup study of untreated developmental hip dysplasia showed marked radiographic improvement in all patients during childhood; however, subtle abnormalities persisted in the radiographs of 40% of the hips. PMID:10416399

  13. The Relationship of Acetabular Dysplasia and Femoroacetabular Impingement to Hip Osteoarthritis: A Focused Review

    PubMed Central

    Royer, Nathaniel K.


    Hip osteoarthritis (OA) leads to significant functional limitations and economic burden. If modifiable risk factors for hip OA are identified, it may be possible to implement preventative measures. Bony abnormalities associated with acetabular dysplasia (AD) and femoroacetabular impingement (FAI) have been recently implicated as risk factors for hip osteoarthritis (OA). The purpose of this focused review is to summarize the available evidence describing the relationship between bony abnormalities and hip OA. A librarian-assisted database search using PubMed, Embase and Central was performed. Relevant articles were identified and assessed for inclusion criteria. The authors reviewed cohort and case control studies that reported on the association between abnormal hip morphology and hip OA. The available literature suggests that an association exists between bony abnormalities found in AD and FAI and hip OA and preliminary evidence suggests that AD is a risk factor for OA, however these conclusions are based on limited evidence. Prospective, longitudinal studies are needed to confirm the causal relationship between abnormal hip morphology and the future development of hip OA. PMID:22108232

  14. Tranexamic acid reduces the blood loss and blood transfusion requirements following peri-acetabular osteotomy.


    Wassilew, G I; Perka, C; Janz, V; Krämer, M; Renner, L


    We have investigated the effect of using tranexamic acid (TXA) during peri-acetabular osteotomy (PAO) on peri-operative blood loss and blood transfusion requirements. In addition we analysed whether the use of TXA was associated with an increased risk of venous thromboembolism (VTE) following this procedure. A consecutive series of 96 PAOs, performed by a single surgeon, were reviewed. A total of 48 patients received TXA and 48 did not. The TXA group received a continuous infusion of TXA at a rate of 10 mg/kg/h. The primary outcome measure was the requirement for blood transfusion. Secondary outcomes included total blood loss, the decrease in the level of haemoglobin in the blood, the length of hospital stay, and the complications of this treatment. The mean rate of transfusion was significantly lower in the TXA group (62.5% vs 12.5%, p < 0.001). The mean blood loss was also significantly reduced in the TXA group (1.9 L (standard deviation (SD) 0.9) vs 1.5 L (SD 0.7), p < 0.01). No post-operative episodes of VTE were identified in either group. The use of TXA reduced the blood loss and the rate of transfusion after PAO significantly, without adverse effects such as an increased rate of VTE.

  15. Retrieval analysis of a failed TriboFit polycarbonate urethane acetabular buffer.


    Biant, Leela C; Gascoyne, Trevor C; Bohm, Eric R; Moran, Matthew


    The purpose of this research was to determine the failure mechanisms and damage features of a TriboFit acetabular buffer implanted directly against a native, prepared acetabulum which was revised after 11months. Retrieval analyses were carried out via light microscopy, gravimetric wear assessment, and observer scoring of visible damage features on the buffer. The volume of material abraded from the backside of the buffer was estimated via three-dimensional reconstruction using a laser scanner. Scanning electron microscopy was used to confirm damage features and mechanisms. Severe abrasion to the backside of the buffer was the primary damage feature, while stippling damage was seen on the articular surface of the buffer. Material loss due to backside abrasion was approximated to be between 0.13360.085 g (gravimetric analyses) and 0.19360.053 g (three-dimensional reconstruction). Implantation of the TriboFit buffer against the patient's native acetabulum without a metal backing allowed for significant movement of the buffer against the bone, resulting in the abrasion seen on this implant. The stippling damage on the articular surface indicates an adhesive wear mechanism which exacerbates movement of the buffer against the acetabulum, thereby increasing backside abrasion.

  16. Studies in Cup Drawing Behavior of Polymer Laminated Sheet Metal

    NASA Astrophysics Data System (ADS)

    Elnagmi, M.; Jain, M.; Bruhis, M.; Nielsen, K.


    Axisymmetric deep drawing behavior of a polymer laminated sheet metal (PLSM) is investigated using an axisymmetric cup drawing test. PLSMs are of interest as a replacement for painted finishes for automotive applications as they have the potential to achieve good quality long lasting and aesthetically appealing surfaces on stamped parts. However, there is limited understanding of PLSMs in automotive deep drawing situations to produce complex 3-D parts. The tests are carried out using well-controlled, laboratory-based, dual-action, servo-hydraulic forming presses under blank-holder force and punch displacement control conditions. An optical strain mapping system is used to measure the surface strains (and to construct 3D strain maps) from the film side of the deformed samples for a range of forming conditions. Deep drawing characteristics such as punch load versus punch displacement traces, strain distribution along the cup profile, flange wrinkling and fracture characteristics are experimentally assessed for stainless steel-plastic film laminated sheet materials. Also the effect of lamination pressure on wrinkling and delamination is investigated for a decorative pressure sensitive adhesive film affixed to the stainless steel sheet.

  17. Suppression Characteristics of Cup-Burner Flames in Low Gravity

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.


    The structure and suppression of laminar methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using physically acting fire-extinguishing agents (CO2, N2, He, and Ar) in normal earth (lg) and zero gravity (0g). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An initial observation of the flame without agent was also made at the NASA Glenn 2.2-Second Drop Tower. An agent was introduced into a low-speed coflowing oxidizing stream by gradually replacing the air until extinguishment occurred under a fixed minimal fuel velocity. The suppression of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff phenomena of the trailing diffusion flame. The thermal and transport properties of the agents affected the flame extinguishment limits.

  18. Automated detection of kinks from blood vessels for optic cup segmentation in retinal images

    NASA Astrophysics Data System (ADS)

    Wong, D. W. K.; Liu, J.; Lim, J. H.; Li, H.; Wong, T. Y.


    The accurate localization of the optic cup in retinal images is important to assess the cup to disc ratio (CDR) for glaucoma screening and management. Glaucoma is physiologically assessed by the increased excavation of the optic cup within the optic nerve head, also known as the optic disc. The CDR is thus an important indicator of risk and severity of glaucoma. In this paper, we propose a method of determining the cup boundary using non-stereographic retinal images by the automatic detection of a morphological feature within the optic disc known as kinks. Kinks are defined as the bendings of small vessels as they traverse from the disc to the cup, providing physiological validation for the cup boundary. To detect kinks, localized patches are first generated from a preliminary cup boundary obtained via level set. Features obtained using edge detection and wavelet transform are combined using a statistical approach rule to identify likely vessel edges. The kinks are then obtained automatically by analyzing the detected vessel edges for angular changes, and these kinks are subsequently used to obtain the cup boundary. A set of retinal images from the Singapore Eye Research Institute was obtained to assess the performance of the method, with each image being clinically graded for the CDR. From experiments, when kinks were used, the error on the CDR was reduced to less than 0.1 CDR units relative to the clinical CDR, which is within the intra-observer variability of 0.2 CDR units.

  19. 78 FR 37712 - Safety Zone; Chicago Match Cup Race; Lake Michigan; Chicago, IL

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... SECURITY Coast Guard 33 CFR Part 165 Safety Zone; Chicago Match Cup Race; Lake Michigan; Chicago, IL AGENCY... safety zone on Lake Michigan near Chicago, Illinois for the 2013 AWMRT Chicago Match Cup Race. This zone... being enforced without permission of the Captain of the Port, Lake Michigan. DATES: This regulation...

  20. 77 FR 7025 - Safety Zones; America's Cup World Series, East Passage, Narragansett Bay, RI

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public meeting. But you may... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zones; America's Cup World Series, East Passage... Bay, Rhode Island, during the America's Cup World Series sailing vessel racing event. This safety...

  1. 77 FR 54815 - Safety Zone: America's Cup World Series Regattas, San Francisco Bay; San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... INFORMATION: Table of Acronyms ACRM America's Cup Race Management DHS Department of Homeland Security FR... public dockets in the January 17, 2008, issue of the Federal Register (73 FR 3316). 4. Public Meeting We... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone: America's Cup World Series Regattas,...

  2. 77 FR 60897 - Safety Zone: America's Cup World Series Finish-Line, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... INFORMATION: Table of Acronyms APA Administrative Procedure Act DHS Department of Homeland Security FR Federal... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone: America's Cup World Series Finish-Line, San... support of the 2012 America's Cup World Series sailing events. This safety zone is established to...

  3. 77 FR 28253 - Safety Zone; America's Cup World Series, East Passage, Narragansett Bay, RI

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Series, East Passage, Narragansett Bay, RI'' in the Federal Register (77 FR 7025). We received one... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; America's Cup World Series, East Passage... the America's Cup World Series (ACWS) sailing vessel racing event. DATES: This rule is effective...

  4. 33 CFR 165.T11-0551 - Safety Zone; America's Cup Sailing Events.

    Code of Federal Regulations, 2013 CFR


    ... provisions of 33 CFR 165.23 apply to this safety zone. No person or vessel underway may enter or remain... Sailing Events. 165.T11-0551 Section 165.T11-0551 Navigation and Navigable Waters COAST GUARD, DEPARTMENT... § 165.T11-0551 Safety Zone; America's Cup Sailing Events. (a) Definitions—(1) America's Cup...

  5. A mechanical bottleneck explains the variation in cup growth during FcγR phagocytosis

    PubMed Central

    van Zon, Jeroen S; Tzircotis, George; Caron, Emmanuelle; Howard, Martin


    Phagocytosis is the process by which cells internalize particulate material, and is of central importance to immunity, homeostasis and development. Here, we study the internalization of immunoglobulin G-coated particles in cells transfected with Fcγ receptors (FcγRs) through the formation of an enveloping phagocytic cup. Using confocal microscopy, we precisely track the location of fluorescently tagged FcγRs during cup growth. Surprisingly, we found that phagocytic cups growing around identical spherical particles showed great variability even within a single cell and exhibited two eventual fates: a cup either stalled before forming a half-cup or it proceeded until the particle was fully enveloped. We explain these observations in terms of a mechanical bottleneck using a simple mathematical model of the overall process of cup growth. The model predicts that reducing F-actin concentration levels, and hence the deforming force, does not necessarily lead to stalled cups, a prediction we verify experimentally. Our analysis gives a coherent explanation for the importance of geometry in phagocytic uptake and provides a unifying framework for integrating the key processes, both biochemical and mechanical, occurring during cup growth. PMID:19690567

  6. 76 FR 39289 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014


    ..., 2008, issue of the Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... waters immediately prior to, during, and immediately after the Detroit APBA Gold Cup boat race....

  7. 75 FR 39448 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Federal Register (75 FR 21191). We received zero comments on the proposed rule. No public meeting was... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... Detroit River during the Detroit APBA Gold Cup. This special local regulation is necessary to...

  8. 75 FR 21191 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014


    ..., 2008 issue of the Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... vessels from portions of the Detroit River during the Detroit APBA Gold Cup. This special local...

  9. Faraday cup with nanosecond response and adjustable impedance for fast electron beam characterization

    SciTech Connect

    Hu Jing; Rovey, Joshua L.


    A movable Faraday cup design with simple structure and adjustable impedance is described in this work. This Faraday cup has external adjustable shunt resistance for self-biased measurement setup and 50 {Omega} characteristic impedance to match with 50 {Omega} standard BNC coaxial cable and vacuum feedthroughs for nanosecond-level pulse signal measurements. Adjustable shunt resistance allows self-biased measurements to be quickly acquired to determine the electron energy distribution function. The performance of the Faraday cup is validated by tests of response time and amplitude of output signal. When compared with a reference source, the percent difference of the Faraday cup signal fall time is less than 10% for fall times greater than 10 ns. The percent difference of the Faraday cup signal pulse width is below 6.7% for pulse widths greater than 10 ns. A pseudospark-generated electron beam is used to compare the amplitude of the Faraday cup signal with a calibrated F-70 commercial current transformer. The error of the Faraday cup output amplitude is below 10% for the 4-14 kV tested pseudospark voltages. The main benefit of this Faraday cup is demonstrated by adjusting the external shunt resistance and performing the self-biased method for obtaining the electron energy distribution function. Results from a 4 kV pseudospark discharge indicate a ''double-humped'' energy distribution.

  10. 77 FR 22706 - Special Local Regulation and Safety Zone; America's Cup Sailing Events, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... the ``America's Cup World Series,'' the ``Louis Vuitton Cup'' challenger selection series, and the... notice regarding our public dockets in the January 17, 2008, issue of the Federal Register (73 FR 3316... public input, we proposed a special local regulation and safety zone on January 30, 2012 (77 FR 4501)....

  11. 78 FR 40396 - Safety Zone; America's Cup Safety Zone and No Loitering Area, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... activities associated with the ``America's Cup World Series'' regattas in 2012 and the ``Louis Vuitton Cup... Department of Homeland Security FR Federal Register A. Regulatory History and Information On January 30, 2012..., and September, 2013 (77 FR 04501). After reviewing all comments received in response to the NPRM,...

  12. Athletic Departments' Operating Expenses as a Predictor of Their Directors' Cup Standing

    ERIC Educational Resources Information Center

    Magner, Amber


    The NACDA Directors' Cup is a competition utilizing an unbiased scoring system that encourages a broad based athletic department as the standard for defining intercollegiate athletic success. Therefore, for NCAA DI athletic administrators the Directors' Cup should be the standard for defining intercollegiate athletic success. The purpose of this…

  13. Post-deformation shape-recovery behavior of vitamin E-diffused, radiation crosslinked polyethylene acetabular components.


    Takahashi, Yasuhito; Tateiwa, Toshiyuki; Shishido, Takaaki; Masaoka, Toshinori; Kubo, Kosuke; Yamamoto, Kengo


    The in-vivo progression of creep and wear in ultra-high molecular weight polyethylene (UHMWPE) acetabular liners has been clinically evaluated by measuring radiographic penetration of femoral heads. In such clinical assessments, however, viscoelastic strain relaxation has been rarely considered after a removal of hip joint loading, potentially leading to an underestimation of the penetrated thickness. The objective of this study was to investigate shape-recovery behavior of pre-compressed, radiation crosslinked and antioxidant vitamin E-diffused UHMWPE acetabular liners, and also to characterize the effects of varying their internal diameter (ID) and wall thickness (WT). We applied uniaxial compression to the UHMWPE specimens of various ID (28, 32, 36mm) and WT (4.8, 6.8, 8.9mm) for 4320min under the constant load of 3000N, and subsequently monitored the strain-relaxation behavior as a function of time after unloading. It was observed that there was a considerable shape recovery of the components after removal of the external static load. Reducing ID and WT significantly accelerated the rate of creep strain recovery, and varying WT was more sensitive to the recovery behavior than ID. Creep deformation of the tested liners recovered mostly within the first 300min after unloading. Note that approximately half of the total recovery amount proceeded just within 5min after unloading. These results suggest a remarkably high capability of shape recovery of vitamin E-diffused highly crosslinked UHMWPE. In conclusion, the time-dependent shape recovering and the diameter-thickness effect on its behavior should be carefully considered when the postoperative penetration is quantified in highly crosslinked UHMWPE acetabular liners (especially on the non-weight bearing radiographs). PMID:27454526

  14. Excellent long-term results of the Müller acetabular reinforcement ring in primary total hip arthroplasty

    PubMed Central

    Sirka, Aurimas; Clauss, Martin; Tarasevicius, Sarunas; Wingstrand, Hans; Stucinskas, Justinas; Robertsson, Otto; Emil Ochsner, Peter; Ilchmann, Thomas


    Background and purpose — The original Müller acetabular reinforcement ring (ARR) shows favorable medium-term results for acetabular reconstruction in total hip arthroplasty, where it is used when the acetabular bone stock is deficient. However, there are no data regarding long-term survival of the device. We therefore investigated long-term survival and analyzed radiological modes of failure. Patients and methods — Between 1984 and 2002, 321 consecutive primary arthroplasties using an ARR were performed in 291 patients. The mean follow-up time was 11 (0–25) years, and 24 hips were lost to follow-up. For survival analysis, we investigated 321 hips and the end of the follow-up was the date of revision, date of death, or the last patient contact date with implant still in situ. Radiological assessment was performed for 160 hips with a minimum of 10 years of follow-up and with radiographs of sufficient quality. It included evaluation of osteolysis, migration, and loosening. Results — 12 ARR THAs were revised: 1 isolated ARR revision for aseptic loosening, 4 revisions of the ARR and the stem for aseptic loosening, 6 for infection, and 1 for recurrent dislocation. The cumulative revision rate for all components, for any reason, at 20 years was 15% (95% CI: 10–22), while for the ARR only it was 7% (95% CI: 4–12) for any reason and 3.4% (95% CI: 1–9) for aseptic loosening. 21 (13%) of 160 ARR THAs examined had radiological changes: 7 had osteolysis but were not loose, and 14 were radiologically loose but were not painful and not revised. Interpretation — Our data suggest that the long-term survival of the ARR is excellent. PMID:26471881

  15. Computed tomography arthrography with traction in the human hip for three-dimensional reconstruction of cartilage and the acetabular labrum

    PubMed Central

    Henak, C.R.; Abraham, C.L.; Peters, C.L.; Sanders, R.K.; Weiss, J.A.; Anderson, A.E.


    AIM To develop and demonstrate the efficacy of a computed tomography arthrography (CTA) protocol for the hip that enables accurate three-dimensional reconstructions of cartilage and excellent visualization of the acetabular labrum. MATERIALS AND METHODS Ninety-three subjects were imaged (104 scans); 68 subjects with abnormal anatomy, 11 patients after periacetabular osteotomy surgery, and 25 subjects with normal anatomy. Fifteen to 25 ml of contrast agent diluted with lidocaine was injected using a lateral oblique approach. A Hare traction splint applied traction during CT. The association between traction force and intra-articular joint space was assessed qualitatively under fluoroscopy. Cartilage geometry was reconstructed from the CTA images for 30 subjects; the maximum joint space under traction was measured. RESULTS Using the Hare traction splint, the intra-articular space and boundaries of cartilage could be clearly delineated throughout the joint; the acetabular labrum was also visible. Dysplastic hips required less traction (~5 kg) than normal and retroverted hips required (>10 kg) to separate the cartilage. An increase in traction force produced a corresponding widening of the intra-articular joint space. Under traction, the maximum width of the intra-articular joint space during CT ranged from 0.98–6.7 mm (2.46 ± 1.16 mm). CONCLUSIONS When applied to subjects with normal and abnormal hip anatomy, the CTA protocol presented yields clear delineation of the cartilage and the acetabular labrum. Use of a Hare traction splint provides a simple, cost-effective method to widen the intra-articular joint space during CT, and provides flexibility to vary the traction as required. PMID:25070373

  16. Bigger size and defatting of bone chips will increase cup stability.


    Ullmark, G


    Morcellised bone allograft in an in vitro model was used to test the tendency towards cup rotation using small or larger fragment sizes of an impacted graft bed and different fat contents. A cup cemented on an impacted graft bed of larger sized bone chips from the Howex bone mill containing natural marrow fat was loaded eccentrically until the cup rotated. This required 3450 N. The same chips impacted in the same way, but defatted with warm saline solution required 7000 N for rotation. The smaller sized bone chips from the Tracer bone mill defatted in a similar manner required only 1950 N for cup rotation. The conclusion was that larger sized chips, partly defatted, prevent rotation of a cup cemented on a graft bed.

  17. Germline genetics of cancer of unknown primary (CUP) and its specific subtypes.


    Hemminki, Kari; Chen, Bowang; Kumar, Abhishek; Melander, Olle; Manjer, Jonas; Hallmans, Göran; Pettersson-Kymmer, Ulrika; Ohlsson, Claes; Folprecht, Gunnar; Löffler, Harald; Krämer, Alwin; Försti, Asta


    Cancer of unknown primary site (CUP) is a fatal cancer diagnosed through metastases at various organs. Little is known about germline genetics of CUP which appears worth of a search in view of reported familial associations in CUP. In the present study, samples from CUP patients were identified from 2 Swedish biobanks and a German clinical trial, totaling 578 CUP patients and 7628 regionally matched controls. Diagnostic data specified the organ where metastases were diagnosed. We carried out a genome-wide association study on CUP cases and controls. In the whole sample set, 6 loci reached an allelic p-value in the range of 10-7 and were supported by data from the three centers. Three associations were located next to non-coding RNA genes. rs2660852 flanked 5'UTR of LTA4H (leukotriene A4 hydrolase), rs477145 was intronic to TIAM1 (T-cell lymphoma invasion and metastases) and rs2835931 was intronic to KCNJ6 (potassium channel, inwardly rectifying subfamily J, member 6). In analysis of subgroups of CUP patients (smokers, non-smokers and CUP with liver metastases) genome-wide significant associations were noted. For patients with liver metastases associations on chromosome 6 and 11, the latter including a cluster of genes DHCR7 and NADSYN1, encoding key enzymes in cholesterol and NAD synthesis, and KRTAP5-7, encoding a keratin associated protein. This first GWAS on CUP provide preliminary evidence that germline genes relating to inflammation (LTA4H), metastatic promotion (TIAM1) in association with lipid metabolic disturbance (chromosome 11 cluster) may contribute to the risk of CUP.

  18. Germline genetics of cancer of unknown primary (CUP) and its specific subtypes

    PubMed Central

    Hemminki, Kari; Chen, Bowang; Kumar, Abhishek; Melander, Olle; Manjer, Jonas; Hallmans, Göran; Pettersson-Kymmer, Ulrika; Ohlsson, Claes; Folprecht, Gunnar; Löffler, Harald; Krämer, Alwin; Försti, Asta


    Cancer of unknown primary site (CUP) is a fatal cancer diagnosed through metastases at various organs. Little is known about germline genetics of CUP which appears worth of a search in view of reported familial associations in CUP. In the present study, samples from CUP patients were identified from 2 Swedish biobanks and a German clinical trial, totaling 578 CUP patients and 7628 regionally matched controls. Diagnostic data specified the organ where metastases were diagnosed. We carried out a genome-wide association study on CUP cases and controls. In the whole sample set, 6 loci reached an allelic p-value in the range of 10−7 and were supported by data from the three centers. Three associations were located next to non-coding RNA genes. rs2660852 flanked 5′UTR of LTA4H (leukotriene A4 hydrolase), rs477145 was intronic to TIAM1 (T-cell lymphoma invasion and metastases) and rs2835931 was intronic to KCNJ6 (potassium channel, inwardly rectifying subfamily J, member 6). In analysis of subgroups of CUP patients (smokers, non-smokers and CUP with liver metastases) genome-wide significant associations were noted. For patients with liver metastases associations on chromosome 6 and 11, the latter including a cluster of genes DHCR7 and NADSYN1, encoding key enzymes in cholesterol and NAD synthesis, and KRTAP5-7, encoding a keratin associated protein. This first GWAS on CUP provide preliminary evidence that germline genes relating to inflammation (LTA4H), metastatic promotion (TIAM1) in association with lipid metabolic disturbance (chromosome 11 cluster) may contribute to the risk of CUP. PMID:26959888

  19. Domestic science: making chemistry your cup of tea.


    Keene, Melanie


    In the early Victorian home, there were plenty of scientific lessons to be uncovered. With the appropriate interrogation, everyday objects could transform seemingly mundane activities such as eating breakfast, washing clothes or reading by candle-light into household lectures that gave children a familiar base from which to explore the hidden properties and marvellous histories of common commodities. Responding to an unprecedented hunger for scientific knowledge, a profusion of introductory texts appeared in the mid-nineteenth century that directed lessons into homes across Britain and beyond. In particular, the science of chemistry found its way into this domestic setting, as writers promoted its practice and practitioners as a source of authoritative expertise on everyday life. One of the most compelling illustrations of this encounter between the public and chemistry took place over a simple cup of tea.

  20. Cup waveguide antenna with integrated polarizer and OMT

    NASA Technical Reports Server (NTRS)

    Acosta, Roberto J. (Inventor); Kory, Carol (Inventor); Lambert, Kevin M. (Inventor)


    A cup waveguide antenna with integrated polarizer and OMT for simultaneously communicating left and right hand circularly polarized electromagnetic waves is adjustable to obtain efficient propagation and reception of electromagnetic waves. The antenna includes a circular waveguide having an orthomode transducer utilizing first and second pins longitudinally spaced apart and oriented orthogonally with respect to each other. Six radially-oriented adjustable polarizer screws extend from the exterior to the interior of the waveguide. A septum intermediate the first and second pins is aligned with the first pin. Adjustment of the polarizer screws enables maximized propagation of and/or response to left hand circularly polarized electromagnetic waves by the first pin while simultaneously enabling maximized propagation of and/or response to right hand circularly polarized electromagnetic waves by the second pin.

  1. Fire Suppression in Low Gravity Using a Cup Burner

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.


    Longer duration missions to the moon, to Mars, and on the International Space Station increase the likelihood of accidental fires. The goal of the present investigation is to: (1) understand the physical and chemical processes of fire suppression in various gravity and O2 levels simulating spacecraft, Mars, and moon missions; (2) provide rigorous testing of numerical models, which include detailed combustion suppression chemistry and radiation sub-models; and (3) provide basic research results useful for advances in space fire safety technology, including new fire-extinguishing agents and approaches. The structure and extinguishment of enclosed, laminar, methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using various fire-extinguishing agents (CO2, N2, He, Ar, CF3H, and Fe(CO)5). The experiments involve both 1g laboratory testing and low-g testing (in drop towers and the KC-135 aircraft). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An agent was introduced into a low-speed coflowing oxidizing stream until extinguishment occurred under a fixed minimal fuel velocity, and thus, the extinguishing agent concentrations were determined. The extinguishment of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff of the trailing diffusion flame. Furthermore, the buoyancy-induced flame flickering in 1g and thermal and transport properties of the agents affected the flame extinguishment limits.

  2. VOCALS-CUpEx: the Chilean Upwelling Experiment

    NASA Astrophysics Data System (ADS)

    Garreaud, R. D.; Rutllant, J. A.; Muñoz, R. C.; Rahn, D. A.; Ramos, M.; Figueroa, D.


    The VAMOS Ocean-Cloud-Atmosphere-Land Study Regional Experiment (VOCALS-REx) was a major field experiment conducted in spring of 2008 off southern Peru and northern Chile, aimed at better understanding the coupled climate systems of the southeast Pacific. Because of logistical constrains, the coastal area around 30° S was not sampled during VOCALS-REx. This area not only marks the poleward edge of the subtropical stratocumulus cloud regime (thus acting as a source of transient disturbances) but is also one of the most active upwelling centers and source of surface ocean kinetic energy along the Chilean coast. To fill such an observational gap, a small, brief, but highly focused field experiment was conducted in late spring 2009 in the near-shore region around 30° S. The Chilean Upwelling Experiment (CUpEx) was endorsed by VOCALS as a regional component. CUpEx included long-term monitoring, an intensive two-week field campaign and off-shore research flights. Our goal was to obtain an atmospheric/oceanic dataset with enough temporal and spatial coverage to be able to document (a) the mean diurnal cycles of the lower-troposphere and upper-ocean in a region of complex topography and coastline geometry, and (b) the ocean-atmosphere response to the rapid changes in coastal winds from strong, upwelling-favorable southerly winds to relaxed southerlies or even downwelling-favorable northerlies. In this paper we describe the measurement platforms and sampling strategy, and provide an observational overview, highlighting some key mean and transient features.

  3. VOCALS-CUpEx: the Chilean Upwelling Experiment

    NASA Astrophysics Data System (ADS)

    Garreaud, R. D.; Rutllant, J. A.; Muñoz, R. C.; Rahn, D. A.; Ramos, M.; Figueroa, D.


    The VAMOS Ocean-Cloud-Atmosphere-Land Study Regional Experiment (VOCALS-REx) was a major field experiment conducted in spring of 2008 off southern Peru and northern Chile, aimed at better understanding the coupled climate systems of the southeast Pacific. Because of logistical constrains, the coastal area around 30° S was not sampled during VOCALS-REx. This area not only marks the poleward edge of the subtropical stratocumulus cloud regime (thus acting as a source of transient disturbances) but is also one of the most active upwelling centers and source of surface ocean kinetic energy along the Chilean coast. To fill such an observational gap, a small, brief, but highly focused field experiment was conducted in late spring 2009 in the near-shore region around 30° S. The Chilean Upwelling Experiment (CUpEx) was endorsed by VOCALS as a regional component. CUpEx included long-term monitoring, an intensive two-week field campaign and off-shore research flights. Our goal was to obtain an atmospheric/oceanic dataset with enough temporal and spatial coverage to be able to document (a) the mean diurnal cycles of the lower-troposphere and upper-ocean in a region of complex topography and coastline geometry, and (b) the ocean-atmosphere response to the rapid changes in coastal winds from strong, upwelling-favorable equatorward flow (southerly winds) to downwelling-favorable poleward flow (northerly winds). In this paper we describe the measurement platforms and sampling strategy, and provide an observational overview, highlighting some key mean-state and transient features.

  4. Fire Suppression in Low Gravity Using a Cup Burner

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.


    Longer duration missions to the moon, to Mars, and on the International Space Station increase the likelihood of accidental fires. The goal of the present investigation is to: (1) understand the physical and chemical processes of fire suppression in various gravity and O2 levels simulating spacecraft, Mars, and moon missions; (2) provide rigorous testing of numerical models, which include detailed combustion-suppression chemistry and radiation sub-models; and (3) provide basic research results useful for advances in space fire safety technology, including new fire-extinguishing agents and approaches.The structure and extinguishment of enclosed, laminar, methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using various fire-extinguishing agents (CO2, N2, He, Ar, CF3H, and Fe(CO)5). The experiments involve both 1g laboratory testing and low-g testing (in drop towers and the KC-135 aircraft). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An agent was introduced into a low-speed coflowing oxidizing stream until extinguishment occurred under a fixed minimal fuel velocity, and thus, the extinguishing agent concentrations were determined. The extinguishment of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff of the trailing diffusion flame. Furthermore, the buoyancy-induced flame flickering in 1g and thermal and transport properties of the agents affected the flame extinguishment limits.

  5. Effects of Aluminum Addition on Tensile and Cup Forming Properties of Three Twinning Induced Plasticity Steels

    NASA Astrophysics Data System (ADS)

    Hong, Seokmin; Shin, Sang Yong; Kim, Hyoung Seop; Lee, Sunghak; Kim, Sung-Kyu; Chin, Kwang-Geun; Kim, Nack J.


    In the present study, a high Mn twinning induced plasticity (TWIP) steel and two Al-added TWIP steels were fabricated, and their microstructures, tensile properties, and cup formability were analyzed to investigate the effects of Al addition on deformation mechanisms in tensile and cup forming tests. In the high Mn steel, the twin formation was activated to increase the strain hardening rate and ultimate tensile strength, which needed the high punch load during the cup forming test. In the Al-added TWIP steels, the twin formation was reduced, while the slip activation increased, thereby leading to the decrease in strain hardening rate and ultimate tensile strength. As twins and slips were homogeneously formed during the tensile or cup forming test, the punch load required for the cup forming and residual stresses were relatively low, and the tensile ductility was sufficiently high even after the cup forming test. This indicated that making use of twins and slips simultaneously in TWIP steels by the Al addition was an effective way to improve overall properties including cup formability.

  6. CUP-1 Is a Novel Protein Involved in Dietary Cholesterol Uptake in Caenorhabditis elegans

    PubMed Central

    Valdes, Victor J.; Athie, Alejandro; Salinas, Laura S.; Navarro, Rosa E.; Vaca, Luis


    Sterols transport and distribution are essential processes in all multicellular organisms. Survival of the nematode Caenorhabditis elegans depends on dietary absorption of sterols present in the environment. However the general mechanisms associated to sterol uptake in nematodes are poorly understood. In the present work we provide evidence showing that a previously uncharacterized transmembrane protein, designated Cholesterol Uptake Protein-1 (CUP-1), is involved in dietary cholesterol uptake in C. elegans. Animals lacking CUP-1 showed hypersensitivity to cholesterol limitation and were unable to uptake cholesterol. A CUP-1-GFP fusion protein colocalized with cholesterol-rich vesicles, endosomes and lysosomes as well as the plasma membrane. Additionally, by FRET imaging, a direct interaction was found between the cholesterol analog DHE and the transmembrane “cholesterol recognition/interaction amino acid consensus” (CRAC) motif present in C. elegans CUP-1. In-silico analysis identified two mammalian homologues of CUP-1. Most interestingly, CRAC motifs are conserved in mammalian CUP-1 homologous. Our results suggest a role of CUP-1 in cholesterol uptake in C. elegans and open up the possibility for the existence of a new class of proteins involved in sterol absorption in mammals. PMID:22479487

  7. An energy minimization method for the correction of cupping artifacts in cone-beam CT.


    Xie, Shipeng; Zhuang, Wenqin; Li, Haibo


    The purpose of this study was to reduce cupping artifacts and improve quantitative accuracy of the images in cone-beam CT (CBCT). An energy minimization method (EMM) is proposed to reduce cupping artifacts in reconstructed image of the CBCT. The cupping artifacts are iteratively optimized by using efficient matrix computations, which are verified to be numerically stable by matrix analysis. Moreover, the energy in our formulation is convex in each of its variables, which brings the robustness of the proposed energy minimization algorithm. The cupping artifacts are estimated as a result of minimizing this energy. The results indicate that proposed algorithm is effective for reducing the cupping artifacts and preserving the quality of the reconstructed image. The proposed method focuses on the reconstructed image without requiring any additional physical equipment; it is easily implemented and provides cupping correction using a single scan acquisition. The experimental results demonstrate that this method can successfully reduce the magnitude of cupping artifacts. The correction algorithm reported here may improve the uniformity of the reconstructed images, thus assisting the development of perfect volume visualization and threshold-based visualization techniques for reconstructed images. PMID:27455478

  8. Supra-acetabular fixation and sacroiliac screws for treating unstable pelvic ring injuries: preliminary results from 20 patients☆

    PubMed Central

    Guimarães, Rodrigo Pereira; de Góes Ribeiro, Arthur; Ulson, Oliver; de Ávila, Ricardo Bertozzi; Ono, Nelson Keiske; Polesello, Giancarlo Cavalli


    Objective To analyze the treatment results from 20 patients who underwent an alternative osteosynthesis method as definitive treatment for pelvic ring fractures. Methods A retrospective analysis was conducted on a series of 20 patients with pelvic ring fractures (Tile type C) and a high risk of postoperative infection, who were treated at Santa Casa de Misericórdia de São Paulo between August 2004 and December 2012. The patients underwent percutaneous supra-acetabular external fixation in association with cannulated 7.0 mm iliosacral screws. Results The patients’ mean age was 40 years (range 22–77 years) and the mean length of follow-up was 18.5 months (range 3–69 months). At the end of the treatment, ten patients (50%) were classified as having good results, nine patients (45%) had fair results and one patient (5%) did not have any improvement. Six patients presented complications, and paresthesia of the lateral femoral cutaneous nerve was the most frequent of these (two patients). Conclusion Supra-acetabular external fixation in association with iliosacral percutaneous osteosynthesis is a good definitive treatment method for patients with a high risk of postoperative infection. PMID:27069879

  9. Hip flexor muscle size, strength and recruitment pattern in patients with acetabular labral tears compared to healthy controls.


    Mendis, M Dilani; Wilson, Stephen J; Hayes, David A; Watts, Mark C; Hides, Julie A


    Acetabular labral tears are a source of hip pain and are considered to be a precursor to hip osteoarthritis. Hip flexor muscles contribute to hip joint stability and function but it is unknown if their size and function is altered in the presence of labral pathology. This study aimed to investigate hip flexor muscle size, strength and recruitment pattern in patients with hip labral pathology compared to control subjects. 12 subjects diagnosed with an unilateral acetabular labral tear were compared to 12 control subjects matched for age and gender. All subjects underwent magnetic resonance imaging (MRI) of their lumbo-pelvic region. Average muscle cross-sectional area (CSA) of the iliacus, psoas, iliopsoas, sartorius, tensor fascia latae and rectus femoris muscles were measured. Hip flexion strength was measured by an externally fixed dynamometer. Individual muscle recruitment pattern during a resisted hip flexion exercise task was measured by muscle functional MRI. Hip flexor muscle strength was found to be decreased in patients with labral pathology compared to control subjects (p < 0.01). No difference between groups or sides was found for hip flexor muscle size (all p > 0.17) and recruitment pattern (all p > 0.53). Decreased hip flexor muscle strength may affect physical function in patients with hip labral pathology by contributing to altered gait patterns and functional tasks. Clinical rehabilitation of these patients may need to include strengthening exercises for the hip flexor muscles.

  10. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.


    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal


    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed.

  11. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.


    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal


    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  12. Acetabular Liner Dissociation following Total Hip Arthroplasty: A Rare but Serious Complication That May Be Easily Misinterpreted in the Emergency Department

    PubMed Central

    O'Neill, Christopher K. J.; Napier, Richard J.; Diamond, Owen J.; O'Brien, Seamus; Beverland, David E.


    Acetabular liner dissociation is a rare complication of Total Hip Arthroplasty (THA) which requires urgent revision surgery. A case is presented in which the correct diagnosis was not appreciated on two separate Emergency Department attendances. The typical symptoms, signs, and radiological features are outlined and the importance of considering a rare complication following a commonly performed procedure is highlighted. PMID:26543652

  13. Influence of clearance on the time-dependent performance of the hip following hemiarthroplasty: A finite element study with biphasic acetabular cartilage properties

    PubMed Central

    Li, Junyan; Hua, Xijin; Jin, Zhongmin; Fisher, John; Wilcox, Ruth K.


    Hip hemiarthroplasty is a common treatment for femoral neck fracture. However, the acetabular cartilage may degenerate after hemiarthroplasty leading to postoperative failure and the need for revision surgery. The clearance between the acetabular cartilage and head of the prosthesis is one of the potential reasons for this failure. In this study, the influence of joint clearance on the biomechanical function of a generic hip model in hemiarthroplasty was investigated using biphasic numerical simulation. Both a prolonged loading period of 4000 s and dynamic gait load of 10 cycles were considered. It was found that a larger clearance led to a higher stress level, a faster reduction in load supported by the fluid and a faster cartilage consolidation process. Additionally, the mechanical performance of the acetabular cartilage in the natural model was similar to that in the hemiarthroplasty model with no clearance but different from the hemiarthroplasty models with clearances of 0.5 mm and larger. The results demonstrated that a larger clearance in hip hemiarthroplasty is more harmful to the acetabular cartilage and prosthesis heads with more available dimensions (i.e. smaller increments in diameter) could be manufactured for surgeons to achieve a lower clearance, and reduced contact stress in hemiarthroplasty surgeries. PMID:24957488

  14. To Compare Time-Weighted Graphs to Evaluate the Inclination of the Acetabular Component of Patients Who Had Total Hip Replacement Surgery

    PubMed Central

    Tomak, Leman; Bek, Yuksel; Tomak, Yılmaz


    Time-weighted graphs are used to detect small shifts in statistical process control. The aim of this study is to evaluate the inclination of the acetabular component with CUmulative SUM (CUSUM) chart, Moving Average (MA) chart, and Exponentially Weighted Moving Average (EWMA) chart. The data were obtained directly from thirty patients who had undergone total hip replacement surgery at Ondokuz Mayis University, Faculty of Medicine. The inclination of the acetabular component of these people, after total hip replacement, was evaluated. CUSUM chart, Moving Average chart, and Exponentially Weighted Moving Average were used to evaluate the quality control process of acetabular component inclination. MINITAB Statistical Software 15.0 was used to generate these control charts. The assessment done with time-weighted charts revealed that the acetabular inclination angles were settled within control limits and the process was under control. It was determined that the change within the control limits had a random pattern. As a result of this study it has been obtained that time-weighted quality control charts which are used mostly in the field of industry can also be used in the field of medicine. It has provided us with a faster visual decision. PMID:26413501

  15. RoboCup 3D Soccer Simulation Server: A Progressing Testbed for AI Researchers

    NASA Astrophysics Data System (ADS)

    Darab, Mohammad Ali Darvish; Ebrahimi, Mosalam

    RoboCup 3D Soccer Simulation is a growing domain that makes a wide variety of AI and Multi-Agent researches possible. The RoboCup 3D Soccer Simulation Server is a Multi-Agent environment that supports 22 independent agents to play a soccer match within a real-time and complex environment. Many researchers from all over the world have been using this simulator to pursue their researches in a wide variety of areas such as multiagent learning, cooperative actions and multiagent planning. This paper illustrates the current organization of RoboCup 3D Soccer Simulation Server.

  16. Operational experience using the novel FixCup collecting main valve

    SciTech Connect

    Giertz, J.; Huhn, F.; Spitz, J.


    On the occasion of the 1995 AIME conference the new PROven (Pressure Regulated Oven) process to control the pressure in coke ovens individually was introduced. This process was made feasible with a new collecting main valve, termed FixCup, with the aid of this valve a variable flow resistance to the raw gas discharge can be realized using a water immersion system. However, just the application of the FixCup system alone--without any pressure regulation--is very advantageous and cost saving. Thyssen has equipped 30 ovens with the new valve. The special constructive features as well as the operational experience using the FixCup valve are treated.

  17. Early predictors of acetabular growth after closed reduction in late detected developmental dysplasia of the hip.


    Li, YiQiang; Xu, HongWen; Li, JingChun; Yu, LingJia; Liu, YuanZhong; Southern, Edward; Liu, HongSheng


    This study evaluates improvement of the acetabular index (AI) in patients with developmental dysplasia of the hip at 4 years after closed reduction, and determines the association between the final AI and a set of factors. Sixty-two patients (74 hips) treated with closed reduction were categorized into three groups according to age: group A (0-12 months, 18 hips), group B (13-18 months, 24 hips), and group C (>18 months, 32 hips). There was no difference in AI among the three groups before reduction (P=0.293). In groups A and C, the AI decreased significantly over time until 3 years after reduction and no differences were observed between the time points of 3 and 4 years. At 4 years after reduction, the AI of group C was significantly higher than that of groups A (P<0.001) and B (P=0.012). The overall AI improvement rate was 28.63%. The AI improvement rate of group A was significantly higher than that of group C (P=0.005). Pearson correlation analysis indicated no correlation between center-head distance discrepancy and the final AI (P=0.811). Linear regression suggested that age and initial AI correlated significantly with the final AI (R=0.617, F=15.031, P<0.001). Other factors, such as sex, center-edge angle of Wiberg, bilaterally involved, and avascular necrosis of the femoral head, showed no correlations with the final AI (P>0.05). According to the coefficients, initial AI (β1=0.432, P<0.001) had greater effect than age (β2=0.197, P=0.023) on the final AI. In conclusion, the AI decreases in all patients after reduction and stabilizes at 3 years after reduction. The AI improvement rate is correlated negatively with age. Age and initial AI are early predictors of the progress of AI after closed reduction in developmental dysplasia of the hip patients. PMID:25305044

  18. Effects of rotational acetabular osteotomy on the mechanical stress within the hip joint in patients with developmental dysplasia of the hip: a subject-specific finite element analysis.


    Ike, H; Inaba, Y; Kobayashi, N; Yukizawa, Y; Hirata, Y; Tomioka, M; Saito, T


    In this study we used subject-specific finite element analysis to investigate the mechanical effects of rotational acetabular osteotomy (RAO) on the hip joint and analysed the correlation between various radiological measurements and mechanical stress in the hip joint. We evaluated 13 hips in 12 patients (two men and ten women, mean age at surgery 32.0 years; 19 to 46) with developmental dysplasia of the hip (DDH) who were treated by RAO. Subject-specific finite element models were constructed from CT data. The centre-edge (CE) angle, acetabular head index (AHI), acetabular angle and acetabular roof angle (ARA) were measured on anteroposterior pelvic radiographs taken before and after RAO. The relationship between equivalent stress in the hip joint and radiological measurements was analysed. The equivalent stress in the acetabulum decreased from 4.1 MPa (2.7 to 6.5) pre-operatively to 2.8 MPa (1.8 to 3.6) post-operatively (p < 0.01). There was a moderate correlation between equivalent stress in the acetabulum and the radiological measurements: CE angle (R = -0.645, p < 0.01); AHI (R = -0.603, p < 0.01); acetabular angle (R = 0.484, p = 0.02); and ARA (R = 0.572, p < 0.01). The equivalent stress in the acetabulum of patients with DDH decreased after RAO. Correction of the CE angle, AHI and ARA was considered to be important in reducing the mechanical stress in the hip joint. PMID:25820887

  19. Effects of rotational acetabular osteotomy on the mechanical stress within the hip joint in patients with developmental dysplasia of the hip: a subject-specific finite element analysis.


    Ike, H; Inaba, Y; Kobayashi, N; Yukizawa, Y; Hirata, Y; Tomioka, M; Saito, T


    In this study we used subject-specific finite element analysis to investigate the mechanical effects of rotational acetabular osteotomy (RAO) on the hip joint and analysed the correlation between various radiological measurements and mechanical stress in the hip joint. We evaluated 13 hips in 12 patients (two men and ten women, mean age at surgery 32.0 years; 19 to 46) with developmental dysplasia of the hip (DDH) who were treated by RAO. Subject-specific finite element models were constructed from CT data. The centre-edge (CE) angle, acetabular head index (AHI), acetabular angle and acetabular roof angle (ARA) were measured on anteroposterior pelvic radiographs taken before and after RAO. The relationship between equivalent stress in the hip joint and radiological measurements was analysed. The equivalent stress in the acetabulum decreased from 4.1 MPa (2.7 to 6.5) pre-operatively to 2.8 MPa (1.8 to 3.6) post-operatively (p < 0.01). There was a moderate correlation between equivalent stress in the acetabulum and the radiological measurements: CE angle (R = -0.645, p < 0.01); AHI (R = -0.603, p < 0.01); acetabular angle (R = 0.484, p = 0.02); and ARA (R = 0.572, p < 0.01). The equivalent stress in the acetabulum of patients with DDH decreased after RAO. Correction of the CE angle, AHI and ARA was considered to be important in reducing the mechanical stress in the hip joint.

  20. Forecasting a winner for Malaysian Cup 2013 using soccer simulation model

    NASA Astrophysics Data System (ADS)

    Yusof, Muhammad Mat; Fauzee, Mohd Soffian Omar; Latif, Rozita Abdul


    This paper investigates through soccer simulation the calculation of the probability for each team winning Malaysia Cup 2013. Our methodology used here is we predict the outcomes of individual matches and then we simulate the Malaysia Cup 2013 tournament 5000 times. As match outcomes are always a matter of uncertainty, statistical model, in particular a double Poisson model is used to predict the number of goals scored and conceded for each team. Maximum likelihood estimation is use to measure the attacking strength and defensive weakness for each team. Based on our simulation result, LionXII has a higher probability in becoming the winner, followed by Selangor, ATM, JDT and Kelantan. Meanwhile, T-Team, Negeri Sembilan and Felda United have lower probabilities to win Malaysia Cup 2013. In summary, we find that the probability for each team becominga winner is small, indicating that the level of competitive balance in Malaysia Cup 2013 is quite high.

  1. Corking Nitrogen-Doped Carbon Nanotube Cups with Gold Nanoparticles for Biodegradable Drug Delivery Applications.


    Burkert, Seth C; Star, Alexander


    Carbon nanomaterials have been proposed as effective drug delivery devices; however their perceived biopersistence and toxicological profile may hinder their applications in medical therapeutics. Nitrogen doping of carbon nanotubes results in a unique "stacked-cup" structure, with cups held together through van der Waals forces. Disrupting these weak interactions yields individual and short-stacked nanocups that can subsequently be corked with gold nanoparticles, resulting in sealed containers for delivery of cargo. Peroxidase-catalyzed reactions can effectively uncork these containers, followed by complete degradation of the graphitic capsule, resulting in effective release of therapeutic cargo while minimizing harmful side effects. The protocols reported herein describe the synthesis of stacked nitrogen-doped carbon nanotube cups followed by effective separation into individual cups and gold nanoparticle cork formation resulting in loaded and sealed containers.

  2. Cupping therapy: A prudent remedy for a plethora of medical ailments.


    Mehta, Piyush; Dhapte, Vividha


    Since ancient times, complementary and alternative medicine (CAM; bǔ chōng yǔ tì dài yī xué) have played an important role in human health and welfare. Many therapeutic approaches in healthcare outside the realm of conventional medicine persist in various parts of the world. There is considerable scientific and commercial potential in CAM, which needs to be explored precisely. Cupping therapy ( bá guàn liáo fǎ), one of the CAM, is practiced across the world. This therapy is believed to act by correcting imbalances in the internal bio field, such as by restoring the flow of "Qi (qì)". Cupping involves applying a heated cup to generate a partial vacuum that mobilizes the blood flow and promotes effective healing. This review outlines various tools and techniques of cupping therapy. PMID:26151023

  3. Mechanistic Based DEM Simulation of Particle Attrition in a Jet Cup

    SciTech Connect

    Xu, Wei; DeCroix, David; Sun, Xin


    The attrition of particles is a major industrial concern in many fluidization systems as it can have undesired effects on the product quality and on the reliable operation of process equipment. Therefore, to accomodate the screening and selection of catalysts for a specific process in fluidized beds, risers, or cyclone applications, their attrition propensity is usually estimated through jet cup attrition testing, where the test material is subjected to high gas velocities in a jet cup. However, this method is far from perfect despite its popularity, largely due to its inconsistency in different testing set-ups. In order to better understand the jet cup testing results as well as their sensitivity to different operating conditions, a coupled computational fluid dynamic (CFD) - discrete element method (DEM) model has been developed in the current study to investigate the particle attrition in a jet cup and its dependence on various factors, e.g. jet velocity, initial particle size, particle density, and apparatus geometry.

  4. Region-based multi-step optic disk and cup segmentation from color fundus image

    NASA Astrophysics Data System (ADS)

    Xiao, Di; Lock, Jane; Manresa, Javier Moreno; Vignarajan, Janardhan; Tay-Kearney, Mei-Ling; Kanagasingam, Yogesan


    Retinal optic cup-disk-ratio (CDR) is a one of important indicators of glaucomatous neuropathy. In this paper, we propose a novel multi-step 4-quadrant thresholding method for optic disk segmentation and a multi-step temporal-nasal segmenting method for optic cup segmentation based on blood vessel inpainted HSL lightness images and green images. The performance of the proposed methods was evaluated on a group of color fundus images and compared with the manual outlining results from two experts. Dice scores of detected disk and cup regions between the auto and manual results were computed and compared. Vertical CDRs were also compared among the three results. The preliminary experiment has demonstrated the robustness of the method for automatic optic disk and cup segmentation and its potential value for clinical application.

  5. Corking Nitrogen-Doped Carbon Nanotube Cups with Gold Nanoparticles for Biodegradable Drug Delivery Applications.


    Burkert, Seth C; Star, Alexander


    Carbon nanomaterials have been proposed as effective drug delivery devices; however their perceived biopersistence and toxicological profile may hinder their applications in medical therapeutics. Nitrogen doping of carbon nanotubes results in a unique "stacked-cup" structure, with cups held together through van der Waals forces. Disrupting these weak interactions yields individual and short-stacked nanocups that can subsequently be corked with gold nanoparticles, resulting in sealed containers for delivery of cargo. Peroxidase-catalyzed reactions can effectively uncork these containers, followed by complete degradation of the graphitic capsule, resulting in effective release of therapeutic cargo while minimizing harmful side effects. The protocols reported herein describe the synthesis of stacked nitrogen-doped carbon nanotube cups followed by effective separation into individual cups and gold nanoparticle cork formation resulting in loaded and sealed containers. PMID:26629615

  6. Second-order motor planning in children: insights from a cup-manipulation-task.


    Wunsch, Kathrin; Weiss, Daniel J; Schack, Thomas; Weigelt, Matthias


    The present study examined the development of anticipatory motor planning in an object manipulation task that has been used to successfully demonstrate motor planning in non-human primates (Weiss et al. in Psychol Sci 18:1063-1068, 2007). Seventy-five participants from four different age groups participated in a cup-manipulation task. One group was preschool children (average age of 5.1 years), two groups were primary school children (7.7 and 9.8 years old respectively) and the final group was comprised of adults. The experimental task entailed reaching for a plastic cup that was vertically suspended in an apparatus in either upright or inverted orientation, removing the cup by its stem and then retrieving a small toy from the inside of the cup. When the cup was inverted in the apparatus, evidence for anticipatory motor planning could be achieved by initially gripping the stem using an inverted (thumb-down) grip posture. We found that when the cup was in upright orientation, all participants reached for the cup using an upright grip (i.e., thumb-up posture). However, when the cup was inverted in the apparatus, only adults consistently used an inverted grasping posture, though the percentage of inverted grips among participants did increase with age. These results suggest a protracted development for anticipatory motor planning abilities in children. Surprisingly, the performance of adults on this task more closely resembles the performance of several nonhuman primate species as opposed to children even at approximately 10 years of age. We discuss how morphological constraints on flexibility may help account for these findings.

  7. Clad vent set cup open end (closure weld zone) wall-thickness study

    SciTech Connect

    Ulrich, G.B.; Sherrill, M.W.


    The wall thickness at the open end of Clad Vent Set (CVS) cups is a very important parameter for maintaining control of the fueled CVS closure weld process. Ideally, the wall thickness in the closure weld zone should be constant. The DOP-26 iridium alloy is very difficult to machine; therefore, key dimensional features are established during the two-draw warm-forming operation. Unfortunately, anisotropy in the forming blanks produces four ears at the open end of each cup. Formation of these ears produces axial and circumferential variations in wall thickness. The cup certification requirement is that the wall thickness in the closure weld zone, defined as the 2.5-mm band at the open end of a cup, measure from 0.63 to 0.73 mm. The wall thickness certification data for the open end of the CVS cups have been statistically evaluated. These data show that the cups recently produced for the Cassini mission have well-controlled open-end wall thicknesses.

  8. Enhancement of optic cup detection through an improved vessel kink detection framework

    NASA Astrophysics Data System (ADS)

    Wong, Damon W. K.; Liu, Jiang; Tan, Ngan Meng; Zhang, Zhuo; Lu, Shijian; Lim, Joo Hwee; Li, Huiqi; Wong, Tien Yin


    Glaucoma is a leading cause of blindness. The presence and extent of progression of glaucoma can be determined if the optic cup can be accurately segmented from retinal images. In this paper, we present a framework which improves the detection of the optic cup. First, a region of interest is obtained from the retinal fundus image, and a pallor-based preliminary cup contour estimate is determined. Patches are then extracted from the ROI along this contour. To improve the usability of the patches, adaptive methods are introduced to ensure the patches are within the optic disc and to minimize redundant information. The patches are then analyzed for vessels by an edge transform which generates pixel segments of likely vessel candidates. Wavelet, color and gradient information are used as input features for a SVM model to classify the candidates as vessel or non-vessel. Subsequently, a rigourous non-parametric method is adopted in which a bi-stage multi-resolution approach is used to probe and localize the location of kinks along the vessels. Finally, contenxtual information is used to fuse pallor and kink information to obtain an enhanced optic cup segmentation. Using a batch of 21 images obtained from the Singapore Eye Research Institute, the new method results in a 12.64% reduction in the average overlap error against a pallor only cup, indicating viable improvements in the segmentation and supporting the use of kinks for optic cup detection.

  9. Optic Disc and Optic Cup Segmentation Methodologies for Glaucoma Image Detection: A Survey

    PubMed Central

    Almazroa, Ahmed; Burman, Ritambhar; Raahemifar, Kaamran; Lakshminarayanan, Vasudevan


    Glaucoma is the second leading cause of loss of vision in the world. Examining the head of optic nerve (cup-to-disc ratio) is very important for diagnosing glaucoma and for patient monitoring after diagnosis. Images of optic disc and optic cup are acquired by fundus camera as well as Optical Coherence Tomography. The optic disc and optic cup segmentation techniques are used to isolate the relevant parts of the retinal image and to calculate the cup-to-disc ratio. The main objective of this paper is to review segmentation methodologies and techniques for the disc and cup boundaries which are utilized to calculate the disc and cup geometrical parameters automatically and accurately to help the professionals in the glaucoma to have a wide view and more details about the optic nerve head structure using retinal fundus images. We provide a brief description of each technique, highlighting its classification and performance metrics. The current and future research directions are summarized and discussed. PMID:26688751

  10. Optic Disc and Optic Cup Segmentation Methodologies for Glaucoma Image Detection: A Survey.


    Almazroa, Ahmed; Burman, Ritambhar; Raahemifar, Kaamran; Lakshminarayanan, Vasudevan


    Glaucoma is the second leading cause of loss of vision in the world. Examining the head of optic nerve (cup-to-disc ratio) is very important for diagnosing glaucoma and for patient monitoring after diagnosis. Images of optic disc and optic cup are acquired by fundus camera as well as Optical Coherence Tomography. The optic disc and optic cup segmentation techniques are used to isolate the relevant parts of the retinal image and to calculate the cup-to-disc ratio. The main objective of this paper is to review segmentation methodologies and techniques for the disc and cup boundaries which are utilized to calculate the disc and cup geometrical parameters automatically and accurately to help the professionals in the glaucoma to have a wide view and more details about the optic nerve head structure using retinal fundus images. We provide a brief description of each technique, highlighting its classification and performance metrics. The current and future research directions are summarized and discussed. PMID:26688751

  11. The RoboCup Mixed Reality League - A Case Study

    NASA Astrophysics Data System (ADS)

    Gerndt, Reinhard; Bohnen, Matthias; da Silva Guerra, Rodrigo; Asada, Minoru

    In typical mixed reality systems there is only a one-way interaction from real to virtual. A human user or the physics of a real object may influence the behavior of virtual objects, but real objects usually cannot be influenced by the virtual world. By introducing real robots into the mixed reality system, we allow a true two-way interaction between virtual and real worlds. Our system has been used since 2007 to implement the RoboCup mixed reality soccer games and other applications for research and edutainment. Our framework system is freely programmable to generate any virtual environment, which may then be further supplemented with virtual and real objects. The system allows for control of any real object based on differential drive robots. The robots may be adapted for different applications, e.g., with markers for identification or with covers to change shape and appearance. They may also be “equipped” with virtual tools. In this chapter we present the hardware and software architecture of our system and some applications. The authors believe this can be seen as a first implementation of Ivan Sutherland’s 1965 idea of the ultimate display: “The ultimate display would, of course, be a room within which the computer can control the existence of matter …” (Sutherland, 1965, Proceedings of IFIPS Congress 2:506-508).

  12. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    NASA Astrophysics Data System (ADS)

    Petracco, Marino


    Coffee beverages are so popular all over the world that there is hardly any need to describe them. But underlying this seemingly commonplace beverage there is a whole realm worth serious scientific study. The complexity of the raw seed matrix, made even more intricate when roasted, requires a deep understanding of its chemical nature. While coffee is not consumed for nutritional purposes, it is appreciated for its taste appeal along with its stimulating effects on mental and physical activity. The attention to quality is of paramount importance to both of these aspects to supply the customers with a pleasant and wholesome product. The chemical approach to the sensory sphere has seen the development of increasingly sophisticated analytical methods where the parts per billion of volatile aromas are not the ultimate frontier of detection limits. In spite of the progress of instrumental techniques, the cup-testing approach still remains the final assessment tool to obtain the approval for choosing the right plant and for conveying the product to the market. This is even truer when espresso, the fashionable type of coffee brewing methods, is considered.

  13. Match statistics related to winning in the group stage of 2014 Brazil FIFA World Cup.


    Liu, Hongyou; Gomez, Miguel-Ángel; Lago-Peñas, Carlos; Sampaio, Jaime


    Identifying match statistics that strongly contribute to winning in football matches is a very important step towards a more predictive and prescriptive performance analysis. The current study aimed to determine relationships between 24 match statistics and the match outcome (win, loss and draw) in all games and close games of the group stage of FIFA World Cup (2014, Brazil) by employing the generalised linear model. The cumulative logistic regression was run in the model taking the value of each match statistic as independent variable to predict the logarithm of the odds of winning. Relationships were assessed as effects of a two-standard-deviation increase in the value of each variable on the change in the probability of a team winning a match. Non-clinical magnitude-based inferences were employed and were evaluated by using the smallest worthwhile change. Results showed that for all the games, nine match statistics had clearly positive effects on the probability of winning (Shot, Shot on Target, Shot from Counter Attack, Shot from Inside Area, Ball Possession, Short Pass, Average Pass Streak, Aerial Advantage and Tackle), four had clearly negative effects (Shot Blocked, Cross, Dribble and Red Card), other 12 statistics had either trivial or unclear effects. While for the close games, the effects of Aerial Advantage and Yellow Card turned to trivial and clearly negative, respectively. Information from the tactical modelling can provide a more thorough and objective match understanding to coaches and performance analysts for evaluating post-match performances and for scouting upcoming oppositions.

  14. The effect of real-time aging on the oxidation and wear of highly cross-linked UHMWPE acetabular liners.


    Wannomae, Keith K; Christensen, Steven D; Freiberg, Andrew A; Bhattacharyya, Shayan; Harris, William H; Muratoglu, Orhun Kamil


    Irradiation decreases the wear of ultra-high molecular weight polyethylene (UHMWPE) but generates residual free radicals, precursors to long-term oxidation. Melting or annealing is used in quenching free radicals. We hypothesized that irradiated and once-annealed UHMWPE would oxidize while irradiated and melted UHMWPE would not, and that the oxidation in the former would increase wear. Acetabular liners were real-time aged by immersion in an aqueous environment that closely mimicked the temperature and oxygen concentration of synovial fluid. After 95 weeks of real-time aging, once-annealed components were oxidized; the melted components were not. The wear rate of the real-time aged irradiated and once-annealed components was higher than the literature reported values of other contemporary highly cross-linked UHMWPEs. Single annealing after irradiation used with terminal gamma sterilization may adversely affect the long-term oxidative stability of UHMWPE components.

  15. Pulsatile dry cupping in patients with osteoarthritis of the knee – a randomized controlled exploratory trial

    PubMed Central


    Introduction Cupping is used in various traditional medicine forms to relieve pain in musculoskeletal diseases. The aim of this study was to investigate the effectiveness of cupping in relieving the symptoms of knee osteoarthritis (OA). Methods In a two-group, randomized controlled exploratory pilot study patients with a clinically and radiological confirmed knee OA (Kellgren-Lawrence Grading Scale: 2-4) and a pain intensity > 40 mm on a 100 mm visual analogue scale (VAS) were included. 40 Patients were randomized to either 8 sessions of pulsatile dry cupping within 4 weeks or no intervention (control). Paracetamol was allowed on demand for both groups. Outcomes were the Western Ontario and McMaster Universities Osteoarthritis (WOMAC) score, the pain intensity on a VAS (0 mm = no pain to 100 mm = maximum intensity) and Quality of Life (SF-36) 4 and 12 weeks after randomization. Use of Paracetamol was documented within the 4-week treatment period. Analyses were performed by analysis of covariance adjusting for the baseline value for each outcome. Results 21 patients were allocated to the cupping group (5 male; mean age 68 ± SD 7.2) and 19 to the control group (8 male; 69 ± 6.8). After 4 weeks the WOMAC global score improved significantly more in the cupping group with a mean of 27.7 (95% confidence interval 22.1; 33.3) compared to 42.2 (36.3; 48.1) in the control group (p = 0.001). After 12 weeks the WOMAC global score were still significantly different in favor for cupping (31.0 (24.9; 37.2) vs. 40.8 (34.4; 47.3) p = 0.032), however the WOMAC subscores for pain and stiffness were not significant anymore. Significantly better outcomes in the cupping group were also observed for pain intensity on VAS and for the SF-36 Physical Component Scale compared to the control group after 4 and 12 weeks. No significant difference was observed for the SF-36 Mental Component Scale and the total number of consumed Paracetamol tablets

  16. Aerobic power and peak power of elite America's Cup sailors.


    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P


    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms. PMID:19234715

  17. Aerobic power and peak power of elite America's Cup sailors.


    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P


    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms.

  18. No increased risk of early revision during the implementation phase of new cup designs

    PubMed Central

    Björk, Mathias; Nemes, Szilard; Rolfson, Ola; Jolbäck, Per; Kärrholm, Johan


    Background and purpose — In Sweden, less than 5% of patients who undergo total hip arthroplasty (THA) have revision. Younger patients have an increased risk of revision. New prosthetic designs are being introduced in order to improve outcomes further. We investigated whether the introductory phase of new cup designs would increase the revision rate. Patients and methods — All THAs and first-time cup revisions performed from 1993 through 2011 were identified in the Swedish Hip Arthroplasty Register. The 15 types of cups used in more than 500 operations and inserted in more than 50 cases in each hospital (n = 52,903) were selected. All cups were given an order number, based on the order in which the cup had been inserted at each hospital. The influence of order number on the risk of revision was analyzed in a regression model, which was adjusted for potentially confounding demographic and surgical data. Revision within 2 years for all reasons (n = 940) was used as primary endpoint. Changes in the risk of revision based on the order number were analyzed using a spline. Results — The order number of the cup had no influence on the risk of early revision (p ≥ 0.7). Categorizing the order number using cutoff values obtained from the splines did not result in any statistically significant changes in risk of revision (p ≥ 0.2). Interpretation — We did not find any increased risk of early revision during the implementation phase of new cup designs. This finding is unexpected, and partly conflicts with data from other registries. The structured and stepwise introduction of new prosthesis designs, facilitated by the annual feedback from the Swedish Hip Arthroplasty Register, may partly explain this discrepancy. PMID:27168095

  19. Relative merits of polystyrene foam and paper in hot drink cups: Implications for packaging

    NASA Astrophysics Data System (ADS)

    Hocking, Martin B.


    An analysis of the overall relative merits of the use of uncoated paper vs molded polystyrene bead foam in single-use 8-oz cups is described here as a manageable example of the use of paper vs plastics in packaging. In raw material requirements the paper cup required about 2.5 times its finished weight of raw wood and about the same hydrocarbon fueling requirement as is needed for the polystyrene foam cup. To process the raw materials about six times as much steam, 13 times as much electric power, and twice as much cooling water are consumed to produce the paper cup as compared to the polystyrene foam cup. Emission rates to air are similar and to water are generally higher for the paper cup. Virtually all primary use factors favor polystyrene foam over paper. Once used both cup types may be recycled. Landfill disposal of the two items under dry conditions will occupy similar landfill volumes after compaction and will confer similarly slow to nonexistent decomposition to either option. Under wet conditions polystyrene foam will not readily degrade, but may help other materials to do so. Paper under wet conditions will biodegrade to produce methane, a significant greenhouse gas, biochemical oxygen demand to any leachate, and instability to the land surface during the process. Both materials can be incinerated cleanly in a municipal waste stream with the option of energy recovery, to yield an ash volume of 2% 5% of the incoming waste volume. Overall this analysis would suggest that polystyrene foam, with an extension to plastics in general, should be given more evenhanded consideration relative to paper in packaging applications than is currently the case.

  20. Preclinical, Clinical, and Over-the-Counter Postmarketing Experience with a New Vaginal Cup: Menstrual Collection

    PubMed Central

    North, Barbara B.


    Abstract Background Menstrual cups have been available for decades, but their use is limited by bulky design and the need for multiple sizes. The Softcup® (Instead, Inc., San Diego, CA) is a simple single-size disposable over-the-counter (OTC) menstrual cup that compresses to tampon shape to facilitate insertion and can be worn during coitus. This report describes preclinical evaluation, clinical testing, and postmarketing monitoring of the Softcup. Methods Preclinical testing complied with U.S. Food and Drug Administration (FDA) guidelines and used standard United States Pharmacopoeia methodologies for assessment of potential toxicity. Clinical testing enrolled 406 women in seven U.S. centers. A detailed written questionnaire assessed safety, acceptability, and effectiveness for menstrual collection. Study safety parameters included pelvic examinations, Pap smears, colposcopy, urinalysis, vaginal pH, wet mounts, gram stain, and vaginal microflora cultures. Postmarketing surveillance of over 100 million Softcups has been conducted by the manufacturer and by the FDA Medwatch system. Results No toxicity or mutagenicity was observed in preclinical evaluations. In clinical testing, after three cycles of cup use, 37% of subjects rated the cup as better than, 29% as worse than, and 34% as equal to pads or tampons. The cup was preferred for comfort, dryness, and less odor. Cups received lower ratings for disposal and convenience. Eighty-one percent of enrolled women were able to insert and remove their first cup using only written instructions. Use difficulties resulting in study discontinuations included cramping (1%), leakage (1%), and improper fit (3%). No safety parameters were adversely affected. No significant health risks were reported during postmarketing surveillance. Conclusions These results demonstrate that a single-size vaginal device has no significant health risks and is acceptable to many women without the need for fitting or other medical services. PMID

  1. Yeast CUP1 protects HeLa cells against copper-induced stress.


    Xie, X X; Ma, Y F; Wang, Q S; Chen, Z L; Liao, R R; Pan, Y C


    As an essential trace element, copper can be toxic in mammalian cells when present in excess. Metallothioneins (MTs) are small, cysteine-rich proteins that avidly bind copper and thus play an important role in detoxification. Yeast CUP1 is a member of the MT gene family. The aim of this study was to determine whether yeast CUP1 could bind copper effectively and protect cells against copper stress. In this study, CUP1 expression was determined by quantitative real-time PCR, and copper content was detected by inductively coupled plasma mass spectrometry. Production of intracellular reactive oxygen species (ROS) was evaluated using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) assay. Cellular viability was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, and the cell cycle distribution of CUP1 was analyzed by fluorescence-activated cell sorting. The data indicated that overexpression of yeast CUP1 in HeLa cells played a protective role against copper-induced stress, leading to increased cellular viability (P<0.05) and decreased ROS production (P<0.05). It was also observed that overexpression of yeast CUP1 reduced the percentage of G1 cells and increased the percentage of S cells, which suggested that it contributed to cell viability. We found that overexpression of yeast CUP1 protected HeLa cells against copper stress. These results offer useful data to elucidate the mechanism of the MT gene on copper metabolism in mammalian cells.

  2. Radiographic and retrieval wear analyses of the first generation highly cross-linked polyethylene cup against a ceramic femoral head.


    Oonishi, Hiroyuki; Kyomoto, Masayuki; Iwamoto, Mikio; Ueno, Masaru; Oonishi, Hironobu


    In this study, the in vivo wear of highly cross-linked polyethylene (CLPE) cups against alumina ceramic femoral heads was evaluated by radiographic and retrieval analysis. The radiographic wear of six ethylene oxide gas-sterilized (i.e., non-cross-linked) conventional polyethylene (PE) cups with the mean follow-up of 20.9 years and 60 CLPE cups with the mean follow-up of 7.4 years was measured. The retrieved 16 PE cups with clinical use for mean 21.5 years and 10 CLPE cups with clinical use for mean 2.9 years was evaluated as a retrieval analysis. In the radiographic analysis, the linear wear of CLPE cups was significantly lower (99% reduction) compared to conventional polyethylene cups. The results of retrieval analyses for both cups were similar to those of radiographic analyses. Even when third-body wear occurred during clinical use, no surface damage was observed on the surface of ceramic femoral heads. The surface is not sensitive to third-body wear, and hence, the ceramic femoral head has a great advantage in terms of the wear of CLPE under third-body wear conditions. In conclusion, CLPE cups used with alumina ceramic femoral heads in total hip arthroplasty should have favorable wear resistance in several in vivo situations.

  3. Open reduction and internal fixation of osteoporotic acetabular fractures through the ilio-inguinal approach: use of buttress plates to control medial displacement of the quadrilateral surface.


    Peter, Robin E


    The number of acetabular fractures in the geriatric population requiring open reduction and internal fixation is increasing. Fractures with medial or anterior displacement are the most frequent types, and via the ilio-inguinal approach buttress plates have proved helpful to maintain the quadrilateral surface or medial acetabular wall. Seven to ten hole 3.5 mm reconstruction plates may be used as buttress plates, placed underneath the usual pelvic brim plate. This retrospective study presents our results with this technique in 13 patients at a minimum follow-up of 12 months (average, 31 months). 85% of the patients had a good result. The early onset of post-traumatic osteoarthritis necessitated total hip arthroplasty in two patients (15%) at 12 and 18 months follow-up, respectively. This treatment option should be considered in the surgeon's armamentarium when fixing these challenging cases.

  4. ‘There are a lot of new people in town: but they are here for soccer, not for business’ a qualitative inquiry into the impact of the 2010 soccer world cup on sex work in South Africa

    PubMed Central


    Background Sports mega-events have expanded in size, popularity and cost. Fuelled by media speculation and moral panics, myths proliferate about the increase in trafficking into forced prostitution as well as sex work in the run-up to such events. This qualitative enquiry explores the perceptions of male, female and transgender sex workers of the 2010 Soccer World Cup held in South Africa, and the impact it had on their work and private lives. Methods A multi-method study design was employed. Data consisted of 14 Focus Group Discussions, 53 sex worker diaries, and responses to two questions in surveys with 1059 male, female and transgender sex workers in three cities. Results Overall, a minority of participants noted changes to the sex sector due to the World Cup and nothing emerged on the feared increases in trafficking into forced prostitution. Participants who observed changes in their work mainly described differences, both positive and negative, in working conditions, income and client relations, as well as police harassment. The accounts of changes were heterogeneous - often conflicting in the same research site and across sites. Conclusions No major shifts occurred in sex work during the World Cup, and only a few inconsequential changes were noted. Sports mega-events provide strategic opportunities to expand health and human rights programmes to sex workers. The 2010 World Cup missed that opportunity. PMID:24915943

  5. Optimizing the physical conditioning of the NASCAR sprint cup pit crew athlete.


    Ferguson, David P; Davis, Adam M; Lightfoot, J Timothy


    Stock car racing is the largest spectator sport in the United States. As a result, National Association for Stock Car Automobile Racing (NASCAR) Sprint Cup teams have begun to invest in strength and conditioning programs for their pit crew athletes. However, there is limited knowledge regarding the physical characteristics of elite NASCAR pit crew athletes, how the NASCAR Sprint Cup season affects basic physiological parameters such as body composition, and what is the most appropriate physical training program that meets the needs of a pit crew athlete. We conducted 3 experiments involving Sprint Cup motorsport athletes to determine predictors of success at the elite level, seasonal physiological changes, and appropriate physical training programs. Our results showed that hamstring flexibility (p = 0.015) and the score on the 2-tire front run test (p = 0.012) were significant predictors of NASCAR Sprint Cup Pit Crew athlete performance. Additionally, during the off season, pit crew athletes lost lean body mass, which did not return until the middle of the season. Therefore, a strength and conditioning program was developed to optimize pit crew athlete performance throughout the season. Implementation of this strength and conditioning program in 1 NASCAR Sprint Cup team demonstrated that pit crew athletes were able to prevent lean body mass loss and have increased muscle power output from the start of the season to the end of the season.

  6. Improved automated optic cup segmentation based on detection of blood vessel bends in retinal fundus images.


    Hatanaka, Yuji; Nagahata, Yuuki; Muramatsu, Chisako; Okumura, Susumu; Ogohara, Kazunori; Sawada, Akira; Ishida, Kyoko; Yamamoto, Tetsuya; Fujita, Hiroshi


    Glaucoma is a leading cause of permanent blindness. Retinal imaging is useful for early detection of glaucoma. In order to evaluate the presence of glaucoma, ophthalmologists may determine the cup and disc areas and diagnose glaucoma using a vertical optic cup-to-disc (C/D) ratio and a rim-to-disc (R/D) ratio. Previously we proposed a method to determine cup edge by analyzing a vertical profile of pixel values, but this method provided a cup edge smaller than that of an ophthalmologist. This paper describes an improved method using the locations of the blood vessel bends. The blood vessels were detected by a concentration feature determined from the density gradient. The blood vessel bends were detected by tracking the blood vessels from the disc edge to the primary cup edge, which was determined by our previous method. Lastly, the vertical C/D ratio and the R/D ratio were calculated. Using forty-four images, including 32 glaucoma images, the AUCs of both the vertical C/D ratio and R/D ratio by this proposed method were 0.966 and 0.936, respectively.

  7. Antidoping programme and biological monitoring before and during the 2014 FIFA World Cup Brazil

    PubMed Central

    Baume, Norbert; Jan, Nicolas; Emery, Caroline; Mandanis, Béatrice; Schweizer, Carine; Giraud, Sylvain; Leuenberger, Nicolas; Marclay, François; Nicoli, Raul; Perrenoud, Laurent; Robinson, Neil; Dvorak, Jiri; Saugy, Martial


    Background The FIFA has implemented an important antidoping programme for the 2014 FIFA World Cup. Aim To perform the analyses before and during the World Cup with biological monitoring of blood and urine samples. Methods All qualified players from the 32 teams participating in the World Cup were tested out-of-competition. During the World Cup, 2–8 players per match were tested. Over 1000 samples were collected in total and analysed in the WADA accredited Laboratory of Lausanne. Results The quality of the analyses was at the required level as described in the WADA technical documents. The urinary steroid profiles of the players were stable and consistent with previously published papers on football players. During the competition, amphetamine was detected in a sample collected on a player who had a therapeutic use exemption for attention deficit hyperactivity disorder. The blood passport data showed no significant difference in haemoglobin values between out-of-competition and postmatch samples. Conclusions Logistical issues linked to biological samples collection, and the overseas shipment during the World Cup did not impair the quality of the analyses, especially when used as the biological passport of football players. PMID:25878079

  8. Development of cup-shaped micro-electromechanical systems-based vector hydrophone

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Liu, Yuan; Zhang, Guojun; Wang, Renxin; Xue, Chenyang; Zhang, Wendong; Liu, Jun


    Similar to the vital performance factors, the receiving sensitivity and the bandwidth exist interactively in the micro-electromechanical systems (MEMS)-based vector hydrophones. Some existing methods can improve the sensitivity of the hydrophone, but these improvements are usually gained at a cost of the bandwidth. However, the cup-shaped MEMS vector hydrophone that is presented in this paper can improve its sensitivity while retaining a sufficient bandwidth. The cup-shaped structure acts as a new sensing unit in the MEMS vector hydrophone, replacing the bionic columnar hair that was previously used for sensing. The relationships between the parameters of the cup-shaped structure and the sensitivity of the vector hydrophone were determined by a theoretical deduction. In addition, simulation analyses were performed, and optimized structural parameters were obtained in this work. ANSYS 15.0 simulation was used to derive the optimum characteristics for the cup-shaped structure. The results of the calibration experiments showed that the sensitivity reached up to -188.5 dB (gain of 40 dB, 1 kHz, 0 dB@1 V/μPa), and the bandwidth was in the 20 Hz-1 kHz range, which is sufficient for an underwater acoustic detection at low frequencies. This work has, thus, proved that the cup-shaped vector hydrophone has superior properties for the engineering applications.

  9. Cupping artifacts analysis and correction for a FPD-based cone-beam CT

    NASA Astrophysics Data System (ADS)

    Zhang, Li; Gao, Hewei; Li, Shuanglei; Chen, Zhiqiang; Xing, Yuxiang


    Cupping artifact is one of the most serious problems in a middle-low energy X-ray Flat panel detector (FPD)-based cone beam CT system. Both beam hardening effects and scatter could induce cupping artifacts in reconstructions and degrade image quality. In this paper, a two-step cupping-correction method is proposed to eliminate cupping: 1) scatter removal; 2) beam hardening correction. By experimental measurement using Beam Stop Array (BSA), the X-ray scatter distribution of a specific object is estimated in the projection image. After interpolation and subtraction, the primary intensity of the projection image is computed. The scatter distribution can also be obtained using convolution with a low-pass filter as kernel. The linearization is used as beam hardening correction method for one-material object. For two-material cylindrical objects, a new approach without iteration involved is present. There are three processes in this approach. Firstly, correct raw projections by the mapping function of the outer material. Secondly, reconstruct the cross-section image from the modified projections. Finally, scale the image by a simple weighting function. After scatter removal and beam hardening correction, the cupping artifacts are well removed, and the contrast of the reconstructed image is remarkably improved.

  10. Synthesis, characterization, and manipulation of nitrogen-doped carbon nanotube cups.


    Allen, Brett L; Kichambare, Padmakar D; Star, Alexander


    Isolated, carbon nanotube cups with diameters of 12-40 nm have been synthesized by chemical vapor deposition through incorporation of nitrogen atoms into graphitic carbon structure and subsequent mechanical separation. Incorporation of nitrogen affords carbon nanotube cups with a unique composition comprising multiwalled, graphitic lattice with nitrogen groups on the exterior rim and hollow interior cavities. These nanostructures demonstrate the ability to participate in hydrogen bonding because of nitrogen functionalities on their open edges. Furthermore, reaction with these nitrogen functionalities results in the coupling of gold nanoparticles (GNPs) to the open rim of carbon nanotube cups. Through atomic force microscopy manipulation and adhesion force measurements, we compare the mobility of these structures on a hydrophilic surface before and after GNP coupling. Understanding of these forces will aid in useful nanostructure assembly for energy and biomedical applications.

  11. Influence of participation in a cup-stacking unit on timing tasks.


    Hart, Melanie A; Smith, Lori A; DeChant, Ann


    Cup stacking is a relatively new activity which has been promoted at conferences for physical educators as having many direct and indirect benefits, such as improved quickness. This study examined the influence of a cup-stacking instructional unit on reaction and anticipation times of 69 children in Grades 2 and 4. Within each grade participants were assigned to an experimental or a control group. The former received a 3-wk. instructional unit following the lesson plans provided by the promoters of cup stacking. The control groups received a standard physical education curriculum. Analysis indicated no significant differences in reaction and anticipation times between the groups before and after practicing the instructional unit. PMID:16491691

  12. Cultural change--empowerment at Sweetheart Cup Company, Inc., Bakery Division.


    Altomonte, W; Mooney, W; Sheldon, D H


    Sweetheart Cup Company always has been associated with fun products--fast food containers, straws, ballpark drink glasses, and maybe the most fun of all--ice cream cones! But making these products of pleasantry at times has not been as festive as it would seem. Sweetheart Cup Company has had its ups and downs in terms of many of the typical manufacturing measurements, but in 1994--under the direction of newly appointed Chief Operating Officer Bill McLaughlin--Sweetheart Cup Company embarked on a new mission. This time everyone would be involved, from headquarters staff in Owings Mills to the fourth-floor oven area workers in the Dallas bakery. The new process goal, "Business Excellence," as we called it, was really an implementation of Class A ERP/MRP II.

  13. Dykes, cups, saucers and sills: Analogue experiments on magma intrusion into brittle rocks

    NASA Astrophysics Data System (ADS)

    Mathieu, L.; van Wyk de Vries, B.; Holohan, Eoghan P.; Troll, Valentin R.


    Magma is transported in the crust by blade-like intrusions such as dykes, sills, saucers, and also collects in thicker laccoliths, lopoliths and plutons. Recently, the importance and great number of shallow (< 5 km) saucer-shaped intrusions has been recognized. Lopoliths and cup-shaped intrusions have also been reported in many geological contexts. Our field observations indicate that many intrusions, especially those emplaced into breccias or fractured rocks, have bulging, lobate margins and have shear faults at their bulbous terminations. Such features suggest that magma can propagate along a self-induced shear fault rather than a hydraulic tension-fracture. To investigate this we use analogue models to explore intrusion propagation in a brittle country rock. The models consist of the injection of analogue magma (honey or Golden syrup) in a granular material (sand or sieved ignimbrite) that is a good analogue for brittle or brecciated rocks. These models have the advantage (over other models that use gelatin) to well represent the properties of brittle materials by allowing both shear-faults and tension fractures to be produced at suitable stresses. In our experiments we mainly obtain vertical dykes and inverted-cone like structures that we call cup-shaped intrusions. Dykes bifurcate into cup-shaped intrusions at depths depending on their viscosity. All cup-shaped intrusions uplift a central block. By injecting against a vertical glass plate we obtain detailed observations of the intrusion propagation style. We observe that dykes commonly split and produce cup-shaped intrusions near the surface and that shear zone-related intrusions develop at the dyke tip. We conclude that many dykes propagate as a viscous indenter resulting from shear failure of host rock rather than tensional hydraulic fracturing of host rocks. The shear propagation model provides an explanation for the shape and formation of cup-shaped intrusions, saucer-sills and lopoliths.

  14. Application of Rapid Prototyping Pelvic Model for Patients with DDH to Facilitate Arthroplasty Planning: A Pilot Study.


    Xu, Jie; Li, Deng; Ma, Ruo-fan; Barden, Bertram; Ding, Yue


    Total hip arthroplasty (THA) is challenging in cases of osteoarthritis secondary to developmental dysplasia of the hip (DDH). Acetabular deficiency makes the positioning of the acetabular component difficult. Computer tomography based, patient-individual three dimensional (3-D) rapid prototype technology (RPT)-models were used to plan the placement of acetabular cup so that a surgeon was able to identify pelvic structures, assess the ideal extent of reaming and determine the size of cup after a reconstructive procedure. Intraclass correlation coefficients (ICCs) were used to analyze the agreement between the sizes of chosen components on the basis of preoperative planning and the actual sizes used in the operation. The use of the 3-D RPT-model facilitates the surgical procedures due to better planning and improved orientation. PMID:26129852

  15. HiCUP: pipeline for mapping and processing Hi-C data

    PubMed Central

    Wingett, Steven; Ewels, Philip; Furlan-Magaril, Mayra; Nagano, Takashi; Schoenfelder, Stefan; Fraser, Peter; Andrews, Simon


    HiCUP is a pipeline for processing sequence data generated by Hi-C and Capture Hi-C (CHi-C) experiments, which are techniques used to investigate three-dimensional genomic organisation. The pipeline maps data to a specified reference genome and removes artefacts that would otherwise hinder subsequent analysis. HiCUP also produces an easy-to-interpret yet detailed quality control (QC) report that assists in refining experimental protocols for future studies. The software is freely available and has already been used for processing Hi-C and CHi-C data in several recently published peer-reviewed studies. PMID:26835000

  16. HiCUP: pipeline for mapping and processing Hi-C data.


    Wingett, Steven; Ewels, Philip; Furlan-Magaril, Mayra; Nagano, Takashi; Schoenfelder, Stefan; Fraser, Peter; Andrews, Simon


    HiCUP is a pipeline for processing sequence data generated by Hi-C and Capture Hi-C (CHi-C) experiments, which are techniques used to investigate three-dimensional genomic organisation. The pipeline maps data to a specified reference genome and removes artefacts that would otherwise hinder subsequent analysis. HiCUP also produces an easy-to-interpret yet detailed quality control (QC) report that assists in refining experimental protocols for future studies. The software is freely available and has already been used for processing Hi-C and CHi-C data in several recently published peer-reviewed studies.

  17. Effects of the 2010 World Cup football tournament on emergency department assault attendances in England.


    Quigg, Zara; Hughes, Karen; Bellis, Mark A


    We explore the impact of the 2010 World Cup, held in South Africa, on levels of assault attendances to 15 emergency departments in England. The majority (70.1%) of assault attendees during the 2010 World Cup was male and aged 18-34 years (52.5%). Assault attendances increased by 37.5% on the days that England played (P 001). Preparation for major sporting events in non-host countries should include violence prevention activity. Emergency department data can be used to identify violence associated with such events and thus inform both the targeting of prevention efforts and assessments of their effectiveness. PMID:22874732

  18. Cup-shaped Intrusions, Morphology and Emplacement Mechanism Investigate Through Analogue Modelling

    NASA Astrophysics Data System (ADS)

    Mathieu, L.; van Wyk de Vries, B.


    We investigate the morphology of large-scale shallow-depth magma intrusions and sub-volcanic complexes with analogue models. Intrusions of analogue magma are done in a granular material that can contain a ductile layer. The model surface is flat to model the formation of plutonic intrusions and it is overlain by a cone when modelling late sub-volcanic complexes. For flat-top models, we obtain cup-shaped intrusions fed by dykes. Cup-shaped intrusions are inverted-cone like bodies. They are different from saucer-shaped intrusions as they possess neither a well developed sill-base, nor an outer rim. However, like saucers, cups are shallow depth intrusions that dome the country rocks. They initiate from an advancing dyke and first develop an inverted-cone like morphology. Then, the central thickness increases and thrusts form at the edge of the domed country rocks. At this stage, the intrusions progressively involve toward a lopolith shape. By using analogue magma of various viscosities we have been able to constrain key relationships: higher intrusion viscosity causes deeper initiation and the deeper they initiate, the larger is the intrusion diameter. A natural example of such intrusion might by the circles of volcanoes like the Azufre-Lastaria (Peru) that might be overlain be a large-scale cup-shaped intrusion. When adding a cone at the surface of the model and, sometimes, a thin ductile layer in the substratum, the morphology of cup-shaped intrusions vary. Note that the ductile layer of our models is not thick enough to induce the gravitational spreading of the cone. Generally, cup-shaped intrusions are asymmetric in cross section and elliptical in plan view. Their formation creates extension structures in the cone (croissant-shaped rift, straight rift or normal fault) and thrusts in some sectors below the cone. Both types of structures are bordered by strike-slip faults. Cups and saucers share many similarities, but differ probably in the fact that saucers are

  19. Stripline fast faraday cup for measuring GHz structure of ion beams


    Bogaty, John M.


    The Stripline Fast Faraday Cup is a device which is used to quantitatively and qualitatively measure gigahertz time structure characteristics of ion beams with energies up to at least 30 Mev per nucleon. A stripline geometry is employed in conjunction with an electrostatic screen and a Faraday cup to provide for analysis of the structural characteristics of an ion beam. The stripline geometry allows for a large reduction in the size of the instrument while the electrostatic screen permits measurements of the properties associated with low speed ion beams.

  20. Cup-Drawing Behavior of High-Strength Steel Sheets Containing Different Volume Fractions of Martensite

    NASA Astrophysics Data System (ADS)

    Choi, Shi-Hoon; Kim, Dae-Wan; Yang, Hoe-Seok; Han, Seong-Ho; Yoon, Jeong Whan


    Planar anisotropy and cup-drawing behavior were investigated for high-strength steel sheets containing different volume fractions of martensite. Macrotexture analysis using XRD was conducted to capture the effect of crystallographic orientation on the planar anisotropy of high-strength steel sheets. A phenomenological yield function, Yld96, which accounts for the anisotropy of yield stress and r-values, was implemented into ABAQUS using the user subroutine UMAT. Cup drawing of high-strength steel sheets was simulated using the FEM code. The profiles of earing and thickness strain were compared with the experimentally measured results.